[{"data":"REJEVAAAAAG8uQAAeyJmcmFtZVJhdGUiOjMwLCJuYW1lIjoidGVkZHlkcmFnb25fZWFydGhfMDMiLCJzdGFnZSI6ImFybWF0dXJlTmFtZSIsInZlcnNpb24iOiI1LjUiLCJjb21wYXRpYmxlVmVyc2lvbiI6IjUuNSIsImFybWF0dXJlIjpbeyJ0eXBlIjoiQXJtYXR1cmUiLCJmcmFtZVJhdGUiOjMwLCJuYW1lIjoiYXJtYXR1cmVOYW1lIiwiYWFiYiI6eyJ4IjotMjIzLjA1LCJ5IjotMjk2LjQ3LCJ3aWR0aCI6NDI2LjAyLCJoZWlnaHQiOjQzNy4xNH0sImJvbmUiOlt7Im5hbWUiOiJyb290In0seyJuYW1lIjoibW9uc3RlcmVmZmVjdCIsInBhcmVudCI6InJvb3QiLCJ0cmFuc2Zvcm0iOnsieCI6Ny40LCJ5IjoyLjQ3fX0seyJsZW5ndGgiOjM2LCJuYW1lIjoidGVkZHlkcmFnb25fZWFydGhfMDNfUGlsbG93XzAxIiwicGFyZW50Ijoicm9vdCIsInRyYW5zZm9ybSI6eyJ4IjotOTguNjEsInkiOjgwLjUzLCJza1giOi0xMTMuNzksInNrWSI6LTExMy43OX19LHsibGVuZ3RoIjoyNywibmFtZSI6InRlZGR5ZHJhZ29uX2VhcnRoXzAzX1BpbGxvd18wMiIsInBhcmVudCI6InJvb3QiLCJ0cmFuc2Zvcm0iOnsieCI6ODYuMjMsInkiOjc4Ljk4LCJza1giOi02MCwic2tZIjotNjB9fSx7Im5hbWUiOiJ0ZWRkeWRyYWdvbl9lYXJ0aF8wM19QaWxsb3dfMSIsInBhcmVudCI6InJvb3QiLCJ0cmFuc2Zvcm0iOnsieCI6MTc0LjcxLCJ5IjotNDQuNjIsInNjWCI6LTF9fSx7Im5hbWUiOiJ0ZWRkeWRyYWdvbl9lYXJ0aF8wM19QaWxsb3dfMiIsInBhcmVudCI6InJvb3QiLCJ0cmFuc2Zvcm0iOnsieCI6LTE0OC4xLCJ5IjotOTAuMjZ9fSx7Im5hbWUiOiJ0ZWRkeWRyYWdvbl9lYXJ0aF8wM19QaWxsb3dfMyIsInBhcmVudCI6InJvb3QiLCJ0cmFuc2Zvcm0iOnsieCI6LTI5LjE1LCJ5IjotMjY5LjIzfX0seyJuYW1lIjoidGVkZHlkcmFnb25fZWFydGhfMDNfUGlsbG93XzQiLCJwYXJlbnQiOiJyb290IiwidHJhbnNmb3JtIjp7IngiOjEyOC45NiwieSI6MjguMjF9fSx7Im5hbWUiOiJ0ZWRkeWRyYWdvbl9lYXJ0aF8wM19lZmZlY3RfMDEiLCJwYXJlbnQiOiJyb290IiwidHJhbnNmb3JtIjp7IngiOi0xMDQuMzUsInkiOi0yMDMuNjh9fSx7Im5hbWUiOiJ0ZWRkeWRyYWdvbl9lYXJ0aF8wM19lZmZlY3RfMSIsInBhcmVudCI6InJvb3QiLCJ0cmFuc2Zvcm0iOnsieCI6MTM0LjI2LCJ5IjotMTM1LjI0fX0seyJuYW1lIjoidGVkZHlkcmFnb25fZWFydGhfMDNfcnVnXzAxIiwicGFyZW50Ijoicm9vdCIsInRyYW5zZm9ybSI6eyJ4IjoxLjQ4LCJ5Ijo4My43OH19LHsibGVuZ3RoIjozMCwibmFtZSI6InRlZGR5ZHJhZ29uX2VhcnRoXzAzX1BpbGxvd181IiwicGFyZW50IjoidGVkZHlkcmFnb25fZWFydGhfMDNfUGlsbG93XzAyIiwidHJhbnNmb3JtIjp7IngiOjk0LjY3LCJ5IjotMjcuMjksInNrWCI6LTM3LjkzLCJza1kiOi0zNy45M319LHsibGVuZ3RoIjoyNywibmFtZSI6InRlZGR5ZHJhZ29uX2VhcnRoXzAzX1BpbGxvd182IiwicGFyZW50IjoidGVkZHlkcmFnb25fZWFydGhfMDNfUGlsbG93XzAxIiwidHJhbnNmb3JtIjp7IngiOjgwLjYzLCJ5Ijo0LjI4LCJza1giOjQuNTMsInNrWSI6NC41M319LHsibGVuZ3RoIjo0MiwibmFtZSI6InRlZGR5ZHJhZ29uX2VhcnRoXzAzX2JvZHlfMSIsInBhcmVudCI6Im1vbnN0ZXJlZmZlY3QiLCJ0cmFuc2Zvcm0iOnsieCI6LTExLjUxLCJ5Ijo3MC4wNywic2tYIjotMC45LCJza1kiOi0wLjl9fSx7Imxlbmd0aCI6MjUsIm5hbWUiOiJ0ZWRkeWRyYWdvbl9lYXJ0aF8wM19ib2R5XzIiLCJwYXJlbnQiOiJ0ZWRkeWRyYWdvbl9lYXJ0aF8wM19ib2R5XzEiLCJ0cmFuc2Zvcm0iOnsieCI6OC4wOSwieSI6LTguNTIsInNrWCI6LTYzLjYxLCJza1kiOi02My42MX19LHsibGVuZ3RoIjoyMiwibmFtZSI6InRlZGR5ZHJhZ29uX2VhcnRoXzAzX2JvZHlfMDIiLCJwYXJlbnQiOiJ0ZWRkeWRyYWdvbl9lYXJ0aF8wM19ib2R5XzIiLCJ0cmFuc2Zvcm0iOnsieCI6MTIuODUsInkiOi0yMC4yOCwic2tYIjotOTguOTQsInNrWSI6LTk4Ljk0fX0seyJsZW5ndGgiOjI0LCJuYW1lIjoidGVkZHlkcmFnb25fZWFydGhfMDNfYm9keV8zIiwicGFyZW50IjoidGVkZHlkcmFnb25fZWFydGhfMDNfYm9keV8yIiwidHJhbnNmb3JtIjp7IngiOjMzLjAzLCJ5IjotMS4xOCwic2tYIjotMTUuODIsInNrWSI6LTE1LjgyfX0seyJsZW5ndGgiOjE5LCJuYW1lIjoidGVkZHlkcmFnb25fZWFydGhfMDNfbGVnXzAxIiwicGFyZW50IjoidGVkZHlkcmFnb25fZWFydGhfMDNfYm9keV8yIiwidHJhbnNmb3JtIjp7IngiOjIuNywieSI6LTE3LjA0LCJza1giOi0xMzEuMzcsInNrWSI6LTEzMS4zN319LHsibGVuZ3RoIjoyMiwibmFtZSI6InRlZGR5ZHJhZ29uX2VhcnRoXzAzX2xlZ18wMiIsInBhcmVudCI6InRlZGR5ZHJhZ29uX2VhcnRoXzAzX2JvZHlfMiIsInRyYW5zZm9ybSI6eyJ4IjoxMS41LCJ5IjoxMy40OSwic2tYIjo2MS44Mywic2tZIjo2MS44M319LHsibGVuZ3RoIjoyMiwibmFtZSI6InRlZGR5ZHJhZ29uX2VhcnRoXzAzX2JvZHlfMDEiLCJwYXJlbnQiOiJ0ZWRkeWRyYWdvbl9lYXJ0aF8wM19ib2R5XzMiLCJ0cmFuc2Zvcm0iOnsieCI6LTUuMiwieSI6MzIuMzgsInNrWCI6LTE3MC4xNywic2tZIjotMTcwLjE3fX0seyJsZW5ndGgiOjI4LCJuYW1lIjoidGVkZHlkcmFnb25fZWFydGhfMDNfYm9keV80IiwicGFyZW50IjoidGVkZHlkcmFnb25fZWFydGhfMDNfYm9keV8zIiwidHJhbnNmb3JtIjp7IngiOjM3LjYsInkiOi00LCJza1giOi0zOS44NCwic2tZIjotMzkuODR9fSx7Imxlbmd0aCI6MjAsIm5hbWUiOiJ0ZWRkeWRyYWdvbl9lYXJ0aF8wM19ib2R5XzUiLCJwYXJlbnQiOiJ0ZWRkeWRyYWdvbl9lYXJ0aF8wM19ib2R5XzAyIiwidHJhbnNmb3JtIjp7IngiOjI1LjgzLCJ5IjowLjE0LCJza1giOjEyLCJza1kiOjEyfX0seyJsZW5ndGgiOjI0LCJuYW1lIjoidGVkZHlkcmFnb25fZWFydGhfMDNfZm9vdF8wMSIsInBhcmVudCI6InRlZGR5ZHJhZ29uX2VhcnRoXzAzX2xlZ18wMSIsInRyYW5zZm9ybSI6eyJ4Ijo1My4xOSwieSI6LTIwLjI4LCJza1giOjc0LjE3LCJza1kiOjc0LjE3fX0seyJsZW5ndGgiOjIyLCJuYW1lIjoidGVkZHlkcmFnb25fZWFydGhfMDNfZm9vdF8wMiIsInBhcmVudCI6InRlZGR5ZHJhZ29uX2VhcnRoXzAzX2xlZ18wMSIsInRyYW5zZm9ybSI6eyJ4Ijo0NS40MiwieSI6LTAuMDMsInNrWCI6LTUuMzksInNrWSI6LTUuMzl9fSx7Imxlbmd0aCI6MjAsIm5hbWUiOiJ0ZWRkeWRyYWdvbl9lYXJ0aF8wM19sZWdfMiIsInBhcmVudCI6InRlZGR5ZHJhZ29uX2VhcnRoXzAzX2xlZ18wMiIsInRyYW5zZm9ybSI6eyJ4IjoyNy4zNSwieSI6MC45NCwic2tYIjoyMi42NSwic2tZIjoyMi42NX19LHsibGVuZ3RoIjoyNywibmFtZSI6InRlZGR5ZHJhZ29uX2VhcnRoXzAzX2FybV8wMSIsInBhcmVudCI6InRlZGR5ZHJhZ29uX2VhcnRoXzAzX2JvZHlfNCIsInRyYW5zZm9ybSI6eyJ4Ijo0OC45MywieSI6LTE3Ljc0LCJza1giOi0xMjYuNzksInNrWSI6LTEyNi43OX19LHsibGVuZ3RoIjoxNywibmFtZSI6InRlZGR5ZHJhZ29uX2VhcnRoXzAzX2FybV8wMiIsInBhcmVudCI6InRlZGR5ZHJhZ29uX2VhcnRoXzAzX2JvZHlfNCIsInRyYW5zZm9ybSI6eyJ4Ijo0LjE1LCJ5IjoxOS42Niwic2tYIjotMTcxLjA1LCJza1kiOi0xNzEuMDV9fSx7Imxlbmd0aCI6MTgsIm5hbWUiOiJ0ZWRkeWRyYWdvbl9lYXJ0aF8wM19ib2R5XzYiLCJwYXJlbnQiOiJ0ZWRkeWRyYWdvbl9lYXJ0aF8wM19ib2R5XzUiLCJ0cmFuc2Zvcm0iOnsieCI6MjQuOTIsInkiOi0xLjI4LCJza1giOjIuMjUsInNrWSI6Mi4yNX19LHsibGVuZ3RoIjozNywibmFtZSI6InRlZGR5ZHJhZ29uX2VhcnRoXzAzX2Zvb3RfMSIsInBhcmVudCI6InRlZGR5ZHJhZ29uX2VhcnRoXzAzX2Zvb3RfMDEiLCJ0cmFuc2Zvcm0iOnsieCI6MjguMzUsInkiOi0xLCJza1giOjUuODQsInNrWSI6NS44NH19LHsibGVuZ3RoIjoyMywibmFtZSI6InRlZGR5ZHJhZ29uX2VhcnRoXzAzX2Zvb3RfMiIsInBhcmVudCI6InRlZGR5ZHJhZ29uX2VhcnRoXzAzX2Zvb3RfMDIiLCJ0cmFuc2Zvcm0iOnsieCI6MjUuNTQsInkiOjMuNSwic2tYIjozMy40OCwic2tZIjozMy40OH19LHsibGVuZ3RoIjo4MywibmFtZSI6InRlZGR5ZHJhZ29uX2VhcnRoXzAzX2hlYWRfMDEiLCJwYXJlbnQiOiJ0ZWRkeWRyYWdvbl9lYXJ0aF8wM19ib2R5XzQiLCJ0cmFuc2Zvcm0iOnsieCI6MzguMTMsInkiOjEuODIsInNrWCI6NDEuMzcsInNrWSI6NDEuMzd9fSx7Imxlbmd0aCI6MzYsIm5hbWUiOiJ0ZWRkeWRyYWdvbl9lYXJ0aF8wM19sZWdfMyIsInBhcmVudCI6InRlZGR5ZHJhZ29uX2VhcnRoXzAzX2xlZ18yIiwidHJhbnNmb3JtIjp7IngiOjI3LjE1LCJ5IjotMC4wNSwic2tYIjotNzUuODgsInNrWSI6LTc1Ljg4fX0seyJuYW1lIjoidGVkZHlkcmFnb25fZWFydGhfMDNfcmliYm9uXzAxIiwicGFyZW50IjoidGVkZHlkcmFnb25fZWFydGhfMDNfYm9keV80IiwidHJhbnNmb3JtIjp7IngiOjEwLjc0LCJ5Ijo2LjMxfX0seyJsZW5ndGgiOjMxLCJuYW1lIjoidGVkZHlkcmFnb25fZWFydGhfMDNfd2luZ18wMSIsInBhcmVudCI6InRlZGR5ZHJhZ29uX2VhcnRoXzAzX2JvZHlfNCIsInRyYW5zZm9ybSI6eyJ4Ijo2My4xNywieSI6LTE5LjksInNrWCI6LTI2LjM4LCJza1kiOi0yNi4zOH19LHsibGVuZ3RoIjozNSwibmFtZSI6InRlZGR5ZHJhZ29uX2VhcnRoXzAzX3dpbmdfMDIiLCJwYXJlbnQiOiJ0ZWRkeWRyYWdvbl9lYXJ0aF8wM19ib2R5XzQiLCJ0cmFuc2Zvcm0iOnsieCI6MjYuMTQsInkiOjE1LjQ0LCJza1giOjY3LjczLCJza1kiOjY3LjczfX0seyJuYW1lIjoibW9uc3RlcmV5ZV8xIiwicGFyZW50IjoidGVkZHlkcmFnb25fZWFydGhfMDNfaGVhZF8wMSIsInRyYW5zZm9ybSI6eyJ4IjoyNC4yMSwieSI6MTd9fSx7Im5hbWUiOiJtb25zdGVyZXllXzIiLCJwYXJlbnQiOiJ0ZWRkeWRyYWdvbl9lYXJ0aF8wM19oZWFkXzAxIiwidHJhbnNmb3JtIjp7IngiOjI5LjEyLCJ5Ijo1NS43OH19LHsibGVuZ3RoIjoyMiwibmFtZSI6InRlZGR5ZHJhZ29uX2VhcnRoXzAzX2FybV8xIiwicGFyZW50IjoidGVkZHlkcmFnb25fZWFydGhfMDNfYXJtXzAxIiwidHJhbnNmb3JtIjp7IngiOjMyLjk4LCJ5IjotMC43MSwic2tYIjotMjgsInNrWSI6LTI4fX0seyJsZW5ndGgiOjE5LCJuYW1lIjoidGVkZHlkcmFnb25fZWFydGhfMDNfYXJtXzIiLCJwYXJlbnQiOiJ0ZWRkeWRyYWdvbl9lYXJ0aF8wM19hcm1fMDIiLCJ0cmFuc2Zvcm0iOnsieCI6MjIuMDcsInkiOjAuMzUsInNrWCI6LTIuMjUsInNrWSI6LTIuMjV9fSx7Imxlbmd0aCI6MjAsIm5hbWUiOiJ0ZWRkeWRyYWdvbl9lYXJ0aF8wM19ib2R5XzciLCJwYXJlbnQiOiJ0ZWRkeWRyYWdvbl9lYXJ0aF8wM19ib2R5XzYiLCJ0cmFuc2Zvcm0iOnsieCI6MjIuOTksInkiOi0wLjQxLCJza1giOjE0LjU2LCJza1kiOjE0LjU2fX0seyJsZW5ndGgiOjIxLCJuYW1lIjoidGVkZHlkcmFnb25fZWFydGhfMDNfZWFyXzAxIiwicGFyZW50IjoidGVkZHlkcmFnb25fZWFydGhfMDNfaGVhZF8wMSIsInRyYW5zZm9ybSI6eyJ4Ijo1OC42OSwieSI6LTMzLjQ2LCJza1giOi03MS4zMiwic2tZIjotNzEuMzJ9fSx7Imxlbmd0aCI6MjMsIm5hbWUiOiJ0ZWRkeWRyYWdvbl9lYXJ0aF8wM19oZWFkXzAyIiwicGFyZW50IjoidGVkZHlkcmFnb25fZWFydGhfMDNfaGVhZF8wMSIsInRyYW5zZm9ybSI6eyJ4Ijo4MC4zNSwieSI6MTUuMTksInNrWCI6NTAuNDEsInNrWSI6NTAuNDF9fSx7Imxlbmd0aCI6NzgsIm5hbWUiOiJ0ZWRkeWRyYWdvbl9lYXJ0aF8wM19oZWFkXzAzIiwicGFyZW50IjoidGVkZHlkcmFnb25fZWFydGhfMDNfaGVhZF8wMSIsInRyYW5zZm9ybSI6eyJ4Ijo4OC41OCwieSI6LTguOTMsInNrWCI6LTIwLjcsInNrWSI6LTIwLjd9fSx7Imxlbmd0aCI6MjMsIm5hbWUiOiJ0ZWRkeWRyYWdvbl9lYXJ0aF8wM19oZWFkXzEiLCJwYXJlbnQiOiJ0ZWRkeWRyYWdvbl9lYXJ0aF8wM19oZWFkXzAxIiwidHJhbnNmb3JtIjp7IngiOjEwLjE5LCJ5Ijo0OC4zOSwic2tYIjotMTM4LjMzLCJza1kiOi0xMzguMzN9fSx7Imxlbmd0aCI6MTMsIm5hbWUiOiJ0ZWRkeWRyYWdvbl9lYXJ0aF8wM19ob3JuXzAxIiwicGFyZW50IjoidGVkZHlkcmFnb25fZWFydGhfMDNfaGVhZF8wMSIsInRyYW5zZm9ybSI6eyJ4Ijo2MCwieSI6My42Nywic2tYIjotMjkuNTgsInNrWSI6LTI5LjU4fX0seyJsZW5ndGgiOjE0LCJuYW1lIjoidGVkZHlkcmFnb25fZWFydGhfMDNfaG9ybl8wMiIsInBhcmVudCI6InRlZGR5ZHJhZ29uX2VhcnRoXzAzX2hlYWRfMDEiLCJ0cmFuc2Zvcm0iOnsieCI6NjUuMzMsInkiOjQ2LjY5LCJza1giOjM5LjU4LCJza1kiOjM5LjU4fX0seyJsZW5ndGgiOjE0LCJuYW1lIjoidGVkZHlkcmFnb25fZWFydGhfMDNfcmliYm9uXzAyIiwicGFyZW50IjoidGVkZHlkcmFnb25fZWFydGhfMDNfcmliYm9uXzAxIiwidHJhbnNmb3JtIjp7IngiOjQuMDQsInkiOi04Ljg5LCJza1giOi0xNDIuMDYsInNrWSI6LTE0Mi4wNn19LHsibGVuZ3RoIjoxNiwibmFtZSI6InRlZGR5ZHJhZ29uX2VhcnRoXzAzX3JpYmJvbl8wMyIsInBhcmVudCI6InRlZGR5ZHJhZ29uX2VhcnRoXzAzX3JpYmJvbl8wMSIsInRyYW5zZm9ybSI6eyJ4IjotMTAuMDYsInkiOjMuNSwic2tYIjotMTY5LjIxLCJza1kiOi0xNjkuMjF9fSx7Imxlbmd0aCI6MTUsIm5hbWUiOiJ0ZWRkeWRyYWdvbl9lYXJ0aF8wM19yaWJib25fMSIsInBhcmVudCI6InRlZGR5ZHJhZ29uX2VhcnRoXzAzX3JpYmJvbl8wMSIsInRyYW5zZm9ybSI6eyJ4Ijo3LjcyLCJ5IjotMTAuMjEsInNrWCI6LTI3LjQ2LCJza1kiOi0yNy40Nn19LHsibGVuZ3RoIjoxMiwibmFtZSI6InRlZGR5ZHJhZ29uX2VhcnRoXzAzX3JpYmJvbl8xMSIsInBhcmVudCI6InRlZGR5ZHJhZ29uX2VhcnRoXzAzX3JpYmJvbl8wMSIsInRyYW5zZm9ybSI6eyJ4IjotNy41OCwieSI6Mi40NSwic2tYIjoxNTIuMzUsInNrWSI6MTUyLjM1fX0seyJsZW5ndGgiOjEyLCJuYW1lIjoidGVkZHlkcmFnb25fZWFydGhfMDNfcmliYm9uXzIiLCJwYXJlbnQiOiJ0ZWRkeWRyYWdvbl9lYXJ0aF8wM19yaWJib25fMDEiLCJ0cmFuc2Zvcm0iOnsieCI6LTQuMzcsInkiOjMuNjksInNrWCI6OTUuNzksInNrWSI6OTUuNzl9fSx7Imxlbmd0aCI6MTMsIm5hbWUiOiJ0ZWRkeWRyYWdvbl9lYXJ0aF8wM19yaWJib25fOCIsInBhcmVudCI6InRlZGR5ZHJhZ29uX2VhcnRoXzAzX3JpYmJvbl8wMSIsInRyYW5zZm9ybSI6eyJ4Ijo0LjE5LCJ5IjotMTMuMDksInNrWCI6LTc3LjEzLCJza1kiOi03Ny4xM319LHsibGVuZ3RoIjoyMSwibmFtZSI6InRlZGR5ZHJhZ29uX2VhcnRoXzAzX3dpbmdfMSIsInBhcmVudCI6InRlZGR5ZHJhZ29uX2VhcnRoXzAzX3dpbmdfMDEiLCJ0cmFuc2Zvcm0iOnsieCI6MzQuNjQsInkiOi0wLjI3LCJza1giOi03LjYyLCJza1kiOi03LjYyfX0seyJsZW5ndGgiOjIyLCJuYW1lIjoidGVkZHlkcmFnb25fZWFydGhfMDNfd2luZ18xMiIsInBhcmVudCI6InRlZGR5ZHJhZ29uX2VhcnRoXzAzX3dpbmdfMDIiLCJ0cmFuc2Zvcm0iOnsieCI6OS44NiwieSI6OC43LCJza1giOjEyLjg2LCJza1kiOjEyLjg2fX0seyJsZW5ndGgiOjIwLCJuYW1lIjoidGVkZHlkcmFnb25fZWFydGhfMDNfd2luZ180IiwicGFyZW50IjoidGVkZHlkcmFnb25fZWFydGhfMDNfd2luZ18wMSIsInRyYW5zZm9ybSI6eyJ4IjowLjkyLCJ5IjotOC40Mywic2tYIjotMzMuNzksInNrWSI6LTMzLjc5fX0seyJsZW5ndGgiOjIxLCJuYW1lIjoidGVkZHlkcmFnb25fZWFydGhfMDNfd2luZ185IiwicGFyZW50IjoidGVkZHlkcmFnb25fZWFydGhfMDNfd2luZ18wMiIsInRyYW5zZm9ybSI6eyJ4Ijo0MC45MiwieSI6MSwic2tYIjoxMC4zNCwic2tZIjoxMC4zNH19LHsibGVuZ3RoIjoxOSwibmFtZSI6InRlZGR5ZHJhZ29uX2VhcnRoXzAzX2FybV8zIiwicGFyZW50IjoidGVkZHlkcmFnb25fZWFydGhfMDNfYXJtXzIiLCJ0cmFuc2Zvcm0iOnsieCI6MjMuMjYsInkiOi0xLjUsInNrWCI6LTQxLjQsInNrWSI6LTQxLjR9fSx7Imxlbmd0aCI6MjMsIm5hbWUiOiJ0ZWRkeWRyYWdvbl9lYXJ0aF8wM19hcm1fNCIsInBhcmVudCI6InRlZGR5ZHJhZ29uX2VhcnRoXzAzX2FybV8xIiwidHJhbnNmb3JtIjp7IngiOjI2Ljc1LCJ5IjotMi4yMSwic2tYIjotMjcuNjQsInNrWSI6LTI3LjY0fX0seyJsZW5ndGgiOjE2LCJuYW1lIjoidGVkZHlkcmFnb25fZWFydGhfMDNfZWFyXzEiLCJwYXJlbnQiOiJ0ZWRkeWRyYWdvbl9lYXJ0aF8wM19lYXJfMDEiLCJ0cmFuc2Zvcm0iOnsieCI6MjQuMTYsInkiOjAuMzMsInNrWCI6MTEuMjIsInNrWSI6MTEuMjJ9fSx7Imxlbmd0aCI6MTAsIm5hbWUiOiJ0ZWRkeWRyYWdvbl9lYXJ0aF8wM19lYXJfMyIsInBhcmVudCI6InRlZGR5ZHJhZ29uX2VhcnRoXzAzX2Vhcl8wMSIsInRyYW5zZm9ybSI6eyJ4IjotMTIuMjgsInkiOi0zMC45OSwic2tYIjotMTAuMzQsInNrWSI6LTEwLjM0fX0seyJsZW5ndGgiOjE0LCJuYW1lIjoidGVkZHlkcmFnb25fZWFydGhfMDNfaGVhZF8yIiwicGFyZW50IjoidGVkZHlkcmFnb25fZWFydGhfMDNfaGVhZF8wMiIsInRyYW5zZm9ybSI6eyJ4IjoyNi4xMiwieSI6LTAuNzIsInNrWCI6LTI3LjEsInNrWSI6LTI3LjF9fSx7Imxlbmd0aCI6MTEsIm5hbWUiOiJ0ZWRkeWRyYWdvbl9lYXJ0aF8wM19oZWFkXzQiLCJwYXJlbnQiOiJ0ZWRkeWRyYWdvbl9lYXJ0aF8wM19oZWFkXzAyIiwidHJhbnNmb3JtIjp7IngiOjIuNTgsInkiOjE5Ljg2LCJza1giOjQxLjI3LCJza1kiOjQxLjI3fX0seyJsZW5ndGgiOjE1LCJuYW1lIjoidGVkZHlkcmFnb25fZWFydGhfMDNfaG9ybl8xIiwicGFyZW50IjoidGVkZHlkcmFnb25fZWFydGhfMDNfaG9ybl8wMSIsInRyYW5zZm9ybSI6eyJ4IjoxMi44Miwic2tYIjowLjUzLCJza1kiOjAuNTN9fSx7Imxlbmd0aCI6MTQsIm5hbWUiOiJ0ZWRkeWRyYWdvbl9lYXJ0aF8wM19ob3JuXzIiLCJwYXJlbnQiOiJ0ZWRkeWRyYWdvbl9lYXJ0aF8wM19ob3JuXzAyIiwidHJhbnNmb3JtIjp7IngiOjE3LjgzLCJ5IjowLjQ3LCJza1giOi0wLjQ1LCJza1kiOi0wLjQ1fX0seyJsZW5ndGgiOjEzLCJuYW1lIjoidGVkZHlkcmFnb25fZWFydGhfMDNfcmliYm9uXzEwIiwicGFyZW50IjoidGVkZHlkcmFnb25fZWFydGhfMDNfcmliYm9uXzIiLCJ0cmFuc2Zvcm0iOnsieCI6MTYuNjcsInkiOi0wLjgzLCJza1giOi0zLjE1LCJza1kiOi0zLjE1fX0seyJsZW5ndGgiOjExLCJuYW1lIjoidGVkZHlkcmFnb25fZWFydGhfMDNfcmliYm9uXzEyIiwicGFyZW50IjoidGVkZHlkcmFnb25fZWFydGhfMDNfcmliYm9uXzExIiwidHJhbnNmb3JtIjp7IngiOjE0LjkxLCJ5IjowLjI1LCJza1giOi0xLjM2LCJza1kiOi0xLjM2fX0seyJsZW5ndGgiOjE1LCJuYW1lIjoidGVkZHlkcmFnb25fZWFydGhfMDNfcmliYm9uXzMiLCJwYXJlbnQiOiJ0ZWRkeWRyYWdvbl9lYXJ0aF8wM19yaWJib25fMDMiLCJ0cmFuc2Zvcm0iOnsieCI6MTkuMjcsInkiOi0wLjA2LCJza1giOjYuNzgsInNrWSI6Ni43OH19LHsibGVuZ3RoIjoxOSwibmFtZSI6InRlZGR5ZHJhZ29uX2VhcnRoXzAzX3JpYmJvbl81IiwicGFyZW50IjoidGVkZHlkcmFnb25fZWFydGhfMDNfcmliYm9uXzAyIiwidHJhbnNmb3JtIjp7IngiOjIxLjc3LCJ5IjowLjg3LCJza1giOi0yLjcsInNrWSI6LTIuN319LHsibGVuZ3RoIjoxOCwibmFtZSI6InRlZGR5ZHJhZ29uX2VhcnRoXzAzX3JpYmJvbl83IiwicGFyZW50IjoidGVkZHlkcmFnb25fZWFydGhfMDNfcmliYm9uXzEiLCJ0cmFuc2Zvcm0iOnsieCI6MTguNTQsInkiOi0wLjc5LCJza1giOi0xMC43LCJza1kiOi0xMC43fX0seyJsZW5ndGgiOjE2LCJuYW1lIjoidGVkZHlkcmFnb25fZWFydGhfMDNfcmliYm9uXzkiLCJwYXJlbnQiOiJ0ZWRkeWRyYWdvbl9lYXJ0aF8wM19yaWJib25fOCIsInRyYW5zZm9ybSI6eyJ4IjoxNi40OCwieSI6MC4wMywic2tYIjotNC4wNSwic2tZIjotNC4wNX19LHsibGVuZ3RoIjoxNywibmFtZSI6InRlZGR5ZHJhZ29uX2VhcnRoXzAzX3dpbmdfMTAiLCJwYXJlbnQiOiJ0ZWRkeWRyYWdvbl9lYXJ0aF8wM193aW5nXzkiLCJ0cmFuc2Zvcm0iOnsieCI6MjcuMjMsInkiOjAuMzgsInNrWCI6Ni4yOSwic2tZIjo2LjI5fX0seyJsZW5ndGgiOjIyLCJuYW1lIjoidGVkZHlkcmFnb25fZWFydGhfMDNfd2luZ18xMyIsInBhcmVudCI6InRlZGR5ZHJhZ29uX2VhcnRoXzAzX3dpbmdfMTIiLCJ0cmFuc2Zvcm0iOnsieCI6MjYuMTUsInkiOjAuODUsInNrWCI6NS4zOSwic2tZIjo1LjM5fX0seyJsZW5ndGgiOjIxLCJuYW1lIjoidGVkZHlkcmFnb25fZWFydGhfMDNfd2luZ18xNSIsInBhcmVudCI6InRlZGR5ZHJhZ29uX2VhcnRoXzAzX3dpbmdfMTIiLCJ0cmFuc2Zvcm0iOnsieCI6LTEyLjkyLCJ5IjoyLjA5LCJza1giOjM1LjMyLCJza1kiOjM1LjMyfX0seyJsZW5ndGgiOjE5LCJuYW1lIjoidGVkZHlkcmFnb25fZWFydGhfMDNfd2luZ18yIiwicGFyZW50IjoidGVkZHlkcmFnb25fZWFydGhfMDNfd2luZ18xIiwidHJhbnNmb3JtIjp7IngiOjI3LjM0LCJ5IjotMS4xNywic2tYIjo2LjI5LCJza1kiOjYuMjl9fSx7Imxlbmd0aCI6MjIsIm5hbWUiOiJ0ZWRkeWRyYWdvbl9lYXJ0aF8wM193aW5nXzUiLCJwYXJlbnQiOiJ0ZWRkeWRyYWdvbl9lYXJ0aF8wM193aW5nXzQiLCJ0cmFuc2Zvcm0iOnsieCI6MjYuMzYsInkiOi0wLjMxLCJza1giOjUuODQsInNrWSI6NS44NH19LHsibGVuZ3RoIjoxMywibmFtZSI6InRlZGR5ZHJhZ29uX2VhcnRoXzAzX3dpbmdfNyIsInBhcmVudCI6InRlZGR5ZHJhZ29uX2VhcnRoXzAzX3dpbmdfNCIsInRyYW5zZm9ybSI6eyJ4IjotMy44OSwieSI6LTcuMTcsInNrWCI6LTU3LjE1LCJza1kiOi01Ny4xNX19LHsibGVuZ3RoIjoyMSwibmFtZSI6InRlZGR5ZHJhZ29uX2VhcnRoXzAzX2Vhcl8yIiwicGFyZW50IjoidGVkZHlkcmFnb25fZWFydGhfMDNfZWFyXzEiLCJ0cmFuc2Zvcm0iOnsieCI6MTkuNjYsInkiOjAuOTYsInNrWCI6MTkuNjUsInNrWSI6MTkuNjV9fSx7Imxlbmd0aCI6MTEsIm5hbWUiOiJ0ZWRkeWRyYWdvbl9lYXJ0aF8wM19lYXJfNCIsInBhcmVudCI6InRlZGR5ZHJhZ29uX2VhcnRoXzAzX2Vhcl8zIiwidHJhbnNmb3JtIjp7IngiOjEzLjcsInkiOjAuNTUsInNrWCI6MTIsInNrWSI6MTJ9fSx7Im5hbWUiOiJ0ZWRkeWRyYWdvbl9lYXJ0aF8wM19lZmZlY3RfMDMiLCJwYXJlbnQiOiJ0ZWRkeWRyYWdvbl9lYXJ0aF8wM19hcm1fMyIsInRyYW5zZm9ybSI6eyJ4Ijo0OS40OSwieSI6LTExLjY4fX0seyJuYW1lIjoidGVkZHlkcmFnb25fZWFydGhfMDNfZWZmZWN0XzA0IiwicGFyZW50IjoidGVkZHlkcmFnb25fZWFydGhfMDNfYXJtXzMiLCJ0cmFuc2Zvcm0iOnsieCI6MjAuNCwieSI6LTIuMjMsInNrWCI6LTEuOTgsInNrWSI6LTEuOTh9fSx7Imxlbmd0aCI6MTYsIm5hbWUiOiJ0ZWRkeWRyYWdvbl9lYXJ0aF8wM19oZWFkXzMiLCJwYXJlbnQiOiJ0ZWRkeWRyYWdvbl9lYXJ0aF8wM19oZWFkXzIiLCJ0cmFuc2Zvcm0iOnsieCI6MTcuMDUsInkiOi0wLjg5LCJza1giOi0zNy4zNywic2tZIjotMzcuMzd9fSx7Imxlbmd0aCI6MTQsIm5hbWUiOiJ0ZWRkeWRyYWdvbl9lYXJ0aF8wM19oZWFkXzUiLCJwYXJlbnQiOiJ0ZWRkeWRyYWdvbl9lYXJ0aF8wM19oZWFkXzQiLCJ0cmFuc2Zvcm0iOnsieCI6MTQuMDksInkiOi0wLjMxLCJza1giOi0xMi44Niwic2tZIjotMTIuODZ9fSx7Imxlbmd0aCI6MjEsIm5hbWUiOiJ0ZWRkeWRyYWdvbl9lYXJ0aF8wM19yaWJib25fNCIsInBhcmVudCI6InRlZGR5ZHJhZ29uX2VhcnRoXzAzX3JpYmJvbl8zIiwidHJhbnNmb3JtIjp7IngiOjE5LjEsInkiOjAuMDcsInNrWCI6NC45OCwic2tZIjo0Ljk4fX0seyJsZW5ndGgiOjIyLCJuYW1lIjoidGVkZHlkcmFnb25fZWFydGhfMDNfcmliYm9uXzYiLCJwYXJlbnQiOiJ0ZWRkeWRyYWdvbl9lYXJ0aF8wM19yaWJib25fNSIsInRyYW5zZm9ybSI6eyJ4IjoyNS40NCwieSI6LTAuNzksInNrWCI6LTMuNiwic2tZIjotMy42fX0seyJuYW1lIjoidGVkZHlkcmFnb25fZWFydGhfMDNfdGFtXzAxIiwicGFyZW50IjoidGVkZHlkcmFnb25fZWFydGhfMDNfYXJtXzMiLCJ0cmFuc2Zvcm0iOnsieCI6MjcuNTUsInkiOi0xMi4yNywic2NYIjowLjgsInNjWSI6MC44fX0seyJsZW5ndGgiOjEwLCJuYW1lIjoidGVkZHlkcmFnb25fZWFydGhfMDNfd2luZ18xMSIsInBhcmVudCI6InRlZGR5ZHJhZ29uX2VhcnRoXzAzX3dpbmdfMTAiLCJ0cmFuc2Zvcm0iOnsieCI6MjAuNDUsInkiOi0wLjEyLCJza1giOi0zNi4xMywic2tZIjotMzYuMTN9fSx7Imxlbmd0aCI6MTMsIm5hbWUiOiJ0ZWRkeWRyYWdvbl9lYXJ0aF8wM193aW5nXzE0IiwicGFyZW50IjoidGVkZHlkcmFnb25fZWFydGhfMDNfd2luZ18xMyIsInRyYW5zZm9ybSI6eyJ4IjoyNy4yNiwieSI6MC42NSwic2tYIjotMTQuOTgsInNrWSI6LTE0Ljk4fX0seyJsZW5ndGgiOjE3LCJuYW1lIjoidGVkZHlkcmFnb25fZWFydGhfMDNfd2luZ18xNiIsInBhcmVudCI6InRlZGR5ZHJhZ29uX2VhcnRoXzAzX3dpbmdfMTUiLCJ0cmFuc2Zvcm0iOnsieCI6MjUuNSwieSI6LTAuODEsInNrWCI6LTUuMzksInNrWSI6LTUuMzl9fSx7Imxlbmd0aCI6MjAsIm5hbWUiOiJ0ZWRkeWRyYWdvbl9lYXJ0aF8wM193aW5nXzMiLCJwYXJlbnQiOiJ0ZWRkeWRyYWdvbl9lYXJ0aF8wM193aW5nXzIiLCJ0cmFuc2Zvcm0iOnsieCI6MjUuNDEsInkiOjAuNjQsInNrWCI6MzAuMDgsInNrWSI6MzAuMDh9fSx7Imxlbmd0aCI6MTcsIm5hbWUiOiJ0ZWRkeWRyYWdvbl9lYXJ0aF8wM193aW5nXzYiLCJwYXJlbnQiOiJ0ZWRkeWRyYWdvbl9lYXJ0aF8wM193aW5nXzUiLCJ0cmFuc2Zvcm0iOnsieCI6MjYuNTIsInkiOjAuNDMsInNrWCI6NS4zOSwic2tZIjo1LjM5fX0seyJsZW5ndGgiOjEyLCJuYW1lIjoidGVkZHlkcmFnb25fZWFydGhfMDNfd2luZ184IiwicGFyZW50IjoidGVkZHlkcmFnb25fZWFydGhfMDNfd2luZ183IiwidHJhbnNmb3JtIjp7IngiOjE3LjIxLCJ5IjowLjQzLCJza1giOjE1LjQsInNrWSI6MTUuNH19LHsibGVuZ3RoIjoxMCwibmFtZSI6InRlZGR5ZHJhZ29uX2VhcnRoXzAzX2hlYWRfNiIsInBhcmVudCI6InRlZGR5ZHJhZ29uX2VhcnRoXzAzX2hlYWRfNSIsInRyYW5zZm9ybSI6eyJ4IjoxNi43NCwieSI6LTAuNDIsInNrWCI6LTI5LjU1LCJza1kiOi0yOS41NX19XSwic2xvdCI6W3sibmFtZSI6ImVmZmVjdF90ZWRkeWRyYWdvbl9lYXJ0aF8wM19lZmZlY3RfMDEiLCJwYXJlbnQiOiJ0ZWRkeWRyYWdvbl9lYXJ0aF8wM19lZmZlY3RfMDEifSx7Im5hbWUiOiJlZmZlY3RfdGVkZHlkcmFnb25fZWFydGhfMDNfZWZmZWN0XzEiLCJwYXJlbnQiOiJ0ZWRkeWRyYWdvbl9lYXJ0aF8wM19lZmZlY3RfMSJ9LHsibmFtZSI6ImVmZmVjdF90ZWRkeWRyYWdvbl9lYXJ0aF8wM19lZmZlY3RfMDIiLCJwYXJlbnQiOiJ0ZWRkeWRyYWdvbl9lYXJ0aF8wM19QaWxsb3dfMSJ9LHsibmFtZSI6ImVmZmVjdF90ZWRkeWRyYWdvbl9lYXJ0aF8wM19lZmZlY3RfMyIsInBhcmVudCI6InRlZGR5ZHJhZ29uX2VhcnRoXzAzX1BpbGxvd18zIn0seyJuYW1lIjoidGVkZHlkcmFnb25fZWFydGhfMDNfcnVnXzAxIiwicGFyZW50IjoidGVkZHlkcmFnb25fZWFydGhfMDNfcnVnXzAxIn0seyJuYW1lIjoidGVkZHlkcmFnb25fZWFydGhfMDNfUGlsbG93XzAxIiwicGFyZW50IjoidGVkZHlkcmFnb25fZWFydGhfMDNfUGlsbG93XzYifSx7Im5hbWUiOiJ0ZWRkeWRyYWdvbl9lYXJ0aF8wM19ib2R5XzAyIiwicGFyZW50IjoidGVkZHlkcmFnb25fZWFydGhfMDNfYm9keV83In0seyJuYW1lIjoidGVkZHlkcmFnb25fZWFydGhfMDNfUGlsbG93XzAyIiwicGFyZW50IjoidGVkZHlkcmFnb25fZWFydGhfMDNfUGlsbG93XzUifSx7Im5hbWUiOiJ0ZWRkeWRyYWdvbl9lYXJ0aF8wM19sZWdfMDIiLCJwYXJlbnQiOiJ0ZWRkeWRyYWdvbl9lYXJ0aF8wM19sZWdfMyJ9LHsibmFtZSI6InRlZGR5ZHJhZ29uX2VhcnRoXzAzX3dpbmdfMDEiLCJwYXJlbnQiOiJ0ZWRkeWRyYWdvbl9lYXJ0aF8wM193aW5nXzgifSx7Im5hbWUiOiJ0ZWRkeWRyYWdvbl9lYXJ0aF8wM193aW5nXzAyIiwicGFyZW50IjoidGVkZHlkcmFnb25fZWFydGhfMDNfd2luZ18xNiJ9LHsibmFtZSI6InRlZGR5ZHJhZ29uX2VhcnRoXzAzX2FybV8wMiIsInBhcmVudCI6InRlZGR5ZHJhZ29uX2VhcnRoXzAzX2FybV8zIn0seyJuYW1lIjoidGVkZHlkcmFnb25fZWFydGhfMDNfYm9keV8wMSIsInBhcmVudCI6InRlZGR5ZHJhZ29uX2VhcnRoXzAzX2JvZHlfMDEifSx7ImRpc3BsYXlJbmRleCI6LTEsIm5hbWUiOiJlZmZlY3RfdGVkZHlkcmFnb25fZWFydGhfMDNfZWZmZWN0XzAzIiwicGFyZW50IjoidGVkZHlkcmFnb25fZWFydGhfMDNfZWZmZWN0XzAzIn0seyJkaXNwbGF5SW5kZXgiOi0xLCJuYW1lIjoidGVkZHlkcmFnb25fZWFydGhfMDNfZm9vdF8wMiIsInBhcmVudCI6InRlZGR5ZHJhZ29uX2VhcnRoXzAzX2Zvb3RfMiJ9LHsibmFtZSI6InRlZGR5ZHJhZ29uX2VhcnRoXzAzX2xlZ18wMSIsInBhcmVudCI6InRlZGR5ZHJhZ29uX2VhcnRoXzAzX2xlZ18wMSJ9LHsibmFtZSI6InRlZGR5ZHJhZ29uX2VhcnRoXzAzX3JpYmJvbl8wMyIsInBhcmVudCI6InRlZGR5ZHJhZ29uX2VhcnRoXzAzX3JpYmJvbl80In0seyJuYW1lIjoidGVkZHlkcmFnb25fZWFydGhfMDNfZm9vdF8wMSIsInBhcmVudCI6InRlZGR5ZHJhZ29uX2VhcnRoXzAzX2Zvb3RfMSJ9LHsibmFtZSI6InRlZGR5ZHJhZ29uX2VhcnRoXzAzX3JpYmJvbl8wMiIsInBhcmVudCI6InRlZGR5ZHJhZ29uX2VhcnRoXzAzX3JpYmJvbl82In0seyJuYW1lIjoidGVkZHlkcmFnb25fZWFydGhfMDNfYXJtXzAxIiwicGFyZW50IjoidGVkZHlkcmFnb25fZWFydGhfMDNfYXJtXzQifSx7Im5hbWUiOiJ0ZWRkeWRyYWdvbl9lYXJ0aF8wM19yaWJib25fMDEiLCJwYXJlbnQiOiJ0ZWRkeWRyYWdvbl9lYXJ0aF8wM19yaWJib25fMTIifSx7ImRpc3BsYXlJbmRleCI6LTEsIm5hbWUiOiJ0ZWRkeWRyYWdvbl9lYXJ0aF8wM190YW1fMDIiLCJwYXJlbnQiOiJ0ZWRkeWRyYWdvbl9lYXJ0aF8wM190YW1fMDEifSx7ImRpc3BsYXlJbmRleCI6LTEsIm5hbWUiOiJ0ZWRkeWRyYWdvbl9lYXJ0aF8wM190YW1fMDEiLCJwYXJlbnQiOiJ0ZWRkeWRyYWdvbl9lYXJ0aF8wM190YW1fMDEifSx7Im5hbWUiOiJ0ZWRkeWRyYWdvbl9lYXJ0aF8wM19oZWFkXzAxIiwicGFyZW50IjoidGVkZHlkcmFnb25fZWFydGhfMDNfaGVhZF8xIn0seyJuYW1lIjoidGVkZHlkcmFnb25fZWFydGhfMDNfZXllXzAxIiwicGFyZW50IjoibW9uc3RlcmV5ZV8xIn0seyJuYW1lIjoidGVkZHlkcmFnb25fZWFydGhfMDNfZWFyXzAxIiwicGFyZW50IjoidGVkZHlkcmFnb25fZWFydGhfMDNfZWFyXzQifSx7Im5hbWUiOiJ0ZWRkeWRyYWdvbl9lYXJ0aF8wM19leWVfMDIiLCJwYXJlbnQiOiJtb25zdGVyZXllXzIifSx7Im5hbWUiOiJ0ZWRkeWRyYWdvbl9lYXJ0aF8wM19ob3JuXzAyIiwicGFyZW50IjoidGVkZHlkcmFnb25fZWFydGhfMDNfaG9ybl8yIn0seyJuYW1lIjoidGVkZHlkcmFnb25fZWFydGhfMDNfaGVhZF8wMiIsInBhcmVudCI6InRlZGR5ZHJhZ29uX2VhcnRoXzAzX2hlYWRfNiJ9LHsibmFtZSI6InRlZGR5ZHJhZ29uX2VhcnRoXzAzX2hlYWRfMDMiLCJwYXJlbnQiOiJ0ZWRkeWRyYWdvbl9lYXJ0aF8wM19oZWFkXzAzIn0seyJuYW1lIjoidGVkZHlkcmFnb25fZWFydGhfMDNfaG9ybl8wMSIsInBhcmVudCI6InRlZGR5ZHJhZ29uX2VhcnRoXzAzX2hvcm5fMSJ9LHsibmFtZSI6ImVmZmVjdF90ZWRkeWRyYWdvbl9lYXJ0aF8wM19lZmZlY3RfMiIsInBhcmVudCI6InRlZGR5ZHJhZ29uX2VhcnRoXzAzX1BpbGxvd18yIn0seyJuYW1lIjoiZWZmZWN0X3RlZGR5ZHJhZ29uX2VhcnRoXzAzX2VmZmVjdF80IiwicGFyZW50IjoidGVkZHlkcmFnb25fZWFydGhfMDNfUGlsbG93XzQifSx7ImRpc3BsYXlJbmRleCI6LTEsIm5hbWUiOiJlZmZlY3RfdGVkZHlkcmFnb25fZWFydGhfMDNfZWZmZWN0XzA0IiwicGFyZW50IjoidGVkZHlkcmFnb25fZWFydGhfMDNfZWZmZWN0XzA0In1dLCJza2luIjpbeyJzbG90IjpbeyJuYW1lIjoiZWZmZWN0X3RlZGR5ZHJhZ29uX2VhcnRoXzAzX2VmZmVjdF8zIiwiZGlzcGxheSI6W3sibmFtZSI6InRlZGR5ZHJhZ29uX2VhcnRoXzAzX2VmZmVjdF8wMiIsInRyYW5zZm9ybSI6eyJ4IjoxLjI0LCJ5Ijo0LjI2fX1dfSx7Im5hbWUiOiJ0ZWRkeWRyYWdvbl9lYXJ0aF8wM19ib2R5XzAyIiwiZGlzcGxheSI6W3sidHlwZSI6Im1lc2giLCJuYW1lIjoidGVkZHlkcmFnb25fZWFydGhfMDNfYm9keV8wMiIsIm9mZnNldCI6MCwidXNlckVkZ2VzIjpbXX1dfSx7Im5hbWUiOiJlZmZlY3RfdGVkZHlkcmFnb25fZWFydGhfMDNfZWZmZWN0XzAzIiwiZGlzcGxheSI6W3sibmFtZSI6InRlZGR5ZHJhZ29uX2VhcnRoXzAzX2VmZmVjdF8wMyIsInRyYW5zZm9ybSI6eyJ4Ijo2Ljc3LCJ5IjozLjQ3LCJza1giOi0zNi4yOSwic2tZIjotMzYuMjl9fV19LHsibmFtZSI6ImVmZmVjdF90ZWRkeWRyYWdvbl9lYXJ0aF8wM19lZmZlY3RfMDEiLCJkaXNwbGF5IjpbeyJuYW1lIjoidGVkZHlkcmFnb25fZWFydGhfMDNfZWZmZWN0XzAxIiwidHJhbnNmb3JtIjp7IngiOi0wLjE5LCJ5IjowLjU4fX1dfSx7Im5hbWUiOiJ0ZWRkeWRyYWdvbl9lYXJ0aF8wM190YW1fMDEiLCJkaXNwbGF5IjpbeyJ0eXBlIjoibWVzaCIsIm5hbWUiOiJ0ZWRkeWRyYWdvbl9lYXJ0aF8wM190YW1fMDEiLCJvZmZzZXQiOjMwNiwidXNlckVkZ2VzIjpbXX1dfSx7Im5hbWUiOiJ0ZWRkeWRyYWdvbl9lYXJ0aF8wM19oZWFkXzAyIiwiZGlzcGxheSI6W3sidHlwZSI6Im1lc2giLCJuYW1lIjoidGVkZHlkcmFnb25fZWFydGhfMDNfaGVhZF8wMiIsIm9mZnNldCI6NTE0LCJ1c2VyRWRnZXMiOltdfV19LHsibmFtZSI6InRlZGR5ZHJhZ29uX2VhcnRoXzAzX2hvcm5fMDIiLCJkaXNwbGF5IjpbeyJ0eXBlIjoibWVzaCIsIm5hbWUiOiJ0ZWRkeWRyYWdvbl9lYXJ0aF8wM19ob3JuXzAyIiwib2Zmc2V0Ijo4NTMsInVzZXJFZGdlcyI6W119XX0seyJuYW1lIjoidGVkZHlkcmFnb25fZWFydGhfMDNfcmliYm9uXzAyIiwiZGlzcGxheSI6W3sidHlwZSI6Im1lc2giLCJuYW1lIjoidGVkZHlkcmFnb25fZWFydGhfMDNfcmliYm9uXzAyIiwib2Zmc2V0IjoxMDExLCJ1c2VyRWRnZXMiOltdfV19LHsibmFtZSI6InRlZGR5ZHJhZ29uX2VhcnRoXzAzX2Vhcl8wMSIsImRpc3BsYXkiOlt7InR5cGUiOiJtZXNoIiwibmFtZSI6InRlZGR5ZHJhZ29uX2VhcnRoXzAzX2Vhcl8wMSIsIm9mZnNldCI6MTI5OCwidXNlckVkZ2VzIjpbXX1dfSx7Im5hbWUiOiJ0ZWRkeWRyYWdvbl9lYXJ0aF8wM19leWVfMDEiLCJkaXNwbGF5IjpbeyJ0eXBlIjoibWVzaCIsIm5hbWUiOiJ0ZWRkeWRyYWdvbl9lYXJ0aF8wM19leWVfMDEiLCJvZmZzZXQiOjE3NzksInVzZXJFZGdlcyI6W119XX0seyJuYW1lIjoiZWZmZWN0X3RlZGR5ZHJhZ29uX2VhcnRoXzAzX2VmZmVjdF80IiwiZGlzcGxheSI6W3sibmFtZSI6InRlZGR5ZHJhZ29uX2VhcnRoXzAzX2VmZmVjdF8wMiIsInRyYW5zZm9ybSI6eyJ4IjoxLjI0LCJ5Ijo0LjI2fX1dfSx7Im5hbWUiOiJ0ZWRkeWRyYWdvbl9lYXJ0aF8wM19ob3JuXzAxIiwiZGlzcGxheSI6W3sidHlwZSI6Im1lc2giLCJuYW1lIjoidGVkZHlkcmFnb25fZWFydGhfMDNfaG9ybl8wMSIsIm9mZnNldCI6MTg0OSwidXNlckVkZ2VzIjpbXX1dfSx7Im5hbWUiOiJ0ZWRkeWRyYWdvbl9lYXJ0aF8wM19mb290XzAxIiwiZGlzcGxheSI6W3sidHlwZSI6Im1lc2giLCJuYW1lIjoidGVkZHlkcmFnb25fZWFydGhfMDNfZm9vdF8wMSIsIm9mZnNldCI6MjA0MywidXNlckVkZ2VzIjpbXX1dfSx7Im5hbWUiOiJlZmZlY3RfdGVkZHlkcmFnb25fZWFydGhfMDNfZWZmZWN0XzAyIiwiZGlzcGxheSI6W3sibmFtZSI6InRlZGR5ZHJhZ29uX2VhcnRoXzAzX2VmZmVjdF8wMiIsInRyYW5zZm9ybSI6eyJ4IjoxLjI0LCJ5Ijo0LjI2fX1dfSx7Im5hbWUiOiJ0ZWRkeWRyYWdvbl9lYXJ0aF8wM190YW1fMDIiLCJkaXNwbGF5IjpbeyJ0eXBlIjoibWVzaCIsIm5hbWUiOiJ0ZWRkeWRyYWdvbl9lYXJ0aF8wM190YW1fMDIiLCJvZmZzZXQiOjIyOTMsInVzZXJFZGdlcyI6W119XX0seyJuYW1lIjoidGVkZHlkcmFnb25fZWFydGhfMDNfd2luZ18wMSIsImRpc3BsYXkiOlt7InR5cGUiOiJtZXNoIiwibmFtZSI6InRlZGR5ZHJhZ29uX2VhcnRoXzAzX3dpbmdfMDEiLCJvZmZzZXQiOjIzNDIsInVzZXJFZGdlcyI6W119XX0seyJuYW1lIjoidGVkZHlkcmFnb25fZWFydGhfMDNfZXllXzAyIiwiZGlzcGxheSI6W3sidHlwZSI6Im1lc2giLCJuYW1lIjoidGVkZHlkcmFnb25fZWFydGhfMDNfZXllXzAyIiwib2Zmc2V0IjoyNzQwLCJ1c2VyRWRnZXMiOltdfV19LHsibmFtZSI6InRlZGR5ZHJhZ29uX2VhcnRoXzAzX2xlZ18wMSIsImRpc3BsYXkiOlt7InR5cGUiOiJtZXNoIiwibmFtZSI6InRlZGR5ZHJhZ29uX2VhcnRoXzAzX2xlZ18wMSIsIm9mZnNldCI6MjgzMSwidXNlckVkZ2VzIjpbXX1dfSx7Im5hbWUiOiJlZmZlY3RfdGVkZHlkcmFnb25fZWFydGhfMDNfZWZmZWN0XzEiLCJkaXNwbGF5IjpbeyJuYW1lIjoidGVkZHlkcmFnb25fZWFydGhfMDNfZWZmZWN0XzAxIiwidHJhbnNmb3JtIjp7IngiOi0wLjE5LCJ5IjowLjU4fX1dfSx7Im5hbWUiOiJ0ZWRkeWRyYWdvbl9lYXJ0aF8wM19QaWxsb3dfMDEiLCJkaXNwbGF5IjpbeyJ0eXBlIjoibWVzaCIsIm5hbWUiOiJ0ZWRkeWRyYWdvbl9lYXJ0aF8wM19QaWxsb3dfMDEiLCJvZmZzZXQiOjI5NDksInVzZXJFZGdlcyI6W119XX0seyJuYW1lIjoidGVkZHlkcmFnb25fZWFydGhfMDNfYXJtXzAxIiwiZGlzcGxheSI6W3sidHlwZSI6Im1lc2giLCJuYW1lIjoidGVkZHlkcmFnb25fZWFydGhfMDNfYXJtXzAxIiwib2Zmc2V0IjozMjcxLCJ1c2VyRWRnZXMiOltdfV19LHsibmFtZSI6InRlZGR5ZHJhZ29uX2VhcnRoXzAzX2JvZHlfMDEiLCJkaXNwbGF5IjpbeyJ0eXBlIjoibWVzaCIsIm5hbWUiOiJ0ZWRkeWRyYWdvbl9lYXJ0aF8wM19ib2R5XzAxIiwib2Zmc2V0IjozNTIyLCJ1c2VyRWRnZXMiOltdfV19LHsibmFtZSI6InRlZGR5ZHJhZ29uX2VhcnRoXzAzX2hlYWRfMDMiLCJkaXNwbGF5IjpbeyJuYW1lIjoidGVkZHlkcmFnb25fZWFydGhfMDNfaGVhZF8wMyIsInRyYW5zZm9ybSI6eyJ4IjozMi43NSwieSI6MS41Miwic2tYIjo5OS41Miwic2tZIjo5OS41Mn19XX0seyJuYW1lIjoidGVkZHlkcmFnb25fZWFydGhfMDNfcnVnXzAxIiwiZGlzcGxheSI6W3sibmFtZSI6InRlZGR5ZHJhZ29uX2VhcnRoXzAzX3J1Z18wMSIsInRyYW5zZm9ybSI6eyJ4IjotNC40MSwieSI6Ni4zOX19XX0seyJuYW1lIjoidGVkZHlkcmFnb25fZWFydGhfMDNfbGVnXzAyIiwiZGlzcGxheSI6W3sidHlwZSI6Im1lc2giLCJuYW1lIjoidGVkZHlkcmFnb25fZWFydGhfMDNfbGVnXzAyIiwib2Zmc2V0IjozOTM2LCJ1c2VyRWRnZXMiOltdfV19LHsibmFtZSI6InRlZGR5ZHJhZ29uX2VhcnRoXzAzX1BpbGxvd18wMiIsImRpc3BsYXkiOlt7InR5cGUiOiJtZXNoIiwibmFtZSI6InRlZGR5ZHJhZ29uX2VhcnRoXzAzX1BpbGxvd18wMiIsIm9mZnNldCI6NDI0OSwidXNlckVkZ2VzIjpbXX1dfSx7Im5hbWUiOiJlZmZlY3RfdGVkZHlkcmFnb25fZWFydGhfMDNfZWZmZWN0XzA0IiwiZGlzcGxheSI6W3sibmFtZSI6InRlZGR5ZHJhZ29uX2VhcnRoXzAzX2VmZmVjdF8wNCIsInRyYW5zZm9ybSI6eyJ4Ijo0LjY2LCJ5IjoxNy4zNiwic2tYIjotMzYuMjksInNrWSI6LTM2LjI5fX1dfSx7Im5hbWUiOiJ0ZWRkeWRyYWdvbl9lYXJ0aF8wM19mb290XzAyIiwiZGlzcGxheSI6W3sidHlwZSI6Im1lc2giLCJuYW1lIjoidGVkZHlkcmFnb25fZWFydGhfMDNfZm9vdF8wMiIsIm9mZnNldCI6NDU0NywidXNlckVkZ2VzIjpbXX1dfSx7Im5hbWUiOiJ0ZWRkeWRyYWdvbl9lYXJ0aF8wM19yaWJib25fMDEiLCJkaXNwbGF5IjpbeyJ0eXBlIjoibWVzaCIsIm5hbWUiOiJ0ZWRkeWRyYWdvbl9lYXJ0aF8wM19yaWJib25fMDEiLCJvZmZzZXQiOjQ3NTAsInVzZXJFZGdlcyI6W119XX0seyJuYW1lIjoidGVkZHlkcmFnb25fZWFydGhfMDNfaGVhZF8wMSIsImRpc3BsYXkiOlt7InR5cGUiOiJtZXNoIiwibmFtZSI6InRlZGR5ZHJhZ29uX2VhcnRoXzAzX2hlYWRfMDEiLCJvZmZzZXQiOjUyNjUsInVzZXJFZGdlcyI6W119XX0seyJuYW1lIjoidGVkZHlkcmFnb25fZWFydGhfMDNfYXJtXzAyIiwiZGlzcGxheSI6W3sidHlwZSI6Im1lc2giLCJuYW1lIjoidGVkZHlkcmFnb25fZWFydGhfMDNfYXJtXzAyIiwib2Zmc2V0Ijo1NTc5LCJ1c2VyRWRnZXMiOltdfV19LHsibmFtZSI6InRlZGR5ZHJhZ29uX2VhcnRoXzAzX3dpbmdfMDIiLCJkaXNwbGF5IjpbeyJ0eXBlIjoibWVzaCIsIm5hbWUiOiJ0ZWRkeWRyYWdvbl9lYXJ0aF8wM193aW5nXzAyIiwib2Zmc2V0Ijo1ODIwLCJ1c2VyRWRnZXMiOltdfV19LHsibmFtZSI6InRlZGR5ZHJhZ29uX2VhcnRoXzAzX3JpYmJvbl8wMyIsImRpc3BsYXkiOlt7InR5cGUiOiJtZXNoIiwibmFtZSI6InRlZGR5ZHJhZ29uX2VhcnRoXzAzX3JpYmJvbl8wMyIsIm9mZnNldCI6NjIxMSwidXNlckVkZ2VzIjpbXX1dfSx7Im5hbWUiOiJlZmZlY3RfdGVkZHlkcmFnb25fZWFydGhfMDNfZWZmZWN0XzIiLCJkaXNwbGF5IjpbeyJuYW1lIjoidGVkZHlkcmFnb25fZWFydGhfMDNfZWZmZWN0XzAyIiwidHJhbnNmb3JtIjp7IngiOjEuMjQsInkiOjQuMjZ9fV19XX1dLCJhbmltYXRpb24iOlt7ImR1cmF0aW9uIjo0NywibmFtZSI6ImF0dGFjayIsImFjdGlvbiI6MCwib2Zmc2V0IjpbMCwwLDBdLCJib25lIjp7Im1vbnN0ZXJlZmZlY3QiOlsxMSw3XSwidGVkZHlkcmFnb25fZWFydGhfMDNfUGlsbG93XzEiOlsxMywxOF0sInRlZGR5ZHJhZ29uX2VhcnRoXzAzX1BpbGxvd18yIjpbMTMsMjhdLCJ0ZWRkeWRyYWdvbl9lYXJ0aF8wM19QaWxsb3dfMyI6WzEzLDM4XSwidGVkZHlkcmFnb25fZWFydGhfMDNfZWZmZWN0XzAxIjpbMTMsNDhdLCJ0ZWRkeWRyYWdvbl9lYXJ0aF8wM19lZmZlY3RfMSI6WzEzLDU4XSwidGVkZHlkcmFnb25fZWFydGhfMDNfYm9keV8yIjpbMTIsNjhdLCJ0ZWRkeWRyYWdvbl9lYXJ0aF8wM19ib2R5XzAyIjpbMTIsNzldLCJ0ZWRkeWRyYWdvbl9lYXJ0aF8wM19ib2R5XzMiOlsxMiw4OV0sInRlZGR5ZHJhZ29uX2VhcnRoXzAzX2xlZ18wMSI6WzEyLDEwNF0sInRlZGR5ZHJhZ29uX2VhcnRoXzAzX2xlZ18wMiI6WzEyLDExNV0sInRlZGR5ZHJhZ29uX2VhcnRoXzAzX2JvZHlfMDEiOlsxMSwxMjYsMTIsMTM3XSwidGVkZHlkcmFnb25fZWFydGhfMDNfYm9keV80IjpbMTIsMTQ4XSwidGVkZHlkcmFnb25fZWFydGhfMDNfYm9keV81IjpbMTIsMTYzXSwidGVkZHlkcmFnb25fZWFydGhfMDNfZm9vdF8wMSI6WzExLDE3NiwxMiwxODZdLCJ0ZWRkeWRyYWdvbl9lYXJ0aF8wM19sZWdfMiI6WzEyLDIwMF0sInRlZGR5ZHJhZ29uX2VhcnRoXzAzX2FybV8wMSI6WzExLDIxNCwxMiwyMjRdLCJ0ZWRkeWRyYWdvbl9lYXJ0aF8wM19hcm1fMDIiOlsxMSwyNDEsMTIsMjUxXSwidGVkZHlkcmFnb25fZWFydGhfMDNfYm9keV82IjpbMTIsMjYxXSwidGVkZHlkcmFnb25fZWFydGhfMDNfZm9vdF8xIjpbMTIsMjczXSwidGVkZHlkcmFnb25fZWFydGhfMDNfaGVhZF8wMSI6WzExLDI4NywxMiwzMDJdLCJ0ZWRkeWRyYWdvbl9lYXJ0aF8wM19sZWdfMyI6WzEyLDMxNF0sInRlZGR5ZHJhZ29uX2VhcnRoXzAzX3JpYmJvbl8wMSI6WzExLDMyOCwxMiwzMzldLCJ0ZWRkeWRyYWdvbl9lYXJ0aF8wM193aW5nXzAxIjpbMTIsMzQ5XSwidGVkZHlkcmFnb25fZWFydGhfMDNfd2luZ18wMiI6WzEyLDM2MF0sInRlZGR5ZHJhZ29uX2VhcnRoXzAzX2FybV8xIjpbMTIsMzcxXSwidGVkZHlkcmFnb25fZWFydGhfMDNfYXJtXzIiOlsxMiwzODhdLCJ0ZWRkeWRyYWdvbl9lYXJ0aF8wM19ib2R5XzciOlsxMiwzOTldLCJ0ZWRkeWRyYWdvbl9lYXJ0aF8wM19lYXJfMDEiOlsxMiw0MTFdLCJ0ZWRkeWRyYWdvbl9lYXJ0aF8wM19oZWFkXzAyIjpbMTIsNDIxXSwidGVkZHlkcmFnb25fZWFydGhfMDNfaGVhZF8wMyI6WzExLDQzMV0sInRlZGR5ZHJhZ29uX2VhcnRoXzAzX2hlYWRfMSI6WzExLDQ0MywxMiw0NTNdLCJ0ZWRkeWRyYWdvbl9lYXJ0aF8wM19ob3JuXzAxIjpbMTIsNDYzXSwidGVkZHlkcmFnb25fZWFydGhfMDNfaG9ybl8wMiI6WzEyLDQ3NF0sInRlZGR5ZHJhZ29uX2VhcnRoXzAzX3JpYmJvbl8wMiI6WzEyLDQ4NV0sInRlZGR5ZHJhZ29uX2VhcnRoXzAzX3JpYmJvbl8wMyI6WzEyLDQ5Nl0sInRlZGR5ZHJhZ29uX2VhcnRoXzAzX3JpYmJvbl8xIjpbMTIsNTA3XSwidGVkZHlkcmFnb25fZWFydGhfMDNfcmliYm9uXzExIjpbMTIsNTE4XSwidGVkZHlkcmFnb25fZWFydGhfMDNfcmliYm9uXzIiOlsxMiw1MjldLCJ0ZWRkeWRyYWdvbl9lYXJ0aF8wM19yaWJib25fOCI6WzEyLDU0MF0sInRlZGR5ZHJhZ29uX2VhcnRoXzAzX3dpbmdfMSI6WzEyLDU1MV0sInRlZGR5ZHJhZ29uX2VhcnRoXzAzX3dpbmdfMTIiOlsxMiw1NjJdLCJ0ZWRkeWRyYWdvbl9lYXJ0aF8wM193aW5nXzQiOlsxMiw1NzNdLCJ0ZWRkeWRyYWdvbl9lYXJ0aF8wM193aW5nXzkiOlsxMiw1ODRdLCJ0ZWRkeWRyYWdvbl9lYXJ0aF8wM19hcm1fMyI6WzEyLDU5NV0sInRlZGR5ZHJhZ29uX2VhcnRoXzAzX2FybV80IjpbMTIsNjA2XSwidGVkZHlkcmFnb25fZWFydGhfMDNfZWFyXzEiOlsxMiw2MjNdLCJ0ZWRkeWRyYWdvbl9lYXJ0aF8wM19oZWFkXzIiOlsxMiw2MzNdLCJ0ZWRkeWRyYWdvbl9lYXJ0aF8wM19oZWFkXzQiOlsxMiw2NDNdLCJ0ZWRkeWRyYWdvbl9lYXJ0aF8wM19ob3JuXzEiOlsxMiw2NTRdLCJ0ZWRkeWRyYWdvbl9lYXJ0aF8wM19ob3JuXzIiOlsxMiw2NjVdLCJ0ZWRkeWRyYWdvbl9lYXJ0aF8wM19yaWJib25fMTAiOlsxMiw2NzZdLCJ0ZWRkeWRyYWdvbl9lYXJ0aF8wM19yaWJib25fMTIiOlsxMiw2ODddLCJ0ZWRkeWRyYWdvbl9lYXJ0aF8wM19yaWJib25fMyI6WzEyLDY5OF0sInRlZGR5ZHJhZ29uX2VhcnRoXzAzX3JpYmJvbl81IjpbMTIsNzA5XSwidGVkZHlkcmFnb25fZWFydGhfMDNfcmliYm9uXzciOlsxMiw3MjBdLCJ0ZWRkeWRyYWdvbl9lYXJ0aF8wM19yaWJib25fOSI6WzEyLDczMV0sInRlZGR5ZHJhZ29uX2VhcnRoXzAzX3dpbmdfMTAiOlsxMiw3NDJdLCJ0ZWRkeWRyYWdvbl9lYXJ0aF8wM193aW5nXzEzIjpbMTIsNzUzXSwidGVkZHlkcmFnb25fZWFydGhfMDNfd2luZ18xNSI6WzEyLDc2NF0sInRlZGR5ZHJhZ29uX2VhcnRoXzAzX3dpbmdfMiI6WzEyLDc3NV0sInRlZGR5ZHJhZ29uX2VhcnRoXzAzX3dpbmdfNSI6WzEyLDc4Nl0sInRlZGR5ZHJhZ29uX2VhcnRoXzAzX3dpbmdfNyI6WzEyLDc5N10sInRlZGR5ZHJhZ29uX2VhcnRoXzAzX2Vhcl8yIjpbMTIsODA4XSwidGVkZHlkcmFnb25fZWFydGhfMDNfZWFyXzQiOlsxMiw4MThdLCJ0ZWRkeWRyYWdvbl9lYXJ0aF8wM19oZWFkXzMiOlsxMiw4MjhdLCJ0ZWRkeWRyYWdvbl9lYXJ0aF8wM19oZWFkXzUiOlsxMiw4MzhdLCJ0ZWRkeWRyYWdvbl9lYXJ0aF8wM19yaWJib25fNCI6WzEyLDg0OV0sInRlZGR5ZHJhZ29uX2VhcnRoXzAzX3JpYmJvbl82IjpbMTIsODYwXSwidGVkZHlkcmFnb25fZWFydGhfMDNfdGFtXzAxIjpbMTMsODcxXSwidGVkZHlkcmFnb25fZWFydGhfMDNfd2luZ18xNCI6WzEyLDg4Nl0sInRlZGR5ZHJhZ29uX2VhcnRoXzAzX3dpbmdfMTYiOlsxMiw4OTddLCJ0ZWRkeWRyYWdvbl9lYXJ0aF8wM193aW5nXzMiOlsxMiw5MDhdLCJ0ZWRkeWRyYWdvbl9lYXJ0aF8wM193aW5nXzYiOlsxMiw5MTldLCJ0ZWRkeWRyYWdvbl9lYXJ0aF8wM193aW5nXzgiOlsxMiw5MzBdLCJ0ZWRkeWRyYWdvbl9lYXJ0aF8wM19oZWFkXzYiOlsxMiw5NDFdLCJ0ZWRkeWRyYWdvbl9lYXJ0aF8wM19QaWxsb3dfNCI6WzEzLDk1Ml19LCJzbG90Ijp7ImVmZmVjdF90ZWRkeWRyYWdvbl9lYXJ0aF8wM19lZmZlY3RfMDEiOlsyMSw5NjBdLCJlZmZlY3RfdGVkZHlkcmFnb25fZWFydGhfMDNfZWZmZWN0XzEiOlsyMSw5NjldLCJlZmZlY3RfdGVkZHlkcmFnb25fZWFydGhfMDNfZWZmZWN0XzAyIjpbMjEsOTc4XSwiZWZmZWN0X3RlZGR5ZHJhZ29uX2VhcnRoXzAzX2VmZmVjdF8yIjpbMjEsOTg3XSwiZWZmZWN0X3RlZGR5ZHJhZ29uX2VhcnRoXzAzX2VmZmVjdF8zIjpbMjEsOTk2XSwiZWZmZWN0X3RlZGR5ZHJhZ29uX2VhcnRoXzAzX2VmZmVjdF80IjpbMjEsMTAwNF0sInRlZGR5ZHJhZ29uX2VhcnRoXzAzX3RhbV8wMSI6WzIwLDEwMTMsMjEsMTAyMV0sInRlZGR5ZHJhZ29uX2VhcnRoXzAzX3RhbV8wMiI6WzIwLDEwMzEsMjEsMTAzOV19fSx7ImR1cmF0aW9uIjo2MCwibmFtZSI6ImlkbGUiLCJvZmZzZXQiOlszMywxMDY2LDQ5NTddLCJib25lIjp7Im1vbnN0ZXJlZmZlY3QiOlsxMSwxMDQ5XSwidGVkZHlkcmFnb25fZWFydGhfMDNfUGlsbG93XzAxIjpbMTEsMTA1N10sInRlZGR5ZHJhZ29uX2VhcnRoXzAzX1BpbGxvd18wMiI6WzExLDEwNjVdLCJ0ZWRkeWRyYWdvbl9lYXJ0aF8wM19QaWxsb3dfNCI6WzEzLDEwNzNdLCJ0ZWRkeWRyYWdvbl9lYXJ0aF8wM19ydWdfMDEiOlsxMSwxMDgxLDEzLDEwODldLCJ0ZWRkeWRyYWdvbl9lYXJ0aF8wM19QaWxsb3dfNSI6WzExLDEwOTddLCJ0ZWRkeWRyYWdvbl9lYXJ0aF8wM19ib2R5XzEiOlsxMSwxMTA1XSwidGVkZHlkcmFnb25fZWFydGhfMDNfYm9keV8yIjpbMTIsMTExM10sInRlZGR5ZHJhZ29uX2VhcnRoXzAzX2JvZHlfMDIiOlsxMiwxMTIxXSwidGVkZHlkcmFnb25fZWFydGhfMDNfYm9keV8zIjpbMTEsMTEyOSwxMiwxMTM5XSwidGVkZHlkcmFnb25fZWFydGhfMDNfbGVnXzAxIjpbMTIsMTE0OV0sInRlZGR5ZHJhZ29uX2VhcnRoXzAzX2xlZ18wMiI6WzEyLDExNTddLCJ0ZWRkeWRyYWdvbl9lYXJ0aF8wM19ib2R5XzAxIjpbMTEsMTE2NSwxMiwxMTc0XSwidGVkZHlkcmFnb25fZWFydGhfMDNfYm9keV80IjpbMTEsMTE4MywxMiwxMTkzXSwidGVkZHlkcmFnb25fZWFydGhfMDNfYm9keV81IjpbMTIsMTIwM10sInRlZGR5ZHJhZ29uX2VhcnRoXzAzX2Zvb3RfMDEiOlsxMSwxMjEzLDEyLDEyMjFdLCJ0ZWRkeWRyYWdvbl9lYXJ0aF8wM19sZWdfMiI6WzEyLDEyMjldLCJ0ZWRkeWRyYWdvbl9lYXJ0aF8wM19hcm1fMDEiOlsxMiwxMjM5XSwidGVkZHlkcmFnb25fZWFydGhfMDNfYXJtXzAyIjpbMTIsMTI0N10sInRlZGR5ZHJhZ29uX2VhcnRoXzAzX2JvZHlfNiI6WzEyLDEyNTVdLCJ0ZWRkeWRyYWdvbl9lYXJ0aF8wM19mb290XzEiOlsxMiwxMjY1XSwidGVkZHlkcmFnb25fZWFydGhfMDNfaGVhZF8wMSI6WzExLDEyNzUsMTIsMTI4NV0sInRlZGR5ZHJhZ29uX2VhcnRoXzAzX2xlZ18zIjpbMTIsMTI5NV0sInRlZGR5ZHJhZ29uX2VhcnRoXzAzX3JpYmJvbl8wMSI6WzExLDEzMDVdLCJ0ZWRkeWRyYWdvbl9lYXJ0aF8wM193aW5nXzAxIjpbMTIsMTMxNV0sInRlZGR5ZHJhZ29uX2VhcnRoXzAzX3dpbmdfMDIiOlsxMiwxMzIzXSwibW9uc3RlcmV5ZV8xIjpbMTMsMTMzMV0sIm1vbnN0ZXJleWVfMiI6WzExLDEzMzksMTIsMTM0N10sInRlZGR5ZHJhZ29uX2VhcnRoXzAzX2FybV8xIjpbMTIsMTM1NV0sInRlZGR5ZHJhZ29uX2VhcnRoXzAzX2FybV8yIjpbMTIsMTM2NV0sInRlZGR5ZHJhZ29uX2VhcnRoXzAzX2JvZHlfNyI6WzEyLDEzNzVdLCJ0ZWRkeWRyYWdvbl9lYXJ0aF8wM19lYXJfMDEiOlsxMiwxMzg1XSwidGVkZHlkcmFnb25fZWFydGhfMDNfaGVhZF8wMiI6WzEyLDEzOTNdLCJ0ZWRkeWRyYWdvbl9lYXJ0aF8wM19oZWFkXzAzIjpbMTEsMTQwMV0sInRlZGR5ZHJhZ29uX2VhcnRoXzAzX2hlYWRfMSI6WzExLDE0MTEsMTIsMTQxOV0sInRlZGR5ZHJhZ29uX2VhcnRoXzAzX2hvcm5fMDEiOlsxMiwxNDI3XSwidGVkZHlkcmFnb25fZWFydGhfMDNfaG9ybl8wMiI6WzEyLDE0MzVdLCJ0ZWRkeWRyYWdvbl9lYXJ0aF8wM19yaWJib25fMDIiOlsxMiwxNDQzXSwidGVkZHlkcmFnb25fZWFydGhfMDNfcmliYm9uXzAzIjpbMTIsMTQ1MV0sInRlZGR5ZHJhZ29uX2VhcnRoXzAzX3JpYmJvbl8xIjpbMTIsMTQ1OV0sInRlZGR5ZHJhZ29uX2VhcnRoXzAzX3JpYmJvbl8xMSI6WzEyLDE0NjddLCJ0ZWRkeWRyYWdvbl9lYXJ0aF8wM19yaWJib25fMiI6WzEyLDE0NzVdLCJ0ZWRkeWRyYWdvbl9lYXJ0aF8wM19yaWJib25fOCI6WzEyLDE0ODNdLCJ0ZWRkeWRyYWdvbl9lYXJ0aF8wM193aW5nXzEiOlsxMiwxNDkxXSwidGVkZHlkcmFnb25fZWFydGhfMDNfd2luZ18xMiI6WzEyLDE1MDBdLCJ0ZWRkeWRyYWdvbl9lYXJ0aF8wM193aW5nXzQiOlsxMiwxNTA4XSwidGVkZHlkcmFnb25fZWFydGhfMDNfd2luZ185IjpbMTIsMTUxNl0sInRlZGR5ZHJhZ29uX2VhcnRoXzAzX2FybV8zIjpbMTIsMTUyNl0sInRlZGR5ZHJhZ29uX2VhcnRoXzAzX2FybV80IjpbMTIsMTUzNl0sInRlZGR5ZHJhZ29uX2VhcnRoXzAzX2Vhcl8xIjpbMTIsMTU0Nl0sInRlZGR5ZHJhZ29uX2VhcnRoXzAzX2Vhcl8zIjpbMTIsMTU1Nl0sInRlZGR5ZHJhZ29uX2VhcnRoXzAzX2hlYWRfMiI6WzEyLDE1NjRdLCJ0ZWRkeWRyYWdvbl9lYXJ0aF8wM19oZWFkXzQiOlsxMiwxNTc0XSwidGVkZHlkcmFnb25fZWFydGhfMDNfaG9ybl8xIjpbMTIsMTU4Ml0sInRlZGR5ZHJhZ29uX2VhcnRoXzAzX2hvcm5fMiI6WzEyLDE1OTJdLCJ0ZWRkeWRyYWdvbl9lYXJ0aF8wM19yaWJib25fMTAiOlsxMiwxNjAyXSwidGVkZHlkcmFnb25fZWFydGhfMDNfcmliYm9uXzEyIjpbMTIsMTYxMl0sInRlZGR5ZHJhZ29uX2VhcnRoXzAzX3JpYmJvbl8zIjpbMTIsMTYyMl0sInRlZGR5ZHJhZ29uX2VhcnRoXzAzX3JpYmJvbl81IjpbMTIsMTYzMl0sInRlZGR5ZHJhZ29uX2VhcnRoXzAzX3JpYmJvbl83IjpbMTIsMTY0Ml0sInRlZGR5ZHJhZ29uX2VhcnRoXzAzX3JpYmJvbl85IjpbMTIsMTY1Ml0sInRlZGR5ZHJhZ29uX2VhcnRoXzAzX3dpbmdfMTAiOlsxMiwxNjYyXSwidGVkZHlkcmFnb25fZWFydGhfMDNfd2luZ18xMyI6WzEyLDE2NzJdLCJ0ZWRkeWRyYWdvbl9lYXJ0aF8wM193aW5nXzE1IjpbMTIsMTY4Ml0sInRlZGR5ZHJhZ29uX2VhcnRoXzAzX3dpbmdfMiI6WzEyLDE2OTBdLCJ0ZWRkeWRyYWdvbl9lYXJ0aF8wM193aW5nXzUiOlsxMiwxNjk5XSwidGVkZHlkcmFnb25fZWFydGhfMDNfd2luZ183IjpbMTIsMTcwOF0sInRlZGR5ZHJhZ29uX2VhcnRoXzAzX2Vhcl8yIjpbMTIsMTcxNl0sInRlZGR5ZHJhZ29uX2VhcnRoXzAzX2Vhcl80IjpbMTIsMTcyNl0sInRlZGR5ZHJhZ29uX2VhcnRoXzAzX2hlYWRfMyI6WzEyLDE3MzZdLCJ0ZWRkeWRyYWdvbl9lYXJ0aF8wM19oZWFkXzUiOlsxMiwxNzQ2XSwidGVkZHlkcmFnb25fZWFydGhfMDNfcmliYm9uXzQiOlsxMiwxNzU2XSwidGVkZHlkcmFnb25fZWFydGhfMDNfcmliYm9uXzYiOlsxMiwxNzY2XSwidGVkZHlkcmFnb25fZWFydGhfMDNfd2luZ18xMSI6WzEyLDE3NzZdLCJ0ZWRkeWRyYWdvbl9lYXJ0aF8wM193aW5nXzE0IjpbMTIsMTc4Nl0sInRlZGR5ZHJhZ29uX2VhcnRoXzAzX3dpbmdfMTYiOlsxMiwxNzk2XSwidGVkZHlkcmFnb25fZWFydGhfMDNfd2luZ18zIjpbMTIsMTgwNl0sInRlZGR5ZHJhZ29uX2VhcnRoXzAzX3dpbmdfNiI6WzEyLDE4MTVdLCJ0ZWRkeWRyYWdvbl9lYXJ0aF8wM193aW5nXzgiOlsxMiwxODI0XSwidGVkZHlkcmFnb25fZWFydGhfMDNfaGVhZF82IjpbMTIsMTgzM10sInRlZGR5ZHJhZ29uX2VhcnRoXzAzX1BpbGxvd182IjpbMTEsMTg0M10sInRlZGR5ZHJhZ29uX2VhcnRoXzAzX2VmZmVjdF8wMSI6WzEzLDE4NTFdLCJ0ZWRkeWRyYWdvbl9lYXJ0aF8wM19QaWxsb3dfMyI6WzEzLDE4NTldLCJ0ZWRkeWRyYWdvbl9lYXJ0aF8wM19lZmZlY3RfMSI6WzEzLDE4NjddLCJ0ZWRkeWRyYWdvbl9lYXJ0aF8wM19QaWxsb3dfMSI6WzEzLDE4NzVdLCJ0ZWRkeWRyYWdvbl9lYXJ0aF8wM19QaWxsb3dfMiI6WzEzLDE4ODNdfSwic2xvdCI6eyJlZmZlY3RfdGVkZHlkcmFnb25fZWFydGhfMDNfZWZmZWN0XzAxIjpbMjEsMTg5MV0sImVmZmVjdF90ZWRkeWRyYWdvbl9lYXJ0aF8wM19lZmZlY3RfMSI6WzIxLDE5MDBdLCJlZmZlY3RfdGVkZHlkcmFnb25fZWFydGhfMDNfZWZmZWN0XzAyIjpbMjEsMTkwOV0sImVmZmVjdF90ZWRkeWRyYWdvbl9lYXJ0aF8wM19lZmZlY3RfMiI6WzIxLDE5MThdLCJlZmZlY3RfdGVkZHlkcmFnb25fZWFydGhfMDNfZWZmZWN0XzMiOlsyMSwxOTI3XSwiZWZmZWN0X3RlZGR5ZHJhZ29uX2VhcnRoXzAzX2VmZmVjdF80IjpbMjEsMTkzNV19fSx7ImR1cmF0aW9uIjoxMjMsIm5hbWUiOiJwb3NlXzEiLCJvZmZzZXQiOls1NiwxODEwLDExNDgwXSwiYm9uZSI6eyJ0ZWRkeWRyYWdvbl9lYXJ0aF8wM19yaWJib25fNyI6WzEyLDE5NDRdLCJ0ZWRkeWRyYWdvbl9lYXJ0aF8wM19QaWxsb3dfMDIiOlsxMSwxOTY4LDEzLDE5ODJdLCJ0ZWRkeWRyYWdvbl9lYXJ0aF8wM19ib2R5XzAxIjpbMTEsMTk5OSwxMiwyMDI2XSwidGVkZHlkcmFnb25fZWFydGhfMDNfd2luZ18xMiI6WzEyLDIwNTNdLCJ0ZWRkeWRyYWdvbl9lYXJ0aF8wM19yaWJib25fMDEiOlsxMSwyMDc5LDEyLDIwODldLCJ0ZWRkeWRyYWdvbl9lYXJ0aF8wM193aW5nXzAxIjpbMTIsMjA5OV0sInRlZGR5ZHJhZ29uX2VhcnRoXzAzX2VmZmVjdF8wMyI6WzExLDIxMjUsMTMsMjEzN10sInRlZGR5ZHJhZ29uX2VhcnRoXzAzX2JvZHlfNCI6WzExLDIxNTEsMTIsMjE3MF0sInRlZGR5ZHJhZ29uX2VhcnRoXzAzX2Vhcl8wMSI6WzEyLDIxOTNdLCJ0ZWRkeWRyYWdvbl9lYXJ0aF8wM19yaWJib25fOSI6WzEyLDIyMTddLCJ0ZWRkeWRyYWdvbl9lYXJ0aF8wM19ib2R5XzIiOlsxMiwyMjQxXSwidGVkZHlkcmFnb25fZWFydGhfMDNfaGVhZF8wMSI6WzExLDIyNjUsMTIsMjI4Nl0sInRlZGR5ZHJhZ29uX2VhcnRoXzAzX3dpbmdfOSI6WzEyLDIzMTBdLCJ0ZWRkeWRyYWdvbl9lYXJ0aF8wM19ob3JuXzEiOlsxMiwyMzM2XSwidGVkZHlkcmFnb25fZWFydGhfMDNfUGlsbG93XzAxIjpbMTEsMjM2MCwxMywyMzcyXSwidGVkZHlkcmFnb25fZWFydGhfMDNfbGVnXzMiOlsxMiwyMzg4XSwidGVkZHlkcmFnb25fZWFydGhfMDNfaGVhZF8zIjpbMTIsMjQyMF0sInRlZGR5ZHJhZ29uX2VhcnRoXzAzX3JpYmJvbl8yIjpbMTIsMjQ0NF0sInRlZGR5ZHJhZ29uX2VhcnRoXzAzX2hlYWRfNiI6WzEyLDI0NjhdLCJ0ZWRkeWRyYWdvbl9lYXJ0aF8wM19lYXJfMiI6WzEyLDI0OTJdLCJ0ZWRkeWRyYWdvbl9lYXJ0aF8wM19hcm1fMDIiOlsxMSwyNTE2LDEyLDI1MzNdLCJ0ZWRkeWRyYWdvbl9lYXJ0aF8wM193aW5nXzciOlsxMiwyNTU4XSwidGVkZHlkcmFnb25fZWFydGhfMDNfd2luZ18xMCI6WzEyLDI1ODRdLCJ0ZWRkeWRyYWdvbl9lYXJ0aF8wM193aW5nXzIiOlsxMSwyNjEwLDEyLDI2MjddLCJ0ZWRkeWRyYWdvbl9lYXJ0aF8wM19ob3JuXzIiOlsxMiwyNjUzXSwibW9uc3RlcmVmZmVjdCI6WzExLDI2NzcsMTIsMjcwNl0sInRlZGR5ZHJhZ29uX2VhcnRoXzAzX3dpbmdfMTYiOlsxMiwyNzE2XSwidGVkZHlkcmFnb25fZWFydGhfMDNfaGVhZF81IjpbMTIsMjc0Ml0sInRlZGR5ZHJhZ29uX2VhcnRoXzAzX3JpYmJvbl82IjpbMTIsMjc2Nl0sInRlZGR5ZHJhZ29uX2VhcnRoXzAzX2JvZHlfNiI6WzEyLDI3ODhdLCJ0ZWRkeWRyYWdvbl9lYXJ0aF8wM193aW5nXzEiOlsxMiwyODEyXSwidGVkZHlkcmFnb25fZWFydGhfMDNfcmliYm9uXzEiOlsxMiwyODM4XSwidGVkZHlkcmFnb25fZWFydGhfMDNfUGlsbG93XzUiOlsxMSwyODYyXSwidGVkZHlkcmFnb25fZWFydGhfMDNfYXJtXzAxIjpbMTEsMjg3MSwxMiwyODkxXSwidGVkZHlkcmFnb25fZWFydGhfMDNfUGlsbG93XzYiOlsxMSwyOTEyXSwidGVkZHlkcmFnb25fZWFydGhfMDNfZWFyXzQiOlsxMiwyOTIxXSwidGVkZHlkcmFnb25fZWFydGhfMDNfd2luZ181IjpbMTIsMjk0NV0sInRlZGR5ZHJhZ29uX2VhcnRoXzAzX2hlYWRfMDIiOlsxMiwyOTcxXSwidGVkZHlkcmFnb25fZWFydGhfMDNfdGFtXzAxIjpbMTIsMjk5NSwxMywzMDEyXSwidGVkZHlkcmFnb25fZWFydGhfMDNfd2luZ182IjpbMTIsMzAyN10sInRlZGR5ZHJhZ29uX2VhcnRoXzAzX3dpbmdfMTEiOlsxMiwzMDUzXSwidGVkZHlkcmFnb25fZWFydGhfMDNfd2luZ18xNCI6WzEyLDMwNzddLCJ0ZWRkeWRyYWdvbl9lYXJ0aF8wM19oZWFkXzIiOlsxMiwzMTAzXSwidGVkZHlkcmFnb25fZWFydGhfMDNfYm9keV8xIjpbMTEsMzEyN10sInRlZGR5ZHJhZ29uX2VhcnRoXzAzX2xlZ18wMiI6WzExLDMxNDAsMTIsMzE3MF0sInRlZGR5ZHJhZ29uX2VhcnRoXzAzX2JvZHlfNyI6WzEyLDMyMDJdLCJ0ZWRkeWRyYWdvbl9lYXJ0aF8wM19yaWJib25fOCI6WzEyLDMyMjZdLCJ0ZWRkeWRyYWdvbl9lYXJ0aF8wM19yaWJib25fMDMiOlsxMiwzMjUwLDEzLDMyNzRdLCJ0ZWRkeWRyYWdvbl9lYXJ0aF8wM19yaWJib25fMyI6WzEyLDMyODVdLCJ0ZWRkeWRyYWdvbl9lYXJ0aF8wM19oZWFkXzEiOlsxMSwzMzA4LDEyLDMzMzRdLCJ0ZWRkeWRyYWdvbl9lYXJ0aF8wM19hcm1fMiI6WzEyLDMzNTNdLCJ0ZWRkeWRyYWdvbl9lYXJ0aF8wM19sZWdfMiI6WzEyLDMzNzhdLCJ0ZWRkeWRyYWdvbl9lYXJ0aF8wM19hcm1fNCI6WzEyLDM0MTBdLCJ0ZWRkeWRyYWdvbl9lYXJ0aF8wM19hcm1fMyI6WzEyLDM0MzFdLCJ0ZWRkeWRyYWdvbl9lYXJ0aF8wM19ob3JuXzAxIjpbMTIsMzQ1Nl0sInRlZGR5ZHJhZ29uX2VhcnRoXzAzX3JpYmJvbl80IjpbMTIsMzQ4MF0sInRlZGR5ZHJhZ29uX2VhcnRoXzAzX2FybV8xIjpbMTIsMzUwMl0sInRlZGR5ZHJhZ29uX2VhcnRoXzAzX2xlZ18wMSI6WzExLDM1MjMsMTIsMzU0OCwxMywzNTgwXSwidGVkZHlkcmFnb25fZWFydGhfMDNfcmliYm9uXzEwIjpbMTIsMzU5MF0sInRlZGR5ZHJhZ29uX2VhcnRoXzAzX3dpbmdfMyI6WzExLDM2MTQsMTIsMzYzMl0sInRlZGR5ZHJhZ29uX2VhcnRoXzAzX2hlYWRfNCI6WzEyLDM2NThdLCJ0ZWRkeWRyYWdvbl9lYXJ0aF8wM19mb290XzEiOlsxMiwzNjgyXSwidGVkZHlkcmFnb25fZWFydGhfMDNfd2luZ18xMyI6WzEyLDM2OTJdLCJ0ZWRkeWRyYWdvbl9lYXJ0aF8wM19mb290XzIiOlsxMSwzNzE4LDEyLDM3MjldLCJ0ZWRkeWRyYWdvbl9lYXJ0aF8wM19yaWJib25fMDIiOlsxMiwzNzUxLDEzLDM3NzVdLCJ0ZWRkeWRyYWdvbl9lYXJ0aF8wM19ib2R5XzAyIjpbMTEsMzc4NiwxMiwzNzk3XSwidGVkZHlkcmFnb25fZWFydGhfMDNfZm9vdF8wMiI6WzExLDM4MjEsMTIsMzg0MV0sInRlZGR5ZHJhZ29uX2VhcnRoXzAzX2VmZmVjdF8wNCI6WzExLDM4NjMsMTIsMzg3MywxMywzODg0XSwidGVkZHlkcmFnb25fZWFydGhfMDNfZWFyXzMiOlsxMSwzODk2LDEyLDM5MDldLCJ0ZWRkeWRyYWdvbl9lYXJ0aF8wM19yaWJib25fMTEiOlsxMiwzOTMyXSwidGVkZHlkcmFnb25fZWFydGhfMDNfd2luZ184IjpbMTIsMzk1Nl0sInRlZGR5ZHJhZ29uX2VhcnRoXzAzX3JpYmJvbl8xMiI6WzEyLDM5ODJdLCJ0ZWRkeWRyYWdvbl9lYXJ0aF8wM19yaWJib25fNSI6WzEyLDQwMDZdLCJ0ZWRkeWRyYWdvbl9lYXJ0aF8wM19ob3JuXzAyIjpbMTIsNDAyOV0sInRlZGR5ZHJhZ29uX2VhcnRoXzAzX3dpbmdfMTUiOlsxMiw0MDUzXSwidGVkZHlkcmFnb25fZWFydGhfMDNfaGVhZF8wMyI6WzExLDQwNzksMTIsNDEwNF0sInRlZGR5ZHJhZ29uX2VhcnRoXzAzX2Vhcl8xIjpbMTIsNDEyNV0sInRlZGR5ZHJhZ29uX2VhcnRoXzAzX2JvZHlfNSI6WzEyLDQxNDldLCJ0ZWRkeWRyYWdvbl9lYXJ0aF8wM193aW5nXzQiOlsxMiw0MTczXSwidGVkZHlkcmFnb25fZWFydGhfMDNfd2luZ18wMiI6WzEyLDQxOTldLCJ0ZWRkeWRyYWdvbl9lYXJ0aF8wM19mb290XzAxIjpbMTEsNDIyNSwxMiw0MjU0XSwidGVkZHlkcmFnb25fZWFydGhfMDNfYm9keV8zIjpbMTEsNDI4MywxMiw0MzAwXSwidGVkZHlkcmFnb25fZWFydGhfMDNfUGlsbG93XzQiOlsxMyw0MzIzXSwidGVkZHlkcmFnb25fZWFydGhfMDNfUGlsbG93XzMiOlsxMyw0MzMzXSwidGVkZHlkcmFnb25fZWFydGhfMDNfZWZmZWN0XzEiOlsxMyw0MzQzXSwidGVkZHlkcmFnb25fZWFydGhfMDNfUGlsbG93XzIiOlsxMyw0MzUzXSwidGVkZHlkcmFnb25fZWFydGhfMDNfUGlsbG93XzEiOlsxMyw0MzYzXSwidGVkZHlkcmFnb25fZWFydGhfMDNfZWZmZWN0XzAxIjpbMTMsNDM3M119LCJzbG90Ijp7ImVmZmVjdF90ZWRkeWRyYWdvbl9lYXJ0aF8wM19lZmZlY3RfMSI6WzIxLDQzODNdLCJlZmZlY3RfdGVkZHlkcmFnb25fZWFydGhfMDNfZWZmZWN0XzAxIjpbMjEsNDM5NV0sImVmZmVjdF90ZWRkeWRyYWdvbl9lYXJ0aF8wM19lZmZlY3RfMiI6WzIxLDQ0MDddLCJlZmZlY3RfdGVkZHlkcmFnb25fZWFydGhfMDNfZWZmZWN0XzAyIjpbMjEsNDQxOV0sImVmZmVjdF90ZWRkeWRyYWdvbl9lYXJ0aF8wM19lZmZlY3RfMDMiOlsyMCw0NDMxLDIxLDQ0MzldLCJlZmZlY3RfdGVkZHlkcmFnb25fZWFydGhfMDNfZWZmZWN0XzMiOlsyMSw0NDUwXSwiZWZmZWN0X3RlZGR5ZHJhZ29uX2VhcnRoXzAzX2VmZmVjdF8wNCI6WzIxLDQ0NjBdLCJlZmZlY3RfdGVkZHlkcmFnb25fZWFydGhfMDNfZWZmZWN0XzQiOlsyMSw0NDcwXSwidGVkZHlkcmFnb25fZWFydGhfMDNfZm9vdF8wMSI6WzIwLDQ0ODJdLCJ0ZWRkeWRyYWdvbl9lYXJ0aF8wM19mb290XzAyIjpbMjAsNDQ5Nl0sInRlZGR5ZHJhZ29uX2VhcnRoXzAzX3RhbV8wMSI6WzIwLDQ1MTAsMjEsNDUxN10sInRlZGR5ZHJhZ29uX2VhcnRoXzAzX3RhbV8wMiI6WzIwLDQ1MjcsMjEsNDUzNF19fSx7ImR1cmF0aW9uIjo1MiwibmFtZSI6InNraWxsX0lkbGUiLCJvZmZzZXQiOlsxMTcsNTUyOCwyOTg1M10sImJvbmUiOnsidGVkZHlkcmFnb25fZWFydGhfMDNfaGVhZF81IjpbMTIsNDU0NF0sInRlZGR5ZHJhZ29uX2VhcnRoXzAzX3dpbmdfNiI6WzEyLDQ1NjBdLCJ0ZWRkeWRyYWdvbl9lYXJ0aF8wM193aW5nXzE2IjpbMTIsNDU3OF0sInRlZGR5ZHJhZ29uX2VhcnRoXzAzX3dpbmdfMTAiOlsxMiw0NTk2XSwidGVkZHlkcmFnb25fZWFydGhfMDNfZWFyXzQiOlsxMiw0NjE0XSwidGVkZHlkcmFnb25fZWFydGhfMDNfaGVhZF8wMyI6WzExLDQ2MjksMTIsNDY0Nl0sInRlZGR5ZHJhZ29uX2VhcnRoXzAzX2Zvb3RfMDEiOlsxMSw0NjYzLDEyLDQ2ODVdLCJ0ZWRkeWRyYWdvbl9lYXJ0aF8wM19ob3JuXzAyIjpbMTIsNDcwN10sInRlZGR5ZHJhZ29uX2VhcnRoXzAzX2xlZ18zIjpbMTIsNDcyMl0sInRlZGR5ZHJhZ29uX2VhcnRoXzAzX2FybV8zIjpbMTIsNDc0NV0sInRlZGR5ZHJhZ29uX2VhcnRoXzAzX3JpYmJvbl84IjpbMTIsNDc1OF0sInRlZGR5ZHJhZ29uX2VhcnRoXzAzX2FybV8wMiI6WzExLDQ3NzQsMTIsNDc4N10sInRlZGR5ZHJhZ29uX2VhcnRoXzAzX3dpbmdfNyI6WzEyLDQ4MDBdLCJ0ZWRkeWRyYWdvbl9lYXJ0aF8wM19oZWFkXzIiOlsxMiw0ODE4XSwidGVkZHlkcmFnb25fZWFydGhfMDNfZm9vdF8yIjpbMTIsNDgzNF0sInRlZGR5ZHJhZ29uX2VhcnRoXzAzX2FybV80IjpbMTIsNDg0Nl0sInRlZGR5ZHJhZ29uX2VhcnRoXzAzX3JpYmJvbl8wMiI6WzEyLDQ4NTldLCJ0ZWRkeWRyYWdvbl9lYXJ0aF8wM19hcm1fMSI6WzEyLDQ4NzVdLCJ0ZWRkeWRyYWdvbl9lYXJ0aF8wM19yaWJib25fMyI6WzEyLDQ4ODhdLCJ0ZWRkeWRyYWdvbl9lYXJ0aF8wM19oZWFkXzMiOlsxMiw0OTAyXSwidGVkZHlkcmFnb25fZWFydGhfMDNfUGlsbG93XzAyIjpbMTEsNDkxOCwxMyw0OTMwXSwidGVkZHlkcmFnb25fZWFydGhfMDNfZWFyXzMiOlsxMiw0OTQzXSwidGVkZHlkcmFnb25fZWFydGhfMDNfZWFyXzAxIjpbMTIsNDk1N10sInRlZGR5ZHJhZ29uX2VhcnRoXzAzX2JvZHlfNCI6WzExLDQ5NzIsMTIsNDk4OF0sInRlZGR5ZHJhZ29uX2VhcnRoXzAzX3dpbmdfMiI6WzExLDUwMDQsMTIsNTAxNl0sInRlZGR5ZHJhZ29uX2VhcnRoXzAzX2JvZHlfNSI6WzEyLDUwMzRdLCJ0ZWRkeWRyYWdvbl9lYXJ0aF8wM19ib2R5XzYiOlsxMiw1MDQ5XSwidGVkZHlkcmFnb25fZWFydGhfMDNfcmliYm9uXzQiOlsxMiw1MDY0XSwidGVkZHlkcmFnb25fZWFydGhfMDNfcmliYm9uXzkiOlsxMiw1MDc4XSwidGVkZHlkcmFnb25fZWFydGhfMDNfbGVnXzAyIjpbMTEsNTA5NCwxMiw1MTE2XSwidGVkZHlkcmFnb25fZWFydGhfMDNfbGVnXzAxIjpbMTEsNTEzOSwxMiw1MTYxXSwidGVkZHlkcmFnb25fZWFydGhfMDNfYXJtXzAxIjpbMTEsNTE4MywxMiw1MTk2XSwidGVkZHlkcmFnb25fZWFydGhfMDNfUGlsbG93XzAxIjpbMTEsNTIwOSwxMyw1MjE5XSwidGVkZHlkcmFnb25fZWFydGhfMDNfd2luZ18xNCI6WzEyLDUyMzFdLCJ0ZWRkeWRyYWdvbl9lYXJ0aF8wM19ib2R5XzAyIjpbMTIsNTI0OV0sInRlZGR5ZHJhZ29uX2VhcnRoXzAzX3dpbmdfMDIiOlsxMiw1MjY0XSwidGVkZHlkcmFnb25fZWFydGhfMDNfcmliYm9uXzIiOlsxMiw1MjgyXSwidGVkZHlkcmFnb25fZWFydGhfMDNfd2luZ18zIjpbMTEsNTI5OCwxMiw1MzE1XSwidGVkZHlkcmFnb25fZWFydGhfMDNfaGVhZF80IjpbMTIsNTMzM10sInRlZGR5ZHJhZ29uX2VhcnRoXzAzX3dpbmdfMTMiOlsxMiw1MzQ5XSwidGVkZHlkcmFnb25fZWFydGhfMDNfcmliYm9uXzUiOlsxMiw1MzY3XSwidGVkZHlkcmFnb25fZWFydGhfMDNfZm9vdF8wMiI6WzExLDUzODEsMTIsNTM5M10sInRlZGR5ZHJhZ29uX2VhcnRoXzAzX3dpbmdfNSI6WzEyLDU0MDVdLCJ0ZWRkeWRyYWdvbl9lYXJ0aF8wM19yaWJib25fNyI6WzEyLDU0MjNdLCJ0ZWRkeWRyYWdvbl9lYXJ0aF8wM19yaWJib25fMTAiOlsxMiw1NDM5XSwidGVkZHlkcmFnb25fZWFydGhfMDNfYm9keV83IjpbMTIsNTQ1NV0sInRlZGR5ZHJhZ29uX2VhcnRoXzAzX2Vhcl8yIjpbMTIsNTQ3MF0sInRlZGR5ZHJhZ29uX2VhcnRoXzAzX3JpYmJvbl8xMSI6WzEyLDU0ODVdLCJ0ZWRkeWRyYWdvbl9lYXJ0aF8wM19ob3JuXzAxIjpbMTIsNTUwMV0sInRlZGR5ZHJhZ29uX2VhcnRoXzAzX3dpbmdfMDEiOlsxMiw1NTE2XSwidGVkZHlkcmFnb25fZWFydGhfMDNfaGVhZF82IjpbMTIsNTUzNF0sIm1vbnN0ZXJlZmZlY3QiOlsxMSw1NTUwXSwidGVkZHlkcmFnb25fZWFydGhfMDNfd2luZ18xNSI6WzEyLDU1NzNdLCJ0ZWRkeWRyYWdvbl9lYXJ0aF8wM19yaWJib25fMDMiOlsxMiw1NTkxXSwidGVkZHlkcmFnb25fZWFydGhfMDNfaGVhZF8xIjpbMTEsNTYwNywxMiw1NjI3XSwidGVkZHlkcmFnb25fZWFydGhfMDNfd2luZ180IjpbMTIsNTYzOV0sInRlZGR5ZHJhZ29uX2VhcnRoXzAzX1BpbGxvd182IjpbMTEsNTY1N10sInRlZGR5ZHJhZ29uX2VhcnRoXzAzX2hvcm5fMiI6WzEyLDU2NjZdLCJ0ZWRkeWRyYWdvbl9lYXJ0aF8wM19hcm1fMiI6WzEyLDU2ODFdLCJ0ZWRkeWRyYWdvbl9lYXJ0aF8wM193aW5nXzgiOlsxMiw1Njk0XSwidGVkZHlkcmFnb25fZWFydGhfMDNfd2luZ185IjpbMTIsNTcxMl0sInRlZGR5ZHJhZ29uX2VhcnRoXzAzX3JpYmJvbl82IjpbMTIsNTczMF0sInRlZGR5ZHJhZ29uX2VhcnRoXzAzX3dpbmdfMTIiOlsxMiw1NzQ0XSwidGVkZHlkcmFnb25fZWFydGhfMDNfcmliYm9uXzEyIjpbMTIsNTc2Ml0sInRlZGR5ZHJhZ29uX2VhcnRoXzAzX2JvZHlfMiI6WzEyLDU3NzhdLCJ0ZWRkeWRyYWdvbl9lYXJ0aF8wM19oZWFkXzAxIjpbMTEsNTc5NCwxMiw1ODA5XSwidGVkZHlkcmFnb25fZWFydGhfMDNfZWFyXzEiOlsxMiw1ODI0XSwidGVkZHlkcmFnb25fZWFydGhfMDNfd2luZ18xIjpbMTIsNTgzOV0sInRlZGR5ZHJhZ29uX2VhcnRoXzAzX2JvZHlfMyI6WzExLDU4NTcsMTIsNTg3Ml0sInRlZGR5ZHJhZ29uX2VhcnRoXzAzX2JvZHlfMDEiOlsxMSw1ODg4LDEyLDU5MDZdLCJ0ZWRkeWRyYWdvbl9lYXJ0aF8wM19oZWFkXzAyIjpbMTIsNTkyNF0sInRlZGR5ZHJhZ29uX2VhcnRoXzAzX2hvcm5fMSI6WzEyLDU5NDBdLCJ0ZWRkeWRyYWdvbl9lYXJ0aF8wM193aW5nXzExIjpbMTIsNTk1NV0sInRlZGR5ZHJhZ29uX2VhcnRoXzAzX2xlZ18yIjpbMTIsNTk3M10sInRlZGR5ZHJhZ29uX2VhcnRoXzAzX3JpYmJvbl8xIjpbMTIsNTk5Nl0sInRlZGR5ZHJhZ29uX2VhcnRoXzAzX1BpbGxvd181IjpbMTEsNjAxMl0sInRlZGR5ZHJhZ29uX2VhcnRoXzAzX2VmZmVjdF8wMyI6WzExLDYwMjAsMTMsNjAzMV0sInRlZGR5ZHJhZ29uX2VhcnRoXzAzX2VmZmVjdF8wNCI6WzExLDYwNDIsMTIsNjA1MSwxMyw2MDYxXSwidGVkZHlkcmFnb25fZWFydGhfMDNfUGlsbG93XzQiOlsxMyw2MDc0XSwidGVkZHlkcmFnb25fZWFydGhfMDNfUGlsbG93XzMiOlsxMyw2MDgyXSwidGVkZHlkcmFnb25fZWFydGhfMDNfZWZmZWN0XzEiOlsxMyw2MDkwXSwidGVkZHlkcmFnb25fZWFydGhfMDNfUGlsbG93XzIiOlsxMyw2MDk4XSwidGVkZHlkcmFnb25fZWFydGhfMDNfUGlsbG93XzEiOlsxMyw2MTA2XSwidGVkZHlkcmFnb25fZWFydGhfMDNfZWZmZWN0XzAxIjpbMTMsNjExNF19LCJzbG90Ijp7ImVmZmVjdF90ZWRkeWRyYWdvbl9lYXJ0aF8wM19lZmZlY3RfMSI6WzIxLDYxMjJdLCJlZmZlY3RfdGVkZHlkcmFnb25fZWFydGhfMDNfZWZmZWN0XzAxIjpbMjEsNjEyOV0sImVmZmVjdF90ZWRkeWRyYWdvbl9lYXJ0aF8wM19lZmZlY3RfMiI6WzIxLDYxMzZdLCJlZmZlY3RfdGVkZHlkcmFnb25fZWFydGhfMDNfZWZmZWN0XzAyIjpbMjEsNjE0M10sImVmZmVjdF90ZWRkeWRyYWdvbl9lYXJ0aF8wM19lZmZlY3RfMDMiOlsyMCw2MTUwLDIxLDYxNTddLCJlZmZlY3RfdGVkZHlkcmFnb25fZWFydGhfMDNfZWZmZWN0XzMiOlsyMSw2MTY1XSwiZWZmZWN0X3RlZGR5ZHJhZ29uX2VhcnRoXzAzX2VmZmVjdF8wNCI6WzIwLDYxNzIsMjEsNjE3OV0sImVmZmVjdF90ZWRkeWRyYWdvbl9lYXJ0aF8wM19lZmZlY3RfNCI6WzIxLDYxODldLCJ0ZWRkeWRyYWdvbl9lYXJ0aF8wM19mb290XzAxIjpbMjAsNjE5Nl0sInRlZGR5ZHJhZ29uX2VhcnRoXzAzX2Zvb3RfMDIiOlsyMCw2MjA2XSwidGVkZHlkcmFnb25fZWFydGhfMDNfdGFtXzAxIjpbMjAsNjIxNiwyMSw2MjIzXSwidGVkZHlkcmFnb25fZWFydGhfMDNfdGFtXzAyIjpbMjAsNjIzMCwyMSw2MjM3XX19LHsiZHVyYXRpb24iOjM4LCJuYW1lIjoic2tpbGxfYXBwZWFyIiwib2Zmc2V0IjpbMTQxLDc2NTQsMzc4NzFdLCJib25lIjp7Im1vbnN0ZXJlZmZlY3QiOlsxMSw2MjQ0XSwidGVkZHlkcmFnb25fZWFydGhfMDNfYm9keV8yIjpbMTIsNjI2Ml0sInRlZGR5ZHJhZ29uX2VhcnRoXzAzX2JvZHlfMDIiOlsxMiw2Mjc1XSwidGVkZHlkcmFnb25fZWFydGhfMDNfYm9keV8zIjpbMTEsNjI4OCwxMiw2MzAwXSwidGVkZHlkcmFnb25fZWFydGhfMDNfbGVnXzAxIjpbMTEsNjMxMywxMiw2MzMwXSwidGVkZHlkcmFnb25fZWFydGhfMDNfbGVnXzAyIjpbMTEsNjM0OCwxMiw2MzY2XSwidGVkZHlkcmFnb25fZWFydGhfMDNfYm9keV8wMSI6WzExLDYzODQsMTIsNjM5OF0sInRlZGR5ZHJhZ29uX2VhcnRoXzAzX2JvZHlfNCI6WzExLDY0MTIsMTIsNjQyNV0sInRlZGR5ZHJhZ29uX2VhcnRoXzAzX2JvZHlfNSI6WzEyLDY0MzhdLCJ0ZWRkeWRyYWdvbl9lYXJ0aF8wM19mb290XzAxIjpbMTEsNjQ1MSwxMiw2NDY4XSwidGVkZHlkcmFnb25fZWFydGhfMDNfZm9vdF8wMiI6WzExLDY0ODUsMTIsNjQ5N10sInRlZGR5ZHJhZ29uX2VhcnRoXzAzX2xlZ18yIjpbMTIsNjUwOV0sInRlZGR5ZHJhZ29uX2VhcnRoXzAzX2FybV8wMSI6WzExLDY1MjcsMTIsNjUzOF0sInRlZGR5ZHJhZ29uX2VhcnRoXzAzX2FybV8wMiI6WzExLDY1NDksMTIsNjU2MF0sInRlZGR5ZHJhZ29uX2VhcnRoXzAzX2JvZHlfNiI6WzEyLDY1NzFdLCJ0ZWRkeWRyYWdvbl9lYXJ0aF8wM19mb290XzIiOlsxMiw2NTg0XSwidGVkZHlkcmFnb25fZWFydGhfMDNfaGVhZF8wMSI6WzExLDY1OTYsMTIsNjYwOV0sInRlZGR5ZHJhZ29uX2VhcnRoXzAzX2xlZ18zIjpbMTIsNjYyMl0sInRlZGR5ZHJhZ29uX2VhcnRoXzAzX3dpbmdfMDEiOlsxMiw2NjQwXSwidGVkZHlkcmFnb25fZWFydGhfMDNfd2luZ18wMiI6WzEyLDY2NTRdLCJ0ZWRkeWRyYWdvbl9lYXJ0aF8wM19hcm1fMSI6WzEyLDY2NjhdLCJ0ZWRkeWRyYWdvbl9lYXJ0aF8wM19hcm1fMiI6WzEyLDY2NzldLCJ0ZWRkeWRyYWdvbl9lYXJ0aF8wM19ib2R5XzciOlsxMiw2NjkwXSwidGVkZHlkcmFnb25fZWFydGhfMDNfZWFyXzAxIjpbMTIsNjcwM10sInRlZGR5ZHJhZ29uX2VhcnRoXzAzX2hlYWRfMDIiOlsxMiw2NzE2XSwidGVkZHlkcmFnb25fZWFydGhfMDNfaGVhZF8wMyI6WzExLDY3MjksMTIsNjc0M10sInRlZGR5ZHJhZ29uX2VhcnRoXzAzX2hlYWRfMSI6WzExLDY3NTcsMTIsNjc3M10sInRlZGR5ZHJhZ29uX2VhcnRoXzAzX2hvcm5fMDEiOlsxMiw2Nzg0XSwidGVkZHlkcmFnb25fZWFydGhfMDNfaG9ybl8wMiI6WzEyLDY3OTddLCJ0ZWRkeWRyYWdvbl9lYXJ0aF8wM19yaWJib25fMDIiOlsxMiw2ODEwXSwidGVkZHlkcmFnb25fZWFydGhfMDNfcmliYm9uXzAzIjpbMTIsNjgyM10sInRlZGR5ZHJhZ29uX2VhcnRoXzAzX3JpYmJvbl8xIjpbMTIsNjgzNl0sInRlZGR5ZHJhZ29uX2VhcnRoXzAzX3JpYmJvbl8xMSI6WzEyLDY4NDldLCJ0ZWRkeWRyYWdvbl9lYXJ0aF8wM19yaWJib25fMiI6WzEyLDY4NjJdLCJ0ZWRkeWRyYWdvbl9lYXJ0aF8wM19yaWJib25fOCI6WzEyLDY4NzVdLCJ0ZWRkeWRyYWdvbl9lYXJ0aF8wM193aW5nXzEiOlsxMiw2ODg4XSwidGVkZHlkcmFnb25fZWFydGhfMDNfd2luZ18xMiI6WzEyLDY5MDJdLCJ0ZWRkeWRyYWdvbl9lYXJ0aF8wM193aW5nXzQiOlsxMiw2OTE2XSwidGVkZHlkcmFnb25fZWFydGhfMDNfd2luZ185IjpbMTIsNjkzMF0sInRlZGR5ZHJhZ29uX2VhcnRoXzAzX2FybV8zIjpbMTIsNjk0NF0sInRlZGR5ZHJhZ29uX2VhcnRoXzAzX2FybV80IjpbMTIsNjk1NV0sInRlZGR5ZHJhZ29uX2VhcnRoXzAzX2Vhcl8xIjpbMTIsNjk2Nl0sInRlZGR5ZHJhZ29uX2VhcnRoXzAzX2Vhcl8zIjpbMTIsNjk3OV0sInRlZGR5ZHJhZ29uX2VhcnRoXzAzX2hlYWRfMiI6WzEyLDY5OTFdLCJ0ZWRkeWRyYWdvbl9lYXJ0aF8wM19oZWFkXzQiOlsxMiw3MDA0XSwidGVkZHlkcmFnb25fZWFydGhfMDNfaG9ybl8xIjpbMTIsNzAxN10sInRlZGR5ZHJhZ29uX2VhcnRoXzAzX2hvcm5fMiI6WzEyLDcwMzBdLCJ0ZWRkeWRyYWdvbl9lYXJ0aF8wM19yaWJib25fMTAiOlsxMiw3MDQzXSwidGVkZHlkcmFnb25fZWFydGhfMDNfcmliYm9uXzEyIjpbMTIsNzA1Nl0sInRlZGR5ZHJhZ29uX2VhcnRoXzAzX3JpYmJvbl8zIjpbMTIsNzA2OV0sInRlZGR5ZHJhZ29uX2VhcnRoXzAzX3JpYmJvbl81IjpbMTIsNzA4MV0sInRlZGR5ZHJhZ29uX2VhcnRoXzAzX3JpYmJvbl83IjpbMTIsNzA5M10sInRlZGR5ZHJhZ29uX2VhcnRoXzAzX3JpYmJvbl85IjpbMTIsNzEwNl0sInRlZGR5ZHJhZ29uX2VhcnRoXzAzX3dpbmdfMTAiOlsxMiw3MTE5XSwidGVkZHlkcmFnb25fZWFydGhfMDNfd2luZ18xMyI6WzEyLDcxMzNdLCJ0ZWRkeWRyYWdvbl9lYXJ0aF8wM193aW5nXzE1IjpbMTIsNzE0N10sInRlZGR5ZHJhZ29uX2VhcnRoXzAzX3dpbmdfMiI6WzExLDcxNjEsMTIsNzE3Ml0sInRlZGR5ZHJhZ29uX2VhcnRoXzAzX3dpbmdfNSI6WzEyLDcxODZdLCJ0ZWRkeWRyYWdvbl9lYXJ0aF8wM193aW5nXzciOlsxMiw3MjAwXSwidGVkZHlkcmFnb25fZWFydGhfMDNfZWFyXzIiOlsxMiw3MjE0XSwidGVkZHlkcmFnb25fZWFydGhfMDNfZWFyXzQiOlsxMiw3MjI3XSwidGVkZHlkcmFnb25fZWFydGhfMDNfaGVhZF8zIjpbMTIsNzI0MF0sInRlZGR5ZHJhZ29uX2VhcnRoXzAzX2hlYWRfNSI6WzEyLDcyNTNdLCJ0ZWRkeWRyYWdvbl9lYXJ0aF8wM19yaWJib25fNCI6WzEyLDcyNjZdLCJ0ZWRkeWRyYWdvbl9lYXJ0aF8wM19yaWJib25fNiI6WzEyLDcyNzhdLCJ0ZWRkeWRyYWdvbl9lYXJ0aF8wM193aW5nXzExIjpbMTIsNzI5MF0sInRlZGR5ZHJhZ29uX2VhcnRoXzAzX3dpbmdfMTQiOlsxMiw3MzA0XSwidGVkZHlkcmFnb25fZWFydGhfMDNfd2luZ18xNiI6WzEyLDczMThdLCJ0ZWRkeWRyYWdvbl9lYXJ0aF8wM193aW5nXzYiOlsxMiw3MzMyXSwidGVkZHlkcmFnb25fZWFydGhfMDNfd2luZ184IjpbMTIsNzM0Nl0sInRlZGR5ZHJhZ29uX2VhcnRoXzAzX2hlYWRfNiI6WzEyLDczNjBdLCJ0ZWRkeWRyYWdvbl9lYXJ0aF8wM193aW5nXzMiOlsxMSw3MzczLDEyLDczODddLCJ0ZWRkeWRyYWdvbl9lYXJ0aF8wM19QaWxsb3dfNCI6WzEzLDc0MDFdLCJ0ZWRkeWRyYWdvbl9lYXJ0aF8wM19QaWxsb3dfMyI6WzEzLDc0MDldLCJ0ZWRkeWRyYWdvbl9lYXJ0aF8wM19lZmZlY3RfMSI6WzEzLDc0MTddLCJ0ZWRkeWRyYWdvbl9lYXJ0aF8wM19QaWxsb3dfMiI6WzEzLDc0MjVdLCJ0ZWRkeWRyYWdvbl9lYXJ0aF8wM19QaWxsb3dfMSI6WzEzLDc0MzNdLCJ0ZWRkeWRyYWdvbl9lYXJ0aF8wM19lZmZlY3RfMDEiOlsxMyw3NDQxXX0sInNsb3QiOnsiZWZmZWN0X3RlZGR5ZHJhZ29uX2VhcnRoXzAzX2VmZmVjdF8xIjpbMjEsNzQ0OV0sImVmZmVjdF90ZWRkeWRyYWdvbl9lYXJ0aF8wM19lZmZlY3RfMDEiOlsyMSw3NDU4XSwiZWZmZWN0X3RlZGR5ZHJhZ29uX2VhcnRoXzAzX2VmZmVjdF8yIjpbMjEsNzQ2N10sImVmZmVjdF90ZWRkeWRyYWdvbl9lYXJ0aF8wM19lZmZlY3RfMDIiOlsyMSw3NDc2XSwiZWZmZWN0X3RlZGR5ZHJhZ29uX2VhcnRoXzAzX2VmZmVjdF8zIjpbMjEsNzQ4NV0sImVmZmVjdF90ZWRkeWRyYWdvbl9lYXJ0aF8wM19lZmZlY3RfNCI6WzIxLDc0OTNdLCJ0ZWRkeWRyYWdvbl9lYXJ0aF8wM19mb290XzAxIjpbMjAsNzUwMl0sInRlZGR5ZHJhZ29uX2VhcnRoXzAzX2Zvb3RfMDIiOlsyMCw3NTEyXSwidGVkZHlkcmFnb25fZWFydGhfMDNfdGFtXzAxIjpbMjAsNzUyMiwyMSw3NTI5XSwidGVkZHlkcmFnb25fZWFydGhfMDNfdGFtXzAyIjpbMjAsNzUzNiwyMSw3NTQzXX19LHsiZHVyYXRpb24iOjE4LCJuYW1lIjoic2tpbGxfZGlzYXBwZWFyIiwiYWN0aW9uIjo3NTUwLCJvZmZzZXQiOlsxNjgsOTE0NCw0MzU3NF0sImJvbmUiOnsidGVkZHlkcmFnb25fZWFydGhfMDNfd2luZ18xMiI6WzEyLDc1NTddLCJ0ZWRkeWRyYWdvbl9lYXJ0aF8wM19hcm1fMSI6WzEyLDc1NjVdLCJ0ZWRkeWRyYWdvbl9lYXJ0aF8wM19yaWJib25fMSI6WzEyLDc1NzNdLCJ0ZWRkeWRyYWdvbl9lYXJ0aF8wM19yaWJib25fMiI6WzEyLDc1ODFdLCJ0ZWRkeWRyYWdvbl9lYXJ0aF8wM19ib2R5XzAxIjpbMTEsNzU4OSwxMiw3NTk3XSwidGVkZHlkcmFnb25fZWFydGhfMDNfZWZmZWN0XzEiOlsxMyw3NjA1XSwidGVkZHlkcmFnb25fZWFydGhfMDNfcmliYm9uXzQiOlsxMiw3NjEyXSwidGVkZHlkcmFnb25fZWFydGhfMDNfYm9keV83IjpbMTIsNzYxOV0sInRlZGR5ZHJhZ29uX2VhcnRoXzAzX2JvZHlfNCI6WzExLDc2MjcsMTIsNzYzNV0sInRlZGR5ZHJhZ29uX2VhcnRoXzAzX3JpYmJvbl8zIjpbMTIsNzY0Ml0sInRlZGR5ZHJhZ29uX2VhcnRoXzAzX2xlZ18yIjpbMTIsNzY0OV0sInRlZGR5ZHJhZ29uX2VhcnRoXzAzX2hlYWRfMDEiOlsxMSw3NjU3LDEyLDc2NjZdLCJ0ZWRkeWRyYWdvbl9lYXJ0aF8wM19ib2R5XzIiOlsxMiw3Njc1XSwidGVkZHlkcmFnb25fZWFydGhfMDNfaGVhZF8yIjpbMTIsNzY4M10sInRlZGR5ZHJhZ29uX2VhcnRoXzAzX3dpbmdfNiI6WzEyLDc2OTFdLCJ0ZWRkeWRyYWdvbl9lYXJ0aF8wM19oZWFkXzUiOlsxMiw3Njk5XSwidGVkZHlkcmFnb25fZWFydGhfMDNfaG9ybl8wMSI6WzEyLDc3MDddLCJ0ZWRkeWRyYWdvbl9lYXJ0aF8wM193aW5nXzE0IjpbMTIsNzcxNV0sInRlZGR5ZHJhZ29uX2VhcnRoXzAzX2Vhcl8yIjpbMTIsNzcyM10sInRlZGR5ZHJhZ29uX2VhcnRoXzAzX3dpbmdfOCI6WzEyLDc3MzFdLCJ0ZWRkeWRyYWdvbl9lYXJ0aF8wM19yaWJib25fMTEiOlsxMiw3NzM5XSwidGVkZHlkcmFnb25fZWFydGhfMDNfd2luZ18xNSI6WzEyLDc3NDddLCJ0ZWRkeWRyYWdvbl9lYXJ0aF8wM19QaWxsb3dfNSI6WzExLDc3NTVdLCJ0ZWRkeWRyYWdvbl9lYXJ0aF8wM19mb290XzAxIjpbMTEsNzc2MywxMiw3NzcxXSwidGVkZHlkcmFnb25fZWFydGhfMDNfUGlsbG93XzQiOlsxMyw3Nzc5XSwidGVkZHlkcmFnb25fZWFydGhfMDNfd2luZ18xMCI6WzEyLDc3ODZdLCJ0ZWRkeWRyYWdvbl9lYXJ0aF8wM19yaWJib25fMTAiOlsxMiw3Nzk0XSwidGVkZHlkcmFnb25fZWFydGhfMDNfYm9keV8wMiI6WzEyLDc4MDJdLCJ0ZWRkeWRyYWdvbl9lYXJ0aF8wM19ob3JuXzAyIjpbMTIsNzgxMF0sInRlZGR5ZHJhZ29uX2VhcnRoXzAzX2JvZHlfNiI6WzEyLDc4MThdLCJ0ZWRkeWRyYWdvbl9lYXJ0aF8wM19oZWFkXzEiOlsxMSw3ODI2XSwidGVkZHlkcmFnb25fZWFydGhfMDNfd2luZ18wMSI6WzEyLDc4MzRdLCJ0ZWRkeWRyYWdvbl9lYXJ0aF8wM19QaWxsb3dfMDIiOlsxMSw3ODQyLDEzLDc4NDldLCJ0ZWRkeWRyYWdvbl9lYXJ0aF8wM19yaWJib25fNiI6WzEyLDc4NThdLCJ0ZWRkeWRyYWdvbl9lYXJ0aF8wM19sZWdfMyI6WzEyLDc4NjVdLCJ0ZWRkeWRyYWdvbl9lYXJ0aF8wM193aW5nXzMiOlsxMiw3ODczXSwidGVkZHlkcmFnb25fZWFydGhfMDNfYm9keV8zIjpbMTEsNzg4MSwxMiw3ODg4XSwidGVkZHlkcmFnb25fZWFydGhfMDNfd2luZ180IjpbMTIsNzg5NV0sInRlZGR5ZHJhZ29uX2VhcnRoXzAzX2VmZmVjdF8wMyI6WzExLDc5MDMsMTMsNzkxMV0sInRlZGR5ZHJhZ29uX2VhcnRoXzAzX3dpbmdfOSI6WzEyLDc5MTldLCJ0ZWRkeWRyYWdvbl9lYXJ0aF8wM19QaWxsb3dfMyI6WzEzLDc5MjddLCJ0ZWRkeWRyYWdvbl9lYXJ0aF8wM19yaWJib25fOSI6WzEyLDc5MzRdLCJ0ZWRkeWRyYWdvbl9lYXJ0aF8wM193aW5nXzEzIjpbMTIsNzk0Ml0sIm1vbnN0ZXJlZmZlY3QiOlsxMSw3OTUwXSwidGVkZHlkcmFnb25fZWFydGhfMDNfZWFyXzEiOlsxMiw3OTU4XSwidGVkZHlkcmFnb25fZWFydGhfMDNfZWZmZWN0XzAxIjpbMTMsNzk2Nl0sInRlZGR5ZHJhZ29uX2VhcnRoXzAzX3JpYmJvbl81IjpbMTIsNzk3M10sInRlZGR5ZHJhZ29uX2VhcnRoXzAzX2VmZmVjdF8wNCI6WzExLDc5ODAsMTIsNzk4NiwxMyw3OTkyXSwidGVkZHlkcmFnb25fZWFydGhfMDNfaG9ybl8xIjpbMTIsNzk5OV0sInRlZGR5ZHJhZ29uX2VhcnRoXzAzX3JpYmJvbl83IjpbMTIsODAwN10sInRlZGR5ZHJhZ29uX2VhcnRoXzAzX1BpbGxvd182IjpbMTEsODAxNV0sInRlZGR5ZHJhZ29uX2VhcnRoXzAzX2FybV8yIjpbMTIsODAyM10sInRlZGR5ZHJhZ29uX2VhcnRoXzAzX3JpYmJvbl8xMiI6WzEyLDgwMzFdLCJ0ZWRkeWRyYWdvbl9lYXJ0aF8wM19QaWxsb3dfMSI6WzEzLDgwMzldLCJ0ZWRkeWRyYWdvbl9lYXJ0aF8wM19QaWxsb3dfMDEiOlsxMSw4MDQ2LDEzLDgwNTNdLCJ0ZWRkeWRyYWdvbl9lYXJ0aF8wM19oZWFkXzAzIjpbMTEsODA2MiwxMiw4MDcwXSwidGVkZHlkcmFnb25fZWFydGhfMDNfd2luZ183IjpbMTIsODA3OF0sInRlZGR5ZHJhZ29uX2VhcnRoXzAzX3JpYmJvbl8wMiI6WzEyLDgwODZdLCJ0ZWRkeWRyYWdvbl9lYXJ0aF8wM19ob3JuXzIiOlsxMiw4MDk0XSwidGVkZHlkcmFnb25fZWFydGhfMDNfaGVhZF82IjpbMTIsODEwMl0sInRlZGR5ZHJhZ29uX2VhcnRoXzAzX3dpbmdfMTYiOlsxMiw4MTEwXSwidGVkZHlkcmFnb25fZWFydGhfMDNfcmliYm9uXzAzIjpbMTIsODExOF0sInRlZGR5ZHJhZ29uX2VhcnRoXzAzX2xlZ18wMiI6WzEyLDgxMjZdLCJ0ZWRkeWRyYWdvbl9lYXJ0aF8wM19QaWxsb3dfMiI6WzEzLDgxMzRdLCJ0ZWRkeWRyYWdvbl9lYXJ0aF8wM19hcm1fMDIiOlsxMSw4MTQxLDEyLDgxNDhdLCJ0ZWRkeWRyYWdvbl9lYXJ0aF8wM193aW5nXzAyIjpbMTIsODE1Nl0sInRlZGR5ZHJhZ29uX2VhcnRoXzAzX2xlZ18wMSI6WzEyLDgxNjRdLCJ0ZWRkeWRyYWdvbl9lYXJ0aF8wM19oZWFkXzMiOlsxMiw4MTcyXSwidGVkZHlkcmFnb25fZWFydGhfMDNfaGVhZF8wMiI6WzEyLDgxODBdLCJ0ZWRkeWRyYWdvbl9lYXJ0aF8wM19hcm1fMyI6WzEyLDgxODhdLCJ0ZWRkeWRyYWdvbl9lYXJ0aF8wM19yaWJib25fOCI6WzEyLDgxOTZdLCJ0ZWRkeWRyYWdvbl9lYXJ0aF8wM193aW5nXzExIjpbMTIsODIwNF0sInRlZGR5ZHJhZ29uX2VhcnRoXzAzX2hlYWRfNCI6WzEyLDgyMTFdLCJ0ZWRkeWRyYWdvbl9lYXJ0aF8wM19hcm1fMDEiOlsxMSw4MjE5LDEyLDgyMjZdLCJ0ZWRkeWRyYWdvbl9lYXJ0aF8wM19lYXJfMyI6WzEyLDgyMzRdLCJ0ZWRkeWRyYWdvbl9lYXJ0aF8wM19hcm1fNCI6WzEyLDgyNDFdLCJ0ZWRkeWRyYWdvbl9lYXJ0aF8wM19ib2R5XzUiOlsxMiw4MjQ5XSwidGVkZHlkcmFnb25fZWFydGhfMDNfd2luZ18xIjpbMTIsODI1N10sInRlZGR5ZHJhZ29uX2VhcnRoXzAzX2Vhcl8wMSI6WzEyLDgyNjVdLCJ0ZWRkeWRyYWdvbl9lYXJ0aF8wM19lYXJfNCI6WzEyLDgyNzNdLCJ0ZWRkeWRyYWdvbl9lYXJ0aF8wM193aW5nXzUiOlsxMiw4MjgxXSwidGVkZHlkcmFnb25fZWFydGhfMDNfd2luZ18yIjpbMTIsODI4OV19LCJzbG90Ijp7ImVmZmVjdF90ZWRkeWRyYWdvbl9lYXJ0aF8wM19lZmZlY3RfMSI6WzIxLDgyOTddLCJlZmZlY3RfdGVkZHlkcmFnb25fZWFydGhfMDNfZWZmZWN0XzAxIjpbMjEsODMwNF0sImVmZmVjdF90ZWRkeWRyYWdvbl9lYXJ0aF8wM19lZmZlY3RfMDIiOlsyMSw4MzExXSwiZWZmZWN0X3RlZGR5ZHJhZ29uX2VhcnRoXzAzX2VmZmVjdF8wMyI6WzIwLDgzMTgsMjEsODMyNV0sImVmZmVjdF90ZWRkeWRyYWdvbl9lYXJ0aF8wM19lZmZlY3RfNCI6WzIxLDgzMzJdLCJ0ZWRkeWRyYWdvbl9lYXJ0aF8wM190YW1fMDEiOlsyMCw4MzM5LDIxLDgzNDVdLCJ0ZWRkeWRyYWdvbl9lYXJ0aF8wM190YW1fMDIiOlsyMCw4MzUxLDIxLDgzNTddfX1dLCJkZWZhdWx0QWN0aW9ucyI6W3sibmFtZSI6ImF0dGFjayJ9XSwiYWN0aW9ucyI6W3sidHlwZSI6MTAsIm5hbWUiOiJhdHRhY2sifSx7InR5cGUiOjEwLCJuYW1lIjoiYXR0YWNrIn1dfV0sIm9mZnNldCI6WzAsMTMwOTYsMTMwOTYsMzUwNjAsNDgxNTYsMzYwLDQ4NTE2LDM4Njk2LDg3MjEyLDkxNjI4LDE3ODg0MCwxNjcyOF0sInRleHR1cmVBdGxhcyI6W3sid2lkdGgiOjEwMjQsImhlaWdodCI6MTAyNCwibmFtZSI6InRlZGR5ZHJhZ29uX2VhcnRoXzAzIiwiaW1hZ2VQYXRoIjoidGVkZHlkcmFnb25fZWFydGhfMDNfdGV4LnBuZyIsIlN1YlRleHR1cmUiOlt7IngiOjgxMiwieSI6MjE3LCJ3aWR0aCI6MTcsImhlaWdodCI6NDMsImZyYW1lWCI6LTEzLCJmcmFtZVkiOi0xMCwiZnJhbWVXaWR0aCI6NDQsImZyYW1lSGVpZ2h0Ijo2MywibmFtZSI6InRlZGR5ZHJhZ29uX2VhcnRoXzAzX2VmZmVjdF8wMSJ9LHsieCI6MzU4LCJ5IjozNzUsIndpZHRoIjoyMCwiaGVpZ2h0IjozOCwiZnJhbWVYIjotMTksImZyYW1lWSI6LTExLCJmcmFtZVdpZHRoIjo1OSwiZnJhbWVIZWlnaHQiOjYzLCJuYW1lIjoidGVkZHlkcmFnb25fZWFydGhfMDNfZWZmZWN0XzAyIn0seyJ4Ijo1MjMsInkiOjM0Niwid2lkdGgiOjI5MCwiaGVpZ2h0Ijo1OCwiZnJhbWVYIjotNiwiZnJhbWVZIjotMjMsImZyYW1lV2lkdGgiOjI5OSwiZnJhbWVIZWlnaHQiOjEwMSwibmFtZSI6InRlZGR5ZHJhZ29uX2VhcnRoXzAzX3J1Z18wMSJ9LHsieCI6MjM3LCJ5IjoxLCJ3aWR0aCI6MjA1LCJoZWlnaHQiOjIwOSwibmFtZSI6InRlZGR5ZHJhZ29uX2VhcnRoXzAzX1BpbGxvd18wMSJ9LHsieCI6NjYzLCJ5IjoyMTcsIndpZHRoIjoxNDcsImhlaWdodCI6OTQsIm5hbWUiOiJ0ZWRkeWRyYWdvbl9lYXJ0aF8wM19ib2R5XzAyIn0seyJ4Ijo0NDQsInkiOjEsIndpZHRoIjoyMDUsImhlaWdodCI6MjA5LCJuYW1lIjoidGVkZHlkcmFnb25fZWFydGhfMDNfUGlsbG93XzAyIn0seyJ4IjozODMsInkiOjM0MSwid2lkdGgiOjEyMywiaGVpZ2h0IjoxMDEsIm5hbWUiOiJ0ZWRkeWRyYWdvbl9lYXJ0aF8wM19sZWdfMDIifSx7IngiOjUyMywieSI6MjE3LCJ3aWR0aCI6MTM4LCJoZWlnaHQiOjEyNywibmFtZSI6InRlZGR5ZHJhZ29uX2VhcnRoXzAzX3dpbmdfMDEifSx7IngiOjM4MywieSI6MjEyLCJ3aWR0aCI6MTM4LCJoZWlnaHQiOjEyNywibmFtZSI6InRlZGR5ZHJhZ29uX2VhcnRoXzAzX3dpbmdfMDIifSx7IngiOjE0OSwieSI6MjMzLCJ3aWR0aCI6ODUsImhlaWdodCI6MTI0LCJuYW1lIjoidGVkZHlkcmFnb25fZWFydGhfMDNfYXJtXzAyIn0seyJ4IjoxLCJ5IjoyMzMsIndpZHRoIjoxNDYsImhlaWdodCI6MTU1LCJuYW1lIjoidGVkZHlkcmFnb25fZWFydGhfMDNfYm9keV8wMSJ9LHsieCI6MSwieSI6MSwid2lkdGgiOjIzNCwiaGVpZ2h0IjoyMzAsImZyYW1lWSI6LTYsImZyYW1lV2lkdGgiOjIzNiwiZnJhbWVIZWlnaHQiOjI1MSwibmFtZSI6InRlZGR5ZHJhZ29uX2VhcnRoXzAzX2VmZmVjdF8wMyJ9LHsieCI6MjM2LCJ5Ijo0NzYsIndpZHRoIjo5OSwiaGVpZ2h0Ijo3NSwibmFtZSI6InRlZGR5ZHJhZ29uX2VhcnRoXzAzX2Zvb3RfMDIifSx7IngiOjEwMiwieSI6NTI4LCJ3aWR0aCI6OTksImhlaWdodCI6NzUsIm5hbWUiOiJ0ZWRkeWRyYWdvbl9lYXJ0aF8wM19sZWdfMDEifSx7IngiOjMzNywieSI6NDQ0LCJ3aWR0aCI6NTksImhlaWdodCI6ODksIm5hbWUiOiJ0ZWRkeWRyYWdvbl9lYXJ0aF8wM19yaWJib25fMDMifSx7IngiOjEsInkiOjQ0NCwid2lkdGgiOjk5LCJoZWlnaHQiOjEwNSwibmFtZSI6InRlZGR5ZHJhZ29uX2VhcnRoXzAzX2Zvb3RfMDEifSx7IngiOjUwOCwieSI6NDA2LCJ3aWR0aCI6NTksImhlaWdodCI6ODksIm5hbWUiOiJ0ZWRkeWRyYWdvbl9lYXJ0aF8wM19yaWJib25fMDIifSx7IngiOjE0OSwieSI6MzU5LCJ3aWR0aCI6ODUsImhlaWdodCI6MTI0LCJuYW1lIjoidGVkZHlkcmFnb25fZWFydGhfMDNfYXJtXzAxIn0seyJ4IjoxLCJ5Ijo2MDUsIndpZHRoIjoxMDAsImhlaWdodCI6NzEsIm5hbWUiOiJ0ZWRkeWRyYWdvbl9lYXJ0aF8wM19yaWJib25fMDEifSx7IngiOjg1MywieSI6MSwid2lkdGgiOjE2OCwiaGVpZ2h0IjoxNzcsIm5hbWUiOiJ0ZWRkeWRyYWdvbl9lYXJ0aF8wM190YW1fMDIifSx7IngiOjg1MywieSI6MTgwLCJ3aWR0aCI6MTY4LCJoZWlnaHQiOjE3NywibmFtZSI6InRlZGR5ZHJhZ29uX2VhcnRoXzAzX3RhbV8wMSJ9LHsieCI6MjM3LCJ5IjoyMTIsIndpZHRoIjoxNDQsImhlaWdodCI6MTYxLCJuYW1lIjoidGVkZHlkcmFnb25fZWFydGhfMDNfaGVhZF8wMSJ9LHsieCI6MzIzLCJ5IjozNzUsIndpZHRoIjozMywiaGVpZ2h0IjozMiwibmFtZSI6InRlZGR5ZHJhZ29uX2VhcnRoXzAzX2V5ZV8wMSJ9LHsieCI6ODE1LCJ5IjozNTksIndpZHRoIjo5MSwiaGVpZ2h0IjoxMzEsIm5hbWUiOiJ0ZWRkeWRyYWdvbl9lYXJ0aF8wM19lYXJfMDEifSx7IngiOjMyMywieSI6NDA5LCJ3aWR0aCI6MzMsImhlaWdodCI6MzIsIm5hbWUiOiJ0ZWRkeWRyYWdvbl9lYXJ0aF8wM19leWVfMDIifSx7IngiOjU2OSwieSI6NDA2LCJ3aWR0aCI6NTksImhlaWdodCI6NjMsIm5hbWUiOiJ0ZWRkeWRyYWdvbl9lYXJ0aF8wM19ob3JuXzAyIn0seyJ4Ijo5MDgsInkiOjQwNiwid2lkdGgiOjk0LCJoZWlnaHQiOjEyMCwibmFtZSI6InRlZGR5ZHJhZ29uX2VhcnRoXzAzX2hlYWRfMDIifSx7IngiOjIzNiwieSI6Mzc1LCJ3aWR0aCI6ODUsImhlaWdodCI6OTksImZyYW1lWCI6LTksImZyYW1lWSI6LTEzLCJmcmFtZVdpZHRoIjoxMDcsImZyYW1lSGVpZ2h0IjoxMjAsIm5hbWUiOiJ0ZWRkeWRyYWdvbl9lYXJ0aF8wM19oZWFkXzAzIn0seyJ4IjozOTgsInkiOjQ0NCwid2lkdGgiOjU5LCJoZWlnaHQiOjYzLCJuYW1lIjoidGVkZHlkcmFnb25fZWFydGhfMDNfaG9ybl8wMSJ9LHsieCI6NjUxLCJ5IjoxLCJ3aWR0aCI6MjAwLCJoZWlnaHQiOjIxNCwiZnJhbWVYIjotMjQsImZyYW1lWSI6LTIzLCJmcmFtZVdpZHRoIjoyMzYsImZyYW1lSGVpZ2h0IjoyNTEsIm5hbWUiOiJ0ZWRkeWRyYWdvbl9lYXJ0aF8wM19lZmZlY3RfMDQifV19XX0gICgANgAAAKYAGAAMAAsACgAkAAsAJAAYAAsACQAkAAoAGAANAAwACAAjAAkAIwAkAAkAGAAOAA0AGQAPAA4AJQAZACQAJAAZABgAGQAOABgABwAjAAgAIwAiACQAIgAlACQABwAGACMABgAiACMAEAAPABkABQAiAAYAGgAQABkAJQAaABkAJgAaACUAIgAhACUAIQAmACUABQAhACIAGwARABoABAAhAAUAGgARABAAJgAbABoAJwAbACYAIAAnACYABAADACEAAwAgACEAIAAmACEAGwASABEAHAASABsAJwAcABsAAgAfACAAAgAgAAMAIAAfACcAHwAcACcAHwAdABwAHAATABIAHQATABwAAQAfAAIAHQAUABMAHgAdAB8AAQAeAB8AHgAUAB0AFQAUAB4AAAAeAAEAAAAVAB4AFgAVAAAAFwAWAAAABACgABsAJwAVAA8AAgAAAAEAAwACAAAAAQAEAAMAAgAAAAEAAwADAAIAAAADAAMAAgAAAAIAAwACAAIAAwACAAIAAwACAAEAAwABAAMAAQADAAEAAwADAAMAAgAAAAMAAwACAAAABAADAAIAAAABAAQAAwACAAAAAQAEAAMAAgAAAAEABAADAAIAAAABAAQAAwACAAAAAQADAAIAAAABAAIAAAABAAEAAQABAAEAAQABAAMAAwACAAAAAwADAAIAAAADAAMAAgAAAAQAAwACAAAAAQACAAAAAQACAAAAAQABAAEAAwACAAAAAQADAAMAAgAAAAIAAwACAAIAAwACAAIAAwACAAEAAwACAAMAAAABAAIAAQACADAARAC6Af//EgApABMAEwApABQAKQAVABQAEQApABIALwAWABUAKQAvABUAEAAsABEALAApABEALwAXABYAJwAvACkALwAqABcAKgAYABcADwAsABAALAAnACkAJwAqAC8ADgAoACwADgAsAA8AJgAZABgAKgAmABgAKAAnACwAJwAuACoAKgAlACYADQAoAA4AJgAAABkAJQAAACYAJAAlACoALgAkACoADAAoAA0AKwAuACcALQArACcAKAAtACcADAAaACgAGgAtACgAJQAkAAAAJAABAAAAIgAjAC4AIwABACQALgAjACQAGgAbAC0AIwACAAEACwAaAAwAKwAgAC4AIAAhAC4AIQAiAC4AHQArAC0AIgACACMAIgADAAIAHAAdAC0AGwAcAC0AHQAeACsACwAbABoAIQADACIACgAbAAsAIQAEAAMAHgAfACsAHwAgACsACgAcABsABQAEACAACQAcAAoAIAAEACEAHwAGACAACQAdABwACAAdAAkABgAFACAACAAHAB4ACAAeAB0AHgAHAB8ABwAGAB8AJgA3AHoCqwINAB4ADgAeACUADgAOACUADwAlABAADwAdAB4ADQAMAB0ADQAlABEAEAAdAB8AHgAfACQAHgAeACQAJQAkABEAJQALAB0ADAAkACMAEQAcAB8AHQALABwAHQAjABIAEQAfACMAJAAKABwACwAgACMAHwAcABsAHwAbACAAHwAaACAAGwAKABMAHAAWAAoACQAIABYACQATABsAHAAhACIAEgAhABIAIwAWABcACgAXABMACgAiAAAAEgAgACEAIwATABQAGwAHABYACAAaACEAIAAHABcAFgAVABoAGwAUABUAGwAYABQAEwAXABgAEwAiAAEAAAAVAAMAIQAVACEAGgAHAAYAFwAZABUAFAACAAEAIgADACIAIQAYABkAFAADAAIAIgAZAAQAFQAEAAMAFQAGABgAFwAGAAUAGAAFAAQAGQAFABkAGAAHABIDHgApAFAAUQBbADwAPQABAAAAAQAAAAEAAAABAAAAAQAAAAEAAAAEAAAAAQACAAQAAwABAAIABAADAAEAAgAEAAEAAgACAAEAAgAEAAEABQACAAQAAwAFAAIABAADAAUAAgAEAAMABQACAAQAAwAFAAIABAABAAQAAgADAAQAAwAAAAYAAwADAAEABQACAAMAAQAFAAIABQAAAAEABgADAAQAAwABAAIABAAEAAEABQACAAQABAAAAAEABQACAAMAAAABAAIABgAAAAEABQAGAAMABAAFAAEABQAGAAMABAAFAAUAAgAGAAMABAAEAAUAAgADAAQABQABAAUAAgADAAQABgABAAUAAgAGAAMABAAGAAAAAQAFAAYAAwAEAAYAAAABAAUABgADAAQAAQAAAAUAAAABAAUAAwAEAAUAAQAFAAIAAwAEAAMABQACAAQAGAAdAIMEsAMSAAoACQAHABEACAARABIACAASAAkACAASABQACgAUAAsACgAGABEABwARABMAEgATABQAEgAXAAwACwAUABcACwAFABEABgAFABMAEQATABYAFAAWABcAFAAXAA0ADAAEAAMAEwADABUAEwAFAAQAEwAVABYAEwAXAA4ADQAPAA4AFwAWAA8AFwAQAA8AFgAVAAAAFgAAABAAFgACABUAAwACAAEAFQABAAAAFQACAOMELQA/AAEAAAABAAAAAgAAAAEAAgAAAAEAAgAAAAEAAgAAAAEAAgAAAAEAAQABAAEAAQABAAEAAgAAAAEAAgAAAAEAAgAAAAEAAgAAAAEAAgAAAAEAAQAAAAEAAAACAAAAAQABAAEAAgAAAAEAAgAAAAEAAgAAAAEAAQAAAAIAAAABACkAOQBYBaIEAQAYAAIABAAkAAUAJAAlAAUACQAIAAcAKAAJAAcABQAlAAYAKAAHAAYAJQAoAAYAIgAkAAQAIAAEAAMAIAAiAAQAHgAgAAIAAgAgAAMAKAAKAAkAGAAcAAIAHAAeAAIAAQAaABgAGgAcABgAAAAaAAEAFAAaABUAFQAaAAAAIwAmACUAFAAZABoAGgAZABwAGQAbABwAGwAdABwAHAAdAB4AHQAfAB4AHgAfACAAHwAhACAAIQAjACIAIAAhACIAIgAjACQAIwAlACQACwAKACgAJQAnACgAJwALACgAJgAnACUAEgAbABkAEwASABkAEwAZABQAGwARAB0AEgARABsAEAAfAB0AEQAQAB0AJwAMAAsAIwAXACYAFgAjACEADwAWACEADwAhAB8AEAAPAB8AFgAXACMAFwAOACYAJgAOACcADgAMACcADgANAAwADgAXABYAAwD8BS4AQwBTAAEAAAABAAAAAgAAAAEAAwAAAAEAAgADAAAAAQACAAIAAQACAAIAAQACAAEAAgABAAIAAQACAAEAAgABAAIAAQACAAEAAgACAAEAAgACAAEAAgACAAAAAQACAAAAAQACAAAAAQABAAAAAQAAAAEAAAACAAEAAgACAAEAAgACAAAAAQABAAAAAQAAAAIAAAABAAEAAAACAAAAAQACAAAAAQABAAEAAwAAAAEAAgACAAEAAgACAAEAAgACAAEAAgACAAEAAgABAAIAAgABAAIAAQACAAEAAgA8AFMAwgYPBhgAIwAZABkAMgAaADIAGwAaACMAMgAZADMAHAAbADIAMwAbADEAMgAjADQAHQAcADMANAAcABgAMQAjADUAHgAdADQANQAdADAAMwAyADEAMAAyABcAMQAYADUAHwAeACwAMQAXADoAIAAfADUAOgAfACAAOwAhADsAAAAhAAAAIgAhADoAOwAgADQAJgA1ABYALAAXAC8ANAAzADAALwAzADsAAQAAAC0AMAAxACwALQAxADoAOQA7ADgAOgA1ACYAOAA1AAIAAQA7ADkAAgA7ADgAOQA6ABUALAAWACQAJQA0AC8AJAA0ACUAJgA0ABUAKwAsAC4ALwAwAC0ALgAwACUANgA4ACUAOAAmADcAOQA4ADYANwA4AAMAAgA5ACQANgAlAAgAJAAvADcAAwA5ACoALQAsACsAKgAsABQAKwAVAAkACAAvAC4ACQAvAAQAAwA3AAoACQAuAAgABwA2AAcABgA2AAUANwA2AAYABQA2AAgANgAkACkALgAtACoAKQAtABMAKAAUABQAKAArAAUABAA3ACgAKgArACkADAAuAAwACwAuAAsACgAuACgAJwAqACcAKQAqABIAKAATABIAEQAoABEAJwAoACcADgApAA4ADQApAA0ADAApABEAEAAnABAADwAnAA8ADgAnAAYAsgceADsATQAoADoATAACAAAAAQADAAAAAQACAAIAAQACAAIAAQACAAIAAQACAAEAAgADAAMABAACAAMAAwAEAAIABAADAAQAAQACAAMAAwAEAAIABAADAAQABQACAAQAAwAEAAUAAgAEAAMABAAFAAIAAwAEAAUAAgACAAQABQACAAQABQABAAUAAQAFAAEABQABAAUAAwADAAQABQADAAMABAAFAAMAAwAEAAUAAwADAAQABQADAAMABAAFAAQAAAADAAQABQACAAAAAwADAAAAAwABAAMAAAADAAEABAAAAAMAAQACAAQAAAADAAEAAgABAAAAAQAAAAEAAAABAAAAAwADAAQABQAEAAMABAABAAIABAADAAQAAQACAAQAAwAEAAEAAgACAAQABQABAAUAAwAEAAUAAgACAAQABQADAAMABAAFAAMAAwAEAAUAAgAEAAUAAwADAAQAAgAEAAMABAABAAIAAwADAAQABQADAAMABAAFAAQAAAADAAQABQACAAAAAwAEAAMABAABAAIABAAAAAMAAQACAAQAAwAEAAEAAgABAAIABAADAAQAAQACAAIAAQACAAIAAAABAAIAAAABABIAFgCSCf//CAARAAkAEQAKAAkABwARAAgAEQALAAoADAARAAcABgAMAAcAEAAAAAsADQAOABEADgAPABEADwAQABEADAANABEAEAALABEABQAMAAYABQANAAwABAANAAUADwABABAAEAABAAAABAADAA0AAwAOAA0AAgABAA8AAgAPAA4AAwACAA4AGgAjANoJpgcWAAkACgALABYACgAZAAgACQAWABkACQAVABYACwAMABUACwAZAAcACAAUABUADAANABQADAAVABgAFgAYABkAFgASAAcAGQAYABIAGQAXABgAFQAUABcAFQARABIAGAATABQADQAOABMADQASAAYABwAQABEAFwAXABEAGAATABcAFAATAA8AFwAPABAAFwAAABMADgAFAAYAEgARAAUAEgAQAAMAEQADAAQAEQAEAAUAEQAAAA8AEwACABAADwABAA8AAAACAAMAEAABAAIADwADAEIKLAA+AB4AAgAAAAEAAgAAAAEAAwACAAAAAQADAAIAAAABAAMAAgAAAAEAAwACAAAAAQABAAIAAQACAAEAAgABAAIAAQACAAIAAgAAAAIAAAABAAIAAAABAAIAAgABAAIAAAABAAMAAgAAAAEAAwACAAAAAQADAAIAAAABAAIAAAABAAIAAAABAAIAAAABAAIAAgAAAAIAAAABAAMAAgAAAAEAAQAAACQAMgDkCpUIGQAaAA8AGgARABAADwAaABAADgAZAA8AGgASABEAGgAbABIADQAYAA4AGAAZAA4AGwATABIAGQAiABoAIwAbABoAIgAjABoADAAXAA0AFwAYAA0AIwATABsAGAAhABkAIQAiABkAIwAAABMAIAAhABgACwAXAAwAHQAgABgAFwAdABgAIgAAACMAFgAXAAsACgAWAAsAAQAAACIAFgAcABcAHAAdABcAIQABACIAAgABACEACQAWAAoACQAVABYAFQAcABYAIAACACEAAwACACAACAAVAAkAHAAeAB0AHgAfAB0AHwAgAB0AHwADACAAFAAcABUACAAUABUAFAAeABwABAADAB8ABgAeABQABwAUAAgABwAGABQAHgAEAB8ABgAFAB4ABQAEAB4AAgB0CxYAHAACAAAAAQACAAAAAQACAAAAAQACAAAAAQABAAEAAQABAAEAAQABAAEAAQABAAIAAAABAAIAAAABAAIAAAABAAIAAAABAAIAAAABAAIAAAABAAIAAAABAAEAAAABAAAAAQAAAAEAAAABAAEAAgAAAAEAAgAAAAEAAgAAAAEAAgAAAAEAAgAAAAEAAQAAAAEAAAABAAEAAgAAAAEAAQABAAEAAQABAAEAAgAAAAEAAgAAAAEAAgAAAAEAEQAPABwM//8LAAkADQALAA0ADAAEAAAACQAAABAADQAJAAAADQAQAA8ADQAPAA4ADQAGAAQABwAEAAIAAAAHAAQACQAKAAkACwAIAAcACQAFAAQABgACAAEAAAAEAAMAAgAxAEQAYAz2CRYAKgAXACoAMAAXABcAMAAYADAAGQAYABUAKgAWABQAJwAVACcAKgAVADAAGgAZACcAKwAqACsAIgAqAC8AGgAwACoAIgAwACIALwAwABMAJwAUACYAJwATAC8AGwAaACIAIQAvACYAHwAnABIAJgATAB8AKwAnACsAIQAiACEAIAAvACAAGwAvACwAIAArACAAAAAbACsAIAAhABEAJgASABEAJQAmAB8ALAArACwAAgABACwAAQAgAAEAAAAgAB4AHwAmACUAHgAmAB4ALAAfABAAJQARACUAHQAeAC0AAgAsAC0AAwACAB0ALQAeAB4ALQAsACQAJQAQACkAHQAlAA8AJAAQACQAKQAlAAQAAwAtACkAHAAdABwALQAdACMAJAAPABwALgAtAC4ABAAtAA4AIwAPACgAKQAkACMAKAAkAAUABAAuACkABwAcAAcALgAcAAgABwApACgACAApAA0AIwAOAA0ADAAjAAcABgAuAAYABQAuAAwACwAjAAkACAAoAAoAKAAjAAsACgAjAAoACQAoAAkAJA02AEoAWQBaAEkAWAA0ACEASwAEAAAAAQACAAMABAAAAAEAAgADAAQAAAABAAIAAwADAAEAAgADAAMAAQACAAMAAQACAAMABAAFAAIAAwAEAAUAAgADAAQABQACAAMABAAFAAIAAgAFAAIAAQAFAAEABQABAAUAAwAGAAQABQADAAYABAAFAAQABwAGAAQABQADAAcABgAEAAMABwAGAAQAAgAHAAYAAgAHAAYAAgAHAAgAAgAHAAgAAwAHAAgAAwAEAAcAAQAIAAMAAwABAAgAAwADAAEACAADAAIAAQADAAQABgAEAAUAAgAFAAYABAAFAAEAAgAGAAcABgAEAAAAAQACAAUABwAGAAAAAQACAAQAAAABAAIAAwADAAAAAQADAAQAAAABAAgAAwABAAUAAgAGAAQAAwAHAAYABAADAAcABgAEAAEABwADAAQABQACAAMABAAFAAIAAQAIAAEAAAABAAEAAQACAAEAAgABAAMAAgAIAAMAFwAdAKoO//8JABMACgATABUACgAKABUACwAVAAwACwATABIAFQAIABMACQAVABQADAAUAA0ADAARABQAFQASABEAFQAHABIAEwAHABMACAAGABEAEgAHAAYAEgARABAAFAAQABYAFAAUABYADQAWAA4ADQAQAA8AFgAWAA8ADgAGAAUAEQAFABAAEQAPAAAADgADAA8AEAAEAAMAEAAFAAQAEAACAAEADwADAAIADwAPAAEAAAAfACYABg///xgABQAEAAIAFwADABcAGAADABgABAADAAEAFwACABgABgAFABYAFwAAABgABwAGAAAAFwABABsABwAYABcAGgAYABoAGwAYABsACAAHABUAFgAAABYAGgAXABkAGgAWABQAFgAVABQAEwAWABMAGQAWAB4ACQAbABsACQAIABIAGQATABoAHQAbAB0AHgAbABkAHQAaABwAHQAZAB4ACgAJABIAEQAZABEAHAAZAB0ADQAeAAwACwAeAB4ACwAKAA0ADAAeABAAHAARABwADgAdAA4ADQAdABAADwAcAA8ADgAcAC8APQCCD0AMHwACAAEAKAAYABcAFgAoABcAFQAoABYAKQAZABgAKAApABgAFAAmABUAJgAoABUAKQAaABkAKQAtABoAEwAmABQALQAbABoAJwApACgAJgAnACgAEgAmABMALQAcABsAEQAQACYAJQAnACYAKgAtACkALQAuABwALgAdABwAEQAmABIAJwAqACkAEAAlACYAJAAqACcALAAuAC0AKgAsAC0ALgAeAB0AJQAkACcAEAAPACUAAAAeAC4ALAAAAC4AKwAsACoADQAkACUADwAOACUADgANACUAJAAjACoAIwArACoAAQAAACwAKwABACwAKwAfAAEADQAhACQAIQAjACQAAgAfACsADAAhAA0AIgACACsAIwAiACsAIQAgACMACwAhAAwAAwACACIACgAhAAsAIAAiACMACgAgACEACQAIACAACQAgAAoABAADACIAIAAFACIABQAEACIABgAFACAACAAHACAABwAGACAAAgA+EAIADAACAAAAAQACAAAAAQACAAAAAQACAAAAAQACAAAAAQACAAAAAQACAAAAAQACAAAAAQACAAAAAQACAAAAAQACAAAAAQABAAEAAQABAAEAAQABAAEAAQABAAIAAAABAAIAAAABAAIAAAABAAIAAAABAAIAAAABAAIAAAABAAIAAAABAAIAAAABAAIAAAABAAIAAAABAAIAAAABAAIAAAABAAIAAAABAAEAAAABAAAAAgAAAAEAAgAAAAEAAgAAAAEAAgAAAAEAAgAAAAEAAQABAAIAAAABAAIAAAABAAIAAAABAAIAAAABAAIAAAABAAIAAAABAAIAAAABAAEAAAACAAAAAQABAAAAIwAvADoRWA0cABIAEQAQABwAEQAbABwAEAAcABMAEgAPABsAEAALABYADAAWABcADAAXAA0ADAAcAB0AEwAKABYACwAXABgADQAZAA4ADQAYABkADQAOABoADwAaABsADwAZABoADgAdABQAEwAbAB0AHAAJABYACgAIABUACQAeAB0AGwAVABcAFgAJABUAFgAaAB4AGwAfAB4AGgAdAAAAFAAiABgAFwAVACIAFwAeAAAAHQAZACAAGgAgAB8AGgAhACAAGQAhABkAGAAiACEAGAABAAAAHgAIAAcAFQAHACIAFQAGACIABwAfAAEAHgACAAEAHwAhAAQAIAAgAAMAHwAFACEAIgAGAAUAIgADAAIAHwAEAAMAIAAFAAQAIQADAMYRGQAlADkAAgABAAIAAgABAAIAAgABAAIAAgABAAIAAgAAAAEAAgAAAAEAAgAAAAEAAQAAAAEAAAABAAAAAQAAAAIAAAACAAMAAAABAAIAAwAAAAEAAgADAAAAAQACAAMAAAABAAIAAgAAAAIAAQACAAEAAgABAAIAAQACAAEAAAACAAAAAgACAAAAAgADAAAAAQACAAMAAAABAAIAAwAAAAEAAgACAAAAAgABAAIAAgABAAIAAgABAAIAAgABAAIAAQABAAIAAAABAAIAAAABADEASwCMEqcOEwAvABQALwAuABQAFAAuAAAALgABAAAAFgAuAC8ALgAVAAEAEgAwABMAFwAvABMAMAAXABMAFgAVAC4AFwAWAC8AFQACAAEAFwAfABYAGAAXADAAEQAZABIAGAAwABIAGQAYABIAKQACABUAGAAfABcAKgAVABYAHwAqABYAKQADAAIAEAAaABEAGgAZABEAKgApABUAKgAtACkAGwAaABAADwAbABAAIAAfABgAGQAgABgAKwAtACoAJQAgABkAHgArACoALQADACkAHgAqAB8AIAAeAB8AHAAbAA8AGgAlABkAGwAmABoAJgAlABoADgAcAA8AIQAeACAAHAAoABsAKAAmABsAJQAhACAALQAEAAMAKwAsAC0ALAAEAC0ADgANABwADQAoABwAJgAkACUAJAAhACUAHgAsACsADAAoAA0AJwAkACYAIQAdAB4AHQAsAB4AIgAdACEAKAAnACYAJAAjACEACwAnACgALAAFAAQADAALACgAIwAiACEAJwAjACQABgAFAB0AHQAFACwACQAjACcACwAKACcACgAJACcAIgAHAB0ABwAGAB0AIwAIACIACAAHACIACQAIACMABQBQExMADQAOABAAFAABAAAAAgABAAAAAQABAAEAAQACAAEAAgAEAAEAAgADAAQABAABAAIAAwAEAAQAAQACAAMABAAEAAEAAgADAAQABAABAAIAAwAEAAQAAQACAAMABAAEAAEAAgADAAQAAwACAAMABAACAAIABAACAAIABAABAAQAAQAEAAIAAwAEAAMAAwAEAAAAAgADAAAAAQAAAAEAAQAEAAEAAgADAAAAAwACAAMAAAACAAMAAAADAAIAAwAEAAEABAABAAQAAQAEAAQAAQACAAMABAAEAAEAAgADAAQAAwABAAIAAAADAAIAAwAEAAQAAQACAAMABAAEAAEAAgADAAQABAABAAIAAwAEAAQAAQACAAMABAADAAIAAwAEAAMAAgADAAQABAABAAIAAwAEAAMAAgADAAQAAQABAAMAAQACAAAAAwACAAMABAAEAAEAAgADAAQAAQABAAEAAAADAAIAAwAAAAIAAwAAACoAOwDTFBUQDwAfABAAKQASABEAEAAfABEAHwApABEAKQAoABIAKAATABIAHgAfAA8ADgAeAA8AHwAgACkAIAAoACkAJwAUABMAHgAdAB8AHQAgAB8AKAAnABMAHQAXACAAIAAYACgAGAAZACgAGQAnACgADgANAB4ADQAdAB4AJwAVABQAFwAYACAAJwAWABUADQAMAB0ADAAXAB0AGQAmACcAJgAWACcAIQAZABgAFwAhABgAHAAhABcAIQAmABkAJgAAABYADAAcABcACwAcAAwAJQAAACYAIQAiACYAIgAlACYAHAAiACEACgAbAAsAJQABAAAACwAbABwAGwAiABwACgAaABsAGwAjACIAIwAkACIAIgAkACUAJAABACUAJAACAAEACQAaAAoAGgAjABsABgAFABoAGgAFACMAIwAEACQAAwACACQACAAaAAkACAAHABoABQAEACMABAADACQABwAGABoAAwB7FRIAGAAfAAMAAAABAAIAAwAAAAEAAgACAAAAAQACAAAAAQACAAAAAQABAAAAAgAAAAEAAgAAAAEAAgAAAAEAAgAAAAEAAwAAAAEAAgADAAAAAQACAAMAAAABAAIAAwAAAAEAAgACAAEAAgABAAIAAQACAAEAAgABAAIAAQACAAIAAQACAAIAAQACAAMAAAABAAIAAwAAAAEAAgACAAEAAgACAAEAAgACAAAAAQADAAAAAQACAAMAAAABAAIAAwAAAAEAAgACAAEAAgABAAIAAQACAAMAAAABAAIAAQABAAEAAAACAAAAAQADAAAAAQACAAMAAAABAAIAAQACAAEAAgABAAIAKgA4AHoWRRElAA4ADQAMAB4ADQAeACUADQALAB4ADAAlAA8ADgAKAB0ACwAdAB4ACwAlACYAEAAlABAADwAJAB0ACgAeACQAJQAmABEAEAAcAB0ACQAdAB8AHgAfACQAHgAkACYAJQAcAB8AHQAIABwACQAmABIAEQAHABsAHAAHABwACAAnABIAJgAkACcAJgAbACAAHwAfACMAJAAnABMAEgAbAB8AHAAgACMAHwAjACcAJAAGABsABwAjACgAJwAUABMAJwAoABQAJwAGABoAGwAaACAAGwAoABUAFAAhACMAIAAaACEAIAAFABoABgAhACIAIwApACgAIwAiACkAIwAWABUAKAAFAAQAGgAEACEAGgADACEABAApABYAKAApABcAFgABACIAIQACAAEAIQADAAIAIQABAAAAIgAiABkAKQAZABgAKQAYABcAKQAAABkAIgACACIXAwALAAIAAAABAAIAAAABAAIAAAABAAIAAAABAAIAAAABAAIAAAABAAIAAAABAAEAAQABAAEAAgAAAAEAAgAAAAEAAgAAAAEAAgAAAAEAAgAAAAEAAgAAAAEAAgAAAAEAAgAAAAEAAgAAAAEAAgAAAAEAAQAAAAIAAAABAAIAAAABAAIAAAABAAIAAAABAAIAAAABAAIAAAABAAIAAAABAAIAAAABAAIAAAABAAIAAAABAAIAAAABAAIAAAABAAIAAAABAAIAAAABAAIAAAABAAIAAAABAAIAAAABAAIAAAABAAIAAAABAAEAAAACAAAAAQACAAAAAQAeACcAEhg8Eg0AGAAOAA4AGQAPABkAEAAPAAwAGAANABgAGQAOABkAEQAQABkAGgARAAsAGAAMABoAEgARAAoAFgAYAAoAGAALABgAFQAZABUAGgAZABcAFQAYABYAFwAYABoAAAASABsAAQAAABsAAAAaABQAGwAaABQAGgAVABcAFAAVAAkAFgAKABQAHAAbAAgABwATABMAHAAUAAIAAQAbABMAFAAXAAgAEwAXAAgAFwAWAAkACAAWABwAAgAbAB0AHAATAAMAAgAcAAcABgATAAYAHQATAB0AAwAcAAYABQAdAAQAAwAdAAUABAAdAAIAihgXAB0AAgAAAAEAAgAAAAEAAQABAAEAAQABAAEAAQABAAEAAQACAAAAAQACAAAAAQACAAAAAQACAAAAAQABAAAAAQAAAAEAAAACAAAAAQACAAAAAQACAAAAAQACAAAAAQACAAAAAQACAAAAAQACAAAAAQABAAAAAgAAAAEAAgAAAAEAAQAAAAIAAAABAAIAAAABAAIAAAABAAEAAQABAAEAQABZABoZnRMwABMAEgAQAC0AEQAwABIAEQAtADAAEQAwABQAEwAPAC0AEAAyADMAMAAOAC0ADwAzABYAFQAzABUAFAAwADMAFAAtAC8AMAAzABcAFgAzABgAFwAsAC8ALQAvADIAMAAOAA0ALQANACwALQAuADIALwAZABgAMwAyABkAMwAuADEAMgAsACsALwArAC4ALwANAAwALAAMACsALAAaABkAMgAxABoAMgALACsADAAmADEALgArACYALgAbABoAMQAmACcAMQAlACYAKwAnABsAMQALACUAKwAKACUACwApACcAJgAlACkAJgAoACkAJQAqABsAJwApACoAJwAKAAkAJQAJACgAJQAqABwAGwAIACgACQA8ACoAKQA7ADwAKQAIADQAKAA7ACkAKAA0ADsAKAAqADwAHAA8AB0AHAAHADQACAA8AD0AHQA9AB4AHQA6ADsANAA1ADQABwA7AD0APAA6AD0AOwA1ADoANAAGADUABwA9AD4AHgA+AB8AHgA2ADUABgA5AD4AOgA6AD4APQA1ADkAOgA+ACAAHwAFADYABgA/ACAAPgA2ADkANQA4AD8AOQA4ADkANgAFADcANgA5AD8APgAEADcABQA3ADgANgAiACEAPwA/ACEAIAAkACMAOAAAADgANwACADcABAADAAIABAA4ACMAPwAjACIAPwABAAAANwACAAEANwAAACQAOAAJABoaRAAzAEUAQAAwADEAIAAyAEEAAgAAAAIAAgAAAAIAAQAAAAEAAAACAAQAAAACAAQAAAADAAQAAAADAAUABgAEAAEAAwAFAAQABgAEAAAABwAFAAYABAAAAAcAAwAFAAYABAAAAAcAAwAFAAYABAAAAAcAAwAFAAYABAAAAAcAAwAEAAYAAAAHAAMAAwAGAAcAAwACAAYAAwABAAMAAgADAAgAAgADAAgAAgADAAgAAgADAAgAAgADAAgAAQAIAAEACAACAAUACAACAAUACAAEAAYAAQAFAAgAAwAGAAEABQAEAAYABAABAAUABAAGAAEAAgAFAAQABgABAAIABQACAAEAAgACAAEAAgACAAEAAgABAAIAAgAAAAIAAgAAAAIABQAGAAQAAAAHAAMAAQAHAAEABQAFAAYABAAAAAEABwAFAAYABAAAAAEABQAEAAYABAABAAUABQAGAAQAAAAHAAMABAAGAAAABwADAAMABgAHAAMAAwAHAAMABQAEAAcAAwAFAAgABAAHAAMABQAIAAEABQABAAUAAQAIAAQABgAEAAAABwABAAQAAQAAAAEAAAACAAAAAgAEAAQAAAABAAIAAwAEAAEAAgABAAQAAwAGAAEABQABAAEAAgABAAIAAQACAC0AQAAVHFUVEAAlABEAJQAmABEAJgASABEADwAlABAAHAATABIAJgAcABIADgAkAA8AJAAlAA8AHgAVABQAHQAeABQAHQAUABMAHAAdABMAHgAfABUAHwAWABUADQAkAA4AJQAbACYAJgAbABwAHAAbAB0AGwAhAB0AHQAhAB4AIQAfAB4AHwAgABYAKQAbACUAIwAkAA0AIAAXABYAJAApACUAIQAgAB8AKAApACQADAAjAA0AIQAiACAAIgAXACAAIwAoACQAIgAAABcAGgAhABsAKQAaABsAGgAiACEAGgAZACIAAQAAACIAJwAoACMACwAnACMADAALACMAKQAsABoALAAZABoAGAABACIAGQAYACIAKAArACkAKwAsACkAKgArACgAGAACAAEACgAnAAsALAAYABkAJwAqACgAAwACABgALAADABgABAADACwACAAqACcAKwAFACwABQAEACwACQAIACcACgAJACcAKgAGACsABgAFACsACAAHACoABwAGACoAAgDJHB4AKwACAAAAAQACAAAAAQACAAAAAQABAAAAAQAAAAEAAAABAAAAAQAAAAEAAAABAAAAAQAAAAEAAAACAAAAAQACAAAAAQACAAAAAQACAAAAAQACAAAAAQACAAAAAQACAAAAAQACAAAAAQACAAAAAQABAAEAAQABAAEAAQABAAAAAgAAAAEAAgAAAAEAAgAAAAEAAgAAAAEAAgAAAAEAAQABAAEAAQABAAEAAgAAAAEAAgAAAAEAAgAAAAEAAgAAAAEAAgAAAAEAAgAAAAEAAQAAAAEAAAACAAAAAQABAAAAAQAAAAEAAAAhACwAmB1TFhMAGgAAABoAAQAAABIAGgATABIAGQAaABoAGwABABsAAgABABkAGwAaABEAGQASABsAAwACABkAHAAbABgAGQARABAAGAARABwAAwAbABgAHQAZAB0AHAAZABwABAADAA8AFwAQABcAGAAQAA4AFgAPABYAFwAPABcAHgAYAB4AHQAYAA0AFQAOABUAFgAOAB0ABAAcAB0ABQAEABYAHwAXAB8AHgAXAAwAFQANACAAHwAWABUAFAAWABQAIAAWAB4ABgAdAAYABQAdAAwAFAAVAAcABgAeAAsAFAAMAAgABwAfAB8ABwAeAAoAIAAUAAsACgAUACAACQAfAAkACAAfAAoACQAgAAMAHB44ACYAGgABAAAAAQAAAAEAAAACAAEAAAACAAEAAAADAAIAAQAAAAMAAgABAAAAAwACAAEAAAACAAIAAQACAAIAAQACAAIAAQABAAIAAQACAAEAAgACAAIAAQADAAIAAQAAAAMAAgABAAAAAwACAAEAAAACAAEAAAACAAEAAAACAAIAAQABAAIAAgACAAEAAwACAAEAAAADAAIAAQAAAAIAAQAAAAEAAAACAAEAAAACAAEAAAADAAIAAQAAAAIAAgABAAIAAgABAAIAAgABADMARwDlHpUXDAAnAA0AJgAPAA4ADQAnAA4AJwAmAA4ACgAnAAsACwAnAAwAJgAlABAAJgAQAA8ACgAJACcAJQAdABAAHQARABAACAAmACcACQAIACcAKwATABIAEQArABIACAAlACYAHQArABEAKwAUABMABwAlAAgAJAAdACUAKgAuACsAHQAqACsAKwAuABQALgAVABQAJAAeAB0ABgAkAAcALQAuACoAHgAqAB0ABwAkACUALgAWABUAJAAjAB4AHgAfACoAHwApACoAKQAtACoAKQAsAC0ABgAFACQAIwAfAB4AFwAWAC4ALQAXAC4ABQAjACQAIwAiAB8AIAAXAC0ALAAgAC0AIgAoACkABQAEACMAIgApAB8AIQAgACwAKAAsACkABAAiACMAIAAYABcAKAAhACwAIAAyABgAMgAZABgABAADACIAIQAyACAAKAAvACEALwAwACEAMQAyACEAMgAaABkAAgAoACIAAwACACIAMAAxACEAAgAvACgAGwAaADIAMQAbADIAAgABAC8AAQAwAC8AMAAcADEAHAAbADEAAQAAADAAAAAcADAACQCxHyIASAA3AEYAVQBWAEcAVwA1AAIAAAABAAIAAAABAAEAAAADAAAAAgABAAMAAAACAAEAAgAAAAIAAwAAAAIAAwACAAIAAwADAAIAAwAEAAIAAwAEAAMAAwAEAAUAAQAEAAIABAAFAAIABAAFAAMAAwAEAAUAAgAEAAUAAwAGAAUABwADAAYABQAHAAMABgAFAAcAAgAGAAcAAgABAAcAAgABAAcAAgABAAcAAgABAAcAAgABAAcAAgABAAcAAQABAAIAAAABAAIAAAABAAMABgAFAAcAAQAGAAIAAAAIAAIAAQAHAAEAAQABAAAABAAAAAIACAAGAAIAAgAGAAQAAgADAAYABQACAAMABQABAAQAAgAAAAgABAAIAAYAAQAHAAMACAAGAAcABAAIAAYABQAHAAEAAQACAAEABwACAAEABwABAAAAAgAAAAEAAgAAAAEAAgABAAcAJQAxAAEh2hgTACQAFAAUACQAFQAkAAAAFQAAABYAFQASACIAEwARACAAEgAiACQAEwAgACIAEgABAAAAJAAQAB4AEQAeACAAEQAgACEAIgAPABwAEAAcAB4AEAAiACMAJAAjAAEAJAAhACMAIgAOABoADwAeAB8AIAAfACEAIAACAAEAIwAcAB0AHgAaABwADwANABgADgAhAAQAIwADAAIAIwAdAB8AHgAfAAUAIQAYABoADgAEAAMAIwAaABsAHAAbAB0AHAAdAAYAHwAFAAQAIQAMABgADQAGAAUAHwAMABcAGAAbAAcAHQAYABkAGgAZABsAGgAZAAgAGwAXABkAGAAHAAYAHQAXAAkAGQAIAAcAGwAKABcADAALAAoADAAJAAgAGQAKAAkAFwADAJUhUgAvAEIAAQAAAAEAAAABAAAAAQAAAAMAAQACAAAAAwABAAIAAAADAAEAAgAAAAIAAQACAAIAAQACAAEAAQABAAEAAQABAAEAAQABAAEAAQABAAIAAQACAAMAAQACAAAAAgACAAAAAgACAAAAAgACAAAAAQAAAAEAAAABAAAAAQABAAEAAQABAAEAAQABAAIAAQACAAIAAQACAAIAAQACAAEAAgACAAIAAAACAAIAAAABAAAAAQAAAAEAAAABAAAAEQBkAGQAZAAAAAAAAAAAAGQAZABkAGQAAAAAAAAAAAAUAGQAZABkAAAAAAAAAAAAUwBkAGQAZAAAAAAAAAAAAAcAZABkAGQAAAAAAAAAAAAMAGQAZABkAAAAAAAAAAAABQBkAGQAZAAAAAAAAAAAAAAAZABkAGQAAAAAAAAAAAAzAGQAZABkAAAAAAAAAAAALgBkAGQAZAAAAAAAAAAAAAEAZABkAGQAAAAAAAAAAAA9CqnCPQrfwKRwjMLXo4jAexRcwuxROL49Ch7C7FEYQDMzu8FmZnZA16NAwQAAuEDNzEw9mpkFQY/CIUHhemBBXI+KQWZm0kHXo5pBSOEiQhSuiUFI4WFChespQVI4jkKPwnW+FK6mQhSuH8HXI7FCzcy0wSncr0JxPRHCClegQgAAQ8IKV45C16N5wmZmcUJcj5DC7FFDQkhhpMIfhQ9CcT20wqRwp0Ep3L7CrkcFQR+FxcLD9cjAhWvBwlyPHsGuR/HAH4WJQj0KrcHNzHhCpHAbws3MSEIzM1PCZmYhQlK4gMLNzO5BmpmUwilcm0HsUabCCtfzQOxRfsIzMx9BPQo8wj0KjUEK19vB16O8QYXrOcH2KOBBpHDFQPYo+EG4HgW/7FFHQs3MgMHXozFChesMwrgeFULXo03CpHDTQVj/pz0gY84+MPUzPjnutD6gGo8+PX6fPkGCwj4dA4I+Mev1PiKrOz4Dzw0/KcsQPoVfIj/HLtE97YE2P8cu0T367Us/HlA2Pt5ZWz/qIZo+y6FlP9eG6j7GM2g/GM8gP+w0Yj9sW0w/V+xXP/rQZT8JOEQ/lzl1P3nMKD+XOXU/HT0OP/iIcD8kf+A+MCppP0vNrj5VGFs/7BJ1PkOtST86rxE+aeMwPyGTjD0EHBo/AAAAAP/s9z4AAAAAmiXhPv2kSj+SkTM/h6cvP3DrNj8IPQs/HY8xPy1b2z5/3iw/dTymPkF9Iz9mg2w+jxkYPwtBDj7mBQg/e4iGPu2B5j5v8MU+GHjePp+rBT9LWcY++YMhP0/psD5qEz8/RGmPPuwSRT+Amvo+ecwoP7xXBT+fqwU/RQ0OPzemxz5bCAo/ArduPGGKI0Ly8lJBfER8P1jnpUFHiwpBk1dnPDeeTUIfso9BnUvBPofB2UGpf5FBLLwbP4NNDEGWfodBgUMoPLSQYkIhc+ZBoOCCPnNkEEL8Ea1Bf/sqP9caQUFuqLNBYYmHPfxJmsDJBsdBTRAVPrktJEKfKfZBPwApPz8BqkGwYdZB2uZGPoscJMDImeFBUHABP3t3yUH9zAdCQj74Pl20zEDF0gRC1c8bPAE9icHnvgxC1VtDP0cLXEGSdQ1CDY5yPm+rj8BK3RNCRKNrP1gltj/7QxFCoOCiPTXRgsFu1yFCEtp6PyNpHcEC8wZCyZOkPFU638GwHSFCAACAP+/0ocFEPMBBWP9/Pyk70sFbeCxBWP9/P3Td5cH/gJ3AWP9/P+aw1MFFqabB2Ed/P75HncENmQ7CppvEOoq/T8JlZczBOBWpOkyAm8Lx3anB07x7P18DPcG+vy3Cnu8nPB+GN8K1MQvCUg/RO+UfkMJHtPXB5uhxPxur7j6jrDnC0egOPXD1CcI2EiHCs9KkPPyTc8JIgBLCrMUnN/WWtMI0bV/BM9xQPwUZfUGliivCIGPuPaPnlcHYAyDCTKaKPTOUNMJe6xPCrMUnN61HlsJQIpLBgPEMP4d08kEONRfCcF+HPhWbYMCVLBjCQ3M9PpvO7sHieQ7CrMUnNxn7b8L0WqbBSrVPPqvuOUK2kfrBhGSxPgKSWkFTRQzC1JrmPik8ScFCRwXC98ySOfbKKsJhSrfBF4IcPRTnbEIbuLjBPGZAPniw3kE/U+3Bd9Y+P01V5j9t0+PBCOboPH+H3MGbt67BcJQ8PMjrKkJ4NrjB4WI9P7OKh0GzbrPBl6h+Plw3NsFQVZ7BPUm6PUdG+0GiXlrBMbZoP0FFmkBS327BAACAP5QjjEGVqx3BWP9/P5gF8kHFovq/WP9/P1Ep+0FvRgNApN9+PzEmCMH5Bb7BHhsBO+05GsKp2YHBF/EdO3gHgMKTKUfBPL1yP8Cy20B106vBD9b/PJBbuMGfn4nBeVioPB02QsLgcGDB6X3zPldm1kFgIm7BB7HTPiUvC8A7WW7B/z7jPR3e3ME9rkjBpaDbPHvfK0LImBbBf97UPo9xbEFSgk7B3ZgOP3d0KcG9gzPB6njMOTvhDMJWTwHABwh+PwXilkC06gHBgqj7O3UCncFHjTfA3jxVPwTAlEGPBIjA6gkrPrQOp8BxKyfAAACAP7VqFkHM/R+/JnBrPHEaG0IFUApBMGRtP47BY0Fd9xVB+8tuPXp4wMA1tzpB2uEvPU6PL0JqQGBBEw9AP+pmpEERFR1Bn8hTPo2Qe8CLKzRBUpsYPyLLu0GRAV5BDMjOPv4pDT/6zF5BxRt5P0w14EB2MWJBXHLcPDkIeMG31oxBjpJ/P55qLsGJoYJBW5TZOgpAAsKFxrtBWP9/Pz2KHcFg4WbAwXN/P9s61EAQZzbAs+8KO0zGMMLGt4JAAACAPy27Tz+GD+i/AACAP/+soUEwWni8hesAQo/CS0JxPTNCKVwxQlyPWkIUrhFCUrhyQgAA0EFSOINCH4VbQTMzh0I9Clc+heuDQj0KZ8EUrnVCmpnlwT0KVUIzMyLCCtchQhSuTMLNzOBBuB5jwrgeWUFSuHHCAACIwEjha8J7FJrBuB5cwgrX/8HNzDrCcT0hwmZmFMK4HkTC7FG6wXsUU8IpXA/BSOFSwrgedUAAAEvCMzOJQexRMcJSuOpBj8IMwgAAIUJcj7bBj8JDQgrXK8HNzFlC16MwQFK4YUJ7FJJB7FFeQsP1REH2KGDCSOHKQUjhTcJ7FBFC16M1wh+FOkJI4RPCPQpYQnsUxsGuR2ZCmplZwZqZbELhehS/uB5lQlyPQkFcj1JC7FHEQTMzOkJmZgNC16MeQhSuG0LheupBj8I0QjMzj0EAAE1Cj8L1P6RwhcAfhQPBmpn/wY/C/cFxPSJBpHAxQbge/UEAACpCzcw0wfYo0MEK14XB7FGkQWZmAcKamQ1CpHBhQaRwZcH2KPBBzxT6PjHOTz8o1c4+pN9OP8R8qT7ghEo/jliLPn2RQD89uFs+2IEzP8/aLT5KByM/1QQRPpHQDj/vOAU+/rfyPuyjEz7zq8k+Q+I+PuYinj71nHQ+ZkmAPt6wnT4010k+eczQPt/DJT6tUf8+npgVPjWYFj+rCSI+v0goPyrjPz7MQD0/7+FyPiKrSz9iZ5o+odtTP7X9uz6UwVk/PE7hPuvFWD/jjQQ/2zNTP6d0GD9/vEc/N2wrP7ahOj+rCTo/Z0QpP0LsRD9ZURM/L1FNP63dpj5Iv10+eLmIPgrcij4M5WQ+8BaoPlqBQT506so+i1Q4Pn/28z5agUE+wcUKP7JoWj7Ezhw/hNOCPmxbLD8vqJ8+Xro5P00tuz5y4UA/pgrWPk6cRD+UvPo+EHpGPyUGET+daEc/lkMDP3UC6j7nqf4+xM6UPpn1Oj/xRuY+SL8NP3WOKT/fT40+440EP667IT9v2KY+obmuPrADtz4Gu8E+1XghPyDSLz9n1Rc/pHBRQtcjosJcjypCPQqgwlK4DkJmZqvCuB4IQilcx8JxPeJBUjjkwvYo0kEpHAHDj8LvQTMzFcMAABxCzcwfw8P1YkJIYSLDpPCEQq4HGsMzM3BCAMANw9cjiEJ7lA3DrkegQq4HCcOPwrJCw/X/woXrv0IzM+bCheu/QgpXw8K4Hq5CZuaywmZmlUJ7lLjC16NzQmbmssJI4U1CXA8Gw9ejMkIpXPjCZmYrQgAA4MIUrlJCpLAXw5qZK0Jczw/DexQOQh9FAMNI4QpCrkfqwpqZQ0JmZtnCH4VUQrge78IfhYBCuJ7+wlK4lUIpXP7C16OnQlK45cJxPYlCj8LjwuxRWULD9czCSOE8QgrXxcKF6zNCFK61wuxRckKk8MLCcT2RQvaozMLNzKhCzczNwpet5T4U6FM/vJawPrK6VT+gVIs+elNJP4fhgz6YaSs/pidMPuBnDD9Ahzk+UpvYPtY5Zj7/PoM+bmmlPtF5LT55IwM/6IIaPqA3HT+reGM+2A0LP+OIpT4s8SA/cv6mPoeKQT83bLs+gjlaPzXS4j68dGs/pyINPy+Gaj9PWDI/NNdRP0F9Qz/0TzA/Quw8PzmXCj9rZUI/JJzmPhqjxT57a8A+xTjvPi0+tT5RgxE/yv3uPlX7dD5i+Lg+AFKbPtQOjz78+9w+hXeJPvAzBj+I19U+GM8YPz0P7j5G0wE/h8QVP1SM4z6tozI/4gHlPhtkSj+nIg0/LPEgPzWYDj/+t/I+J04mP8iYyz7tmS0/sI++Poe/Pj/zHwo/0T8xP5QwKz+lZic/qFJLP96rJj8AAIA/Ph5QQmoMJUIAAIA/QXJEQhBz/0EAAIA/fVNVQv0AwEEAAIA/GXOFQgVVnUEAAIA/u4afQlKSM0EAAIA/lCy8QtLQykApXA8+uAblQnUXwkCskPI+ZNdrQV+RAMJRvcU+f74VQVvPBcKsxac37AhDwQfUicKHbYs+2MrdQcixFMJORTo/RfabQR49v8GsxSc4aE5kP3dfk8I34PM8jzoyQlsR+MEHX3g/u36pQcbcwcCsxSc3uMqMQRFghsIAAIA/48lFQS2OT0B8uGQ8/KMWQrKSNMF2bHw/+7bVPv4GcsBSSR06/YkyQulV6sAaFw4/o+ubQXCZI0BfmNw+NzQcvg0Jh0A421w8eqSJQWkFLsInwkY/yKG0QelHcUH2fw4+apKpwORhgEGj6aw95bfLQaBjBsKE8DA/DtqiQSCS3kFfJLQ9RMhswQ6ZxkEgKWI+/lnoQYFZqcEEIdk+zYhXQZgpIkL0Gjs96+3fwfIH9kHYuwc/BF7jQZf/1sAK3Lo8mVNkv5GpSULKVEE7Dpk1wtMS70EjZ3k/5aOeQVcnB0EAAIA/GY4AQSpnM0EZc3c+IDCHQQdNIkCSIkI/0vOov3eTKUB7FC4+f6R3QiEWQEInMQg+f42SQYXMh0DwbTI/5gFHQDgvrEDuWsI+O6XTQYCaCcHcuus+Z994QMyW28COzCM+i7fawE7BS8FE3Xc/5EV8QSBfScBv2LY7gsYBwWMK3MBpjNY8CeeCwcY7oMFcj0I+8AuhQpVnz0E8pSM/5SIGQbCo1kCU+x0+HAWKwBBpW8F1q2c8g1Vvwa9NicGZuxY7FouaweeV8cGieqs9W5MPQoRQvMFljWo/i2krQRyBKsGCqPs3+J4MQbiRb8K30fA+82q8QeAEqsGTqYI8giniQGGVm8GRfgM/9SdVQNZ1psGCqPs3uiNmwMtnZ8IzM7M+lR6+QiQzeUGWzxo/ZbwaQf9xMcHgLZA6EbQewfHMhcElzDQ9UCY9wT6h58Fcj0I+/finQsqdh0Hmlk4/3TZrQFXz1r+mm0Q7RC+3wfJ28sFcj0I+LeycQl0BAkIrwfI+fjBCQQjOR0HnOo07yLeTwe1orEBtkJk+EX8UQD+EPcGP39s8/4MOwTfXXcGpTZw7meJ6wXfCwsH430o/dyyoQcQ+nkArweI9OdHjwBMgLkCtTPg8mbyAQN/+usF5XT8948qVwOjPxcHItaE8ZbXUwLqs/cE5tHA/+VKyQDYL8EDA7B48Sm9jwSVHmL4kC5g5rFNSQUqkBcJ8m34850fOQO7rAcJNFQw9X2vbQA/eA8K8lkg/94g3QUp6gkH2tMM9efltwb+GJEGgVPs73l6IQZlqAcJn1ec9ZiCAQagI3cGc3O86zyQ3Qm9gvUEJUAs/kaXMQBhi9UEna1Q9RwDdwanvlEGX4io8wBXQQT9MoMH4iMg+wuqNQRPlR8FRMU49p5X/QeJ0ikGXVgM/mYdBwIqflUGbOLk8k8PewWvFWEAkC5g6gh2jQWlSqsFxWhA+tfksQVdqmMGdLos+7/6AQFcPmcFcj0I+MNSSQuskHEKdnYw9OE1fQQ9VpEHjiDU8TRykwfYtVkEpeSU/igAQQeu738B5r5o9UGdewLiz9MCrJgg8pFdgwYwNgsEpXI8+GxWJQgEDA0L68oI9AUjAQJ1XokHaAy06483bwXi1GEE9fic/mzQ3QArb97+cUAg5TFcpweCzgsCZR346FLOvwbdOhcEAAIA/V7hwQgGAAEJcj0I+eG2LQoCPOEJh/Z88nZSIQYtd30EZkD08YM+owZz/qkEhk0Q/UrUxQFjnKMBJYzQ8fdcwwSYSDcHVlc88cc3vQXP16kHtu+I9SmckwWFX5EHWbjs7olIewt3I2UAkl78+OAptQTYb8MAGR/k+H83oPyKQ48Dv5ik9dWtIwAW1F0IE54w7kGUewt3LlEF0RnQ/XJdFQUqN5r8fhVNCzczGwuxRT0JxvdLChetZQuxR3cK4HnpCH4XjwjOzhkJ7lOjC9qiSQo9C7MLDdaBCM7PvwmZmrELXo+3CUji0Qs1M5sIAALRCcT3bwq7HrUIzs83CuB6kQqRwv8KaGZlCUriwwlwPjkJcD6fCMzOBQoXrqMJ7FG9CUjiuwvYoXULNTLjCAACgQuzR4sLD9aVCw/XYwuzRkEJxPdvCrseZQgrXy8J7FHVCZubTwilcfULXo8LCPYqLQjOztsIyA3U+68UgPzANYz4+eQg/jXqIPl705T61VM4+JLnMPpI/+D5KKbg+3BEWP/w1qT6jATQ/PDGbPl70TT9wmaM+cOteP1qBwT6la14/4V3uPnzyUD8rwRI/tf07P+C5Lz8oCiQ/y6FNP0QXDD/IQWE/BkzgPvWEXT94YrY+wcVSP2B2jz7nNT4/tAIzPxqGzz5q+z8/8rX3PicUEj/hXe4+i4klP/59Fj+GWsM+5iIGP9dR1T7HLik/LJoGP3R7QT8AAIA/BLvbv2hLGcEAAIA/IFOfPzXrbcHwM34/PJDUQEhXisEktOU7ucIwwazMjsFGlFY/nG1tQQCracFHrCU++dI3wHCOccHH9Aw/mmKhQQ5EWMEjFeY+xfwcQAp8X8HuPTw+YsHPQUWTMsHd71A/PbADQRcROcHnHSc8PJwBQvwWAsHhYn0/HjxqQTzGB8EAAIA/qp6UQTtzeMAAAIA/ZfSZQcAtuD8AAIA/cxJ6QX0CtEBSLLc7ToHWQUwDFEEAkX4/WJ8OQQ2eDUF075E+34CUQXyHO0GeBzc/EQElP4UYNEG4O0s/YT8aQWMEX0GADlM+h7gEwR52VkFOtHM/69YTQAcLY0GfsEQ9Wgl6weiQWUGGOH4/GlcFwNZ2FkHxaOM7K92fwftvDEEAAIA/2sqEwOyAiUAAAIA/JeGNwDouHMDi6ZU8ETjhQUNbUsAJUHs/B6AlQZw9a8AAAIA/yPgXQetfAUCtbqU+qAGfQe/KpMACSC0/t8AFQCVQs8D+t5I9qtKTQcZ9aUBYqG0/cHUfPwu7S0BkBno/LswOQQ6bFcGOHr88cj4NwWs9HsEAAIA/BkyiQEqFrb/de3A/2ejIQJm56kC1N3g9oq45wWjG2EAK13NBCtejwQrXg0GuR3HB4XqeQZqZGUDXo6xBj8JRQTMzs0F7FLxBPQq9QR+FCkLsUcBBPQoyQmZmxEEAAFpCcT3AQa5He0KPwotBexR8QvYoFEE9CndC16MgQDMzbEIzM7PArkdkQgAAWMGF61ZCw/VIwdejOkJxPQ7BSOGiQR+Fu8CkcBVBH4VrwKRwPb+F67G/KVwPwXsUjj+4HoHBFK6/QD0Ko8EzMx9BrkfBwQAAJME9CvFBXI82waRwG0JmZpBB16PYwIXroUC4HmnBexQuQXsUbsGF61FASOG6wHE9IkHNzJzAZmYWQHE9OkBxPSJBcT06QJqZmT8K109B9igsQa5HXUEfhes+rke1QT0KJ0H2KMBBAACAv65HAUIfhSNBMzMEQvYoDEFcjyxCrkeBvz0KKkJxPaq/cT1JQvYoFEGamVFCxJQgP6VJKT3a/iU/kBTRPRVvND8yyZg+Mxs8PwVp1j5Btz8/ZB4JP1chRT9cICk/X+9GP4KLRT9mMUk/V0NiP1/vRj+lMXo/QYIqP//Kej+22wY/LzR3P4AO0z4zbW8/aamMPqW9aT9kIxA+QStgP/5gID7D00s/R49fPrMkAD8K9Ik+097APgTnnD7Q1YY+/cGwPhwlLz6la8Y+4Si5PfXW8D57FC49FZEJPwAAAADwFkg+LUMcP/c7ND4wZDU/oMMsPyBGSD7Ytug+pg/dPXugDT9l39U9nl7ZPkIJUz7Edwo/A89dPtE/0T6oxps+xHcKP6jGmz5UUsc+q8/VPiMtDT8xmdo+5wDBPqG5Bj900gs/H50KPwtetD5uiyI/xOsKP4OjJD9WmgQ/BahBPwtetD6c3D8//KmxPjBMVj+22wY/w0dcPwAAgD9sJbHAoHeawAAAgD/9wbS+HiXZwHwnHj9MIYRB2SxHwbivwz5U25PAh9FYwZuP6z3oG9dBC2d6wY1FUz9dhLxA7RWCwQRzdD2VT5TBVFeFwVIPUTtAVBRCDPOOwUJgHT+ObIFB/viPwQ+cwz70nALBiwiOwbIRKD6cKtlBw6Khwez6VT9O+TpA/iaawR6naDy+zRNCUuOrwbxcfD9mmkxBfHWfwQAAgD8wF7ZBfZalwQAAgD9CvPhBAiOjwQAAgD9irvtBHm5dwQAAgD8aSvNBQjGzwAAAgD99AN9BQtibPwAAgD/h1NBBtgIWQQAAgD/fvbdBtt6KQaGEGTzQTilCPH5sQUaZfT/IA35Brs2EQZKuaT9s43xBsTBXQS+Gsj0wJyjBjrNZQd21hDyE59ZB88JAQQLZez+Y8pFAWHs2QTnR/j6cpYRBnwE0QbyWAD/wg7XAt/0hQQYNdT8cBwJB3XshQRwlLz1MAGHBAx4JQQAAgD/1tiw/7WEJQQAAgD8Q9YXA4mGKQAAAgD8seAfBIG9pP2uCAD+KQs1B9AxfQYz4/j6ZODW/qnFrQaUU9D3K0glCrTFlQcR8YT+pyABBH2p6QZkNej+IY/VACXAXwd83vjz3lVnBc80vwQAAgD/dHdk/uruOQAAAgD9aKxo/g9Khv671fT80YylB1mahQKlqAjwz4TXBoxxpQAAAgD9BcylBjq3wv71vvD6SDptBiAiZQHrHIT8XcyTA/OhyQFbxFj+moZJBc+o7wAQc0j5EglDAEbN9wAAAgD9RU/JAAJuBQDyInTzOhOhB5dugwDi+dj+yEPJAQ36xwNeGijwIVYzBXNS7wNrmfj9yKYpBfbF7QD4/jDv6MwfBxWmGQBKlTT+R8Y1BJxzEwBppST7gF+vASvW5wNjwdD75K9hB5RCRQCLDQj8qPp8/BzCtQP6arD16DtZBQKLWwPhraj8Qz9c/XVW6wAAAgD9V9jxBeemTwIKo+zqhsBRC2CJpQISBfz9S5TZBaySlQAAAgD+d5JlBxPmoQAAAgD8ib6hBL4KrwD0KycF7FELC9ij8wRSuU8LsUR3Cj8JkwnE9NsKPwnnCFK5Kws3MisKPwlfCM7OawgAAWsKux6fCuB5Owj2KssLhejzCzcy2whSuTsI9Cr3CUrhjwhSuxsKkcHrC7FHUwgAAhsIfheLCH4WOwj2K9cKux5TC1yMDwxQumMLhOgzDFC6WwhQuFMN7FI3C7JEawylcfsL2aB3DmplawgrXHMPD9TfCrkcaw6RwFsJ7lBbDzczgwQpXEcNmZprB7NEKw65HZcE9SgTDcT2awOxR68I9CkfA4frbwvYorMCF687ChesFwXuUv8JSuD7BhWurwmZmbsH2qJrCXI+Kwbiei8L2KJDBUrh5ws3MhMFmZlHCheuVwc3MN8KPwhXBpPD4wuxRJsI9irLC16MLwgAArMLXo/jBw3WnwgrXhMIz8wvDhettwq4HFMOamW/CXA/8wtejUsJ71AXDCtc2wq7HDcPNzBDCUvgGwzMzKcKaGfjCrkdHwsP138KuRxnC7NHLwgrX8cGk8OHCAACowRSu9sJ7FErBSGHhwgrXncHXo87C4XrewYXrt8IAALjB9qiewjMzJcI9CqTCCtcyws1MlcJI4QTC4fqYwoXrEcIK14TCZmbMwexRj8IpXMvBw/Vuwq7TKD9Dc2U/vtkWP0DZXD9y4QA/BYZUP3yb3j5fQUo/3NfBPsGoPD+vd68+ER4tP8xFrD5xWiA/Bg29PgPPFT/60NU+ZaURP45AvD5digs/dbCePlwbAj/idX0+DJPpPvrtSz7y0s0+BP8bPn+kqD46r/E9IeWHPlBTyz1VwUg+yLXhPTGZCj69+yM+nUuxPUVHcj4M5YQ9U3mrPnXIjT0RNtw+Ub21PUesBT/Bc+89EXAgP3nMID6tNDk/+dpTPpgvRz+8dIM+YvNhP+2evD7gvmY/kpbaPnFaYD/SHfQ+0/ZXP2MLCT9E+k0/Cr8cP6eWRT8RHi0/+8s+PxzTOz/NzDw/X0FKPynLQD8G9V0/n806P95xaj8sK1U/QPuhPgX69D4DzxU/bEMNP9MwHD90DBg/4KEgP8JRUj4v+ko+pU6QPk60Cz466Y0+j9+bPvCntj63tHo+A8/dPvSJPD6kqgk/TtFxPqn78D48paM+saLGPjXS0j4ZrQM/gjn6Pt5xGj9f784+L2k0P6Vrpj4W+0s/zAvQPlABOD+wrPQ+ijwhP6CJED850S4/4jspP/eS9j7Y9SM/UWbjPhtkMj9BDhI/tMguPyveCD9bfEI/+aAnP7U3OD81Byg/aodPPwAAQD8ki6FAN3DjwQAAgD4ZqcfAeDudwXE9Cj/4+AFB/jUOwsLd6T4Oi6A/SyiNwaMGUzuJTn/B6Vlzwf5DWj+RriBBs9yBwcjqFj4vI+LAV316wfWE5T6tW41BweZVwd48DT8UN30/XwpnwZ30Pj28gcZB+EwIwQ4QdD98wg9BO+YywQAAgD9m435Ba7fDwB7EzjyiIKlBY6wEwmtlwjyGqxfBLxUBwgx2cz9woZ5BSM9Vv0ymCj6+96lB8TDYwYe/5j155ALB5RzSwdR9QD//5KBBYLepQG5ujD7X3ZNBINe3wcZtdD4bqSHBdxSuweqyGDu2m+ZBuGxWQVsl+D5ivYtBLtAWQdmZgj7V3L9BClW0wYCCAz9K+JPAEDOzwbG/bD6r0bdBDEcbQXLhID4Yj/dBj9ynwSsYPT/zhiBA7s2xwZxQiDnNmL/BgYqAwb3j1D1v2u9BPPswQV+1Mj3fER1CEzGPwbraYj82WTRBpo+mwebo8TzBlHPBMYeNwZaVJj1xjxlCXnFeQazFpzurcTpCbeBewYkHTD90+plBgtiSwWFPOz4dStzAnmqQwdjwdDzUYTdCdEKNQY/CxT5ErOVBANZfwdOkHD+8rF9AE/qIwZzc7zqszVlCDEa8Qe6xtD2vRxJCDtcbwRppaT/IO0VBUTZ8wazFJztyTi9CqD6AwJNXfz++tahBB+FMwQAAgD+vStxBOMQAwQAAgD+hG/dBjKx0vwAAgD+Cw+9BY93PQAAAgD/F1shBLUdgQTuqGjpMUUNC0GoAQsai6TsxC/NBd+/SQWgFfj9ZHpVBH5SiQfFL/TxW4R5Co0gEQloSoD0GEa1BTbPoQQYSZD8tEjVBiZvOQVuZUD7o6OZBlw8FQkFIVj47WzBBxx/7QUpGFj8OSgZAC4H8QZ8CCD/54Y9BtPf/QRObTz7PrdY9ewwBQukriD4affzAfTgQQlPoRD/+wyZBynrmQY9T9D2N2/3AXN70QZlk5D0DIYDBmM0UQlK4nj7+oZlCy3yvwem3Lz/hkKPATOamQX+HojoavMXBRK/OQeqyGDvJtQXCFWYZQuxReD/MP4tCWSaWwZet9TyspCbBywVxQexReD+5HHtCMdGdwUa28zycMzvBR1YEQYKoezkFP8/ABukaQuxReD+GsVpCCF2pwSvB4jyx207BWTQGPpm7FjvsKsfAcP7zQexReD8ZYjBCO4+1wZtVnzyw9G3BhgomwazFJzzC/sfA0X+eQSQLmDnqJHjBEOq3QexReD+yLw1Cjey/wW05FzyLtIPBlAaZwe/mqTw30cfAdLEuQazFJzd00orBTp1kQQAAgD8UmdtB7jrHwQAAgD86mKBBh0HBwQAAgD/PZCdBBHOmwQAAgD9pLHFAZ0ytwfoncD/c7g1AJQvEQXE9Cj0wjYbB59zfQepb5jzQI8rBQN0WQq4SrD7Z5UlBIomwwUloCz4d3HrBKcmdwXTqyjw0JLdBU/RTQfTDAD9cGzpBfSIoQa9fsD4bmaZAlqKswU91SD1G1rbB5GuOwXdKxz23NXhBeldGQTVeAj9OkYdASF4zQXXNlD5NIkE/4R2twazFpzk43dnB1PaHwXf4Az+vTzJBBZw4QRsqRj4IUFy+B3g0QVj/ZzsdbBFC39cIQFkXfz+w9IBBniaQwAAAgD/JOZ5BdPOvQIz43j5aVbJBSBeCwFoSED9t3Ek/v8OzwBQi4Dqt5TlCFgUBQmBZqT0Nta9BoUzSQCzUaj/PzYFAylWQQLZnFjzsbylCTD6rQflOjD1Bnq9BNA2JQTMbbD//GPNAfVdnQW9k3j09xPVBQOihQZta1j5L8iRBtAKSQfoK8j7Ddz/AKW6bQc6qZz91RvdAr2XAQFWkwj29nhjBRlUMQVhWGj3OnfhB72LPwHzycD9Cta5A0GwAweHurDxoRfRBI23MQUvNHj9QtoBByroXwad5Zz7SNx3B0+EAwZYmpTtwYsBBEv/RQX4dGD5XcXdBRuS3QZdzcT94WWlBaWKEQKtbPT0ebgrBUB6zQLxXLTxR1MjB8jReQcx6WT+W9TtBc9CNQVlRwz0KpQzB+9WbQQ2mYT3ghqTBhRDYQVK4nj4g2YxCCA7lwcwLMD+kylC/uZhKQdPZSToUyrDBbaaHQUiKyDpyygfCO9voQVK4nj7xaW9CTRsHwtejMD+xMCw/pheAP13+Gz8TOgFAF/5NweLplTy3S8LBIE4KwaeWDT79Cy1BPRqjQc6qbz7lx6Y/SAigQaRwvT6jvQ5CgUwBwhjPQD6iGAfBWG+rwdY51j60uANA6YAhQazKvjxIcxbBIxg8Qfc7lD1TOQxBuLXhwVAZfzzlPqXBGwXIwWLbojunoaFBUUTQQL01aD80OPNAgzqPQAAAgD9y2tRAObRlwHoZhT2lNH+/y93nwRe3UTnQCfPBZ92+wfyMMz+71StBhvR/QEYIbz48bAvAg1J/QNtQOT8VGidBcZjSwPtcjT4nXZXAjIvJwEjh+j7mU91BclgFwlyPAj88rvI/9dEAQFK4nj69+H9BDCb3wdejMD9DqA3A3NUSwXE9XsEzM1PAexQ6wexROMFI4aLAuB5pwQAAMEAK13fBXI8CQVK4QsF7FEJBcT3qwMP1WEEzMzO/PQo7QaRwtUBSuNZAUrguQWZm5r4pXEtB4XrUwEjhMkG4HkXBzcyUQLgeDUGF63HApHCNQM3MBMHhelS/7FEYwVK4rsAzM/PAuB4RwexRaMCPwvU9FK6nP+m3rz6byWc/7ZnlPVZIST8peXU9DjIRP0/poD1lcKQ+VwlWPglQMz5g5cA+gbKpPZHtFD891aE99blCPwlQMz5WK2M/zR64PgcIZj9QGRc/EwpRPwxZRT/Q1RY/m8lnP97I7D73zFI+9bmaPsOBoD6twHA+FTrvPuikhz6M+B4/GEO5PhppQT/6JxA//+cAP5qZiUCF6wDDuB4Fvkhh/MI9Cve/FC7vwlK4/r+kcN7CMzOzvynczsIzM7M+FC6+wgrX+0BSOLLC4Xp8Qbier8L2KMBB7NG0wo/C7UFI4cLCAAD8QT2K0sJI4dhBXA/hwo/Cq0H2KO/CFK53QY/C+sL2KCBBAEAAw8P1gEDsUfTC7FGgQArX4sKF6+FA9qjQwlK4GkGFa7/C16PYQLge9sLXozxBMzPswgrXiUEAgN3CUrimQXsU0cKkcBFBw3XlwilcU0EfBdXCXI+OQexRwsJl5Jw+Yi0+PqYnbD4Tfmk+4h5LPqwcqj7I0kc+EyzuPqkTUD77yxY/pidsPq7TOD9Of7Y+tJNRP+oJ+z6/YFc/R3IhP35STT9eojo/1xcxP4/kQj/lYRE/TE8wP8425z5oXBg/WTStPk2E/T7ogno+i3HOPrSOSj77lpk+eQGWPiUGoT6NKN0+h4qxPqezEz+wA8c+4uQ2P4eKsT7lCo8+iXvcPoUIuD6iXQU/vFz0PtOkFD9OtBM/TInEPkwa0z4dOOc+5DELP1cEBz/MejE/za9mOWdMDEJTkOG/7fB/Px3msUGw5/u/MSUSPOCFB0Ikd9rAw7Z9Pzb5p0G/sODA0/avO7yKnkKHzpvBms5OPeJ64UFw3CnBgbJxPxxCdEHFICzB3GPpPfIYjkKORY/BDaYhPlYWokHf/1TBCmg6P34o6kB/F1bB5svbPjEWfkLnEn3BKe0tPpDqSkGiV3PBNjzNPqWMjr7GT3PBLnNKP764XkJBsEfBhIFnPcjohkBibIHBqU0cPs8NDMH6x4DBAACAP4oZTUJtTXzAAACAP/UkTkJ2OoJAAACAP46/XkL7XDpBAACAP+LCfkKZ+n1BAACAPxJvj0KbyoBBGy/dPtP4m0JKHiZBy2cRP89ARUEfdWtBbxIDP2ZgpkGNYzlB09n5PrFXAUFFMzhBMQgsPgGF4UEsZvdATP1UP4gNd0G71vJAqOMxPZ8rtEL2HxfBHuF0P3fLnkGVwFBA5E5pPPH05UG+zITAHVp8PyMrfkESgonA3V5SPAcilUJvgzfB83GtPbAhoUFMOr/A9wZnP+eB6EANY8HAhZkGP3MYhEJnLfbAICliPnTmLUGmsdzAyLWBPvn0AMBpG9zA7lryPj5laEJCV13AdAwAP3PJ7j92aeTAs5jYPBZSMMHiKOHAODKPO7Pg5UHLC6K/TOB+P+1vfkEi4rS/QmBlPQyPs0Gbi/c/VKlxP/hGGkFcI+w/yy3dPk8SXEFM7JhAc2gRP8iHej/Ko5hAT135PlDciUJaFLlAsVADP40i10DR48dAHaz/PPXIoEGacNi/9wF4P7Nj6EB3DOG/Iqt7PvXCikKmWQXA2Ng1Pzv5L0GB/b6+hLszPYCa6b8vW7a+AACAPzv1Kz+I24Y/CleFwmZm0EKPQqLC7NHEQincu8Izs6hCZmbPwnuUjEI9CtnChetgQtcj2sL2KChCmhnPwsP1CkIp3MnCCtfJQaTwtMIK151Bzcygwj0KlUEAgI3CmpmFQRSuccIpXK1BAABawoXr80EAADTC7FEjQuxREcIpXFlCFK73wSlciUJcj+rBHwWeQlK49sHXo69CSOEbwrgewkIK10vC4XrOQuH6usJcj9xBKdymwoXr00GPwpLC9ijWQYVrgcLsURNCPQpfws3MU0KuRzvCj0KLQuxRK8KF66dCzcw1wlI4u0KkcKfCFK4XQlK4n8IK10RCmpnBws3MOUIK17vCMzNTQsP1pMJmZnBC4XqXwjMzk0LD9YbCClevQqRwYsK4nsJCf4cKP5Rqbz/SOso+PE5hP4zzhz6WCT8/aLMqPkjEHD+An/E9Q//0Pjc35j3zyK8+yR8sPpUrjD5+NUc+Bp47PtvEmT532wU+FMvNPuc19j1trf8+vJbQPayQGj+srRg+AOMpPyWvbj68eUI//bypPpbsWD94l+s+4dFmP768GD/8GGs/dO8xP6EtZz/Sb0c/KCdSP2fyXT/AJjM/9RBtPx4Wij51dlI+qB2+PvK1Rz7iI/I+YmdKPsuEDz9kQJY+fa4mP3/e5D6I1z0/XRYbPzgtSD9fBz4/y2dBPyqMVT/3r7w+paCbPiel0D6dutI+ofhxPvlJxT6M84c+yjLkPkwawz4U6AM/aAXmPqrUJD9FZAg/+BlHP5yKJD8bnl4/sdxyPwQmAMHvEIzBbypSPbZmF8J1kUvB1sU1PxmKkEBzIdbBBHOUPkim0sEYqbnB441sPriluUFhH/LB4NtEP8OFAcFZuOTBbTmXPJs1IUI3fvnBjUV7P8kZDUEJ+PnBAACAP1GVvEEMluvBAACAP81SEkJLA77BAACAP4j2IkLWl3nBAACAPz6eQEJfexHBAACAP0coQkKPAy5AprgqPNQBkEJ6nnxBdlR9P32KNEIPKERBpN8+PX0liULFGchBXhF0PxulKkJZR65BBRcLPnWpa0JmgflBlzldP126BkLdSedBv/GlPq0zQUIxtfxBeQYtP2pNuUFpHfNBNZguP+MKCkIL8QhCRs6iPvprG0HiswlCA7JvP6euk0E+CgpCqWqCPTI1x8DyUxFCa5p/P18OXEDoU/xB09nJOi7Fq8GboAtCAACAPzjFxsBLDdxBAACAPwGFTsFVqaxBAACAP2j1g8Ec9BxBAACAP44zd8Ev42jAAACAP/41K0KR1FrAZVOuO7DRhUItRhFBsaJ+Pz+KHULcUsNAcy6FPTGOdUKI24tBillvP+P9CkKJZHBBWOc4Pg0YQULAj5xBgsVRPwVOr0FXfZNBsCA1PzzY7kFlsJVBUb2VPko3YEAipZtBoKZ+P+x2L0HLZIxBFFysO2p+dsETxqFBAACAP4qTVMBJlVZBAACAPxF2IsHGh8NAAACAP93Q6UGcDFs/HuG0OqTRNkIKzDI+6KR/P8ESi0Fw6xi/AACAP3gS2kHNKmrBAACAP1dPokFKCW3BAACAP6OoC0ESm/bAx7rYPipStkG2PhLB9aETP4d/y8DuCPHAgXhtP+NSz0A7JBjBuTaUPb38tME4qMfAu9B8PyPw7cAZg6rAM6dLPDwpEMLmMiq/SOFFQo/CZ0LDdY5CMzMoQoVrnUIfhXtBhWumQuxRsMDhepRCXI/WwY/CaUKF60/C16MsQo/Cc8JxPZpBpHCIwj0KN8Ap3InCZmbowexRXcIK10TCFK4Ywj0KasIK1x/Bhetwws3MZEF7FDHCKVwwQqRw28EK13JCheuZwBQui0KkcLdBM7OKQutz1T4niGI/QNmEPigPWz8DYBw+NSk9PyxlmT07GSQ/SkaOPdGuAj/Twbo9ChGwPoiFGj5324U+fsaFPi/6Kj4u/8E+9+ThPXjuDT/T9u898dc0PxpuID6H4VM/+KWOPmfyZT/CNMw+VitjPynoFj8/qVY/EQE3P3MuPT/DgVA/mbsWP6Q2YT97FHjChevpwDOzhcJSuGrB4XqZwnE9gsEzM7nCheudwSnc08IUruXBAIDjwlyPI8IzM+fCpHBSwo/C2sJxPWzCexTuwo/Ci8KFa/vChWumwmYmAcMzs8XCAAAAw4Xr38JxPezCCtfxwqTw2MLNTPLCuB7LwnuU48LD9bXC4frYwmbmmcI9itLChet4wuzRw8IpXEbC7FGywq5HGcIK16DChev1wVwPjcJxPa7Bj8JkwoXrg8EAADTC4XpUwY/C98HhelTBuB6NwQrXs8Fcj9rAUrgJwsP1WMAUrkPCrkcBwFwPxsIpXHbCzcymwqRwdcJcj5LCrkdrwvYogMIAAGPCH4VnwsP1kMFmZkbCPQq9wVK4K8KuR+fBKdzZwqRwyMKPQr7CuB61wlwPnsJxPajC9ihrwlwPk8IUriDCj8JZwj0K48LDdbHCMzPKwmZmlcLXo+7B16MVwrgeVcKF6ynCw/WNwqRwJcLNTLLCCtcrwo9Cz8LsUT3CpHAvwh+FX8Fcj/DB4Xqswe/JCz9WDm0/LNQCP4Y4Xj9q9uA+h/laP3IWpj6SBVQ/by9pPsPwQT+7Jy8+9l0pP1qBIT4PuRE/1ZVPPrq9BD/A5wc+6ufdPqrUrD0dIKg+7kJzPTElUj7JsIo9IuDQPUG8Dj5YcwA9VWpWPtcS8jzEzoQ+MzOzPb8OrD7mPwQ+1hzgPt83Hj59XAs/HY9ZPizUIj/vA5A+f7w3P09Asz760EU/4h7bPtF0Vj9Ycwg/0ERgPyUGIT/FPWY/6E09P8U9Zj/PMVg/Iy1VPzv8bT8i/T4/MPB0P4IcJD+RuHc/UTGOPoBI/z61N8g+3xoAPzfD7T4BNQU/5fIHP5VgCT8DeBM/kURXPyzUIj+4I0w/hzMvPyV6QT/F/lI+sANHPpaynD4uc4o+wW7YPtdppD7jwhE/cxHPPj9SND9xAw4/g90wPmrekT48g4Y+8G3KPnOFRz+TUjA/VAAcP58fJj8wTPY+uXAoPz/jsj5hMiU/X0F6PkljHD8Pfy0/Y5xfP6gYRz/0T1A/wYs+PJvT2UFVHwvCnntPPuwwKcAnhQnC4C2QOtA3AcJFVf/BM9xIP0gpx0Hd4ohAKgDGPOoOAELyItvBCtz6PjSnN0CEItzBxf6yPDde0cE+0MzBaJHtPmBevEHsoU9BbENFO1GUJ0KIyc3B1T4tP9DkTUG/5dbBpdoHPlI9gcHxHM/Buw9APhpz7kGHaKZBknTNPlPl50F+gcfBDmcOP7O/lT325svBkdUtPboGHUKU/wdCd9ZuPR52LEIWTIrBmKNvPzG5bUHSlJnBUiy3O1+LLEJpXUZCAACAPy60xkEqbgvBWp4HPdo/U0FCdRvCd74fPFLn8sFQh+DB0QV1P2jz5kF2exxAyk+KPknVNUHLwfDBCOaoPXV33ME/cpzBCrolP9zVv0GIQx9BjNbBPi5kykEXidDBtcPfPr21V8Gsb7jB3sg8PtkJDkJ1CJZBbHj6PVIkGELjlpLB8l5VP1nPtT/m5rXBDws1PblPMkLwq/RBpFN/P3fghkEs5JPBTrQrO4ikS0JrKzVCAACAP2Nc30FQrTXBAACAP4fn+UFZJsg/AACAP+iG10F1UCNBS1kGPGT2akKXpbZBcuHAPVpdB0IeVKNBHcllPzepiUEaMU5BMZTTPTyiO0JdXLVB/aT6PjGAsEHNa6xBWHPQPh648kAoMZ5BbxIDO4tRjUJONqhBzTvOPkCCA0LgE89BIy0NP/x8B0EJSNJBQgkzPaBE57+WdvVBnZ2MPSxIWUK2/rdBCMk6P2Veg0F4Y81B04dOPngw/cCuBt9B442sPtLNG0LZU7VBy9YiP2SjnT+8cLpBcjPcPH8ousFmgdlBizdCP0TXxUGDr6xBNh93PjeHS8H1yaJB3SR2Py9ET0GFGIxBsacdPX/RvsFF/WtBtaZ5PzT9778kIDVBZhTLPO7rvMEsPYFAahMXP5ggUMH9FoJA3NfRPpBtgcFdKd/AP1fbPaJbu8E147vAdZNgP8lPwsDvxInBB+t/PMYR2cHFWi3Bbf9KPI4j9sHl8ofBrMUnNzOtSMKPaJvBS+VVP75npUAkFcPB/7IbPsaWkcFn0KXBgqj7N7swKMJpi/jB498HP/PVmUGJfrPBrDnwProDhMALqLTBF7dROMfb88HmjA7CyNInPlVs5EHHVGPBuAZWP0+M4UCZ/4jBMQisO8uFgcF2jxnCSKd+P8PBlUGl3AbBfcucPAThBkKdabjBJUDNPuRpfEA5l7PB4Nv0PPct8cHShhPBY9EMP12zZEH0TGZBJhl5PqxonEGqloPBqfuwPrmnFsH9VGXBYr48OeWPFsIr8o9AQWX8PSuMvkHC+YpB7kKTPniRjL9r94hBX14APVH5J0J/T3vBob4FPzteFUE5NWXB1PGYPBqzmsHXqDHBmUf+Otm6GELYXIZBOX/DPnoGWEGIBH1BMzMzPcFAOMHFToRBVkh5PoW0BEKJzkXB2skIP5RuHD4z4kLBY5coPZT150F/u2pBBoE1PjaohEChKGpBpmF4O5aHp8Fi84FByEEJPakxuEF69r/BB+t/PoNPt8CyyLnBEQEHO4tPCcI/J6TB0eg2P1I7aUEgZRhBSRGJPhlja0HRRpTBjnVRPlwTV8HdjofBUBkHP9mml0BaBAFBcOuePuoqAEE/tVTBY3pCPIeanMHdyzDB7dMZP5maOUFsndVADFmdPeb8b8COWfBAAACAPxhCCkEQwh49Lq2GPKJTK0JQJZdA78l7P1BagEEMI4VA5zqNO1vyckKh6w5AJUAFPzlGzEHwIL5ALEjzPlACgr93h+hAF7exPg8MGEKNt5FAo8wmP4fzLEAiTadA2gOtOoVOvsGN8RBBAACAP51AP0H7MY6/RpRWPo0r9UHuWeXArd0+P5I2Hj+CFRbBm8k3PdmZBkLpOhlCzzFQP6SuSkE/I0fB68VQPW6ujMFD/Z3ADAILPittlkFTA9dBAACAP+/uJsD+SEk+AACAP/s8kkGlgqw+AACAP4KeGEGTO6y/AACAP1M5iT9vLwLAAACAP2fvgEHF+PS+AACAP9uL3kC/9jzAJ6VAP88wLkHC6QHBx2h9PvTcBcHxB9LAAAAEwbgehcAzM9vAw/XgwOxRqMB7FA7BMzMTwFK4CsEpXA8+zcwAwUjhWkApXNfAMzPLQHE9msCamRFBH4U7wMP1LEGamRk/KVwXQUjhakDD9ehAhevBQHsUTkC4Hr1AcT2KvwAAmEAK15PAFK4XQIXr6cCkcD2/16OIwKRwjcB7FK6+hetRwGZmJkBmZua/pHC1QHsUrj6uR/lAzcwMQJqZGT7Xo7A/Urh+QOF6VEAfhWvArkdhv8E5wz68rk8/r7GbPrZKQD+yS4Q+COYwPzxmkD4UBRo/aVehPkG3Bz/oML8+UAHgPhkc5T6yEbg+wRwFP7ahkj5cjyI/NdKCPkXwNz+Rm6E+rd1GPys1yz5rmj8/RzgFPyBGMD8lQCU/yuAYP+lgPT8eFvo+lZpNP3NLyz4KETA/2lXoPlLyEj/F5gM/Ckv8PsrgGD9wsdI+gjkqP1w9tz4+eRg/SkYWP18MLT/AePY+dHsBPwjmMD9SuJ6/exTiQfYoBME9CpdBKVw/wY/CBUEpXEvBAACgwAAAFMEpXInBzcyMv1yP2sGuRxlBexQFwq5HrUG4HgbC9igIQgAA8MG4Hi5CmpnjwYXrWELheuzBuB51QmZm3MF7lItCSOGawfYomEK4Hu3AUriUQnE9ikBcD4pCzcyKQWZmdkLD9cxBhetDQnE9+EEfhRFCmpkHQtej0EEzMxBCAAB8QQrXFULhegRB7FENQs3MdEGamalBw/UAQbge3UC4HgVB9igwwVK4B0LXo4RBH4XzQZqZOUBcjwBC7FFMwRSuWEIpXD9BhetDQj0KF7+kcEpCSOFmwXXlSz+KjmQ9owFkP+ohGj5yp3Q/2zOLPgAAgD9TluE+AACAP2X8Gz8L73I/q+dEP0SLXD8ldWI/xLE+P+6Ubj8nZh0/7pRuP4W2BD/dXnI/j8LVPgAAgD87368+AACAPxzTcz71EG0/Y2ITPoy5Sz+6TgM+Q5AjP2NiEz43puc+8+VFPm1zoz6RD5o+8rBQPvWc1D7opPc9qWoCP4qOZD1MGhs/AAAAAJAxLz8AAAAAMLsnP+W4Uz5I3EM/Bi+6PmDqTz92Mhg/r1r5PkoHqz6NCw8/0GH+PiDvFT/3OzQ/KzWbPhU67z7Q1cY+ZfwbP8JR0j6Q90o/mhn3whSuvkJIYQ7D4fq2QuG6McP2qJtCFO4/wz2Kh0I9SkvDZmZXQs2MU8MK1wNCpPBXw65HSUGksFfDAADIwB8FUsP2KLbBSCFFw5qZC8JmpjXDexQawq6HIcMzMx3C1+MUw83MD8LsUQrDj8LjwcP1BsOamSjCzcz5wuxRYMLDdd7Cj8KCwuF6vsLNzJPCrseXwlK4kMIfhW7CMzN5wnE9RMLNzEvCrkcmwh+FAcKamRHCzcxUwT0KAcIfhQtAZmYNwoXro0GuRyrCPQoTQmZmTsJSuElC4Xpywq7HgkL2qJfCFK6fQincrcIzM7BCKdzOwvaovkJm5h7DmhmqQsP1N8OF61FAzYwiwwrXU8H2qC7DuB4QQnvUG8OF65dBM7P3wkjh+j8K19rChesRwsN1nsLXoyfC9ii1wjMz88AUrnTCSOEawY/CmMIzM4VBZubdwo/C1UGF6w7DcT02Qq5H7MLsUYJCrseqwkjhS0IAgMLCM7OeQpdWAz84SmY/SaLXPiaNYT+ztX4+Ic1QPxfUNz46ekQ/W0L+PZhpMz9Hyas9ptAZPwfrfz2U2QA/HoqCPfOO0z6nP7s9QxyrPu0NHj53Z40+C2NrPoqOhD6M86c+RKiCPsKGxz7434o+E/LhPlk0nT5pUuo+nWh3Pra5AT8YJjM+n80SP2qkBT69xiY/lN63Pa7wPj9PBsc9CD1TP2PRFD6wcmA/bm5MPsHKaT/luJM+SzxwP1J+wj4wZHU/02roPvCFcT/9pAo/G4FoP7mNHj8/Ol0/vk0vP2LzUT8fokE/rvA+P6BUUz+HFjE/THFdP5p3HD84SmY/v2WuPrWmWT/zyF8+UvLqPkJgpT5SfsI+WReHPj2bHT/vILY+BcAIPwQEAz9LyOc+/g4VPzmciT6DwDo/rK14PsmTLD88ZtA+PE5RPz9Xyz4wTD4/6ucFP4ofEz/SOhI/S1nWPuxMKT+1Ggo/21BBP1MFMz+e7y8/cjMkP8CyUj8jFX4/825fwCRc5sHKGvU7A/Gswhmf0sE6zG8/RxT0QEvjMcLymIE9BECZwuFVK8L4ayo/wIsJQrWdjsLAJqs+0kZQwi9mj8KfWQo/bkdFQpx8oMJzS+s+ko0Xwq6So8Lfw9U+ZEeFQsULqsJpHRU/WACowZXWr8LFrIc+OiyyQg5PqMJOKDw/gv64P/qmscIWNRg+1wLbQpjmn8IT8lk/yA+xQfd+rMKQvZ49+UT9QnFAkMKmJ2w/M04fQgGan8I0vxo9vHYLQ0cYccJlU3Y/uzRWQnL/icJF2HA8DV0RQ/dXLsL3O3w/ygBzQhpRU8Ihk4w7dW4OQxiw38Ey5n4/fj9sQgYWFMIAAIA/iqVUQpApjsEAAIA/slE3QvYq3sAAAIA/nSANQtB/ET8AAIA/AVo8QioLBEEAAIA//q1jQrDBskH3zBI7TZoKQ9A9PULja38/3MJ0QsJEGUKndDA82/ILQ9DBgkKGPX0/E9Z/Qu7jYEI+7fA85rsCQyLtpELud3g/fX1gQpj2k0LhYoU9gPDlQiSRukL8Um8/bQwlQskGrELfidk9BaTIQvvAxEIczmQ/hHzYQeF+uEKE00I+IJ2gQq56w0J3Sk8/eefhQOpiukJh/Z8+6gxzQiSMvUKoADA/FIdKwXaPt0IUedI+NLYzQpKiuELOwhY/+hjlwScqtUIdrAc/kVzrQUo1pEJ2pvA+2ZwzwlFAo0Lt2Cg/lY+LQXTeiULXTK4+KYZnwsziikKlLEs/gkQJQUChXELLSlM+XJ2Hwg2jYUKInWk/V0y8vxx6I0KADrM91+idwnPWK0Kxv3w/l+wIwVP7qEG46U88aSivwp6svkEAAIA/kzY6wQ1J9EAAAIA/6JE5wcIWJsHcaFA/P3mhQTr2Y8LzWT4+SDGCwlQ4YcJzS+s95zrSQrS+O8LqlWI/TuiiQfH1U8Ifnbo8kDDfQrtzpcFvKno/TyznQUii2sHbbbc+7MqOQqSMTsJrSCQ/wPBZwcQNXMIiN2M+DcmeQuRE3MGQMUc/3cBvwMLu/MEAAIA/xRbkP68chkAukKA8Q9veQiA8FULX+no/Lz4FQrfx80GgT6Q98W/QQmo/hkJkdWs/8NPjQUwjc0JHAxg+Bs6aQqWXK0KH/lk/F2orvmwCG0JyxJo+V+KGQtxLjUIfnTI/lvT8wKdnhkLxnQg/efBFQghwOELOwu4+9vPdwXCiMEIZ4ug+ttxYQruiJkFMjgs/hsfOwY86A0HrcyU/kX1HQi+C08GMFbU+nVkEwg2M4cEAAIA/f4mvQVW6OsFFEm0/Y7mtQZAqwEGdaJc9a69kwnqowkEAAIA/KfgHPz833D8zMwjCuB5NQvYoK8KF6yZCCtdKwj0K5UGkcFrCAABkQWZmWsLD9ag+AABNwnsUZsEpXDHC7FHWwbgeEcIfhRTCcT3oweF6K8KkcKHBMzM0wtejPMEzMyjCheu5wNejAMKuR2HACteTwUjhusDsUdjAH4XjwGZmpkAAALjACteBQc3MTD9xPc5BXI9yQEjhDEIfhcs/AAA5QuxR6MDD9VVCFK6lwexRYkIAAOzB9igHwnE9gsGPwv3BXI+iweF6pMHXo9DB4XoYwa5H1cEfhZNAPQq3wT0KlUFI4ZbBCtfzQc3MBMFI4ShCH4WzwQAAPkKF6/3BrkcMQgAAG8KPwsVBH4UlwuxRHEGuRyfChesJwdejEcIfhbHBJxTSPsZQXj9Ub50+0JtKP+VEWz5Ziy8/RSosPsLdET9FKiw+nUbqPs1YVD4Pf60+07yTPsZtdD5YOcQ+nfQePuzd7z7+8d492ZkSPwrcuj3W4is/nzzsPUvlPT/qykc+s9JEP5BmnD5L5T0/+tXMPh4WOj/fN/4+xT0+P5vmFT/n+1E/kZspP3b9Wj+UEz0/iGhUP0DeUz/9vDk/hNNiP0w3ET+KPGk/gxftPkmAOj6AYB4/eJdLPl9BEj/52pM+3e8AP1BwwT6taf4+stf7Pl6iCj8/4xo/J8IWPz9XMz9rnzY/845LP5IFDD+3elY/9u7fPqHWPD+XrbU+V3gnP6G+pT5Smwg/h/miPt48xT5miMM+qDWNPvN2BD3rhWdC023IQOm3dz9mLb1BcZavQShJVz6JcT5C3lFiQQ4tSj9ESS5BblTBQcLAKz8rgAdCvTinQSx9qD49IY3Ajz6+QcuEdz/LsZlBxFu8QdaoBz0CApXBc4yaQcf0BD15u0BCL/yDQQywdz+XCKtAi6ayQf32xT5sVwVCN2GZQdoDHT/kUxDBu8aNQaRwZT/vr5lBbV2NQaN11D3oSqbBMj0cQQAAgD/VUdFAQ85kQQAAgD9aB8q/rAAeQQAAgD8iiuHAVmUlQAAAgD/9RfLADvDJwC2Vfz9ddE+/lvJ6wS5W1DoPdfvBnDA7wsucdj9LHS5BFSq5wfT9VDt9pw/BSHjxwe3YCD2VY5XB2GwlwliQPj8emrRBtMfMwYB9tD0d0R9Ac9/WwUF9Kz7uzCDBgVkEwkYIjz4lUAhCj+Dowca/Dz5A12RBeHrEwZyKFD8elii/HpfMwRvYKj3cyC5CSrYKwrN7cjxMRctBPbDHweiHcT/u3BVBCzemwZlH/jr3rkdCysUxwjSAfz/HhqdBiDKpwVj/fz8wCfRBLamUwVj/fz8dchpCxJUswVj/fz9LxR9CPuERPwAAgD+PMg1C0wxZQQAAgD/1wt5AwiDYQPzGfz9FTWxAZBfHwJ9xYTpGzxLCsfUWwpvmfT++sHhBKeTbwFovBjx50evBBJfiwbpJRD+4lN9B2Wm8wHDOSD7XywDAgObdwCQLGD2NTrrBgTqMwbIubj0rvyRCHjYuwVysWD83ZEBB10mkwIiAwz1dBDvBXL8WwQ4yyTuOb1JCetSewSwOpz3ijNJBjgH2wC+LaT/hLwpACK+hwGjoHzruwndC4IbhwV7Xfz/z7WRBbYIDwFj/fz9wGu9B2geUwCvB4jqVeVxCeSi0wPiNfz8evtVBsxgiQYlBoD2LuSdC3d8jQCf3az/rxDNBdk00QQWoCT9lHPhBEGQKQaeu7D4WW6G/T5I5QQAAgD99R35BzqEfQQQhGT7wxwtCkdgDQRe3WT/o3h3AqDQNQZLodT8XuaJBcioJQWFsIT1tSnjBVsoQQOF6Y0JI4XpCUrg2Qh8FnkL2KNxB7FGyQh+Fq0A9CrZCKVyXwexRskL2KCHC4fqkQj0KXsIUroBCH4V1wmZmM0LXo3bCcT3AQa5HYcKamRlAKVxDws3MiMEpXBTC9igPwpqZ2cEzMz/CexSCwQrXWMLD9SjAAABcwgAAOEH2KD/CPQqrQbgeAML2KNxBcT1iwZqZFkLNzMxAmplFQgrXu0FSuGZCexQvQoXr10Ep3JNCZmYDQuxRYkIpXAJCcT0SQgAAvEFmZqRB7FF8QXE9KkCPwlFBUrgmwcP1CEEK1/nBmpkJQM3MKcJSuArCH4VUQpqZHcEUrjdCMzOPQT0KHkK4HsVArkexQRSumcGkcNNBcT0iwj0KDkLD9SzCexReQQrXu8FI4apAhevxP9ejiEAfhTvBPQprwa5HA8KF61nBzcyMwXE9AcIUrpVBHwWmQsP1ikEK12lCFK4XwPaogELNzMzBcT2RQvYoLEAfBZ5CuB4uQgAAbUK4Hi5CFK4YQpqZBkIfhZVBjZdePwdCSj+77Uo/jShlP60XKz+J6nU/nzwEPz8AeT89RLM+iep1P9C4UD7n42o/2PXLPavnTD95I3M9hbYsP5Skaz0aUQo/gLfAPboxzT4lzBQ+bM+MPkAwZz6FJR4+xT2WPnqNnT2Mobw+VrwRPVJh7D5dM/k8EQEPP3qNnT07UyA/b9g2Pq0XKz88g5Y+beI8P6Bs2j50e1E/AG8JP7D+Xz/68io/eCgqP4/HXD/7dDQ/fh1APw39Mz/lCh8/BhIkPxiVBD+mfhY/KxPOPv/PET+x3KI+e9oJPxghPD42PP0+MxvkPSQLeD4kYjo/TBrTPhB6Lj9xPRo/zeQjP8KjBT+9Ogc/YVSyPulIDj8X2U4+WkcdP3kePD46HvM+NlmjPorl1j5ZTPw+dF7TPpOMzD4Kv5Q+S5OCPiBGmD498rc+7BI1PpSkGz8Axms/lE0ZP9szQz8vUe0+q+dMP6Hbmz5Lk1o/7xv/Po0oZT/xLkc/rYZEP/EuRz/iryE/Htw1P2N/AT8AAIA/8SBpQeVpaMEAxlM/l7pGQj4K6EBg5TA+W6UGQoelFsEAAIA/mOv6QQXriEFY/38/ZdsSQf0ClUHWrX4/hBtxwSQVg0FVwag7NmoCwmzQGsEM5Uw/xlMRwn0WFkGojD8+XB4Pwoiw/sGSrpk7M2Jnwr4DQcJJnQA8cr4zwtVAvsIBTQQ/Mw9NwugZEMEbu9Q+IZLPwd+KVcKCxeE8lQoqwrqchMJbXyQ9qcOswZ1TxsIbL50+3E9jwlyw5MH+SAk/LRMuwcckhsKUE209IETCwaS7lsIkYso9qtblv9/ivMJZhhg+rR9jwrqhRcJ56Q4/9WH5QLGRmMITuLU9hZdzwIdHnsLd71A+JMKCQYdxqMIsvEs9TGhMwhznjcK86Os+Pu3sQbqLocKNesg94U6TQYYEm8LMf8g+t3EBQhl4icLA7B48FkQtwriptMIbgZg+QL9JQmnTpMLaVYg9UJIbQjjSksK1NyA/Zdc1QvzeUcL3zJI47zH6wVKr2cKreAM+crqQQjCzn8KVSKI8/CltQhTvgcKrCVo/h9peQnKqA8Jwd1Y9MOyuQrQumMIK1yM7TZWRQnfwZMJi83E/JoF0QoakksGQ96o8LunDQgrzicKcp3o/za10QpfTtMA7qpo7Vg/RQusUZMIEyn4/7wdcQsat0EAAAIA/KawmQtf0cUEAAIA//564QTLle0FYcwA6lTRDQvckF0A7338/F8+QQAP5QEEAOkw/wAnyQQjEfEH3dQA+NpaSwfLuJ0GXOZ09v2kAwk0is0EyPQk/EEJ2QcL/8UFNhO0+xWafwSuos0AAAIA/nAZkwIBrD8EAAIA/NZj4QaNs8D+s4g09D9MUQjgKdsHyB4M+0qyYQW9FuEFeaK486SWgwaP1m0FKKTA/+2eGQdqnIkHrHAM+ziwUQrPvYkESMaU+7j2nvlkDfkHtngw/2ff9v0jAiEEm5Gs/L91eQS05h0BW1KA9CqpgwdYN+EFVwag7HJ9xQmZpecGny9I+iSHyQXjIzMBaRxU/agCDwBtN0cAAAIA/rdEIQYMSEcAAAIA/nqHmQbJBiEAAAIA/gQAnQj9di0BOucI+PBfywSMan8Eg7wU/xJ/bwEChHcI5tEg9mK/fwcWePsJjekI99PqywdoKl8KIS448BkeqwKmn1cE+s1w/OkolQTXHoMEEVs49mHWFwYscw8HItaE8lPHkwYu5ScLaA606aTW0QYe4AsJoP3I/1njgQd9ZDEBpjFY902i2QAun70H+JrQ+1KsaQizvfcGh+Ak/HN4WQSyPScHEmd89JPuAwQYxxcHmllY9bPtlwapdOcLediE/sSm/QS+8E8Ju3U0+a1t1PxaPE8IJM+096gziwLfpQsLLvks+mHQPwkpkFsKgNxU/QlvQQBsxUcIVdLs9rUI5wQ2lYcINpgE+lOWFwLd/j8KfyJM9rdAYwsYRbcKBPgE/BQ/HQSENgMK4kt09ErMUQdS+esI5KKE+F819QZTIfMLir8k8K3+Swev9hsIfEdM+IWEkQgt1R8I6dSU+jUCoQQKRMsKnls0+PgpVQV9IJ8LYgRM+RupTQvFk28EDYJw+RcjSQZp+nsHh7gw/5LW+P/XLmsFQGb894niAQt15P8J5XT89VQIrQh6nEcJXJlw/qcXFQcCyrMHnHac7ONPawVkzrcIYYH8+VsJYQsrohMLx9Io975wYQnkiZMLReS0/PpoJQpd3IcJPQJM9kzibQrgJc8I2WSM8dolsQmatNMKaCGs/nKMrQjaGjsEAAIA/yDi1QfU7LUFDc70+hZatQZzaW8G4QAo/p5srQaXqHUG8Irg9Fuy9QUwLwUHZfHw/H19EwIaFrcAmqjc8L0wGwvHDXsFFLyM7WixBwundVMKeDD4/puirwf/dg779h3Q+TWOkwfeWtsEPKBs8L5g2wpm4DcLb3Bg8jyQvwrTumsIAAIA/NFLWQKZu0kAAAIA/gQp8QXDuSr8R5KA7tjEhQhADxkHG4cw97/GbvUxy10FXIWU/UcmDwH7Ox0Ahk1w/br2LQY60XkHesA0+uXaZwYV6sEGamWpCzcyzQrgeM0IAgKxC4Xr0QaTwqkIK159BCtefQtejYEEfBYdC9igYQTMzVELD9TBBUrgmQj0Kb0G4HgVCZma0QXsUxkF7FAVCXI+4QaRwLkKkcNNBexRjQlK42kHXo4tCj8L5QZqZm0LXo8BBexS2QgrXo0FxPdFCmpm5QezR3kJI4QJCAIDdQvYoOkLsUdNCKVxoQnuUxULsUYxCM7OzQo/CpUI9CqRC9ii1Qo/CjUIzM7pCzUyZQo/CGkK4HqBCSOFQQnuUnEKPwmlCKVzxQR+FIEKamTNCZmYtQqRwbkIpXCtCCtemQsP1B0K4nrRCpHDTQa5HxUIUrg9CzcywQgAAP0KuR4BCpHBbQpqZQUIUrmRC16P4QXE9ZUJmZvJBcT2OQpqZQ0Kk8JNCcT2FQriekUJm5p5CKVyUQmZmtUJcj3BCzUzIQj0KPEI1DO8+L/paP7d/tT6vzlE/sKx0Pl7XTz86ehw+48JBP5z51T3CUSI/ybCKPYRH+z7QfqQ9vqTBPl8M5T0bEpc+QPsxPsWsVz7LoYU+UaVGPhWpsD45tGg+c4XnPgnhcT7oMA8/D5eMPmwhID+rIVE+a9Q7PzfDLT4KEVg/85NKPkUNZj+PwpU+vW9kP7LX2z7rrVk/xxELP7coSz+Yhik/2lU4P9ieST9O7ic/gPFcP8jNED8GKmM/THEdP0uTsj4VbyQ/Mlr3PrSrID8CZQs/73JxPsnIuT5XCbY+eCjKPoZa8z5hicc+r7ErP23/mj6LNzo/xQNqPodtSz94eqU+4uk1P5AU4T5dFgM/gjkCP9qPxD7NHgg/UPx4PrByCD8vhnI+QX0rP1u2xj4YsjI/djIIPx+/Lz810iI/3lkzP1t8Oj/C+g8/eGJOPwPP3T4a3YE9vdQQQuw8AUKvmRw/OgqiQclPzEENVKY+ufvTwYtp475ZUbM+TzC0QZ8e4EGgNx0/6h2/QGrD1kFH5hE9WP75wd6fX8Ehdj4/k7AFQTeR1EFvEoM+Mxb1wDHA90HmdGk/Ogb6vxpCpEGPU7Q9efybwWjt6kGeB38/R8/pwJR1+0DguXc7R47qwarYnUEAAIA/1nwywWOI2cCM838/YzURwfepkMFivjw5j8QjwinQYcC70Hw/BtOZwM1W0sEzp0s8Baggwlr5S8GuKnM/41pMQPnJCcKhSk09mK8PwkLXusHIzWA/f69fQV2JDsJ+jPk9zGLTwVvW5ME+szQ/KDfBQc9a/sFGtpM+ROt4wSTT58Hde7g7eBWNQaPlQcInvb8+HQUVQvYo8sF0ewk/MDA4wCJ4AsJGJbU9UBDCQTZDFMIPYqc97G9IQr1FzsFy3Nk+bmYrQdG1BcK6Sfw+kN/iQeaqwMFihPA7X6hpQiYsAsLUYBo+AmN8QVp0K8LLhFc/1/oaQjnQq8EabsA8lujXQXITS8Ln+3k/0JZEQl15SMEAAIA/WgZaQtEZdz4AAIA/KLZJQuU0M0EAAIA/hHMaQusyk0EAAIA/qo7RQRZEpUEAAIA/LZJFQSjfrUFFEj08z7k8QvyQBEEPC30/jZhMwH+tq0E1QdQ9384pQpKSkUEyd2U/mWVfwQ1UmkH6RJ47WRlBQrdPEEJVh5w+ul4DQhH1wkEkfzA/a1iywRClN0Ho9pI8iFRiQt0FkME/OoU+3nadQTDq5cHayTg/CQLQQfvXY8FbfIo9KxLcQQGAicHNr24/iaiFQUJLdcCgVPs7v8HfQb7KK8GvCH4/bwYpQer457+FmW4/cGAhQenmlcGdLos9QRW8wQcwOMHnbwI/7DHFQQZSbcHYR/c+yQ8JwbdBWMGPwvU7DROLQICwF8L4/FA+83cdQm13asFtczM/GriiQG0nmMFrZcI9hDZQQUA10MGpaoI7d0J+QqMMs8HZJeo9vIbDQSTgDcIgtWE/ZcAGQmZJNMEOFWM8Kq3iQbO1M8IEc3w/Bz4vQrTJHMEAAIA/J3siQjvHGkAAAIA/ZKvIQUiXET/tR4o8E1ItQgbfG8D+DlU/ACpXQVBOFMHNdRo+2iGzQMeYeMEAAIA/bZAOv5x23L8AAIA/ZBEjQaxZxL+rz2U/GkUMQU+XQ0FrfdE9Nd5MwVuQjEFXCYY+x7TZQW8Of0GZ0zU/n9K0QOZYXkFt4uQ8TCmWwUCUi8FsCXk7Xt8zQgXGeUH7OmA/wEWvQYkl2EBcVfY9zRT8wLgLW8AAAIA/pBXpv9oO/0AAAIA/P+WAQSewFkEAAIA/HCEBQjIoHkHheixBH4XrPkjhakE9Cl/B16OsQaRww8HsUQZCj8IXwuF6T0Jcj0bCpPCJQuxRY8Kk8LBCUrhrwjOz3EK4HmLCmhn9Qh+FRsIz8w9D7FEhwppZHkNxPcjBClcnQ5qZ4cDXoy1DpHANQdcjL0NSuNZBmtkrQ+xROUIpXCRD7FF7QsP1GEM9CphCSGEJQyncq0Jcj+dCj0K6Qkhhv0JxPb1CHwWTQvaouUIzM19CrkerQmZmHkKuR5ZCZmbOQTMzekKF64NBAAArQj0KI0FI4aZBKVyJQsP1KsK4HsFCKVwbwpoZ9EIK1+nBmlkPQ7gencE9ihBDzcyUQGbm5kLNzMTACletQgrXY8EfhUNC7FGYwbgeHUKamT1BClebQpqZt0GF6+ZCKVwJQppZEkNSuB1CUrj9Qh+FfEKk8L9CFK6AQo/CdEKamVhCuB4dQnE9IEIHtso9XBvaPjqv8T2A1LY+wkwbPsEcnT6rPlc+ARN4PiJUmT4vwD4+2QjEPlN5Gz66vfQ+xy4RPmu3FT/Q8hw+u/IpPy/APj5trT8/mFFsPqyoUT9Eo5s+tOVcP3+8xz6gw2Q/dbDuPlmjZj8wZA0/OIRiP7JGJT/pJlk/xHw5P3TqSj8FqEk/Km83P87HVT9Ldhw/hZleP31cAz8RcGA/4UXPPs07Xj8fEaM+FmpVP6A3dT6PjUg/F0gwPmQeOT891QE+K94gPxu7xD2mCgY/e0nDPi6QYD4xfAQ/yatzPjdUJD8IWpE+Z+0+PyveqD7KbEA/6WXkPvQVHD8c8Mk+mz3wPhEZtj6M1pE+WFaqPuW4cz5XCfY+i8PZPkmdCD/0FRw/n5MWPzKsQj9b0xw/aVIqP3vaOT8svAM/qFI7P4+NsD6A1C4/5bhzPnGPHT+Muds+0zPyQQ000cKSIhI/9jNRwK8gycLe5bI+yMgyQizZ2MJpjCY/h0knQc1tvcJSD5E+OexkQh5j18Kvdzc/RSWfQc3drMKZ9UI+hNyVQtIc0MLyQU8/mPL8QT5ekcIkl789mWq8QiUivMJ0DGg/obsiQrXRU8I3ww09SfjZQo60pcIlI3c//8c1QvwaDMLDgZA7cBvxQsIHhsJV3n4//VYzQv7EdsEAAIA/z8EdQpBUvUAAAIA/QfbyQecTqEH9n8M8fy8EQ0+wGsFY4nk/pBGWQVPXE0INbNU9TEX8QmI+J0HXUWU/siLPP25yREJMT3g+UR7mQpPT2UGF60E/33CLwQ0kXkKtL8I+aeXQQmCEIkKC5x4/OyYIwrdUbkL0/QQ/HjizQpm2S0LJAvY+5ElQwhdXakJXPis/6iuOQuFLZ0ICgqk+AtiNwumMUkKSrkk/kzRUQq1ZbkIYQ1k+KHaswnjFK0IHQmI/vrYPQlM9YUKJ6u09mXHDwiyo7kEuynQ/+XKcQb8WP0KoUjM9ecbSwseKUEGYo38/71MhQAyqAkI0gLc63BPbwoSlFcEAAIA/wQgNwdIZgEGBW38/79WSwSvogsAK1yM75tHOwpS1TMJh/Xc/p9ynwW0vuMF1HwA91rC7wrlzh8LzVGc/c+qfwQs2KcImU8U97Guiwh+lpMLtR1I/j8d/wRwycsKt3TY+sKyFwtaBvMKYbjI/VZxfwPUFncIyIJs+ysQ3wlx8ycK3fw0/nANFQUHTvcJD/+Q+fSO7wd/sz8JvgYQ9eEbBQhoemMIqb28/iz38QakHFcLaAy07eWbWQiLbR8JUUn8/RZG+QQPqIsGCHJQ6yz7fQgmsuMFKtX8/DZQsQRXQW0GrW709WO/jQt0fIT7jU2g/UUzTv9YLBkJVMKo+rA27QqtTVUEu5yo/PfvOwWO2+kEo1f49Z6uwQv4TisGzJGA/BJoywRmNgEDbv7I93eahQnrqOMJdp2k/DBRSP7z4usGUvHo+9myEQlK2osIzUEE/EJ0sQS+NcMLghOI+J6UKQilzlMLovA4/ytqTwcXQk8KPcBo/QfkwQnq2DcKTHcs+oBYLwjuqFcKdnTQ/+xhVQkWcP0B2w5Y+NRFNwj+Nx7/sTCk/Z5+AQmspAULYZK0+fUdywsmq4kEMWW0/hCoIQsoX2kEjLZU9ZbWiwjRSuEAAAIA/kmOMQRW7jj/LSmM/CbwPQbJmCMJqpOU9uZl9wiMsaMLesD0/87AjQct6cMKmm4Q+NrA5wnKZm8KaGdHCUjiuQh+F1cJI4Z9CCtfewvaoikKk8OPCSOFuQuzR4MK4HkNCKdzJwilcKEIzM7TCSOEoQnsUm8JSuEJCzcyAwuF6K0IfhVbCMzM4Qj0KOMK4HmZCH4UlwgpXi0IUrh/ChWukQrgeN8Kux7lC4XpfwuF6xUKaGYDChevRQqTwlcJcD9dC9qirwoVr0EIpXMDCzczFQuF6msK4HlpCHwWXwrgegELs0YnCuB6RQkjhZ8Jcj1tCZuaHwsP1dEJSuF7CKVyeQh8FisLD9bBCj0Ktwkjhp0IULrnCM7OSQlyPwcKuR3VCXI/GwlK4UUJXIeU+DTdoPzNtvz7qIWI/QfGDPuUnXT+BBCU+asFTP8FumD1u+js/WMWbPbGiDj9Iigg+zTvePqZEgj59XKs+8nuLPqUUFD7nNbY+JH8wPbVs/T5xGw09Mc4fPzF8hD0qjD0/fQUJPtl3TT9BZYw+XwxNP5IF3D5q+08/7dgQP/EuRz+8VzU/e2YxP/NUTz+u2Bc/JVhkP5QTnT50Kb4+BP/LPuFi1T5lpQE/9InMPsvb0T6R7Rw+ZojTPjgynz7v5iE/S1mWPlLVJD9seAI/AFIDP3wnLj+Kzcc+XwwtP3dKhz5yMyQ/+GsyPhToGz+Tb1Y+FgVaQgQEUL9zY0o/iD2uQWWanMEXSJA9iNpXQq921UBV9m0/2qbLQUuPUMEAAIA/JAUBQr2iacAAAIA/hR4TQuB8pkAAAIA/gEYWQjjNgUEAAIA/hRveQeCIyUEAAIA/GTWJQZXX2kGSIvI9MU12QYGcyUEGu2E/949gQAqVvUH7rgg/J0iFP6LKzkG6oO4+264BwR+fAEIjMkQ/sO36wCrUl0HXNG8+1W6awdyZ+kEKgHk/aHIswdeFsEC46c88C3DpwTO7rUEAAIA/fwQrwds978AAAIA/wwDwwKuIncEAAIA/yuLqP8Il3MHguX8/JcJVQTF66sGz74o6VBHiwYEspcGTqXo/oum5QeSNAMKmuKo8yqGswQGm48FNoWs/32MJQraT9MEc66I9ZjE3wRscBcLeAkk/tg0tQjFPvMHp8Vs+qEAIvkpRAcK+3g0/qu1LQldfbcHmP+Q+lLExQbeg6sE177g9PuSJQe8gnUFy4Wg/0zn9PzNZkEFjf1k+wqaYQWgfIkGAn0k/8DHdvzGFEUEAAIA/rx2AQXfyOr5tHEk/Ph8Xv+AKRUGsi1s+jHSHwT0jrkGx3EI/6jYwQRJKIEGcinQ+nFQIwbozV0EAAIA/RMrCQGtqMsFI/ng/IBCvQaW1b8EUIuA8ou5TwaddVsHFIOA+bJ8SQq9+i8D27g8/efKdQGL+SsH3Hi493ngZQsl89UBpHXU/HgNQQQo4ZsAAAIA/Qx+dQQHJ6EAAAIA/E7a/QYj0dkFmZgzCzczMwRSuCMIK1wfCmpkCwtejJ8J7FOLBKVxDwtejqsEUrjbCAABEwTMzJ8KF61HAMzMVwvYorEBxPQHC16MsQR+F1cF7FH5BXI/IwTMzoUEK18/BMzOzQYXr5cHNzNxBFK4DwilcC0IAABTCmpktQnE9IsIK101Cw/UnwqRwYUKF6wbCH4VnQtej4sFcj2lCpHCPwexRZkIAAAzBj8JUQuF6FL+amVVCexSuQI/CSUJ7FFZBcT0vQo/CaUFI4RNCUrgmQc3M8kFSuJZAPQrFQdejML/2KKZBPQrXwArXY0GkcN3AZmYaQQAAAL9SuE5AH4WjQHsUrsDhehRBpHB9wa5HPUFmZr7BmplNQQAA7MFcjyJAcT0Ewo/C3cApXArCKVyDwXsUsEHD9azB4XrGQXsUgMEK17tBhesxwSlcZ0G4HqPBMzNrQVyPbsG4Hm1B9igswVK45EHXo7bBexQSQh+F48HsUTBC9ijwwfYo/EHXo3DBrkceQgAAhMEfhTxCXI9qwZqZ6UFSuBLB9igPQs3MnMAfhShCcT06QJqZuUBSuLLBcT2KwEjh2MEfhU/BMzPxwdejvMHNzATCZmbIwXE9osH2KEDB7FGewSlcH8Bcj5TBmpm5QD0Kg8GuR8lA7FEsweF6lL/D9RTB16MswQrX48DsUabBexSGwF5LyDwJG74+nL8JPcHKgT7Takg9ptUQPq8Ivj0zMzM9pgomPmPRtD0KgIE+Ik8SPsFzrz5CCVM+stfbPsmOjT5zhfc+yQK2Pg/RCD8hyME+n8gTP18puz5Ahxk/Fk2nPm/YJj/yJIk+jWI5PxlzVz6tUU8/f/YjPpHyYz8pXA8+NXtwP+5Cgz7pZXQ/wD6qPiS0dT+7RPU+Xp1zPyy8Gz/2Ymg/OSg5P6foaD8O204/GVZhP12Kaz8QXVA/NPRvP1XePj8i4GA/S+UtP8NHTD/hRR8/2sk4P7RZFT8FFyM/g6MEP+5aIj/SxvE+8IU5PyLg0D6YwE0/MXykPqrUXD+LcV4+EAZmP135DD7Qs2k/ZvekPYqORD+itDc97loiP9cS8jyrJgA/oIkYP7e02j6RuB8/U5YBPxNJHD+dLhM/fCwFP4iA4z5kzAU/KowFPwAdBj/HgBQ/I2cpP+bo0T4ktD0/+HCpPkkRUT/SAJ4+COYwP3EbBT/9gkU/L6j/PiLgWD/0bAY/6PYqP9o4Gj9r1Ds/MJ4pPwYSTD8uxUU/0gDePl1t1T54KKo+Oh6zPgaeez5gH50+D+4OPoYghz6L4P89+mHkPkbOgj7A5+c+FoezPpKz8D7SAN4+0EQAP3OA4D7HgBQ/E2a6PiHIGT9aDYk+KbMhP9KpKz7dQSw/dqZIP9LyuUG6LjPBiGNdPsIAjEGWE8dBHht5P/66y0FqhkXAVYfcPCxzWUE/VAFCAACAPy/q10FvnptAWP9/P6W/y0E7yk5BF7dROQqpGUKcawNBlfF/P8LcjkEcmUhBU9DtPYtk5UEo5xxBpkRiP/Wx/0BIs0RBU5YxP4KClUH97SxBzcycPtd2AMD4yDZBrMWnN188+cHfcwTCdQIaPFr3pEEiRYjAaJF9P9w+C0HYrTNBgqj7N7NlnsCO4Y9BrMUnOIRAzsG6e8XBrMUnN0a/4MERouTAcy4lPuCwUEE49xnAQQ5SP5j0jz8pExZBs+8KOnsBmMEITdhA4C2QPANI+sDUrIXBEFjpPl5aEUHOHpc/yeXPPtVVgcDNyCtBB0KyOTGiwsEMReRAkbgHPjOmdsDNH1LBvFetO+mInsFvl1bB7wPgPug190Cdi6pAet/4PfIm5cDNqFxBrMUnOe6w38HJ5BhBBvXNPj1r0j4tL0PBLbIdPXjBecGs7EPB2PWbPt6wD0HllgpBp5YtPcCt8sCWnYpBYr68OAdE6MHiOU9BXmgOP0tgZkDNi1zBOdbFPbVrRcHOcVrBlIclPpeyH0F3IXRBEY1uO+DNG8GcIb1BrMUnOPBJAcIKDZZB09kJP2f7IEFOHnfBSaKXPiB1ucCoS2/B9gt2PdTqHUEQi7xBrMUnNwAtFsKOxclB9UqJPjG4kkFHYYHBJ/crP9erIEAdpHPBJqo3PG1UCkGsBwNCa/EpPWDZ3EH+Gn7B8YByP4TyO0HD2GbB6nhMOkaZukABxyFCOsx/P7NwnEFuhz/BAACAP5eooEF1YhjAajB9P1x5l0H7C0dAhLszPDjmiUCuJf/BeTtSP5xFaUF6F0lBfA83Pg82IUF4ybnBLVsDP7rjGUHOrKJBVkj5PpRVYUHYy27BYFnpPZ51+T+9ZsxBLNRiP6v8Z0FTGbXAXHfzO+m7Jb934vdBahh+P1YcjkG/2Ri/WP9/P5tRmkExn/dAAACAP/ieY0GiD0NB/mX3Ow81q0HsJUNBjBB+P7qTxkAoj0FB++j0PgUcTEHjOy5B24oFP7zsGcBMXilBj/zBO24fg8HLdmDA5wDBOyfRXsFObo/BMnd1P4ZEoUA92RVBfzDwPN9XIcEvDw5BxOsaPtzLE8G/FnTAQbfXPa6KQMFvYTDB10w+P/UsuL8PKspA8G1aPg0LucCwvRXBaNDQPCD7RcGjE6/AxCUXP9h6u8BxQQ7BF9kuPtJP4sCPBBpBArwFPR5rEMGebYTBiIVqP7OR3T5LfVrBs7W+PFKmcMF4jmzBZvfkPOk28cAKCYxBVd4OO0xlKsHXYsfBKctQP32wA0E60ojBYqE2PuaZ4MBHYY3BSFB8Oyq+H8HJX81BbCH4PsH8jUHMC5TBou4DP4LCJED8MpPBAB0GPmd940EYyI7BGHhePz0GU0G46IfB+RQAPZhbEUK5ooPBCf53P/fKp0GlpnDBAACAP0k8tEFMPFfAXoD9PSlCZ0F+Xt7BTE9gP/Yts0GWGdhAVwnmPtUJm0GbVZzBrfoMP5jwokHoMIFB5E6JPtFaQUBv4pdAuEACPGEPMcEurDFBgqj7Nzhm+sEtG8ZArWk2P5NYnD6MuO7A3Xs4PAacf8G4nfDAAACAP+45Cj/X5Ji/AACAP4aIvr8bPJM/J6WgPsMRuEC8iRnA220nP7Qiq8CYwMBArMWnOcnmxcEYoRBAvTpHO+AwIcHS3nlA5CzsPBOI4sDMTBfBq7IXP3DVZD9yQp7AMj2RPu/AB8GsA8M/Yr68OMrf18HXoS/Ax53SPYvICsEQGrO/vHmqPP8CL8FulidAVwTfPs5FMMA/rt3APpY+PcTsLMEDa/W/Wp6HPty98cCntazA6IeBPvUFCsHZJcJAdAwIPmunQj/IsDBBs+8KO4mdf8G4Y3pBgqj7N0/fE8Ko6xtBqz5PP92J2UBeErvAHOtiPVBNGcHToLHAgSErPUYC0D8vv6VBrMUnN3gQKcIjGI9BS81+PoKxgkGw1fXAnpg1P7YQMz2ih9vAj8J1OznxTr/1YuBBrMWnO3P/vkFZBsDAY7l9P6pL70Dai5jAXKwoP8kJyEBEXR1AXVBfPCtXKcF1hi1AJqqnPtqhTkAwYs7AlIf1PvP5YkFQdo5AfZaHPjlPMcAZZqRAchY2Pgg7FEFDjz/BXVCfPTdTq8D7pUXBIEYIPbF/okH9+RNBB9MgP4pQRUAVNyRBWBxOPNYkhUEwEGfBrd2mPigyBUC/VmrBAACAP12FjEBdjHu+AACAP33jQ0EAtxC+AACAP7FA2UC5RkBAY3pCPN6kPEGufg7BtHF8PxypQEANLkJAgqh7OMGDf8FIzV8/Dvj8OlCXYsHd6WzBAACAP+LIYUH8htI/AACAP1hyi0Cgwpk/WP9/P3KBdUEFWvE98UsdP6sHP0Hm6EbBz2bFPuo6IUGgKoJBijzJPSCAhUF4egrBGM8AP0JPuL47JwHBA3iLPSoGdkEAPzNBXTOpPk7m8b+eEjFB/88pP5HM/0Cf1JLAesepPqbM1EBGoOZAW86lO3D/JMFM4M5AAACAP1foOL6U+f+/2GSNPMVIxT+KwGTBtKt4P3wyFj8YdzbAWvU5PE+ffcEKoClBAACAPzckAkHE4wHAH7pgPuPVj0Gb3KC/0NBHP9UUyz9CvJa/AACAP+l4P0HXJIi+AACoQSlcf8FmZjpBheulwa5H4T2PwtXBj8JZwVyPB8JI4cLBrkc3wlyP+sHXo2zCw/UNwilcl8K4HhHCSGG6wh+F/cG4ntrCcT28wcN19sIfhU/B4foEw65HsUDNjAnDPQrFQaTwCMOF6ypCFC4Bw83MaUKPQufC4fqHQuzRxcIKV45CSGGqwlK4kEIfhYzCuB6NQlK4Y8IpXIBCUrhAwilcgEK4HhjCCtdoQnE96sE9Cj1CXI+ywbgeBkIpXH/Bj8IFQOxREMLsURRB16M5whSuqUG4Hk/CuB4SQjMzWsIAAE1CMzNWws3MUUIpXDLCXI9SQuxRG8KkcD9Cj8L7wVyPK0JmZsrBzcwHQnsUKMJSuMRBcT0MwjMz20EfBfjCuB4mQmZm0cJSuEJC7NGkwgrXTUJmZnzC7FHgwB+F6sLNzPxA4XrFwj0KlUF7FJzCj8KPwfYou8JxPWbBSGGRwpqZgcAK11/CkbgHPw03aD8BMO4+QZ9gP5YmxT4tIVc/j1OUPtO8Sz/uPVw+rcA4Pwe2Kj78jCM/m/4MPqVJCT/zVAc+l+LaPoLiJz75oKc+ludhPqCmdj6Cc5Y+L6M4PuFA2D5uhhs+GhcOP/xSHz5BSC4/U65QPnk7Sj/EX5M+ejZbP/iIyD5632A/yjL0PsX+Yj891RE/gc9fP0YIJz+AfVQ/H/Q0P4B9VD+DF0U/CeFJPwQEUz+lazY/GhdePyECHj8NN2g/ADrMPolBSD/VsuU+is03PwETCD+aQi8/sVAjPyzUKj8Pfz0/L2ksP1qePz9Mpjo/y/g/P8PTQz/2ejc/uYhPP1mjLj8QWFk/qrceP3bDPj8aFw4/jNZJP5EKEz+il3E+9igsPwoutj5g5Tg/pg/9Pn/ZPT/vOB0/wa2rPsZQjj4OvuA+gCvJPvt5Az+/fQU/+MKEPtie2T4KgJE+rwgOP+BKtj5JnSg/S+UtPgh0j8HkKrlBBYZUP6soF0LhdSQ+MZn6PsDwcMGoulBBwLICP3NvKULc2BlBMdNmPy3yNsHUVhA/PWHJPWrMP0KjyqpBAACAPx4Z4sDGmWTBAACAP1omI0BBM9nBAACAP12IZEE0RhLCAACAPwVu7UG4eC/CAACAP6bOOkLwLEDCAACAPxigfUJ9sDrCAACAP9lKnUJpfCXCAACAP/OFtEIkoAPCAACAPwKuxEJQL3rBtDx/PxjmykL0VU1AVaRCOyOGGMKC2LxC0ZF0P6a0wkJyxLNBb9g2PXWCP8LznppCHm1UP346rkL5FyJC6UguPt/sUMLsEmRCSOF6P54hkUJthFRCEsKjPID6RsLjtxdCSOF6PwHmbkKUp2tCEsKjPCj+L8KCkshBMzNzP4g9NUJy7HtCzcxMPUC9D8JIM0dBrkdhPxwT/0GhN39Cj8L1PZKg08GPLDpAmplZP3p+sEFE+2xC+5YZPlCugMFfLF2+wAmFO1KuQUEO3nRCRfV+P0BVH8Gd7gTBAACAP2Uvqj0m5DrBAACAPwg7UEFy6ynBAACAP05m3kHu4+zAAACAPwYU779gJjA/mplZP6ePGkFxMrdA+5YZPhEX5kG5JPxBmplZP8X5iUHkJ4NB+5YZPtwAgEFZvORBmplZP9uEt0HXE/dB+5YZPq5PB0A+bKxBmplZP1mLxkEIEzZC+5YZPmBJEMFo7D1B2ubGPBYYgkGJvkFCIch5P+UdksA+E4BAAACAP8jQnr+8YDS/AACAP31p4EBr+mvAAACAP9Yxa0GnZrPAheuBPqZbIkH0TPZBlgk/P/7AO0FY7VFBM4qFPg4+wD9fqbdBlzk9P6svu0HailNB/fZ9P3ybskI3/gZBuEACPGAjAsJi4qRCFYxiP0A2kkKVY9BBF5rrPWGTAMIeEmpCMzNzP1aEUkJXkRVCzcxMPdgdw8EDuRFCrkdhP2foCEKGei9Cj8L1PQ4zb8Hf25pBAACAP03/l0JhDcDBAACAP9PockKPELnArYZ0P9wFKkJbNQxBsYo3PbwxDUCfV0xCAACAPy+QSkJIRPHBAACAP4TA9kE2trTBAACAPyqHg0FFJBPB1yOkQh+F90EK151C9igmQmbmjkJxPT5CzcxnQo/CSkIUri1CXI88QvYo/EH2KB5CAAC2QT0K9UGF64dBH4WTQRSuX0E9CqdAj8JhQcP1EMEfhZFBj8K7wY/CwUHNzP7BrkcKQuF6DcIzMzVCMzP3wcP1UEJxPbTBexRfQq5HIcEzM21CPQqXP9ejgkKPwiVBSOGSQqRwdUEfBaFCexSsQTMz40FmZqDBUrgfQilct8GPwixC7FE0wYXrO0JI4fo/16NWQnE9YkFcj3ZCPQqvQdejk0LD9QBCAACAQhSuHEKPwk9CzcwKQsP1JkIUrtVBzcwBQs3MREEK19tBZmbGP6Rw00GF6yXBfNViP/lJJT9PXVk/izI7P/jfQj/wokc/yTwaP+8gTj8V49w+MdNGP4wVlT7NIzc/Gm5APrG/JD87/PU9yJgLPzlirT0ukOA+oImwPT2bpT4OMgk+uTZUPnHJUT6M+A4+vTqnPmaI4z2e7+c+aYwWPsrgCD/3x1s+vocTP19GoT5aLx4/ksvPPjJVMD9YqPU+KctIP3EbBT+5GV4/TtERPzElgj4yVXA+LZXHPviIWD5hT9s+L2mcPk0y8j6RCtM+RzgNPzKsAj9SSSU/DqESP5j6ST+w/ic/SWMsPw1UNj/wFgg//yEtP7ah0j7bohw/0JuaPtbF/T7ZPXk+EmvRPp2dbD7PMaA+AACAP1XV7UG7A8LAAACAP+oH+0HH4ptAAACAPzVh2UEf51dBWTSdPPA9SEKiB4lAtRV7P3c8gkFrfLBBdJhvPsERJELlkYFBOxlEPz8Czz9jI8hBj/xBOtsyUUI4ILpBwcUiPx906kHbrcBB4BC6Pl4kRsGphblBPsvzPChHI0KiuuFBOxlcP9AgjUFlpeRBGD7iPV/cwMG+yJZBKpEkPiv42kEqY+lB7j1UP7NLhUAbE+hB2EcnPCX/CcKnICRB3BHuPjdUX0EMjtlBw/UIP6uNEsGjCtRBenBXP6Z+MT97PK9BeTsiPrimscHhlqVBdsN+P7U0NMHlKk5BF/GdO34yB8KBeTNBAACAPxEjh8HeZYdAAACAPxFrg8GkHdbAAACAP7QGBsH7NXHBfA9/P08J+D/3H5TBnNxvOxkCm8GyIZ3BQltWPyEkbUFiZorBcSAkPsWa0cAjXo/BxvkbO04GOMEWIADCpPyUPqzD1EHpHoTB/B0aP9/kpUA1ZYXBFhPbPauGYcCcsLrBH7qgPAVUFUIMb5bBteDFPrEEgEF3UpTBLQkYPxhlukBPp4zBNL+aPRBvvkF1CsDBcqdsP3GodEHeK4TBdQKaOz8eAUJVQ+DBU8t+P0t/wkGLAV/BPX5/P8sijMAiYZNAHhsBO3TE1MERsU1AAACAP2toOMA1zuXAfVx7P/OJEkESHsDAbFuUPD1uSsGiYdvAC0alPlLotkF48JfAZB4pP2A0fj9CBKLAz72HPBuLZcFIL4vBFCJgO6yKEkLdIdLADYlrP0c2bUHa3MrACKycPRoUSMAfUxPB0hgtPSnUyEEBOinByy11Pz9V7ECh27LAAACAP0J/tkEa9LC/f4eiOsGcJ0IDX7vAFK5/P8LqhkGC/RBBSWiLPcP/A0IyTltAT5JuPxyIgUBXLyJB+mGEOqEnMEKQhBFBl+JKPxzerEEinBlBoWdTPuFGCcEigedAMZmqPSHy2UHkoEhBMqxqPzEalkC6IEZBsb/8PoDFdkFggFRBgJ8BP1jH5MAZkUpBvsFvP72be0CfIR9B1eyBPccClMHjBA5B9ijkQFK45MHhehRBMzMkwoXrZUHD9VTCFK6bQR+Fe8IzM89BzcyUwvYoDkJcj6fCcT00QtcjtMIUrl9CAADBwrgeh0LD9cfCcb2XQtejzsKamaBCexTZwjOzqUJ7lNzC9ii4QgCA0MK4nrtCCle7wuH6uULXI6XCZma1QgrXjcKaGalC4XprwnsUmkKuR0vC16OeQuxRJsLD9ZtCCtf1wRSukEJSuKjBAAB+QuxRaME9CllCzcwwwVK4LkJ7FELB7FEhQvYo1MDhegVCPQonwOxRtkEUrifAuB5dQVyPDsGuR/lAAACOwUjhg0J7FFrCrkdaQtejVsLD9TlCPQpPwgrXGEIAAIzBXI/6QQAAysGF6wJCSOFewsP1LkIKV4DCCtdUQuF6j8JSOINCM7OWwlwPnUIzM6bCPQqmQilcwMJI4exB9igpwsP1MELD9SLC9ihqQtejI8KFa4pCmpkYwo/CH0J7FPbBuB5AQq5Hx8HhemBCj8KZwexRmkEUrhrC4XqMQaRw4cEK16NBMzObwdej6EFmZjrBEjFlPrD+Lz/KGnU+pN8WP6RwjT4Pl/w+MlWgPoWx1T52Mrg+DDynPrX92z4Sa4E+H0v/PmsOUD73xxM/0zAcPnNoKT83GgA+t9E4P7Ytyj19BUE/hc5rPX15ST+LpjM9iuVWP3cQuz2bIFo/7+EyPi+jWD/xRoY+L2lUP1pHtT6x+Ug/8+XlPoAOOz8PKAM/gEg/PxTLFT8lzDw/yasrP+5aMj+OHj8/YvMhP8RaTD95zBA/E2FTP2lS+j70N1E//OPtPgpLXD8oCtQ+QWVkP6DDrD5BZWQ/FXSLPlOzVz94KGo+Zd9FP9F0Jj+daPc+T10RP0jh+j5PWAI/cEIBP8kC5j6SXEY/DXHMPkG8Nj91jtE+bovyPs11+j4Sg9A+ms4OP7L0sT760CU/dF6jPh3JPT/SHYQ+whdGPzarHj5FDcY+bFsUP1Jh/D6eexc/2LYYPyUjFz9Vhyw/RrEcP5Bm7D79nys/RzgFP4NuNz9HPRQ/5+NCP/qznz6Lphs/M1CZPv7UMD+MLaQ+xopCPxAjxD4XK1I/Zk4XP5yxRMEFAsjA5WHRPjijhMFQkyjAgNR+PymBjb9LQ0LBKxiVOz8pWMHUZW7BAACAP3+ROkFYmXjB1q1+P7E9s0EqCIvBjxmoO6UarMHRHWzBrMWnN7xI3r9Gpw/CoBVQPxfaDUIIX5rBQKQ/PpYuEMH45ZfBrMUnN8dSsUBNsTvC8rWnPrkZQ0IX+4rBuCMsP3/BjUB035vBv7dpPStCbkKJkFrB8bpePwpee0E+Jo7BHEKVPW0EV8H6N4bBbqPhPhyi4EHQI3TBoS0PP7KNXr/KM3rBi3H+PAEyHELGlyDB4L52P8azKUFJYzrBPiKmO6yJk7/c2nHBYi02P9BlmkFP7hfB7KOTPicrk0A7AwTB7MD5PWqSz0HMMDLBtKtgP5T2LkG0CLXAcjPcOeU4BkLUg7vBAACAPxUnYEFQ3++/CCB9P94iKEGq6dtAF9Q3PMILGEK8iTvB8ddMPw1wfD9vwDxBnZ1MPv0Y+UHDqV/AJqq3PDNXqEEUyopB8S43Pt8jHcEgVmdBo3VMPymesUFhGUlAnFCIOZfbrMG9SX5Bpu1/P189PkEnbBBBUU6EPrXD6UEQ7UxBXMk2P+fTn78SBkRBe9rhPE62HkKMI7XBJLkkP/bgk0Gv8XNBKA8LPnr/Q8HgUD1BbARiPihm90FIcX/BLT7FPiDbckHpXcFBxcl9PFABjsEYypxBc2gZP2X9/EGaKM/AVACMPSsj/0AskgFCTn9uPw7f40Gi4X9AYviIPHeSP0JQBxtB7bZ7P1J2qkGr5khBZaogPo9bGkIBWnlBv9RXP1PdN0F/aYxBkQrjPvvv6EE73pJBEHoOPzV65j9eY5tBe2tgP00slUHz9oNB7Z78Pa4tB8GqroRBqyZ4P3ZbbkEx2q1BtRX7PHjFSsE3katBXmN/P9cN9UCSyclBxvkbOzWrocFI8MFBAACAP/8XOcCYa8NBDHbDPNGGvsH3yzBBqON5P83rNcGk6ItBxy4xPl7fo8FmhGE/p7NTP2HQhcH3mQNBznBrPwseNkF+Wb5AthDkOzaphcHe04E/SDOWPT/RpEGzyavBAACAP/E8vz8xhoo+B19YPg2K8EF8Oi1BludJPx1koUG4JBvAFqR5P0ZzWUHTvitBSWjLPLAOT8FL/SVBAACAP61z6UCWmB9AWP9/P2+MxkGcrR/AFhgiPx3qGEJyd4o/zeSrPv6CKMBZQxA/tI4qPA2xz0Gi21vBKT+pPA53x79nJGjBaqRVP45/F0Ho2aU/umspPoZ2KEFkL3fBCroFPwu3qEFoxt1AybBKPt9ZrMDA4eVAPKVjPjKEtkFteTfBUvJqPXjGlL+0q03BNUEsP80EGkFTVQdBRnynPpBiUkEpVALBAACAP5dO4DxkrEI//B1KPt1TREE9/U1A2XdNPy6kkD9pLLzAsmhSP0mxNkFpWJRASKeuO6z5ZMFb5KRA1bK1PYCkqkGJ5j/B7BesPQRyRsCTajjBdbA+PoxitEF221lB2/lePuDAGMCFxFBBxJQYPztoMEGKvhTBYr48O0gb6EGBVbRB2ZQLPrpsnEBynapBaOifOvul18FvEGNBIAxcP46nqEHaLpnAAACAPydogkHcFhfAV3gHP7t4v0FbXoJAAg7xPlglAcDI45ZAR6zVPqeh/EGGliVBNSkVP0EfoEAE5TpBAACAP9IHR0BmWjDARKgaP5pUyMAiIhFAKa7KPtuvxsAipbm/TTKyPbYLN8Fc9B5BD7lpP1TAfMCstvBAYyh/P1SkgUBOPH5BRfVWO1dht8Ebx2lBXI83QgAAa0IpXBJCAABmQrge8UF7FFxCMzPtQSlcOUKuR+VBuB4ZQuxR4EHNzOxBpHDVQWZmoEGamclBAAA4QY/Ct0HhenRAexSaQR+Fy8CuR5FBexSGwXE9kkGamcvBUrjQQR+FxcE9CgxCUriowWZmGEJI4TLBrkclQgAAwL97FDhC7FEUQeF6QUIUrotBpHBJQgAA2kEK11JCMzMUQnE9W0JmZjlCUrhfQpqZXkKPwl1ChetyQlK4yEHsUXzBrkf3QWZmZsGamdVBKVzHwHsUA0IfhbPApHDlQY/ClUBmZg9CheuRQDMz+UEUrltBcT0eQpqZZUHD9QdCrke5QRSuKUKuR71BZmYOQo/CBkJ7FDJCcT0MQilcFEKF6zJCexQ1QmZmN0Ii4Dg/PUl6P1mGED9SuHY/1xfpPtWVbz+GyeQ+G55WPzQu3D4qbz8/o8zWPhh4Jj9A9so+vQALP54Mvj6GyeQ+Ka6qPoaPuD4TZoo+GCF8PoC3gD5iSgQ+wcqBPuutAT2vlMU+A+wjPeiHCT8+s6Q9K/sWPzF8RD4O+CQ/AOOZPmpqOT898tc+RKNDP8+DAz+WPkw/tLAfPxh4Vj9A3js/sp1fPxueVj/7dGQ/nl5xP9NNYj8AAIA/Xfm8PquyDz6ojO8+VmUfPkD2yj56jX0+W7H/Pk9Ygj40Ltw+eo29PvFLDT9J17w+KbPxPs+g8T78bx0/EjH1Ppc5BT8D7BM//88pPwxZFT8JOAw/yTwyP5n1Mj90KTY/2qwSP0D7UT8BMDY/EjFVPwAAgD+shQFCXptkwFj/fz9cRO9BVV2vQFj/fz+MwtRBmLU4QVj/fz/QaY9BeRAuQazFJzeFhDZC2j9tQd21BDxDdt9Bs8A6QdnrfT+t5xxBA6osQazFpzco8RRCxoVIQXiXqz7BnJpBXSMmQaUxKj/DfI8/qxQkQTgyjzvhM95BgFgqQbJjcz+XWxtBtgoaQRfUNz12ZgjBEWMlQUX1tj7cv5lBFEoTQbaEJD93foU/Qk8TQWcscj/jvTNBFSwMQRsvXT3SCN7ALVMbQQAAgD/+lcw+uR4OQQAAgD8caxzBDgPPQAAAgD+0eI/BPjpeQAAAgD+eAWrBeyZpwAAAgD+gTwTBqs4twQAAgD+CrgZAqNQnwcAhVD/f3kRBkgklwWB2Lz5eCgLBxsUVwd9scz2wMMBBkMsywaTCcD+gIlpANJI5wWK+vDiTKYXBGTEkwTFCYD+/nj5BHK5BwTrp/T3BdAPBZhU4wbh1dz54N69BWZU+weohQj+xLuA/JN9CwSdmPTtj1P9BsxJBwfJBfz+ObDxB/VhTwQAAgD/KLqpBc+tgwQAAgD8pHfVBRvNewQAAgD8IcA5C0WZMwQAAgD9mXdHAcUaFPgAAgD/IalTAYs+YwAAAgD9CbT9AOh/0PwAAgD9b4rJAaz1nwA5KaD/JCV9BJzhqQFCqvT1zUZvAZ1WKQNO8Kz+6pYFBRzVJwAqFqD6pB1rAN9YswCuH1j2wX7pBjaWKQHMuZT+hjJBAIL54QAAAgD8+nt5AfPCFwLvVcz/ybmVBgQNLQNmZQj0XJI/AcjtgQFYODT/4VIVBIkSewATi5T7mBTfA5SOZwFj/fz/crMVAHXdTQAAAgD8xfQtBol+rwFj/fz8fiopBgKNSQAAAgD8QGZxBdWCVwDwZRBlEGTwZTBlEGUQZTBlUGVwZXBlUGUQZZBlkGUQZRBlsGUQZdBlEGUQZdBlEGXQZRBlEGXQZRBl0GUQZRBl0GTwZRBlEGTwZTBlEGUQZTBlUGVwZXBlUGUQZZBlkGUQZRBlsGUQZdBlEGUQZdBlMGUQZRBlMGUQZRBlMGTwZRBlEGTwZRBlEGTwZRBlkGWQZRBlkGWQZRBlUGVwZXBlUGVwZXBlUGUQZdBlEGXwZRBl0GUQZbBlEGWwZRBlEGUQZhBlEGYwZdBlEGUQZdBlEGUQZdBlEGXQZRBlEGXQZRBl0GUQZRBl0GUwZRBk8GUQZRBlkGVQZXBl0GXQZRBlEGWwZRBmMGUQZhBmMGXQZRBlEGXQZRBl0GUwZRBlEGUwZPBlEGUQZPBlEGWQZZBlEGVQZXBlcGVQZRBlsGUQZdBlEGUQZdBlEGXQZRBl0GUQZTBlEGTwZRBlUGUQZdBlEGXQZdBl0GQAAAAAAAAAAAAAAAD0Kz0AAAAAA16O5wgAAAADNzITCAAAAAGZmNcIAAAAAAAAAAAAAgD8AAIA/AACAPwAAgD8pXI8+CtejPilcjz4K16M+AACAPwAAgD8AAIA/AACAPwAAgD8AAIA/CtejPgrXoz4K16M+CtejPgAAgD8AAIA/AACAPwAAgD8AAIA/AACAPwrXoz4K16M+CtejPgrXoz4AAIA/AACAPwrXoz4K16M+CtejPgrXoz4AAIA/AACAPwAAgD8AAIA/CtejPgrXoz4K16M+CtejPgrXoz4K16M+AACAPwAAgD8AAIA/AACAPwrXoz4K16M+AAAAAAAAAAArLE09AAAAAKegbL0AAAAADE9FPAAAAACTn+c9AAAAAAAAAAAAAAAAAAAAAAAAAADryH09AAAAAEBRur4AAAAA6kHdPQAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAArLE09AAAAACssTT0AAAAADwZGvQAAAAAPBka9AAAAALfcrzwAAAAAt9yvPAAAAAAxmk69AAAAAAAAAAAAAAAAAAAAAAAAAADZcLg9AAAAAInb1L4AAAAAJk8bvwAAAACLhJS+AAAAAAAAAAAAAAAAAAAAAAAAAADWMpe9AAAAAMEZIj8AAAAA2nywPgAAAAD7lRA+AAAAAAAAAAAAAAAAAAAAAAAAAABxPQo/9ij8P8P1eMAfhWs/w/V4wB+Faz8fhZNAZmZmwAAAAAAAAAAAAAAAAAAAAADY6Ze9AAAAAKNUCj4AAAAAo1QKPgAAAADhDpq9AAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAACssTT0AAAAAKyxNPQAAAAALQQQ9AAAAAAtBBD0AAAAAuhrRPQAAAAC6GtE9AAAAANa5tz0AAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAA68h9PQAAAADryH09AAAAAEBRur4AAAAAQFG6vgAAAADqQd09AAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAHE9SsDNzDzAcT1KwM3MPMAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAADg7Ho9AAAAAODsej0AAAAAnm2pvQAAAACebam9AAAAAHkioL0AAAAAeSKgvQAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAADWMpe9AAAAANYyl70AAAAA0Eu2PQAAAADQS7Y9AAAAALUzcL0AAAAAtTNwvQAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAC/9ihowQAAAL/2KGjBAAAAAAAAAAAAAAAAAAAAAJzakD4AAAAAsnzvvwAAAACd5dO/AAAAAGnj3r8AAAAAEbfKvwAAAAASSuO/AAAAAGSNzb8AAAAAAf3gvwAAAACQXsi/AAAAABNZ2b8AAAAANfqOJQAAAAAAAAAAAAAAAAAAAAAAAAAAXI+iQJqZgcBcj6JAmpmBwAAAAAAAAAAAAAAAAAAAAAAh8w0/AAAAAMXokr8AAAAAxeiSvwAAAAA1+o6lAAAAAAAAAAAAAAAAAAAAAAAAAADryH09AAAAAEBRur4AAAAAQFG6vgAAAADqQd09AAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAODsej0AAAAAZi2TvgAAAABmLZO+AAAAAKeg7L0AAAAAp6DsvQAAAAAksIq9AAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAKRwfcCamWnApHB9wJqZacDsUVRBpHD9v+xRVEGkcP2/MzNjQVyPqsAzM2NBXI+qwPYozEAzM4vAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAz6wlvgAAAADPrCW+AAAAAHMvx74AAAAAcy/HvgAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAADWMpe9AAAAALsmyT4AAAAAuybJPgAAAAAdIGo+AAAAAB0gaj4AAAAAvulBPgAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAABxPQZBw/V4QHE9BkHD9XhAPQp3QArXE0AAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAApBhy+AAAAACkGHL4AAAAAAAAAAAAAAAAAAAAAAAAAAFKntj0AAAAAQmvzvQAAAABCa/O9AAAAAIg8xD0AAAAAAAAAAAAAAAAAAAAAAAAAAG/b/r0AAAAADE/FPQAAAAAMT8U9AAAAAFtdCL4AAAAAAAAAAAAAAAAAAAAAAAAAAIadM74AAAAAdmufPQAAAABi2Uo+AAAAAIUM5L0AAAAA6ro8PQAAAACOOxW+AAAAAABzwjwAAAAABdMCvgAAAAAIioM9AAAAACdni70AAAAAAAAAAAAAAAAAAAAAAAAAALSejr0AAAAA3leZPQAAAAB952G+AAAAAF2Dub0AAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAA68h9PQAAAABAUbq+AAAAAEBRur4AAAAA6kHdPQAAAAAAAAAAAAAAAAAAAAAAAAAA03uWPQAAAAALQQS+AAAAAPhNQD0AAAAAAAAAAAAAAAAAAAAAAAAAAFimB74AAAAA0wI3PAAAAADTAjc8AAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAHsUMkHsUYDA16OowPYo/D/Xo6jA9ij8P4/Ctb89Cpc/AAAAAAAAAAAAAAAAAAAAAArXYz+F6/G/hetxQArXIz2F63FACtcjPQAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAMrFRL4AAAAAysVEvgAAAAAAAAAAAAAAAAAAAAAAAAAAm7YovgAAAAC5DBA+AAAAALkMED4AAAAA5Ey7vQAAAAAAAAAAAAAAAAAAAAAAAAAAGuJIvgAAAABI4yM+AAAAAEjjIz4AAAAAkejmvQAAAAAAAAAAAAAAAAAAAAAAAAAAv3qRPQAAAAAiB0u9AAAAAPHHTr4AAAAAtlUPvgAAAAAAAAAAAAAAAAAAAAAAAAAAllboPQAAAAAiB0u9AAAAALL1Tr4AAAAAtlUPvgAAAAAAAAAAAAAAAAAAAAAAAAAAZqg7PgAAAABw/R2+AAAAAHD9Hb4AAAAAL/s9PgAAAAAAAAAAAAAAAAAAAAAAAAAAkod3vgAAAABI4yM+AAAAAEjjIz4AAAAAVe+GvgAAAAAAAAAAAAAAAAAAAAAAAAAAkod3vgAAAABI4yM+AAAAAEjjIz4AAAAAVe+GvgAAAAAAAAAAAAAAAAAAAAAAAAAAZqg7PgAAAABw/R2+AAAAAHD9Hb4AAAAAL/s9PgAAAAAAAAAAAAAAAAAAAAAAAAAAUqe2PQAAAABCa/O9AAAAAEJr870AAAAAiDzEPQAAAAAAAAAAAAAAAAAAAAAAAAAAb9v+vQAAAAAMT8U9AAAAAAxPxT0AAAAAW10IvgAAAAAAAAAAAAAAAAAAAAAAAAAAUqe2PQAAAAC1M3A9AAAAALUzcD0AAAAAiDzEPQAAAAAAAAAAAAAAAAAAAAAAAAAAb9v+vQAAAAAMT8U9AAAAAAxPxT0AAAAA8+u2vgAAAAAAAAAAAAAAAAAAAAAAAAAAHjaRvgAAAACvPs49AAAAAK8+zj0AAAAAqldtPAAAAAAAAAAAAAAAAAAAAAAAAAAAhp0zvgAAAACPSVY+AAAAAKaSqz4AAAAAZSEbPQAAAAAXK0g+AAAAAIjDZDsAAAAAfXgxPgAAAAC33K88AAAAACHvWj4AAAAAETamPQAAAAAAAAAAAAAAAAAAAAAAAAAA03uWPQAAAABHUlS+AAAAAO5//rwAAAAAAAAAAAAAAAAAAAAAAAAAAFimB74AAAAAz6ylPgAAAADPrKU+AAAAAAAAAAAAAAAAAAAAAAAAAABYpge+AAAAANMCNzwAAAAA0wI3PAAAAABxhD6+AAAAAAAAAAAAAAAAAAAAAAAAAACbtii+AAAAALkMED4AAAAAuQwQPgAAAADkTLu9AAAAAAAAAAAAAAAAAAAAAAAAAAAa4ki+AAAAAEjjIz4AAAAASOMjPgAAAACR6Oa9AAAAAAAAAAAAAAAAAAAAAAAAAACSh3e+AAAAAEjjIz4AAAAASOMjPgAAAABV74a+AAAAAAAAAAAAAAAAAAAAAAAAAACSh3e+AAAAAEjjIz4AAAAASOMjPgAAAABV74a+AAAAAAAAAAAAAAAAAAAAAAAAAAA1+g48AAAAACIHS70AAAAA8cdOvgAAAAC49B++AAAAAAAAAAAAAAAAAAAAAAAAAAC/epE9AAAAACIHS70AAAAA8cdOvgAAAAC2VQ++AAAAAAAAAAAAAAAAAAAAAAAAAABmqDs+AAAAAHD9Hb4AAAAAcP0dvgAAAAAv+z0+AAAAAAAAAAAAAAAAAAAAAAAAAABmqDs+AAAAAHD9Hb4AAAAAcP0dvgAAAAAv+z0+AAAAAAAAAAAAAAAAAAAAAAAAAABv2/69AAAAAAxPxT0AAAAADE/FPQAAAADz67a+AAAAAAAAAAAAAAAAAAAAAAAAAABv2/69AAAAAAxPxT0AAAAADE/FPQAAAABbXQi+AAAAAAAAAAAAAAAAAAAAAAAAAABv2/69AAAAAAxPxT0AAAAADE/FPQAAAABbXQi+AAAAAAAAAAAAAAAAAAAAAAAAAABSp7Y9AAAAAEJr870AAAAAQmvzvQAAAACIPMQ9AAAAAAAAAAAAAAAAAAAAAAAAAABSp7Y9AAAAAMpWlL0AAAAAylaUvQAAAACIPMQ9AAAAAAAAAAAAAAAAAAAAAAAAAABSp7Y9AAAAAEJr870AAAAAQmvzvQAAAACIPMQ9AAAAAAAAAAAAAAAAAAAAAAAAAADTe5Y9AAAAAM4bVr4AAAAAE2YGvQAAAAAAAAAAAAAAAAAAAAAAAAAAJk8bPgAAAABMshS9AAAAAEyyFL0AAAAAAAAAAAAAAAAAAAAAAAAAAFimB74AAAAA/TQhPgAAAAD9NCE+AAAAAAAAAAAAAAAAAAAAAAAAAABYpge+AAAAAL3R0T0AAAAAvdHRPQAAAAAQr4W9AAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAACIHS70AAAAA8cdOvgAAAAC49B++AAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAACIHS70AAAAA8cdOvgAAAAC49B++AAAAAAAAAAAAAAAAAACAPwAAgD8AAIA/AACAP8P1iD/D9Yg/AACAPwAAgD/D9Yg/w/WIPwAAgD8AAIA/w/WIP8P1iD8AAIA/AACAP8P1iD/D9Yg/AACAPwAAgD8AAAAAAAAAAG/b/r0AAAAADE/FPQAAAAAMT8U9AAAAAFtdCL4AAAAAAAAAAAAAAAAAAAAAAAAAAG/b/r0AAAAADE/FPQAAAAAMT8U9AAAAAFtdCL4AAAAAAAAAAAAAAAAAAAAAAAAAAFKntj0AAAAAQmvzvQAAAABCa/O9AAAAAIg8xD0AAAAAAAAAAAAAAAAAAAAAAAAAAFKntj0AAAAAzQ2VvQAAAADNDZW9AAAAAIg8xD0AAAAAAAAAAAAAAAAAAAAAAAAAAFKntj0AAAAAQmvzvQAAAABCa/O9AAAAAIg8xD0AAAAAAAAAAAAAAAAAAAAAAAAAAFimB74AAAAAl3iHPQAAAACXeIc9AAAAABCvhb0AAAAAAAAAAAAAAAA9Chc/zcwMPxSuhz8fhYs/PQoXP83MDD8AAAAAAAAAAAAAAAAfhcHBAAAAAAAAAAAAAAAAAAAAAK5H0cDD9ZjBAAAAAAAAAAAAAAAAAAAAABSun0CamV3BAAAAAAAAAAA9Chc/zcwMPxSuhz8fhYs/PQoXP83MDD8AAAAAAAAAAAAAAAC4HmVAAAAAAAAAAAAAAIA/AACAPwAAgD8zM3M/AACAPwAAgD8AAAAAAAAAAOxRSMBmZuY/AAAAAAAAAAAAAAAAAAAAAD0KV757FFbBAAAAAAAAAAAAAAAAAAAAALqTML0AAAAAAAAAAAAAAAAAAAAAAAAAAKIy6z0AAAAAAAAAAAAAAACamRk/7FE4vgAAAAAAAAAAAAAAAAAAAAAUrmdA16OQv5qZGT/sUTi+AAAAAAAAAAAAAAAAAAAAAFtT2bwAAAAAW1PZvAAAAAAAAAAAAAAAAAAAAAAAAAAAhQzkPQAAAAAAAAAAAAAAAAAAAAAAAAAAhP6ivQAAAAAAAAAAAAAAAFK4nj8K16O+AAAAAAAAAADNzBhBexQewFK4nj8K16O+zOt1vAAAAABvZIklAAAAAC5q7r0AAAAAzOt1vAAAAAC4HkU/AAAAAAAAAAAAAAAAAAAAAAAAAABmZqZAAAAAALgeRT8AAAAAAAAAAAAAAAAAAAAAAAAAAGT/+70AAAAAZP/7vQAAAAAAAAAAAAAAAPAovjwAAAAA3TV6pQAAAADdNXqlAAAAAKIy6z0AAAAA8Ci+PAAAAAAAAAAAAAAAAClc7z9SuJ4+AAAAAAAAAAAAAAAAAAAAAJs9yT0AAAAAAAAAAAAAAAAIioO8AAAAAMZxfKUAAAAAxnF8pQAAAACE/qK9AAAAAAiKg7wAAAAAAAAAAAAAAACqV229AAAAAAAAAAAAAAAAAAAAAAAAAAD+u0G9AAAAAAAAAAAAAAAA8Ci+PAAAAADdNXqlAAAAAN01eqUAAAAAojLrPQAAAADwKL48AAAAAFXl1zwAAAAAlDA3JQAAAACUMDclAAAAAPLfvj0AAAAAVeXXPAAAAACPwjU/cT0KPwAAAAAAAAAAAAAAAAAAAAAAACBAMzPzP4/CNT9xPQo/AAAAAAAAAAAAAAAAAAAAABcryDwAAAAAFyvIPAAAAAAAAAAAAAAAAAiKg7wAAAAAxnF8pQAAAADGcXylAAAAAIT+or0AAAAACIqDvAAAAAAfhWs+rkfhPQAAAAAAAAAAAAAAAAAAAABI4RpASOGaPx+Faz6uR+E9AAAAAAAAAACP2iU+AAAAAAAAAAAAAAAAAAAAAAAAAACreYy9AAAAAAAAAAAAAAAAAACAPwAAgD8AAIA/XI+CPwAAgD8AAIA/AAAAAAAAAACkcJ0/ZmamPwAAAAAAAAAAAAAAAAAAAADOlLW9AAAAAAAAAAAAAAAAE2aGvAAAAADCuDKkAAAAAMK4MqQAAAAAqldtvQAAAAATZoa8AAAAAGYvXLwAAAAArIdNJQAAAACsh00lAAAAAP67Qb0AAAAAZi9cvAAAAADwKL48AAAAAN01eqUAAAAA3TV6pQAAAACiMus9AAAAAPAovjwAAAAAAAAAAAAAAABeCto9AAAAAAAAAAAAAAAAAAAAAAAAAAB8YEG+AAAAAAAAAAAAAAAAhevRPx+F674AAAAAAAAAAAAAAAAAAAAAw/XYQOF69L+F69E/H4XrvgAAAAAAAAAACtfjP+F6BEAAAAAAAAAAAAAAAAAAAAAA9Q+fvQAAAAAAAAAAAAAAAAAAAAAAAAAA/kLivQAAAAAAAAAAAAAAAAAAAAAAAAAAUP72vQAAAAAAAAAAAAAAAAAAAAAAAAAA6JQLvgAAAAAAAAAAAAAAAAAAAAAAAAAAeAowvgAAAAAAAAAAAAAAAAAAAAAAAAAAAQQSPgAAAAAAAAAAAAAAAAAAAAAAAAAAsvVOvgAAAAAAAAAAAAAAAAAAAAAAAAAAgJ5ivQAAAAAAAAAAAAAAAAAAAAAAAAAA/SpyPgAAAAAAAAAAAAAAAHd5YD0AAAAAHkIJPAAAAABBX/s+AAAAAHd5YD0AAAAAAAAAAAAAAACreYy9AAAAAAAAAAAAAAAAAAAAAAAAAAA+prE9AAAAAAAAAAAAAAAAE2aGvAAAAADCuDKkAAAAAMK4MqQAAAAAM8ouvgAAAAATZoa8AAAAAGYvXLwAAAAArIdNJQAAAACsh00lAAAAAP67Qb0AAAAAZi9cvAAAAAATZoa8AAAAAMK4MqQAAAAAwrgypAAAAACqV229AAAAABNmhrwAAAAAfedhPAAAAAB82SAlAAAAAHzZICUAAAAAXgraPQAAAAB952E8AAAAAAAAAAAAAAAAUHdWvAAAAAAAAAAAAAAAABcryLwAAAAAllboJAAAAACWVugkAAAAAHxgQb4AAAAAFyvIvAAAAAAAAAAAAAAAAHxgQb4AAAAAAAAAAAAAAACfe2q8AAAAAHtGCKUAAAAAe0YIpQAAAAD+QuK9AAAAAJ97arwAAAAA/a2AvAAAAADF3uMkAAAAAMXe4yQAAAAAUP72vQAAAAD9rYC8AAAAAKaSq7sAAAAAufxkJQAAAAC5/GQlAAAAAICeYr0AAAAAppKruwAAAABztJ68AAAAAHtGiCUAAAAAe0aIJQAAAACy9U6+AAAAAHO0nrwAAAAAmQ3pvAAAAADCuLKkAAAAAMK4sqQAAAAAeAowvgAAAACZDem8AAAAAN/eubwAAAAAxd5jJQAAAADF3mMlAAAAAOiUC74AAAAA3965vAAAAAByC188AAAAAMK4sqMAAAAAwriyowAAAAABBBI+AAAAAHILXzwAAAAA3965PAAAAADF3mOlAAAAAMXeY6UAAAAA/SpyPgAAAADf3rk8AAAAAD+08r0AAAAAfNkgpQAAAAB82SClAAAAAC3X1b4AAAAAP7TyvQAAAAA7aJC8AAAAAJQwN6UAAAAAlDA3pQAAAAAm1ju+AAAAADtokLwAAAAAAAAAAAAAAACreYy9AAAAAAAAAAAAAAAAR1JUPQAAAAAdmck8AAAAAE1H9j0AAAAAR1JUPQAAAAA7aJA8AAAAAB5CCTwAAAAA3TV6PgAAAAA7aJA8AAAAAAAAAAAAAAAAPqaxPQAAAAAAAAAAAAAAAD8t0jwAAAAAwriyIwAAAADCuLIjAAAAAF4K2j0AAAAAPy3SPAAAAAAu4826AAAAAG9kiSQAAAAAb2SJJAAAAABQd1a8AAAAAC7jzboAAAAA5Ew7vQAAAADCuLIkAAAAAMK4siQAAAAAfGBBvgAAAADkTDu9AAAAABcryLwAAAAAllboJAAAAACWVugkAAAAAHxgQb4AAAAAFyvIvAAAAAD/ZIG9AAAAAMK4siQAAAAAwriyJAAAAAB4CjC+AAAAAP9kgb0AAAAAKyxNvQAAAADCuLIkAAAAAMK4siQAAAAA6JQLvgAAAAArLE29AAAAADPKrr0AAAAAkgqGpQAAAACSCoalAAAAADPKLr4AAAAAM8quvQAAAABKCVW9AAAAAKyHTaUAAAAArIdNpQAAAAAm1ju+AAAAAEoJVb0AAAAAiMNkvAAAAADF3mMlAAAAAMXeYyUAAAAATLIUvgAAAACIw2S8AAAAADyAAL4AAAAAvUoxPQAAAABU15a+AAAAADyAAL4AAAAAieWDPQAAAAAdmck8AAAAAFCBhT4AAAAAieWDPQAAAADuf/48AAAAAB5CCTwAAAAA3TV6PgAAAADuf/48AAAAAORMO70AAAAAwriyJAAAAADCuLIkAAAAAHxgQb4AAAAA5Ew7vQAAAAAAAAAAAAAAAD0KF8AAAAAAAAAAAAAAAAAK16M+CtejPgAAgD8AAIA/CtejPgrXoz4AAIA/AACAPwrXoz4K16M+AACAPwAAgD8K16M+CtejPgAAgD8AAIA/CtejPgrXoz4AAIA/AACAPylcjz4K16M+AACAPwAAgD8AAIA/AACAPwrXoz4K16M+AACAPwAAgD8AAAAAAAAAAGaoOz4AAAAAnvTJvQAAAAA5v9A8AAAAAHD9Hb4AAAAAOb/QPAAAAABw/R2+AAAAAI0jJT4AAAAA7xzGvgAAAAAvjI0+AAAAAI0jJT4AAAAA7xzGvgAAAAAvjI0+AAAAAI0jJT4AAAAA7xzGvgAAAAAvjI0+AAAAAPYdYD4AAAAAZqg7PgAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAA16P4wQAAAADXo/jB7FFAQdejT8LsUUBB16NPwgAAAADXo/jBAAAAAAAAssEAAAAAAAAAAAAAgD8AAIA/AACAPwAAgD97FG4/H4WLP3sUbj8fhYs/AACAPwAAgD8AAIA/AACAP3E9ij+PwnU/cT2KP4/CdT8AAIA/AACAPwAAgD8AAIA/AACAP8P1iD8AAIA/AACAPwAAAAAAAAAArkeBQFK4vr/D9XjAH4VrPwrX68BmZsY/w/V4wB+Faz8K1+vAZmbGP8P1eMAfhWs/16PwPqRw3T9SuAZBexTuv0jhMsGkcJ1Aj8KlQK5HYb7Xo/A+pHDdP1K4BkF7FO6/SOEywaRwnUCPwqVArkdhvtej8D6kcN0/UrgGQXsU7r9I4TLBpHCdQI/CpUCuR2G+7FEYQNejcD9xPQo/9ij8PwAAAAAAAAAAAAAAAAAAAABsnV2+AAAAAKNUCj4AAAAAzpQ1PgAAAACjVAo+AAAAAM6UNT4AAAAAo1QKPgAAAAAQr4W9AAAAAAOZc74AAAAAsvXOPgAAAACBtlK+AAAAABCvhb0AAAAAA5lzvgAAAACy9c4+AAAAAIG2Ur4AAAAAEK+FvQAAAAADmXO+AAAAALL1zj4AAAAAgbZSvgAAAADdNfq9AAAAANjpl70AAAAAAAAAAAAAAAAAAAAAAAAAAG/b/r0AAAAADE/FPQAAAAATZoY8AAAAAAxPxT0AAAAAE2aGPAAAAAAMT8U9AAAAAPYd4L0AAAAAddpPvgAAAAD2HeC9AAAAAMABMr4AAAAA9h3gvQAAAAB12k++AAAAAPYd4L0AAAAAwAEyvgAAAAD2HeC9AAAAAHXaT74AAAAA9h3gvQAAAADAATK+AAAAAG/b/r0AAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAcT0GQcP1eEBxPQZBw/V4QAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAACkGHL4AAAAAKQYcvgAAAAAAAAAAAAAAAAAAAAAAAAAAAHNCPgAAAABCa/O9AAAAACOOa74AAAAAQmvzvQAAAAAjjmu+AAAAAEJr870AAAAAfNmgPQAAAACzkpY+AAAAAKTzmj4AAAAAY3hbvQAAAAB82aA9AAAAALOSlj4AAAAApPOaPgAAAABjeFu9AAAAAHzZoD0AAAAAs5KWPgAAAACk85o+AAAAAGN4W70AAAAAUqe2PQAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAABxPQpBMzMWQnE9CkEzMxZCw/UAQexRxEHD9QBB7FHEQQAAAAAAAAAAAACAPwAAgD8AAIA/AACAPwAAAD8AAAA/AADAPwAAwD8zMzM/MzMzP5qZmT+amZk/MzMzPzMzMz8AAMA/AADAPwAAgD8AAIA/AAAAAAAAAAAAAAAAAAAAAD0Kv8DD9ag/uB4lwc3MnEAfhRvAj8IlQD0Kv8DD9ag/uB4lwc3MnEAfhRvAj8IlQD0Kv8DD9ag/uB4lwc3MnEAfhRvAj8IlQK5HkcAfhes/rkfZwK5HwT8AAAAAAAAAAAAAAAAAAAAA18f4PAAAAAATZga8AAAAANfHeD0AAAAA/a0APQAAAADXx3g9AAAAAP2tAD0AAAAAzOv1OwAAAAAiB0s8AAAAAMgmNDwAAAAAzOv1OwAAAAAiB0s8AAAAAMgmNDwAAAAAzOv1OwAAAAAiB0s8AAAAAMgmNDwAAAAAQNYRPAAAAAAAAAAAAAAAAAAAAAAAAAAAJTcrPgAAAAAnXVy+AAAAAByLCD0AAAAAJ11cvgAAAAAciwg9AAAAACddXL4AAAAAC0GEPQAAAACKbCQ+AAAAAKeg7L0AAAAAC0GEPQAAAACKbCQ+AAAAAKeg7L0AAAAAC0GEPQAAAACKbCQ+AAAAAKeg7L0AAAAAM1HPvAAAAADTe5Y9AAAAAAAAAAAAAAAAAAAAAAAAAABmqDs+AAAAAAxPRb4AAAAAV44XvAAAAABw/R2+AAAAAFeOF7wAAAAAcP0dvgAAAACNIyU+AAAAAN9vib4AAAAAMJiFPgAAAACNIyU+AAAAAN9vib4AAAAAMJiFPgAAAACNIyU+AAAAAN9vib4AAAAAMJiFPgAAAADXQFg+AAAAAGaoOz4AAAAAAAAAAAAAAAAAAAAAAAAAACssTT0AAAAAls/HvQAAAABZI/m9AAAAAKegbL0AAAAAWSP5vQAAAACnoGy9AAAAAESbUz0AAAAAXgpaPQAAAAAIioO7AAAAAESbUz0AAAAAXgpaPQAAAAAIioO7AAAAAESbUz0AAAAAXgpaPQAAAAAIioO7AAAAAKpX7TwAAAAAKyxNPQAAAAAAAAAAAAAAAAAAAAAAAAAAXI8ywOF6JMAK13NApHCFwArXc0CkcIXAKVwvwHE96r97FD7ApHD9v3sUPsCkcP2/KVwvwHE96r97FD7ApHD9v3sUPsCkcP2/KVwvwHE96r97FD7ApHD9v3sUPsCkcP2/j8I1wIXr8b97FD7ApHD9vwAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAE3KhL4AAAAA32+JvgAAAABNyoS+AAAAAN9vib4AAAAATcqEvgAAAADKxUS+AAAAAPnej74AAAAA+d6PvgAAAADKxUS+AAAAAPnej74AAAAA+d6PvgAAAADKxUS+AAAAAPnej74AAAAA+d6PvgAAAAAg12q+AAAAANugmD0AAAAAAAAAAAAAAAAAAAAAAAAAAG/b/r0AAAAADE/FPQAAAAATZoY8AAAAAAxPxT0AAAAAE2aGPAAAAAAMT8U9AAAAAPYd4L0AAAAAddpPvgAAAAD2HeC9AAAAAMABMr4AAAAA9h3gvQAAAAB12k++AAAAAPYd4L0AAAAAwAEyvgAAAAD2HeC9AAAAAHXaT74AAAAA9h3gvQAAAADAATK+AAAAAG/b/r0AAAAAAAAAAAAAAAAAAAAAAAAAALdhh74AAAAAH06BPgAAAADWKGi+AAAAAB9OgT4AAAAA1ihovgAAAAAfToE+AAAAAIuEFL4AAAAAvlhyPQAAAAAAc8K+AAAAAIuEFL4AAAAAvlhyPQAAAAAAc8K+AAAAAIuEFL4AAAAAvlhyPQAAAAAAc8K+AAAAABNmhr4AAAAAm7YovgAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAABcjz7BZmZowlyPPsFmZmjCAAAAANej+MEAAAAAH4WPwQAAAAAAAAAAAACAPwAAgD8AAIA/AACAP3sUbj8fhYs/AACAPwAAgD8AAIA/AACAPwrXgz/sUXg/CteDP+xReD8AAIA/AACAPwAAgD8AAIA/AACAP83MjD8AAIA/AACAPwAAAAAAAAAALdUMvQAAAAD8l9k+AAAAAMPQor4AAAAA/JfZPgAAAADD0KK+AAAAAPyX2T4AAAAABLsSPgAAAADGe6u+AAAAADTiHj4AAAAABLsSPgAAAAAEuxI+AAAAADTiHj4AAAAABLsSPgAAAADGe6u+AAAAADTiHj4AAAAABLsSPgAAAAAEuxI+AAAAADTiHj4AAAAABLsSPgAAAADGe6u+AAAAADTiHj4AAAAABLsSPgAAAAAEuxI+AAAAADTiHj4AAAAANOIePgAAAAAAAAAAAAAAAAAAAAAAAAAAsMVuvgAAAABmqDs+AAAAAL1KMT0AAAAAZqg7PgAAAAC9SjE9AAAAAGaoOz4AAAAAWKYHvgAAAAAG4cM8AAAAACoqhL4AAAAAWKYHvgAAAAAG4cM8AAAAACoqhL4AAAAAWKYHvgAAAAAG4cM8AAAAACoqhL4AAAAAeAowvgAAAABYpge+AAAAAAAAAAAAAAAAAAAAAAAAAACSh3e+AAAAAKGryj4AAAAAXgraPQAAAABI4yM+AAAAAF4K2j0AAAAASOMjPgAAAACd3Fm+AAAAAKwArTwAAAAAJJrjvgAAAACd3Fm+AAAAAKwArTwAAAAAJJrjvgAAAACd3Fm+AAAAAKwArTwAAAAAJJrjvgAAAAA5RKi+AAAAAJKHd74AAAAAAAAAAAAAAAAAAAAAAAAAAJkNab0AAAAA5wO8PQAAAAAG4UO9AAAAAOcDvD0AAAAABuFDvQAAAADnA7w9AAAAALDF7r0AAAAAUqc2PgAAAACmkis9AAAAALDF7r0AAAAAUqc2PgAAAACmkis9AAAAALDF7r0AAAAAUqc2PgAAAACmkis9AAAAAE3AVb0AAAAAWKYHvgAAAAAAAAAAAAAAAAAAAAAAAAAAJTcrPgAAAAD1G5e+AAAAAPAoPr0AAAAA9RuXvgAAAADwKD69AAAAAPUbl74AAAAAC0GEPQAAAACKbCQ+AAAAAKeg7L0AAAAAC0GEPQAAAACKbCQ+AAAAAKeg7L0AAAAAC0GEPQAAAACKbCQ+AAAAAKeg7L0AAAAAM1HPvAAAAADTe5Y9AAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAFyPokCamYHAXI+iQJqZgcBSuP4/16OAwAAAAAAAAAAAUrj+P9ejgMAAAAAAAAAAAFK4/j/Xo4DAAAAAAAAAAACPwrU/7FE4wAAAAAAAAAAAAAAAAAAAAAAh8w0/AAAAAI4xZr8AAAAACPv8vgAAAACOMWa/AAAAAAj7/L4AAAAAjjFmvwAAAAAI+/y+AAAAAI4xZr8AAAAACPv8vgAAAAAeJma/AAAAAP2jUb4AAAAAeq+8vwAAAACWVmi+AAAAAHqvvL8AAAAAllZovgAAAAB6r7y/AAAAAIR3gj0AAAAAFyvIvQAAAAA1+o4lAAAAAAAAAAAAAAAAgs5CPgAAAABCa/O9AAAAAF+zGb0AAAAAQmvzvQAAAABfsxm9AAAAAEJr870AAAAAfNmgPQAAAABj8To+AAAAAHiPhz4AAAAAY3hbvQAAAAB82aA9AAAAAGPxOj4AAAAAeI+HPgAAAABjeFu9AAAAAHzZoD0AAAAAY/E6PgAAAAB4j4c+AAAAAGN4W70AAAAAUqe2PQAAAAAAAAAAAAAAAAAAAAAAAAAAb9v+vQAAAAAMT8U9AAAAABNmhjwAAAAADE/FPQAAAAATZoY8AAAAAAxPxT0AAAAA9h3gvQAAAAB12k++AAAAAPYd4L0AAAAAY/2yvgAAAAD2HeC9AAAAAHXaT74AAAAA9h3gvQAAAABj/bK+AAAAAPYd4L0AAAAAddpPvgAAAAD2HeC9AAAAAGP9sr4AAAAAb9v+vQAAAAAAAAAAAAAAAAAAAAAAAAAACtcjv0jh+j8AAAAAAAAAAAAAAAAAAAAAPQqfwJqZsUAAAAAAAAAAAAAAAAAAAAAAPQqfwJqZsUAAAAAAAAAAAAAAAAAAAAAAPQqfwJqZsUAAAAAAAAAAAAAAAAAAAAAACzdVPgAAAABCa/O9AAAAABNmhj4AAAAAQmvzvQAAAAATZoY+AAAAAEJr870AAAAAfNmgPQAAAABYnFg+AAAAAC+C3j4AAAAAY3hbvQAAAAB82aA9AAAAAFicWD4AAAAAL4LePgAAAABjeFu9AAAAAHzZoD0AAAAAWJxYPgAAAAAvgt4+AAAAAGN4W70AAAAAUqe2PQAAAAAAAAAAAAAAAAAAAAAAAAAAd3eXvgAAAABmOYs+AAAAAEdSVL4AAAAAZjmLPgAAAABHUlS+AAAAAGY5iz4AAAAAe8EwvgAAAAD/ZAE9AAAAAFmo0L4AAAAAe8EwvgAAAAD/ZAE9AAAAAFmo0L4AAAAAe8EwvgAAAAD/ZAE9AAAAAFmo0L4AAAAAi4SUvgAAAAAa4ki+AAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAPQrPQEjhssDhehLCSOGywOF6EsIAAAAAcT0wwgAAAAAUruXBAAAAAArXt8IAAAAAcT0wwhSuF0HsUQrCAAAAAOzRkcIAAAAAcT0wwgAAAAAUruXBAAAAAArXt8IAAAAAcT0wwhSuF0HsUQrCAAAAAOzRkcIAAAAAcT0wwgAAAAAUruXBAAAAAArXt8IAAAAAcT0wwhSuF0HsUQrCAAAAAOzRkcIAAAAAPQrPQAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAKRiyz0AAAAApGLLPQAAAAAAAAAAAAAAAAAAAAAAAAAAb9v+vQAAAAAMT8U9AAAAABNmhjwAAAAADE/FPQAAAAATZoY8AAAAAAxPxT0AAAAA9h3gvQAAAAB12k++AAAAAPYd4L0AAAAAwAEyvgAAAAD2HeC9AAAAAHXaT74AAAAA9h3gvQAAAADAATK+AAAAAPYd4L0AAAAAddpPvgAAAAD2HeC9AAAAAMABMr4AAAAAb9v+vQAAAAAAAAAAAAAAAAAAAAAAAAAAmQ1pvQAAAACGLgM+AAAAAPWWP7wAAAAAhi4DPgAAAAD1lj+8AAAAAIYuAz4AAAAAsMXuvQAAAABTtfc9AAAAAOTFmr0AAAAAsMXuvQAAAABTtfc9AAAAAOTFmr0AAAAAsMXuvQAAAABTtfc9AAAAAOTFmr0AAAAAKHXMvQAAAABYpge+AAAAAAAAAAAAAAAAAAAAAAAAAAB7SFG+AAAAAHvBMD4AAAAAG3OYPgAAAAB+CYE9AAAAABtzmD4AAAAAfgmBPQAAAAAAAAAAAAAAADTY7z0AAAAAl3iHvgAAAAAAAAAAAAAAADTY7z0AAAAAl3iHvgAAAAAAAAAAAAAAADTY7z0AAAAAya1UvgAAAAAAAAAAAAAAAAAAAAAAAAAA+E1APQAAAAD9rYC+AAAAAKaSK70AAAAA/a2AvgAAAACmkiu9AAAAAP2tgL4AAAAAx5+TvgAAAAC1PR+/AAAAAAAAAAAAAAAAx5+TvgAAAAC1PR+/AAAAAAAAAAAAAAAAx5+TvgAAAAC1PR+/AAAAAAAAAAAAAAAAx58TvgAAAAA1+o49AAAAAAAAAAAAAAAAAAAAAAAAAADHlWQ+AAAAAEJr870AAAAAzzNGPgAAAABCa/O9AAAAAM8zRj4AAAAAQmvzvQAAAAB82aA9AAAAALOSlj4AAAAALeEEPwAAAABjeFu9AAAAAHzZoD0AAAAAs5KWPgAAAAAt4QQ/AAAAAGN4W70AAAAAfNmgPQAAAACzkpY+AAAAAC3hBD8AAAAAY3hbvQAAAABSp7Y9AAAAAAAAAAAAAAAAAAAAAAAAAABmqDs+AAAAAC+Mjb4AAAAA/2SBvQAAAABw/R2+AAAAAP9kgb0AAAAAcP0dvgAAAACNIyU+AAAAAInlA74AAAAAgUeiPQAAAACNIyU+AAAAAInlA74AAAAAgUeiPQAAAACNIyU+AAAAAInlA74AAAAAgUeiPQAAAABNR/Y9AAAAAGaoOz4AAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAA7FEIwWZmNkAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAACuR8HAcT2UwZqZWb+kcJPBrkfBwHE9lMGamVm/pHCTwa5HwcBxPZTBuB4FwKRwxcAAALDAcT0qwbgeBcCkcMXAAACwwHE9KsG4HgXApHDFwAAAsMBxPSrBcT06wAAA6MAAAAAAAAAAAAAAAAAAAAAAnNqQPgAAAAD/WIm/AAAAADgmPL8AAAAA/1iJvwAAAAA4Jjy/AAAAAEdTib8AAAAARJtTvAAAAABp5ty9AAAAAESbU7wAAAAAaebcvQAAAABEm1O8AAAAAGnm3L0AAAAARkQTvQAAAABPdQ0/AAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAIXrQcEAAAAAAAAAAAAAAAAAAAAAAAAAAGFIez4AAAAAYmqauwAAAAACElO+AAAAAGJqmrsAAAAAAhJTvgAAAABiapq7AAAAANy4CD4AAAAAINdqPgAAAADy3z69AAAAANy4CD4AAAAAINdqPgAAAADy3z69AAAAANy4CD4AAAAAINdqPgAAAADy3z69AAAAAL1KMT0AAAAAJk8bPgAAAAAAAAAAAAAAAAAAAAAAAAAAUqe2PQAAAADKVpS9AAAAADX6DjwAAAAAylaUvQAAAAA1+g48AAAAAMpWlL0AAAAAfNmgPQAAAACFhcM9AAAAABNmBr4AAAAAY3hbvQAAAAB82aA9AAAAAIWFwz0AAAAAE2YGvgAAAABjeFu9AAAAAHzZoD0AAAAAhYXDPQAAAAATZga+AAAAAGN4W70AAAAAUqe2PQAAAAAAAAAAAAAAAAAAAAAAAAAAsMVuvgAAAABU1xY9AAAAAEHk0r0AAAAAVNcWPQAAAABB5NK9AAAAAFTXFj0AAAAAsMXuvQAAAAD+u0G9AAAAADNF174AAAAAsMXuvQAAAAD+u0G9AAAAADNF174AAAAAsMXuvQAAAAD+u0G9AAAAADNF174AAAAAS5B1vgAAAABYpge+AAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAADm/UL4AAAAAPznKPgAAAAA5v1C+AAAAAD85yj4AAAAAOb9QvgAAAAA/Oco+AAAAADm/UL4AAAAAPznKPgAAAAA5v1C+AAAAAAAAAAAAAAAAAACAPwAAgD8AAIA/AACAP2ZmZj8K14M/AACAPwAAgD9mZmY/CteDPwAAgD8AAIA/ZmZmPwrXgz8AAIA/AACAP2ZmZj8K14M/AACAPwAAgD8AAAAAAAAAAFKntj0AAAAAzQ2VvQAAAAAeQgk8AAAAAM0Nlb0AAAAAHkIJPAAAAADNDZW9AAAAAHzZoD0AAAAAy2TVPQAAAACiMus9AAAAAGN4W70AAAAAfNmgPQAAAADLZNU9AAAAAKIy6z0AAAAAY3hbvQAAAAB82aA9AAAAAMtk1T0AAAAAojLrPQAAAABjeFu9AAAAAFKntj0AAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAABlqjvQAAAAAAAAAAAAAAAAZao70AAAAAAAAAAAAAAADfZVq+AAAAAHQ7v70AAAAAAAAAAAAAAACbtqi+AAAAAN9lWr4AAAAAdDu/vQAAAAAAAAAAAAAAAJu2qL4AAAAA32VavgAAAAB0O7+9AAAAAAAAAAAAAAAAm7aovgAAAAAAAAAAAAAAAAAAAAAAAAAAb9v+vQAAAAAMT8U9AAAAABNmhjwAAAAADE/FPQAAAAATZoY8AAAAAAxPxT0AAAAAE9U2PgAAAABqg6Q+AAAAAPYd4L0AAAAATLKUPAAAAAAT1TY+AAAAAGqDpD4AAAAA9h3gvQAAAABMspQ8AAAAABPVNj4AAAAAaoOkPgAAAAD2HeC9AAAAAEyylDwAAAAAb9v+vQAAAAAAAAAAAAAAAAAAAAAAAAAAsMVuvgAAAACjz7I+AAAAAI9JVj4AAAAAo8+yPgAAAACPSVY+AAAAAKPPsj4AAAAAsMXuvQAAAAAIB3W+AAAAAPc1UL8AAAAAsMXuvQAAAAAIB3W+AAAAAPc1UL8AAAAAsMXuvQAAAAAIB3W+AAAAAPc1UL8AAAAASF7MvgAAAABYpge+AAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAADMzf8EAAIA+hesJQbgeBb4zM3/BAACAPoXrCUG4HgW+MzN/wQAAgD4AAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAD2KJy/CtcjP2ZmlsAAAHDA9iicvwrXIz9mZpbAAABwwPYonL8K1yM/rkfBv3sUXsApXJfAXI8WwQAAAAAAAAAArkfBv3sUXsCuR8G/exRewAAAAAAAAAAArkfBv3sUXsApXJfAXI8WwQAAAAAAAAAArkfBv3sUXsCuR8G/exRewAAAAAAAAAAArkfBv3sUXsApXJfAXI8WwQAAAAAAAAAArkfBv3sUXsCuR8G/exRewAAAAAAAAAAAAAAAAAAAAADWMpe9AAAAAAiEhz8AAAAAblKVPwAAAAAIhIc/AAAAAG5SlT8AAAAACISHPwAAAAABeb4/AAAAABwIej8AAAAA2ffYvQAAAABZLSg+AAAAAE3AVb0AAAAAwriyvQAAAAABeb4/AAAAABwIej8AAAAArQ7uvQAAAABZLSg+AAAAAE3AVb0AAAAAjAu1vgAAAAABeb4/AAAAABwIej8AAAAAjAu1vgAAAABZLSg+AAAAAE3AVb0AAAAAjAu1vgAAAACMC7W+AAAAADX6jqUAAAAAAAAAAAAAAABlIRs9AAAAAP2tgL4AAAAAppIrvQAAAAD9rYC+AAAAAKaSK70AAAAA/a2AvgAAAADHn5O+AAAAALU9H78AAAAAAAAAAAAAAADHn5O+AAAAALU9H78AAAAAAAAAAAAAAADHn5O+AAAAALU9H78AAAAAAAAAAAAAAADHnxO+AAAAADX6jj0AAAAAAAAAAAAAAAAAAAAAAAAAAGaoOz4AAAAADE9FvgAAAABXjhe8AAAAAHD9Hb4AAAAAV44XvAAAAABw/R2+AAAAAI0jJT4AAAAA32+JvgAAAAAwmIU+AAAAAI0jJT4AAAAA32+JvgAAAAAwmIU+AAAAAI0jJT4AAAAA32+JvgAAAAAwmIU+AAAAANdAWD4AAAAAZqg7PgAAAAAAAAAAAAAAAAAAAAAAAAAAnvTJvQAAAADxx04+AAAAAF+p6j4AAAAAIgdLvQAAAABfqeo+AAAAACIHS70AAAAAKHXMPQAAAACuJl4+AAAAAJu2KL4AAAAAKHXMPQAAAACuJl4+AAAAAJu2KL4AAAAAKHXMPQAAAACuJl4+AAAAAJu2KL4AAAAAzOt1vQAAAACWVug9AAAAAAAAAAAAAAAAAACAPwAAgD8AAIA/AACAPwAAgD9cj0I/AACAPwAAgD8AAIA/XI9CPwAAgD8AAIA/AAAAAAAAAABB5FK+AAAAAIT+Ir0AAAAAAHPCPAAAAADdNfq8AAAAAABzwjwAAAAA3TX6vAAAAAAAAAAAAAAAADTY7z0AAAAAl3iHvgAAAAAAAAAAAAAAADTY7z0AAAAAl3iHvgAAAAAAAAAAAAAAADTY7z0AAAAAl3iHvgAAAADY32i+AAAAAAAAAAAAAAAAAAAAAAAAAABxPTrAw/UovwrXi0DsUXg/CteLQOxReD8Urkc/4XrUvx+FK8D2KNy/j8JVQBSuBz8Urkc/4XrUvwrXYz+F6/G/FK5HP+F61L8fhSvA9ijcv4/CVUAUrgc/FK5HP+F61L8K12M/hevxvxSuRz/hetS/H4UrwPYo3L+PwlVAFK4HPxSuRz/hetS/CtdjP4Xr8b8K12M/hevxvwAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAGJqmr4AAAAAYmqavgAAAAAAAAAAAAAAAAAAAAAAAAAAW9r5vQAAAAAAAAAAAAAAAAAAAAAAAAAAW9r5vQAAAAAAAAAAAAAAAAAAAAAAAAAAW9r5vQAAAAAAAAAAAAAAAAAAAAAAAAAAtJ6OvQAAAACTn+e+AAAAAAf5s74AAAAAk5/nvgAAAAAH+bO+AAAAAJOf574AAAAAB/mzvgAAAACTn+e+AAAAAAf5s74AAAAAk5/nvgAAAADDxKq+AAAAAD0Tmb4AAAAANgaHvgAAAAA9E5m+AAAAADYGh74AAAAAPROZvgAAAADtfbW+AAAAABWMt74AAAAAAAAAAAAAAAAAAAAAAAAAAEoJVb0AAAAAKHODvgAAAADhDpo+AAAAAChzg74AAAAA4Q6aPgAAAAAoc4O+AAAAAA3sjL4AAAAA+nPxPgAAAABDjRI+AAAAAEyylDsAAAAAfgmBPQAAAABvVF4+AAAAAA3sjL4AAAAA+nPxPgAAAAAh+Qk+AAAAAGydXT0AAAAAEK+FPQAAAADfYxE/AAAAAA3sjL4AAAAA+nPxPgAAAADfYxE/AAAAAA3sjL4AAAAADeyMvgAAAADfYxE/AAAAAN9jET8AAAAAAAAAAAAAAAAAAAAAAAAAAIadM74AAAAAFhNYPgAAAAC33K+8AAAAABYTWD4AAAAAt9yvvAAAAAAWE1g+AAAAAIySVb4AAAAAe0hRvgAAAACMklW+AAAAAHtIUb4AAAAAjJJVvgAAAAB7SFG+AAAAAAiAVL4AAAAAeanAPQAAAAAAAAAAAAAAAAAAAAAAAAAAHjaRvgAAAAC3V9g+AAAAAFimBz8AAAAAt1fYPgAAAABYpgc/AAAAALdX2D4AAAAAWKYHPwAAAAC3V9g+AAAAAFimBz8AAAAAt1fYPgAAAABlFaM+AAAAAGHBWj4AAAAAV44XPgAAAABhwVo+AAAAAFeOFz4AAAAAYcFaPgAAAABeClo9AAAAACfuqz4AAAAAAAAAAAAAAAAAAAAAAAAAALdhh74AAAAAH06BPgAAAADWKGi+AAAAAB9OgT4AAAAA1ihovgAAAAAfToE+AAAAAIuEFL4AAAAAvlhyPQAAAAAAc8K+AAAAAIuEFL4AAAAAvlhyPQAAAAAAc8K+AAAAAIuEFL4AAAAAvlhyPQAAAAAAc8K+AAAAABNmhr4AAAAAm7YovgAAAAAAAAAAAAAAAAAAAAAAAAAAhP4ivgAAAABSp7Y9AAAAAOVa/D0AAAAALuPNPQAAAADlWvw9AAAAAC7jzT0AAAAAAAAAAAAAAAA02O89AAAAAJd4h74AAAAAAAAAAAAAAAA02O89AAAAAJd4h74AAAAAAAAAAAAAAAA02O89AAAAAA51dr4AAAAAAAAAAAAAAAAAAAAAAAAAAIadM74AAAAAhP6iPQAAAAD9rYA8AAAAAIT+oj0AAAAA/a2APAAAAACE/qI9AAAAAOMygr4AAAAAMSuevgAAAADjMoK+AAAAADErnr4AAAAA4zKCvgAAAAAxK56+AAAAAH39iL4AAAAAeanAPQAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAADNzHzArkfpwM3MfMCuR+nAAAAAAAAAAACF67G/4XokwD0K9z8fhQvAAAAAAAAAAADNzHzArkfpwM3MfMCuR+nAAAAAAAAAAACF67G/4XokwD0K9z8fhQvAAAAAAAAAAADNzHzArkfpwM3MfMCuR+nAAAAAAAAAAACF67G/4XokwD0K9z8fhQvAAAAAAAAAAAAAAAAAAAAAANlwuD0AAAAAhPpvvwAAAACygCK/AAAAAIT6b78AAAAAsoAivwAAAAAU72+/AAAAADXwXz4AAAAA83COPgAAAADuf34+AAAAAJs7gL8AAAAAC8IovwAAAADuf34+AAAAADXwXz4AAAAAriZePgAAAADuf34+AAAAAJs7gL8AAAAAC8IovwAAAADuf34+AAAAADXwXz4AAAAAXfyYPgAAAADuf34+AAAAAJs7gL8AAAAAC8IovwAAAADuf34+AAAAAO5/fj4AAAAAAAAAAAAAAAAAAIA/AACAPwAAgD8AAIA/uB6FPwAAgD+4HoU/AACAPwAAgD8AAIA/AAAAAAAAAACSh3e+AAAAAKGryj4AAAAAXgraPQAAAABI4yM+AAAAAF4K2j0AAAAASOMjPgAAAACd3Fm+AAAAAKlVJD8AAAAAQeKJvgAAAACd3Fm+AAAAAKlVJD8AAAAAQeKJvgAAAACd3Fm+AAAAAKlVJD8AAAAAQeKJvgAAAACP0Ha+AAAAAJKHd74AAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAACAPgrXu8CamRk/KVy3wAAAAAAAAAAAAAAAAAAAAAAAAIA+Cte7wJqZGT8pXLfAAAAAAAAAAAAAAAAAAAAAAAAAgD4K17vAmpkZPylct8AAAAAAAAAAAAAAAAAAAAAASglVvgAAAABCa/O9AAAAAKeeo74AAAAAQmvzvQAAAACnnqO+AAAAAEJr870AAAAAQEVCvgAAAADuEM6+AAAAANNxZ74AAAAAY3hbvQAAAABARUK+AAAAAO4Qzr4AAAAA03FnvgAAAABjeFu9AAAAAEBFQr4AAAAA7hDOvgAAAADTcWe+AAAAAGN4W70AAAAAUqe2PQAAAAAAAAAAAAAAAAAAAAAAAAAAsMVuvgAAAABU1xY9AAAAAEHk0r0AAAAAVNcWPQAAAABB5NK9AAAAAFTXFj0AAAAAsMXuvQAAAADqurw9AAAAAKCdCb4AAAAAsMXuvQAAAADqurw9AAAAAKCdCb4AAAAAsMXuvQAAAADqurw9AAAAAKCdCb4AAAAAam39vQAAAABYpge+AAAAAAAAAAAAAAAAAAAAAAAAAACZDek8AAAAAG9UXj0AAAAAb1RePQAAAAAAAAAAAAAAAAAAAAAAAAAAb9v+vQAAAAAMT8U9AAAAABNmhjwAAAAADE/FPQAAAAATZoY8AAAAAAxPxT0AAAAA9h3gvQAAAAB12k++AAAAAPYd4L0AAAAAwAEyvgAAAAD2HeC9AAAAAHXaT74AAAAA9h3gvQAAAADAATK+AAAAAPYd4L0AAAAAddpPvgAAAAD2HeC9AAAAAMABMr4AAAAAb9v+vQAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAIA+FK7HvwAAAAAAAAAAAACAPhSux78AAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAB3eeC9AAAAAFXl174AAAAAd3ngvQAAAABV5de+AAAAAHd54L0AAAAAAAAAAAAAAAAAAAAAAAAAANOBEj8AAAAAAAAAAAAAAAAAAAAAAAAAANOBEj8AAAAAAAAAAAAAAAAAAAAAAAAAANOBEj8AAAAAAAAAAAAAAAAAAAAAAAAAAGFSKr4AAAAAyTR1PQAAAADjNEs+AAAAACIHS70AAAAA4zRLPgAAAAAiB0u9AAAAAPPtfz0AAAAAWBU4PgAAAADxx06+AAAAAPPtfz0AAAAAWBU4PgAAAADxx06+AAAAAPPtfz0AAAAAWBU4PgAAAADxx06+AAAAAJMYx70AAAAAv3qRPQAAAAAAAAAAAAAAAAAAgD8AAIA/AACAPwAAgD8AAIA/XI9CPwAAgD8AAIA/AACAP1yPQj8AAIA/AACAPwAAAAAAAAAAAAAAAAAAAACuR6HAZmamwAAAAAAAAAAArkehwGZmpsAAAAAAAAAAAAAAAAAAAAAA68h9PQAAAAD9rYC+AAAAAKaSK70AAAAA/a2AvgAAAACmkiu9AAAAAP2tgL4AAAAArjANvwAAAAC7LEW/AAAAAAAAAAAAAAAArjANvwAAAAC7LEW/AAAAAAAAAAAAAAAArjANvwAAAAC7LEW/AAAAAAAAAAAAAAAAvmKhvgAAAAA1+o49AAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAALgeBb5I4fq/AAAAAAAAAAC4HgW+SOH6vwAAAAAAAAAAAAAAAAAAAACPwjFBAACgQAAAAAAAAAAAAAAAAAAAAACPwjFBAACgQAAAAAAAAAAAAAAAAAAAAACPwjFBAACgQAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAGN4270AAAAAbkadvQAAAABjeNu9AAAAAG5Gnb0AAAAAY3jbvQAAAAAAAAAAAAAAAAAAAAAAAAAAch1TvwAAAAAAAAAAAAAAAAAAAAAAAAAAch1TvwAAAAAAAAAAAAAAAAAAAAAAAAAAch1TvwAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAADsUTVC4XpsQexRNULhemxBAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAA8pQzwAAAAADylDPAAAAAAH7JuMAAAAAA2w/JwAAAAAAAAIA/AACAPwAAgD8AAIA/AAAAPwAAAD8AAIA/AACAPwAAAD8AAAA/AACAPwAAgD97FC4/exQuPwAAAAAAAAAAAAAAAAAAAADNzEy+PQoXwHE9CsCPwvU8zcxMvj0KF8BxPQrAj8L1PM3MTL49ChfAAAAAAAAAAAAAAAAAAAAAAPWWvz0AAAAA+wTBPQAAAACSkSY+AAAAAPsEwT0AAAAAkpEmPgAAAAD7BME9AAAAAAAAAAAAAAAAiDzEPQAAAACanji+AAAAAAAAAAAAAAAAiDzEPQAAAACanji+AAAAAAAAAAAAAAAAiDzEPQAAAACanji+AAAAANlwuL0AAAAAAAAAAAAAAAAAAAAAAAAAAJKHd74AAAAAM0+GPgAAAACMnIQ9AAAAAEjjIz4AAAAAjJyEPQAAAABI4yM+AAAAAJ3cWb4AAAAAYVIqPgAAAAD2J4++AAAAAJ3cWb4AAAAAYVIqPgAAAAD2J4++AAAAAJ3cWb4AAAAAYVIqPgAAAAD2J4++AAAAAGT/e74AAAAAkod3vgAAAAAAAAAAAAAAAAAAAAAAAAAAp6BsvQAAAABCa/O9AAAAAF+zGb0AAAAAQmvzvQAAAABfsxm9AAAAAEJr870AAAAAfNmgPQAAAABj8To+AAAAAI7CNb4AAAAAY3hbvQAAAAB82aA9AAAAAGPxOj4AAAAAjsI1vgAAAABjeFu9AAAAAHzZoD0AAAAAY/E6PgAAAACOwjW+AAAAAGN4W70AAAAAUqe2PQAAAAAAAAAAAAAAAAAAAAAAAAAAkod3vgAAAAAzT4Y+AAAAAIychD0AAAAASOMjPgAAAACMnIQ9AAAAAEjjIz4AAAAAndxZvgAAAABhUio+AAAAAPYnj74AAAAAndxZvgAAAABhUio+AAAAAPYnj74AAAAAndxZvgAAAABhUio+AAAAAPYnj74AAAAAZP97vgAAAACSh3e+AAAAAAAAAAAAAAAAAAAAAAAAAAC2xD++AAAAAHfyvz0AAAAA9h1gPgAAAAD9rYC8AAAAAPYdYD4AAAAA/a2AvAAAAAAAAAAAAAAAADTY7z0AAAAAl3iHvgAAAAAAAAAAAAAAADTY7z0AAAAAl3iHvgAAAAAAAAAAAAAAADTY7z0AAAAAl3iHvgAAAABp5ly+AAAAAAAAAAAAAAAAAAAAAAAAAAB3d5e+AAAAAGY5iz4AAAAAR1JUvgAAAABmOYs+AAAAAEdSVL4AAAAAZjmLPgAAAAB7wTC+AAAAAP9kAT0AAAAAWajQvgAAAAB7wTC+AAAAAP9kAT0AAAAAWajQvgAAAAB7wTC+AAAAAP9kAT0AAAAAWajQvgAAAACLhJS+AAAAABriSL4AAAAAAAAAAAAAAAAAAAAAAAAAAG/b/r0AAAAADE/FPQAAAAATZoY8AAAAAAxPxT0AAAAAE2aGPAAAAAAMT8U9AAAAAPYd4L0AAAAAddpPvgAAAAD2HeC9AAAAAMABMr4AAAAA9h3gvQAAAAB12k++AAAAAPYd4L0AAAAAwAEyvgAAAAD2HeC9AAAAAHXaT74AAAAA9h3gvQAAAADAATK+AAAAAG/b/r0AAAAAAAAAAAAAAAAAAAAAAAAAAArXo7yuR+E9CtcjvT0KVz7henTAhevRP+F6dMCF69E/AAAAAAAAAABxPXrA9ii8P4/ChUFxPcrAj8KFQXE9ysAAAAAAAAAAAHE9esD2KLw/j8KFQXE9ysCPwoVBcT3KwAAAAAAAAAAAcT16wPYovD+PwoVBcT3KwI/ChUFxPcrArkd9QfYo3MCuR2G/CtejPAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAFVet70AAAAAFytIPgAAAAB6OhC+AAAAAAAAAAAAAAAAVV63vQAAAAAXK0g+AAAAAHo6EL4AAAAAAAAAAAAAAABVXre9AAAAABcrSD4AAAAAejoQvgAAAACx5429AAAAAH8Xwj0AAAAAAAAAAAAAAAAAAAAAAAAAACU3Kz4AAAAAMjeWvgAAAADTAje9AAAAADI3lr4AAAAA0wI3vQAAAAAyN5a+AAAAAAtBhD0AAAAAimwkPgAAAACnoOy9AAAAAAtBhD0AAAAAimwkPgAAAACnoOy9AAAAAAtBhD0AAAAAimwkPgAAAACnoOy9AAAAADNRz7wAAAAA03uWPQAAAAAAAAAAAAAAAAAAAAAAAAAArQ5uPQAAAAD9rYC+AAAAAKaSK70AAAAA/a2AvgAAAACmkiu9AAAAAP2tgL4AAAAAx5+TvgAAAAC1PR+/AAAAAAAAAAAAAAAAx5+TvgAAAAC1PR+/AAAAAAAAAAAAAAAAx5+TvgAAAAC1PR+/AAAAAAAAAAAAAAAAx58TvgAAAAA1+o49AAAAAAAAAAAAAAAAAAAAAAAAAAC6GlE+AAAAALUzcD0AAAAAtlUPPgAAAAC1M3A9AAAAALZVDz4AAAAAtTNwPQAAAAB82aA9AAAAAGPxOj4AAAAAl/OvPgAAAABjeFu9AAAAAHzZoD0AAAAAY/E6PgAAAACX868+AAAAAGN4W70AAAAAfNmgPQAAAABj8To+AAAAAJfzrz4AAAAAY3hbvQAAAABSp7Y9AAAAAAAAAAAAAAAAAAAAAAAAAABv2/69AAAAAAxPxT0AAAAAE2aGPAAAAAAMT8U9AAAAABNmhjwAAAAADE/FPQAAAAD2HeC9AAAAAHXaT74AAAAA9h3gvQAAAADAATK+AAAAAPYd4L0AAAAAddpPvgAAAAD2HeC9AAAAAMABMr4AAAAA9h3gvQAAAAB12k++AAAAAPYd4L0AAAAAwAEyvgAAAABv2/69AAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAHE9SsDNzDzAcT1KwM3MPMAUrpfAhetxwBSul8CF63HA4XqswJqZicAUrpfAhetxwBSul8CF63HA4XqswJqZicAUrpfAhetxwBSul8CF63HA4XqswJqZicAUrpfAhetxwBSul8CF63HA4XqswJqZicAUrpfAhetxwBSul8CF63HA4XqswJqZicAUrpfAhetxwBSul8CF63HA4XqswJqZicDheqzAmpmJwAAAAAAAAAAAAAAAAAAAAAC6kzA9AAAAAIT+Ir0AAAAAhP4ivQAAAACanri+AAAAAJqeuL4AAAAAVv3HvgAAAACanri+AAAAAJqeuL4AAAAAVv3HvgAAAACanri+AAAAAJqeuL4AAAAAVv3HvgAAAACanri+AAAAAJqeuL4AAAAAVv3HvgAAAACanri+AAAAAJqeuL4AAAAAVv3HvgAAAACanri+AAAAAJqeuL4AAAAAVv3HvgAAAABW/ce+AAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAFK41sAfhes/FK6HQOF6lL8AAAAAAAAAAFK41sAfhes/FK6HQOF6lL8AAAAAAAAAAFK41sAfhes/FK6HQOF6lL/2KNw/16PwvgAAAAAAAAAAAAAAAAAAAAA7aBA9AAAAAMZ9dL0AAAAAyCY0vAAAAABuzb29AAAAAMgmNLwAAAAAbs29vQAAAADM6/U7AAAAACIHSzwAAAAAyCY0PAAAAADM6/U7AAAAACIHSzwAAAAAyCY0PAAAAADM6/U7AAAAACIHSzwAAAAAyCY0PAAAAABA1hE8AAAAAAAAAAAAAAAAPQoXP83MDD8Uroc/H4WLPz0KFz/NzAw/FK6HPx+Fiz89Chc/zcwMPwAAgD8AAIA/CtejPgrXoz4AAIA/AACAPwrXoz4K16M+AACAPwAAgD8K16M+CtejPgAAgD8AAIA/CtejPgrXoz4AAIA/AACAPwrXoz4K16M+AACAPwAAgD8K16M+CtejPgAAgD8AAIA/CtejPgrXoz4AAIA/AACAPwAAgD8AAIA/KVyPPgrXoz4AAIA/AACAPylcjz4K16M+AACAPwAAgD8K16M+CtejPgAAgD8AAIA/CtejPgrXoz4AAIA/AACAPwrXoz4K16M+AAAAAAAAAABYpge+AAAAALDF7r0AAAAAU7X3PQAAAADkxZq9AAAAALDF7r0AAAAAU7X3PQAAAADkxZq9AAAAALDF7r0AAAAAU7X3PQAAAAAodcy9AAAAAAAAAAAAAAAAUqe2PQAAAAB82aA9AAAAAMtk1T0AAAAAojLrPQAAAABjeFu9AAAAAHzZoD0AAAAAy2TVPQAAAACiMus9AAAAAGN4W70AAAAAfNmgPQAAAADLZNU9AAAAAGN4W70AAAAAAAAAAAAAAABv2/69AAAAAPYd4L0AAAAAddpPvgAAAAD2HeC9AAAAAMABMr4AAAAA9h3gvQAAAAB12k++AAAAAPYd4L0AAAAAwAEyvgAAAAD2HeC9AAAAAHXaT74AAAAAwAEyvgAAAAAAAAAAAAAAAG/b/r0AAAAA9h3gvQAAAAB12k++AAAAAPYd4L0AAAAAY/2yvgAAAAD2HeC9AAAAAHXaT74AAAAA9h3gvQAAAABj/bK+AAAAAPYd4L0AAAAAddpPvgAAAABj/bK+AAAAAAAAAAAAAAAAJk8bPgAAAADcuAg+AAAAACDXaj4AAAAA8t8+vQAAAADcuAg+AAAAACDXaj4AAAAA8t8+vQAAAADcuAg+AAAAAL1KMT0AAAAAAAAAAAAAAAAAAAAAAAAAAHE9esD2KLw/j8KFQXE9ysCPwoVBcT3KwAAAAAAAAAAAcT16wPYovD+PwoVBcT3KwI/ChUFxPcrAAAAAAAAAAABxPXrA9ii8P65HfUH2KNzAAAAAAAAAAAAAAAAAAAAAAFVet70AAAAAFytIPgAAAAB6OhC+AAAAAAAAAAAAAAAAVV63vQAAAAAXK0g+AAAAAHo6EL4AAAAAAAAAAAAAAABVXre9AAAAALHnjb0AAAAAAAAAAAAAAADheqzAmpmJwBSul8CF63HAFK6XwIXrccDheqzAmpmJwBSul8CF63HAFK6XwIXrccDheqzAmpmJwBSul8CF63HAFK6XwIXrccDheqzAmpmJwBSul8CF63HAFK6XwIXrccDheqzAmpmJwBSul8CF63HAFK6XwIXrccDheqzAmpmJwAAAAAAAAAAAVv3HvgAAAACanri+AAAAAJqeuL4AAAAAVv3HvgAAAACanri+AAAAAJqeuL4AAAAAVv3HvgAAAACanri+AAAAAJqeuL4AAAAAVv3HvgAAAACanri+AAAAAJqeuL4AAAAAVv3HvgAAAACanri+AAAAAJqeuL4AAAAAVv3HvgAAAAAAAAAAAAAAABriSL4AAAAAe8EwvgAAAAD/ZAE9AAAAAFmo0L4AAAAAe8EwvgAAAAD/ZAE9AAAAAFmo0L4AAAAAe8EwvgAAAACLhJS+AAAAAAAAAAAAAAAANOIePgAAAAAfyam9AAAAAAS7Ej4AAAAAxnurvgAAAAA04h4+AAAAAAS7Ej4AAAAABLsSPgAAAAA04h4+AAAAAAS7Ej4AAAAAxnurvgAAAAA04h4+AAAAAAS7Ej4AAAAABLsSPgAAAAA04h4+AAAAAAS7Ej4AAAAAxnurvgAAAAA04h4+AAAAAAAAAAAAAAAAJ+6rPgAAAABlFaM+AAAAAGHBWj4AAAAAV44XPgAAAABhwVo+AAAAAFeOFz4AAAAAVe8GPgAAAAAAAAAAAAAAAGaoOz4AAAAAjSMlPgAAAADfb4m+AAAAADCYhT4AAAAAjSMlPgAAAADfb4m+AAAAADCYhT4AAAAAjSMlPgAAAADfb4m+AAAAANdAWD4AAAAAAAAAAAAAAAAAAAAAAAAAAFK4/j/Xo4DAAAAAAAAAAABSuP4/16OAwAAAAAAAAAAAUrj+P9ejgMCPwrU/7FE4wAAAAAAAAAAAFyvIvQAAAAD9o1G+AAAAAHqvvL8AAAAAllZovgAAAAB6r7y/AAAAAJZWaL4AAAAA2fuLvwAAAAAAAAAAAAAAAFKntj0AAAAAfNmgPQAAAABj8To+AAAAAHiPhz4AAAAAY3hbvQAAAAB82aA9AAAAAGPxOj4AAAAAeI+HPgAAAABjeFu9AAAAAHzZoD0AAAAAY/E6PgAAAABjeFu9AAAAAAAAAAAAAAAAWKYHvgAAAACwxe69AAAAAAgHdb4AAAAA9zVQvwAAAACwxe69AAAAAAgHdb4AAAAA9zVQvwAAAACwxe69AAAAAAgHdb4AAAAASF7MvgAAAAAAAAAAAAAAAAAAAAAAAAAA04ESPwAAAAAAAAAAAAAAAAAAAAAAAAAA04ESPwAAAAAAAAAAAAAAAAAAAAAAAAAAeanAPQAAAACMklW+AAAAAHtIUb4AAAAAjJJVvgAAAAB7SFG+AAAAAIySVb4AAAAACIBUvgAAAAAAAAAAAAAAAL96kT0AAAAA8+1/PQAAAABYFTg+AAAAAPHHTr4AAAAA8+1/PQAAAABYFTg+AAAAAPHHTr4AAAAA8+1/PQAAAABYFTg+AAAAAJMYx70AAAAAAAAAAAAAAAB5qcA9AAAAAOMygr4AAAAAMSuevgAAAADjMoK+AAAAADErnr4AAAAA4zKCvgAAAAB9/Yi+AAAAAAAAAAAAAAAAAAAAAAAAAAA02O89AAAAAJd4h74AAAAAAAAAAAAAAAA02O89AAAAAJd4h74AAAAAAAAAAAAAAADY32i+AAAAAAAAAAAAAAAAWKYHvgAAAABYpge+AAAAAAbhwzwAAAAAKiqEvgAAAABYpge+AAAAAAbhwzwAAAAAKiqEvgAAAABYpge+AAAAAAbhwzwAAAAAeAowvgAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAANej+MEAAAAA16P4wexRQEHXo0/C7FFAQdejT8IAAAAAAACywQAAgD8AAIA/AACAPwAAgD8AAIA/exSOPwAAgD97FI4/AACAPwAAgD8AAIA/AACAP3E9ij+PwnU/AACAPwAAgD8AAAAAAAAAAAAAAAAAAAAAiDzEPQAAAACanji+AAAAAAAAAAAAAAAAiDzEPQAAAACanji+AAAAAAAAAAAAAAAA2XC4vQAAAAAAAAAAAAAAANN7lj0AAAAAC0GEPQAAAACKbCQ+AAAAAKeg7L0AAAAAC0GEPQAAAACKbCQ+AAAAAKeg7L0AAAAAC0GEPQAAAAAzUc+8AAAAAAAAAAAAAAAArkfZwK5HwT89Cr/Aw/WoP7geJcHNzJxAH4UbwI/CJUA9Cr/Aw/WoP7geJcHNzJxAH4UbwI/CJUA9Cr/Aw/WoP7geJcHNzJxArkeRwB+F6z8AAAAAAAAAAAAAAAAAAAAAzOv1OwAAAAAiB0s8AAAAAMgmNDwAAAAAzOv1OwAAAAAiB0s8AAAAAMgmNDwAAAAAzOv1OwAAAAAiB0s8AAAAAEDWETwAAAAAAAAAAAAAAAAAAAAAAAAAAD0Kn8CambFAAAAAAAAAAAAAAAAAAAAAAD0Kn8CambFAAAAAAAAAAAAAAAAAAAAAAFKntj0AAAAAfNmgPQAAAABYnFg+AAAAAC+C3j4AAAAAY3hbvQAAAAB82aA9AAAAAFicWD4AAAAAL4LePgAAAABjeFu9AAAAAHzZoD0AAAAAWJxYPgAAAABjeFu9AAAAAAAAAAAAAAAANfqOPQAAAADHn5O+AAAAALU9H78AAAAAAAAAAAAAAADHn5O+AAAAALU9H78AAAAAAAAAAAAAAADHn5O+AAAAAMefE74AAAAAAAAAAAAAAAA1+o49AAAAAMefk74AAAAAtT0fvwAAAAAAAAAAAAAAAMefk74AAAAAtT0fvwAAAAAAAAAAAAAAAMefk74AAAAAx58TvgAAAAAAAAAAAAAAAAAAAAAAAAAANNjvPQAAAACXeIe+AAAAAAAAAAAAAAAANNjvPQAAAACXeIe+AAAAAAAAAAAAAAAADnV2vgAAAAAAAAAAAAAAAGaoOz4AAAAAjSMlPgAAAADfb4m+AAAAADCYhT4AAAAAjSMlPgAAAADfb4m+AAAAADCYhT4AAAAAjSMlPgAAAADfb4m+AAAAANdAWD4AAAAAAAAAAAAAAAAAAAAAAAAAAK5Hwb97FF7AKVyXwFyPFsEAAAAAAAAAAK5Hwb97FF7ArkfBv3sUXsAAAAAAAAAAAK5Hwb97FF7AKVyXwFyPFsEAAAAAAAAAAK5Hwb97FF7ArkfBv3sUXsAAAAAAAAAAAK5Hwb97FF7AKVyXwFyPFsEAAAAAAAAAAAAAAAAAAAAAjAu1vgAAAAAfRYc/AAAAAAF5vj8AAAAAHAh6PwAAAADZ99i9AAAAAFktKD4AAAAATcBVvQAAAADCuLK9AAAAAAF5vj8AAAAAHAh6PwAAAACtDu69AAAAAFktKD4AAAAATcBVvQAAAACMC7W+AAAAAAF5vj8AAAAAHAh6PwAAAACMC7W+AAAAAAAAAAAAAAAAAAAAAAAAAADNzHzArkfpwM3MfMCuR+nAAAAAAAAAAACF67G/4XokwD0K9z8fhQvAAAAAAAAAAADNzHzArkfpwM3MfMCuR+nAAAAAAAAAAACF67G/4XokwD0K9z8fhQvAAAAAAAAAAADNzHzArkfpwM3MfMCuR+nAAAAAAAAAAAAAAAAAAAAAAO5/fj4AAAAANfBfPgAAAADzcI4+AAAAAO5/fj4AAAAAmzuAvwAAAAALwii/AAAAAO5/fj4AAAAANfBfPgAAAACuJl4+AAAAAO5/fj4AAAAAmzuAvwAAAAALwii/AAAAAO5/fj4AAAAANfBfPgAAAABd/Jg+AAAAAO5/fj4AAAAAAAAAAAAAAAAAAAAAAAAAALgeBcCkcMXAAACwwHE9KsG4HgXApHDFwAAAsMBxPSrBuB4FwKRwxcBxPTrAAADowAAAAAAAAAAAT3UNPwAAAABEm1O8AAAAAGnm3L0AAAAARJtTvAAAAABp5ty9AAAAAESbU7wAAAAARkQTvQAAAAAAAAAAAAAAAAAAAAAAAAAAXI8+wWZmaMJcjz7BZmZowgAAAAAfhY/BAACAPwAAgD8AAIA/AACAPwAAgD8fhYs/AACAPwAAgD8AAIA/AACAPwrXgz/sUXg/AACAPwAAgD8AAAAAAAAAAG/b/r0AAAAAE9U2PgAAAABqg6Q+AAAAAPYd4L0AAAAATLKUPAAAAAAT1TY+AAAAAGqDpD4AAAAA9h3gvQAAAABMspQ8AAAAABPVNj4AAAAAaoOkPgAAAABMspQ8AAAAAAAAAAAAAAAANfqOPQAAAACuMA2/AAAAALssRb8AAAAAAAAAAAAAAACuMA2/AAAAALssRb8AAAAAAAAAAAAAAACuMA2/AAAAAL5iob4AAAAAAAAAAAAAAABv2/69AAAAAPYd4L0AAAAAddpPvgAAAAD2HeC9AAAAAMABMr4AAAAA9h3gvQAAAAB12k++AAAAAPYd4L0AAAAAwAEyvgAAAAD2HeC9AAAAAHXaT74AAAAAwAEyvgAAAAAAAAAAAAAAAJKHd74AAAAAndxZvgAAAACsAK08AAAAACSa474AAAAAndxZvgAAAACsAK08AAAAACSa474AAAAAndxZvgAAAACsAK08AAAAADlEqL4AAAAAAAAAAAAAAAAAAAAAAAAAAAAAgD4K17vAmpkZPylct8AAAAAAAAAAAAAAAAAAAAAAAACAPgrXu8CamRk/KVy3wAAAAAAAAAAAAAAAAAAAAAAAAIA+Cte7wAAAAAAAAAAAAAAAAAAAAABSp7Y9AAAAAEBFQr4AAAAA7hDOvgAAAADTcWe+AAAAAGN4W70AAAAAQEVCvgAAAADuEM6+AAAAANNxZ74AAAAAY3hbvQAAAABARUK+AAAAAO4Qzr4AAAAAY3hbvQAAAAAAAAAAAAAAAFimB74AAAAAsMXuvQAAAADqurw9AAAAAKCdCb4AAAAAsMXuvQAAAADqurw9AAAAAKCdCb4AAAAAsMXuvQAAAADqurw9AAAAAGpt/b0AAAAAAAAAAAAAAABv2/69AAAAAPYd4L0AAAAAddpPvgAAAAD2HeC9AAAAAMABMr4AAAAA9h3gvQAAAAB12k++AAAAAPYd4L0AAAAAwAEyvgAAAAD2HeC9AAAAAHXaT74AAAAAwAEyvgAAAAAAAAAAAAAAAAAAAAAAAAAANNjvPQAAAACXeIe+AAAAAAAAAAAAAAAANNjvPQAAAACXeIe+AAAAAAAAAAAAAAAAaeZcvgAAAAAAAAAAAAAAAAAAAAAAAAAAj8IxQQAAoEAAAAAAAAAAAAAAAAAAAAAAj8IxQQAAoEAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAByHVO/AAAAAAAAAAAAAAAAAAAAAAAAAAByHVO/AAAAAAAAAAAAAAAAAAAAAAAAAABSp7Y9AAAAAHzZoD0AAAAAhYXDPQAAAAATZga+AAAAAGN4W70AAAAAfNmgPQAAAACFhcM9AAAAABNmBr4AAAAAY3hbvQAAAAB82aA9AAAAAIWFwz0AAAAAY3hbvQAAAAAAAAAAAAAAAGaoOz4AAAAAjSMlPgAAAADvHMa+AAAAAC+MjT4AAAAAjSMlPgAAAADvHMa+AAAAAC+MjT4AAAAAjSMlPgAAAADvHMa+AAAAAPYdYD4AAAAAAAAAAAAAAACSh3e+AAAAAJ3cWb4AAAAAqVUkPwAAAABB4om+AAAAAJ3cWb4AAAAAqVUkPwAAAABB4om+AAAAAJ3cWb4AAAAAqVUkPwAAAACP0Ha+AAAAAAAAAAAAAAAANfqOPQAAAADHn5O+AAAAALU9H78AAAAAAAAAAAAAAADHn5O+AAAAALU9H78AAAAAAAAAAAAAAADHn5O+AAAAAMefE74AAAAAAAAAAAAAAADTe5Y9AAAAAAtBhD0AAAAAimwkPgAAAACnoOy9AAAAAAtBhD0AAAAAimwkPgAAAACnoOy9AAAAAAtBhD0AAAAAM1HPvAAAAAAAAAAAAAAAAJKHd74AAAAAndxZvgAAAABhUio+AAAAAPYnj74AAAAAndxZvgAAAABhUio+AAAAAPYnj74AAAAAndxZvgAAAABhUio+AAAAAGT/e74AAAAAAAAAAAAAAACbtii+AAAAAIuEFL4AAAAAvlhyPQAAAAAAc8K+AAAAAIuEFL4AAAAAvlhyPQAAAAAAc8K+AAAAAIuEFL4AAAAAE2aGvgAAAAAAAAAAAAAAAFKntj0AAAAAfNmgPQAAAACzkpY+AAAAAKTzmj4AAAAAY3hbvQAAAAB82aA9AAAAALOSlj4AAAAApPOaPgAAAABjeFu9AAAAAHzZoD0AAAAAs5KWPgAAAABjeFu9AAAAAAAAAAAAAAAAWKYHvgAAAACwxe69AAAAAFKnNj4AAAAAppIrPQAAAACwxe69AAAAAFKnNj4AAAAAppIrPQAAAACwxe69AAAAAFKnNj4AAAAATcBVvQAAAAAAAAAAAAAAAAAAAAA9Cs9AAAAAAKRw5cEAAAAAcT0wwgAAAAAUruXBAAAAAArXt8IAAAAAcT0wwhSuF0HsUQrCAAAAAOzRkcIAAAAAcT0wwgAAAAAUruXBAAAAAArXt8IAAAAAcT0wwhSuF0HsUQrCAAAAAOzRkcIAAAAAcT0wwgAAAAAUruXBAAAAAOzRkcIAAAAAAAAAAG/b/r0AAAAA9h3gvQAAAAB12k++AAAAAPYd4L0AAAAAwAEyvgAAAAD2HeC9AAAAAHXaT74AAAAA9h3gvQAAAADAATK+AAAAAPYd4L0AAAAAddpPvgAAAADAATK+AAAAAAAAAAAAAAAAllboPQAAAAAodcw9AAAAAK4mXj4AAAAAm7YovgAAAAAodcw9AAAAAK4mXj4AAAAAm7YovgAAAAAodcw9AAAAAK4mXj4AAAAAzOt1vQAAAAAAAAAAAAAAAArXYz+F6/G/FK5HP+F61L8fhSvA9ijcv4/CVUAUrgc/FK5HP+F61L8K12M/hevxvxSuRz/hetS/H4UrwPYo3L+PwlVAFK4HPxSuRz/hetS/CtdjP4Xr8b8Urkc/4XrUvx+FK8D2KNy/CtdjP4Xr8b8AAAAAAAAAAAAAAAAAAAAAW9r5vQAAAAAAAAAAAAAAAAAAAAAAAAAAW9r5vQAAAAAAAAAAAAAAAAAAAAAAAAAAUqe2PQAAAAB82aA9AAAAAGPxOj4AAAAAl/OvPgAAAABjeFu9AAAAAHzZoD0AAAAAY/E6PgAAAACX868+AAAAAGN4W70AAAAAfNmgPQAAAABj8To+AAAAAGN4W70AAAAAAAAAAAAAAAAAAAAAAAAAAFyP+sAAAAAAAAAAAAAAAAAAAAAAAAAAABriSL4AAAAAe8EwvgAAAAD/ZAE9AAAAAFmo0L4AAAAAe8EwvgAAAAD/ZAE9AAAAAFmo0L4AAAAAe8EwvgAAAACLhJS+AAAAAAAAAAAAAAAAFYy3vgAAAADDxKq+AAAAAD0Tmb4AAAAANgaHvgAAAAA9E5m+AAAAADYGh74AAAAAvcXZvgAAAAAAAAAAAAAAAFKntj0AAAAAfNmgPQAAAABj8To+AAAAAI7CNb4AAAAAY3hbvQAAAAB82aA9AAAAAGPxOj4AAAAAjsI1vgAAAABjeFu9AAAAAHzZoD0AAAAAY/E6PgAAAABjeFu9AAAAAAAAAAAAAAAAb9v+vQAAAAD2HeC9AAAAAHXaT74AAAAA9h3gvQAAAADAATK+AAAAAPYd4L0AAAAAddpPvgAAAAD2HeC9AAAAAMABMr4AAAAA9h3gvQAAAAB12k++AAAAAMABMr4AAAAAAAAAAAAAAAAAAAAAAAAAADTY7z0AAAAAl3iHvgAAAAAAAAAAAAAAADTY7z0AAAAAl3iHvgAAAAAAAAAAAAAAAMmtVL4AAAAAAAAAAAAAAABv2/69AAAAAPYd4L0AAAAAddpPvgAAAAD2HeC9AAAAAMABMr4AAAAA9h3gvQAAAAB12k++AAAAAPYd4L0AAAAAwAEyvgAAAAD2HeC9AAAAAHXaT74AAAAAwAEyvgAAAAAAAAAAAAAAAJKHd74AAAAAndxZvgAAAABhUio+AAAAAPYnj74AAAAAndxZvgAAAABhUio+AAAAAPYnj74AAAAAndxZvgAAAABhUio+AAAAAGT/e74AAAAAAAAAAAAAAAArLE09AAAAAESbUz0AAAAAXgpaPQAAAAAIioO7AAAAAESbUz0AAAAAXgpaPQAAAAAIioO7AAAAAESbUz0AAAAAXgpaPQAAAACqV+08AAAAAAAAAAAAAAAAexQ+wKRw/b8pXC/AcT3qv3sUPsCkcP2/exQ+wKRw/b8pXC/AcT3qv3sUPsCkcP2/exQ+wKRw/b8pXC/AcT3qv4/CNcCF6/G/AAAAAAAAAADboJg9AAAAAMrFRL4AAAAA+d6PvgAAAAD53o++AAAAAMrFRL4AAAAA+d6PvgAAAAD53o++AAAAAMrFRL4AAAAAINdqvgAAAAAAAAAAAAAAANN7lj0AAAAAC0GEPQAAAACKbCQ+AAAAAKeg7L0AAAAAC0GEPQAAAACKbCQ+AAAAAKeg7L0AAAAAC0GEPQAAAAAzUc+8AAAAAAAAAAAAAAAAUqe2PQAAAAB82aA9AAAAALOSlj4AAAAALeEEPwAAAABjeFu9AAAAAHzZoD0AAAAAs5KWPgAAAAAt4QQ/AAAAAGN4W70AAAAAfNmgPQAAAACzkpY+AAAAAGN4W70AAAAAAAAAAAAAAAAAAAAAAAAAAFK41sAfhes/FK6HQOF6lL8AAAAAAAAAAFK41sAfhes/FK6HQOF6lL8AAAAAAAAAAFK41sAfhes/9ijcP9ej8L4AAAAAAAAAAAAAAAAAAAAAzOv1OwAAAAAiB0s8AAAAAMgmNDwAAAAAzOv1OwAAAAAiB0s8AAAAAMgmNDwAAAAAzOv1OwAAAAAiB0s8AAAAAEDWETwAAAAAAAAAAAAAAABxPQo/9ij8P9ej8D6kcN0/UrgGQXsU7r9I4TLBpHCdQI/CpUCuR2G+16PwPqRw3T9SuAZBexTuv0jhMsGkcJ1Aj8KlQK5HYb7Xo/A+pHDdP1K4BkF7FO6/7FEYQNejcD8AAAAAAAAAANjpl70AAAAAEK+FvQAAAAADmXO+AAAAALL1zj4AAAAAgbZSvgAAAAAQr4W9AAAAAAOZc74AAAAAsvXOPgAAAACBtlK+AAAAABCvhb0AAAAAA5lzvgAAAADdNfq9AAAAAAAAAAAAAAAAWKYHvgAAAACwxe69AAAAAP67Qb0AAAAAM0XXvgAAAACwxe69AAAAAP67Qb0AAAAAM0XXvgAAAACwxe69AAAAAP67Qb0AAAAAS5B1vgAAAAAAAAAAAAAAAJu2KL4AAAAAi4QUvgAAAAC+WHI9AAAAAABzwr4AAAAAi4QUvgAAAAC+WHI9AAAAAABzwr4AAAAAi4QUvgAAAAATZoa+AAAAAAAAAAAAAAAAAAAAAAAAAADfZVq+AAAAAHQ7v70AAAAAAAAAAAAAAACbtqi+AAAAAN9lWr4AAAAAdDu/vQAAAAAAAAAAAAAAAJu2qL4AAAAA32VavgAAAAB0O7+9AAAAAJu2qL4AAAAAAAAAAAAAAADfYxE/AAAAABYdh74AAAAADeyMvgAAAAD6c/E+AAAAAEONEj4AAAAATLKUOwAAAAB+CYE9AAAAAG9UXj4AAAAADeyMvgAAAAD6c/E+AAAAACH5CT4AAAAAbJ1dPQAAAAAQr4U9AAAAAN9jET8AAAAADeyMvgAAAAD6c/E+AAAAAN9jET8AAAAAAAAAAAAAAABmqDs+AAAAAI0jJT4AAAAAieUDvgAAAACBR6I9AAAAAI0jJT4AAAAAieUDvgAAAACBR6I9AAAAAI0jJT4AAAAAieUDvgAAAABNR/Y9AAAAAAAAAAAAAAAAZmbuwMP1OEAAAAAAAAAAAAAAAAAAAAAAcT0KQTMzFkJxPQpBMzMWQsP1AEHsUcRBw/UAQexRxEHXo/A/w/W4QAAAgD8AAIA/AAAAPwAAAD8AAMA/AADAPzMzMz8zMzM/pHB9P6RwfT+ambk/mpm5PwAAAAAAAAAAuB5FwGZmZsG4HkXAZmZmwexRNULhemxBAAAAAAAAAAAAAAAAAAAAAPKUM8AAAAAA8pQzwAAAAAB+ybjAAAAAAAAAgD8AAIA/AAAAPwAAAD8AAIA/AACAPwAAgD8AAIA/AAAAPwAAAD8AAIA/AACAPwAAAD8AAAA/exQuP3sULj89Chc/zcwMPxSuhz8fhYs/PQpXP+F6VD8AAIA/AACAPwrXoz4K16M+hesRP4XrET8K16M+CtejPgAAgD8AAIA/CtcjPwrXIz8AAIA/AACAPwrXoz4K16M+ZmYmP2ZmJj8AAIA/AACAPylcjz4K16M+H4XrPkjh+j4K16M+CtejPgAAgD8AAIA/PQoXPz0KFz8AAAAAFK7lwQAAAAAK17fCAAAAAHE9MMIUrhdB7FEKwgAAAADs0ZHCAAAAAHE9MMIAAAAAFK7lwQAAAAAK17fCAAAAAHE9MMIUrhdB7FEKwgAAAADs0ZHCAAAAAHE9MMIAAAAAFK7lwQAAAAAAAAAAXgpaPQAAAAAIioO7AAAAAESbUz0AAAAAXgpaPQAAAAAIioO7AAAAAESbUz0AAAAAAAAAAAAAAAAAAAAAAAAAALssRb8AAAAAAAAAAAAAAACuMA2/AAAAALssRb8AAAAAAAAAAAAAAACuMA2/AAAAAAAAAAAAAAAAAAAAAAAAAABSuNbAH4XrPxSuh0DhepS/AAAAAAAAAABSuNbAH4XrPxSuh0DhepS/AAAAAAAAAAAAAAAAAAAAACIHSzwAAAAAyCY0PAAAAADM6/U7AAAAACIHSzwAAAAAyCY0PAAAAADM6/U7AAAAAAAAAAAAAAAAzcx8wK5H6cAAAAAAAAAAAIXrsb/heiTAPQr3Px+FC8AAAAAAAAAAAM3MfMCuR+nAzcx8wK5H6cAAAAAAAAAAAIXrsb/heiTAPQr3Px+FC8AAAAAAAAAAAM3MfMCuR+nAKyxNvQAAAAAb+ri+AAAAAJs7gL8AAAAAC8IovwAAAACE9HO+AAAAAB5Cib4AAAAAT2mVPQAAAACE9HO+AAAAAJs7gL8AAAAAC8IovwAAAADQSza+AAAAAInbVL4AAAAAKyxNvQAAAAApXJfAXI8WwQAAAAAAAAAArkfBv3sUXsCuR8G/exRewAAAAAAAAAAArkfBv3sUXsApXJfAXI8WwQAAAAAAAAAArkfBv3sUXsCuR8G/exRewAAAAAAAAAAArkfBv3sUXsApXJfAXI8WwRwIej8AAAAAUHdWPAAAAABZLSg+AAAAAE3AVb0AAAAAt9yvPAAAAAABeb4/AAAAABwIej8AAAAA2ffYvQAAAABZLSg+AAAAAE3AVb0AAAAAaxa9vQAAAAABeb4/AAAAABwIej8AAAAAUrgGQXsU7r9I4TLBpHCdQI/CpUCuR2G+16PwPqRw3T9SuAZBexTuv0jhMsGkcJ1Aj8KlQK5HYb7Xo/A+pHDdP1K4BkF7FO6/QmtzvgAAAACy9c4+AAAAAIG2Ur4AAAAAEK+FvQAAAAADmXO+AAAAALL1zj4AAAAAgbZSvgAAAAAQr4W9AAAAAEJrc74AAAAAAAAAAAAAAAC4HiXBzcycQB+FG8CPwiVAPQq/wMP1qD+4HiXBzcycQB+FG8CPwiVAPQq/wMP1qD8AAAAAAAAAAAAAAAAAAAAAIgdLPAAAAADIJjQ8AAAAAMzr9TsAAAAAIgdLPAAAAADIJjQ8AAAAAMzr9TsAAAAAAAAAAAAAAAAAAAAAAAAAALU9H78AAAAAAAAAAAAAAADHn5O+AAAAALU9H78AAAAAAAAAAAAAAADHn5O+AAAAAAAAAAAAAAAAFK6XwIXrccDheqzAmpmJwBSul8CF63HAFK6XwIXrccDheqzAmpmJwBSul8CF63HAFK6XwIXrccDheqzAmpmJwBSul8CF63HAFK6XwIXrccDheqzAmpmJwBSul8CF63HAmp64vgAAAABW/ce+AAAAAJqeuL4AAAAAmp64vgAAAABW/ce+AAAAAJqeuL4AAAAAmp64vgAAAABW/ce+AAAAAJqeuL4AAAAAmp64vgAAAABW/ce+AAAAAJqeuL4AAAAAAAAAAAAAAAAAAAAAAAAAAI/CMUEAAKBAAAAAAAAAAAAAAAAAAAAAAI/CMUEAAKBAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAch1TvwAAAAAAAAAAAAAAAAAAAAAAAAAAch1TvwAAAAAAAAAAAAAAAPpz8T4AAAAAsd1ePgAAAACmkis9AAAAACOO6z0AAAAAhYVDPgAAAAAN7Iy+AAAAAPpz8T4AAAAAq3mMPgAAAAAN7Iy+AAAAAC1crT0AAAAA460qPgAAAAAN7Iy+AAAAAPpz8T4AAAAAAAAAAAAAAAAAALDAcT0qwbgeBcCkcMXAAACwwHE9KsG4HgXApHDFwAAAAAAAAAAAAAAAAAAAAABp5ty9AAAAAESbU7wAAAAAaebcvQAAAABEm1O8AAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAFK4/j/Xo4DAAAAAAAAAAABSuP4/16OAwAAAAAAAAAAAAAAAAAAAAADXQNg9AAAAAPhNQD0AAAAA10DYPQAAAAD4TUA9AAAAAAAAAAAAAAAAAAAAAAAAAAC1PR+/AAAAAAAAAAAAAAAAx5+TvgAAAAC1PR+/AAAAAAAAAAAAAAAAx5+TvgAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAADTgRI/AAAAAAAAAAAAAAAAAAAAAAAAAADTgRI/AAAAAAAAAAAAAAAAAAAAAAAAAAB7FD7ApHD9v3sUPsCkcP2/KVwvwHE96r97FD7ApHD9v3sUPsCkcP2/KVwvwHE96r8AAAAAAAAAAAAAAAAAAAAA+d6PvgAAAAD53o++AAAAAMrFRL4AAAAA+d6PvgAAAAD53o++AAAAAMrFRL4AAAAAAAAAAAAAAADGe6u+AAAAADTiHj4AAAAABLsSPgAAAAAEuxI+AAAAADTiHj4AAAAABLsSPgAAAADGe6u+AAAAADTiHj4AAAAABLsSPgAAAAAEuxI+AAAAADTiHj4AAAAABLsSPgAAAADGe6u+AAAAALOSlj4AAAAApPOaPgAAAABjeFu9AAAAAHzZoD0AAAAAs5KWPgAAAACk85o+AAAAAGN4W70AAAAAfNmgPQAAAACzkpY+AAAAAHXaT74AAAAA9h3gvQAAAADAATK+AAAAAPYd4L0AAAAAddpPvgAAAAD2HeC9AAAAAMABMr4AAAAA9h3gvQAAAAB12k++AAAAAAAAAAAAAAAAMSuevgAAAADjMoK+AAAAADErnr4AAAAA4zKCvgAAAAAAAAAAAAAAAAAAAAAAAAAA18f4vgAAAADkxZq+AAAAANfH+L4AAAAA5MWavgAAAAAAAAAAAAAAAAAAAAAAAAAAtT0fvwAAAAAAAAAAAAAAAMefk74AAAAAtT0fvwAAAAAAAAAAAAAAAMefk74AAAAAAAAAAAAAAAAAAAAAAAAAAIpsJD4AAAAAp6DsvQAAAAALQYQ9AAAAAIpsJD4AAAAAp6DsvQAAAAALQYQ9AAAAAAAAAAAAAAAAAAAAAAAAAAD+u0G9AAAAADNF174AAAAAsMXuvQAAAAD+u0G9AAAAADNF174AAAAAsMXuvQAAAAAAAAAAAAAAAAAAAAAAAAAAcT16wPYovD+PwoVBcT3KwI/ChUFxPcrAAAAAAAAAAABxPXrA9ii8P4/ChUFxPcrAj8KFQXE9ysAAAAAAAAAAAAAAAAAAAAAAVV63vQAAAAAXK0g+AAAAAHo6EL4AAAAAAAAAAAAAAABVXre9AAAAABcrSD4AAAAAejoQvgAAAAAAAAAAAAAAAB+FK8D2KNy/j8JVQBSuBz8Urkc/4XrUvwrXYz+F6/G/FK5HP+F61L8fhSvA9ijcv4/CVUAUrgc/FK5HP+F61L8K12M/hevxvxSuRz/hetS/H4UrwPYo3L8AAAAAAAAAAFva+b0AAAAAAAAAAAAAAAAAAAAAAAAAAFva+b0AAAAAAAAAAAAAAAAAAAAAAAAAAL5Ycj0AAAAAAHPCvgAAAACLhBS+AAAAAL5Ycj0AAAAAAHPCvgAAAACLhBS+AAAAAAAAAAAAAAAAAAAAAAAAAAD/ZAE9AAAAAFmo0L4AAAAAe8EwvgAAAAD/ZAE9AAAAAFmo0L4AAAAAe8EwvgAAAAAAAAAAAAAAAAAAAAAAAAAAWBU4PgAAAADxx06+AAAAAPPtfz0AAAAAWBU4PgAAAADxx06+AAAAAPPtfz0AAAAAAAAAAAAAAAAAAAAAAAAAAK4mXj4AAAAAm7YovgAAAAAodcw9AAAAAK4mXj4AAAAAm7YovgAAAAAodcw9AAAAAAAAAAAAAAAAAAAAAAAAAACJ5QO+AAAAAIFHoj0AAAAAjSMlPgAAAACJ5QO+AAAAAIFHoj0AAAAAjSMlPgAAAAAAAAAAAAAAAAAAAAAAAAAAYVIqPgAAAAD2J4++AAAAAJ3cWb4AAAAAYVIqPgAAAAD2J4++AAAAAJ3cWb4AAAAAAAAAAAAAAAAAAAAAAAAAAKwArTwAAAAAJJrjvgAAAACd3Fm+AAAAAKwArTwAAAAAJJrjvgAAAACd3Fm+AAAAAAAAAAAAAAAAAAAAAAAAAADfb4m+AAAAADCYhT4AAAAAjSMlPgAAAADfb4m+AAAAADCYhT4AAAAAjSMlPgAAAAAAAAAAAAAAALOSlj4AAAAALeEEPwAAAABjeFu9AAAAAHzZoD0AAAAAs5KWPgAAAAAt4QQ/AAAAAGN4W70AAAAAfNmgPQAAAACzkpY+AAAAAHXaT74AAAAA9h3gvQAAAADAATK+AAAAAPYd4L0AAAAAddpPvgAAAAD2HeC9AAAAAMABMr4AAAAA9h3gvQAAAAB12k++AAAAAGPxOj4AAAAAl/OvPgAAAABjeFu9AAAAAHzZoD0AAAAAY/E6PgAAAACX868+AAAAAGN4W70AAAAAfNmgPQAAAABj8To+AAAAAHXaT74AAAAA9h3gvQAAAADAATK+AAAAAPYd4L0AAAAAddpPvgAAAAD2HeC9AAAAAMABMr4AAAAA9h3gvQAAAAB12k++AAAAAAAAAAAAAAAAdmsfvQAAAADWubc9AAAAAHZrH70AAAAA1rm3PQAAAAAAAAAAAAAAAAAAAAAAAAAAe0hRvgAAAACMklW+AAAAAHtIUb4AAAAAjJJVvgAAAAAAAAAAAAAAAAAAAAAAAAAAimwkPgAAAACnoOy9AAAAAAtBhD0AAAAAimwkPgAAAACnoOy9AAAAAAtBhD0AAAAAAAAAAAAAAAAAAAAAAAAAAIg8xD0AAAAAmp44vgAAAAAAAAAAAAAAAIg8xD0AAAAAmp44vgAAAAAAAAAAAAAAAAAAAAAAAAAACAd1vgAAAAD3NVC/AAAAALDF7r0AAAAACAd1vgAAAAD3NVC/AAAAALDF7r0AAAAAAAAAAAAAAAAAAAAAAAAAAOq6vD0AAAAAoJ0JvgAAAACwxe69AAAAAOq6vD0AAAAAoJ0JvgAAAACwxe69AAAAAAAAAAAAAAAAAAAAAAAAAAC+WHI9AAAAAABzwr4AAAAAi4QUvgAAAAC+WHI9AAAAAABzwr4AAAAAi4QUvgAAAAAAAAAAAAAAAAAAAAAAAAAA/2QBPQAAAABZqNC+AAAAAHvBML4AAAAA/2QBPQAAAABZqNC+AAAAAHvBML4AAAAAAAAAAAAAAAAAAAAAAAAAAKlVJD8AAAAAQeKJvgAAAACd3Fm+AAAAAKlVJD8AAAAAQeKJvgAAAACd3Fm+AAAAAAAAAAAAAAAAAAAAAAAAAABhUio+AAAAAPYnj74AAAAAndxZvgAAAABhUio+AAAAAPYnj74AAAAAndxZvgAAAAAAAAAAAAAAAAAAAAAAAAAANNjvPQAAAACXeIe+AAAAAAAAAAAAAAAANNjvPQAAAACXeIe+AAAAAAAAAAAAAAAAAAAAAAAAAAA02O89AAAAAJd4h74AAAAAAAAAAAAAAAA02O89AAAAAJd4h74AAAAAAAAAAAAAAAAAAAAAAAAAAO8cxr4AAAAAL4yNPgAAAACNIyU+AAAAAO8cxr4AAAAAL4yNPgAAAACNIyU+AAAAAAAAAAAAAAAAAAAAAAAAAADfb4m+AAAAADCYhT4AAAAAjSMlPgAAAADfb4m+AAAAADCYhT4AAAAAjSMlPgAAAAAAAAAAAAAAAHXaT74AAAAA9h3gvQAAAABj/bK+AAAAAPYd4L0AAAAAddpPvgAAAAD2HeC9AAAAAGP9sr4AAAAA9h3gvQAAAAB12k++AAAAAHXaT74AAAAA9h3gvQAAAADAATK+AAAAAPYd4L0AAAAAddpPvgAAAAD2HeC9AAAAAMABMr4AAAAA9h3gvQAAAAB12k++AAAAAHXaT74AAAAA9h3gvQAAAADAATK+AAAAAPYd4L0AAAAAddpPvgAAAAD2HeC9AAAAAMABMr4AAAAA9h3gvQAAAAB12k++AAAAAAAAAAAAAAAAPQqfwJqZsUAAAAAAAAAAAAAAAAAAAAAAPQqfwJqZsUAAAAAAAAAAAFicWD4AAAAAL4LePgAAAABjeFu9AAAAAHzZoD0AAAAAWJxYPgAAAAAvgt4+AAAAAGN4W70AAAAAfNmgPQAAAABYnFg+AAAAAIWFwz0AAAAAE2YGvgAAAABjeFu9AAAAAHzZoD0AAAAAhYXDPQAAAAATZga+AAAAAGN4W70AAAAAfNmgPQAAAACFhcM9AAAAAGPxOj4AAAAAeI+HPgAAAABjeFu9AAAAAHzZoD0AAAAAY/E6PgAAAAB4j4c+AAAAAGN4W70AAAAAfNmgPQAAAABj8To+AAAAAAAAAAAAAAAAimwkPgAAAACnoOy9AAAAAAtBhD0AAAAAimwkPgAAAACnoOy9AAAAAAtBhD0AAAAAAAAAAAAAAAAAAAAAAAAAACDXaj4AAAAA8t8+vQAAAADcuAg+AAAAACDXaj4AAAAA8t8+vQAAAADcuAg+AAAAAAAAAAAAAAAAAAAAAAAAAAAG4cM8AAAAACoqhL4AAAAAWKYHvgAAAAAG4cM8AAAAACoqhL4AAAAAWKYHvgAAAAAAAAAAAAAAAAAAAAAAAAAAU7X3PQAAAADkxZq9AAAAALDF7r0AAAAAU7X3PQAAAADkxZq9AAAAALDF7r0AAAAAAAAAAAAAAAAAAAAAAAAAADTY7z0AAAAAl3iHvgAAAAAAAAAAAAAAADTY7z0AAAAAl3iHvgAAAAAAAAAAAAAAAAAAAAAAAAAANNjvPQAAAACXeIe+AAAAAAAAAAAAAAAANNjvPQAAAACXeIe+AAAAAAAAAAAAAAAAdDu/vQAAAABQd9akAAAAAJu2qL4AAAAA32VavgAAAAB0O7+9AAAAADX6DqUAAAAAm7aovgAAAADfZVq+AAAAAHQ7v70AAAAAaoOkPgAAAAD2HeC9AAAAAEyylDwAAAAAE9U2PgAAAABqg6Q+AAAAAPYd4L0AAAAATLKUPAAAAAAT1TY+AAAAAGqDpD4AAAAAddpPvgAAAAD2HeC9AAAAAMABMr4AAAAA9h3gvQAAAAB12k++AAAAAPYd4L0AAAAAwAEyvgAAAAD2HeC9AAAAAHXaT74AAAAAy2TVPQAAAACiMus9AAAAAGN4W70AAAAAfNmgPQAAAADLZNU9AAAAAKIy6z0AAAAAY3hbvQAAAAB82aA9AAAAAMtk1T0AAAAAY/E6PgAAAACOwjW+AAAAAGN4W70AAAAAfNmgPQAAAABj8To+AAAAAI7CNb4AAAAAY3hbvQAAAAB82aA9AAAAAGPxOj4AAAAAAAAAAAAAAABSpzY+AAAAAKaSKz0AAAAAsMXuvQAAAABSpzY+AAAAAKaSKz0AAAAAsMXuvQAAAAAAAAAAAAAAAAAAgD4K17vAmpkZPylct8AAAAAAAAAAAAAAAAAAAAAAAACAPgrXu8CamRk/KVy3wAAAAAAAAAAAAAAAAAAAAAAAAIA+Cte7wO4Qzr4AAAAA03FnvgAAAABjeFu9AAAAAEBFQr4AAAAA7hDOvgAAAADTcWe+AAAAAGN4W70AAAAAQEVCvgAAAADuEM6+AAAAAD0KFz/NzAw/FK6HPx+Fiz89Chc/zcwMPwAAgD8AAIA/CtejPgrXoz4AAIA/AACAPwrXoz4K16M+AACAPwAAgD8K16M+CtejPgAAgD8AAIA/CtejPgrXoz4AAIA/AACAPwAAgD8AAIA/KVyPPgrXoz4AAIA/AACAPwrXoz4K16M+AACAPwAAgD8K16M+CtejPsABMr4AAAAAb9v+vQAAAAA1+g4lAAAAAH39iL4AAAAAeanAPQAAAADdNXolAAAAAE1H9j0AAAAAZqg7PgAAAAA1+o4lAAAAADlEqL4AAAAAkod3vgAAAAA1+o4lAAAAAOxRGEDXo3A/cT0KP/Yo/D8AAAAAAAAAAN01+r0AAAAA2OmXvQAAAAAAAAAAAAAAAArXIz8K1yM/CtejPgrXoz4OdXa+AAAAADX6DqUAAAAAx58TvgAAAAA1+o49AAAAAMK4MqUAAAAArkeRwB+F6z+uR9nArkfBPwAAAAAAAAAAQNYRPAAAAACUMDclAAAAANjfaL4AAAAANfoOJAAAAADfYxE/AAAAAN9jET8AAAAANfoOJQAAAACPwjXAhevxv4/CNcCF6/G/exQ+wKRw/b8AAAAAAAAAACDXar4AAAAARTibvgAAAADboJg9AAAAADX6jiUAAAAAqlftPAAAAAArLE09AAAAADX6jiQAAAAASF7MvgAAAABYpge+AAAAADX6jiQAAAAAY3hbvQAAAABSp7Y9AAAAADX6DqUAAAAAKHXMvQAAAABYpge+AAAAADX6jqMAAAAAE2aGvgAAAACbtii+AAAAADX6DqUAAAAATLKUPAAAAABv2/69AAAAAHzZICUAAAAAM1HPvAAAAADTe5Y9AAAAAJZWaKUAAAAAY3hbvQAAAABSp7Y9AAAAADX6DqUAAAAAZP97vgAAAACSh3e+AAAAAFB31qQAAAAAwAEyvgAAAABv2/69AAAAADX6DiUAAAAAAAAAAAAAAADsUQjBZmY2QAAAAAAAAAAA4XqswJqZicDheqzAmpmJwAAAAAAAAAAAVv3HvgAAAABW/ce+AAAAADX6jqQAAAAAPQpXP+F6VD89Chc/zcwMP2P9sr4AAAAAb9v+vQAAAAAAAAAAAAAAAI/Qdr4AAAAAkod3vgAAAAA1+g4kAAAAAL5iob4AAAAANfqOPQAAAAA1+o4kAAAAAIuElL4AAAAAGuJIvgAAAAA1+o4kAAAAAMefE74AAAAANfqOPQAAAADCuDKlAAAAAArXYz+F6/G/CtdjP4Xr8b8AAAAAAAAAAGN4W70AAAAAUqe2PQAAAAA1+g6lAAAAAAAAAAAAALLBAAAAAAAAAAAAAIA/AACAPwAAgD8AAIA/AACAP8P1iD8AAIA/AACAP8mtVL4AAAAAUHfWJAAAAAA04h4+AAAAADTiHj4AAAAANfqOJQAAAABjeFu9AAAAAFKntj0AAAAANfoOpQAAAAD2KNw/16PwvgAAAAAAAAAAQNYRPAAAAACUMDclAAAAAGN4W70AAAAAUqe2PQAAAAA1+g6lAAAAANej8D/D9bhA16PwP8P1uEDheiXCuB77wpqZuT+ambk/7FEYQOxRGEAAAIA/AACAP8ABMr4AAAAAb9v+vQAAAAA1+g4lAAAAAIXrET+F6xE/AACAPwAAgD/XQFg+AAAAAGaoOz4AAAAAUHfWJAAAAADAATK+AAAAAG/b/r0AAAAANfoOJQAAAAAAAAAA7NGRwgAAAAA9Cs9AAAAAAAAAAAAzUc+8AAAAANN7lj0AAAAAllZopQAAAAA9Chc/PQoXPwrXoz4K16M+aeZcvgAAAAA1+o4lAAAAAOxRNULhemxB4zICPwAAAAB7FC4/exQuPwAAAD8AAAA/E2aGvgAAAACbtii+AAAAADX6DqUAAAAA9h1gPgAAAABmqDs+AAAAADX6DiUAAAAAAAAAAAAAAACF60HBAAAAAAAAAAAAAAAAvcXZvgAAAAAVjLe+AAAAADX6jiQAAAAAZP97vgAAAACSh3e+AAAAAFB31qQAAAAAH4XrPkjh+j4AAIA/AACAPwAAAAAfhY/BAAAAAAAAAAAAAIA/AACAPwAAgD8AAIA/AACAP83MjD8AAIA/AACAP65HfUH2KNzArkdhvwrXozwAAAAAAAAAALHnjb0AAAAAfxfCPQAAAAA1+g6kAAAAAGN4W70AAAAAUqe2PQAAAAA1+g6lAAAAAJMYx70AAAAAv3qRPQAAAAA1+g6lAAAAAIuElL4AAAAAGuJIvgAAAAA1+o4kAAAAAE3AVb0AAAAAWKYHvgAAAADCuDIlAAAAAMABMr4AAAAAb9v+vQAAAAA1+g4lAAAAAMzrdb0AAAAAllboPQAAAAA1+g6kAAAAAIwLtb4AAAAAjAu1vgAAAABQd1alAAAAAGZmJj9mZiY/AACAPwAAgD+PwrU/7FE4wAAAAAAAAAAA2fuLvwAAAAAXK8i9AAAAAAAAAAAAAAAAwAEyvgAAAABv2/69AAAAADX6DiUAAAAA7n9+PgAAAADuf34+AAAAAMK4MqUAAAAAeAowvgAAAABYpge+AAAAAFB31qQAAAAAS5B1vgAAAABYpge+AAAAAMK4MiUAAAAAVe8GPgAAAABrlRg/AAAAADX6jiUAAAAA10BYPgAAAABmqDs+AAAAAFB31iQAAAAAm7aovgAAAAA1+o6kAAAAAGpt/b0AAAAAWKYHvgAAAAA1+o4kAAAAAHE9OsAAAOjAAAAAAAAAAABGRBO9AAAAAE91DT8AAAAANfqOJAAAAADZcLi9AAAAADX6jqQAAAAACIBUvgAAAAB5qcA9AAAAADX6jiUAAAAAx58TvgAAAAA1+o49AAAAAMK4MqUAAAAAY3hbvQAAAABSp7Y9AAAAADX6DqUAAAAAM1HPvAAAAADTe5Y9AAAAAJZWaKUAAAAAvUoxPQAAAAAmTxs+AAAAAFB3ViUAAAAAY3hbvQAAAABSp7Y9AAAAADX6DqUAAAAAY3hbvQAAAABSp7Y9AAAAADX6DqUAAAAAAAAAAAAADQABAAAAAAAAAAIACAB+Aj8GYgrADkgT8xfBHLghBwACAAUAjAnZETgZnB+hJAsAAgAIAEcBHwTaBywM8BANFnUbIiESAAIAFABoAG0B3wKfBJoGwAgHC2QN0g9LEsUUPhesGQkcUB52IHEiMSSjJagmJQACAAsAIAG2Ax8HBws2D4cT2hcJHPEfWiPwJS8AAAAAAAIAHgAyALYAeAFqAoQDvgQSBnwH9wiBChUMtQ1aDwQRsRJfFAwWthdbGfsajxwZHpQf/iBSIowjpiSYJVom3iYdAAAAHgACAAgA3wHrBQcLphBqFgkcJSExJSUAAQAvAAAAAAACAA8AqwBKAoIEHwcFChgNSRCHE8cW+BkLHfEfjiLGJGUmDgAAABcAAgAPAKsASgKCBB8HBQoYDUkQhxPHFvgZCx3xH44ixiRlJiUAAQAvAAAAAAACAA8AqwBKAoIEHwcFChgNSRCHE8cW+BkLHfEfjiLGJGUmDgAAABsAAgALACABtgMfBwcLNg+HE9oXCRzxH1oj8CUlAAEALwAAAAAAAgAPAKsASgKCBB8HBQoYDUkQhxPHFvgZCx3xH44ixiRlJg4AAAASAAIAFABoAG0B3wKfBJoGwAgHC2QN0g9LEsUUPhesGQkcUB52IHEiMSSjJagmJQABAC8AAAAAAAIADwCrAEoCggQfBwUKGA1JEIcTxxb4GQsd8R+OIsYkZSYOAAAAFQACABEAigDfAbYD6wViCAcLzA2mEIcTahZEGQkcrh4lIVojMSWGJiUAAQAvAAAAAAACAAgAfgI/BmIKwA5IE/MXwRy4IQcAAgAFAIwJ2RE4GZwfoSQLAAIACABHAR8E2gcsDPAQDRZ1GyIhEgACABQAaABtAd8CnwSaBsAIBwtkDdIPSxLFFD4XrBkJHFAediBxIjEkoyWoJiUAAgALACABtgMfBwcLNg+HE9oXCRzxH1oj8CUvAAAAAAACAAcAfwOMCPgNhxMYGYQekSMGAAIABQC2AwcLhxMJHFojCgACABwAOQDNAKYBtQLtA0gFvwZLCOkJlwtPDRAP2RCiEm4UNxYAGMEZeRsnHcUeUSDIISMjWyRqJUMm1yYlAAIACwAgAbYDHwcHCzYPhxPaFwkc8R9aI/AlLwAAAAAAAgAIAH4CPwZiCsAOSBPzF8EcuCEHAAAACQACAAMA/QSBDhQaCwAAAA0AAgAGAN8CwAjSDz4XUB4xJBIAAAAUAAIAEgA4AzoGFgnVC3cOBBF5E9cVHhhNGmMcXB42IO0hfCPYJPUlvyYlAAAAJwACAAkAjgEABWwJXQ6HE7MYpB0QIoIlLwAAAAAAAgAIAH4CPwZiCsAOSBPzF8EcuCEHAAIABQCMCdkROBmcH6EkCwACAAgARwEfBNoHLAzwEA0WdRsiIRIAAgAUAGgAbQHfAp8EmgbACAcLZA3SD0sSxRQ+F6wZCRxQHnYgcSIxJKMlqCYlAAIACwAgAbYDHwcHCzYPhxPaFwkc8R9aI/AlLwAAAAAAAgAIAH4CPwZiCsAOSBPzF8EcuCEHAAIABQCMCdkROBmcH6EkCwACAAgARwEfBNoHLAzwEA0WdRsiIRIAAgAUAGgAbQHfAp8EmgbACAcLZA3SD0sSxRQ+F6wZCRxQHnYgcSIxJKMlqCYlAAIACwAgAbYDHwcHCzYPhxPaFwkc8R9aI/AlLwAAAAAAAgAIAH4CPwZiCsAOSBPzF8EcuCEHAAIABQCMCdkROBmcH6EkCwAAABIAAgAUAGgAbQHfAp8EmgbACAcLZA3SD0sSxRQ+F6wZCRxQHnYgcSIxJKMlqCYlAAIACwAgAbYDHwcHCzYPhxPaFwkc8R9aI/AlLwAAAAAAAgAIAH4CPwZiCsAOSBPzF8EcuCEHAAIABQCMCdkROBmcH6EkCwAAABIAAgAUAGgAbQHfAp8EmgbACAcLZA3SD0sSxRQ+F6wZCRxQHnYgcSIxJKMlqCYlAAIACwAgAbYDHwcHCzYPhxPaFwkc8R9aI/AlLwAAAAAAAgAIAH4CPwZiCsAOSBPzF8EcuCEHAAAACgACAAIABwsJHAsAAAAOAAIABQCQAtoHgQ4NFkQeEgAAABUAAgARAGMDjAaMCWwMLw/ZEWcU3hY4GXkbmx2cH3ghJyOhJNkltyYlAAAAKAACAAgA3wHrBQcLphBqFgkcJSExJS8AAAAAAAIABwB/A4wI+A2HExgZhB6RIwYAAAAIAAIAAwAfB4cT8R8KAAAADAACABoAQQDpAN8BDQNrBOsFiQc/CQcL3Qy9DqYQkhJ+FGoWUxgzGgkc0R2HHyUhpSIDJDElJybPJiUAAAAnAAIACQCOAQAFbAldDocTsxikHRAigiUvAAAAAAACAAoA4wHSBBcIjgsoD94SqhaOGokepiIJAAIAAwDRDTgZVSILAAIAAwD9BIEOFBoNAAIABgDfAsAI0g8+F1AeMSQSAAAAAAACAAgAfgI/BmIKwA5IE/MXwRy4IQcAAgADANENOBlVIgkAAgADANENOBlVIgsAAgADAP0EgQ4UGg0AAgAGAN8CwAjSDz4XUB4xJBIAAAAUAAAAJwACAAkAEAF5A6kGYgqBDvISpBeTHLchLwAAAAAAAgAIAH4CPwZiCsAOSBPzF8EcuCEHAAAACQACAAMA0Q04GVUiCwAAAA0AAgAGAN8CwAjSDz4XUB4xJBIAAAAUAAIAEgBVACoBVwLGA2oFOAcpCTkLYw2lD/0RZxTiFnAZCxy2HnEhOSQlAAAAJwAAAAAAAgAIAH4CPwZiCsAOSBPzF8EcuCEHAAIABQCMCdkROBmcH6EkCwACABsAPADaAMEB3wIpBJcFHwfACHIKNAz/DdIPrBGHE2QVPhcRGdwanhxQHvEfeSHnIjEkTyU2JtQmJQACAAsAIAG2Ax8HBws2D4cT2hcJHPEfWiPwJS8AAAAAAAIACAB+Aj8GYgrADkgT8xfBHLghBwACAAUAjAnZETgZnB+hJAsAAgAEAAAFXQ6zGBAiDgACAAUAtgMHC4cTCRxaIxIAAgAEAAAFXQ6zGBAiFQACAAQAAAVdDrMYECIYAAIABAAABV0OsxgQIhsAAgAEAAAFXQ6zGBAiHgACAAQAAAVdDrMYECIhAAIABQC2AwcLhxMJHFojJQACAAsAIAG2Ax8HBws2D4cT2hcJHPEfWiPwJS8AAAAAAAIACAB+Aj8GYgrADkgT8xfBHLghBwACAAUAjAnZETgZnB+hJAsAAAAlAAIACwAgAbYDHwcHCzYPhxPaFwkc8R9aI/AlLwAAAAAAAgAIAH4CPwZiCsAOSBPzF8EcuCEHAAIABQCMCdkROBmcH6EkCwAAACUAAgALACABtgMfBwcLNg+HE9oXCRzxH1oj8CUvAAAAAAACAAcAfwOMCPgNhxMYGYQekSMGAAAACgACAAUAtgMHC4cTCRxaIw4AAgAYAEsADAEiAngDAAWvBnwIYApYDF0OahB+EpIUphazGLgasByUHmEgECKYI+4kBCbFJiUAAAApAAIABwBKAh8HGA2HE/gZ8R/GJC8AAAAAAAIADAB9Ad4DjgZnCWEMcQ+UEsgVDBlhHMkfTCMLAAAADAACAAUAtgMHC4cTCRxaIxAAAgADAP0EgQ4UGhIAAAAXAAIADwDLA1EHpQrRDdsQxhOQFjgZvxseHlMgVSIbJJMloSYlAAAAKgACAAYA3wLACNIPPhdQHjEkLwAAAAAAAgAIAH4CPwZiCsAOSBPzF8EcuCEHAAIAAwDRDTgZVSIJAAIAAwAfB4cT8R8LAAIAAwD9BIEOFBoNAAIABgDfAsAI0g8+F1AeMSQSAAAAFAACABIAVQAqAVcCxgNqBTgHKQk5C2MNpQ/9EWcU4hZwGQscth5xITkkJQACAAMAHweHE/EfJwACAAkA7gVKC0MQ5xQ4GTAdvyDGIw4mLwAAAAAAAgAKAOMB0gQXCI4LKA/eEqoWjhqJHqYiCQACAAMAHweHE/EfCwACAAMA/QSBDhQaDQACAAYA3wLACNIPPhdQHjEkEgAAACcAAgAJAO4FSgtDEOcUOBkwHb8gxiMOJi8AAAAAAAIADAB9Ad4DjgZnCWEMcQ+UEsgVDBlhHMkfTCMLAAAADAACAAUAtgMHC4cTCRxaIxAAAgADANENOBlVIhIAAAAXAAIADwCrAEoCggQfBwUKGA1JEIcTxxb4GQsd8R+OIsYkZSYlAAAAKgACAAYA+gErBocLpRFVGHwfLwAAAAAAAQAHAAIABQCMCdkROBmcH6EkCwAAABIAAgAUAGgAbQHfAp8EmgbACAcLZA3SD0sSxRQ+F6wZCRxQHnYgcSIxJKMlqCYlAAIACwAgAbYDHwcHCzYPhxPaFwkc8R9aI/AlLwAAAAAAAQAHAAIABQCMCdkROBmcH6EkCwAAABIAAgAUAGgAbQHfAp8EmgbACAcLZA3SD0sSxRQ+F6wZCRxQHnYgcSIxJKMlqCYlAAAAAAACAAgAfgI/BmIKwA5IE/MXwRy4IQcAAgAFAIwJ2RE4GZwfoSQLAAAAEgACABQAaABtAd8CnwSaBsAIBwtkDdIPSxLFFD4XrBkJHFAediBxIjEkoyWoJiUAAgALACABtgMfBwcLNg+HE9oXCRzxH1oj8CUvAAAAAAACAAgAfgI/BmIKwA5IE/MXwRy4IQcAAgAFAIwJ2RE4GZwfoSQLAAAAEgACABQAaABtAd8CnwSaBsAIBwtkDdIPSxLFFD4XrBkJHFAediBxIjEkoyWoJiUAAgALACABtgMfBwcLNg+HE9oXCRzxH1oj8CUvAAAAAAACAAgAfgI/BmIKwA5IE/MXwRy4IQcAAgAFAIwJ2RE4GZwfoSQLAAIABAAABV0OsxgQIg4AAgAFALYDBwuHEwkcWiMSAAIABAAABV0OsxgQIhUAAgAEAAAFXQ6zGBAiGAACAAQAAAVdDrMYECIbAAIABAAABV0OsxgQIh4AAgAEAAAFXQ6zGBAiIQACAAUAtgMHC4cTCRxaIyUAAgALACABtgMfBwcLNg+HE9oXCRzxH1oj8CUvAAAAAAACAAgAfgI/BmIKwA5IE/MXwRy4IQcAAgAFAIwJ2RE4GZwfoSQLAAIACABHAR8E2gcsDPAQDRZ1GyIhEgACABQAaABtAd8CnwSaBsAIBwtkDdIPSxLFFD4XrBkJHFAediBxIjEkoyWoJiUAAgALACABtgMfBwcLNg+HE9oXCRzxH1oj8CUvAAAAAAACAAsAAAIbBYwIIwzQD4cTQBftGoQe9SEQJQoAAAAMAAIABQC2AwcLhxMJHFojEAACABYAVwA3AXYC/AO3BZwHoQm9C+sNJRBmEqoU6xYlGVMbbx10H1khFCOaJNkluSYlAAAAKwACAAUAtgMHC4cTCRxaIy8AAAAAAAIACAB+Aj8GYgrADkgT8xfBHLghBwACAAUAjAnZETgZnB+hJAsAAgAIAEcBHwTaBywM8BANFnUbIiESAAIAFABoAG0B3wKfBJoGwAgHC2QN0g9LEsUUPhesGQkcUB52IHEiMSSjJagmJQAAAAAAAgAIAH4CPwZiCsAOSBPzF8EcuCEHAAIABQCMCdkROBmcH6EkCwAAABIAAgAUAGgAbQHfAp8EmgbACAcLZA3SD0sSxRQ+F6wZCRxQHnYgcSIxJKMlqCYlAAAAAAACAAgAfgI/BmIKwA5IE/MXwRy4IQcAAAALAAIABQCMCdkROBmcH6EkDwAAACUAAAApAAIABwBKAh8HGA2HE/gZ8R/GJC8AAAAAAAIACAB+Aj8GYgrADkgT8xfBHLghBwACAAUAjAnZETgZnB+hJAsAAAASAAIAFABoAG0B3wKfBJoGwAgHC2QN0g9LEsUUPhesGQkcUB52IHEiMSSjJagmJQAAAAAAAgAIAH4CPwZiCsAOSBPzF8EcuCEHAAIABQCMCdkROBmcH6EkCwAAABIAAgAUAGgAbQHfAp8EmgbACAcLZA3SD0sSxRQ+F6wZCRxQHnYgcSIxJKMlqCYlAAAAAAACAAgAfgI/BmIKwA5IE/MXwRy4IQcAAgAFAIwJ2RE4GZwfoSQLAAAAEgACABQAaABtAd8CnwSaBsAIBwtkDdIPSxLFFD4XrBkJHFAediBxIjEkoyWoJiUAAgALACABtgMfBwcLNg+HE9oXCRzxH1oj8CUvAAAAAAACAAgAfgI/BmIKwA5IE/MXwRy4IQcAAgAFAIwJ2RE4GZwfoSQLAAAAEgACABQAaABtAd8CnwSaBsAIBwtkDdIPSxLFFD4XrBkJHFAediBxIjEkoyWoJiUAAgALACABtgMfBwcLNg+HE9oXCRzxH1oj8CUvAAAAAAACAAgAfgI/BmIKwA5IE/MXwRy4IQcAAgAFAMX7DP8HCGgUvSALAAIACABE/Bv8DP+HBOsLaBTsHPEjEgACABkAR/4E/TL8z/vT+zv8Af0e/o7/TAFOA48FBwivCn0NahBnE2sWZRlNHAkfjCG5I3YloSYqAAIABgCe+u/6cQAjCj0WnCEvAAAAAAACAAgAfgI/BmIKwA5IE/MXwRy4IQcAAgAFAMX7DP8HCGgUvSALAAIACABE/Bv8DP+HBOsLaBTsHPEjEgACABkAR/4E/TL8z/vT+zv8Af0e/o7/TAFOA48FBwivCn0NahBnE2sWZRlNHAkfjCG5I3YloSYqAAIABgCe+u/6cQAjCj0WnCEvAAAAAAACAAgAfgI/BmIKwA5IE/MXwRy4IQcAAgAFAIwJ2RE4GZwfoSQLAAAAEgACABQAaABtAd8CnwSaBsAIBwtkDdIPSxLFFD4XrBkJHFAediBxIjEkoyWoJiUAAgALACABtgMfBwcLNg+HE9oXCRzxH1oj8CUvAAAAAAACAAgAfgI/BmIKwA5IE/MXwRy4IQcAAgAFAIwJ2RE4GZwfoSQLAAAAEgACABQAaABtAd8CnwSaBsAIBwtkDdIPSxLFFD4XrBkJHFAediBxIjEkoyWoJiUAAgALACABtgMfBwcLNg+HE9oXCRzxH1oj8CUvAAAAAAACAAgAfgI/BmIKwA5IE/MXwRy4IQcAAgAFAIwJ2RE4GZwfoSQLAAAAEgACABQAaABtAd8CnwSaBsAIBwtkDdIPSxLFFD4XrBkJHFAediBxIjEkoyWoJiUAAgALACABtgMfBwcLNg+HE9oXCRzxH1oj8CUvAAAAAAACAAgAfgI/BmIKwA5IE/MXwRy4IQcAAgAFAIwJ2RE4GZwfoSQLAAAAEgACABQAaABtAd8CnwSaBsAIBwtkDdIPSxLFFD4XrBkJHFAediBxIjEkoyWoJiUAAgALACABtgMfBwcLNg+HE9oXCRzxH1oj8CUvAAAAAAACAAgAfgI/BmIKwA5IE/MXwRy4IQcAAgAFAIwJ2RE4GZwfoSQLAAAAEgACABQAaABtAd8CnwSaBsAIBwtkDdIPSxLFFD4XrBkJHFAediBxIjEkoyWoJiUAAgALACABtgMfBwcLNg+HE9oXCRzxH1oj8CUvAAAAAAACAAgAfgI/BmIKwA5IE/MXwRy4IQcAAgAFAIwJ2RE4GZwfoSQLAAAAEgACABQAaABtAd8CnwSaBsAIBwtkDdIPSxLFFD4XrBkJHFAediBxIjEkoyWoJiUAAgALACABtgMfBwcLNg+HE9oXCRzxH1oj8CUvAAAAAAACAAgAfgI/BmIKwA5IE/MXwRy4IQcAAgAFAIwJ2RE4GZwfoSQLAAAAEgACABQAaABtAd8CnwSaBsAIBwtkDdIPSxLFFD4XrBkJHFAediBxIjEkoyWoJiUAAgALACABtgMfBwcLNg+HE9oXCRzxH1oj8CUvAAAAAAACAAgAfgI/BmIKwA5IE/MXwRy4IQcAAgAFAIwJ2RE4GZwfoSQLAAAAEgACABQAaABtAd8CnwSaBsAIBwtkDdIPSxLFFD4XrBkJHFAediBxIjEkoyWoJiUAAgALACABtgMfBwcLNg+HE9oXCRzxH1oj8CUvAAAAAAACAAgAfgI/BmIKwA5IE/MXwRy4IQcAAgAFAIwJ2RE4GZwfoSQLAAAAEgACABQAaABtAd8CnwSaBsAIBwtkDdIPSxLFFD4XrBkJHFAediBxIjEkoyWoJiUAAgALACABtgMfBwcLNg+HE9oXCRzxH1oj8CUvAAAAAAACAAgAfgI/BmIKwA5IE/MXwRy4IQcAAgAFAIwJ2RE4GZwfoSQLAAIABAAABV0OsxgQIg4AAgAFALYDBwuHEwkcWiMSAAIABAAABV0OsxgQIhUAAgAEAAAFXQ6zGBAiGAACAAQAAAVdDrMYECIbAAIABAAABV0OsxgQIh4AAgAEAAAFXQ6zGBAiIQACAAUAtgMHC4cTCRxaIyUAAgALACABtgMfBwcLNg+HE9oXCRzxH1oj8CUvAAAAAAACAAgAfgI/BmIKwA5IE/MXwRy4IQcAAgAFAIwJ2RE4GZwfoSQLAAIACABHAR8E2gcsDPAQDRZ1GyIhEgACABQAaABtAd8CnwSaBsAIBwtkDdIPSxLFFD4XrBkJHFAediBxIjEkoyWoJiUAAAAAAAIACAB+Aj8GYgrADkgT8xfBHLghBwACAAUAjAnZETgZnB+hJAsAAAASAAIAFABoAG0B3wKfBJoGwAgHC2QN0g9LEsUUPhesGQkcUB52IHEiMSSjJagmJQAAAAAAAgAIAH4CPwZiCsAOSBPzF8EcuCEHAAIABQCMCdkROBmcH6EkCwAAABIAAgAUAGgAbQHfAp8EmgbACAcLZA3SD0sSxRQ+F6wZCRxQHnYgcSIxJKMlqCYlAAIACwAgAbYDHwcHCzYPhxPaFwkc8R9aI/AlLwAAAAAAAgAIAH4CPwZiCsAOSBPzF8EcuCEHAAIABQCMCdkROBmcH6EkCwAAABIAAgAUAGgAbQHfAp8EmgbACAcLZA3SD0sSxRQ+F6wZCRxQHnYgcSIxJKMlqCYlAAIACwAgAbYDHwcHCzYPhxPaFwkc8R9aI/AlLwAAAAAAAgAIAH4CPwZiCsAOSBPzF8EcuCEHAAIABQCMCdkROBmcH6EkCwAAABIAAgAUAGgAbQHfAp8EmgbACAcLZA3SD0sSxRQ+F6wZCRxQHnYgcSIxJKMlqCYlAAIACwAgAbYDHwcHCzYPhxPaFwkc8R9aI/AlLwAAAAAAAgAIAH4CPwZiCsAOSBPzF8EcuCEHAAIABQCMCdkROBmcH6EkCwAAABIAAgAUAGgAbQHfAp8EmgbACAcLZA3SD0sSxRQ+F6wZCRxQHnYgcSIxJKMlqCYlAAIACwAgAbYDHwcHCzYPhxPaFwkc8R9aI/AlLwAAAAAAAgAIAH4CPwZiCsAOSBPzF8EcuCEHAAIABQCMCdkROBmcH6EkCwAAABIAAgAUAGgAbQHfAp8EmgbACAcLZA3SD0sSxRQ+F6wZCRxQHnYgcSIxJKMlqCYlAAIACwAgAbYDHwcHCzYPhxPaFwkc8R9aI/AlLwAAAAAAAgAIAH4CPwZiCsAOSBPzF8EcuCEHAAIABQDF+wz/BwhoFL0gCwACAAgARPwb/Az/hwTrC2gU7BzxIxIAAgAZAEf+BP0y/M/70/s7/AH9Hv6O/0wBTgOPBQcIrwp9DWoQZxNrFmUZTRwJH4whuSN2JaEmKgACAAYAnvrv+nEAIwo9FpwhLwAAAAAAAgAIAH4CPwZiCsAOSBPzF8EcuCEHAAIABQDF+wz/BwhoFL0gCwACAAgARPwb/Az/hwTrC2gU7BzxIxIAAgAZAEf+BP0y/M/70/s7/AH9Hv6O/0wBTgOPBQcIrwp9DWoQZxNrFmUZTRwJH4whuSN2JaEmKgACAAYAnvrv+nEAIwo9FpwhLwAAAAAAAgAIAH4CPwZiCsAOSBPzF8EcuCEHAAIABQCMCdkROBmcH6EkCwAAABIAAgAUAGgAbQHfAp8EmgbACAcLZA3SD0sSxRQ+F6wZCRxQHnYgcSIxJKMlqCYlAAIACwAgAbYDHwcHCzYPhxPaFwkc8R9aI/AlLwAAAAAAAgAIAH4CPwZiCsAOSBPzF8EcuCEHAAIABQCMCdkROBmcH6EkCwAAABIAAgAUAGgAbQHfAp8EmgbACAcLZA3SD0sSxRQ+F6wZCRxQHnYgcSIxJKMlqCYlAAIACwAgAbYDHwcHCzYPhxPaFwkc8R9aI/AlLwAAAAAAAgAIAH4CPwZiCsAOSBPzF8EcuCEHAAIABQCMCdkROBmcH6EkCwAAABIAAgAUAGgAbQHfAp8EmgbACAcLZA3SD0sSxRQ+F6wZCRxQHnYgcSIxJKMlqCYlAAIACwAgAbYDHwcHCzYPhxPaFwkc8R9aI/AlLwAAAAAAAgAIAH4CPwZiCsAOSBPzF8EcuCEHAAIABQCMCdkROBmcH6EkCwAAABIAAgAUAGgAbQHfAp8EmgbACAcLZA3SD0sSxRQ+F6wZCRxQHnYgcSIxJKMlqCYlAAIACwAgAbYDHwcHCzYPhxPaFwkc8R9aI/AlLwAAAAAAAgAIAH4CPwZiCsAOSBPzF8EcuCEHAAIABQCMCdkROBmcH6EkCwAAABIAAgAUAGgAbQHfAp8EmgbACAcLZA3SD0sSxRQ+F6wZCRxQHnYgcSIxJKMlqCYlAAIACwAgAbYDHwcHCzYPhxPaFwkc8R9aI/AlLwAAAAAAAgAIAH4CPwZiCsAOSBPzF8EcuCEHAAIABQCMCdkROBmcH6EkCwAAABIAAgAUAGgAbQHfAp8EmgbACAcLZA3SD0sSxRQ+F6wZCRxQHnYgcSIxJKMlqCYlAAIACwAgAbYDHwcHCzYPhxPaFwkc8R9aI/AlLwAAAAAAAgAIAH4CPwZiCsAOSBPzF8EcuCEHAAIABQCMCdkROBmcH6EkCwAAABIAAgAUAGgAbQHfAp8EmgbACAcLZA3SD0sSxRQ+F6wZCRxQHnYgcSIxJKMlqCYlAAIACwAgAbYDHwcHCzYPhxPaFwkc8R9aI/AlLwAAAAAAAgAIAH4CPwZiCsAOSBPzF8EcuCEHAAIABQCMCdkROBmcH6EkCwAAABIAAgAUAGgAbQHfAp8EmgbACAcLZA3SD0sSxRQ+F6wZCRxQHnYgcSIxJKMlqCYlAAIACwAgAbYDHwcHCzYPhxPaFwkc8R9aI/AlLwAAAAAAAgAIAH4CPwZiCsAOSBPzF8EcuCEHAAIABQCMCdkROBmcH6EkCwACAAgARwEfBNoHLAzwEA0WdRsiIRIAAgAUAGgAbQHfAp8EmgbACAcLZA3SD0sSxRQ+F6wZCRxQHnYgcSIxJKMlqCYlAAAAAAACAAgAfgI/BmIKwA5IE/MXwRy4IQcAAgAFAIwJ2RE4GZwfoSQLAAAAEgACABQAaABtAd8CnwSaBsAIBwtkDdIPSxLFFD4XrBkJHFAediBxIjEkoyWoJiUAAAAAAAIACAB+Aj8GYgrADkgT8xfBHLghBwACAAUAjAnZETgZnB+hJAsAAAASAAIAFABoAG0B3wKfBJoGwAgHC2QN0g9LEsUUPhesGQkcUB52IHEiMSSjJagmJQAAAAAAAgAIAH4CPwZiCsAOSBPzF8EcuCEHAAIABQCMCdkROBmcH6EkCwAAABIAAgAUAGgAbQHfAp8EmgbACAcLZA3SD0sSxRQ+F6wZCRxQHnYgcSIxJKMlqCYlAAIACwAgAbYDHwcHCzYPhxPaFwkc8R9aI/AlLwAAAAAAAgAIAH4CPwZiCsAOSBPzF8EcuCEHAAAACwACAAgARPwb/Az/hwTrC2gU7BzxIxIAAgAZAEf+BP0y/M/70/s7/AH9Hv6O/0wBTgOPBQcIrwp9DWoQZxNrFmUZTRwJH4whuSN2JaEmKgACAAYAnvrv+nEAIwo9FpwhLwAAAAAAAgAIAH4CPwZiCsAOSBPzF8EcuCEHAAAACwACAAgARPwb/Az/hwTrC2gU7BzxIxIAAgAZAEf+BP0y/M/70/s7/AH9Hv6O/0wBTgOPBQcIrwp9DWoQZxNrFmUZTRwJH4whuSN2JaEmKgACAAYAnvrv+nEAIwo9FpwhLwAAAAAAAAALAAEADgABABIAAQAVAAEAGAABABsAAQAeAAEAIQABACUAAAAAAAIACAB+Aj8GYgrADkgT8xfBHLghBwACAAUAjAnZETgZnB+hJAsAAAASAAIAFABoAG0B3wKfBJoGwAgHC2QN0g9LEsUUPhesGQkcUB52IHEiMSSjJagmJQACAAsAIAG2Ax8HBws2D4cT2hcJHPEfWiPwJS8AAAAAAAIACAB+Aj8GYgrADkgT8xfBHLghBwACAAUAjAnZETgZnB+hJAsAAAASAAIAFABoAG0B3wKfBJoGwAgHC2QN0g9LEsUUPhesGQkcUB52IHEiMSSjJagmJQACAAsAIAG2Ax8HBws2D4cT2hcJHPEfWiPwJS8AAAAAAAIACAB+Aj8GYgrADkgT8xfBHLghBwACAAUAjAnZETgZnB+hJAsAAAASAAIAFABoAG0B3wKfBJoGwAgHC2QN0g9LEsUUPhesGQkcUB52IHEiMSSjJagmJQACAAsAIAG2Ax8HBws2D4cT2hcJHPEfWiPwJS8AAAAAAAIACAB+Aj8GYgrADkgT8xfBHLghBwACAAUAjAnZETgZnB+hJAsAAAASAAIAFABoAG0B3wKfBJoGwAgHC2QN0g9LEsUUPhesGQkcUB52IHEiMSSjJagmJQACAAsAIAG2Ax8HBws2D4cT2hcJHPEfWiPwJS8AAAAAAAIACAB+Aj8GYgrADkgT8xfBHLghBwACAAUAjAnZETgZnB+hJAsAAAASAAIAFABoAG0B3wKfBJoGwAgHC2QN0g9LEsUUPhesGQkcUB52IHEiMSSjJagmJQACAAsAIAG2Ax8HBws2D4cT2hcJHPEfWiPwJS8AAAAAAAIACAB+Aj8GYgrADkgT8xfBHLghBwACAAUAjAnZETgZnB+hJAsAAAASAAIAFABoAG0B3wKfBJoGwAgHC2QN0g9LEsUUPhesGQkcUB52IHEiMSSjJagmJQACAAsAIAG2Ax8HBws2D4cT2hcJHPEfWiPwJS8AAAAAAAEAFwABAC8AAAAAAAEADgAAABsAAQAvAAAAAAABABAAAAAeAAEALwAAAAAAAQASAAAAGwABAC8AAAAAAAEAEAAAABkAAQAvAAAAAAABAA0AAQAvAAAAAAABAA8AAAAcAAEALwAAAAAA//8HAAAALQD//wAAAQAHAAEACwAAACgAAQAtAAAAAAD//wcAAAAtAP//AAABAAcAAQALAAAAKAABAC0AAAAAAAIAHwB1AFIBWwJ/A7IE8gU7B4wI4Qk7C5kM+A1aD78QIhKHE+4UURa2FxgZdxrVGy8dhB7VHx4hXiKRI7UkviWbJh4AAgAfAC8AqwBkAUoCVgOCBMYFHweKCAUKigsYDa4OSRDoEYcTKBXHFmIY+BmGGwsdhh7xH0ohjiK6I8YkrCVlJuEmPAAAAAAAAgAjAGEAHAEAAvoCBgQbBTsGYAeMCLoJ7gojDFwNlQ7QDw0RSxKHE8UUAxZAF3sYtBntGiIcVh2EHrAf1SD1IQojFiQQJfQlryYiAAIAGwA8ANoAwQHfAikElwUfB8AIcgo0DP8N0g+sEYcTZBU+FxEZ3BqeHFAe8R95IeciMSRPJTYm1CY8AAAAAAACACMAYQAcAQAC+gIGBBsFOwZgB4wIugnuCiMMXA2VDtAPDRFLEocTxRQDFkAXexi0Ge0aIhxWHYQesB/VIPUhCiMWJBAl9CWvJiIAAgAbADwA2gDBAd8CKQSXBR8HwAhyCjQM/w3SD6wRhxNkFT4XERncGp4cUB7xH3kh5yIxJE8lNibUJjwAAAAAAAEAHgABADwAAAAAAAIAHwAvAKsAZAFKAlYDggTGBR8HiggFCooLGA2uDkkQ6BGHEygVxxZiGPgZhhsLHYYe8R9KIY4iuiPGJKwlZSbhJh4AAgAfAC8AqwBkAUoCVgOCBMYFHweKCAUKigsYDa4OSRDoEYcTKBXHFmIY+BmGGwsdhh7xH0ohjiK6I8YkrCVlJuEmPAAAAAAAAgAfAC8AqwBkAUoCVgOCBMYFHweKCAUKigsYDa4OSRDoEYcTKBXHFmIY+BmGGwsdhh7xH0ohjiK6I8YkrCVlJuEmHgACAB8ALwCrAGQBSgJWA4IExgUfB4oIBQqKCxgNrg5JEOgRhxMoFccWYhj4GYYbCx2GHvEfSiGOIrojxiSsJWUm4SY8AAAAAAACACMAYQAcAQAC+gIGBBsFOwZgB4wIugnuCiMMXA2VDtAPDRFLEocTxRQDFkAXexi0Ge0aIhxWHYQesB/VIPUhCiMWJBAl9CWvJiIAAgAbADwA2gDBAd8CKQSXBR8HwAhyCjQM/w3SD6wRhxNkFT4XERncGp4cUB7xH3kh5yIxJE8lNibUJjwAAAAAAAIAHwB1AFIBWwJ/A7IE8gU7B4wI4Qk7C5kM+A1aD78QIhKHE+4UURa2FxgZdxrVGy8dhB7VHx4hXiKRI7UkviWbJh4AAgAfAC8AqwBkAUoCVgOCBMYFHweKCAUKigsYDa4OSRDoEYcTKBXHFmIY+BmGGwsdhh7xH0ohjiK6I8YkrCVlJuEmPAAAAAAAAgAfAHUAUgFbAn8DsgTyBTsHjAjhCTsLmQz4DVoPvxAiEocT7hRRFrYXGBl3GtUbLx2EHtUfHiFeIpEjtSS+JZsmHgACAB8ALwCrAGQBSgJWA4IExgUfB4oIBQqKCxgNrg5JEOgRhxMoFccWYhj4GYYbCx2GHvEfSiGOIrojxiSsJWUm4SY8AAAAAAACAB8AdQBSAVsCfwOyBPIFOweMCOEJOwuZDPgNWg+/ECIShxPuFFEWthcYGXca1RsvHYQe1R8eIV4ikSO1JL4lmyYeAAIAHwAvAKsAZAFKAlYDggTGBR8HiggFCooLGA2uDkkQ6BGHEygVxxZiGPgZhhsLHYYe8R9KIY4iuiPGJKwlZSbhJjwAAAAAAAIABgCLB/0N/xOsGfweyiMFAAIAGgBBAOkA3wENA2sE6wWJBz8JBwvdDL0OphCSEn4UahZTGDMaCRzRHYcfJSGlIgMkMSUnJs8mHgACAAYA3wLACNIPPhdQHjEkIwACABoADgA4AH0A3wBeAfkBsQKGA3gEiAW0Bv4HZgnqCokMRA4bEAwSFxQ7FnQYwRohHZAfCyKMJDwAAAAAAAIABgCLB/0N/xOsGfweyiMFAAIAGgBBAOkA3wENA2sE6wWJBz8JBwvdDL0OphCSEn4UahZTGDMaCRzRHYcfJSGlIgMkMSUnJs8mHgACAAYA3wLACNIPPhdQHjEkIwACABoADgA4AH0A3wBeAfkBsQKGA3gEiAW0Bv4HZgnqCokMRA4bEAwSFxQ7FnQYwRohHZAfCyKMJDwAAAAAAAIAHwB1AFIBWwJ/A7IE8gU7B4wI4Qk7C5kM+A1aD78QIhKHE+4UURa2FxgZdxrVGy8dhB7VHx4hXiKRI7UkviWbJh4AAgAfAC8AqwBkAUoCVgOCBMYFHweKCAUKigsYDa4OSRDoEYcTKBXHFmIY+BmGGwsdhh7xH0ohjiK6I8YkrCVlJuEmPAAAAAAAAgAfAHUAUgFbAn8DsgTyBTsHjAjhCTsLmQz4DVoPvxAiEocT7hRRFrYXGBl3GtUbLx2EHtUfHiFeIpEjtSS+JZsmHgACAB8ALwCrAGQBSgJWA4IExgUfB4oIBQqKCxgNrg5JEOgRhxMoFccWYhj4GYYbCx2GHvEfSiGOIrojxiSsJWUm4SY8AAAAAAACAAcA1Aa5DDESVRcsHKggmSQGAAIAHwAvAKsAZAFKAlYDggTGBR8HiggFCooLGA2uDkkQ6BGHEygVxxZiGPgZhhsLHYYe8R9KIY4iuiPGJKwlZSbhJiQAAgAZADYAxACWAZwCzgMhBZIGGwi3CWQLHA3fDqsQfBJSFCgW/xfTGaQbbR0uH+QgjCIkJKclPAAAAAAAAgAHANQGuQwxElUXLByoIJkkBgACAB8ALwCrAGQBSgJWA4IExgUfB4oIBQqKCxgNrg5JEOgRhxMoFccWYhj4GYYbCx2GHvEfSiGOIrojxiSsJWUm4SYkAAIAGQA2AMQAlgGcAs4DIQWSBhsItwlkCxwN3w6rEHwSUhQoFv8X0xmkG20dLh/kIIwiJCSnJTwAAAAAAAIACwCtBL4Ijgw0ELcTGxdiGoUdfiA/I6QlCgACABUAXwBRAacCSQQiBiYISwqGDNQOKhGHE+YVPBiKGsUc6h7uIMciaSS/JbEmHgACAAsAIAG2Ax8HBws2D4cT2hcJHPEfWiPwJSgAAgAVABUAVAC9AFEBEAL7AhIEVAXDBl4IJAoVDDAOdBDgEnEVJRj4Gucd6CD7IzwAAAAAAAIACwCtBL4Ijgw0ELcTGxdiGoUdfiA/I6QlCgACABUAXwBRAacCSQQiBiYISwqGDNQOKhGHE+YVPBiKGsUc6h7uIMciaSS/JbEmHgACAAsAIAG2Ax8HBws2D4cT2hcJHPEfWiPwJSgAAgAVABUAVAC9AFEBEAL7AhIEVAXDBl4IJAoVDDAOdBDgEnEVJRj4Gucd6CD7IzwAAAAAAAIACQBgBSMKnQ7jEv4W7RqoHiIiLyUIAAIAFwBRACABSgK2A1gFHwcHCQcLGA02D10RhxOzFdoX+BkJHAke8R+4IVojxiTwJb8mHgAAACYAAgAXADoA0wC1AdACGQSJBRcHvgh7CkkMJg4NEP4R9hPwFe4X6xnkG9sdyh+xIYojViU8AAAAAAACAB8AdQBSAVsCfwOyBPIFOweMCOEJOwuZDPgNWg+/ECIShxPuFFEWthcYGXca1RsvHYQe1R8eIV4ikSO1JL4lmyYeAAIAHwAvAKsAZAFKAlYDggTGBR8HiggFCooLGA2uDkkQ6BGHEygVxxZiGPgZhhsLHYYe8R9KIY4iuiPGJKwlZSbhJjwAAAAAAAIAHwB1AFIBWwJ/A7IE8gU7B4wI4Qk7C5kM+A1aD78QIhKHE+4UURa2FxgZdxrVGy8dhB7VHx4hXiKRI7UkviWbJh4AAgAfAC8AqwBkAUoCVgOCBMYFHweKCAUKigsYDa4OSRDoEYcTKBXHFmIY+BmGGwsdhh7xH0ohjiK6I8YkrCVlJuEmPAAAAAAAAgAJAGUFLgqrDvUSDxf8GrUeKiIzJQgAAgAXAFEAIAFKArYDWAUfBwcJBwsYDTYPXRGHE7MV2hf4GQkcCR7xH7ghWiPGJPAlvyYeAAAAJgACABcAOgDTALUB0AIZBIkFFwe+CHsKSQwmDg0Q/hH2E/AV7hfrGeQb2x3KH7EhiiNWJTwAAAAAAAIAHwB1AFIBWwJ/A7IE8gU7B4wI4Qk7C5kM+A1aD78QIhKHE+4UURa2FxgZdxrVGy8dhB7VHx4hXiKRI7UkviWbJh4AAgAfAC8AqwBkAUoCVgOCBMYFHweKCAUKigsYDa4OSRDoEYcTKBXHFmIY+BmGGwsdhh7xH0ohjiK6I8YkrCVlJuEmPAAAAAAAAgAfAHUAUgFbAn8DsgTyBTsHjAjhCTsLmQz4DVoPvxAiEocT7hRRFrYXGBl3GtUbLx2EHtUfHiFeIpEjtSS+JZsmHgACAB8ALwCrAGQBSgJWA4IExgUfB4oIBQqKCxgNrg5JEOgRhxMoFccWYhj4GYYbCx2GHvEfSiGOIrojxiSsJWUm4SY8AAAAAAACAA8AeAOaBo8JZwwpD9cRdBT+FnoZ4Rs0Hm8giiJ6JCEmDgACABEAigDfAbYD6wViCAcLzA2mEIcTahZEGQkcrh4lIVojMSWGJh4AAAAsAAIAEQBfAFUBugJzBG0GmgjuCmIN7Q+JEi4V2heFGikdxB9NIr8kPAAAAAAAAgALAG0Ebwg7DOIPaRPUFiEaTR1SICAjlSUKAAIAFQBfAFEBpwJJBCIGJghLCoYM1A4qEYcT5hU8GIoaxRzqHu4gxyJpJL8lsSYeAAAAKAACABUAPwDmAN0BFAN9BA4GxAeUCXwLeA2DD5sRvRPlFRMYQxpzHKEeyiDsIgQlPAAAAAAAAgALAEoD0QZnCgIOmBEoFakYFxxnH4giUiUKAAIAFQBfAFEBpwJJBCIGJghLCoYM1A4qEYcT5hU8GIoaxRzqHu4gxyJpJL8lsSYeAAIACwAgAbYDHwcHCzYPhxPaFwkc8R9aI/AlKAACABUAPwDmAN0BFAN9BA4GxAeUCXwLeA2DD5sRvRPlFRMYQxpzHKEeyiDsIgQlPAAAAAAAAgALAEoD0QZnCgIOmBEoFakYFxxnH4giUiUKAAIAFQBfAFEBpwJJBCIGJghLCoYM1A4qEYcT5hU8GIoaxRzqHu4gxyJpJL8lsSYeAAIACwAgAbYDHwcHCzYPhxPaFwkc8R9aI/AlKAACABUAPwDmAN0BFAN9BA4GxAeUCXwLeA2DD5sRvRPlFRMYQxpzHKEeyiDsIgQlPAAAAAAAAgAQAEkDRAYWCcoLaQ72EHIT3hU8GIcaxBzrHvsg7SK2JDkmDwACABAAmQAQAhUEewYlCf0L9g4AEhAVGhgTG+sdlSD7IgAldyYeAAAALQACABAAbwCJARkDAwUvB40JEgy0DmsRMBT+FswZlhxWHwQimiQ8AAAAAAACAAYA1Ad5DpcURxqGHyQkBQACABoAQQDpAN8BDQNrBOsFiQc/CQcL3Qy9DqYQkhJ+FGoWUxgzGgkc0R2HHyUhpSIDJDElJybPJh4AAAAjAAIAGgA0AL8AigGKArID/QRkBuEHcgkRC74MdQ4zEPcRvxOHFU4XFBnWGpAcQh7oH4EhCSN8JNUlPAAAAAAAAgAfAHUAUgFbAn8DsgTyBTsHjAjhCTsLmQz4DVoPvxAiEocT7hRRFrYXGBl3GtUbLx2EHtUfHiFeIpEjtSS+JZsmHgACAB8ALwCrAGQBSgJWA4IExgUfB4oIBQqKCxgNrg5JEOgRhxMoFccWYhj4GYYbCx2GHvEfSiGOIrojxiSsJWUm4SY8AAAAAAACAB8AdQBSAVsCfwOyBPIFOweMCOEJOwuZDPgNWg+/ECIShxPuFFEWthcYGXca1RsvHYQe1R8eIV4ikSO1JL4lmyYeAAIAHwAvAKsAZAFKAlYDggTGBR8HiggFCooLGA2uDkkQ6BGHEygVxxZiGPgZhhsLHYYe8R9KIY4iuiPGJKwlZSbhJjwAAAAAAAIAHwAvAKsAZAFKAlYDggTGBR8HiggFCooLGA2uDkkQ6BGHEygVxxZiGPgZhhsLHYYe8R9KIY4iuiPGJKwlZSbhJh4AAgAfAC8AqwBkAUoCVgOCBMYFHweKCAUKigsYDa4OSRDoEYcTKBXHFmIY+BmGGwsdhh7xH0ohjiK6I8YkrCVlJuEmPAAAAAAAAgAfAC8AqwBkAUoCVgOCBMYFHweKCAUKigsYDa4OSRDoEYcTKBXHFmIY+BmGGwsdhh7xH0ohjiK6I8YkrCVlJuEmHgACAB8ALwCrAGQBSgJWA4IExgUfB4oIBQqKCxgNrg5JEOgRhxMoFccWYhj4GYYbCx2GHvEfSiGOIrojxiSsJWUm4SY8AAAAAAACAB8ALwCrAGQBSgJWA4IExgUfB4oIBQqKCxgNrg5JEOgRhxMoFccWYhj4GYYbCx2GHvEfSiGOIrojxiSsJWUm4SYeAAIAHwAvAKsAZAFKAlYDggTGBR8HiggFCooLGA2uDkkQ6BGHEygVxxZiGPgZhhsLHYYe8R9KIY4iuiPGJKwlZSbhJjwAAAAAAAIACwBtBG8IOwziD2kT1BYhGk0dUiAgI5UlCgACABUAXwBRAacCSQQiBiYISwqGDNQOKhGHE+YVPBiKGsUc6h7uIMciaSS/JbEmHgAAACgAAgAVADwA2gDBAeICMgSoBUAH9gjCCqQMmA6fELQS1RQDFzkZehvAHQ8gYSK4JDwAAAAAAAIACwBtBG8IOwziD2kT1BYhGk0dUiAgI5UlCgACABUAXwBRAacCSQQiBiYISwqGDNQOKhGHE+YVPBiKGsUc6h7uIMciaSS/JbEmHgAAACgAAgAVADwA1wC3Ac0CDwR2BfsGnQhWCiUMCA79DwUSHRREFnoYwBoVHXkf7iF2JDwAAAAAAAIAFACwAiMFdgeyCd4L/A0PEBcSFBQJFvMX0hmnG3AdKx/YIHEi8iNPJXMmEwACAAwA+gBBA0kGyQmUDYcRiRV8GUcdxyDPIxYmHgAAADEAAgAMALYAdALaBLYH5QpMDtgRexUmGc0cYSDSIzwAAAAAAAIAHwB1AFIBWwJ/A7IE8gU7B4wI4Qk7C5kM+A1aD78QIhKHE+4UURa2FxgZdxrVGy8dhB7VHx4hXiKRI7UkviWbJh4AAgAfAC8AqwBkAUoCVgOCBMYFHweKCAUKigsYDa4OSRDoEYcTKBXHFmIY+BmGGwsdhh7xH0ohjiK6I8YkrCVlJuEmPAAAAAAAAgAfAHUAUgFbAn8DsgTyBTsHjAjhCTsLmQz4DVoPvxAiEocT7hRRFrYXGBl3GtUbLx2EHtUfHiFeIpEjtSS+JZsmHgACAB8ALwCrAGQBSgJWA4IExgUfB4oIBQqKCxgNrg5JEOgRhxMoFccWYhj4GYYbCx2GHvEfSiGOIrojxiSsJWUm4SY8AAAAAAACAAoA3gQ8CVoNTBEYFb8YQhyYH7IiaSUJAAIAFgBXADcBdgL8A7cFnAehCb0L6w0lEGYSqhTrFiUZUxtvHXQfWSEUI5ok2SW5Jh4AAAAnAAIAFgA8ANsAxgHsAkIEwAVeBxcJ5wrIDLoOtxC+EssU3BbxGAcbGh0qHzMhMyMpJTwAAAAAAAIAHwB1AFIBWwJ/A7IE8gU7B4wI4Qk7C5kM+A1aD78QIhKHE+4UURa2FxgZdxrVGy8dhB7VHx4hXiKRI7UkviWbJh4AAgAfAC8AqwBkAUoCVgOCBMYFHweKCAUKigsYDa4OSRDoEYcTKBXHFmIY+BmGGwsdhh7xH0ohjiK6I8YkrCVlJuEmPAAAAAAAAgAfAHUAUgFbAn8DsgTyBTsHjAjhCTsLmQz4DVoPvxAiEocT7hRRFrYXGBl3GtUbLx2EHtUfHiFeIpEjtSS+JZsmHgACAB8ALwCrAGQBSgJWA4IExgUfB4oIBQqKCxgNrg5JEOgRhxMoFccWYhj4GYYbCx2GHvEfSiGOIrojxiSsJWUm4SY8AAAAAAACAB8AdQBSAVsCfwOyBPIFOweMCOEJOwuZDPgNWg+/ECIShxPuFFEWthcYGXca1RsvHYQe1R8eIV4ikSO1JL4lmyYeAAIAHwAvAKsAZAFKAlYDggTGBR8HiggFCooLGA2uDkkQ6BGHEygVxxZiGPgZhhsLHYYe8R9KIY4iuiPGJKwlZSbhJjwAAAAAAAIAHwB1AFIBWwJ/A7IE8gU7B4wI4Qk7C5kM+A1aD78QIhKHE+4UURa2FxgZdxrVGy8dhB7VHx4hXiKRI7UkviWbJh4AAgAfAC8AqwBkAUoCVgOCBMYFHweKCAUKigsYDa4OSRDoEYcTKBXHFmIY+BmGGwsdhh7xH0ohjiK6I8YkrCVlJuEmPAAAAAAAAgAfAHUAUgFbAn8DsgTyBTsHjAjhCTsLmQz4DVoPvxAiEocT7hRRFrYXGBl3GtUbLx2EHtUfHiFeIpEjtSS+JZsmHgACAB8ALwCrAGQBSgJWA4IExgUfB4oIBQqKCxgNrg5JEOgRhxMoFccWYhj4GYYbCx2GHvEfSiGOIrojxiSsJWUm4SY8AAAAAAACAB8AdQBSAVsCfwOyBPIFOweMCOEJOwuZDPgNWg+/ECIShxPuFFEWthcYGXca1RsvHYQe1R8eIV4ikSO1JL4lmyYeAAIAHwAvAKsAZAFKAlYDggTGBR8HiggFCooLGA2uDkkQ6BGHEygVxxZiGPgZhhsLHYYe8R9KIY4iuiPGJKwlZSbhJjwAAAAAAAIAHwB1AFIBWwJ/A7IE8gU7B4wI4Qk7C5kM+A1aD78QIhKHE+4UURa2FxgZdxrVGy8dhB7VHx4hXiKRI7UkviWbJh4AAgAfAC8AqwBkAUoCVgOCBMYFHweKCAUKigsYDa4OSRDoEYcTKBXHFmIY+BmGGwsdhh7xH0ohjiK6I8YkrCVlJuEmPAAAAAAAAgAfAHUAUgFbAn8DsgTyBTsHjAjhCTsLmQz4DVoPvxAiEocT7hRRFrYXGBl3GtUbLx2EHtUfHiFeIpEjtSS+JZsmHgACAB8ALwCrAGQBSgJWA4IExgUfB4oIBQqKCxgNrg5JEOgRhxMoFccWYhj4GYYbCx2GHvEfSiGOIrojxiSsJWUm4SY8AAAAAAACAB8AdQBSAVsCfwOyBPIFOweMCOEJOwuZDPgNWg+/ECIShxPuFFEWthcYGXca1RsvHYQe1R8eIV4ikSO1JL4lmyYeAAIAHwAvAKsAZAFKAlYDggTGBR8HiggFCooLGA2uDkkQ6BGHEygVxxZiGPgZhhsLHYYe8R9KIY4iuiPGJKwlZSbhJjwAAAAAAAIAHwB1AFIBWwJ/A7IE8gU7B4wI4Qk7C5kM+A1aD78QIhKHE+4UURa2FxgZdxrVGy8dhB7VHx4hXiKRI7UkviWbJh4AAgAfAC8AqwBkAUoCVgOCBMYFHweKCAUKigsYDa4OSRDoEYcTKBXHFmIY+BmGGwsdhh7xH0ohjiK6I8YkrCVlJuEmPAAAAAAAAgAGADYHqQ3FE5YZBx/mIwUAAgAfAC8AqwBkAUoCVgOCBMYFHweKCAUKigsYDa4OSRDoEYcTKBXHFmIY+BmGGwsdhh7xH0ohjiK6I8YkrCVlJuEmIwACABoAKACTADIB+gHkAuwDDAVDBo0H6QhVCs8LWA3sDo0QOBLvE68VeRdMGSkbDR38HvIg8yL9JDwAAAAAAAIAHwB1AFIBWwJ/A7IE8gU7B4wI4Qk7C5kM+A1aD78QIhKHE+4UURa2FxgZdxrVGy8dhB7VHx4hXiKRI7UkviWbJh4AAgAfAC8AqwBkAUoCVgOCBMYFHweKCAUKigsYDa4OSRDoEYcTKBXHFmIY+BmGGwsdhh7xH0ohjiK6I8YkrCVlJuEmPAAAAAAAAgAfAHUAUgFbAn8DsgTyBTsHjAjhCTsLmQz4DVoPvxAiEocT7hRRFrYXGBl3GtUbLx2EHtUfHiFeIpEjtSS+JZsmHgACAB8ALwCrAGQBSgJWA4IExgUfB4oIBQqKCxgNrg5JEOgRhxMoFccWYhj4GYYbCx2GHvEfSiGOIrojxiSsJWUm4SY8AAAAAAACAAYA3QZIDXATUxnfHtgjBQACABoAQQDpAN8BDQNrBOsFiQc/CQcL3Qy9DqYQkhJ+FGoWUxgzGgkc0R2HHyUhpSIDJDElJybPJh4AAAAjAAIAGgA0AL8AigGKArID/QRkBuEHcgkRC74MdQ4zEPcRvxOHFU4XFBnWGpAcQh7oH4EhCSN8JNUlPAAAAAAAAgAVAH4CzQQBByMJNQs9DToPLhEYE/oU1BakGGwaKhzeHYQfHSGjIhMkYSV5JhQAAgALACABtgMfBwcLNg+HE9oXCRzxH1oj8CUeAAAAMgACAAsAsQBbAqcEaAeFCuwNlBF2FY4Z2B1XIjwAAAAAAAIAFQB+As0EAQcjCTULPQ06Dy4RGBP6FNQWpBhsGioc3h2EHx0hoyITJGEleSYUAAIACwAgAbYDHwcHCzYPhxPaFwkc8R9aI/AlHgAAADIAAgALALMAagLQBLEH8wp+DkISNRZNGn8exCI8AAAAAAACAAcA1Aa5DDESVRcsHKggmSQGAAIAGQBGAPoA/gFBA7IESQb+B8kJqAuUDYoPhxGHE4kVhhd8GWgbRx0SH8cgXiLPIxIlFibKJh4AAAAkAAIAGQA2AMQAlgGcAs4DIQWSBhsItwlkCxwN3w6rEHwSUhQoFv8X0xmkG20dLh/kIIwiJCSnJTwAAAAAAAIAHwB1AFIBWwJ/A7IE8gU7B4wI4Qk7C5kM+A1aD78QIhKHE+4UURa2FxgZdxrVGy8dhB7VHx4hXiKRI7UkviWbJh4AAgAfAC8AqwBkAUoCVgOCBMYFHweKCAUKigsYDa4OSRDoEYcTKBXHFmIY+BmGGwsdhh7xH0ohjiK6I8YkrCVlJuEmPAAAAAAAAgAHANQGuQwxElUXLByoIJkkBgACABkARgD6AP4BQQOyBEkG/gfJCagLlA2KD4cRhxOJFYYXfBloG0cdEh/HIF4izyMSJRYmyiYeAAAAJAACABkANgDEAJYBnALOAyEFkgYbCLcJZAscDd8OqxB8ElIUKBb/F9MZpBttHS4f5CCMIiQkpyU8AAAAAAACAB8AdQBSAVsCfwOyBPIFOweMCOEJOwuZDPgNWg+/ECIShxPuFFEWthcYGXca1RsvHYQe1R8eIV4ikSO1JL4lmyYeAAIAHwAvAKsAZAFKAlYDggTGBR8HiggFCooLGA2uDkkQ6BGHEygVxxZiGPgZhhsLHYYe8R9KIY4iuiPGJKwlZSbhJjwAAAAAAAIABwDUBrkMMRJVFywcqCCZJAYAAgAZAEYA+gD+AUEDsgRJBv4HyQmoC5QNig+HEYcTiRWGF3wZaBtHHRIfxyBeIs8jEiUWJsomHgAAACQAAgAZADYAxACWAZwCzgMhBZIGGwi3CWQLHA3fDqsQfBJSFCgW/xfTGaQbbR0uH+QgjCIkJKclPAAAAAAAAgAHANQGuQwxElUXLByoIJkkBgACABkARgD6AP4BQQOyBEkG/gfJCagLlA2KD4cRhxOJFYYXfBloG0cdEh/HIF4izyMSJRYmyiYeAAAAJAACABkANgDEAJYBnALOAyEFkgYbCLcJZAscDd8OqxB8ElIUKBb/F9MZpBttHS4f5CCMIiQkpyU8AAAAAAACAAYAVQfXDfYTwBkoH/gjBQACABoAQQDpAN8BDQNrBOsFiQc/CQcL3Qy9DqYQkhJ+FGoWUxgzGgkc0R2HHyUhpSIDJDElJybPJh4AAAAjAAIAGgA0AL8AigGKArID/QRkBuEHcgkRC74MdQ4zEPcRvxOHFU4XFBnWGpAcQh7oH4EhCSN8JNUlPAAAAAAAAgALAHIEdAhADOsPeBPmFjgaaB1uIDojpiUKAAIAFQBNABQBMwKWAywF7AbMCMUK0gztDhURQhNxFaIXzBnwGwgeDyAAItYjiSUeAAAAKAACABUAXwBRAacCSQQiBiYISwqGDNQOKhGHE+YVPBiKGsUc6h7uIMciaSS/JbEmPAAAAAAAAgAIAKIFygqzD2sU8xhDHUsh2SQHAAIAGABLAAwBIgJ4AwAFrwZ8CGAKWAxdDmoQfhKSFKYWsxi4GrAclB5hIBAimCPuJAQmxSYeAAAAJQACABgAOADLAKUBtgLyA1QF0wZqCBUK0gucDXIPTxEyExkVARfpGM8asRyLHl4gIiLbI4AlPAAAAAAAAgAIAKIFygqzD2sU8xhDHUsh2SQHAAIAGABLAAwBIgJ4AwAFrwZ8CGAKWAxdDmoQfhKSFKYWsxi4GrAclB5hIBAimCPuJAQmxSYeAAAAJQACABgAOADLAKUBtgLyA1QF0wZqCBUK0gucDXIPTxEyExkVARfpGM8asRyLHl4gIiLbI4AlPAAAAAAAAgAGAP4GUg1bEyQZnh6eIwUAAgAaAEEA6QDfAQ0DawTrBYkHPwkHC90MvQ6mEJISfhRqFlMYMxoJHNEdhx8lIaUiAyQxJScmzyYeAAAAIwACABoANAC/AIoBigKyA/0EZAbhB3IJEQu+DHUOMxD3Eb8ThxVOFxQZ1hqQHEIe6B+BIQkjfCTVJTwAAAAAAAIACwA6BBMIxQtcD90SSBabGdYc7R/WIm0lCgACABUATQAUATMClgMsBewGzAjFCtIM7Q4VEUITcRWiF8wZ8BsIHg8gACLWI4klHgAAACgAAgAVAF8AUQGnAkkEIgYmCEsKhgzUDioRhxPmFTwYihrFHOoe7iDHImkkvyWxJjwAAAAAAAIACwBtBG8IOwziD2kT1BYhGk0dUiAgI5UlCgACABUAXwBRAacCSQQiBiYISwqGDNQOKhGHE+YVPBiKGsUc6h7uIMciaSS/JbEmHgAAACgAAgAVAD8A5gDdARQDfQQOBsQHlAl8C3gNgw+bEb0T5RUTGEMacxyhHsog7CIEJTwAAAAAAAIABgDdBkgNcBNTGd8e2CMFAAIAGgBBAOkA3wENA2sE6wWJBz8JBwvdDL0OphCSEn4UahZTGDMaCRzRHYcfJSGlIgMkMSUnJs8mHgAAACMAAgAaADQAvwCKAYoCsgP9BGQG4QdyCRELvgx1DjMQ9xG/E4cVThcUGdYakBxCHugfgSEJI3wk1SU8AAAAAAACAB8AdQBSAVsCfwOyBPIFOweMCOEJOwuZDPgNWg+/ECIShxPuFFEWthcYGXca1RsvHYQe1R8eIV4ikSO1JL4lmyYeAAIAHwAvAKsAZAFKAlYDggTGBR8HiggFCooLGA2uDkkQ6BGHEygVxxZiGPgZhhsLHYYe8R9KIY4iuiPGJKwlZSbhJjwAAAAAAAIACwA0BBgI1Qt3DwATcBbJGQQdGSD8IoQlCgACAB8ALwCrAGQBSgJWA4IExgUfB4oIBQqKCxgNrg5JEOgRhxMoFccWYhj4GYYbCx2GHvEfSiGOIrojxiSsJWUm4SYoAAIAFQAWAFgAxwBjAS4CJgNNBKAFIwfRCKoKrQzXDicRmRMqFtUYlRtnHkYhKiQ8AAAAAAACAAYASgfVDQMU3RlNHxgkBQACAB8ALwCrAGQBSgJWA4IExgUfB4oIBQqKCxgNrg5JEOgRhxMoFccWYhj4GYYbCx2GHvEfSiGOIrojxiSsJWUm4SYjAAIAGgAoAJMAMgH6AeQC7AMMBUMGjQfpCFUKzwtYDewOjRA4Eu8TrxV5F0wZKRsNHfwe8iDzIv0kPAAAAAAAAgAfAHUAUgFbAn8DsgTyBTsHjAjhCTsLmQz4DVoPvxAiEocT7hRRFrYXGBl3GtUbLx2EHtUfHiFeIpEjtSS+JZsmHgACAB8ALwCrAGQBSgJWA4IExgUfB4oIBQqKCxgNrg5JEOgRhxMoFccWYhj4GYYbCx2GHvEfSiGOIrojxiSsJWUm4SY8AAAAAAACAAoA3gQ8CVoNTBEYFb8YQhyYH7IiaSUJAAIAFgBXADcBdgL8A7cFnAehCb0L6w0lEGYSqhTrFiUZUxtvHXQfWSEUI5ok2SW5Jh4AAAAnAAIAFgA8ANsAxgHsAkIEwAVeBxcJ5wrIDLoOtxC+EssU3BbxGAcbGh0qHzMhMyMpJTwAAAAAAAIABwDUBrkMMRJVFywcqCCZJAYAAgAZAEYA+gD+AUEDsgRJBv4HyQmoC5QNig+HEYcTiRWGF3wZaBtHHRIfxyBeIs8jEiUWJsomHgAAACQAAgAZADYAxACWAZwCzgMhBZIGGwi3CWQLHA3fDqsQfBJSFCgW/xfTGaQbbR0uH+QgjCIkJKclPAAAAAAAAgAKAN4EPAlaDUwRGBW/GEIcmB+yImklCQACABYAVwA3AXYC/AO3BZwHoQm9C+sNJRBmEqoU6xYlGVMbbx10H1khFCOaJNkluSYeAAAAJwACABYAPADbAMYB7AJCBMAFXgcXCecKyAy6DrcQvhLLFNwW8RgHGxodKh8zITMjKSU8AAAAAAACAAcA1Aa5DDESVRcsHKggmSQGAAIAGQBGAPoA/gFBA7IESQb+B8kJqAuUDYoPhxGHE4kVhhd8GWgbRx0SH8cgXiLPIxIlFibKJh4AAAAkAAIAGQA2AMQAlgGcAs4DIQWSBhsItwlkCxwN3w6rEHwSUhQoFv8X0xmkG20dLh/kIIwiJCSnJTwAAAAAAAIADQCwAxkHXgqHDZ0QnxOOFmoZMBzcHmkhxiPWJQwAAgATAHIAjgEeAwAFHwdsCdgLXQ7uEIcTIhazGDgbpB3xHxAi8iOCJZ4mHgAAACoAAgATAEUA/AAMAmED7wSrBo8IkwqwDOUOLRGDE+UVUhjEGjwdtB8sIqEkPAAAAAAAAgANALADGQdeCocNnRCfE44WahkwHNweaSHGI9YlDAACABMAcgCOAR4DAAUfB2wJ2AtdDu4QhxMiFrMYOBukHfEfECLyI4IlniYeAAAAKgACABMARQD8AAwCYQPvBKsGjwiTCrAM5Q4tEYMT5RVSGMQaPB20HywioSQ8AAAAAAACABAA7AKxBWEI/wqTDRoQlxIJFW8XyRkWHFMefCCKInIkGSYPAAIAEACZABACFQR7BiUJ/Qv2DgASEBUaGBMb6x2VIPsiACV3Jh4AAAAtAAIAEABUADMBfgIfBAgGKQh6CvUMkQ9IEhgV+xfuGuwd9CAAJDwAAAAAAAIACwBtBG8IOwziD2kT1BYhGk0dUiAgI5UlCgACABUAXwBRAacCSQQiBiYISwqGDNQOKhGHE+YVPBiKGsUc6h7uIMciaSS/JbEmHgAAACgAAgAVAD8A5gDdARQDfQQOBsQHlAl8C3gNgw+bEb0T5RUTGEMacxyhHsog7CIEJTwAAAAAAAIABgDdBkgNcBNTGd8e2CMFAAIAGgBBAOkA3wENA2sE6wWJBz8JBwvdDL0OphCSEn4UahZTGDMaCRzRHYcfJSGlIgMkMSUnJs8mHgAAACMAAgAaADQAvwCKAYoCsgP9BGQG4QdyCRELvgx1DjMQ9xG/E4cVThcUGdYakBxCHugfgSEJI3wk1SU8AAAAAAACABAA7AKxBWEI/wqTDRoQlxIJFW8XyRkWHFMefCCKInIkGSYPAAIAHwAvAKsAZAFKAlYDggTGBR8HiggFCooLGA2uDkkQ6BGHEygVxxZiGPgZhhsLHYYe8R9KIY4iuiPGJKwlZSbhJi0AAgAQAFQAMwF+Ah8ECAYpCHoK9QyRD0gSGBX7F+4a7B30IAAkPAAAAAAAAgALAD4EMAj7C6oPPxO7FhgaVR1mIDwjqyUKAAIAHwAvAKsAZAFKAlYDggTGBR8HiggFCooLGA2uDkkQ6BGHEygVxxZiGPgZhhsLHYYe8R9KIY4iuiPGJKwlZSbhJigAAgAVABYAWADHAGMBLgImA00EoAUjB9EIqgqtDNcOJxGZEyoW1RiVG2ceRiEqJDwAAAAAAAIABgA2B6kNxROWGQcf5iMFAAIAHwAvAKsAZAFKAlYDggTGBR8HiggFCooLGA2uDkkQ6BGHEygVxxZiGPgZhhsLHYYe8R9KIY4iuiPGJKwlZSbhJiMAAgAaACgAkwAyAfoB5ALsAwwFQwaNB+kIVQrPC1gN7A6NEDgS7xOvFXkXTBkpGw0d/B7yIPMi/SQ8AAAAAAACAAoA3gQ8CVoNTBEYFb8YQhyYH7IiaSUJAAIAFgBXADcBdgL8A7cFnAehCb0L6w0lEGYSqhTrFiUZUxtvHXQfWSEUI5ok2SW5Jh4AAAAnAAIAFgA8ANsAxgHsAkIEwAVeBxcJ5wrIDLoOtxC+EssU3BbxGAcbGh0qHzMhMyMpJTwAAAAAAAIAIwBhABwBAAL6AgYEGwU7BmAHjAi6Ce4KIwxcDZUO0A8NEUsShxPFFAMWQBd7GLQZ7RoiHFYdhB6wH9Ug9SEKIxYkECX0Ja8mIgACABsAPADaAMEB3wIpBJcFHwfACHIKNAz/DdIPrBGHE2QVPhcRGdwanhxQHvEfeSHnIjEkTyU2JtQmPAAAAAAAAgAYAK0A4wFPA9cEdAYfCNMJjwtPDRQP2hCkEmwUNhb8F8EZgRs9HfEenCA5IsEjLSVjJhcAAgAmACAAdwD6AKABZAJBAzIENgVJBmgHlQjJCQcLSgyUDeIONBCHEd0SMxSJFdwWLhh8GcYaCRxHHXseqB/HINoh3iLPI6wkcCUWJpkm8CY8AAAAAAACACMAYQAcAQAC+gIGBBsFOwZgB4wIugnuCiMMXA2VDtAPDRFLEocTxRQDFkAXexi0Ge0aIhxWHYQesB/VIPUhCiMWJBAl9CWvJiIAAgAbADwA2gDBAd8CKQSXBR8HwAhyCjQM/w3SD6wRhxNkFT4XERncGp4cUB7xH3kh5yIxJE8lNibUJjwAAAAAAAIAHACJAIYBtAL7A1YFvQYuCKYJIwulDCkOsA85EcMSTRTXFWAX5xhrGu0bah3iHlMguiEVI1wkiiWHJhsAAgAiACgAkQAvAfYB3wLkAwAFMAZxB8AIGgp+C+oMXQ7SD00RyRJHFMMVPhezGCYakhv2HFAenx/gIBAiLCMxJBol4SV/JugmPAAAAAAAAgAnAFEA8wC5AZQCfwNzBHAFdAZ9B4wInAmxCscL3gz4DRQPMBBNEWoShxOmFMMV4Bb8FxgZMhpJG18cdB2EHpMfnCCgIZ0ikSN8JFclHSa/JiYAAgAXAFEAIAFKArYDWAUfBwcJBwsYDTYPXRGHE7MV2hf4GQkcCR7xH7ghWiPGJPAlvyY8AAAAAAACAB8AdQBSAVsCfwOyBPIFOweMCOEJOwuZDPgNWg+/ECIShxPuFFEWthcYGXca1RsvHYQe1R8eIV4ikSO1JL4lmyYeAAIAHwAvAKsAZAFKAlYDggTGBR8HiggFCooLGA2uDkkQ6BGHEygVxxZiGPgZhhsLHYYe8R9KIY4iuiPGJKwlZSbhJjwAAAAAAAEAEgAAACIAAQA8AAAAAAABABUAAAAmAAEAPAAAAAAAAQAXAAAAIwABADwAAAAAAAEAFAAAACAAAQA8AAAAAAABABAAAQA8AAAAAAABABMAAAAkAAEAPAAAAAAAAgAIAN8B6wUHC6YQahYJHCUhMSUHAAIABQC2AwcLhxMJHFojCwACAAsAogBBApMEbQeuCj8ODhINFjAabR66IhUAAgAMAAEE+gfoC8APfRMWF38arR2PIBMjHCWFJiAAAgAKAFEBSQQmCIYMKhHmFYoa6h7HIr8lKQACAAwAAQT6B+gLwA99ExYXfxqtHY8gEyMcJYUmNAACAAUAtgMHC4cTCRxaIzgAAgAGAN8CwAjSDz4XUB4xJD0AAgAJAI4BAAVsCV0OhxOzGKQdECKCJUUAAgAHAEoCHwcYDYcT+BnxH8YkSwACAAYA3wLACNIPPhdQHjEkUAACAAkAjgEABWwJXQ6HE7MYpB0QIoIlWAACAAcASgIfBxgNhxP4GfEfxiReAAIABgDfAsAI0g8+F1AeMSRjAAIACQCOAQAFbAldDocTsxikHRAigiVrAAIABAAcAwAK1xK4HG4AAgAFAO8HQw8+Ftcc3yJyAAIACgCaBQILIhDsFEsZMh2LIEcjVCWdJnsAAAAAAAAANAACAAYALAQSClgQuBb+HOQiOQACAAMA8woGFWMeOwACABcAgQLpBD0HfQmtC80N3g/fEdITuBWNF1UZChuvHEEevh8mIXQipiO4JKMlXybfJlEAAgAEAGsDVQrvEp0cVAACABkALgClAFYBMgIzA1MEjQXfBkMIuglBC9UMdw4mEOARpRNzFUkXKRkRGwAd9R7zIPciASVsAAIAAwDfA+oMAhluAAIABADUCHARuhlyIXEAAAAAAAAAMQACAAQAwwqiFEMd9SM0AAIABgAsBBIKWBC4Fv4c5CI5AAIAAwDzCgYVYx47AAIAFwCBAukEPQd9Ca0LzQ3eD98R0hO4FY0XVRkKG68cQR6+HyYhdCKmI7gkoyVfJt8mUQACAAQAawNVCu8SnRxUAAIAGQAuAKUAVgEyAjMDUwSNBd8GQwi6CUEL1Qx3DiYQ4BGlE3MVSRcpGREbAB31HvMg9yIBJWwAAgADAN8D6gwCGW4AAgAEANQIcBG6GXIhcQAAAHMAAQB7AAAAAAACAAgA3wHrBQcLphBqFgkcJSExJQcAAgAFALYDBwuHEwkcWiMLAAIADAD6AEEDSQbJCZQNhxGJFXwZRx3HIM8jFiYWAAIACwAgAbYDHwcHCzYPhxPaFwkc8R9aI/AlIAACAAsAIAG2Ax8HBws2D4cT2hcJHPEfWiPwJSoAAgALACABtgMfBwcLNg+HE9oXCRzxH1oj8CU0AAIABQC2AwcLhxMJHFojOAACAAQAAAVdDrMYECI7AAIACADfAesFBwumEGoWCRwlITElQgACAAMAHweHE/EfRAACAAgA3wHrBQcLphBqFgkcJSExJUsAAgAEAAAFXQ6zGBAiTgACAAgA3wHrBQcLphBqFgkcJSExJVUAAgADAB8HhxPxH1cAAgAIAN8B6wUHC6YQahYJHCUhMSVeAAIABAAABV0OsxgQImEAAgAIAN8B6wUHC6YQahYJHCUhMSVoAAIAAwAfB4cT8R9qAAIABQBjArsHow5vFq8ebgACAAUAIQiBD3kWBx36InIAAgAKAJoFAgsiEOwUSxkyHYsgRyNUJZ0mewAAAAAAAgAIAN8B6wUHC6YQahYJHCUhMSUHAAIABQC2AwcLhxMJHFojCwACAAwA+gBBA0kGyQmUDYcRiRV8GUcdxyDPIxYmFgACAAsAIAG2Ax8HBws2D4cT2hcJHPEfWiPwJSAAAgALACABtgMfBwcLNg+HE9oXCRzxH1oj8CUqAAIACwAgAbYDHwcHCzYPhxPaFwkc8R9aI/AlNAACAAUAtgMHC4cTCRxaIzgAAgAEAAAFXQ6zGBAiOwACAAgA3wHrBQcLphBqFgkcJSExJUIAAgADAB8HhxPxH0QAAgAIAN8B6wUHC6YQahYJHCUhMSVLAAIABAAABV0OsxgQIk4AAgAIAN8B6wUHC6YQahYJHCUhMSVVAAIAAwAfB4cT8R9XAAIACADfAesFBwumEGoWCRwlITElXgACAAQAAAVdDrMYECJhAAIACADfAesFBwumEGoWCRwlITElaAACAAMAHweHE/EfagACAAUAYwK7B6MObxavHm4AAgAFACEIgQ95Fgcd+iJyAAIACgCaBQILIhDsFEsZMh2LIEcjVCWdJnsAAAAAAAIACADfAesFBwumEGoWCRwlITElBwACAAUAtgMHC4cTCRxaIwsAAgALACABtgMfBwcLNg+HE9oXCRzxH1oj8CUVAAIADAD6AEEDSQbJCZQNhxGJFXwZRx3HIM8jFiYgAAIACgBRAUkEJgiGDCoR5hWKGuoexyK/JSkAAgAMAPoAQQNJBskJlA2HEYkVfBlHHccgzyMWJjQAAgAFALYDBwuHEwkcWiM4AAIABAAABV0OsxgQIjsAAgAIAN8B6wUHC6YQahYJHCUhMSVCAAIABwBKAh8HGA2HE/gZ8R/GJEgAAgAEAAAFXQ6zGBAiSwACAAQAAAVdDrMYECJOAAIACADfAesFBwumEGoWCRwlITElVQACAAcASgIfBxgNhxP4GfEfxiRbAAIABAAABV0OsxgQIl4AAgAEAAAFXQ6zGBAiYQACAAgA3wHrBQcLphBqFgkcJSExJWgAAgAHAEoCHwcYDYcT+BnxH8YkbgACAAUAGwUjDIcT7Rr1IXIAAgAKAJoFAgsiEOwUSxkyHYsgRyNUJZ0mewAAAAAAAAAHAAIABQC2AwcLhxMJHFojCwAAADQAAgAFALYDBwuHEwkcWiM4AAAAAAAAAAcAAgAFALYDBwuHEwkcWiMLAAAANAACAAUAtgMHC4cTCRxaIzgAAAAAAAIACQD7BsYM3hFxFpEaQx5/ITMkMiYIAAIABQC2AwcLhxMJHFojDAACAAoAUQFJBCYIhgwqEeYVihrqHscivyUVAAIADAD6AEEDSQbJCZQNhxGJFXwZRx3HIM8jFiYgAAIACgBRAUkEJgiGDCoR5hWKGuoexyK/JSkAAgAMAPoAQQNJBskJlA2HEYkVfBlHHccgzyMWJjQAAgAFALYDBwuHEwkcWiM4AAIABAAABV0OsxgQIjsAAgAIAN8B6wUHC6YQahYJHCUhMSVCAAIABwBKAh8HGA2HE/gZ8R/GJEgAAgAEAAAFXQ6zGBAiSwACAAQAAAVdDrMYECJOAAIACADfAesFBwumEGoWCRwlITElVQACAAcASgIfBxgNhxP4GfEfxiRbAAIABAAABV0OsxgQIl4AAgAEAAAFXQ6zGBAiYQACAAgA3wHrBQcLphBqFgkcJSExJWgAAgAHAEoCHwcYDYcT+BnxH8YkbgACAAUAGwUjDIcT7Rr1IXIAAgAKAJoFAgsiEOwUSxkyHYsgRyNUJZ0mewAAAAAAAQA0AAIABQC2AwcLhxMJHFojOAABAD0AAQBDAAEAawABAG4AAAAAAAEANAACAAUAtgMHC4cTCRxaIzgAAQA9AAEAQwABAFYAAQBoAAEAawABAG4AAAAAAAIANQARAEEAigDpAFsB3wFvAg0DtgNrBCYF6wW4BokHYgg/CSAKBwvwC90MzA29DrAPphCbEZIShxN+FHUVahZgF1MYRBkzGiAbCRzwHNEdrh6HH1ggJSHqIaUiWiMDJKEkMSW1JScmhibPJv8mNAACAAUAtgMHC4cTCRxaIzgAAgAGAN8CwAjSDz4XUB4xJD0AAgAIAN8B6wUHC6YQahYJHCUhMSVEAAIACADfAesFBwumEGoWCRwlITElSwACAAYA3wLACNIPPhdQHjEkUAACAAgA3wHrBQcLphBqFgkcJSExJVcAAgAIAN8B6wUHC6YQahYJHCUhMSVeAAIABgDfAsAI0g8+F1AeMSRjAAIACADfAesFBwumEGoWCRwlITElagACAAUAYwK7B6MObxavHm4AAgAFACEIgQ95Fgcd+iJyAAIACgCaBQILIhDsFEsZMh2LIEcjVCWdJnsAAAAAAAIACADfAesFBwumEGoWCRwlITElBwACAAUAtgMHC4cTCRxaIwsAAgALAGMCfAiOEAoZyyAmJ7orai41LywubCsVAAIADAANAmAHmw51FvMdayR+Kf0s2y4gL9wtJCsgAAIACgBRAUkEJgiGDCoR5hWKGuoexyK/JSkAAgAMAA0CYAebDnUW8x1rJH4p/SzbLiAv3C0kKzQAAgAFALYDBwuHEwkcWiM4AAIABgDfAsAI0g8+F1AeMSQ9AAIACADfAesFBwumEGoWCRwlITElRAACAAgA3wHrBQcLphBqFgkcJSExJUsAAgAGAN8CwAjSDz4XUB4xJFAAAgAIAN8B6wUHC6YQahYJHCUhMSVXAAIACADfAesFBwumEGoWCRwlITElXgACAAYA3wLACNIPPhdQHjEkYwACAAgA3wHrBQcLphBqFgkcJSExJWoAAgAFAGMCuwejDm8Wrx5uAAIABQAhCIEPeRYHHfoicgAAAAAAAgAJAI4BAAVsCV0OhxOzGKQdECKCJQgAAgAFALYDBwuHEwkcWiMMAAIADAAEAh0H+w2CFd0caSPDKKMs5y56L1kuiCsXAAIACgDBAnkJERLrGtwiLSlrLWAv9C4rLCAAAgAMAAQCHQf7DYIV3RxpI8MooyznLnovWS6IKysAAgAKAMECeQkREusa3CItKWstYC/0LissNAACAAUAtgMHC4cTCRxaIzgAAgAHAEoCHwcYDYcT+BnxH8YkPgACAAgA3wHrBQcLphBqFgkcJSExJUUAAgAHAEoCHwcYDYcT+BnxH8YkSwACAAcASgIfBxgNhxP4GfEfxiRRAAIACADfAesFBwumEGoWCRwlITElWAACAAcASgIfBxgNhxP4GfEfxiReAAIABwBKAh8HGA2HE/gZ8R/GJGQAAgAIAN8B6wUHC6YQahYJHCUhMSVrAAIABAAcAwAK1xK4HG4AAgAFAO8HQw8+Ftcc3yJyAAIACgCaBQILIhDsFEsZMh2LIEcjVCWdJnsAAAAAAAIACADfAesFBwumEGoWCRwlITElBwACAAUAtgMHC4cTCRxaIwsAAgALAKIAQQKTBG0Hrgo/Dg4SDRYwGm0euiIVAAIADAABBPoH6AvAD30TFhd/Gq0djyATIxwlhSYgAAIACgBRAUkEJgiGDCoR5hWKGuoexyK/JSkAAgAMAAEE+gfoC8APfRMWF38arR2PIBMjHCWFJjQAAgAFALYDBwuHEwkcWiM4AAIABgDfAsAI0g8+F1AeMSQ9AAIACQCOAQAFbAldDocTsxikHRAigiVFAAIABwBKAh8HGA2HE/gZ8R/GJEsAAgAGAN8CwAjSDz4XUB4xJFAAAgAJAI4BAAVsCV0OhxOzGKQdECKCJVgAAgAHAEoCHwcYDYcT+BnxH8YkXgACAAYA3wLACNIPPhdQHjEkYwACAAkAjgEABWwJXQ6HE7MYpB0QIoIlawACAAQAHAMACtcSuBxuAAIABQDvB0MPPhbXHN8icgACAAoAmgUCCyIQ7BRLGTIdiyBHI1QlnSZ7AAAAAAACAAgA3wHrBQcLphBqFgkcJSExJQcAAgAFALYDBwuHEwkcWiMLAAIACwBjAnwIjhAKGcsgJie6K2ouNS8sLmwrFQACAAwADQJgB5sOdRbzHWskfin9LNsuIC/cLSQrIAACAAoAUQFJBCYIhgwqEeYVihrqHscivyUpAAIADAANAmAHmw51FvMdayR+Kf0s2y4gL9wtJCs0AAIABQC2AwcLhxMJHFojOAACAAYA3wLACNIPPhdQHjEkPQACAAgA3wHrBQcLphBqFgkcJSExJUQAAgAIAN8B6wUHC6YQahYJHCUhMSVLAAIABgDfAsAI0g8+F1AeMSRQAAIACADfAesFBwumEGoWCRwlITElVwACAAgA3wHrBQcLphBqFgkcJSExJV4AAgAGAN8CwAjSDz4XUB4xJGMAAgAIAN8B6wUHC6YQahYJHCUhMSVqAAIABQBjArsHow5vFq8ebgACAAUAIQiBD3kWBx36InIAAgAKAJoFAgsiEOwUSxkyHYsgRyNUJZ0mewAAAAAAAgAIAN8B6wUHC6YQahYJHCUhMSUHAAIABQC2AwcLhxMJHFojCwACACoAGwBjANEAXgEFAsMCkgNzBGIFXAZiB3EIhwmlCsoL8wwfDk8PgxC3Ee0SIxRZFY0WwRfxGB0aRhtrHIkdnx6uH7QgriGdIn4jTSQLJbIlPyatJvUmNAACAAUAtgMHC4cTCRxaIzgAAgAHAFIG7wtEEWUWTxv2HzAkPgAAAEQAAgAIAG4E0QgwDYsR4hU4Goke1CJLAAIABwBSBu8LRBFlFk8b9h8wJFEAAABXAAIACABuBNEIMA2LEeIVOBqJHtQiXgACAAcAUgbvC0QRZRZPG/YfMCRkAAAAagACAAUAkgYZDZsTGhqWIG4AAgAFAIUGCQ2OExEalCByAAIACgCaBQILIhDsFEsZMh2LIEcjVCWdJnsAAAAAAAIACADfAesFBwumEGoWCRwlITElBwACAAUAtgMHC4cTCRxaIwsAAgAMAPoAQQNJBskJlA2HEYkVfBlHHccgzyMWJhYAAgALACABtgMfBwcLNg+HE9oXCRzxH1oj8CUgAAIACwAgAbYDHwcHCzYPhxPaFwkc8R9aI/AlKgACAAsAIAG2Ax8HBws2D4cT2hcJHPEfWiPwJTQAAgAFALYDBwuHEwkcWiM4AAIABwBSBu8LRBFlFk8b9h8wJD4AAABEAAIACABuBNEIMA2LEeIVOBqJHtQiSwACAAcAUgbvC0QRZRZPG/YfMCRRAAAAVwACAAgAbgTRCDANixHiFTgaiR7UIl4AAgAHAFIG7wtEEWUWTxv2HzAkZAAAAGoAAgAFAJIGGQ2bExoaliBuAAIABQCFBgkNjhMRGpQgcgACAAoAmgUCCyIQ7BRLGTIdiyBHI1QlnSZ7AAAAAAACAAgA3wHrBQcLphBqFgkcJSExJQcAAgAFALYDBwuHEwkcWiMLAAIACwAgAbYDHwcHCzYPhxPaFwkc8R9aI/AlFQACAAwA+gBBA0kGyQmUDYcRiRV8GUcdxyDPIxYmIAACAAoAUQFJBCYIhgwqEeYVihrqHscivyUpAAIADAD6AEEDSQbJCZQNhxGJFXwZRx3HIM8jFiY0AAIABQC2AwcLhxMJHFojOAACAAQAAAVdDrMYECI7AAIACADfAesFBwumEGoWCRwlITElQgACAAcASgIfBxgNhxP4GfEfxiRIAAIABAAABV0OsxgQIksAAgAEAAAFXQ6zGBAiTgACAAgA3wHrBQcLphBqFgkcJSExJVUAAgAHAEoCHwcYDYcT+BnxH8YkWwACAAQAAAVdDrMYECJeAAIABAAABV0OsxgQImEAAgAIAN8B6wUHC6YQahYJHCUhMSVoAAIABwBKAh8HGA2HE/gZ8R/GJG4AAgAFABsFIwyHE+0a9SFyAAIACgCaBQILIhDsFEsZMh2LIEcjVCWdJnsAAAAAAAIACADfAesFBwumEGoWCRwlITElBwACAAUAtgMHC4cTCRxaIwsAAgAMAPoAQQNJBskJlA2HEYkVfBlHHccgzyMWJhYAAgALACABtgMfBwcLNg+HE9oXCRzxH1oj8CUgAAIACwAgAbYDHwcHCzYPhxPaFwkc8R9aI/AlKgACAAsAIAG2Ax8HBws2D4cT2hcJHPEfWiPwJTQAAgAFALYDBwuHEwkcWiM4AAIABwBKAh8HGA2HE/gZ8R/GJD4AAgAIAN8B6wUHC6YQahYJHCUhMSVFAAIABwBKAh8HGA2HE/gZ8R/GJEsAAgAHAEoCHwcYDYcT+BnxH8YkUQACAAgA3wHrBQcLphBqFgkcJSExJVgAAgAHAEoCHwcYDYcT+BnxH8YkXgACAAcASgIfBxgNhxP4GfEfxiRkAAIACADfAesFBwumEGoWCRwlITElawACAAQAHAMACtcSuBxuAAIABQDvB0MPPhbXHN8icgACAAoAmgUCCyIQ7BRLGTIdiyBHI1QlnSZ7AAAAAAAAADsAAgAYAEsADAEiAngDAAWvBnwIYApYDF0OahB+EpIUphazGLgasByUHmEgECKYI+4kBCbFJlIAAgADABkF1w6IGlQAAgAZAEYA+gD+AUEDsgRJBv4HyQmoC5QNig+HEYcTiRWGF3wZaBtHHRIfxyBeIs8jEiUWJsombAACAAMAmwltE0cdbgACAAQAWAokFOMcziNxAAAAAAAAADAAAgAFAAcJdhEiGcIfzSQ0AAIACAD6AmAHIwwNEQMW7RqwHxYkOwACABgASwAMASICeAMABa8GfAhgClgMXQ5qEH4SkhSmFrMYuBqwHJQeYSAQIpgj7iQEJsUmUgACAAMAGQXXDogaVAACABkARgD6AP4BQQOyBEkG/gfJCagLlA2KD4cRhxOJFYYXfBloG0cdEh/HIF4izyMSJRYmyiZsAAIAAwCbCW0TRx1uAAIABABYCiQU4xzOI3EAAABzAAEAewAAAAAAAgAIAN8B6wUHC6YQahYJHCUhMSUHAAIABQC2AwcLhxMJHFojCwACAAsAIAG2Ax8HBws2D4cT2hcJHPEfWiPwJRUAAgAMAPoAQQNJBskJlA2HEYkVfBlHHccgzyMWJiAAAgAKAFEBSQQmCIYMKhHmFYoa6h7HIr8lKQACAAwA+gBBA0kGyQmUDYcRiRV8GUcdxyDPIxYmNAACAAUAtgMHC4cTCRxaIzgAAQA7AAEAPgABAEIAAABEAAEASAABAEsAAQBOAAEAUQABAFUAAABXAAEAWwABAF4AAQBhAAEAZAABAGgAAABqAAEAbgABAHIAAgAKALsDdAcmC9IOdBIKFpMZDR12IM0jewAAAAAAAgAJAI4BAAVsCV0OhxOzGKQdECKCJQgAAgAFALYDBwuHEwkcWiMMAAIADACwAQYG7wt6Eu4YxB6mI2In3SkOK/YqnikXAAIACgBQAgsIeQ83F0UeCyQwKJEqJSvzKSAAAgAMALABBgbvC3oS7hjEHqYjYifdKQ4r9iqeKSsAAgAKAFACCwh5DzcXRR4LJDAokSolK/MpNAACAAUAtgMHC4cTCRxaIzgAAgAGAN8CwAjSDz4XUB4xJD0AAgAIAN8B6wUHC6YQahYJHCUhMSVEAAIACADfAesFBwumEGoWCRwlITElSwACAAYA3wLACNIPPhdQHjEkUAACAAgA3wHrBQcLphBqFgkcJSExJVcAAgAIAN8B6wUHC6YQahYJHCUhMSVeAAIABgDfAsAI0g8+F1AeMSRjAAIACADfAesFBwumEGoWCRwlITElagACAAUAYwK7B6MObxavHm4AAgAFACEIgQ95Fgcd+iJyAAIACgCaBQILIhDsFEsZMh2LIEcjVCWdJnsAAAAAAAIACADfAesFBwumEGoWCRwlITElBwACAAUAtgMHC4cTCRxaIwsAAgALAKIAQQKTBG0Hrgo/Dg4SDRYwGm0euiIVAAIADAABBPoH6AvAD30TFhd/Gq0djyATIxwlhSYgAAIACgBRAUkEJgiGDCoR5hWKGuoexyK/JSkAAgAMAAEE+gfoC8APfRMWF38arR2PIBMjHCWFJjQAAgAFALYDBwuHEwkcWiM4AAIABgDfAsAI0g8+F1AeMSQ9AAIACQCOAQAFbAldDocTsxikHRAigiVFAAIABwBKAh8HGA2HE/gZ8R/GJEsAAgAGAN8CwAjSDz4XUB4xJFAAAgAJAI4BAAVsCV0OhxOzGKQdECKCJVgAAgAHAEoCHwcYDYcT+BnxH8YkXgACAAYA3wLACNIPPhdQHjEkYwACAAkAjgEABWwJXQ6HE7MYpB0QIoIlawACAAQAHAMACtcSuBxuAAIABQDvB0MPPhbXHN8icgACAAoAmgUCCyIQ7BRLGTIdiyBHI1QlnSZ7AAAAAAACAAkAjgEABWwJXQ6HE7MYpB0QIoIlCAACAAUAtgMHC4cTCRxaIwwAAgAMALABBgbvC3oS7hjEHqYjYifdKQ4r9iqeKRcAAgAKAFACCwh5DzcXRR4LJDAokSolK/MpIAACAAwAsAEGBu8LehLuGMQepiNiJ90pDiv2Kp4pKwACAAoAUAILCHkPNxdFHgskMCiRKiUr8yk0AAIABQC2AwcLhxMJHFojOAACAAYA3wLACNIPPhdQHjEkPQACAAgA3wHrBQcLphBqFgkcJSExJUQAAgAIAN8B6wUHC6YQahYJHCUhMSVLAAIABgDfAsAI0g8+F1AeMSRQAAIACADfAesFBwumEGoWCRwlITElVwACAAgA3wHrBQcLphBqFgkcJSExJV4AAgAGAN8CwAjSDz4XUB4xJGMAAgAIAN8B6wUHC6YQahYJHCUhMSVqAAIABQBjArsHow5vFq8ebgACAAUAIQiBD3kWBx36InIAAgAKAJoFAgsiEOwUSxkyHYsgRyNUJZ0mewAAAAAAAgAJAI4BAAVsCV0OhxOzGKQdECKCJQgAAgAFALYDBwuHEwkcWiMMAAIADAAEAh0H+w2CFd0caSPDKKMs5y56L1kuiCsXAAIACgDBAnkJERLrGtwiLSlrLWAv9C4rLCAAAgAMAAQCHQf7DYIV3RxpI8MooyznLnovWS6IKysAAgAKAMECeQkREusa3CItKWstYC/0LissNAACAAUAtgMHC4cTCRxaIzgAAgAHAEoCHwcYDYcT+BnxH8YkPgACAAgA3wHrBQcLphBqFgkcJSExJUUAAgAHAEoCHwcYDYcT+BnxH8YkSwACAAcASgIfBxgNhxP4GfEfxiRRAAIACADfAesFBwumEGoWCRwlITElWAACAAcASgIfBxgNhxP4GfEfxiReAAIABwBKAh8HGA2HE/gZ8R/GJGQAAgAIAN8B6wUHC6YQahYJHCUhMSVrAAIABAAcAwAK1xK4HG4AAgAFAO8HQw8+Ftcc3yJyAAIACgCaBQILIhDsFEsZMh2LIEcjVCWdJnsAAAAAAAIACADfAesFBwumEGoWCRwlITElBwACAAUAtgMHC4cTCRxaIwsAAgAqAA8AOQB6ANEAOwG1AUEC2QJ/AzEE7QS0BYQGXAc7CCMJEgoGCwAMAA0GDg8PHBAuEUMSXBN3FJcVtxbbFwAZJhpQG3kcpR3RHv4fKyFZIogjtiTiJTQAAgAFALYDBwuHEwkcWiM4AAIACwAgAbYDHwcHCzYPhxPaFwkc8R9aI/AlQgACAAoAUQFJBCYIhgwqEeYVihrqHscivyVLAAIACwAgAbYDHwcHCzYPhxPaFwkc8R9aI/AlVQACAAoAUQFJBCYIhgwqEeYVihrqHscivyVeAAIACwAgAbYDHwcHCzYPhxPaFwkc8R9aI/AlaAACAAcASgIfBxgNhxP4GfEfxiRuAAIABQBvCOIP1BZNHSAjcgAAAAAAAgAIAN8B6wUHC6YQahYJHCUhMSUHAAIABQC2AwcLhxMJHFojCwACAAYAyQHuBXELzBGrGNMfEAACAAYAmgf0DuEVLByEIW8lFQACAAYAyQHuBXELzBGrGNMfGgACAAcAqgYmDVgTHxlPHqciyiUgAAIABQC2AwcLhxMJHFojJAACAAYAmgf0DuEVLByEIW8lKQACAAYAyQHuBXELzBGrGNMfLgACAAcAqgYmDVgTHxlPHqciyiU0AAIABQC2AwcLhxMJHFojOAACAAsAIAG2Ax8HBws2D4cT2hcJHPEfWiPwJUIAAgAKAFEBSQQmCIYMKhHmFYoa6h7HIr8lSwACAAsAIAG2Ax8HBws2D4cT2hcJHPEfWiPwJVUAAgAKAFEBSQQmCIYMKhHmFYoa6h7HIr8lXgACAAsAIAG2Ax8HBws2D4cT2hcJHPEfWiPwJWgAAgAHAEoCHwcYDYcT+BnxH8YkbgACAAUAbwjiD9QWTR0gI3IAAgAKAJoFAgsiEOwUSxkyHYsgRyNUJZ0mewAAAAAAAgAJAPsGxgzeEXEWkRpDHn8hMyQyJggAAgAFALYDBwuHEwkcWiMMAAIACgBRAUkEJgiGDCoR5hWKGuoexyK/JRUAAgAMAPoAQQNJBskJlA2HEYkVfBlHHccgzyMWJiAAAgAKAFEBSQQmCIYMKhHmFYoa6h7HIr8lKQACAAwA+gBBA0kGyQmUDYcRiRV8GUcdxyDPIxYmNAACAAUAtgMHC4cTCRxaIzgAAgAEAAAFXQ6zGBAiOwACAAgA3wHrBQcLphBqFgkcJSExJUIAAgAHAEoCHwcYDYcT+BnxH8YkSAACAAQAAAVdDrMYECJLAAIABAAABV0OsxgQIk4AAgAIAN8B6wUHC6YQahYJHCUhMSVVAAIABwBKAh8HGA2HE/gZ8R/GJFsAAgAEAAAFXQ6zGBAiXgACAAQAAAVdDrMYECJhAAIACADfAesFBwumEGoWCRwlITElaAACAAcASgIfBxgNhxP4GfEfxiRuAAIABQAbBSMMhxPtGvUhcgACAAoAmgUCCyIQ7BRLGTIdiyBHI1QlnSZ7AAAAAAACAAgA3wHrBQcLphBqFgkcJSExJQcAAgAFALYDBwuHEwkcWiMLAAIACwAgAbYDHwcHCzYPhxPaFwkc8R9aI/AlFQACAAwA+gBBA0kGyQmUDYcRiRV8GUcdxyDPIxYmIAACAAoAUQFJBCYIhgwqEeYVihrqHscivyUpAAIADAD6AEEDSQbJCZQNhxGJFXwZRx3HIM8jFiY0AAIABQC2AwcLhxMJHFojOAACAAQAAAVdDrMYECI7AAIACADfAesFBwumEGoWCRwlITElQgACAAcASgIfBxgNhxP4GfEfxiRIAAIABAAABV0OsxgQIksAAgAEAAAFXQ6zGBAiTgACAAgA3wHrBQcLphBqFgkcJSExJVUAAgAHAEoCHwcYDYcT+BnxH8YkWwACAAQAAAVdDrMYECJeAAIABAAABV0OsxgQImEAAgAIAN8B6wUHC6YQahYJHCUhMSVoAAIABwBKAh8HGA2HE/gZ8R/GJG4AAgAFABsFIwyHE+0a9SFyAAIACgCaBQILIhDsFEsZMh2LIEcjVCWdJnsAAAAAAAIACQD7BsYM3hFxFpEaQx5/ITMkMiYIAAIABQC2AwcLhxMJHFojDAACADAAFQBOAKUAFgGcATYC3wKXA1sEKgUEBuUGzwfACLYJsgqyC7UMvA3HDtIP4hDxEQATEBQfFS4WPhdJGFQZWxpeG14cWh1QHkEfKyAMIeYhtSJ5IzEk2iR0JfolaybCJvsmOwACAAgA3wHrBQcLphBqFgkcJSExJUIAAgAHAEoCHwcYDYcT+BnxH8YkSAACAAcASgIfBxgNhxP4GfEfxiROAAIACADfAesFBwumEGoWCRwlITElVQACAAcASgIfBxgNhxP4GfEfxiRbAAIABwBKAh8HGA2HE/gZ8R/GJGEAAgAIAN8B6wUHC6YQahYJHCUhMSVoAAIABwBKAh8HGA2HE/gZ8R/GJG4AAAAAAAIACQD7BsYM3hFxFpEaQx5/ITMkMiYIAAIABQC2AwcLhxMJHFojDAACAAoAUQFJBCYIhgwqEeYVihrqHscivyUVAAIADAD6AEEDSQbJCZQNhxGJFXwZRx3HIM8jFiYgAAIACgBRAUkEJgiGDCoR5hWKGuoexyK/JSkAAgAMAPoAQQNJBskJlA2HEYkVfBlHHccgzyMWJjQAAgAFALYDBwuHEwkcWiM4AAIABAAABV0OsxgQIjsAAgAIAN8B6wUHC6YQahYJHCUhMSVCAAIABwBKAh8HGA2HE/gZ8R/GJEgAAgAEAAAFXQ6zGBAiSwACAAQAAAVdDrMYECJOAAIACADfAesFBwumEGoWCRwlITElVQACAAcASgIfBxgNhxP4GfEfxiRbAAIABAAABV0OsxgQIl4AAgAEAAAFXQ6zGBAiYQACAAgA3wHrBQcLphBqFgkcJSExJWgAAgAHAEoCHwcYDYcT+BnxH8YkbgACAAUAGwUjDIcT7Rr1IXIAAgAKAJoFAgsiEOwUSxkyHYsgRyNUJZ0mewAAAAAAAgAIAN8B6wUHC6YQahYJHCUhMSUHAAIABQC2AwcLhxMJHFojCwACAAwA+gBBA0kGyQmUDYcRiRV8GUcdxyDPIxYmFgACAAsAIAG2Ax8HBws2D4cT2hcJHPEfWiPwJSAAAgALACABtgMfBwcLNg+HE9oXCRzxH1oj8CUqAAIACwAgAbYDHwcHCzYPhxPaFwkc8R9aI/AlNAACAAUAtgMHC4cTCRxaIzgAAgAHAEoCHwcYDYcT+BnxH8YkPgACAAgA3wHrBQcLphBqFgkcJSExJUUAAgAHAEoCHwcYDYcT+BnxH8YkSwACAAcASgIfBxgNhxP4GfEfxiRRAAIACADfAesFBwumEGoWCRwlITElWAACAAcASgIfBxgNhxP4GfEfxiReAAIABwBKAh8HGA2HE/gZ8R/GJGQAAgAIAN8B6wUHC6YQahYJHCUhMSVrAAIABAAcAwAK1xK4HG4AAgAFAO8HQw8+Ftcc3yJyAAIACgCaBQILIhDsFEsZMh2LIEcjVCWdJnsAAAAAAAIACADfAesFBwumEGoWCRwlITElBwACAAUAtgMHC4cTCRxaIwsAAAA0AAIABQC2AwcLhxMJHFojOAACAAQANgvmFD0d0iM7AAIABAA2C+YUPR3SIz4AAgAFALMGVw3mE2IaxCBCAAIAAwDBDUAZYyJEAAIABQB2CdARQBmqH6wkSAACAAQACAj5D8wXgB9LAAIABAA2C+YUPR3SI04AAgAEADYL5hQ9HdIjUQACAAUAswZXDeYTYhrEIFUAAgADAMENQBljIlcAAgAFAHYJ0BFAGaofrCRbAAIABAAICPkPzBeAH14AAgAEADYL5hQ9HdIjYQACAAQANgvmFD0d0iNkAAIABQCzBlcN5hNiGsQgaAACAAMAwQ1AGWMiagACAAUAdgnQEUAZqh+sJG4AAgAFAJ8GMA23EzgasCByAAIACgC7A3QHJgvSDnQSChaTGQ0ddiDNI3sAAAAAAAIACADfAesFBwumEGoWCRwlITElBwACAAUAtgMHC4cTCRxaIwsAAAA0AAIABQC2AwcLhxMJHFojOAAAAAAAAgAIAN8B6wUHC6YQahYJHCUhMSUHAAIABQC2AwcLhxMJHFojCwACAAsAIAG2Ax8HBws2D4cT2hcJHPEfWiPwJRUAAgAMAPoAQQNJBskJlA2HEYkVfBlHHccgzyMWJiAAAgAKAFEBSQQmCIYMKhHmFYoa6h7HIr8lKQACAAwA+gBBA0kGyQmUDYcRiRV8GUcdxyDPIxYmNAACAAUAtgMHC4cTCRxaIzgAAgAEAAAFXQ6zGBAiOwACAAgA3wHrBQcLphBqFgkcJSExJUIAAgAHAEoCHwcYDYcT+BnxH8YkSAACAAQAAAVdDrMYECJLAAIABAAABV0OsxgQIk4AAgAIAN8B6wUHC6YQahYJHCUhMSVVAAIABwBKAh8HGA2HE/gZ8R/GJFsAAgAEAAAFXQ6zGBAiXgACAAQAAAVdDrMYECJhAAIACADfAesFBwumEGoWCRwlITElaAACAAcASgIfBxgNhxP4GfEfxiRuAAIABQAbBSMMhxPtGvUhcgACAAoAmgUCCyIQ7BRLGTIdiyBHI1QlnSZ7AAAAAAACAAkAjgEABWwJXQ6HE7MYpB0QIoIlCAACAAUAtgMHC4cTCRxaIwwAAgAMALABBgbvC3oS7hjEHqYjYifdKQ4r9iqeKRcAAgAKAFACCwh5DzcXRR4LJDAokSolK/MpIAACAAwAsAEGBu8LehLuGMQepiNiJ90pDiv2Kp4pKwACAAoAUAILCHkPNxdFHgskMCiRKiUr8yk0AAIABQC2AwcLhxMJHFojOAACAAYA3wLACNIPPhdQHjEkPQACAAgA3wHrBQcLphBqFgkcJSExJUQAAgAIAN8B6wUHC6YQahYJHCUhMSVLAAIABgDfAsAI0g8+F1AeMSRQAAIACADfAesFBwumEGoWCRwlITElVwACAAgA3wHrBQcLphBqFgkcJSExJV4AAgAGAN8CwAjSDz4XUB4xJGMAAgAIAN8B6wUHC6YQahYJHCUhMSVqAAIABQBjArsHow5vFq8ebgACAAUAIQiBD3kWBx36InIAAgAKAJoFAgsiEOwUSxkyHYsgRyNUJZ0mewAAAAAAAgAIAN8B6wUHC6YQahYJHCUhMSUHAAIABQC2AwcLhxMJHFojCwACAAsAogFqBpYNyhWVHf4jnihjK28s8SsYKhUAAgAMAJsADAIFBGEGDAn3Cx8PfRIPFtsZ5h0/IiAAAgAKAFEBSQQmCIYMKhHmFYoa6h7HIr8lKQACAAwAmwAMAgUEYQYMCfcLHw99Eg8W2xnmHT8iNAACAAUAtgMHC4cTCRxaIzgAAgAKAE0DRQeIC+cPRBSFGJIcTSCJI/wlQQACAAkAJgG8AyAHDAtXD+cTpRh/HV4iSQACAAMAWgVXDxAbSwACAAoATQNFB4gL5w9EFIUYkhxNIIkj/CVUAAIACQAmAbwDIAcMC1cP5xOlGH8dXiJcAAIAAwBaBVcPEBteAAIACgBNA0UHiAvnD0QUhRiSHE0giSP8JWcAAgAIAE8BPgQXCIkMaRGWFvobgSFuAAIABQCWBiANqBMqGqYgcgAAAAAAAgAIAN8B6wUHC6YQahYJHCUhMSUHAAIABQC2AwcLhxMJHFojCwACAAsAGgODC5cWZiEkKjcwqjO+NMMzADGyLBUAAgAMAJUB0wW3CzQSbxjoHVoiryXqJxcpSimWKCAAAgAKAFEBSQQmCIYMKhHmFYoa6h7HIr8lKQACAAwAlQHTBbcLNBJvGOgdWiKvJeonFylKKZYoNAACAAUAtgMHC4cTCRxaIzgAAgAHAEoCHwcYDYcT+BnxH8YkPgACAAgA3wHrBQcLphBqFgkcJSExJUUAAgAHAEoCHwcYDYcT+BnxH8YkSwACAAcASgIfBxgNhxP4GfEfxiRRAAIACADfAesFBwumEGoWCRwlITElWAACAAcASgIfBxgNhxP4GfEfxiReAAIABwBKAh8HGA2HE/gZ8R/GJGQAAgAIAN8B6wUHC6YQahYJHCUhMSVrAAIABAAcAwAK1xK4HG4AAgAFAO8HQw8+Ftcc3yJyAAIACgCaBQILIhDsFEsZMh2LIEcjVCWdJnsAAAAAAAIACQD7BsYM3hFxFpEaQx5/ITMkMiYIAAIABQC2AwcLhxMJHFojDAACAAoAUQFJBCYIhgwqEeYVihrqHscivyUVAAIADAD6AEEDSQbJCZQNhxGJFXwZRx3HIM8jFiYgAAIACgBRAUkEJgiGDCoR5hWKGuoexyK/JSkAAgAMAPoAQQNJBskJlA2HEYkVfBlHHccgzyMWJjQAAgAFALYDBwuHEwkcWiM4AAIABAAABV0OsxgQIjsAAgAIAN8B6wUHC6YQahYJHCUhMSVCAAIABwBKAh8HGA2HE/gZ8R/GJEgAAgAEAAAFXQ6zGBAiSwACAAQAAAVdDrMYECJOAAIACADfAesFBwumEGoWCRwlITElVQACAAcASgIfBxgNhxP4GfEfxiRbAAIABAAABV0OsxgQIl4AAgAEAAAFXQ6zGBAiYQACAAgA3wHrBQcLphBqFgkcJSExJWgAAgAHAEoCHwcYDYcT+BnxH8YkbgACAAUAGwUjDIcT7Rr1IXIAAgAKAJoFAgsiEOwUSxkyHYsgRyNUJZ0mewAAAAAAAgAIAN8B6wUHC6YQahYJHCUhMSUHAAIABQC2AwcLhxMJHFojCwACAAsAogBBApMEbQeuCj8ODhINFjAabR66IhUAAgAMAAEE+gfoC8APfRMWF38arR2PIBMjHCWFJiAAAgAKAFEBSQQmCIYMKhHmFYoa6h7HIr8lKQACAAwAAQT6B+gLwA99ExYXfxqtHY8gEyMcJYUmNAACAAUAtgMHC4cTCRxaIzgAAgAGAN8CwAjSDz4XUB4xJD0AAgAJAI4BAAVsCV0OhxOzGKQdECKCJUUAAgAHAEoCHwcYDYcT+BnxH8YkSwACAAYA3wLACNIPPhdQHjEkUAACAAkAjgEABWwJXQ6HE7MYpB0QIoIlWAACAAcASgIfBxgNhxP4GfEfxiReAAIABgDfAsAI0g8+F1AeMSRjAAIACQCOAQAFbAldDocTsxikHRAigiVrAAIABAAcAwAK1xK4HG4AAgAFAO8HQw8+Ftcc3yJyAAIACgCaBQILIhDsFEsZMh2LIEcjVCWdJnsAAAAAAAAAbgACAAYALAQSClgQuBb+HOQicwACAAkAjgEABWwJXQ6HE7MYpB0QIoIlewAAAAAAAgAIAN8B6wUHC6YQahYJHCUhMSUHAAIABQC2AwcLhxMJHFojCwACAAsAIAG2Ax8HBws2D4cT2hcJHPEfWiPwJRUAAgAMAPoAQQNJBskJlA2HEYkVfBlHHccgzyMWJiAAAgAKAFEBSQQmCIYMKhHmFYoa6h7HIr8lKQACAAwA+gBBA0kGyQmUDYcRiRV8GUcdxyDPIxYmNAACAAUAtgMHC4cTCRxaIzgAAgAKAFEBSQQmCIYMKhHmFYoa6h7HIr8lQQACAAsAIAG2Ax8HBws2D4cT2hcJHPEfWiPwJUsAAgAKAFEBSQQmCIYMKhHmFYoa6h7HIr8lVAACAAsAIAG2Ax8HBws2D4cT2hcJHPEfWiPwJV4AAgAKAFEBSQQmCIYMKhHmFYoa6h7HIr8lZwACAAgAVQFrBIIINQ1KEo4X4BwYIm4AAgAFAIcI/w/xFmQdLiNyAAAAAAACAAgA3wHrBQcLphBqFgkcJSExJQcAAgAFALYDBwuHEwkcWiMLAAIACwAgAbYDHwcHCzYPhxPaFwkc8R9aI/AlFQACAAwA+gBBA0kGyQmUDYcRiRV8GUcdxyDPIxYmIAACAAoAUQFJBCYIhgwqEeYVihrqHscivyUpAAIADAD6AEEDSQbJCZQNhxGJFXwZRx3HIM8jFiY0AAIABQC2AwcLhxMJHFojOAACAAoAUQFJBCYIhgwqEeYVihrqHscivyVBAAIACwAgAbYDHwcHCzYPhxPaFwkc8R9aI/AlSwACAAoAUQFJBCYIhgwqEeYVihrqHscivyVUAAIACwAgAbYDHwcHCzYPhxPaFwkc8R9aI/AlXgACAAoAUQFJBCYIhgwqEeYVihrqHscivyVnAAIACABVAWsEggg1DUoSjhfgHBgibgACAAUAhwj/D/EWZB0uI3IAAgAKAJoFAgsiEOwUSxkyHYsgRyNUJZ0mewAAAAAAAABuAAIABgDfAsAI0g8+F1AeMSRzAAIACQCOAQAFbAldDocTsxikHRAigiV7AAAAAAACAAkAjgEABWwJXQ6HE7MYpB0QIoIlCAACAAUAtgMHC4cTCRxaIwwAAgAMAAQCHQf7DYIV3RxpI8MooyznLnovWS6IKxcAAgAKAMECeQkREusa3CItKWstYC/0LissIAACAAwABAIdB/sNghXdHGkjwyijLOcuei9ZLogrKwACAAoAwQJ5CRES6xrcIi0pay1gL/QuKyw0AAIABQC2AwcLhxMJHFojOAACAAcASgIfBxgNhxP4GfEfxiQ+AAIACADfAesFBwumEGoWCRwlITElRQACAAcASgIfBxgNhxP4GfEfxiRLAAIABwBKAh8HGA2HE/gZ8R/GJFEAAgAIAN8B6wUHC6YQahYJHCUhMSVYAAIABwBKAh8HGA2HE/gZ8R/GJF4AAgAHAEoCHwcYDYcT+BnxH8YkZAACAAgA3wHrBQcLphBqFgkcJSExJWsAAgAEABwDAArXErgcbgACAAUA7wdDDz4W1xzfInIAAgAKAJoFAgsiEOwUSxkyHYsgRyNUJZ0mewAAAAAAAgAJAPsGxgzeEXEWkRpDHn8hMyQyJggAAgAFALYDBwuHEwkcWiMMAAIACgBRAUkEJgiGDCoR5hWKGuoexyK/JRUAAgAMAPoAQQNJBskJlA2HEYkVfBlHHccgzyMWJiAAAgAKAFEBSQQmCIYMKhHmFYoa6h7HIr8lKQACAAwA+gBBA0kGyQmUDYcRiRV8GUcdxyDPIxYmNAACAAUAtgMHC4cTCRxaIzgAAgAEAAAFXQ6zGBAiOwACAAgA3wHrBQcLphBqFgkcJSExJUIAAgAHAEoCHwcYDYcT+BnxH8YkSAACAAQAAAVdDrMYECJLAAIABAAABV0OsxgQIk4AAgAIAN8B6wUHC6YQahYJHCUhMSVVAAIABwBKAh8HGA2HE/gZ8R/GJFsAAgAEAAAFXQ6zGBAiXgACAAQAAAVdDrMYECJhAAIACADfAesFBwumEGoWCRwlITElaAACAAcASgIfBxgNhxP4GfEfxiRuAAIABQAbBSMMhxPtGvUhcgACAAoAmgUCCyIQ7BRLGTIdiyBHI1QlnSZ7AAAAAAACAAkAjgEABWwJXQ6HE7MYpB0QIoIlCAACAAUAtgMHC4cTCRxaIwwAAgAMALABBgbvC3oS7hjEHqYjYifdKQ4r9iqeKRcAAgAKAFACCwh5DzcXRR4LJDAokSolK/MpIAACAAwAsAEGBu8LehLuGMQepiNiJ90pDiv2Kp4pKwACAAoAUAILCHkPNxdFHgskMCiRKiUr8yk0AAIABQC2AwcLhxMJHFojOAACAAYA3wLACNIPPhdQHjEkPQACAAgA3wHrBQcLphBqFgkcJSExJUQAAgAIAN8B6wUHC6YQahYJHCUhMSVLAAIABgDfAsAI0g8+F1AeMSRQAAIACADfAesFBwumEGoWCRwlITElVwACAAgA3wHrBQcLphBqFgkcJSExJV4AAgAGAN8CwAjSDz4XUB4xJGMAAgAIAN8B6wUHC6YQahYJHCUhMSVqAAIABQBjArsHow5vFq8ebgACAAUAIQiBD3kWBx36InIAAgAKAJoFAgsiEOwUSxkyHYsgRyNUJZ0mewAAAAAAAAAHAAIABQC2AwcLhxMJHFojCwACAAYAegEnBVEKihCIFxgfEAACAAYASAaQDLoSohgiHggjFQACAAYAVAXBC6ESdBm6H74kGgACAAcAfQUAC3AQuBXBGmwflyMgAAIABQC2AwcLhxMJHFojJAACAAYASAaQDLoSohgiHggjKQACAAYAVAXBC6ESdBm6H74kLgACAAcAfQUAC3AQuBXBGmwflyM0AAIABQC2AwcLhxMJHFojOAAAAAAAAAALAAIABgB6AScFUQqKEIgXGB8QAAIABgBIBpAMuhKiGCIeCCMVAAIABgBUBcELoRJ0GbofviQaAAIABwB9BQALcBC4FcEabB+XIyAAAgAFALYDBwuHEwkcWiMkAAIABgBIBpAMuhKiGCIeCCMpAAIABgBUBcELoRJ0GbofviQuAAIABwB9BQALcBC4FcEabB+XIzQAAAAAAAIACQD7BsYM3hFxFpEaQx5/ITMkMiYIAAIABQC2AwcLhxMJHFojDAACAAoAUQFJBCYIhgwqEeYVihrqHscivyUVAAIADAD6AEEDSQbJCZQNhxGJFXwZRx3HIM8jFiYgAAIACgBRAUkEJgiGDCoR5hWKGuoexyK/JSkAAgAMAPoAQQNJBskJlA2HEYkVfBlHHccgzyMWJjQAAgAFALYDBwuHEwkcWiM4AAIABAAABV0OsxgQIjsAAgAIAN8B6wUHC6YQahYJHCUhMSVCAAIABwBKAh8HGA2HE/gZ8R/GJEgAAgAEAAAFXQ6zGBAiSwACAAQAAAVdDrMYECJOAAIACADfAesFBwumEGoWCRwlITElVQACAAcASgIfBxgNhxP4GfEfxiRbAAIABAAABV0OsxgQIl4AAgAEAAAFXQ6zGBAiYQACAAgA3wHrBQcLphBqFgkcJSExJWgAAgAHAEoCHwcYDYcT+BnxH8YkbgACAAUAGwUjDIcT7Rr1IXIAAgAKAJoFAgsiEOwUSxkyHYsgRyNUJZ0mewAAAAAAAAALAAIACwAgAbYDHwcHCzYPhxPaFwkc8R9aI/AlFQACAAwA+gBBA0kGyQmUDYcRiRV8GUcdxyDPIxYmIAACAAoAUQFJBCYIhgwqEeYVihrqHscivyUpAAIADAD6AEEDSQbJCZQNhxGJFXwZRx3HIM8jFiY0AAIABQC2AwcLhxMJHFojOAACAAQAAAVdDrMYECI7AAIACADfAesFBwumEGoWCRwlITElQgACAAcASgIfBxgNhxP4GfEfxiRIAAIABAAABV0OsxgQIksAAgAEAAAFXQ6zGBAiTgACAAgA3wHrBQcLphBqFgkcJSExJVUAAgAHAEoCHwcYDYcT+BnxH8YkWwACAAQAAAVdDrMYECJeAAIABAAABV0OsxgQImEAAgAIAN8B6wUHC6YQahYJHCUhMSVoAAIABwBKAh8HGA2HE/gZ8R/GJG4AAgAFABsFIwyHE+0a9SFyAAAAAAACAAgA3wHrBQcLphBqFgkcJSExJQcAAgAFALYDBwuHEwkcWiMLAAIACwAgAbYDHwcHCzYPhxPaFwkc8R9aI/AlFQACAAwA+gBBA0kGyQmUDYcRiRV8GUcdxyDPIxYmIAACAAoAUQFJBCYIhgwqEeYVihrqHscivyUpAAIADAD6AEEDSQbJCZQNhxGJFXwZRx3HIM8jFiY0AAIABQC2AwcLhxMJHFojOAACAAQAAAVdDrMYECI7AAIACADfAesFBwumEGoWCRwlITElQgACAAcASgIfBxgNhxP4GfEfxiRIAAIABAAABV0OsxgQIksAAgAEAAAFXQ6zGBAiTgACAAgA3wHrBQcLphBqFgkcJSExJVUAAgAHAEoCHwcYDYcT+BnxH8YkWwACAAQAAAVdDrMYECJeAAIABAAABV0OsxgQImEAAgAIAN8B6wUHC6YQahYJHCUhMSVoAAIABwBKAh8HGA2HE/gZ8R/GJG4AAgAFABsFIwyHE+0a9SFyAAIACgCaBQILIhDsFEsZMh2LIEcjVCWdJnsAAAAAAAIACQCOAQAFbAldDocTsxikHRAigiUIAAIABQC2AwcLhxMJHFojDAACAAwAsAEGBu8LehLuGMQepiNiJ90pDiv2Kp4pFwACAAoAUAILCHkPNxdFHgskMCiRKiUr8ykgAAIADACwAQYG7wt6Eu4YxB6mI2In3SkOK/YqnikrAAIACgBQAgsIeQ83F0UeCyQwKJEqJSvzKTQAAgAFALYDBwuHEwkcWiM4AAIABgDfAsAI0g8+F1AeMSQ9AAIACADfAesFBwumEGoWCRwlITElRAACAAgA3wHrBQcLphBqFgkcJSExJUsAAgAGAN8CwAjSDz4XUB4xJFAAAgAIAN8B6wUHC6YQahYJHCUhMSVXAAIACADfAesFBwumEGoWCRwlITElXgACAAYA3wLACNIPPhdQHjEkYwACAAgA3wHrBQcLphBqFgkcJSExJWoAAgAFAGMCuwejDm8Wrx5uAAIABQAhCIEPeRYHHfoicgACAAoAmgUCCyIQ7BRLGTIdiyBHI1QlnSZ7AAAAAAAAAAcAAgAFALYDBwuHEwkcWiMLAAIACwAgAbYDHwcHCzYPhxPaFwkc8R9aI/AlFQACAAwA+gBBA0kGyQmUDYcRiRV8GUcdxyDPIxYmIAACAAoAUQFJBCYIhgwqEeYVihrqHscivyUpAAIADAD6AEEDSQbJCZQNhxGJFXwZRx3HIM8jFiY0AAIABQC2AwcLhxMJHFojOAAAAAAAAgAIAN8B6wUHC6YQahYJHCUhMSUHAAIABQC2AwcLhxMJHFojCwACAAsAIAG2Ax8HBws2D4cT2hcJHPEfWiPwJRUAAgAMAPoAQQNJBskJlA2HEYkVfBlHHccgzyMWJiAAAgAKAFEBSQQmCIYMKhHmFYoa6h7HIr8lKQACAAwA+gBBA0kGyQmUDYcRiRV8GUcdxyDPIxYmNAACAAUAtgMHC4cTCRxaIzgAAgAEADYL5hQ9HdIjOwACAAQANgvmFD0d0iM+AAIABQCzBlcN5hNiGsQgQgACAAMAwQ1AGWMiRAACAAUAdgnQEUAZqh+sJEgAAgAEAAgI+Q/MF4AfSwACAAQANgvmFD0d0iNOAAIABAA2C+YUPR3SI1EAAgAFALMGVw3mE2IaxCBVAAIAAwDBDUAZYyJXAAIABQB2CdARQBmqH6wkWwACAAQACAj5D8wXgB9eAAIABAA2C+YUPR3SI2EAAgAEADYL5hQ9HdIjZAACAAUAswZXDeYTYhrEIGgAAgADAMENQBljImoAAgAFAHYJ0BFAGaofrCRuAAAAAAACAAgA3wHrBQcLphBqFgkcJSExJQcAAgAFALYDBwuHEwkcWiMLAAIACwAgAbYDHwcHCzYPhxPaFwkc8R9aI/AlFQACAAwA+gBBA0kGyQmUDYcRiRV8GUcdxyDPIxYmIAACAAoAUQFJBCYIhgwqEeYVihrqHscivyUpAAIADAD6AEEDSQbJCZQNhxGJFXwZRx3HIM8jFiY0AAIABQC2AwcLhxMJHFojOAACAAQANgvmFD0d0iM7AAIABAA2C+YUPR3SIz4AAgAFALMGVw3mE2IaxCBCAAIAAwDBDUAZYyJEAAIABQB2CdARQBmqH6wkSAACAAQACAj5D8wXgB9LAAIABAA2C+YUPR3SI04AAgAEADYL5hQ9HdIjUQACAAUAswZXDeYTYhrEIFUAAgADAMENQBljIlcAAgAFAHYJ0BFAGaofrCRbAAIABAAICPkPzBeAH14AAgAEADYL5hQ9HdIjYQACAAQANgvmFD0d0iNkAAIABQCzBlcN5hNiGsQgaAACAAMAwQ1AGWMiagACAAUAdgnQEUAZqh+sJG4AAQByAAIACgC7A3QHJgvSDnQSChaTGQ0ddiDNI3sAAAAAAAIACADfAesFBwumEGoWCRwlITElBwACAAUAtgMHC4cTCRxaIwsAAgALABoDgwuXFmYhJCo3MKozvjTDMwAxsiwVAAIADACVAdMFtws0Em8Y6B1aIq8l6icXKUopliggAAIACgBRAUkEJgiGDCoR5hWKGuoexyK/JSkAAgAMAJUB0wW3CzQSbxjoHVoiryXqJxcpSimWKDQAAgAFALYDBwuHEwkcWiM4AAIABwBKAh8HGA2HE/gZ8R/GJD4AAgAIAN8B6wUHC6YQahYJHCUhMSVFAAIABwBKAh8HGA2HE/gZ8R/GJEsAAgAHAEoCHwcYDYcT+BnxH8YkUQACAAgA3wHrBQcLphBqFgkcJSExJVgAAgAHAEoCHwcYDYcT+BnxH8YkXgACAAcASgIfBxgNhxP4GfEfxiRkAAIACADfAesFBwumEGoWCRwlITElawACAAQAHAMACtcSuBxuAAIABQDvB0MPPhbXHN8icgACAAoAmgUCCyIQ7BRLGTIdiyBHI1QlnSZ7AAAAAAACAAgA3wHrBQcLphBqFgkcJSExJQcAAgAFALYDBwuHEwkcWiMLAAIACwCiAEECkwRtB64KPw4OEg0WMBptHroiFQACAAwAAQT6B+gLwA99ExYXfxqtHY8gEyMcJYUmIAACAAoAUQFJBCYIhgwqEeYVihrqHscivyUpAAIADAABBPoH6AvAD30TFhd/Gq0djyATIxwlhSY0AAIABQC2AwcLhxMJHFojOAACAAYA3wLACNIPPhdQHjEkPQACAAkAjgEABWwJXQ6HE7MYpB0QIoIlRQACAAcASgIfBxgNhxP4GfEfxiRLAAIABgDfAsAI0g8+F1AeMSRQAAIACQCOAQAFbAldDocTsxikHRAigiVYAAIABwBKAh8HGA2HE/gZ8R/GJF4AAgAGAN8CwAjSDz4XUB4xJGMAAgAJAI4BAAVsCV0OhxOzGKQdECKCJWsAAgAEABwDAArXErgcbgACAAUA7wdDDz4W1xzfInIAAgAKAJoFAgsiEOwUSxkyHYsgRyNUJZ0mewAAAAAAAgAIAN8B6wUHC6YQahYJHCUhMSUHAAIABQC2AwcLhxMJHFojCwACAAsAogFqBpYNyhWVHf4jnihjK28s8SsYKhUAAgAMAJsADAIFBGEGDAn3Cx8PfRIPFtsZ5h0/IiAAAgAKAEICtwWECXgNgBGQFZgZjB1ZIc4kKQACAAwAmwAMAgUEYQYMCfcLHw99Eg8W2xnmHT8iNAACAAUAtgMHC4cTCRxaIzgAAgAGAIUFJwwHE7QZyx+0JD0AAgAJAI4BAAVsCV0OhxOzGKQdECKCJUUAAgAHALIBWgUHClcPERUQGyghSwACAAYAhQUnDAcTtBnLH7QkUAACAAkAjgEABWwJXQ6HE7MYpB0QIoIlWAACAAcAsgFaBQcKVw8RFRAbKCFeAAIABgCFBScMBxO0GcsftCRjAAIACQCOAQAFbAldDocTsxikHRAigiVrAAIABAD1ApAJNhItHG4AAgAFAFUG1gxnE/4ZkyByAAIACgCaBQILIhDsFEsZMh2LIEcjVCWdJnsAAAAAAAIADAD6AEEDSQbJCZQNhxGJFXwZRx3HIM8jFiYLAAIACwCiAWoGlg3KFZUd/iOeKGMrbyzxKxgqFQACAAwAmwAMAgUEYQYMCfcLHw99Eg8W2xnmHT8iIAACAAoAQgK3BYQJeA2AEZAVmBmMHVkhziQpAAIADACbAAwCBQRhBgwJ9wsfD30SDxbbGeYdPyI0AAAAAAACAAgA3wHrBQcLphBqFgkcJSExJQcAAgAFALYDBwuHEwkcWiMLAAIACwCiAWoGlg3KFZUd/iOeKGMrbyzxKxgqFQACAAwAmwAMAgUEYQYMCfcLHw99Eg8W2xnmHT8iIAACAAoAUQFJBCYIhgwqEeYVihrqHscivyUpAAIADACbAAwCBQRhBgwJ9wsfD30SDxbbGeYdPyI0AAIABQC2AwcLhxMJHFojOAACAAgAJAQlCXEOyRP8GNwdLCKIJT8AAgAJAI4BAAVsCV0OhxOzGKQdECKCJUcAAgAFAMMCYghXDwsXHx9LAAIACAAkBCUJcQ7JE/wY3B0sIoglUgACAAkAjgEABWwJXQ6HE7MYpB0QIoIlWgACAAUAwwJiCFcPCxcfH14AAgAIACQEJQlxDskT/BjcHSwiiCVlAAIACQCOAQAFbAldDocTsxikHRAigiVtAAIAAgDtBfATbgACAAUA0QU9DNoSkBlUIHIAAAAAAAIACADfAesFBwumEGoWCRwlITElBwACAAUAtgMHC4cTCRxaIwsAAAA0AAIABQC2AwcLhxMJHFojOAACAAQANgvmFD0d0iM7AAIACAB1BloM0BHgFoQbqh80I+AlQgACAAMAwQ1AGWMiRAACAAUAdgnQEUAZqh+sJEgAAgAEAAgI+Q/MF4AfSwACAAQANgvmFD0d0iNOAAIACAB1BloM0BHgFoQbqh80I+AlVQACAAMAwQ1AGWMiVwACAAUAdgnQEUAZqh+sJFsAAgAEAAgI+Q/MF4AfXgACAAQANgvmFD0d0iNhAAIACAB1BloM0BHgFoQbqh80I+AlaAACAAMAwQ1AGWMiagACAAUAdgnQEUAZqh+sJG4AAQByAAIACgCaBQILIhDsFEsZMh2LIEcjVCWdJnsAAAAAAAIACADfAesFBwumEGoWCRwlITElBwACAAUAtgMHC4cTCRxaIwsAAAA0AAIABQC2AwcLhxMJHFojOAACAAQANgvmFD0d0iM7AAIACAB1BloM0BHgFoQbqh80I+AlQgACAAMAwQ1AGWMiRAACAAsA6AR2CcEN0BGlFUAZmRyqH2MirCRZJk4AAgAIAHUGWgzQEeAWhBuqHzQj4CVVAAIAAwDBDUAZYyJXAAIACwDoBHYJwQ3QEaUVQBmZHKofYyKsJFkmYQACAAgAdQZaDNAR4BaEG6ofNCPgJWgAAgADAMENQBljImoAAAAAAAIACADfAesFBwumEGoWCRwlITElBwACAAUAtgMHC4cTCRxaIwsAAgAGAMkB7gVxC8wRqxjTHxAAAgAGAJoH9A7hFSwchCFvJRUAAgAGAMkB7gVxC8wRqxjTHxoAAgAHAKoGJg1YEx8ZTx6nIsolIAACAAUAtgMHC4cTCRxaIyQAAgAGAJoH9A7hFSwchCFvJSkAAgAGAMkB7gVxC8wRqxjTHy4AAgAHAKoGJg1YEx8ZTx6nIsolNAACAAUAtgMHC4cTCRxaIzgAAgALACABtgMfBwcLNg+HE9oXCRzxH1oj8CVCAAIACgBRAUkEJgiGDCoR5hWKGuoexyK/JUsAAgALACABtgMfBwcLNg+HE9oXCRzxH1oj8CVVAAIACgBRAUkEJgiGDCoR5hWKGuoexyK/JV4AAgALACABtgMfBwcLNg+HE9oXCRzxH1oj8CVoAAIABwBKAh8HGA2HE/gZ8R/GJG4AAgAFAG8I4g/UFk0dICNyAAIACgCaBQILIhDsFEsZMh2LIEcjVCWdJnsAAAAAAAIACADfAesFBwumEGoWCRwlITElBwACAAUAtgMHC4cTCRxaIwsAAgALACABtgMfBwcLNg+HE9oXCRzxH1oj8CUVAAIADAD6AEEDSQbJCZQNhxGJFXwZRx3HIM8jFiYgAAIACgBRAUkEJgiGDCoR5hWKGuoexyK/JSkAAgAMAPoAQQNJBskJlA2HEYkVfBlHHccgzyMWJjQAAgAFALYDBwuHEwkcWiM4AAEAOwABAD4AAQBCAAEARAABAEgAAQBLAAEATgABAFEAAQBVAAEAVwABAFsAAQBeAAEAYQABAGQAAQBoAAAAagABAG4AAQByAAIACgC7A3QHJgvSDnQSChaTGQ0ddiDNI3sAAAAAAAIACADfAesFBwumEGoWCRwlITElBwACAAUAtgMHC4cTCRxaIwsAAgALACABtgMfBwcLNg+HE9oXCRzxH1oj8CUVAAIADAD6AEEDSQbJCZQNhxGJFXwZRx3HIM8jFiYgAAIACgBRAUkEJgiGDCoR5hWKGuoexyK/JSkAAgAMAPoAQQNJBskJlA2HEYkVfBlHHccgzyMWJjQAAgAFALYDBwuHEwkcWiM4AAIACgBRAUkEJgiGDCoR5hWKGuoexyK/JUEAAgALACABtgMfBwcLNg+HE9oXCRzxH1oj8CVLAAIACgBRAUkEJgiGDCoR5hWKGuoexyK/JVQAAgALACABtgMfBwcLNg+HE9oXCRzxH1oj8CVeAAIACgBRAUkEJgiGDCoR5hWKGuoexyK/JWcAAgAIAFUBawSCCDUNShKOF+AcGCJuAAIABQCHCP8P8RZkHS4jcgACAAoAmgUCCyIQ7BRLGTIdiyBHI1QlnSZ7AAAAAAACAAgA3wHrBQcLphBqFgkcJSExJQcAAgAFALYDBwuHEwkcWiMLAAIABgDJAe4FcQvMEasY0x8QAAIABgCaB/QO4RUsHIQhbyUVAAIABgDJAe4FcQvMEasY0x8aAAIABwCqBiYNWBMfGU8epyLKJSAAAgAFALYDBwuHEwkcWiMkAAIABgCaB/QO4RUsHIQhbyUpAAIABgDJAe4FcQvMEasY0x8uAAIABwCqBiYNWBMfGU8epyLKJTQAAgAFALYDBwuHEwkcWiM4AAIACwAgAbYDHwcHCzYPhxPaFwkc8R9aI/AlQgACAAoAUQFJBCYIhgwqEeYVihrqHscivyVLAAIACwAgAbYDHwcHCzYPhxPaFwkc8R9aI/AlVQACAAoAUQFJBCYIhgwqEeYVihrqHscivyVeAAIACwAgAbYDHwcHCzYPhxPaFwkc8R9aI/AlaAACAAcASgIfBxgNhxP4GfEfxiRuAAIABQBvCOIP1BZNHSAjcgACAAoAmgUCCyIQ7BRLGTIdiyBHI1QlnSZ7AAAAAAACAAgA3wHrBQcLphBqFgkcJSExJQcAAgAFALYDBwuHEwkcWiMLAAIADAD6AEEDSQbJCZQNhxGJFXwZRx3HIM8jFiYWAAIACwAgAbYDHwcHCzYPhxPaFwkc8R9aI/AlIAACAAsAIAG2Ax8HBws2D4cT2hcJHPEfWiPwJSoAAgALACABtgMfBwcLNg+HE9oXCRzxH1oj8CU0AAIABQC2AwcLhxMJHFojOAACAAcASgIfBxgNhxP4GfEfxiQ+AAIACADfAesFBwumEGoWCRwlITElRQACAAcASgIfBxgNhxP4GfEfxiRLAAIABwBKAh8HGA2HE/gZ8R/GJFEAAgAIAN8B6wUHC6YQahYJHCUhMSVYAAIABwBKAh8HGA2HE/gZ8R/GJF4AAgAHAEoCHwcYDYcT+BnxH8YkZAACAAgA3wHrBQcLphBqFgkcJSExJWsAAgAEABwDAArXErgcbgACAAUA7wdDDz4W1xzfInIAAgAKAJoFAgsiEOwUSxkyHYsgRyNUJZ0mewAAAAAAAgAIAN8B6wUHC6YQahYJHCUhMSUHAAIABQC2AwcLhxMJHFojCwACAAsAogFqBpYNyhWVHf4jnihjK28s8SsYKhUAAgAMAJsADAIFBGEGDAn3Cx8PfRIPFtsZ5h0/IiAAAgAKAFEBSQQmCIYMKhHmFYoa6h7HIr8lKQACAAwAmwAMAgUEYQYMCfcLHw99Eg8W2xnmHT8iNAACAAUAtgMHC4cTCRxaIzgAAgAKAE0DRQeIC+cPRBSFGJIcTSCJI/wlQQACAAkAjgEABWwJXQ6HE7MYpB0QIoIlSQACAAMAWgVXDxAbSwACAAoATQNFB4gL5w9EFIUYkhxNIIkj/CVUAAIACQCOAQAFbAldDocTsxikHRAigiVcAAIAAwBaBVcPEBteAAIACgBNA0UHiAvnD0QUhRiSHE0giSP8JWcAAgAIAJwBMQXHCegOSBSpGc4ebSNuAAIABQAjCcEQrBf7HYYjcgAAAAAAAgAIAN8B6wUHC6YQahYJHCUhMSUHAAIABQC2AwcLhxMJHFojCwACAAsAIAG2Ax8HBws2D4cT2hcJHPEfWiPwJRUAAgAMAPoAQQNJBskJlA2HEYkVfBlHHccgzyMWJiAAAgAKAFEBSQQmCIYMKhHmFYoa6h7HIr8lKQACAAwA+gBBA0kGyQmUDYcRiRV8GUcdxyDPIxYmNAACAAUAtgMHC4cTCRxaIzgAAgAKAFEBSQQmCIYMKhHmFYoa6h7HIr8lQQACAAsAIAG2Ax8HBws2D4cT2hcJHPEfWiPwJUsAAgAKAFEBSQQmCIYMKhHmFYoa6h7HIr8lVAACAAsAIAG2Ax8HBws2D4cT2hcJHPEfWiPwJV4AAgAKAFEBSQQmCIYMKhHmFYoa6h7HIr8lZwACAAgAVQFrBIIINQ1KEo4X4BwYIm4AAgAFAIcI/w/xFmQdLiNyAAIACgCaBQILIhDsFEsZMh2LIEcjVCWdJnsAAAAAAAIANQARAEEAigDpAFsB3wFvAg0DtgNrBCYF6wW4BokHYgg/CSAKBwvwC90MzA29DrAPphCbEZIShxN+FHUVahZgF1MYRBkzGiAbCRzwHNEdrh6HH1ggJSHqIaUiWiMDJKEkMSW1JScmhibPJv8mNAACAAUAtgMHC4cTCRxaIzgAAgAEADYL5hQ9HdIjOwACAAQANgvmFD0d0iM+AAIABQCzBlcN5hNiGsQgQgACAAMAwQ1AGWMiRAACAAUAdgnQEUAZqh+sJEgAAgAEAAgI+Q/MF4AfSwACAAQANgvmFD0d0iNOAAIABAA2C+YUPR3SI1EAAgAFALMGVw3mE2IaxCBVAAIAAwDBDUAZYyJXAAIABQB2CdARQBmqH6wkWwACAAQACAj5D8wXgB9eAAIABAA2C+YUPR3SI2EAAgAEADYL5hQ9HdIjZAACAAUAswZXDeYTYhrEIGgAAgADAMENQBljImoAAgAFAHYJ0BFAGaofrCRuAAAAAAACAAgA3wHrBQcLphBqFgkcJSExJQcAAgAFALYDBwuHEwkcWiMLAAIACwAgAbYDHwcHCzYPhxPaFwkc8R9aI/AlFQACAAwA+gBBA0kGyQmUDYcRiRV8GUcdxyDPIxYmIAACAAoAUQFJBCYIhgwqEeYVihrqHscivyUpAAIADAD6AEEDSQbJCZQNhxGJFXwZRx3HIM8jFiY0AAIABQC2AwcLhxMJHFojOAACAAQANgvmFD0d0iM7AAIABAA2C+YUPR3SIz4AAgAFALMGVw3mE2IaxCBCAAIAAwDBDUAZYyJEAAIABQB2CdARQBmqH6wkSAACAAQACAj5D8wXgB9LAAIABAA2C+YUPR3SI04AAgAEADYL5hQ9HdIjUQACAAUAswZXDeYTYhrEIFUAAgADAMENQBljIlcAAgAFAHYJ0BFAGaofrCRbAAIABAAICPkPzBeAH14AAgAEADYL5hQ9HdIjYQACAAQANgvmFD0d0iNkAAIABQCzBlcN5hNiGsQgaAACAAMAwQ1AGWMiagACAAUAdgnQEUAZqh+sJG4AAQByAAIACgCaBQILIhDsFEsZMh2LIEcjVCWdJnsAAAAAAAIADAD6AEEDSQbJCZQNhxGJFXwZRx3HIM8jFiYLAAIACwAgAbYDHwcHCzYPhxPaFwkc8R9aI/AlFQACAFYABwAaADkAYQCTAM0ADgFXAaYB+wFVArUCGQOBA+0DXQTRBEgFwgU/Br8GQQfEB0sI0wheCekJdwoHC5cLKgy8DE8N5A17DhAPpw9AENkQcBEJEqISPBPUE24UBxWgFTcW0BZpFwAYlRgsGcEZVBrmGnkbCRyZHCcdsh09HsUeTB/PH1Eg0SBOIcghPyKzIiMjjyP3I1skuyQVJWoluSUCJkMmfSavJtcm9iYJJ2oAAgAFAHYJ0BFAGaofrCRuAAAAAAACAAgA3wHrBQcLphBqFgkcJSExJQcAAgAFALYDBwuHEwkcWiMLAAIACwCiAEECkwRtB64KPw4OEg0WMBptHroiFQACAAwAAQT6B+gLwA99ExYXfxqtHY8gEyMcJYUmIAACAAoAUQFJBCYIhgwqEeYVihrqHscivyUpAAIADAABBPoH6AvAD30TFhd/Gq0djyATIxwlhSY0AAIABQC2AwcLhxMJHFojOAACAAYA3wLACNIPPhdQHjEkPQACAAkAjgEABWwJXQ6HE7MYpB0QIoIlRQACAAcASgIfBxgNhxP4GfEfxiRLAAIABgDfAsAI0g8+F1AeMSRQAAIACQCOAQAFbAldDocTsxikHRAigiVYAAIABwBKAh8HGA2HE/gZ8R/GJF4AAgAGAN8CwAjSDz4XUB4xJGMAAgAJAI4BAAVsCV0OhxOzGKQdECKCJWsAAgAEABwDAArXErgcbgACAAUA7wdDDz4W1xzfInIAAgAKAJoFAgsiEOwUSxkyHYsgRyNUJZ0mewAAAAAAAgA5AFYBnALSA/0EHAYzB0EISQlICkILNgwmDRAO9Q7VD7EQihFdEi0T+hPDFIgVSxYKF8QXfRgwGeMZkRo8G+QbiBwpHccdYB74HosfGyCnIC8hsyE0Iq8iJyOaIwgkcSTUJDMliiXaJSQmZSaeJs0m8SYIJzgAAgAEAEwIXxA0GMYfOwACAAgAeQPXB7QMyxHpFtsbaiBNJEIAAgAHABsF2QrdENgWhRyKIWIlSAACAAQA2gETBzwP/xlLAAIABABMCF8QNBjGH04AAgAIAHkD1we0DMsR6RbbG2ogTSRVAAIABwAbBdkK3RDYFoUciiFiJVsAAgAEANoBEwc8D/8ZXgACAAQATAhfEDQYxh9hAAIACAB5A9cHtAzLEekW2xtqIE0kaAACAAcAGwXZCt0Q2BaFHIohYiVuAAAAAAACAAkA+wbGDN4RcRaRGkMefyEzJDImCAACAAUAtgMHC4cTCRxaIwwAAgAKAFEBSQQmCIYMKhHmFYoa6h7HIr8lFQACAAwA+gBBA0kGyQmUDYcRiRV8GUcdxyDPIxYmIAACAAoAUQFJBCYIhgwqEeYVihrqHscivyUpAAIADAD6AEEDSQbJCZQNhxGJFXwZRx3HIM8jFiY0AAIABQC2AwcLhxMJHFojOAACAAQATAhfEDQYxh87AAIACAB5A9cHtAzLEekW2xtqIE0kQgACAAcAGwXZCt0Q2BaFHIohYiVIAAIABADaARMHPA//GUsAAgAEAEwIXxA0GMYfTgACAAgAeQPXB7QMyxHpFtsbaiBNJFUAAgAHABsF2QrdENgWhRyKIWIlWwACAAQA2gETBzwP/xleAAIABABMCF8QNBjGH2EAAgAIAHkD1we0DMsR6RbbG2ogTSRoAAIABwAbBdkK3RDYFoUciiFiJW4AAgAFAHMD6AgqDw4Wth1yAAIACgCaBQILIhDsFEsZMh2LIEcjVCWdJnsAAAAAAAIACQCOAQAFbAldDocTsxikHRAigiUIAAIABQC2AwcLhxMJHFojDAACAAwAsAEGBu8LehLuGMQepiNiJ90pDiv2Kp4pFwACAAoAUAILCHkPNxdFHgskMCiRKiUr8ykgAAIADACwAQYG7wt6Eu4YxB6mI2In3SkOK/YqnikrAAIACgBQAgsIeQ83F0UeCyQwKJEqJSvzKTQAAgAFALYDBwuHEwkcWiM4AAIABgDfAsAI0g8+F1AeMSQ9AAIACADfAesFBwumEGoWCRwlITElRAACAAgA3wHrBQcLphBqFgkcJSExJUsAAgAGAN8CwAjSDz4XUB4xJFAAAgAIAN8B6wUHC6YQahYJHCUhMSVXAAIACADfAesFBwumEGoWCRwlITElXgACAAYA3wLACNIPPhdQHjEkYwACAAgA3wHrBQcLphBqFgkcJSExJWoAAgAFAGMCuwejDm8Wrx5uAAIABQAhCIEPeRYHHfoicgACAAoAmgUCCyIQ7BRLGTIdiyBHI1QlnSZ7AAAAAAACAAgA3wHrBQcLphBqFgkcJSExJQcAAgAFALYDBwuHEwkcWiMLAAAANAACAAUAtgMHC4cTCRxaIzgAAAAAAAIACADfAesFBwumEGoWCRwlITElBwACAAUAtgMHC4cTCRxaIwsAAgALACABtgMfBwcLNg+HE9oXCRzxH1oj8CUVAAIADAD6AEEDSQbJCZQNhxGJFXwZRx3HIM8jFiYgAAIACgBRAUkEJgiGDCoR5hWKGuoexyK/JSkAAgAMAPoAQQNJBskJlA2HEYkVfBlHHccgzyMWJjQAAgAFALYDBwuHEwkcWiM4AAIABAAABV0OsxgQIjsAAgAIAN8B6wUHC6YQahYJHCUhMSVCAAIABwBKAh8HGA2HE/gZ8R/GJEgAAgAEAAAFXQ6zGBAiSwACAAQAAAVdDrMYECJOAAIACADfAesFBwumEGoWCRwlITElVQACAAcASgIfBxgNhxP4GfEfxiRbAAIABAAABV0OsxgQIl4AAgAEAAAFXQ6zGBAiYQACAAgA3wHrBQcLphBqFgkcJSExJWgAAgAHAEoCHwcYDYcT+BnxH8YkbgACAAUAGwUjDIcT7Rr1IXIAAgAKAJoFAgsiEOwUSxkyHYsgRyNUJZ0mewAAAAAAAAALAAIACwAgAbYDHwcHCzYPhxPaFwkc8R9aI/AlFQACAAwA+gBBA0kGyQmUDYcRiRV8GUcdxyDPIxYmIAACAAoAUQFJBCYIhgwqEeYVihrqHscivyUpAAIADAD6AEEDSQbJCZQNhxGJFXwZRx3HIM8jFiY0AAAAAAAAAAcAAgAFALYDBwuHEwkcWiMLAAIACwAgAbYDHwcHCzYPhxPaFwkc8R9aI/AlFQACAAwA+gBBA0kGyQmUDYcRiRV8GUcdxyDPIxYmIAACAAoAUQFJBCYIhgwqEeYVihrqHscivyUpAAIADAD6AEEDSQbJCZQNhxGJFXwZRx3HIM8jFiY0AAIABQC2AwcLhxMJHFojOAAAAEIAAgADAMENQBljIkQAAgAFAHYJ0BFAGaofrCRIAAAAVQACAAMAwQ1AGWMiVwACAAUAdgnQEUAZqh+sJFsAAABoAAIAAwDBDUAZYyJqAAIABQB2CdARQBmqH6wkbgAAAAAAAgAIAN8B6wUHC6YQahYJHCUhMSUHAAIABQC2AwcLhxMJHFojCwACAAsAogFqBpYNyhWVHf4jnihjK28s8SsYKhUAAgAMAJsADAIFBGEGDAn3Cx8PfRIPFtsZ5h0/IiAAAgAKAEICtwWECXgNgBGQFZgZjB1ZIc4kKQACAAwAmwAMAgUEYQYMCfcLHw99Eg8W2xnmHT8iNAACAAUAtgMHC4cTCRxaIzgAAgAGAIUFJwwHE7QZyx+0JD0AAgAJAI4BAAVsCV0OhxOzGKQdECKCJUUAAgAHALIBWgUHClcPERUQGyghSwACAAYAhQUnDAcTtBnLH7QkUAACAAkAjgEABWwJXQ6HE7MYpB0QIoIlWAACAAcAsgFaBQcKVw8RFRAbKCFeAAIABgCFBScMBxO0GcsftCRjAAIACQCOAQAFbAldDocTsxikHRAigiVrAAIABAD1ApAJNhItHG4AAgAFAFUG1gxnE/4ZkyByAAIACgCaBQILIhDsFEsZMh2LIEcjVCWdJnsAAAAAAAIADAD6AEEDSQbJCZQNhxGJFXwZRx3HIM8jFiYLAAIACwCiAWoGlg3KFZUd/iOeKGMrbyzxKxgqFQACAAwAmwAMAgUEYQYMCfcLHw99Eg8W2xnmHT8iIAACAAoAQgK3BYQJeA2AEZAVmBmMHVkhziQpAAIADACbAAwCBQRhBgwJ9wsfD30SDxbbGeYdPyI0AAAAAAACAAwA+gBBA0kGyQmUDYcRiRV8GUcdxyDPIxYmCwACAAsAGgODC5cWZiEkKjcwqjO+NMMzADGyLBUAAgAMAJUB0wW3CzQSbxjoHVoiryXqJxcpSimWKCAAAgAKAFEBSQQmCIYMKhHmFYoa6h7HIr8lKQACAAwAlQHTBbcLNBJvGOgdWiKvJeonFylKKZYoNAAAAAAAAgAIAN8B6wUHC6YQahYJHCUhMSUHAAIABQC2AwcLhxMJHFojCwACAAsAGgODC5cWZiEkKjcwqjO+NMMzADGyLBUAAgAMAJUB0wW3CzQSbxjoHVoiryXqJxcpSimWKCAAAgAKAFEBSQQmCIYMKhHmFYoa6h7HIr8lKQACAAwAlQHTBbcLNBJvGOgdWiKvJeonFylKKZYoNAACAAUAtgMHC4cTCRxaIzgAAQA+AAEARAABAEsAAQBRAAEAVwABAF4AAQBkAAEAagABAG4AAQByAAIACgCaBQILIhDsFEsZMh2LIEcjVCWdJnsAAAAAAAAACwACAAsAIAG2Ax8HBws2D4cT2hcJHPEfWiPwJRUAAgAMAPoAQQNJBskJlA2HEYkVfBlHHccgzyMWJiAAAgAKAFEBSQQmCIYMKhHmFYoa6h7HIr8lKQACAAwA+gBBA0kGyQmUDYcRiRV8GUcdxyDPIxYmNAACAA8AqwBKAoIEHwcFChgNSRCHE8cW+BkLHfEfjiLGJGUmQgACAAMAwQ1AGWMiRAACAAUAdgnQEUAZqh+sJEgAAABVAAIAAwDBDUAZYyJXAAIABQB2CdARQBmqH6wkWwAAAGgAAgADAMENQBljImoAAgAFAHYJ0BFAGaofrCRuAAAAAAAAAAcAAgAFALYDBwuHEwkcWiMLAAIACwAgAbYDHwcHCzYPhxPaFwkc8R9aI/AlFQACAAwA+gBBA0kGyQmUDYcRiRV8GUcdxyDPIxYmIAACAAoAUQFJBCYIhgwqEeYVihrqHscivyUpAAIADAD6AEEDSQbJCZQNhxGJFXwZRx3HIM8jFiY0AAIABQC2AwcLhxMJHFojOAAAAEIAAgADAMENQBljIkQAAgAFAHYJ0BFAGaofrCRIAAAAVQACAAMAwQ1AGWMiVwACAAUAdgnQEUAZqh+sJFsAAABoAAIAAwDBDUAZYyJqAAIABQB2CdARQBmqH6wkbgAAAAAAAAA9AAEAQwABAGcAAQBuAAAAAAAAAEkAAQBTAAEAXAABAGcAAQBuAAAAAAAAAEMAAQBJAAEAUwABAFwAAQBnAAEAbgAAAAAAAgAJAI4BAAVsCV0OhxOzGKQdECKCJQgAAgAFALYDBwuHEwkcWiMMAAIADAAEAh0H+w2CFd0caSPDKKMs5y56L1kuiCsXAAIACgDBAnkJERLrGtwiLSlrLWAv9C4rLCAAAgAMAAQCHQf7DYIV3RxpI8MooyznLnovWS6IKysAAgAKAMECeQkREusa3CItKWstYC/0LissNAACAAUAEgNwCSARMBnUIDgAAAAAAAIACQCOAQAFbAldDocTsxikHRAigiUIAAIABQC2AwcLhxMJHFojDAACAAwABAIdB/sNghXdHGkjwyijLOcuei9ZLogrFwACAAoAwQJ5CRES6xrcIi0pay1gL/QuKywgAAIADAAEAh0H+w2CFd0caSPDKKMs5y56L1kuiCsrAAIACgDBAnkJERLrGtwiLSlrLWAv9C4rLDQAAgAFABIDcAkgETAZ1CA4AAIABwBKAh8HGA2HE/gZ8R/GJD4AAgAIAN8B6wUHC6YQahYJHCUhMSVFAAIABwBKAh8HGA2HE/gZ8R/GJEsAAgAHAEoCHwcYDYcT+BnxH8YkUQACAAgA3wHrBQcLphBqFgkcJSExJVgAAgAHAEoCHwcYDYcT+BnxH8YkXgACAAcASgIfBxgNhxP4GfEfxiRkAAIACADfAesFBwumEGoWCRwlITElawACAAQAHAMACtcSuBxuAAIABQDvB0MPPhbXHN8icgAAAAAAAgAIAN8B6wUHC6YQahYJHCUhMSUHAAIABQC2AwcLhxMJHFojCwACAAsAogBBApMEbQeuCj8ODhINFjAabR66IhUAAgAMAAEE+gfoC8APfRMWF38arR2PIBMjHCWFJiAAAgAKAFEBSQQmCIYMKhHmFYoa6h7HIr8lKQACAAwAAQT6B+gLwA99ExYXfxqtHY8gEyMcJYUmNAACAAUAtgMHC4cTCRxaIzgAAgAGAN8CwAjSDz4XUB4xJD0AAgAJAI4BAAVsCV0OhxOzGKQdECKCJUUAAgAHAEoCHwcYDYcT+BnxH8YkSwACAAYA3wLACNIPPhdQHjEkUAACAAkAjgEABWwJXQ6HE7MYpB0QIoIlWAACAAcASgIfBxgNhxP4GfEfxiReAAIABgDfAsAI0g8+F1AeMSRjAAIACQCOAQAFbAldDocTsxikHRAigiVrAAIABAAcAwAK1xK4HG4AAgAFAO8HQw8+Ftcc3yJyAAIACgCaBQILIhDsFEsZMh2LIEcjVCWdJnsAAAAAAAIACQD7BsYM3hFxFpEaQx5/ITMkMiYIAAIABQC2AwcLhxMJHFojDAACAAoAUQFJBCYIhgwqEeYVihrqHscivyUVAAIADAD6AEEDSQbJCZQNhxGJFXwZRx3HIM8jFiYgAAIACgBRAUkEJgiGDCoR5hWKGuoexyK/JSkAAgAMAPoAQQNJBskJlA2HEYkVfBlHHccgzyMWJjQAAgAFALYDBwuHEwkcWiM4AAIABAAABV0OsxgQIjsAAgAIAN8B6wUHC6YQahYJHCUhMSVCAAIABwBKAh8HGA2HE/gZ8R/GJEgAAgAEAAAFXQ6zGBAiSwACAAQAAAVdDrMYECJOAAIACADfAesFBwumEGoWCRwlITElVQACAAcASgIfBxgNhxP4GfEfxiRbAAIABAAABV0OsxgQIl4AAgAEAAAFXQ6zGBAiYQACAAgA3wHrBQcLphBqFgkcJSExJWgAAgAHAEoCHwcYDYcT+BnxH8YkbgACAAUAGwUjDIcT7Rr1IXIAAgAKAJoFAgsiEOwUSxkyHYsgRyNUJZ0mewAAAAAAAgAIAN8B6wUHC6YQahYJHCUhMSUHAAIABQC2AwcLhxMJHFojCwACAAsAogBBApMEbQeuCj8ODhINFjAabR66IhUAAgAMAAEE+gfoC8APfRMWF38arR2PIBMjHCWFJiAAAgAKAFEBSQQmCIYMKhHmFYoa6h7HIr8lKQACAAwAAQT6B+gLwA99ExYXfxqtHY8gEyMcJYUmNAACAAUAtgMHC4cTCRxaIzgAAgAGAN8CwAjSDz4XUB4xJD0AAgAJAI4BAAVsCV0OhxOzGKQdECKCJUUAAgAHAEoCHwcYDYcT+BnxH8YkSwACAAYA3wLACNIPPhdQHjEkUAACAAkAjgEABWwJXQ6HE7MYpB0QIoIlWAACAAcASgIfBxgNhxP4GfEfxiReAAIABgDfAsAI0g8+F1AeMSRjAAIACQCOAQAFbAldDocTsxikHRAigiVrAAIABAAcAwAK1xK4HG4AAgAFAO8HQw8+Ftcc3yJyAAIACgCaBQILIhDsFEsZMh2LIEcjVCWdJnsAAAAAAAIACADfAesFBwumEGoWCRwlITElBwACAAUAtgMHC4cTCRxaIwsAAgALAKIBagaWDcoVlR3+I54oYytvLPErGCoVAAIADACbAAwCBQRhBgwJ9wsfD30SDxbbGeYdPyIgAAIACgBRAUkEJgiGDCoR5hWKGuoexyK/JSkAAgAMAJsADAIFBGEGDAn3Cx8PfRIPFtsZ5h0/IjQAAgAFALYDBwuHEwkcWiM4AAIACAAkBCUJcQ7JE/wY3B0sIoglPwACAAkAjgEABWwJXQ6HE7MYpB0QIoIlRwACAAUAtgMHC4cTCRxaI0sAAgAIACQEJQlxDskT/BjcHSwiiCVSAAIACQCOAQAFbAldDocTsxikHRAigiVaAAIABQC2AwcLhxMJHFojXgACAAgAJAQlCXEOyRP8GNwdLCKIJWUAAgAJAI4BAAVsCV0OhxOzGKQdECKCJW0AAgACAA8GNBRuAAIABQD8BigOPhUaHH8icgAAAAAAAgAIAN8B6wUHC6YQahYJHCUhMSUHAAIABQC2AwcLhxMJHFojCwACAAwA+gBBA0kGyQmUDYcRiRV8GUcdxyDPIxYmFgACAAsAIAG2Ax8HBws2D4cT2hcJHPEfWiPwJSAAAgALACABtgMfBwcLNg+HE9oXCRzxH1oj8CUqAAIACwAgAbYDHwcHCzYPhxPaFwkc8R9aI/AlNAACAAUAtgMHC4cTCRxaIzgAAgAHAEoCHwcYDYcT+BnxH8YkPgACAAgA3wHrBQcLphBqFgkcJSExJUUAAgAHAEoCHwcYDYcT+BnxH8YkSwACAAcASgIfBxgNhxP4GfEfxiRRAAIACADfAesFBwumEGoWCRwlITElWAACAAcASgIfBxgNhxP4GfEfxiReAAIABwBKAh8HGA2HE/gZ8R/GJGQAAgAIAN8B6wUHC6YQahYJHCUhMSVrAAIABAAcAwAK1xK4HG4AAgAFAO8HQw8+Ftcc3yJyAAIACgCaBQILIhDsFEsZMh2LIEcjVCWdJnsAAAAAAAIACADfAesFBwumEGoWCRwlITElBwACAAUAtgMHC4cTCRxaIwsAAgALACABtgMfBwcLNg+HE9oXCRzxH1oj8CUVAAIADAD6AEEDSQbJCZQNhxGJFXwZRx3HIM8jFiYgAAIACgBRAUkEJgiGDCoR5hWKGuoexyK/JSkAAgAMAPoAQQNJBskJlA2HEYkVfBlHHccgzyMWJjQAAgAFALYDBwuHEwkcWiM4AAIABAAABV0OsxgQIjsAAgAIAN8B6wUHC6YQahYJHCUhMSVCAAIABwBKAh8HGA2HE/gZ8R/GJEgAAgAEAAAFXQ6zGBAiSwACAAQAAAVdDrMYECJOAAIACADfAesFBwumEGoWCRwlITElVQACAAcASgIfBxgNhxP4GfEfxiRbAAIABAAABV0OsxgQIl4AAgAEAAAFXQ6zGBAiYQACAAgA3wHrBQcLphBqFgkcJSExJWgAAgAHAEoCHwcYDYcT+BnxH8YkbgACAAUAGwUjDIcT7Rr1IXIAAgAKAJoFAgsiEOwUSxkyHYsgRyNUJZ0mewAAAAAAAgAIAN8B6wUHC6YQahYJHCUhMSUHAAIABQC2AwcLhxMJHFojCwACABYAVwA3AXYC/AO3BZwHoQm9C+sNJRBmEqoU6xYlGVMbbx10H1khFCOaJNkluSYgAAAANAACAAUAtgMHC4cTCRxaIzgAAgAFALYDBwuHEwkcWiM8AAIABwBKAh8HGA2HE/gZ8R/GJEIAAgAFAPQCLAnFEM4YiSBGAAIABgAlB0EOIhWDGxIhQiVLAAIABQC2AwcLhxMJHFojTwACAAcASgIfBxgNhxP4GfEfxiRVAAIABQD0AiwJxRDOGIkgWQACAAYAJQdBDiIVgxsSIUIlXgACAAUAtgMHC4cTCRxaI2IAAgAHAEoCHwcYDYcT+BnxH8YkaAACAAUAYgK7B6gOdxa4HmwAAgADAOkJyxONHW4AAgAGAFAH0A3oE6sZDR/hI3MAAgAJACcGDwycEbkWUBtGH4ci+SSGJnsAAAAAAAIAOQAPADkAeQDNADIBpgEnArUCTQPtA5cESAUABr8GgQdLCBgJ6Qm+CpcLcgxPDS8OEA/zD9kQvBGiEocTbhRUFTcWHRcAGOEYwRmeGnkbUhwnHfgdxR6PH1EgECHIIXkiIyPDI1sk6SRqJd4lQyaXJtcmASc4AAIABQC2AwcLhxMJHFojPAACAAcASgIfBxgNhxP4GfEfxiRCAAIABQD0AiwJxRDOGIkgRgACAAYAJQdBDiIVgxsSIUIlSwACAAUAtgMHC4cTCRxaI08AAgAHAEoCHwcYDYcT+BnxH8YkVQACAAUA9AIsCcUQzhiJIFkAAgAGACUHQQ4iFYMbEiFCJV4AAgAFALYDBwuHEwkcWiNiAAIABwBKAh8HGA2HE/gZ8R/GJGgAAgAFAGICuweoDncWuB5sAAIAAwDpCcsTjR1uAAIABgBQB9AN6BOrGQ0f4SNzAAIACQAnBg8MnBG5FlAbRh+HIvkkhiZ7AAAAAAACAAkAjgEABWwJXQ6HE7MYpB0QIoIlCAACAAUAtgMHC4cTCRxaIwwAAgAMAAQCHQf7DYIV3RxpI8MooyznLnovWS6IKxcAAgAKAMECeQkREusa3CItKWstYC/0LissIAACAAwABAIdB/sNghXdHGkjwyijLOcuei9ZLogrKwACAAoAwQJ5CRES6xrcIi0pay1gL/QuKyw0AAIABQC2AwcLhxMJHFojOAACAAcASgIfBxgNhxP4GfEfxiQ+AAIACADfAesFBwumEGoWCRwlITElRQACAAcASgIfBxgNhxP4GfEfxiRLAAIABwBKAh8HGA2HE/gZ8R/GJFEAAgAIAN8B6wUHC6YQahYJHCUhMSVYAAIABwBKAh8HGA2HE/gZ8R/GJF4AAgAHAEoCHwcYDYcT+BnxH8YkZAACAAgA3wHrBQcLphBqFgkcJSExJWsAAgAEABwDAArXErgcbgACAAUA7wdDDz4W1xzfInIAAgAKAJoFAgsiEOwUSxkyHYsgRyNUJZ0mewAAAAAAAgAIAN8B6wUHC6YQahYJHCUhMSUHAAIABQC2AwcLhxMJHFojCwACAAsAGgODC5cWZiEkKjcwqjO+NMMzADGyLBUAAgAMAJUB0wW3CzQSbxjoHVoiryXqJxcpSimWKCAAAgAKAFEBSQQmCIYMKhHmFYoa6h7HIr8lKQACAAwAlQHTBbcLNBJvGOgdWiKvJeonFylKKZYoNAACAAUAtgMHC4cTCRxaIzgAAgAHAEoCHwcYDYcT+BnxH8YkPgACAAgA3wHrBQcLphBqFgkcJSExJUUAAgAHAEoCHwcYDYcT+BnxH8YkSwACAAcASgIfBxgNhxP4GfEfxiRRAAIACADfAesFBwumEGoWCRwlITElWAACAAcASgIfBxgNhxP4GfEfxiReAAIABwBKAh8HGA2HE/gZ8R/GJGQAAgAIAN8B6wUHC6YQahYJHCUhMSVrAAIABAAcAwAK1xK4HG4AAgAFAO8HQw8+Ftcc3yJyAAIACgCaBQILIhDsFEsZMh2LIEcjVCWdJnsAAAAAAAIACQD7BsYM3hFxFpEaQx5/ITMkMiYIAAIABQC2AwcLhxMJHFojDAACAAoAUQFJBCYIhgwqEeYVihrqHscivyUVAAIADAD6AEEDSQbJCZQNhxGJFXwZRx3HIM8jFiYgAAIACgBRAUkEJgiGDCoR5hWKGuoexyK/JSkAAgAMAPoAQQNJBskJlA2HEYkVfBlHHccgzyMWJjQAAgAFALYDBwuHEwkcWiM4AAIABAAABV0OsxgQIjsAAgAIAN8B6wUHC6YQahYJHCUhMSVCAAIABwBKAh8HGA2HE/gZ8R/GJEgAAgAEAAAFXQ6zGBAiSwACAAQAAAVdDrMYECJOAAIACADfAesFBwumEGoWCRwlITElVQACAAcASgIfBxgNhxP4GfEfxiRbAAIABAAABV0OsxgQIl4AAgAEAAAFXQ6zGBAiYQACAAgA3wHrBQcLphBqFgkcJSExJWgAAgAHAEoCHwcYDYcT+BnxH8YkbgACAAUAGwUjDIcT7Rr1IXIAAgAKAJoFAgsiEOwUSxkyHYsgRyNUJZ0mewAAAAAAAgAIAN8B6wUHC6YQahYJHCUhMSUHAAIABQC2AwcLhxMJHFojCwACAAsAIAG2Ax8HBws2D4cT2hcJHPEfWiPwJRUAAgAMAPoAQQNJBskJlA2HEYkVfBlHHccgzyMWJiAAAgAKAFEBSQQmCIYMKhHmFYoa6h7HIr8lKQACAAwA+gBBA0kGyQmUDYcRiRV8GUcdxyDPIxYmNAACAAUAtgMHC4cTCRxaIzgAAgAEAAAFXQ6zGBAiOwACAAgA3wHrBQcLphBqFgkcJSExJUIAAgAHAEoCHwcYDYcT+BnxH8YkSAACAAQAAAVdDrMYECJLAAIABAAABV0OsxgQIk4AAgAIAN8B6wUHC6YQahYJHCUhMSVVAAIABwBKAh8HGA2HE/gZ8R/GJFsAAgAEAAAFXQ6zGBAiXgACAAQAAAVdDrMYECJhAAIACADfAesFBwumEGoWCRwlITElaAACAAcASgIfBxgNhxP4GfEfxiRuAAIABQAbBSMMhxPtGvUhcgACAAoAmgUCCyIQ7BRLGTIdiyBHI1QlnSZ7AAAAAAACAAgA3wHrBQcLphBqFgkcJSExJQcAAgAFALYDBwuHEwkcWiMLAAAANAACAAUAtgMHC4cTCRxaIzgAAAA7AAIABAC6CVASWRq3IT4AAgAFAJ8GMA23EzgasCBCAAAARAACAAUAPAiDD2UW5BzZIkgAAgAEAPEHzA+gF2YfSwAAAE4AAgAEALoJUBJZGrchUQACAAUAnwYwDbcTOBqwIFUAAABXAAIABQA8CIMPZRbkHNkiWwACAAQA8QfMD6AXZh9eAAAAYQACAAQAuglQElkatyFkAAIABQCfBjANtxM4GrAgaAAAAGoAAgAFADwIgw9lFuQc2SJuAAEAcgACAAoAmgUCCyIQ7BRLGTIdiyBHI1QlnSZ7AAAAAAACAAgA3wHrBQcLphBqFgkcJSExJQcAAgAFALYDBwuHEwkcWiMLAAAANAACAAUAtgMHC4cTCRxaIzgAAAA7AAIABAC6CVASWRq3IT4AAgAFAJ8GMA23EzgasCBCAAAARAACAAUAPAiDD2UW5BzZIkgAAgAEAPEHzA+gF2YfSwAAAE4AAgAEALoJUBJZGrchUQACAAUAnwYwDbcTOBqwIFUAAABXAAIABQA8CIMPZRbkHNkiWwACAAQA8QfMD6AXZh9eAAAAYQACAAQAuglQElkatyFkAAIABQCfBjANtxM4GrAgaAAAAGoAAgAFADwIgw9lFuQc2SJuAAEAcgACAAoAmgUCCyIQ7BRLGTIdiyBHI1QlnSZ7AAAAAAACADkADwA5AHkAzQAyAaYBJwK1Ak0D7QOXBEgFAAa/BoEHSwgYCekJvgqXC3IMTw0vDhAP8w/ZELwRohKHE24UVBU3Fh0XABjhGMEZnhp5G1IcJx34HcUejx9RIBAhyCF5IiMjwyNbJOkkaiXeJUMmlybXJgEnOAACAAYA3wLACNIPPhdQHjEkPQACAAgA3wHrBQcLphBqFgkcJSExJUQAAgAIAN8B6wUHC6YQahYJHCUhMSVLAAIABgDfAsAI0g8+F1AeMSRQAAIACADfAesFBwumEGoWCRwlITElVwACAAgA3wHrBQcLphBqFgkcJSExJV4AAgAGAN8CwAjSDz4XUB4xJGMAAgAIAN8B6wUHC6YQahYJHCUhMSVqAAIABQBjArsHow5vFq8ebgACAAUAIQiBD3kWBx36InIAAAAAAAIACADfAesFBwumEGoWCRwlITElBwACAAUAtgMHC4cTCRxaIwsAAgALAGMCfAiOEAoZyyAmJ7orai41LywubCsVAAIADAANAmAHmw51FvMdayR+Kf0s2y4gL9wtJCsgAAIACgBRAUkEJgiGDCoR5hWKGuoexyK/JSkAAgAMAA0CYAebDnUW8x1rJH4p/SzbLiAv3C0kKzQAAgAFALYDBwuHEwkcWiM4AAIABgDfAsAI0g8+F1AeMSQ9AAIACADfAesFBwumEGoWCRwlITElRAACAAgA3wHrBQcLphBqFgkcJSExJUsAAgAGAN8CwAjSDz4XUB4xJFAAAgAIAN8B6wUHC6YQahYJHCUhMSVXAAIACADfAesFBwumEGoWCRwlITElXgACAAYA3wLACNIPPhdQHjEkYwACAAgA3wHrBQcLphBqFgkcJSExJWoAAgAFAGMCuwejDm8Wrx5uAAIABQAhCIEPeRYHHfoicgAAAAAAAQAfAAEAPQABAFwAAQB7AAAAAAACACQAXAARAewB3wLhA+4EBAYfB0IIaQmRCr4L7gwfDlEPhRC4Ee0SIxRYFYsWvxfxGCIaUht/HKcdzh7xHwwhIiIvIzEkJCX/JbQmIwACABsAPADaAMEB3wIpBJcFHwfACHIKNAz/DdIPrBGHE2QVPhcRGdwanhxQHvEfeSHnIjEkTyU2JtQmPQACACQAJACDABIByAGdAo0DkgSrBdMGCghLCZYK6QtDDaIOBxBsEdQSPBSkFQkXbhjNGScbehzFHQYfPSBlIX4igyNzJEgl/iWNJuwmYAACABwAOQDNAKYBtQLtA0gFvwZLCOkJlwtPDRAP2RCiEm4UNxYAGMEZeRsnHcUeUSDIISMjWyRqJUMm1yZ7AAAAAAACAB0AggB0AZQCzgMbBXQG1gdBCbEKIwybDRQPjhALEocTBRWCFvwXdRntGl8czx06H5wg9SFCI3wknCWOJhwAAgAiACgAkQAvAfYB3wLkAwAFMAZxB8AIGgp+C+oMXQ7SD00RyRJHFMMVPhezGCYakhv2HFAenx/gIBAiLCMxJBol4SV/JugmPQACAB0ANQDBAI4BjgK2AwAFZQbfB2wJBwusDF0OERDMEYcTRBX/FrMYZBoJHKQdMR+rIBAiWiOCJIIlTybbJlkAAgAjACYAigAgAd8BvQK2A8cE6wUfB2IIrwkHC2YMzA02D6YQFhKHE/oUahbaF0QZqhoJHGEdrh7xHyUhSSJaI1MkMSXwJYYm6iZ7AAAAAAACACAAbwBDAUICWQOCBLcF9AY5CIQJ0gojDHgNzg4nEIAR2xI1FJAV6RZCGJgZ7Ro+HIwd1x4cIFkhjiK3I84kzSWhJh8AAgAfAC8AqwBkAUoCVgOCBMYFHweKCAUKigsYDa4OSRDoEYcTKBXHFmIY+BmGGwsdhh7xH0ohjiK6I8YkrCVlJuEmPQACACAALACiAFEBLAIrA0kEfwXKBiYIkQkHC4YMDQ6aDyoRvhJSFOYVdhcDGYoaCRx/HeoeRiCRIcci5SPkJL8lbibkJlwAAgAgACwAogBRASwCKwNJBH8FygYmCJEJBwuGDA0Omg8qEb4SUhTmFXYXAxmKGgkcfx3qHkYgkSHHIuUj5CS/JW4m5CZ7AAAAAAACACgATgDqAKkBfQJhA08ERQVCBkQHSghTCV4KbQt/DJINpQ67D88Q5hH8EhQUKhVBFlUXaxh+GZEaoxuyHL0dxh7MH84gyyHBIq8jkyRnJSYmwiYnAAIAFwBRACABSgK2A1gFHwcHCQcLGA02D10RhxOzFdoX+BkJHAke8R+4IVojxiTwJb8mPQACACgAHQBtAOQAfQExAv0C3QPPBM4F2gbzBxMJPAptC6IM3Q0bD10QoRHmEioUbxWzFvUXMxluGqMb1Bz9HR0fNiBCIUEiMyMTJN8kkyUsJqMm8yZkAAIAGABLAAwBIgJ4AwAFrwZ8CGAKWAxdDmoQfhKSFKYWsxi4GrAclB5hIBAimCPuJAQmxSZ7AAAAAAACABkAogDJASIDmQQjBrsHXAkFC7MMZQ4aENARhxNAFfYWqxhdGgsctB1VH+0gdyLuI0clbiYYAAIAJgAgAHcA+gCgAWQCQQMyBDYFSQZoB5UIyQkHC0oMlA3iDjQQhxHdEjMUiRXcFi4YfBnGGgkcRx17HqgfxyDaId4izyOsJHAlFiaZJvAmPQACABkARgD6AP4BQQOyBEkG/gfJCagLlA2KD4cRhxOJFYYXfBloG0cdEh/HIF4izyMSJRYmyiZVAAIAJwAfAHIA7wCOAUoCHgMHBAAFCQYfB0AIbAmfCtgLGA1dDqMP7hA6EocT1hQiFm0Xsxj4GTgbcRykHdAe8R8HIRAiCSPyI8YkgiUhJp4m8SZ7AAAAAAABABYAAAAnAAEAPQABAFMAAABkAAEAewAAAAAAAQASAAAAIwABAD0AAQBQAAAAYAABAHsAAAAAAAEAFAAAACEAAQA9AAEAUgAAAF4AAQB7AAAAAAABABgAAAAkAAEAPQABAFUAAABhAAEAewAAAAAA//84AAAAbgD//wAAAQA4AAEAQwABAFYAAQBoAAEAbgAAAAAAAQAQAAEAPQABAE4AAQB7AAAAAAABAD0AAgAXAFEAIAFKArYDWAUfBwcJBwsYDTYPXRGHE7MV2hf4GQkcCR7xH7ghWiPGJPAlvyZTAAIAEwByAI4BHgMABR8HbAnYC10O7hCHEyIWsxg4G6Qd8R8QIvIjgiWeJmUAAQBuAAAAAAABABMAAAAlAAEAPQABAFEAAABiAAEAewAAAAAAAAAIAP//NgAAAEIA//9GAAAAUwD//1kAAABmAP//bAAAAAAA//8IAAAANgD//0IAAABGAP//UwAAAFkA//9mAAAAbAD//wAA//8HAAAAAAABAAcAAgAFABsFIwyHE+0a9SELAAAANAACAAsAIAG2Ax8HBws2D4cT2hcJHPEfWiPwJT4AAAAAAP//BwAAAAAAAQAHAAIABQAbBSMMhxPtGvUhCwAAADQAAgALACABtgMfBwcLNg+HE9oXCRzxH1oj8CU+AAAAAAABAAUAAgAEAA8MuRZGH/kkCAACAAYA3wLACNIPPhdQHjEkDQACAAgA3wHrBQcLphBqFgkcJSExJRQAAgAIAN8B6wUHC6YQahYJHCUhMSUbAAIABgDfAsAI0g8+F1AeMSQgAAIACADfAesFBwumEGoWCRwlITElJwACAAgA3wHrBQcLphBqFgkcJSExJS4AAgAGAN8CwAjSDz4XUB4xJDMAAgACAAcLCRw0AAAAAAABAAUAAgAEAA8MuRZGH/kkCAACAAQAAAVdDrMYECILAAIACADfAesFBwumEGoWCRwlITElEgACAAcASgIfBxgNhxP4GfEfxiQYAAIABAAABV0OsxgQIhsAAgAEAAAFXQ6zGBAiHgACAAgA3wHrBQcLphBqFgkcJSExJSUAAgAHAEoCHwcYDYcT+BnxH8YkKwACAAQAAAVdDrMYECIuAAIABAAABV0OsxgQIjEAAgAEAAAFXQ6zGBAiNAAAAAAAAQAFAAIABAAPDLkWRh/5JAgAAgAEAAAFXQ6zGBAiCwACAAgA3wHrBQcLphBqFgkcJSExJRIAAgAHAEoCHwcYDYcT+BnxH8YkGAACAAQAAAVdDrMYECIbAAIABAAABV0OsxgQIh4AAgAIAN8B6wUHC6YQahYJHCUhMSUlAAIABwBKAh8HGA2HE/gZ8R/GJCsAAgAEAAAFXQ6zGBAiLgACAAQAAAVdDrMYECIxAAIABAAABV0OsxgQIjQAAAAAAAEABQACAAQADwy5FkYf+SQIAAIABAAABV0OsxgQIgsAAgAIAN8B6wUHC6YQahYJHCUhMSUSAAIABwBKAh8HGA2HE/gZ8R/GJBgAAgAEAAAFXQ6zGBAiGwACAAQAAAVdDrMYECIeAAIACADfAesFBwumEGoWCRwlITElJQACAAcASgIfBxgNhxP4GfEfxiQrAAIABAAABV0OsxgQIi4AAgAEAAAFXQ6zGBAiMQACAAQAAAVdDrMYECI0AAAAAAABAAUAAgAEAA8MuRZGH/kkCAACAAcASgIfBxgNhxP4GfEfxiQOAAIACADfAesFBwumEGoWCRwlITElFQACAAcASgIfBxgNhxP4GfEfxiQbAAIABwBKAh8HGA2HE/gZ8R/GJCEAAgAIAN8B6wUHC6YQahYJHCUhMSUoAAIABwBKAh8HGA2HE/gZ8R/GJC4AAgAHAEoCHwcYDYcT+BnxH8YkNAAAAAAAAAAIAAIABQC2AwcLhxMJHFojDAACAAcASgIfBxgNhxP4GfEfxiQSAAIABQD0AiwJxRDOGIkgFgACAAYAJQdBDiIVgxsSIUIlGwACAAUAtgMHC4cTCRxaIx8AAgAHAEoCHwcYDYcT+BnxH8YkJQACAAUA9AIsCcUQzhiJICkAAgAGACUHQQ4iFYMbEiFCJS4AAgAFALYDBwuHEwkcWiMyAAIAAwAfB4cT8R80AAAAAAAAAAgAAgAFALYDBwuHEwkcWiMMAAIABwBKAh8HGA2HE/gZ8R/GJBIAAgAFAPQCLAnFEM4YiSAWAAIABgAlB0EOIhWDGxIhQiUbAAIABQC2AwcLhxMJHFojHwACAAcASgIfBxgNhxP4GfEfxiQlAAIABQD0AiwJxRDOGIkgKQACAAYAJQdBDiIVgxsSIUIlLgACAAUAtgMHC4cTCRxaIzIAAgADAB8HhxPxHzQAAAAAAAEABQACAAQADwy5FkYf+SQIAAAACwACAAQAuglQElkatyEOAAIABQCfBjANtxM4GrAgEgAAABQAAgAFADwIgw9lFuQc2SIYAAIABADxB8wPoBdmHxsAAAAeAAIABAC6CVASWRq3ISEAAgAFAJ8GMA23EzgasCAlAAAAJwACAAUAPAiDD2UW5BzZIisAAgAEAPEHzA+gF2YfLgAAADEAAgAEALoJUBJZGrchNAAAAAAAAQAFAAIABAAPDLkWRh/5JAgAAAALAAIABAC6CVASWRq3IQ4AAgAFAJ8GMA23EzgasCASAAAAFAACAAUAPAiDD2UW5BzZIhgAAgAEAPEHzA+gF2YfGwAAAB4AAgAEALoJUBJZGrchIQACAAUAnwYwDbcTOBqwICUAAAAnAAIABQA8CIMPZRbkHNkiKwACAAQA8QfMD6AXZh8uAAAAMQACAAQAuglQElkatyE0AAAAAAABAAUAAgAEAA8MuRZGH/kkCAACAAcASgIfBxgNhxP4GfEfxiQOAAIACADfAesFBwumEGoWCRwlITElFQACAAcASgIfBxgNhxP4GfEfxiQbAAIABwBKAh8HGA2HE/gZ8R/GJCEAAgAIAN8B6wUHC6YQahYJHCUhMSUoAAIABwBKAh8HGA2HE/gZ8R/GJC4AAgAHAEoCHwcYDYcT+BnxH8YkNAAAAAAAAQAFAAIAAgCaDb4aBgACAAMAuA8NHCQkCAABAAsAAQAOAAEAEgAAABQAAQAYAAEAGwABAB4AAQAhAAEAJQAAACcAAQArAAEALgABADEAAQA0AAAAAAABAAUAAgAEAA8MuRZGH/kkCAACAAsAIAG2Ax8HBws2D4cT2hcJHPEfWiPwJRIAAgAKAFEBSQQmCIYMKhHmFYoa6h7HIr8lGwACAAsAIAG2Ax8HBws2D4cT2hcJHPEfWiPwJSUAAgAKAFEBSQQmCIYMKhHmFYoa6h7HIr8lLgACAAcASgIfBxgNhxP4GfEfxiQ0AAAAAAABAAUAAgAEAA8MuRZGH/kkCAACAAYA3wLACNIPPhdQHjEkDQACAAkAjgEABWwJXQ6HE7MYpB0QIoIlFQACAAcASgIfBxgNhxP4GfEfxiQbAAIABgDfAsAI0g8+F1AeMSQgAAIACQCOAQAFbAldDocTsxikHRAigiUoAAIABwBKAh8HGA2HE/gZ8R/GJC4AAgAGAN8CwAjSDz4XUB4xJDMAAgACAAcLCRw0AAAAAAABAAUAAgAEAA8MuRZGH/kkCAACAAsAIAG2Ax8HBws2D4cT2hcJHPEfWiPwJRIAAgAKAFEBSQQmCIYMKhHmFYoa6h7HIr8lGwACAAsAIAG2Ax8HBws2D4cT2hcJHPEfWiPwJSUAAgAKAFEBSQQmCIYMKhHmFYoa6h7HIr8lLgACAAcASgIfBxgNhxP4GfEfxiQ0AAAAAAABAAUAAgAEAA8MuRZGH/kkCAACAAsAIAG2Ax8HBws2D4cT2hcJHPEfWiPwJRIAAgAKAFEBSQQmCIYMKhHmFYoa6h7HIr8lGwACAAsAIAG2Ax8HBws2D4cT2hcJHPEfWiPwJSUAAgAKAFEBSQQmCIYMKhHmFYoa6h7HIr8lLgACAAcASgIfBxgNhxP4GfEfxiQ0AAAAAAABAAUAAgAEAA8MuRZGH/kkCAACAAQAAAVdDrMYECILAAIACADfAesFBwumEGoWCRwlITElEgACAAcASgIfBxgNhxP4GfEfxiQYAAIABAAABV0OsxgQIhsAAgAEAAAFXQ6zGBAiHgACAAgA3wHrBQcLphBqFgkcJSExJSUAAgAHAEoCHwcYDYcT+BnxH8YkKwACAAQAAAVdDrMYECIuAAIABAAABV0OsxgQIjEAAgAEAAAFXQ6zGBAiNAAAAAAAAQAFAAIABAAPDLkWRh/5JAgAAgAGAN8CwAjSDz4XUB4xJA0AAgAIAN8B6wUHC6YQahYJHCUhMSUUAAIACADfAesFBwumEGoWCRwlITElGwACAAYA3wLACNIPPhdQHjEkIAACAAgA3wHrBQcLphBqFgkcJSExJScAAgAIAN8B6wUHC6YQahYJHCUhMSUuAAIABgDfAsAI0g8+F1AeMSQzAAIAAgAHCwkcNAAAAAAAAAASAAIAAwDBDUAZYyIUAAIABQB2CdARQBmqH6wkGAAAACUAAgADAMENQBljIicAAgAFAHYJ0BFAGaofrCQrAAAAAAABAAUAAgAEAA8MuRZGH/kkCAACAAoAUQFJBCYIhgwqEeYVihrqHscivyURAAIACwAgAbYDHwcHCzYPhxPaFwkc8R9aI/AlGwACAAoAUQFJBCYIhgwqEeYVihrqHscivyUkAAIACwAgAbYDHwcHCzYPhxPaFwkc8R9aI/AlLgACAAcASgIfBxgNhxP4GfEfxiQ0AAAAAAABAAUAAgAEAA8MuRZGH/kkCAACAAYAhQUnDAcTtBnLH7QkDQACAAkAjgEABWwJXQ6HE7MYpB0QIoIlFQACAAcAsgFaBQcKVw8RFRAbKCEbAAIABgCFBScMBxO0GcsftCQgAAIACQCOAQAFbAldDocTsxikHRAigiUoAAIABwCyAVoFBwpXDxEVEBsoIS4AAgAGAIUFJwwHE7QZyx+0JDMAAgACAAcLCRw0AAAAAAABAAUAAgAEAA8MuRZGH/kkCAACAAoAUQFJBCYIhgwqEeYVihrqHscivyURAAIACwAgAbYDHwcHCzYPhxPaFwkc8R9aI/AlGwACAAoAUQFJBCYIhgwqEeYVihrqHscivyUkAAIACwAgAbYDHwcHCzYPhxPaFwkc8R9aI/AlLgACAAcASgIfBxgNhxP4GfEfxiQ0AAAAAAAAAAgAAgAIACQEJQlxDskT/BjcHSwiiCUPAAIACQCOAQAFbAldDocTsxikHRAigiUXAAIABQDDAmIIVw8LFx8fGwACAAgAJAQlCXEOyRP8GNwdLCKIJSIAAgAJAI4BAAVsCV0OhxOzGKQdECKCJSoAAgAFAMMCYghXDwsXHx8uAAIABwC+BHQKdBBpFhUcKiEvJTQAAAAAAAEABQAAAAgAAgAGAN8CwAjSDz4XUB4xJA0AAgAIAN8B6wUHC6YQahYJHCUhMSUUAAIACADfAesFBwumEGoWCRwlITElGwACAAYA3wLACNIPPhdQHjEkIAACAAgA3wHrBQcLphBqFgkcJSExJScAAgAIAN8B6wUHC6YQahYJHCUhMSUuAAIABgDfAsAI0g8+F1AeMSQzAAIAAgAHCwkcNAAAAAAAAgAHAIkB7QRaCXcOGBQbGnMgBgACAAQA5gmLE1AceiMJAAIAAwDzCgYVYx4LAAIAFwCBAukEPQd9Ca0LzQ3eD98R0hO4FY0XVRkKG68cQR6+HyYhdCKmI7gkoyVfJt8mIQACAAQAawNVCu8SnRwkAAIAEQBbAEABhAIRBNYFygfkCR8Mdw7pEHITDxa+GH4bTh4sIRgkNAAAAAAAAgAFAIQCygd3Dg8WTh4EAAIAAwBdDBIY5yEGAAIABADmCYsTUBx6IwkAAgADAPMKBhVjHgsAAgAXAIEC6QQ9B30JrQvNDd4P3xHSE7gVjRdVGQobrxxBHr4fJiF0IqYjuCSjJV8m3yYhAAIABABrA1UK7xKdHCQAAgARAFsAQAGEAhEE1gXKB+QJHwx3DukQchMPFr4YfhtOHiwhGCQ0AAAAAAAAAAgAAgAHAEoCHwcYDYcT+BnxH8YkDgACAAgA3wHrBQcLphBqFgkcJSExJRUAAgAHAEoCHwcYDYcT+BnxH8YkGwACAAcASgIfBxgNhxP4GfEfxiQhAAIACADfAesFBwumEGoWCRwlITElKAACAAcASgIfBxgNhxP4GfEfxiQuAAIABwBKAh8HGA2HE/gZ8R/GJDQAAAAAAAEABQACAAQADwy5FkYf+SQIAAIABwBKAh8HGA2HE/gZ8R/GJA4AAgAIAN8B6wUHC6YQahYJHCUhMSUVAAIABwBKAh8HGA2HE/gZ8R/GJBsAAgAHAEoCHwcYDYcT+BnxH8YkIQACAAgA3wHrBQcLphBqFgkcJSExJSgAAgAHAEoCHwcYDYcT+BnxH8YkLgACAAcASgIfBxgNhxP4GfEfxiQ0AAAAAAABAAUAAgAEAA8MuRZGH/kkCAACAAYA3wLACNIPPhdQHjEkDQACAAgA3wHrBQcLphBqFgkcJSExJRQAAgAIAN8B6wUHC6YQahYJHCUhMSUbAAIABgDfAsAI0g8+F1AeMSQgAAIACADfAesFBwumEGoWCRwlITElJwACAAgA3wHrBQcLphBqFgkcJSExJS4AAgAGAN8CwAjSDz4XUB4xJDMAAgACAAcLCRw0AAAAAAABAAUAAgAEAA8MuRZGH/kkCAACAAYA3wLACNIPPhdQHjEkDQACAAgA3wHrBQcLphBqFgkcJSExJRQAAgAIAN8B6wUHC6YQahYJHCUhMSUbAAIABgDfAsAI0g8+F1AeMSQgAAIACADfAesFBwumEGoWCRwlITElJwACAAgA3wHrBQcLphBqFgkcJSExJS4AAgAGAN8CwAjSDz4XUB4xJDMAAgACAAcLCRw0AAAAAAABAAsAAgAIAN8B6wUHC6YQahYJHCUhMSUSAAIABwBKAh8HGA2HE/gZ8R/GJBgAAgAHAEoCHwcYDYcT+BnxH8YkHgACAAgA3wHrBQcLphBqFgkcJSExJSUAAgAHAEoCHwcYDYcT+BnxH8YkKwAAAAAAAQAFAAIABAAPDLkWRh/5JAgAAgAEAAAFXQ6zGBAiCwACAAgA3wHrBQcLphBqFgkcJSExJRIAAgAHAEoCHwcYDYcT+BnxH8YkGAACAAQAAAVdDrMYECIbAAIABAAABV0OsxgQIh4AAgAIAN8B6wUHC6YQahYJHCUhMSUlAAIABwBKAh8HGA2HE/gZ8R/GJCsAAgAEAAAFXQ6zGBAiLgACAAQAAAVdDrMYECIxAAIABAAABV0OsxgQIjQAAAAAAAEABQACAAQADwy5FkYf+SQIAAIABwBKAh8HGA2HE/gZ8R/GJA4AAgAIAN8B6wUHC6YQahYJHCUhMSUVAAIABwBKAh8HGA2HE/gZ8R/GJBsAAgAHAEoCHwcYDYcT+BnxH8YkIQACAAgA3wHrBQcLphBqFgkcJSExJSgAAgAHAEoCHwcYDYcT+BnxH8YkLgACAAcASgIfBxgNhxP4GfEfxiQ0AAAAAAABAAUAAgAEAA8MuRZGH/kkCAACAAcASgIfBxgNhxP4GfEfxiQOAAIACADfAesFBwumEGoWCRwlITElFQACAAcASgIfBxgNhxP4GfEfxiQbAAIABwBKAh8HGA2HE/gZ8R/GJCEAAgAIAN8B6wUHC6YQahYJHCUhMSUoAAIABwBKAh8HGA2HE/gZ8R/GJC4AAgAHAEoCHwcYDYcT+BnxH8YkNAAAAAAAAAAIAAIACgBNA0UHiAvnD0QUhRiSHE0giSP8JREAAgAJAI4BAAVsCV0OhxOzGKQdECKCJRkAAgADAFoFVw8QGxsAAgAKAE0DRQeIC+cPRBSFGJIcTSCJI/wlJAACAAkAjgEABWwJXQ6HE7MYpB0QIoIlLAACAAMAWgVXDxAbLgACAAcAvgR0CnQQaRYVHCohLyU0AAAAAAABAAUAAgAEAA8MuRZGH/kkCAACAAYA3wLACNIPPhdQHjEkDQACAAkAjgEABWwJXQ6HE7MYpB0QIoIlFQACAAcASgIfBxgNhxP4GfEfxiQbAAIABgDfAsAI0g8+F1AeMSQgAAIACQCOAQAFbAldDocTsxikHRAigiUoAAIABwBKAh8HGA2HE/gZ8R/GJC4AAgAGAN8CwAjSDz4XUB4xJDMAAgACAAcLCRw0AAAAAAABAAYAAgADALgPDRwkJAgAAgAEADYL5hQ9HdIjCwACAAQANgvmFD0d0iMOAAIABQCzBlcN5hNiGsQgEgACAAMAwQ1AGWMiFAACAAUAdgnQEUAZqh+sJBgAAgAEAAgI+Q/MF4AfGwACAAQANgvmFD0d0iMeAAIABAA2C+YUPR3SIyEAAgAFALMGVw3mE2IaxCAlAAIAAwDBDUAZYyInAAIABQB2CdARQBmqH6wkKwACAAQACAj5D8wXgB8uAAIABAA2C+YUPR3SIzEAAgAEADYL5hQ9HdIjNAAAAAAAAQAFAAIAAgB5ECMeBgACAAMAuA8NHCQkCAACAAQANgvmFD0d0iMLAAIABAA2C+YUPR3SIw4AAgAFALMGVw3mE2IaxCASAAIAAwDBDUAZYyIUAAIABQB2CdARQBmqH6wkGAACAAQACAj5D8wXgB8bAAIABAA2C+YUPR3SIx4AAgAEADYL5hQ9HdIjIQACAAUAswZXDeYTYhrEICUAAgADAMENQBljIicAAgAFAHYJ0BFAGaofrCQrAAIABAAICPkPzBeAHy4AAgAEADYL5hQ9HdIjMQACAAQANgvmFD0d0iM0AAAAAAABAAUAAgAEAA8MuRZGH/kkCAACAAQANgvmFD0d0iMLAAIABAA2C+YUPR3SIw4AAgAFALMGVw3mE2IaxCASAAIAAwDBDUAZYyIUAAIABQB2CdARQBmqH6wkGAACAAQACAj5D8wXgB8bAAIABAA2C+YUPR3SIx4AAgAEADYL5hQ9HdIjIQACAAUAswZXDeYTYhrEICUAAgADAMENQBljIicAAgAFAHYJ0BFAGaofrCQrAAIABAAICPkPzBeAHy4AAgAEADYL5hQ9HdIjMQACAAQANgvmFD0d0iM0AAAAAAABAAUAAgAEAA8MuRZGH/kkCAACAAQANgvmFD0d0iMLAAIABAA2C+YUPR3SIw4AAgAFALMGVw3mE2IaxCASAAIAAwDBDUAZYyIUAAIABQB2CdARQBmqH6wkGAACAAQACAj5D8wXgB8bAAIABAA2C+YUPR3SIx4AAgAEADYL5hQ9HdIjIQACAAUAswZXDeYTYhrEICUAAgADAMENQBljIicAAgAFAHYJ0BFAGaofrCQrAAIABAAICPkPzBeAHy4AAgAEADYL5hQ9HdIjMQACAAQANgvmFD0d0iM0AAAAAAABAAUAAgAEAA8MuRZGH/kkCAACAAoAUQFJBCYIhgwqEeYVihrqHscivyURAAIACwAgAbYDHwcHCzYPhxPaFwkc8R9aI/AlGwACAAoAUQFJBCYIhgwqEeYVihrqHscivyUkAAIACwAgAbYDHwcHCzYPhxPaFwkc8R9aI/AlLgACAAcASgIfBxgNhxP4GfEfxiQ0AAAAAAABAAUAAgAEAA8MuRZGH/kkCAACAAoAUQFJBCYIhgwqEeYVihrqHscivyURAAIACwAgAbYDHwcHCzYPhxPaFwkc8R9aI/AlGwACAAoAUQFJBCYIhgwqEeYVihrqHscivyUkAAIACwAgAbYDHwcHCzYPhxPaFwkc8R9aI/AlLgACAAcASgIfBxgNhxP4GfEfxiQ0AAAAAAACAAwAtwBvAswEmQe4ChMOlhE4FecYmxxCIMcjCwACABgASwAMASICeAMABa8GfAhgClgMXQ5qEH4SkhSmFrMYuBqwHJQeYSAQIpgj7iQEJsUmIgACAAMAGQXXDogaJAACABEAigDfAbYD6wViCAcLzA2mEIcTahZEGQkcrh4lIVojMSWGJjQAAAAAAAIABQDLApwI0A+sF6gfBAACAAMAQA3bGEAiBgACAAYAxQcCD7kV0BsYIS0lCwACABgASwAMASICeAMABa8GfAhgClgMXQ5qEH4SkhSmFrMYuBqwHJQeYSAQIpgj7iQEJsUmIgACAAMAGQXXDogaJAACABEAigDfAbYD6wViCAcLzA2mEIcTahZEGQkcrh4lIVojMSWGJjQAAAAAAAEABQACAAQADwy5FkYf+SQIAAIABAAABV0OsxgQIgsAAgAIAN8B6wUHC6YQahYJHCUhMSUSAAIABwBKAh8HGA2HE/gZ8R/GJBgAAgAEAAAFXQ6zGBAiGwACAAQAAAVdDrMYECIeAAIACADfAesFBwumEGoWCRwlITElJQACAAcASgIfBxgNhxP4GfEfxiQrAAIABAAABV0OsxgQIi4AAgAEAAAFXQ6zGBAiMQACAAQAAAVdDrMYECI0AAAAAAABAAUAAgAEAA8MuRZGH/kkCAABAA4AAQAUAAEAGwABACEAAQAnAAEALgABADQAAAAAAAEABQACAAQADwy5FkYf+SQIAAIABAAABV0OsxgQIgsAAgAIAN8B6wUHC6YQahYJHCUhMSUSAAIABwBKAh8HGA2HE/gZ8R/GJBgAAgAEAAAFXQ6zGBAiGwACAAQAAAVdDrMYECIeAAIACADfAesFBwumEGoWCRwlITElJQACAAcASgIfBxgNhxP4GfEfxiQrAAIABAAABV0OsxgQIi4AAgAEAAAFXQ6zGBAiMQACAAQAAAVdDrMYECI0AAAAAAABAAUAAgAEAA8MuRZGH/kkCAACAAYA3wLACNIPPhdQHjEkDQACAAkAjgEABWwJXQ6HE7MYpB0QIoIlFQACAAcASgIfBxgNhxP4GfEfxiQbAAIABgDfAsAI0g8+F1AeMSQgAAIACQCOAQAFbAldDocTsxikHRAigiUoAAIABwBKAh8HGA2HE/gZ8R/GJC4AAgAGAN8CwAjSDz4XUB4xJDMAAgACAAcLCRw0AAAAAAABAAgAAgAEAEwIXxA0GMYfCwACAAgAeQPXB7QMyxHpFtsbaiBNJBIAAgAHABsF2QrdENgWhRyKIWIlGAACAAQA2gETBzwP/xkbAAIABABMCF8QNBjGHx4AAgAIAHkD1we0DMsR6RbbG2ogTSQlAAIABwAbBdkK3RDYFoUciiFiJSsAAgAEANoBEwc8D/8ZLgACAAQATAhfEDQYxh8xAAIABADqBr8P7BhCITQAAAAAAAEABQACAAQADwy5FkYf+SQIAAIABABMCF8QNBjGHwsAAgAIAHkD1we0DMsR6RbbG2ogTSQSAAIABwAbBdkK3RDYFoUciiFiJRgAAgAEANoBEwc8D/8ZGwACAAQATAhfEDQYxh8eAAIACAB5A9cHtAzLEekW2xtqIE0kJQACAAcAGwXZCt0Q2BaFHIohYiUrAAIABADaARMHPA//GS4AAgAEAEwIXxA0GMYfMQACAAQA6ga/D+wYQiE0AAAAAAABAAUAAgAEAA8MuRZGH/kkCAACAAYA3wLACNIPPhdQHjEkDQACAAgA3wHrBQcLphBqFgkcJSExJRQAAgAIAN8B6wUHC6YQahYJHCUhMSUbAAIABgDfAsAI0g8+F1AeMSQgAAIACADfAesFBwumEGoWCRwlITElJwACAAgA3wHrBQcLphBqFgkcJSExJS4AAgAGAN8CwAjSDz4XUB4xJDMAAgACAAcLCRw0AAAAAAABAAUAAgAEAA8MuRZGH/kkCAACAAQAAAVdDrMYECILAAIACADfAesFBwumEGoWCRwlITElEgACAAcASgIfBxgNhxP4GfEfxiQYAAIABAAABV0OsxgQIhsAAgAEAAAFXQ6zGBAiHgACAAgA3wHrBQcLphBqFgkcJSExJSUAAgAHAEoCHwcYDYcT+BnxH8YkKwACAAQAAAVdDrMYECIuAAIABAAABV0OsxgQIjEAAgAEAAAFXQ6zGBAiNAAAAAAAAAAIAAIACAAkBCUJcQ7JE/wY3B0sIoglDwACAAkAjgEABWwJXQ6HE7MYpB0QIoIlFwACAAUAtgMHC4cTCRxaIxsAAgAIACQEJQlxDskT/BjcHSwiiCUiAAIACQCOAQAFbAldDocTsxikHRAigiUqAAIABQC2AwcLhxMJHFojLgACAAcAvgR0CnQQaRYVHCohLyU0AAAAAAAAABIAAgADAMENQBljIhQAAgAFAHYJ0BFAGaofrCQYAAAAJQACAAMAwQ1AGWMiJwACAAUAdgnQEUAZqh+sJCsAAAAAAAAAEgACAAMAwQ1AGWMiFAACAAUAdgnQEUAZqh+sJBgAAAAlAAIAAwDBDUAZYyInAAIABQB2CdARQBmqH6wkKwAAAAAAAQAFAAIABAAPDLkWRh/5JAgAAgAEAAAFXQ6zGBAiCwACAAgA3wHrBQcLphBqFgkcJSExJRIAAgAHAEoCHwcYDYcT+BnxH8YkGAACAAQAAAVdDrMYECIbAAIABAAABV0OsxgQIh4AAgAIAN8B6wUHC6YQahYJHCUhMSUlAAIABwBKAh8HGA2HE/gZ8R/GJCsAAgAEAAAFXQ6zGBAiLgACAAQAAAVdDrMYECIxAAIABAAABV0OsxgQIjQAAAAAAAEABQACAAQADwy5FkYf+SQIAAIABgDfAsAI0g8+F1AeMSQNAAIACQCOAQAFbAldDocTsxikHRAigiUVAAIABwBKAh8HGA2HE/gZ8R/GJBsAAgAGAN8CwAjSDz4XUB4xJCAAAgAJAI4BAAVsCV0OhxOzGKQdECKCJSgAAgAHAEoCHwcYDYcT+BnxH8YkLgACAAYA3wLACNIPPhdQHjEkMwACAAIABwsJHDQAAAAAAAEABQACAAQADwy5FkYf+SQIAAIABgDfAsAI0g8+F1AeMSQNAAIACQCOAQAFbAldDocTsxikHRAigiUVAAIABwBKAh8HGA2HE/gZ8R/GJBsAAgAGAN8CwAjSDz4XUB4xJCAAAgAJAI4BAAVsCV0OhxOzGKQdECKCJSgAAgAHAEoCHwcYDYcT+BnxH8YkLgACAAYA3wLACNIPPhdQHjEkMwACAAIABwsJHDQAAAAAAAEABQACAAQADwy5FkYf+SQIAAIABwBKAh8HGA2HE/gZ8R/GJA4AAgAIAN8B6wUHC6YQahYJHCUhMSUVAAIABwBKAh8HGA2HE/gZ8R/GJBsAAgAHAEoCHwcYDYcT+BnxH8YkIQACAAgA3wHrBQcLphBqFgkcJSExJSgAAgAHAEoCHwcYDYcT+BnxH8YkLgACAAcASgIfBxgNhxP4GfEfxiQ0AAAAAAABAAUAAgAEAA8MuRZGH/kkCAACAAcASgIfBxgNhxP4GfEfxiQOAAIACADfAesFBwumEGoWCRwlITElFQACAAcASgIfBxgNhxP4GfEfxiQbAAIABwBKAh8HGA2HE/gZ8R/GJCEAAgAIAN8B6wUHC6YQahYJHCUhMSUoAAIABwBKAh8HGA2HE/gZ8R/GJC4AAgAHAEoCHwcYDYcT+BnxH8YkNAAAAAAAAQAFAAIABAAPDLkWRh/5JAgAAgAGAN8CwAjSDz4XUB4xJA0AAgAJAI4BAAVsCV0OhxOzGKQdECKCJRUAAgAHAEoCHwcYDYcT+BnxH8YkGwACAAYA3wLACNIPPhdQHjEkIAACAAkAjgEABWwJXQ6HE7MYpB0QIoIlKAACAAcASgIfBxgNhxP4GfEfxiQuAAIABgDfAsAI0g8+F1AeMSQzAAIAAgAHCwkcNAAAAAAAAQAFAAIABAAPDLkWRh/5JAgAAgAHAEoCHwcYDYcT+BnxH8YkDgACAAgA3wHrBQcLphBqFgkcJSExJRUAAgAHAEoCHwcYDYcT+BnxH8YkGwACAAcASgIfBxgNhxP4GfEfxiQhAAIACADfAesFBwumEGoWCRwlITElKAACAAcASgIfBxgNhxP4GfEfxiQuAAIABwBKAh8HGA2HE/gZ8R/GJDQAAAAAAAEABQACAAQADwy5FkYf+SQIAAIABAAABV0OsxgQIgsAAgAIAN8B6wUHC6YQahYJHCUhMSUSAAIABwBKAh8HGA2HE/gZ8R/GJBgAAgAEAAAFXQ6zGBAiGwACAAQAAAVdDrMYECIeAAIACADfAesFBwumEGoWCRwlITElJQACAAcASgIfBxgNhxP4GfEfxiQrAAIABAAABV0OsxgQIi4AAgAEAAAFXQ6zGBAiMQACAAQAAAVdDrMYECI0AAAAAAABAAUAAgAEAA8MuRZGH/kkCAACAAYA3wLACNIPPhdQHjEkDQACAAgA3wHrBQcLphBqFgkcJSExJRQAAgAIAN8B6wUHC6YQahYJHCUhMSUbAAIABgDfAsAI0g8+F1AeMSQgAAIACADfAesFBwumEGoWCRwlITElJwACAAgA3wHrBQcLphBqFgkcJSExJS4AAgAGAN8CwAjSDz4XUB4xJDMAAgACAAcLCRw0AAAAAAABAAUAAgACAJoNvhoGAAIAAwC4Dw0cJCQIAAIABAA2C+YUPR3SIwsAAgAEADYL5hQ9HdIjDgACAAUAswZXDeYTYhrEIBIAAgADAMENQBljIhQAAgAFAHYJ0BFAGaofrCQYAAIABAAICPkPzBeAHxsAAgAEADYL5hQ9HdIjHgACAAQANgvmFD0d0iMhAAIABQCzBlcN5hNiGsQgJQACAAMAwQ1AGWMiJwACAAUAdgnQEUAZqh+sJCsAAgAEAAgI+Q/MF4AfLgACAAQANgvmFD0d0iMxAAIABAA2C+YUPR3SIzQAAAAAAAEABQACAAQADwy5FkYf+SQIAAIABAAABV0OsxgQIgsAAgAIAN8B6wUHC6YQahYJHCUhMSUSAAIABwBKAh8HGA2HE/gZ8R/GJBgAAgAEAAAFXQ6zGBAiGwACAAQAAAVdDrMYECIeAAIACADfAesFBwumEGoWCRwlITElJQACAAcASgIfBxgNhxP4GfEfxiQrAAIABAAABV0OsxgQIi4AAgAEAAAFXQ6zGBAiMQACAAQAAAVdDrMYECI0AAAAAAABAAUAAgAEAA8MuRZGH/kkCAACAAYAhQUnDAcTtBnLH7QkDQACAAkAjgEABWwJXQ6HE7MYpB0QIoIlFQACAAcAsgFaBQcKVw8RFRAbKCEbAAIABgCFBScMBxO0GcsftCQgAAIACQCOAQAFbAldDocTsxikHRAigiUoAAIABwCyAVoFBwpXDxEVEBsoIS4AAgAGAIUFJwwHE7QZyx+0JDMAAgACAAcLCRw0AAAAAAABAAUAAgAEAA8MuRZGH/kkCAACAAQANgvmFD0d0iMLAAIACAB1BloM0BHgFoQbqh80I+AlEgACAAMAwQ1AGWMiFAACAAUAdgnQEUAZqh+sJBgAAgAEAAgI+Q/MF4AfGwACAAQANgvmFD0d0iMeAAIACAB1BloM0BHgFoQbqh80I+AlJQACAAMAwQ1AGWMiJwACAAUAdgnQEUAZqh+sJCsAAgAEAAgI+Q/MF4AfLgACAAQANgvmFD0d0iMxAAIABAA2C+YUPR3SIzQAAAAAAAEACwACAAgAdQZaDNAR4BaEG6ofNCPgJRIAAgADAMENQBljIhQAAgALAOgEdgnBDdARpRVAGZkcqh9jIqwkWSYeAAIACAB1BloM0BHgFoQbqh80I+AlJQACAAMAwQ1AGWMiJwAAAAAAAQAFAAIABAAPDLkWRh/5JAgAAgAEAAAFXQ6zGBAiCwACAAgA3wHrBQcLphBqFgkcJSExJRIAAgAHAEoCHwcYDYcT+BnxH8YkGAACAAQAAAVdDrMYECIbAAIABAAABV0OsxgQIh4AAgAIAN8B6wUHC6YQahYJHCUhMSUlAAIABwBKAh8HGA2HE/gZ8R/GJCsAAgAEAAAFXQ6zGBAiLgACAAQAAAVdDrMYECIxAAIABAAABV0OsxgQIjQAAAAAAAAAAwACAAQAWAo5FBAd9CMGAAIABgDfAsAI0g8+F1AeMSQLAAAAAAABAAUAAgAEAA8MuRZGH/kkCAACAAcASgIfBxgNhxP4GfEfxiQOAAIACADfAesFBwumEGoWCRwlITElFQACAAcASgIfBxgNhxP4GfEfxiQbAAIABwBKAh8HGA2HE/gZ8R/GJCEAAgAIAN8B6wUHC6YQahYJHCUhMSUoAAIABwBKAh8HGA2HE/gZ8R/GJC4AAgAHAEoCHwcYDYcT+BnxH8YkNAAAAAAAAQAFAAIABAAPDLkWRh/5JAgAAgALACABtgMfBwcLNg+HE9oXCRzxH1oj8CUSAAIACgBRAUkEJgiGDCoR5hWKGuoexyK/JRsAAgALACABtgMfBwcLNg+HE9oXCRzxH1oj8CUlAAIACgBRAUkEJgiGDCoR5hWKGuoexyK/JS4AAgAHAEoCHwcYDYcT+BnxH8YkNAAAAAAAAQAFAAIABAAPDLkWRh/5JAgAAgAEAAAFXQ6zGBAiCwACAAgA3wHrBQcLphBqFgkcJSExJRIAAgAHAEoCHwcYDYcT+BnxH8YkGAACAAQAAAVdDrMYECIbAAIABAAABV0OsxgQIh4AAgAIAN8B6wUHC6YQahYJHCUhMSUlAAIABwBKAh8HGA2HE/gZ8R/GJCsAAgAEAAAFXQ6zGBAiLgACAAQAAAVdDrMYECIxAAIABAAABV0OsxgQIjQAAAAAAAEABQACAAQADwy5FkYf+SQIAAIABAAABV0OsxgQIgsAAgAIAN8B6wUHC6YQahYJHCUhMSUSAAIABwBKAh8HGA2HE/gZ8R/GJBgAAgAEAAAFXQ6zGBAiGwACAAQAAAVdDrMYECIeAAIACADfAesFBwumEGoWCRwlITElJQACAAcASgIfBxgNhxP4GfEfxiQrAAIABAAABV0OsxgQIi4AAgAEAAAFXQ6zGBAiMQACAAQAAAVdDrMYECI0AAAAAAAAAAgAAgAKAE0DRQeIC+cPRBSFGJIcTSCJI/wlEQACAAkAJgG8AyAHDAtXD+cTpRh/HV4iGQACAAMAWgVXDxAbGwACAAoATQNFB4gL5w9EFIUYkhxNIIkj/CUkAAIACQAmAbwDIAcMC1cP5xOlGH8dXiIsAAIAAwBaBVcPEBsuAAIABwC+BHQKdBBpFhUcKiEvJTQAAAAAAAEABQACAAQADwy5FkYf+SQIAAIABAAABV0OsxgQIgsAAgAIAN8B6wUHC6YQahYJHCUhMSUSAAIABwBKAh8HGA2HE/gZ8R/GJBgAAgAEAAAFXQ6zGBAiGwACAAQAAAVdDrMYECIeAAIACADfAesFBwumEGoWCRwlITElJQACAAcASgIfBxgNhxP4GfEfxiQrAAIABAAABV0OsxgQIi4AAgAEAAAFXQ6zGBAiMQACAAQAAAVdDrMYECI0AAAAAAABAAUAAgAEAA8MuRZGH/kkCAACAAYA3wLACNIPPhdQHjEkDQACAAkAjgEABWwJXQ6HE7MYpB0QIoIlFQACAAcASgIfBxgNhxP4GfEfxiQbAAIABgDfAsAI0g8+F1AeMSQgAAIACQCOAQAFbAldDocTsxikHRAigiUoAAIABwBKAh8HGA2HE/gZ8R/GJC4AAgAGAN8CwAjSDz4XUB4xJDMAAgACAAcLCRw0AAAAAAABAAUAAgAEAA8MuRZGH/kkCAACAAYA3wLACNIPPhdQHjEkDQACAAgA3wHrBQcLphBqFgkcJSExJRQAAgAIAN8B6wUHC6YQahYJHCUhMSUbAAIABgDfAsAI0g8+F1AeMSQgAAIACADfAesFBwumEGoWCRwlITElJwACAAgA3wHrBQcLphBqFgkcJSExJS4AAgAGAN8CwAjSDz4XUB4xJDMAAgACAAcLCRw0AAAAAAABAAUAAgAEAA8MuRZGH/kkCAACAAcAUgbvC0QRZRZPG/YfMCQOAAAAFAACAAgAbgTRCDANixHiFTgaiR7UIhsAAgAHAFIG7wtEEWUWTxv2HzAkIQAAACcAAgAIAG4E0QgwDYsR4hU4Goke1CIuAAIABwBSBu8LRBFlFk8b9h8wJDQAAAAAAAEABQACAAQADwy5FkYf+SQIAAIABwBSBu8LRBFlFk8b9h8wJA4AAAAUAAIACABuBNEIMA2LEeIVOBqJHtQiGwACAAcAUgbvC0QRZRZPG/YfMCQhAAAAJwACAAgAbgTRCDANixHiFTgaiR7UIi4AAgAHAFIG7wtEEWUWTxv2HzAkNAAAAAAAAQAFAAIABAAPDLkWRh/5JAgAAgAHAEoCHwcYDYcT+BnxH8YkDgACAAgA3wHrBQcLphBqFgkcJSExJRUAAgAHAEoCHwcYDYcT+BnxH8YkGwACAAcASgIfBxgNhxP4GfEfxiQhAAIACADfAesFBwumEGoWCRwlITElKAACAAcASgIfBxgNhxP4GfEfxiQuAAIABwBKAh8HGA2HE/gZ8R/GJDQAAAAAAAEABQACAAQADwy5FkYf+SQIAAIABAAABV0OsxgQIgsAAgAIAN8B6wUHC6YQahYJHCUhMSUSAAIABwBKAh8HGA2HE/gZ8R/GJBgAAgAEAAAFXQ6zGBAiGwACAAQAAAVdDrMYECIeAAIACADfAesFBwumEGoWCRwlITElJQACAAcASgIfBxgNhxP4GfEfxiQrAAIABAAABV0OsxgQIi4AAgAEAAAFXQ6zGBAiMQACAAQAAAVdDrMYECI0AAAAAAAAAAgAAgAGAN8CwAjSDz4XUB4xJA0AAgAIAN8B6wUHC6YQahYJHCUhMSUUAAIACADfAesFBwumEGoWCRwlITElGwACAAYA3wLACNIPPhdQHjEkIAACAAgA3wHrBQcLphBqFgkcJSExJScAAgAIAN8B6wUHC6YQahYJHCUhMSUuAAIABgDfAsAI0g8+F1AeMSQzAAIAAgAHCwkcNAAAAAAAAAAFAAIABAAPDLkWRh/5JAgAAgAGAN8CwAjSDz4XUB4xJA0AAgAIAN8B6wUHC6YQahYJHCUhMSUUAAIACADfAesFBwumEGoWCRwlITElGwACAAYA3wLACNIPPhdQHjEkIAACAAgA3wHrBQcLphBqFgkcJSExJScAAgAIAN8B6wUHC6YQahYJHCUhMSUuAAIABgDfAsAI0g8+F1AeMSQzAAIAAgAHCwkcNAAAAAAAAQAFAAIABAAPDLkWRh/5JAgAAgAEAAAFXQ6zGBAiCwACAAgA3wHrBQcLphBqFgkcJSExJRIAAgADAB8HhxPxHxQAAgAIAN8B6wUHC6YQahYJHCUhMSUbAAIABAAABV0OsxgQIh4AAgAIAN8B6wUHC6YQahYJHCUhMSUlAAIAAwAfB4cT8R8nAAIACADfAesFBwumEGoWCRwlITElLgACAAQAAAVdDrMYECIxAAIABAAABV0OsxgQIjQAAAAAAAEABQACAAQADwy5FkYf+SQIAAIABAAABV0OsxgQIgsAAgAIAN8B6wUHC6YQahYJHCUhMSUSAAIAAwAfB4cT8R8UAAIACADfAesFBwumEGoWCRwlITElGwACAAQAAAVdDrMYECIeAAIACADfAesFBwumEGoWCRwlITElJQACAAMAHweHE/EfJwACAAgA3wHrBQcLphBqFgkcJSExJS4AAgAEAAAFXQ6zGBAiMQACAAQAAAVdDrMYECI0AAAAAAABAAUAAgAEAA8MuRZGH/kkCAACAAYA3wLACNIPPhdQHjEkDQACAAgA3wHrBQcLphBqFgkcJSExJRQAAgAIAN8B6wUHC6YQahYJHCUhMSUbAAIABgDfAsAI0g8+F1AeMSQgAAIACADfAesFBwumEGoWCRwlITElJwACAAgA3wHrBQcLphBqFgkcJSExJS4AAgAGAN8CwAjSDz4XUB4xJDMAAgACAAcLCRw0AAAAAAABAAUAAgAEAA8MuRZGH/kkCAACAAcASgIfBxgNhxP4GfEfxiQOAAIACADfAesFBwumEGoWCRwlITElFQACAAcASgIfBxgNhxP4GfEfxiQbAAIABwBKAh8HGA2HE/gZ8R/GJCEAAgAIAN8B6wUHC6YQahYJHCUhMSUoAAIABwBKAh8HGA2HE/gZ8R/GJC4AAgAHAEoCHwcYDYcT+BnxH8YkNAAAAAAAAAAFAAIABAAPDLkWRh/5JAgAAgAEAAAFXQ6zGBAiCwACAAgA3wHrBQcLphBqFgkcJSExJRIAAgAHAEoCHwcYDYcT+BnxH8YkGAACAAQAAAVdDrMYECIbAAIABAAABV0OsxgQIh4AAgAIAN8B6wUHC6YQahYJHCUhMSUlAAIABwBKAh8HGA2HE/gZ8R/GJCsAAgAEAAAFXQ6zGBAiLgACAAQAAAVdDrMYECIxAAIABAAABV0OsxgQIjQAAAAAAAEABQACAAIAmg2+GgYAAgADALgPDRwkJAgAAQALAAEADgABABIAAQAUAAEAGAABABsAAQAeAAEAIQABACUAAQAnAAEAKwABAC4AAQAxAAEANAAAAAAAAQAFAAIABAAPDLkWRh/5JAgAAgAGAN8CwAjSDz4XUB4xJA0AAgAJAI4BAAVsCV0OhxOzGKQdECKCJRUAAgAHAEoCHwcYDYcT+BnxH8YkGwACAAYA3wLACNIPPhdQHjEkIAACAAkAjgEABWwJXQ6HE7MYpB0QIoIlKAACAAcASgIfBxgNhxP4GfEfxiQuAAIABgDfAsAI0g8+F1AeMSQzAAIAAgAHCwkcNAAAAAAAAgAHAIkB7QRaCXcOGBQbGnMgBgACAAYAEAcbDtwUJButIAclCwAAAAAAAQAIAAEADQABABMAAQAzAAEANAAAAAAAAQAIAAEADQABABMAAQAzAAEANAAAAAAAAQAFAAEADQABABMAAAAAAAEAGQABACMAAQAsAAEANAAAAAAAAQAFAAEADQABABMAAAAZAAEAIwABACwAAQA0AAAAAAABACMAAQA0AAAAAAACACkAHABoANoAbQEbAt8CtgOfBJcFmgaoB8AI3wkHCzQMZA2bDtIPDRFLEocTxRQDFj4XdRisGdwaCRwxHVAeaB92IHkhcSJaIzEk9SSjJTYmqCb0JigAAgANAGoAhQErA0IFtwd4CnoNshAbFKsXXhstHxQjNAAAAAAAAgAhACoAmQA/ARACBAMVBD4FewbJByUJjAr9C3gN9g56EAAShxMQFZYWGhiYGRMbhBzrHUcflSDSIfsiDCQAJdEldybmJiAAAgAVADUAxACcAbAC9gNnBf0GsgiDCmoMZg50EJESuxTvFi4ZdRvCHREgZSK7JDQAAAAAAAIAJAAkAIMAEgHIAZ0CjQOSBKsF0wYKCEsJlgrpC0MNog4HEGwR1BI8FKQVCRduGM0ZJxt6HMUdBh89IGUhfiKDI3MkSCX+JY0m7CYjAAIAEgBCAPYAAwJaA+4EtQapCMEK+QxMD7gRNxTJFmcZFBzKHochSSQ0AAAAAAACAC0AGABXALkANwHMAXYCMQP8A9QEtwWlBpwHmwihCawKvQvSDOsNBw8lEEYRZhKHE6oUyhXrFgkYJRk+GlMbZBxvHXUedB9rIFkhPCIUI98jmiREJdklVya5JvgmLAACAAkArgCAAjgFqQiyDDsRMRaEGychNAAAAAAAAgAcADkAzQCmAbUC7QNIBb8GSwjpCZcLTw0QD9kQohJuFDcWABjBGXkbJx3FHlEgyCEjI1skaiVDJtcmGwACABoAJgCPAC0B+QHsAgAEMAV4BtcHSQnKCloM+A2gD1IRDRPPFJcWZRg1Ggoc4B24H48haCM9JTQAAAAAAAEAGQAAAAAAAQAVAAAAAAABABcAAAAAAAEAGwAAAAAA//8IAAAAAAABAAgAAQATAAAAAAABABMAAAAAAP//BQAAAAAAAQAFAAEADQACABcAUQAgAUoCtgNYBR8HBwkHCxgNNg9dEYcTsxXaF/gZCRwJHvEfuCFaI8Yk8CW/JiMAAgASAH0AswFlA24FtwctCsMMbw8qEuYUoRdNGuMcWR+iIasjXSWTJjQAAAAAAAEAFgAAAAAAAAASAP//GwAAACUA//8uAAAAAAD//xIAAAAbAP//JQAAAC4A//8AAP//BQAAAAAAAQAFAAAAAAD//wUAAAAAAAEABQAAAAAAAgAEALoJUBJZGrchAwACAAUAswZXDeYTYhrEIAcAAgADAMENQBljIgkAAgAFAHYJ0BFAGaofrCQNAAIABAAICPkPzBeAHxAAAgAEADYL5hQ9HdIjEwACAAQANgvmFD0d0iMWAAIABQCzBlcN5hNiGsQgGgACAAMAwQ1AGWMiHAACAAUAdgnQEUAZqh+sJCAAAgAEAAgI+Q/MF4AfIwACAAQANgvmFD0d0iMmAAAAAAABAAIAAgAIAN8B6wUHC6YQahYJHCUhMSUJAAIACADfAesFBwumEGoWCRwlITElEAACAAYA3wLACNIPPhdQHjEkFQACAAgA3wHrBQcLphBqFgkcJSExJRwAAgAIAN8B6wUHC6YQahYJHCUhMSUjAAIABAAABV0OsxgQIiYAAAAAAAEAAwABAAkAAQAQAAEAFgABABwAAQAjAAEAJgAAAAAAAQACAAIACADfAesFBwumEGoWCRwlITElCQACAAgA3wHrBQcLphBqFgkcJSExJRAAAgAGAN8CwAjSDz4XUB4xJBUAAgAIAN8B6wUHC6YQahYJHCUhMSUcAAIACADfAesFBwumEGoWCRwlITElIwAAAAAAAQACAAIACADfAesFBwumEGoWCRwlITElCQACAAgA3wHrBQcLphBqFgkcJSExJRAAAgAGAN8CwAjSDz4XUB4xJBUAAgAIAN8B6wUHC6YQahYJHCUhMSUcAAIACADfAesFBwumEGoWCRwlITElIwACAAQAAAVdDrMYECImAAAAAAACAAQAuglQElkatyEDAAIABQCzBlcN5hNiGsQgBwACAAMAwQ1AGWMiCQACAAUAdgnQEUAZqh+sJA0AAgAEAAgI+Q/MF4AfEAACAAQANgvmFD0d0iMTAAIABAA2C+YUPR3SIxYAAgAFALMGVw3mE2IaxCAaAAIAAwDBDUAZYyIcAAIABQB2CdARQBmqH6wkIAACAAQACAj5D8wXgB8jAAAAAAACAAQAuglQElkatyEDAAIABQCzBlcN5hNiGsQgBwACAAMAwQ1AGWMiCQACAAUAdgnQEUAZqh+sJA0AAgAEAAgI+Q/MF4AfEAACAAQANgvmFD0d0iMTAAIABAA2C+YUPR3SIxYAAgAFALMGVw3mE2IaxCAaAAIAAwDBDUAZYyIcAAIABQB2CdARQBmqH6wkIAACAAQACAj5D8wXgB8jAAIABAA2C+YUPR3SIyYAAAAAAAIABAC6CVASWRq3IQMAAgAFALMGVw3mE2IaxCAHAAIAAwDBDUAZYyIJAAIABQB2CdARQBmqH6wkDQACAAQACAj5D8wXgB8QAAIABAA2C+YUPR3SIxMAAgAEADYL5hQ9HdIjFgACAAUAswZXDeYTYhrEIBoAAgADAMENQBljIhwAAgAFAHYJ0BFAGaofrCQgAAIABAAICPkPzBeAHyMAAgAEADYL5hQ9HdIjJgAAAAAAAgAEALoJUBJZGrchAwACAAUAswZXDeYTYhrEIAcAAgADAMENQBljIgkAAgAFAHYJ0BFAGaofrCQNAAIABAAICPkPzBeAHxAAAgAEADYL5hQ9HdIjEwACAAQANgvmFD0d0iMWAAIABQCzBlcN5hNiGsQgGgACAAMAwQ1AGWMiHAACAAUAdgnQEUAZqh+sJCAAAgAEAAgI+Q/MF4AfIwACAAQANgvmFD0d0iMmAAAAAAACAAgA+gJgByMMDREDFu0asB8WJAcAAgADAB8HhxPxHwkAAgAIAN8B6wUHC6YQahYJHCUhMSUQAAIABAAABV0OsxgQIhMAAgAIAN8B6wUHC6YQahYJHCUhMSUaAAIAAwAfB4cT8R8cAAIACADfAesFBwumEGoWCRwlITElIwACAAQAAAVdDrMYECImAAAAAAACAAgA+gJgByMMDREDFu0asB8WJAcAAgADAB8HhxPxHwkAAgAIAN8B6wUHC6YQahYJHCUhMSUQAAIABAAABV0OsxgQIhMAAgAIAN8B6wUHC6YQahYJHCUhMSUaAAIAAwAfB4cT8R8cAAIACADfAesFBwumEGoWCRwlITElIwACAAQAAAVdDrMYECImAAAAAAABAAIAAgAIAN8B6wUHC6YQahYJHCUhMSUJAAIACADfAesFBwumEGoWCRwlITElEAACAAYA3wLACNIPPhdQHjEkFQACAAgA3wHrBQcLphBqFgkcJSExJRwAAgAIAN8B6wUHC6YQahYJHCUhMSUjAAIABAAABV0OsxgQIiYAAAAAAAEAAgACAAgA3wHrBQcLphBqFgkcJSExJQkAAgAIAN8B6wUHC6YQahYJHCUhMSUQAAIABgDfAsAI0g8+F1AeMSQVAAIACADfAesFBwumEGoWCRwlITElHAACAAgA3wHrBQcLphBqFgkcJSExJSMAAgAEAAAFXQ6zGBAiJgAAAAAAAQADAAIACADfAesFBwumEGoWCRwlITElCgACAAcASgIfBxgNhxP4GfEfxiQQAAIABwBKAh8HGA2HE/gZ8R/GJBYAAgAIAN8B6wUHC6YQahYJHCUhMSUdAAIABwBKAh8HGA2HE/gZ8R/GJCMAAgAEAAAFXQ6zGBAiJgAAAAAAAgAEANEI+hDlGIUgAwACAAUAnwYwDbcTOBqwIAcAAAAJAAIABQA8CIMPZRbkHNkiDQACAAQA8QfMD6AXZh8QAAAAEwACAAQAuglQElkatyEWAAIABQCfBjANtxM4GrAgGgAAABwAAgAFADwIgw9lFuQc2SIgAAIABADxB8wPoBdmHyMAAAAAAAIABADRCPoQ5RiFIAMAAgAFAJ8GMA23EzgasCAHAAAACQACAAUAPAiDD2UW5BzZIg0AAgAEAPEHzA+gF2YfEAAAABMAAgAEALoJUBJZGrchFgACAAUAnwYwDbcTOBqwIBoAAAAcAAIABQA8CIMPZRbkHNkiIAACAAQA8QfMD6AXZh8jAAAAAAABAAcAAgADAMENQBljIgkAAgAFAHYJ0BFAGaofrCQNAAAAGgACAAMAwQ1AGWMiHAACAAUAdgnQEUAZqh+sJCAAAAAAAAEABwACAAMAwQ1AGWMiCQACAAUAdgnQEUAZqh+sJA0AAAAaAAIAAwDBDUAZYyIcAAIABQB2CdARQBmqH6wkIAAAAAAAAQADAAEABwABAAkAAQANAAEAEAABABMAAQAWAAEAGgABABwAAQAgAAEAIwABACYAAAAAAAEABgACAAsAIAG2Ax8HBws2D4cT2hcJHPEfWiPwJRAAAgAKAFEBSQQmCIYMKhHmFYoa6h7HIr8lGQACAAsAIAG2Ax8HBws2D4cT2hcJHPEfWiPwJSMAAgAEAAAFXQ6zGBAiJgAAAAAAAQAGAAIACwAgAbYDHwcHCzYPhxPaFwkc8R9aI/AlEAACAAoAUQFJBCYIhgwqEeYVihrqHscivyUZAAIACwAgAbYDHwcHCzYPhxPaFwkc8R9aI/AlIwACAAQAAAVdDrMYECImAAAAAAABAAcAAgAKAFEBSQQmCIYMKhHmFYoa6h7HIr8lEAACAAsAIAG2Ax8HBws2D4cT2hcJHPEfWiPwJRoAAgAKAFEBSQQmCIYMKhHmFYoa6h7HIr8lIwACAAQAAAVdDrMYECImAAAAAAABAAcAAgAKAFEBSQQmCIYMKhHmFYoa6h7HIr8lEAACAAsAIAG2Ax8HBws2D4cT2hcJHPEfWiPwJRoAAgAKAFEBSQQmCIYMKhHmFYoa6h7HIr8lIwACAAQAAAVdDrMYECImAAAAAAABAAMAAgAIAN8B6wUHC6YQahYJHCUhMSUKAAIABwBKAh8HGA2HE/gZ8R/GJBAAAgAHAEoCHwcYDYcT+BnxH8YkFgACAAgA3wHrBQcLphBqFgkcJSExJR0AAgAHAEoCHwcYDYcT+BnxH8YkIwACAAQAAAVdDrMYECImAAAAAAABAAcAAgADAMENQBljIgkAAgAFAHYJ0BFAGaofrCQNAAAAGgACAAMAwQ1AGWMiHAACAAUAdgnQEUAZqh+sJCAAAAAAAAEAAwAAAAkAAgAIAG4E0QgwDYsR4hU4Goke1CIQAAIABwBSBu8LRBFlFk8b9h8wJBYAAAAcAAIACABuBNEIMA2LEeIVOBqJHtQiIwACAAQAuglQElkatyEmAAAAAAABAAMAAAAJAAIACABuBNEIMA2LEeIVOBqJHtQiEAACAAcAUgbvC0QRZRZPG/YfMCQWAAAAHAACAAgAbgTRCDANixHiFTgaiR7UIiMAAgAEALoJUBJZGrchJgAAAAAAAQADAAEABwAAAAkAAQANAAEAEAABABMAAQAWAAEAGgAAABwAAQAgAAEAIwABACYAAAAAAAIACAD6AmAHIwwNEQMW7RqwHxYkBwACAAcASgIfBxgNhxP4GfEfxiQNAAIABAAABV0OsxgQIhAAAgAEAAAFXQ6zGBAiEwACAAgA3wHrBQcLphBqFgkcJSExJRoAAgAHAEoCHwcYDYcT+BnxH8YkIAACAAQAAAVdDrMYECIjAAIABAAABV0OsxgQIiYAAAAAAAIACAD6AmAHIwwNEQMW7RqwHxYkBwACAAcASgIfBxgNhxP4GfEfxiQNAAIABAAABV0OsxgQIhAAAgAEAAAFXQ6zGBAiEwACAAgA3wHrBQcLphBqFgkcJSExJRoAAgAHAEoCHwcYDYcT+BnxH8YkIAACAAQAAAVdDrMYECIjAAIABAAABV0OsxgQIiYAAAAAAAEABgACAAsAIAG2Ax8HBws2D4cT2hcJHPEfWiPwJRAAAgAKAFEBSQQmCIYMKhHmFYoa6h7HIr8lGQACAAsAIAG2Ax8HBws2D4cT2hcJHPEfWiPwJSMAAgAEAAAFXQ6zGBAiJgAAAAAAAQAHAAIACgBRAUkEJgiGDCoR5hWKGuoexyK/JRAAAgALACABtgMfBwcLNg+HE9oXCRzxH1oj8CUaAAIACgBRAUkEJgiGDCoR5hWKGuoexyK/JSMAAgAEAAAFXQ6zGBAiJgAAAAAAAQADAAIACADfAesFBwumEGoWCRwlITElCgACAAcASgIfBxgNhxP4GfEfxiQQAAIABwBKAh8HGA2HE/gZ8R/GJBYAAgAIAN8B6wUHC6YQahYJHCUhMSUdAAIABwBKAh8HGA2HE/gZ8R/GJCMAAgAEAAAFXQ6zGBAiJgAAAAAAAQADAAIACADfAesFBwumEGoWCRwlITElCgACAAcASgIfBxgNhxP4GfEfxiQQAAIABwBKAh8HGA2HE/gZ8R/GJBYAAgAIAN8B6wUHC6YQahYJHCUhMSUdAAIABwBKAh8HGA2HE/gZ8R/GJCMAAgAEAAAFXQ6zGBAiJgAAAAAAAQACAAIACADfAesFBwumEGoWCRwlITElCQACAAgA3wHrBQcLphBqFgkcJSExJRAAAgAGAN8CwAjSDz4XUB4xJBUAAgAIAN8B6wUHC6YQahYJHCUhMSUcAAIACADfAesFBwumEGoWCRwlITElIwACAAQAAAVdDrMYECImAAAAAAABAAEAAgAHAEoCHwcYDYcT+BnxH8YkBwACAAUA9AIsCcUQzhiJIAsAAgAGACUHQQ4iFYMbEiFCJRAAAgAFALYDBwuHEwkcWiMUAAIABwBKAh8HGA2HE/gZ8R/GJBoAAgAFAPQCLAnFEM4YiSAeAAIABgAlB0EOIhWDGxIhQiUjAAAAAAABAAEAAgAHAEoCHwcYDYcT+BnxH8YkBwACAAUA9AIsCcUQzhiJIAsAAgAGACUHQQ4iFYMbEiFCJRAAAgAFALYDBwuHEwkcWiMUAAIABwBKAh8HGA2HE/gZ8R/GJBoAAgAFAPQCLAnFEM4YiSAeAAIABgAlB0EOIhWDGxIhQiUjAAAAAAACAAgArQW3CoMPJBSbGOQc8SCdJAcAAgADAMENQBljIgkAAgAFAHYJ0BFAGaofrCQNAAIABAAICPkPzBeAHxAAAgAEADYL5hQ9HdIjEwACAAgAdQZaDNAR4BaEG6ofNCPgJRoAAgADAMENQBljIhwAAgAFAHYJ0BFAGaofrCQgAAIABAAICPkPzBeAHyMAAgAEADYL5hQ9HdIjJgAAAAAAAgAIAK0FtwqDDyQUmxjkHPEgnSQHAAIAAwDBDUAZYyIJAAIACwDoBHYJwQ3QEaUVQBmZHKofYyKsJFkmEwACAAgAdQZaDNAR4BaEG6ofNCPgJRoAAgADAMENQBljIhwAAAAAAAEAAwACAAgA3wHrBQcLphBqFgkcJSExJQoAAgAHAEoCHwcYDYcT+BnxH8YkEAACAAcASgIfBxgNhxP4GfEfxiQWAAIACADfAesFBwumEGoWCRwlITElHQACAAcASgIfBxgNhxP4GfEfxiQjAAIABAAABV0OsxgQIiYAAAAAAAEAAwACAAgA3wHrBQcLphBqFgkcJSExJQoAAgAHAEoCHwcYDYcT+BnxH8YkEAACAAcASgIfBxgNhxP4GfEfxiQWAAIACADfAesFBwumEGoWCRwlITElHQACAAcASgIfBxgNhxP4GfEfxiQjAAIABAAABV0OsxgQIiYAAAAAAAEAAgACAAkAjgEABWwJXQ6HE7MYpB0QIoIlCgACAAcAsgFaBQcKVw8RFRAbKCEQAAIABgCFBScMBxO0GcsftCQVAAIACQCOAQAFbAldDocTsxikHRAigiUdAAIABwCyAVoFBwpXDxEVEBsoISMAAgAEABwIqRH9GvAiJgAAAAAAAQACAAIACQCOAQAFbAldDocTsxikHRAigiUKAAIABwCyAVoFBwpXDxEVEBsoIRAAAgAGAIUFJwwHE7QZyx+0JBUAAgAJAI4BAAVsCV0OhxOzGKQdECKCJR0AAgAHALIBWgUHClcPERUQGyghIwACAAQAHAipEf0a8CImAAAAAAABAAIAAgAJAI4BAAVsCV0OhxOzGKQdECKCJQoAAgAHAEoCHwcYDYcT+BnxH8YkEAACAAYA3wLACNIPPhdQHjEkFQACAAkAjgEABWwJXQ6HE7MYpB0QIoIlHQACAAcASgIfBxgNhxP4GfEfxiQjAAIABAAABV0OsxgQIiYAAAAAAAEAAgACAAkAjgEABWwJXQ6HE7MYpB0QIoIlCgACAAcASgIfBxgNhxP4GfEfxiQQAAIABgDfAsAI0g8+F1AeMSQVAAIACQCOAQAFbAldDocTsxikHRAigiUdAAIABwBKAh8HGA2HE/gZ8R/GJCMAAgAEAAAFXQ6zGBAiJgAAAAAAAQACAAIACQCOAQAFbAldDocTsxikHRAigiUKAAIABwBKAh8HGA2HE/gZ8R/GJBAAAgAGAN8CwAjSDz4XUB4xJBUAAgAJAI4BAAVsCV0OhxOzGKQdECKCJR0AAgAHAEoCHwcYDYcT+BnxH8YkIwACAAQAAAVdDrMYECImAAAAAAABAAIAAgAJAI4BAAVsCV0OhxOzGKQdECKCJQoAAgAHAEoCHwcYDYcT+BnxH8YkEAACAAYA3wLACNIPPhdQHjEkFQACAAkAjgEABWwJXQ6HE7MYpB0QIoIlHQACAAcASgIfBxgNhxP4GfEfxiQjAAIABAAABV0OsxgQIiYAAAAAAAIACAD6AmAHIwwNEQMW7RqwHxYkBwACAAcASgIfBxgNhxP4GfEfxiQNAAIABAAABV0OsxgQIhAAAgAEAAAFXQ6zGBAiEwACAAgA3wHrBQcLphBqFgkcJSExJRoAAgAHAEoCHwcYDYcT+BnxH8YkIAACAAQAAAVdDrMYECIjAAIABAAABV0OsxgQIiYAAAAAAAIACAD6AmAHIwwNEQMW7RqwHxYkBwACAAcASgIfBxgNhxP4GfEfxiQNAAIABAAABV0OsxgQIhAAAgAEAAAFXQ6zGBAiEwACAAgA3wHrBQcLphBqFgkcJSExJRoAAgAHAEoCHwcYDYcT+BnxH8YkIAACAAQAAAVdDrMYECIjAAIABAAABV0OsxgQIiYAAAAAAAIACAD6AmAHIwwNEQMW7RqwHxYkBwACAAcASgIfBxgNhxP4GfEfxiQNAAIABAAABV0OsxgQIhAAAgAEAAAFXQ6zGBAiEwACAAgA3wHrBQcLphBqFgkcJSExJRoAAgAHAEoCHwcYDYcT+BnxH8YkIAACAAQAAAVdDrMYECIjAAIABAAABV0OsxgQIiYAAAAAAAIACAD6AmAHIwwNEQMW7RqwHxYkBwACAAcASgIfBxgNhxP4GfEfxiQNAAIABAAABV0OsxgQIhAAAgAEAAAFXQ6zGBAiEwACAAgA3wHrBQcLphBqFgkcJSExJRoAAgAHAEoCHwcYDYcT+BnxH8YkIAACAAQAAAVdDrMYECIjAAIABAAABV0OsxgQIiYAAAAAAAEABwACAAoAUQFJBCYIhgwqEeYVihrqHscivyUQAAIACwAgAbYDHwcHCzYPhxPaFwkc8R9aI/AlGgACAAoAUQFJBCYIhgwqEeYVihrqHscivyUjAAIABAAABV0OsxgQIiYAAAAAAAEABgACAAsAIAG2Ax8HBws2D4cT2hcJHPEfWiPwJRAAAgAKAFEBSQQmCIYMKhHmFYoa6h7HIr8lGQACAAsAIAG2Ax8HBws2D4cT2hcJHPEfWiPwJSMAAgAEAAAFXQ6zGBAiJgAAAAAAAQADAAIACADfAesFBwumEGoWCRwlITElCgACAAcASgIfBxgNhxP4GfEfxiQQAAIABwBKAh8HGA2HE/gZ8R/GJBYAAgAIAN8B6wUHC6YQahYJHCUhMSUdAAIABwBKAh8HGA2HE/gZ8R/GJCMAAgAEAAAFXQ6zGBAiJgAAAAAAAQADAAIACADfAesFBwumEGoWCRwlITElCgACAAcASgIfBxgNhxP4GfEfxiQQAAIABwBKAh8HGA2HE/gZ8R/GJBYAAgAIAN8B6wUHC6YQahYJHCUhMSUdAAIABwBKAh8HGA2HE/gZ8R/GJCMAAAAAAAEAAgACAAgA3wHrBQcLphBqFgkcJSExJQkAAgAIAN8B6wUHC6YQahYJHCUhMSUQAAIABgDfAsAI0g8+F1AeMSQVAAIACADfAesFBwumEGoWCRwlITElHAACAAgA3wHrBQcLphBqFgkcJSExJSMAAgAEAAAFXQ6zGBAiJgAAAAAAAQACAAIACADfAesFBwumEGoWCRwlITElCQACAAgA3wHrBQcLphBqFgkcJSExJRAAAgAGAN8CwAjSDz4XUB4xJBUAAgAIAN8B6wUHC6YQahYJHCUhMSUcAAIACADfAesFBwumEGoWCRwlITElIwACAAQAAAVdDrMYECImAAAAAAABAAMAAgAIAN8B6wUHC6YQahYJHCUhMSUKAAIABwBKAh8HGA2HE/gZ8R/GJBAAAgAHAEoCHwcYDYcT+BnxH8YkFgACAAgA3wHrBQcLphBqFgkcJSExJR0AAgAHAEoCHwcYDYcT+BnxH8YkIwACAAQAAAVdDrMYECImAAAAAAABAAMAAgAIAN8B6wUHC6YQahYJHCUhMSUKAAIABwBKAh8HGA2HE/gZ8R/GJBAAAgAHAEoCHwcYDYcT+BnxH8YkFgACAAgA3wHrBQcLphBqFgkcJSExJR0AAgAHAEoCHwcYDYcT+BnxH8YkIwACAAQAAAVdDrMYECImAAAAAAABAAIAAgAJAI4BAAVsCV0OhxOzGKQdECKCJQoAAgAHAEoCHwcYDYcT+BnxH8YkEAACAAYA3wLACNIPPhdQHjEkFQACAAkAjgEABWwJXQ6HE7MYpB0QIoIlHQACAAcASgIfBxgNhxP4GfEfxiQjAAIABAAABV0OsxgQIiYAAAAAAAEAAgACAAkAjgEABWwJXQ6HE7MYpB0QIoIlCgACAAcASgIfBxgNhxP4GfEfxiQQAAIABgDfAsAI0g8+F1AeMSQVAAIACQCOAQAFbAldDocTsxikHRAigiUdAAIABwBKAh8HGA2HE/gZ8R/GJCMAAgAEAAAFXQ6zGBAiJgAAAAAAAQAEAAIACQCOAQAFbAldDocTsxikHRAigiUMAAIABQDDAmIIVw8LFx8fEAACAAgAJAQlCXEOyRP8GNwdLCKIJRcAAgAJAI4BAAVsCV0OhxOzGKQdECKCJR8AAgAFAMMCYghXDwsXHx8jAAAAAAABAAQAAgAJAI4BAAVsCV0OhxOzGKQdECKCJQwAAgAFALYDBwuHEwkcWiMQAAIACAAkBCUJcQ7JE/wY3B0sIoglFwACAAkAjgEABWwJXQ6HE7MYpB0QIoIlHwACAAUAtgMHC4cTCRxaIyMAAAAAAAEAAgACAAkAjgEABWwJXQ6HE7MYpB0QIoIlCgACAAcASgIfBxgNhxP4GfEfxiQQAAIABgDfAsAI0g8+F1AeMSQVAAIACQCOAQAFbAldDocTsxikHRAigiUdAAIABwBKAh8HGA2HE/gZ8R/GJCMAAgAEAAAFXQ6zGBAiJgAAAAAAAQACAAIACQCOAQAFbAldDocTsxikHRAigiUKAAIABwBKAh8HGA2HE/gZ8R/GJBAAAgAGAN8CwAjSDz4XUB4xJBUAAgAJAI4BAAVsCV0OhxOzGKQdECKCJR0AAgAHAEoCHwcYDYcT+BnxH8YkIwACAAQAAAVdDrMYECImAAAAAAACAAgA+gJgByMMDREDFu0asB8WJAcAAgAHAEoCHwcYDYcT+BnxH8YkDQACAAQAAAVdDrMYECIQAAIABAAABV0OsxgQIhMAAgAIAN8B6wUHC6YQahYJHCUhMSUaAAIABwBKAh8HGA2HE/gZ8R/GJCAAAgAEAAAFXQ6zGBAiIwACAAQAAAVdDrMYECImAAAAAAACAAgA+gJgByMMDREDFu0asB8WJAcAAgAHAEoCHwcYDYcT+BnxH8YkDQACAAQAAAVdDrMYECIQAAIABAAABV0OsxgQIhMAAgAIAN8B6wUHC6YQahYJHCUhMSUaAAIABwBKAh8HGA2HE/gZ8R/GJCAAAgAEAAAFXQ6zGBAiIwACAAQAAAVdDrMYECImAAAAAAACAAgA+gJgByMMDREDFu0asB8WJAcAAgAHAEoCHwcYDYcT+BnxH8YkDQACAAQAAAVdDrMYECIQAAIABAAABV0OsxgQIhMAAgAIAN8B6wUHC6YQahYJHCUhMSUaAAIABwBKAh8HGA2HE/gZ8R/GJCAAAgAEAAAFXQ6zGBAiIwACAAQAAAVdDrMYECImAAAAAAACAAgA+gJgByMMDREDFu0asB8WJAcAAgAHAEoCHwcYDYcT+BnxH8YkDQACAAcASgIfBxgNhxP4GfEfxiQTAAIACADfAesFBwumEGoWCRwlITElGgACAAcASgIfBxgNhxP4GfEfxiQgAAAAAAACAAgA+gJgByMMDREDFu0asB8WJAcAAgAHAEoCHwcYDYcT+BnxH8YkDQACAAQAAAVdDrMYECIQAAIABAAABV0OsxgQIhMAAgAIAN8B6wUHC6YQahYJHCUhMSUaAAIABwBKAh8HGA2HE/gZ8R/GJCAAAgAEAAAFXQ6zGBAiIwACAAQAAAVdDrMYECImAAAAAAACAAgA+gJgByMMDREDFu0asB8WJAcAAgAHAEoCHwcYDYcT+BnxH8YkDQACAAQAAAVdDrMYECIQAAIABAAABV0OsxgQIhMAAgAIAN8B6wUHC6YQahYJHCUhMSUaAAIABwBKAh8HGA2HE/gZ8R/GJCAAAgAEAAAFXQ6zGBAiIwACAAQAAAVdDrMYECImAAAAAAACAAgA+gJgByMMDREDFu0asB8WJAcAAgAHAEoCHwcYDYcT+BnxH8YkDQACAAQAAAVdDrMYECIQAAIABAAABV0OsxgQIhMAAgAIAN8B6wUHC6YQahYJHCUhMSUaAAIABwBKAh8HGA2HE/gZ8R/GJCAAAgAEAAAFXQ6zGBAiIwACAAQAAAVdDrMYECImAAAAAAABAAMAAgAIAN8B6wUHC6YQahYJHCUhMSUKAAIABwBKAh8HGA2HE/gZ8R/GJBAAAgAHAEoCHwcYDYcT+BnxH8YkFgACAAgA3wHrBQcLphBqFgkcJSExJR0AAgAHAEoCHwcYDYcT+BnxH8YkIwACAAQAAAVdDrMYECImAAAAAAABAAMAAgAIAN8B6wUHC6YQahYJHCUhMSUKAAIABwBKAh8HGA2HE/gZ8R/GJBAAAgAHAEoCHwcYDYcT+BnxH8YkFgACAAgA3wHrBQcLphBqFgkcJSExJR0AAgAHAEoCHwcYDYcT+BnxH8YkIwACAAQAAAVdDrMYECImAAAAAAABAAIAAgAIAN8B6wUHC6YQahYJHCUhMSUJAAIACADfAesFBwumEGoWCRwlITElEAACAAYA3wLACNIPPhdQHjEkFQACAAgA3wHrBQcLphBqFgkcJSExJRwAAgAIAN8B6wUHC6YQahYJHCUhMSUjAAIABAAABV0OsxgQIiYAAAAAAAEAAgACAAgA3wHrBQcLphBqFgkcJSExJQkAAgAIAN8B6wUHC6YQahYJHCUhMSUQAAIABgDfAsAI0g8+F1AeMSQVAAIACADfAesFBwumEGoWCRwlITElHAACAAgA3wHrBQcLphBqFgkcJSExJSMAAgAEAAAFXQ6zGBAiJgAAAAAAAQAGAAIACQCOAQAFbAldDocTsxikHRAigiUOAAIAAwBaBVcPEBsQAAIACgBNA0UHiAvnD0QUhRiSHE0giSP8JRkAAgAJAI4BAAVsCV0OhxOzGKQdECKCJSEAAgADAFoFVw8QGyMAAAAAAAEABgACAAkAJgG8AyAHDAtXD+cTpRh/HV4iDgACAAMAWgVXDxAbEAACAAoATQNFB4gL5w9EFIUYkhxNIIkj/CUZAAIACQAmAbwDIAcMC1cP5xOlGH8dXiIhAAIAAwBaBVcPEBsjAAAAAAACAAgA+gJgByMMDREDFu0asB8WJAcAAgAHAEoCHwcYDYcT+BnxH8YkDQACAAQAAAVdDrMYECIQAAIABAAABV0OsxgQIhMAAgAIAN8B6wUHC6YQahYJHCUhMSUaAAIABwBKAh8HGA2HE/gZ8R/GJCAAAgAEAAAFXQ6zGBAiIwACAAQAAAVdDrMYECImAAAAAAACAAgA+gJgByMMDREDFu0asB8WJAcAAgAHAEoCHwcYDYcT+BnxH8YkDQACAAQAAAVdDrMYECIQAAIABAAABV0OsxgQIhMAAgAIAN8B6wUHC6YQahYJHCUhMSUaAAIABwBKAh8HGA2HE/gZ8R/GJCAAAgAEAAAFXQ6zGBAiIwACAAQAAAVdDrMYECImAAAAAAACAAgA+gJgByMMDREDFu0asB8WJAcAAgAHAEoCHwcYDYcT+BnxH8YkDQACAAQAAAVdDrMYECIQAAIABAAABV0OsxgQIhMAAgAIAN8B6wUHC6YQahYJHCUhMSUaAAIABwBKAh8HGA2HE/gZ8R/GJCAAAgAEAAAFXQ6zGBAiIwACAAQAAAVdDrMYECImAAAAAAACAAgA+gJgByMMDREDFu0asB8WJAcAAgAHAEoCHwcYDYcT+BnxH8YkDQACAAQAAAVdDrMYECIQAAIABAAABV0OsxgQIhMAAgAIAN8B6wUHC6YQahYJHCUhMSUaAAIABwBKAh8HGA2HE/gZ8R/GJCAAAgAEAAAFXQ6zGBAiIwACAAQAAAVdDrMYECImAAAAAAACAAgA+gJgByMMDREDFu0asB8WJAcAAgAHAEoCHwcYDYcT+BnxH8YkDQACAAQAAAVdDrMYECIQAAIABAAABV0OsxgQIhMAAgAIAN8B6wUHC6YQahYJHCUhMSUaAAIABwBKAh8HGA2HE/gZ8R/GJCAAAgAEAAAFXQ6zGBAiIwACAAQAAAVdDrMYECImAAAAAAABAAIAAgAIAN8B6wUHC6YQahYJHCUhMSUJAAIACADfAesFBwumEGoWCRwlITElEAACAAYA3wLACNIPPhdQHjEkFQACAAgA3wHrBQcLphBqFgkcJSExJRwAAgAIAN8B6wUHC6YQahYJHCUhMSUjAAIABAAABV0OsxgQIiYAAAAAAAIACADgA1QI8QydEUYW5BpkH6QjBwACAAcAGwXZCt0Q2BaFHIohYiUNAAIABADaARMHPA//GRAAAgAEAEwIXxA0GMYfEwACAAgAeQPXB7QMyxHpFtsbaiBNJBoAAgAHABsF2QrdENgWhRyKIWIlIAACAAQA2gETBzwP/xkjAAIABABMCF8QNBjGHyYAAAAAAAIACADgA1QI8QydEUYW5BpkH6QjBwACAAcAGwXZCt0Q2BaFHIohYiUNAAIABADaARMHPA//GRAAAgAEAEwIXxA0GMYfEwACAAgAeQPXB7QMyxHpFtsbaiBNJBoAAgAHABsF2QrdENgWhRyKIWIlIAACAAQA2gETBzwP/xkjAAIABABMCF8QNBjGHyYAAAAAAAEAEwABACYAAAAAAAIAFgDEAB8CswNmBSwHAgnhCsYMsg6eEJASgBRyFl4YShovHA4e5B+qIV0j8SRMJhUAAgASAH0AswFlA24FtwctCsMMbw8qEuYUoRdNGuMcWR+iIasjXSWTJiYAAAAAAAIAEgAGAcQCwgTkBhsJYAuuDQMQWxK1FA0XYhmwG/UdLCBOIkwkCiYRAAIAFgBXADcBdgL8A7cFnAehCb0L6w0lEGYSqhTrFiUZUxtvHXQfWSEUI5ok2SW5JiYAAAAAAAIAFADiAGkCLAQQBgoIEgojDDsOWBB4EpgUuBbVGO0a/hwGHwAh5CKnJC4mEwACABQAaABtAd8CnwSaBsAIBwtkDdIPSxLFFD4XrBkJHFAediBxIjEkoyWoJiYAAAAAAAIAGQCiAMkBIgOZBCMGuwdcCQULswxlDhoQ0BGHE0AV9harGF0aCxy0HVUf7SB3Iu4jRyVuJhgAAgAPAKsASgKCBB8HBQoYDUkQhxPHFvgZCx3xH44ixiRlJiYAAAAAAAIADwBSAX8D8gWMCDsL+A2/EIcTURYYGdUbhB4eIZEjviUOAAIAGQBGAPoA/gFBA7IESQb+B8kJqAuUDYoPhxGHE4kVhhd8GWgbRx0SH8cgXiLPIxIlFibKJiYAAAAAAAEADQAAABgAAQAmAAAAAAABAAsAAAAVAAEAJgAAAAAAAQANAAAAFAABACYAAAAAAAEADgAAABYAAQAmAAAAAAABAAoAAQAmAAAAAAABAAwAAAAXAAEAJgAAAAAAAAAHAP//EAAAABoA//8jAAAAAAD//wcAAAAQAP//GgAAACMA//8AAP//AwAAAAAAAQADAAAAAAD//wMAAAAAAAEAAwAAAAAAAAAAAAEAAQABAAAAAAACAAcASgIfBxgNhxP4GfEfxiQGAAIADQBqBLkI4AzXEJgUGBhQGzUewiDtIq0k+iXJJhIAAAAAAAIABwBDByAOgBRCGj8fQyMDJgYAAgANAGoEuQjgDNcQmBQYGFAbNR7CIO0irST6JckmEgAAAAAAAgAHAH4G4AwHE9EYDR59IrklBgACAA0AagS5COAM1xCYFBgYUBs1HsIg7SKtJPolySYSAAAAAAACAAcAfgbgDAcT0RgNHn0iuSUGAAIADQBqBLkI4AzXEJgUGBhQGzUewiDtIq0k+iXJJhIAAAAAAAIABwC+BkgNgxNKGXMewSLUJQYAAgANAGoEuQjgDNcQmBQYGFAbNR7CIO0irST6JckmEgAAAAAAAgAHAL4GSA2DE0oZcx7BItQlBgACAA0AagS5COAM1xCYFBgYUBs1HsIg7SKtJPolySYSAAAAAAACABMAowJDBd8HdQoBDYQP+hFgFLYW+BgiGzIdIx/wIJMiBSQ+JTMm1SYSAAAAAAACAAcAHgiCDxgWyBt1IAEkRCYGAAAAAAACAAcAfgbgDAcT0RgNHn0iuSUGAAIADQBqBLkI4AzXEJgUGBhQGzUewiDtIq0k+iXJJhIAAAAAAAIABwC+BkgNgxNKGXMewSLUJQYAAgANAGoEuQjgDNcQmBQYGFAbNR7CIO0irST6JckmEgAAAAAAAgAHAL4GSA2DE0oZcx7BItQlBgAAAAAAAgAHAOcDTwgUDR0SUxekHPQhBgAAAAAAAAAGAAIADQDwAt0FxwiuC5AOaxFBFA4X1BmPHEEf5yGCJBIAAAAAAAIABADDB5MPZxc7HwMAAgAEANsHrQ94F0MfBgACAA0AagS5COAM1xCYFBgYUBs1HsIg7SKtJPolySYSAAAAAAACAAQAwweTD2cXOx8DAAIABADbB60PeBdDHwYAAgANAGoEuQjgDNcQmBQYGFAbNR7CIO0irST6JckmEgAAAAAAAgAHAL4GSA2DE0oZcx7BItQlBgACAA0AagS5COAM1xCYFBgYUBs1HsIg7SKtJPolySYSAAAAAAACAAcAvgZIDYMTShlzHsEi1CUGAAIADQBqBLkI4AzXEJgUGBhQGzUewiDtIq0k+iXJJhIAAAAAAAIABwBKAh8HGA2HE/gZ8R/GJAYAAgANAGoEuQjgDNcQmBQYGFAbNR7CIO0irST6JckmEgAAAAAAAgAHAL4GSA2DE0oZcx7BItQlBgACAA0AagS5COAM1xCYFBgYUBs1HsIg7SKtJPolySYSAAAAAAACAAcAfgbgDAcT0RgNHn0iuSUGAAIADQBqBLkI4AzXEJgUGBhQGzUewiDtIq0k+iXJJhIAAAAAAAIABwBKAh8HGA2HE/gZ8R/GJAYAAgANAGoEuQjgDNcQmBQYGFAbNR7CIO0irST6JckmEgAAAAAAAgAHAH4G4AwHE9EYDR59IrklBgACAA0AagS5COAM1xCYFBgYUBs1HsIg7SKtJPolySYSAAAAAAACAAcASgIfBxgNhxP4GfEfxiQGAAIADQBqBLkI4AzXEJgUGBhQGzUewiDtIq0k+iXJJhIAAAAAAAIABwB+BuAMBxPRGA0efSK5JQYAAgANAGoEuQjgDNcQmBQYGFAbNR7CIO0irST6JckmEgAAAAAAAgAHAEoCHwcYDYcT+BnxH8YkBgACAA0AagS5COAM1xCYFBgYUBs1HsIg7SKtJPolySYSAAAAAAACAAgA3wHrBQcLphBqFgkcJSExJQcAAgAMAPoAQQNJBskJlA2HEYkVfBlHHccgzyMWJhIAAAAAAAAABgACAA0AagS5COAM1xCYFBgYUBs1HsIg7SKtJPolySYSAAAAAAAAAAYAAgANAGoEuQjgDNcQmBQYGFAbNR7CIO0irST6JckmEgAAAAAAAQASAAAAAAACAAcASgIfBxgNhxP4GfEfxiQGAAIADQBqBLkI4AzXEJgUGBhQGzUewiDtIq0k+iXJJhIAAAAAAAIABwB+BuAMBxPRGA0efSK5JQYAAgANAGoEuQjgDNcQmBQYGFAbNR7CIO0irST6JckmEgAAAAAAAQAGAAIADQBqBLkI4AzXEJgUGBhQGzUewiDtIq0k+iXJJhIAAAAAAAIABwB+BuAMBxPRGA0efSK5JQYAAgANAGoEuQjgDNcQmBQYGFAbNR7CIO0irST6JckmEgAAAAAAAgAHAH4G4AwHE9EYDR59IrklBgACAA0AagS5COAM1xCYFBgYUBs1HsIg7SKtJPolySYSAAAAAAAAAAYAAgANAGoEuQjgDNcQmBQYGFAbNR7CIO0irST6JckmEgAAAAAAAgAHAEoCHwcYDYcT+BnxH8YkBgACAA0AagS5COAM1xCYFBgYUBs1HsIg7SKtJPolySYSAAAAAAACAAUAXgeYDqIVZByjIgQAAAAAAAIABQBeB5gOohVkHKMiBAAAAAcAAQASAAAAAAACAAcA+ATtCdwOxxOqGIMdUCIGAAAAAAAAAAYAAgANAPAC3QXHCK4LkA5rEUEUDhfUGY8cQR/nIYIkEgAAAAAAAgAHAL0A3AJABs8KchATF6IeBgACAA0AagS5COAM1xCYFBgYUBs1HsIg7SKtJPolySYSAAAAAAACAAcAvgZIDYMTShlzHsEi1CUGAAAAAAACAAcAvgZIDYMTShlzHsEi1CUGAAAAAAACAAcASgIfBxgNhxP4GfEfxiQGAAIADQBqBLkI4AzXEJgUGBhQGzUewiDtIq0k+iXJJhIAAAAAAAEAAgABAAcAAAAAAAEAAgABAAcAAAAAAAIABwBKAh8HGA2HE/gZ8R/GJAYAAgANAGoEuQjgDNcQmBQYGFAbNR7CIO0irST6JckmEgAAAAAAAgATAGQC0QRDB7cJKgybDgYRaRPCFQoYQxpkHGweUyAUIqYj/yQRJsomEgAAAAAAAgAHAH4G4AwHE9EYDR59IrklBgACAA0AagS5COAM1xCYFBgYUBs1HsIg7SKtJPolySYSAAAAAAACAAcASgIfBxgNhxP4GfEfxiQGAAIADQBqBLkI4AzXEJgUGBhQGzUewiDtIq0k+iXJJhIAAAAAAAIABwAIBQgK/A7mE8UYlh1aIgYAAgANAPAC3QXHCK4LkA5rEUEUDhfUGY8cQR/nIYIkEgAAAAAAAgAHAH4G4AwHE9EYDR59IrklBgACAA0AagS5COAM1xCYFBgYUBs1HsIg7SKtJPolySYSAAAAAAACABMAuAJoBRIItApJDdMPTRK3FA4XTxl2G4AdaR8sIcQiKyRYJUAm2SYSAAAAAAACAAcAOAX0CuYQzxZvHHEhUyUGAAAAAAAAAAAAAAAAAAEABAAAAAAAAgAHAH4G4AwHE9EYDR59IrklBgACAA0AagS5COAM1xCYFBgYUBs1HsIg7SKtJPolySYSAAAAAAACAAcAfgbgDAcT0RgNHn0iuSUGAAIADQBqBLkI4AzXEJgUGBhQGzUewiDtIq0k+iXJJhIAAAAAAAIACADfAesFBwumEGoWCRwlITElBwACAAwA+gBBA0kGyQmUDYcRiRV8GUcdxyDPIxYmEgAAAAAAAgAHACMH7A1CFAYaDh8jI/glBgACAA0AagS5COAM1xCYFBgYUBs1HsIg7SKtJPolySYSAAAAAAACAAcAfgbgDAcT0RgNHn0iuSUGAAIADQBqBLkI4AzXEJgUGBhQGzUewiDtIq0k+iXJJhIAAAAAAAIAEwAwAnIExAYfCYAL5Q1KEKwSCBVZF5wZyxvkHd4ftSFdI84k9yXCJhIAAAAAAAIABQClCPcQrhhzH68kBAAAAAAAAgAFAKUI9xCuGHMfryQEAAAABwABABIAAAAAAAIACABcBnQMNhKNF18ciiDlIzAmBwACAAwAwARfCc8NBRL4FZ0Z6RzSH00iUCTPJb0mEgAAAAAAAgAIAFwGdAw2Eo0XXxyKIOUjMCYHAAIADADABF8Jzw0FEvgVnRnpHNIfTSJQJM8lvSYSAAAAAAACAAcASgIfBxgNhxP4GfEfxiQGAAIADQBqBLkI4AzXEJgUGBhQGzUewiDtIq0k+iXJJhIAAAAAAAIABwCgBGQJRw49E0EYSB1CIgYAAgANAGoEuQjgDNcQmBQYGFAbNR7CIO0irST6JckmEgAAAAAAAgAHAH4G4AwHE9EYDR59IrklBgACAA0AagS5COAM1xCYFBgYUBs1HsIg7SKtJPolySYSAAAAAAACAAcAvgZIDYMTShlzHsEi1CUGAAIADQBqBLkI4AzXEJgUGBhQGzUewiDtIq0k+iXJJhIAAAAAAAIABwBKAh8HGA2HE/gZ8R/GJAYAAgANAGoEuQjgDNcQmBQYGFAbNR7CIO0irST6JckmEgAAAAAAAgAHAKAEZAlHDj0TQRhIHUIiBgACAA0AagS5COAM1xCYFBgYUBs1HsIg7SKtJPolySYSAAAAAAAAAAYAAgANAPAC3QXHCK4LkA5rEUEUDhfUGY8cQR/nIYIkEgAAAAAAAgATAJECIwWxBzwKwgw/D7ERGBRuFrEY4Br1HOwewSBtIukjLCUpJtImEgAAAAAAAgAHACMH7A1CFAYaDh8jI/glBgAAAAAAAgAHACMH7A1CFAYaDh8jI/glBgACAA0AagS5COAM1xCYFBgYUBs1HsIg7SKtJPolySYSAAAAAAACAAcASgIfBxgNhxP4GfEfxiQGAAIADQBqBLkI4AzXEJgUGBhQGzUewiDtIq0k+iXJJhIAAAAAAAAABgACAA0AagS5COAM1xCYFBgYUBs1HsIg7SKtJPolySYSAAAAAAACAAcAvgZIDYMTShlzHsEi1CUGAAIADQBqBLkI4AzXEJgUGBhQGzUewiDtIq0k+iXJJhIAAAAAAAIABwC+BkgNgxNKGXMewSLUJQYAAgANAGoEuQjgDNcQmBQYGFAbNR7CIO0irST6JckmEgAAAAAAAgAHACMH7A1CFAYaDh8jI/glBgACAA0AagS5COAM1xCYFBgYUBs1HsIg7SKtJPolySYSAAAAAAACAAcAfgbgDAcT0RgNHn0iuSUGAAIADQBqBLkI4AzXEJgUGBhQGzUewiDtIq0k+iXJJhIAAAAAAAIABwBKAh8HGA2HE/gZ8R/GJAYAAAAAAAIABwC+BkgNgxNKGXMewSLUJQYAAgANAGoEuQjgDNcQmBQYGFAbNR7CIO0irST6JckmEgAAAAAAAgAHAEMHIA6AFEIaPx9DIwMmBgAAAAAAAgAHAEMHIA6AFEIaPx9DIwMmBgACAA0AagS5COAM1xCYFBgYUBs1HsIg7SKtJPolySYSAAAAAAACAAcAfgbgDAcT0RgNHn0iuSUGAAAAAAACAAcAQwcgDoAUQho/H0MjAyYGAAIADQBqBLkI4AzXEJgUGBhQGzUewiDtIq0k+iXJJhIAAAAAAAIABwB+BuAMBxPRGA0efSK5JQYAAgANAGoEuQjgDNcQmBQYGFAbNR7CIO0irST6JckmEgAAAAAAAgAHAEoCHwcYDYcT+BnxH8YkBgACAA0AagS5COAM1xCYFBgYUBs1HsIg7SKtJPolySYSAAAAAAACAAcAfgbgDAcT0RgNHn0iuSUGAAIADQBqBLkI4AzXEJgUGBhQGzUewiDtIq0k+iXJJhIAAAAAAAIABwB+BuAMBxPRGA0efSK5JQYAAgANAGoEuQjgDNcQmBQYGFAbNR7CIO0irST6JckmEgAAAAAAAgAHAEoCHwcYDYcT+BnxH8YkBgACAA0AagS5COAM1xCYFBgYUBs1HsIg7SKtJPolySYSAAAAAAACAAcASgIfBxgNhxP4GfEfxiQGAAIADQBqBLkI4AzXEJgUGBhQGzUewiDtIq0k+iXJJhIAAAAAAAEAEgAAAAAAAQASAAAAAAABABIAAAAAAAAACwD//wAAAQAHAAAAAAABABIAAAAAAAAAAAAAAAAAAAAAAAAAAABkAAAAAgAAAAAAAAADAGQAAAAGAAIAAAAHABIAGgAlADwASgBkAAAABQACAAwATABtAG8AegB8AGQAAAAFAAIAFgB+AJAAkgCkAKYAZAAAAAUAAgAgAKgAugC8AMoAzABkAAAABQACACoAzgDgAOIA+QD7AGQAAAAFAAIANAD9AA8BEQElAScBZAAAAAYAAgA+ACkBNAE8AUcBXgFsAWQAAAAFAAIASgBuAXgBgAGfAa0BZAAAAAoAAgBUAK8BugG8AcIBxAHNAc8B5AHmAfIBZAAAAAYAAgBoAPQB/wEHAhICKQI3AmQAAAAGAAIAdAA5AkQCTAJXAm4CfAJkAAAABgACAIAAfgKJApECkwKqArgCZAAAAAYAAgCMALoCxQLNAs8C5gL0AmQAAAAKAAIAmAD2AgEDAwMIAwoDEgMUAygDKgM1A2QAAAAIAAIArAA3A0EDQwNJA0sDaANqA3YDZAAAAAUAAgC8AHgDhQOLA5EDmgNkAAAACQACAMYAnAOnA60DswO5A8IDxAPGA9IDZAAAAAkAAgDYANQD3wPhA+cD6QPyA/QDCQQLBGQAAAAFAAIA6gANBBgEIAQ+BEwEZAAAAAwAAgD0AE4EWQRhBGgEcAR3BH4EhQSMBJMEmwSpBGQAAAAFAAIADAGrBLYEvgTABM4EZAAAAAUAAgAWAdAE2wTjBOUE8wRkAAAABwACACAB9QT/BAEFCQUkBSYFMAVkAAAACQACAC4BMgVBBUMFSwVRBVMFZQVnBXAFZAAAAAoAAgBAAXIFfQWDBYkFjwWYBZoFrwW1BcEFZAAAAAcAAgBUAcMF0AXWBdwF5QXnBfMFZAAAAAkAAgBiAfUFBAYGBg4GFAYWBigGKgYzBmQAAAAGAAIAdAE1BjcGPwZBBlgGZgZkAAAABQACAIABaAZqBnIGdAaLBmQAAAAGAAIAigGNBpgGoAaiBrkGxwZkAAAABgACAJYByQbUBtwG3gb1BgMHZAAAAAwAAgCiAQUHEAcYBx8HJwcuBzUHPAdDB0oHUgdgB2QAAAAGAAIAugFiB20HdQeAB5cHpQdkAAAABwACAMYBpwe1B7cHvwfYB9oH4gdkAAAABQACANQB5AfvB/cHAggZCGQAAAAFAAIA3gEbCCYILggwCEcIZAAAAAcAAgDoAUkIVAhWCF4IYAhiCGwIZAAAAAUAAgD2AW4IeQiBCIMImghkAAAABQACAAACnAinCK8IsQjICGQAAAAGAAIACgLKCNUI3QjfCPYIBAlkAAAABgACABYCBgkRCRkJGwkyCUAJZAAAAAYAAgAiAkIJTQlVCWAJfAmFCWQAAAAGAAIALgKHCZIJmgmlCcEJyglkAAAABgACADoCzAnXCd8J4Qn4CQYKZAAAAAYAAgBGAggKEwobCh0KNApCCmQAAAAGAAIAUgJECk8KVwpZCnAKfgpkAAAABgACAF4CgAqLCpMKlQqsCroKZAAAAAYAAgBqArwKxwrPCtEK6Ar2CmQAAAAGAAIAdgL4CgMLCwsNCyQLMgtkAAAABgACAIICNAs/C0cLSQtgC24LZAAAAAYAAgCOAnALewuDC4ULnAuqC2QAAAAGAAIAmgKsC7cLvwvBC9gL5gtkAAAADAACAKYC6AvzC/sLAgwKDBEMGAwfDCYMLQw1DEMMZAAAAAUAAgC+AkUMUAxYDGMMegxkAAAABQACAMgCfAyHDI8MkQyoDGQAAAAGAAIA0gKqDLUMvQy/DNYM5AxkAAAABgACAN4C5gzxDPkM+wwSDSANZAAAAAYAAgDqAiINLQ01DTcNTg1cDWQAAAAGAAIA9gJeDWkNcQ1zDYoNmA1kAAAABgACAAIDmg2lDa0Nrw3GDdQNZAAAAAYAAgAOA9YN4Q3pDfQNEA4ZDmQAAAAGAAIAGgMbDiYOLg45DlUOXg5kAAAABgACACYDYA5rDnMOdQ6MDpoOZAAAAAYAAgAyA5wOpw6vDrEOyA7WDmQAAAAGAAIAPgPYDuMO6w7tDgQPEg9kAAAABgACAEoDFA8fDycPKQ9AD04PZAAAAAYAAgBWA1APWw9jD2UPfA+KD2QAAAAGAAIAYgOMD5cPnw+hD7gPxg9kAAAABgACAG4DyA/TD9sP3Q/0DwIQZAAAAAYAAgB6AwQQDxAXEBkQMBA+EGQAAAAFAAIAhgNAEEsQUxBeEHUQZAAAAAUAAgCQA3cQghCKEIwQoxBkAAAABQACAJoDpRCwELgQuhDREGQAAAAGAAIApAPTEN4Q5hDoEP8QDRFkAAAABgACALADDxEaERwRJxFDEUwRZAAAAAYAAgC8A04RWRFbEWYRghGLEWQAAAAKAAIAyAONEY8RkRGTEZURlxGZEZsRnRGfEWQAAAAGAAIA3AOhEawRtBG2Ec0R2xFkAAAABgACAOgD3RHoEfAR8hEJEhcSZAAAAAYAAgD0AxkSJBIsEi4SRRJTEmQAAAAGAAIAAARVEmASaBJqEoESjxJkAAAABgACAAwEkRKcEqQSphK9EssSZAAAAAYAAgAYBM0S2BLgEuIS+RIHE2QAAAADAAIAJAQJEwsTDRNkAAAABAABAAAADxMRExMTFRNkAAAABAABAAQAFxMZExsTHRNkAAAABAABAAgAHxMhEyMTJRNkAAAABAABAAwAJxMpEysTLRNkAAAAAwABABAALxMxEzMTZAAAAAQAAQATADUTNxM5EzsTZAAAAAMAAAAAAD0TPxNBE2QAAAAFAAEAFwBDE0UTRxNJE0sTZAAAAAMAAAAAAE0TTxNRE2QAAAAFAAEAHABTE1UTVxNZE1sTZAAAAAMAAgAAAAAAIgBEAGQAAAADAAIABgBGAGwAigBkAAAAAwACAAwAjACyANAAZAAAAAMAAgASANIA1ADWAGQAAAADAAIAGADYAPoAHAFkAAAAAwACAB4AHgFAAWIBZAAAAAMAAgAkAGQBigGoAWQAAAADAAIAKgCqAcwB7gFkAAAAAwACADAA8AESAjQCZAAAAAMAAgA2ADYCWAJ6AmQAAAAFAAIAPAB8AoUCogKrAsgCZAAAAAUAAgBGAMoC0wLwAvkCFgNkAAAAAwACAFAAGAM6A1wDZAAAAAMAAgBWAF4DgAOiA2QAAAAEAAIAXACkA64D0APsA2QAAAAEAAIAZADuA/gDGgQ2BGQAAAAFAAIAbAA4BEYEXgRsBIQEZAAAAAUAAgB2AIYElASsBLoE0gRkAAAABQACAIAA1ATgBPoE/AQWBWQAAAADAAIAigAYBToFXAVkAAAAAwACAJAAXgWABaIFZAAAAAUAAgCWAKQFsAXKBcwF5gVkAAAAAwACAKAA6AUKBiwGZAAAAAMAAgCmAC4GUAZyBmQAAAAFAAIArAB0BoYGmgacBrAGZAAAAAUAAgC2ALIGwAbYBtoG8gZkAAAABQACAMAA9AYCBxoHKAdAB2QAAAAFAAIAygBCB1AHaAd2B44HZAAAAAUAAgDUAJAHowe2B7gHywdkAAAABQACAN4AzQfWB/MH9QcSCGQAAAADAAIA6AAUCDYIWAhkAAAAAwACAO4AWgh8CJ4IZAAAAAMAAgD0AKAIwgjkCGQAAAADAAIA+gDmCAgJKglkAAAAAwACAAABLAlOCXAJZAAAAAUAAgAGAXIJgAmYCZoJsglkAAAABQACABABtAnCCdoJ3An0CWQAAAAFAAIAGgH2CQ0KHAoeCi0KZAAAAAMAAgAkAS8KUQpzCmQAAAADAAIAKgF1CpcKuQpkAAAABQACADABuwrICuEK4wr8CmQAAAADAAIAOgH+CiALQgtkAAAAAwACAEABRAtmC4gLZAAAAAMAAgBGAYoLrAvOC2QAAAADAAIATAHQC/ILFAxkAAAAAwACAFIBFgw4DFoMZAAAAAMAAgBYAVwMfgygDGQAAAADAAIAXgGiDMQM5gxkAAAAAwACAGQB6AwKDSwNZAAAAAMAAgBqAS4NUA1yDWQAAAADAAIAcAF0DZYNuA1kAAAABAACAHYBug3DDeUNAg5kAAAAAwACAH4BBA4mDkgOZAAAAAMAAgCEAUoObA6ODmQAAAAFAAIAigGQDpkOtg64DtUOZAAAAAUAAgCUAdcO7w79Dv8ODQ9kAAAABQACAJ4BDw8nDzUPNw9FD2QAAAAFAAIAqAFHD1EPbQ9vD4sPZAAAAAMAAgCyAY0Prw/RD2QAAAAFAAIAuAHTD90P+Q/7DxcQZAAAAAMAAgDCARkQOxBdEGQAAAAFAAIAyAFfEGkQhRCHEKMQZAAAAAUAAgDSAaUQrxDLEM0Q6RBkAAAABQACANwB6xD0EBERExEwEWQAAAAFAAIA5gEyEUARWBFaEXIRZAAAAAUAAgDwAXQRfxGaEZwRtxFkAAAABQACAPoBuRHEEd8R4RH8EWQAAAAFAAIABAL+EQcSJBImEkMSZAAAAAUAAgAOAkUSUxJrEm0ShRJkAAAABQACABgChxKVEq0SrxLHEmQAAAAFAAIAIgLJEtIS7xLxEg4TZAAAAAMAAgAsAhATMhNUE2QAAAAEAAIAMgJWE2QThhOeE2QAAAAEAAIAOgKgE6kTyxPoE2QAAAADAAIAQgLqEwwULhRkAAAABQACAEgCMBQ9FFYUWBRxFGQAAAAFAAIAUgJzFH0UmRSbFLcUZAAAAAUAAgBcArkUxhTfFOEU+hRkAAAABQACAGYC/BQGFSIVJBVAFWQAAAAFAAIAcAJCFVIVaBVqFYAVZAAAAAUAAgB6AoIVkhWoFaoVwBVkAAAABQACAIQCwhXVFegV6hX9FWQAAAAFAAIAjgL/FQ0WJRYnFj8WZAAAAAUAAgCYAkEWShZnFmkWhhZkAAAABAACAKICiBabFr0W0BZkAAAABAACAKoC0hbgFgIXGhdkAAAABAACALICHBclF0cXZBdkAAAABQACALoCZhdzF4wXjhenF2QAAAADAAIAxAKpF88X7RdkAAAAAwACAMoC7xcKGDMYZAAAAAMAAgDQAjUYWxh5GGQAAAADAAIA1gJ7GJoYvxhkAAAAAwACANwCwRjrGAUZZAAAAAMAAgDiAgcZKRlLGWQAAAAEAAEAAABNGU8ZURlTGWQAAAAEAAEABABVGVcZWRlbGWQAAAAEAAEACABdGV8ZYRljGWQAAAAEAAEADABlGWcZaRlrGWQAAAADAAEAEABtGW8ZcRlkAAAABAABABMAcxl1GXcZeRlkAAAAEwACAAAAAAALABMAIQAwAD0ATABUAF0AaQBzAHwAiACSAJsApwCuALYAwwBkAAAACQACACYAxQDHANAA1gDwAPcAEwEZASABZAAAAAwAAgA4ACIBJAErATQBOgFUAVsBdwF9AYQBhgGIAWQAAAAWAAIAUACKAZUBnQGsAboByAHWAd4B5QHwAfYBAQIIAhMCGQIkAisCNgI8AkQCTAJZAmQAAAAWAAIAfABbAmYCbgJ9AosCmQKnAq8CtgLBAscC0gLZAuQC6gL1AvwCBwMNAxUDHQMqA2QAAAAVAAIAqAAsAzcDPwNNA1wDaQN4A4ADhwOSA5wDowOqA7UDvwPGA80D2APiA+oD9wNkAAAABQACANIA+QP7AwMEBQQNBGQAAAAFAAIA3AAPBBEEGQQbBCMEZAAAABUAAgDmACUEMQQ5BEYEVQRiBHEEeQSABIsElQScBKMErgS4BL8ExgTRBNsE4wTwBGQAAAAHAAIAEAHyBPQE/AT+BAAFAgUEBWQAAAAJAAIAHgEGBQgFEAUSBRQFFgUYBRoFHAVkAAAADgACADABHgVWBV4FZwVyBX0FhgWRBZwFpQWwBbgFwAXNBWQAAAASAAIATAHPBdoF4gXwBf8FDAYbBiMGLAY3BkIGSwZWBmEGagZ1Bn0GhQZkAAAAEwACAHABhwaTBpsGqga3BsYG0wbbBuUG8Ab6BgQHDwcZByMHLgc1Bz0HSgdkAAAAEwACAJYBTAdXB18HbQd8B4kHmAegB6kHtQe/B8gH1AfeB+cH8wf6BwIIDwhkAAAAEwACALwBEQgcCCQIMghBCE4IXQhlCG4IeQiECI0ImAijCKwItwi/CMcI1AhkAAAAEAACAOIB1gjhCOkIFgkeCSgJKgk1CT8JQQlMCVYJWAlgCWgJdQlkAAAAEwACAAICdwmCCYoJmQmnCbUJwwnLCdUJ1wniCewJ7gn5CQMKBQoNChUKIgpkAAAAFQACACgCJAovCjcKRQpUCmEKcAp4Cn8KigqUCpsKogqtCrcKvgrFCtAK2griCu8KZAAAABMAAgBSAvEK/AoECxMLIQsvCz0LRQtPC1oLZAtuC3kLgwuNC5gLnwunC7QLZAAAAAcAAgB4ArYLuAvTC9kL9Qv7CwIMZAAAAAsAAgCGAgQMBgwODBkMNAw6DFYMXAxjDGUMZwxkAAAAGwACAJwCaQx0DHwMigyZDKYMtQy9DL8MwQzDDMUMxwzJDMsMzQzPDNEM0wzVDNcM2QzbDN0M3wzhDO4MZAAAABMAAgDSAvAM/AwEDRMNIA0vDTwNRA1NDVgNYw1sDXcNgg2LDZYNng2mDbMNZAAAABMAAgD4ArUNwA3IDdYN5Q3yDQEOCQ4SDh4OKA4xDj0ORw5QDlwOYw5rDngOZAAAABMAAgAeA3oOhg6ODp0Oqg65DsYOzg7XDuIO7Q72DgEPDA8VDyAPKA8wDz0PZAAAABMAAgBEAz8PSw9TD2IPbw9+D4sPkw+dD6gPsg+8D8cP0Q/bD+YP7Q/1DwIQZAAAAAwAAgBqAwQQDxAXEEQQTBBaEGcQdRCCEJAQmhCiEGQAAAAUAAIAggOkEK8QtxDAEMkQ0hDcEOQQ7RD2EAARCBEWESMRMRE+EUwRVhFeEWsRZAAAABUAAgCqA20ReRGBEY4RnRGqEbkRwRHIEdMR3RHkEesR9hEAEgcSDhIZEiMSKxI4EmQAAAAVAAIA1AM6EkUSTRJbEmoSdxKGEo4SlRKgEqoSsRK4EsMSzRLUEtsS5hLwEvgSBRNkAAAADAACAP4DBxMTExsTThNZE2MTbRN4E4ITjBOXE6ETZAAAABUAAgAWBKMTrxO3E8QT0xPgE+8T9xP+EwkUExQaFCEULBQ2FD0URBRPFFkUYRRuFGQAAAATAAIAQARwFHsUgxSSFKAUrhS8FMQUzhTZFOMU7RT4FAIVDBUXFR4VJhUzFWQAAAAYAAIAZgQ1FUAVSBVKFVIVWRVgFWgVbhV2FX0VhBWLFZMVmRWhFagVrxW2Fb4VxBXMFdQV4RVkAAAABQACAJYE4xXuFfYV+BUAFmQAAAAVAAIAoAQCFg0WFRYjFjIWPxZOFlYWXRZoFnIWeRaAFosWlRacFqMWrha4FsAWzRZkAAAAEwACAMoEzxbbFuMW8hb/Fg4XGxcjFywXNxdCF0sXVhdhF2oXdRd9F4UXkhdkAAAAEQACAPAElBefF6cXtRfEF9EX4BfoF/UXARgHGBQYIBgmGDMYPhhGGGQAAAATAAIAEgVIGFMYWxhpGHgYhRiUGJwYphixGLsYxRjQGNoY5BjvGPYY/hgLGWQAAAAVAAIAOAUNGRkZIRkuGT0ZShlZGWEZaBlzGX0ZhBmLGZYZoBmnGa4ZuRnDGcsZ2BlkAAAAEwACAGIF2hnlGe0Z+xkKGhcaJhouGjcaQxpNGlYaYhpsGnUagRqIGpAanRpkAAAABAACAIgFnxqhGqoathpkAAAADwACAJAFuBrDGssa2RroGvUaBBsMGxkbJxs0G0IbTxtaG2IbZAAAABAAAgCuBWQbbxt3G4UblBuhG7AbuBvFG9Mb4BvuG/sbBhwOHBscZAAAAAQAAgDOBR0cHxwoHDQcZAAAABMAAgDWBTYcQhxKHFkcZhx1HIIcihyUHJ8cqRyzHL4cyBzSHN0c5BzsHPkcZAAAABUAAgD8BfscBx0PHRwdKx04HUcdTx1WHWEdax1yHXkdhB2OHZUdnB2nHbEduR3GHWQAAAATAAIAJgbIHdQd3B3rHfgdBx4UHhweJR4wHjseRB5PHloeYx5uHnYefh6LHmQAAAAMAAIATAaNHo8elx6gHqkesh68HsQezR7WHuAe6B5kAAAACgACAGQG6h7sHvUe/h4HHxEfGR8iHysfNR9kAAAAFQACAHgGNx9DH0sfWB9nH3Qfgx+LH5IfnR+nH64ftR/AH8of0R/YH+Mf7R/1HwIgZAAAABMAAgCiBgQgBiAUICMgMCA/IEcgTiBZIGMgaiBxIHwghiCNIJQgnyCpILEgZAAAABUAAgDIBrMgviDGINQg4yDwIP8gByEOIRkhIyEqITEhPCFGIU0hVCFfIWkhcSF+IWQAAAATAAIA8gaAIYwhlCGjIbAhvyHMIdQh3SHoIfMh/CEHIhIiGyImIi4iNiJDImQAAAAIAAIAGAdFIkciTyJdImwieSKIIpAiZAAAABkAAgAoB5IinSKlIrMiwiLPIt4i5iLtIvQi/CICIwojESMYIx8jJyMtIzUjPCNDI0ojUiNYI2AjZAAAABsAAgBaB2IjbSN1I4MjkiOfI64jtiO9I8QjzCPSI9oj4SPoI+8j9yP9IwUkDCQTJBokIiQoJDAkMiQ/JGQAAAATAAIAkAdBJEwkVCRiJHEkfiSNJJUknySqJLQkviTJJNMk3SToJO8k9yQEJWQAAAATAAIAtgcGJRElGSUnJTYlQyVSJVolYyVvJXklgiWOJZgloSWtJbQlvCXJJWQAAAATAAIA3AfLJdYl3iXsJfslCCYXJh8mKCY0Jj4mRyZTJl0mZiZyJnkmgSaOJmQAAAAGAAIAAgiQJp8mrSa8Jskm2CZkAAAAEgACAA4I2iblJu0m+yYKJxcnJicuJzknRSdNJ1gnZCdsJ3cngyeIJ5AnZAAAABUAAgAyCJInnSelJ6cnrye2J8EnxyfPJ9Yn3SfoJ+4n9if9JwQoDygVKB0oHygsKGQAAAAOAAIAXAguKDkoQShDKEsoUihdKGMocSh8KIIokCibKKEoZAAAABQAAgB4CKMorii2KL8oyCjRKNso4yjsKPUo/ygHKRUpIikwKT0pSylVKV0pailkAAAAGwACAKAIbCl3KX8pjSmcKakpuCnAKcIpxCnGKcgpyinMKc4p0CnSKdQp1inYKdop3CneKeAp4inkKfEpZAAAABAAAgDWCPMp/ikGKhQqIyowKj8qRypUKmIqbyp9KooqlSqdKqoqZAAAABQAAgD2CKwqtyq/Ksgq0SraKuQq7Cr1Kv4qCCsQKx4rKys5K0YrVCteK2YrcytkAAAAEwACAB4JdSuAK4grlyulK7MrwSvJK9Mr3ivoK/Ir/SsHLBEsHCwjLCssOCxkAAAAEQACAEQJOixFLE0sWyxqLHcshiyOLJsspyytLLosxizMLNks5CzsLGQAAAAQAAIAZgnuLPksAS0PLR4tKy06LUItTy1dLWoteC2FLZAtmC2lLWQAAAAUAAIAhgmnLd8t5y3uLfUt/S0DLgsuEi4ZLiAuKC4uLjYuPS5ELksuUy5ZLmEuZAAAABsAAgCuCWMubi52LoQuky6gLq8uty6+LsUuzS7TLtsu4i7pLvAu+C7+LgYvDS8ULxsvIy8pLzEvMy9AL2QAAAAFAAIA5AlCL1EvXy+4L8AvZAAAABMAAgDuCcIvzS/VL+Mv8i//Lw4wFjAfMCswNTA+MEowVDBdMGkwcDB4MIUwZAAAAA0AAgAUCocwwzDKMNUw3zDmMO0w+DACMQkxEDEbMSUxZAAAABUAAgAuCicxMzE7MUgxVzFkMXMxezGCMY0xlzGeMaUxsDG6McExyDHTMd0x5THyMWQAAAATAAIAWAr0MQAyCDIXMiQyMzJAMkgyUTJcMmcycDJ7MoYyjzKaMqIyqjK3MmQAAAAFAAIAfgq5MsQyzDLOMtYyZAAAABUAAgCICtgy4zLrMvkyCDMVMyQzLDMzMz4zSDNPM1YzYTNrM3IzeTOEM44zljOjM2QAAAAGAAIAsgqlM6cztTPEM9Ez4DNkAAAAEQACAL4K4jPkM+wz+jMJNBY0JTQtNC80NTQ9ND80RTRNNE80VTRdNGQAAAATAAIA4ApfNGo0cjSANI80nDSrNLM0vDTINNI02zTnNPE0+jQGNQ01FTUiNWQAAAAGAAIABgskNTM1QTVQNV01bDVkAAAABgACABILbjV9NYs1mjWnNbY1ZAAAABMAAgAeC7g1wzXLNdk16DX1NQQ2DDYONhA2EjYUNhY2GDYaNhw2HjYgNi02ZAAAAA8AAgBECy82MTY/Nk42WzZqNnw2gjaKNow2kjaaNpw2ojaqNmQAAAARAAIAYgusNq42tjbENtM24DbvNvc2+Tb/Ngc3CTcPNxc3GTcfNyc3ZAAAAAUAAgCECyk3KzctNy83MTdkAAAABgACAI4LMzc1Nzc3OTc7Nz03ZAAAAAcAAgCaCz83QTdDN0U3RzdJN0s3ZAAAAAgAAgCoC003WTdhN3A3fTeMN5k3oTdkAAAAEgACALgLozevN7c3xjfTN+I37zf3NwE4DDgWOCA4Kzg1OD84SjhROFk4ZAAAABMAAgDcC1s4ZjhuOHw4iziYOKc4rzi4OMQ4zjjXOOM47Tj2OAI5CTkROR45ZAAAABUAAgACDCA5LDk0OUE5UDldOWw5dDl7OYY5kDmXOZ45qTmzObo5wTnMOdY53jnrOWQAAAATAAIALAztOfg5ADoOOh06Kjo5OkE6SjpWOmA6aTp1On86iDqUOps6ozqwOmQAAAASAAIAUgyyOr06xTrTOuI67zr+OgY7ETsdOyU7MDs8O0Q7TztbO2A7aDtkAAAAEwACAHYMajt1O307jDuaO6g7tju+O8g70zvdO+c78jv8OwY8ETwYPCA8LTxkAAAAFQACAJwMLzw6PEI8UDxfPGw8ezyDPIo8lTyfPKY8rTy4PMI8yTzQPNs85TztPPo8ZAAAABQAAgDGDPw8Bz0PPSg9Kj0yPTo9RD1MPVU9XT1nPW89eD2APYo9kj2YPaE9rT1kAAAAEAACAO4Mrz3rPfM9/T0FPg4+Fj4gPig+MT45PkM+Sz5RPlo+Zj5kAAAAEwACAA4NaD50Pnw+iz6YPqc+tD68PsY+0T7bPuU+8D76PgQ/Dz8WPx4/Kz9kAAAAEwACADQNLT84P0A/Tj9dP2o/eT+BP4s/lj+gP6o/tT+/P8k/1D/bP+M/8D9kAAAAFQACAFoN8j/+PwZAE0AiQC9APkBGQE1AWEBiQGlAcEB7QIVAjECTQJ5AqECwQL1AZAAAABUAAgCEDb9AykDSQOBA70D8QAtBE0EaQSVBL0E2QT1BSEFSQVlBYEFrQXVBfUGKQWQAAAAYAAIArg2MQZdBn0GhQalBq0GyQbpBvEHEQctBzUHUQdxB3kHmQe1B70H2Qf5BAEIIQgpCF0JkAAAAGAACAN4NGUIkQixCLkI2QjhCP0JHQklCUUJYQlpCYUJpQmtCc0J6QnxCg0KLQo1ClUKXQqRCZAAAAAwAAgAODqZC4kLrQvZCAUMKQxVDIEMpQzRDPENEQ2QAAAASAAIAJg5GQ1FDWUNnQ3ZDg0OSQ5pDo0OuQ7lDwkPNQ9hD4UPsQ/RD/ENkAAAABQACAEoO/kMARAJEBEQGRGQAAAAFAAIAVA4IRC9ETUR0RJNEZAAAAAUAAgBeDpVEtUTaRPpEIEVkAAAABQACAGgOIkVFRWdFikWtRWQAAAAFAAIAcg6vRdpF9EUfRjpGZAAAAAUAAgB8DjxGWEaBRp1Gx0ZkAAAABwABAAAAyUbLRs1Gz0bRRtNG1UZkAAAABwABAAcA10bZRttG3UbfRuFG40ZkAAAABwABAA4A5UbnRulG60btRu9G8UZkAAAABwABABUA80b1RvdG+Ub7Rv1G/0ZkAAAAAwAAAAAAAUcDRwVHZAAAAAYAAQAcAAdHCUcLRw1HD0cRR2QAAAAFAAEAIgATRxVHF0cZRxtHZAAAAAUAAQAnAB1HH0c5R09HUUdkAAAABwABACwAU0dVR1dHWUdbR11HX0dkAAAACQAAAAAAYUdjR2VHZ0dpR2tHbUdvR3FHZAAAAAkAAAAAAHNHdUd3R3lHe0d9R39HgUeDR2QAAAACAAAAAACFR4dHZAAAAAUAAQAzAIlHi0eTR5VHo0dkAAAAAgAAAAAApUenR2QAAAAFAAEAOACpR6tHs0e1R8NHZAAAAAsAAgAAAAAAAgAJABIAHQAoADEAPABHAFAAVQBkAAAADQACABYAVwBZAGAAZwByAHwAgwCKAJUAnwCmAK0AtABkAAAADQACADAAtgC4AL8AxgDRANsA4gDpAPQA/gAFAQwBEwFkAAAADQACAEoAFQEXAR4BJQEwAToBQQFIAVMBXQFkAWsBcgFkAAAACgACAGQAdAF2AX0BhwGSAZwBpgGxAbsBxQFkAAAADAACAHgAxwHJAdEB2wHjAewB9AH+AQYCDwIXAh0CZAAAAAwAAgCQAB8CIQIpAjMCOwJEAkwCVgJeAmcCbwJ1AmQAAAARAAIAqAB3AnkCgAKCAokCkQKTApsCogKkAqsCswK1Ar0CxALGAs0CZAAAABEAAgDKAM8C0QLYAtoC4QLpAusC8wL6AvwCAwMLAw0DFQMcAx4DJQNkAAAACgACAOwAJwMpAzADOgNFA08DWQNkA24DeANkAAAAEgACAAABegN8A4EDhwOJA4sDjQOPA5EDkwOVA5cDmQObA50DnwOhA6MDZAAAAAgAAgAkAaUDpwOuA7wDyQPXA+QD7gNkAAAACwACADQB8APyA/kDAgQOBBgEIQQtBDcEQARFBGQAAAAIAAIASgFHBEkEUAReBGsEeQSGBJAEZAAAAAgAAgBaAZIElASbBKkEtgTEBNEE2wRkAAAADQACAGoB3QTfBOYE7QT4BAIFCQUQBRsFJQUsBTMFOgVkAAAACwACAIQBPAU+BUUFTgVZBWQFbQV4BYMFjAWRBWQAAAAHAAIAmgGTBZUFmwWjBaUFqwWzBWQAAAAIAAIAqAG1BbcFvgXLBdkF5gX0Bf4FZAAAAAsAAgC4AQAGAgYJBhIGHgYoBjEGPQZHBlAGVQZkAAAACAACAM4BVwZZBmAGbQZ7BogGlgagBmQAAAAJAAIA3gGiBqQGrwa7BsMGzgbaBuIG7AZkAAAACwACAPAB7gbwBvIG+wYGBxEHGgclBzAHOQc+B2QAAAAHAAIABgJAB0oHUQdXB3EHeAeMB2QAAAAIAAIAFAKOB5YHnAejB6kHwwfKB94HZAAAAAkAAgAkAuAH4gfsB/cHAQgLCBYIIAgqCGQAAAAKAAIANgIsCC4INQg/CEoIVAheCGkIcwh9CGQAAAALAAIASgJ/CIEIiAiRCJwIpwiwCLsIxgjPCNQIZAAAAAsAAgBgAtYI2AjfCOgI8wj+CAcJEgkdCSYJKwlkAAAABwACAHYCLQkvCToJRAlOCVkJYwlkAAAADQACAIQCZQlnCW4JdQmACYoJkQmYCaMJrQm0CbsJwglkAAAACgACAJ4CxAnGCc0J1wniCewJ9gkBCgsKFQpkAAAACgACALICFwoZCiAKKgo1Cj8KSQpUCl4KaApkAAAACQACAMYCagpsCnkKhQqLCpgKpAqqCrQKZAAAAAsAAgDYArYKuAq/CsgK1AreCucK8wr9CgYLCwtkAAAAEQACAO4CDQsPCxULHAsjCysLMQs5C0ALRwtOC1YLXAtkC2sLcgt5C2QAAAASAAIAEAN7C30LgguIC48LlgueC6QLrAuzC7oLwQvJC88L1wveC+UL7AtkAAAAEQACADQD7gvwC/cL/gsFDA0MEwwbDCIMKQwwDDgMPgxGDE0MVAxbDGQAAAARAAIAVgNdDF8MZgxtDHQMfAyCDIoMkQyYDJ8MpwytDLUMvAzDDMoMZAAAAAgAAgB4A8wMzgzVDOIM8Az9DAsNFQ1kAAAACAACAIgDFw0ZDSANLQ07DUgNVg1gDWQAAAAFAAIAmANiDXENjA2SDaYNZAAAAAcAAgCiA6gNsA22Db8N2g3gDfQNZAAAAA0AAgCwA/YN+A3/DQYOEQ4bDiIOKQ40Dj4ORQ5MDlMOZAAAAAoAAgDKA1UOVw5eDmAOYg5kDmYOaA5qDmwOZAAAAA0AAgDeA24OcA53Dn4OiQ6TDpoOoQ6sDrYOvQ7EDssOZAAAAAsAAgD4A80Ozw7WDt8O6w71Dv4OCg8UDx0PIg9kAAAADAACAA4EJA8mDy0POA9CD0kPUA9bD2UPbA9zD3oPZAAAAA0AAgAmBHwPfg+FD4wPlw+hD6gPrw+6D8QPyw/SD9kPZAAAAAsAAgBABNsP3Q/kD+0P+A8DEAwQFxAiECsQMBBkAAAADQACAFYEMhA0EDsQQhBNEFcQXhBlEHAQehCBEIgQjxBkAAAACQACAHAEkRCTEJ4QqhCyEL0QyRDRENsQZAAAAAcAAgCCBN0Q3xDlEO0Q7xD1EP0QZAAAAAcAAgCQBP8QAREHEQ8REREXER8RZAAAAA0AAgCeBCERIxEqETERPBFGEU0RVBFfEWkRcBF3EX4RZAAAAAsAAgC4BIARghGJEZIRnhGoEbERvRHHEdAR1RFkAAAACwACAM4E1xHZEeAR6RH1Ef8RCBIUEh4SJxIsEmQAAAAKAAIA5AQuEjASNxJBEkwSVhJgEmsSdRJ/EmQAAAAKAAIA+ASBEoMSihKUEp8SqRKzEr4SyBLSEmQAAAALAAIADAXUEtYS3RLmEvIS/BIFExETGxMkEykTZAAAAAoAAgAiBSsTLRM0Ez4TSRNTE10TaBNyE3wTZAAAAA0AAgA2BX4TgBOHE44TmROjE6oTsRO8E8YTzRPUE9sTZAAAAAsAAgBQBd0T3xPmE+8T+hMFFA4UGRQkFC0UMhRkAAAAEgACAGYFNBQ2FDsUQRRIFE8UVxRdFGUUbBRzFHoUghSIFJAUlxSeFKUUZAAAAA0AAgCKBacUqRSwFLcUwhTMFNMU2hTlFO8U9hT9FAQVZAAAAAsAAgCkBQYVCBUPFRgVJBUuFTcVQxVNFVYVWxVkAAAADwACALoFXRVfFWYVbRV4FX4VhhWNFZQVnxWlFa0VtBW7FcIVZAAAAAcAAgDYBcQVxhXRFdcV5RXwFfYVZAAAAA0AAgDmBfgV+hUBFggWExYdFiQWKxY2FkAWRxZOFlUWZAAAAAQAAgAABlcWWRZgFmkWZAAAAAoAAgAIBmsWbRZ0Fn4WiRaTFp0WqBayFrwWZAAAAAgAAgAcBr4WwBbHFtUW4hbwFv0WBxdkAAAADQACACwGCRcLFxIXGRckFy4XNRc8F0cXURdYF18XZhdkAAAADQACAEYGaBdqF3EXeBeDF40XlBebF6YXsBe3F74XxRdkAAAACQACAGAGxxfJF9YX4hfoF/UXARgHGBEYZAAAAA0AAgByBhMYFRgcGCMYLhg4GD8YRhhRGFsYYhhpGHAYZAAAAAsAAgCMBnIYdBh7GIQYkBiaGKMYrxi5GMIYxxhkAAAACwACAKIGyRjLGNIY2xjmGPEY+hgFGRAZGRkeGWQAAAAKAAIAuAYgGSIZKRkzGTUZQBlKGUwZVxlhGWQAAAAKAAIAzAZjGWUZbBl2GXgZgxmNGY8ZmhmkGWQAAAAKAAIA4AamGagZrxm5GcQZzhnYGeMZ7Rn3GWQAAAANAAIA9Ab5GfsZAhoJGhQaHholGiwaNxpBGkgaTxpWGmQAAAAKAAIADgdYGloaYxpuGnkaghqNGpgaoRqmGmQAAAALAAIAIgeoGqoasRq6GsUa0BrZGuQa7xr4Gv0aZAAAAA0AAgA4B/8aARsIGw8bGhsgGysbMhs9G0MbThtVG1wbZAAAAA0AAgBSB14bYBtnG24beRt/G4obkRucG6IbrRu0G7sbZAAAAAsAAgBsB70bvxvGG88b2hvlG+4b+RsEHA0cEhxkAAAACgACAIIHFBwWHB0cJxwyHDwcRhxRHFscZRxkAAAADQACAJYHZxxpHHAcdxyCHIwckxyaHKUcrxy2HL0cxBxkAAAAEgACALAHxhzIHM0c0xzVHNcc2RzbHN0c3xzhHOMc5RznHOkc6xztHO8cZAAAAAsAAgDUB/Ec8xz6HAMdDx0ZHSIdLh04HUEdRh1kAAAAAwACAOoHSB1SHVsdZAAAAAYAAgDwB10dXx1hHWMdZR1nHWQAAAAGAAIA/AdpHWsdbR1vHXEdcx1kAAAABAACAAgIdR13HXkdex1kAAAABQACABAIfR1/HYEdgx2FHWQAAAAIAAIAGgiHHYkdix2NHY8dkR2THZUdZAAAAAMAAgAqCJcdmR2bHWQAAAADAAIAMAidHckd2R1kAAAAAwACADYI2x3/HRceZAAAAAMAAgA8CBkeQB5VHmQAAAADAAIAQghXHocekx5kAAAAAwACAEgIlR60HtEeZAAAAAIAAQAAANMe1R5kAAAAAgABAAIA1x7ZHmQAAAACAAEABADbHt0eZAAAAAIAAQAGAN8e4R5kAAAAAgAAAAAA4x7lHmQAAAADAAEACADnHuke6x5kAAAAAgABAAsA7R7vHmQAAAACAAAAAADxHvMeZAAAAAUAAQANAPUe9x75HhMfKB9kAAAAAgABABIAKh8sH2QAAAAFAAAAAAAuHzAfMh80HzYfZAAAAAUAAAAAADgfOh88Hz4fQB9kAAAAAgAAAAAAQh9EH2QAAAACAAEAFABGH0gfZAAAAAIAAAAAAEofTB9kAAAAAgABABYATh9QH2QAAAANAAIAAAAAAAcADwAVAB0AJAArADIAOgBAAEgATwBWAGQAAAAIAAIAGgBYAFoAZQBwAHkAhACPAJYAZAAAAAgAAgAqAJgAmgCcAJ4AoACiAKQApgBkAAAABwACADoAqACqALUAwADJANQA3wBkAAAACAACAEgA4QDjAO4A+QACAQ0BGAEfAWQAAAAMAAIAWAAhASgBMAE2AT4BRQFMAVMBWwFhAWkBcAFkAAAADQACAHAAcgF5AYEBhwGPAZYBnQGkAawBsgG6AcEByAFkAAAADQACAIoAygHRAdkB3wHnAe4B9QH8AQQCCgISAhkCIAJkAAAADQACAKQAIgIpAjECNwI/AkYCTQJUAlwCYgJqAnECeAJkAAAACQACAL4AegKFAosClgKdAqgCrgK5AsACZAAAAAkAAgDQAMICzQLTAt4C5QLwAvYCAQMIA2QAAAAIAAIA4gAKAwwDFwMiAysDNgNBA0gDZAAAAAgAAgDyAEoDTANXA2IDawN2A4EDiANkAAAACAACAAIBigOMA5cDoQOrA7YDwAPHA2QAAAAMAAIAEgHJA9AD2APaA+ID6QPrA/ID+gP8AwQECwRkAAAADAACACoBDQQUBBwEHgQmBC0ELwQ2BD4EQARIBE8EZAAAAAcAAgBCAVEEUwRZBGEEYwRpBHEEZAAAAAcAAgBQAXMEdQR7BIMEhQSLBJMEZAAAAA0AAgBeAZUElwSZBJsEnQSfBKEEowSlBKcEqQSrBK0EZAAAAAYAAgB4Aa8EsQS/BMwE2gThBGQAAAAGAAIAhAHjBOUE8wQABQ4FFQVkAAAABgACAJABFwUZBSYFNAVBBUgFZAAAAAYAAgCcAUoFTAVZBWcFdAV7BWQAAAAIAAIAqAF9BX8FigWUBZ4FqQWzBboFZAAAAAcAAgC4AbwFvgXEBcwFzgXUBdwFZAAAAAgAAgDGAd4F4AXiBe0F9wX5BQQGCwZkAAAACAACANYBDQYPBhEGHAYmBigGMwY6BmQAAAANAAIA5gE8Bj4GQAZCBkQGRgZIBkoGTAZOBlAGUgZUBmQAAAAJAAIAAAJWBmEGawZyBnkGhAaOBpUGnAZkAAAACQACABICngapBrMGugbBBswG1gbdBuQGZAAAAAYAAgAkAuYG6Ab2BgMHEQcYB2QAAAAGAAIAMAIaBxwHKQc3B0QHSwdkAAAACAACADwCTQdPB1oHZAduB3kHgweKB2QAAAAIAAIATAKMB44HmQejB60HuAfCB8kHZAAAAAgAAgBcAssHzQfYB+MH7Af3BwIICQhkAAAACQACAGwCCwgNCBcIHwgoCDAIOghCCEsIZAAAAAkAAgB+Ak0ITwhZCGEIaghyCHwIhAiNCGQAAAALAAIAkAKPCJoIoAioCK8ItgjBCMcIzwjWCN0IZAAAAAYAAgCmAt8I6gjwCP4ICQkPCWQAAAAIAAIAsgIRCRMJHgkoCTIJPQlHCU4JZAAAAAgAAgDCAlAJUgldCWcJcQl8CYYJjQlkAAAACAACANICjwmRCZ0JpwmwCbwJxgnNCWQAAAAIAAIA4gLPCdEJ3QnnCfAJ/AkGCg0KZAAAAAgAAgDyAg8KEQodCicKMAo8CkYKTQpkAAAACAACAAIDTwpRCl0KZwpwCnwKhgqNCmQAAAAIAAIAEgOPCpEKnQqnCrAKvArGCs0KZAAAAAgAAgAiA88K0QrdCucK8Ar8CgYLDQtkAAAACQACADIDDwsaCyQLKwsyCz0LRwtOC1ULZAAAAAkAAgBEA1cLYgtsC3MLeguFC48LlgudC2QAAAAJAAIAVgOfC6oLtAu7C8ILzQvXC94L5QtkAAAACQACAGgD5wvyC/wLAwwKDBUMHwwmDC0MZAAAAAYAAgB6Ay8MMQw+DEwMWQxgDGQAAAAGAAIAhgNiDGQMcgx/DI0MlAxkAAAACAACAJIDlgyYDKMMrQy3DMIMzAzTDGQAAAAHAAIAogPVDNcM4gzsDPYMAQ0LDWQAAAAIAAIAsAMNDQ8NGg0lDS4NOQ1EDUsNZAAAAAgAAgDAA00NTw1aDWUNbg15DYQNiw1kAAAACAACANADjQ2PDZoNpA2uDbkNww3KDWQAAAAIAAIA4APMDc4N2Q3jDe0N+A0CDgkOZAAAAAgAAgDwAwsODQ4ZDiMOLA44DkIOSQ5kAAAACAACAAAESw5NDlkOYw5sDngOgg6JDmQAAAAHAAIAEASLDo0OmQ6hDqwOuA7ADmQAAAAHAAIAHgTCDsQO0A7YDuMO7w73DmQAAAAIAAIALAT5DvsOBw8RDxoPJg8wDzcPZAAAAAgAAgA8BDkPOw9HD1EPWg9mD3APdw9kAAAACQACAEwEeQ+ED44PlQ+cD6cPsQ+4D78PZAAAAAkAAgBeBMEPzA/WD90P5A/vD/kPABAHEGQAAAAJAAIAcAQJEBQQHhAlECwQNxBBEEgQTxBkAAAABgACAIIEURBcEGYQcBB7EIUQZAAAAAkAAgCOBIcQkhCcEKMQqhC1EL8QxhDNEGQAAAAJAAIAoATPENoQ5BDrEPIQ/RAHEQ4RFRFkAAAACQACALIEFxEiESwRMxE6EUURTxFWEV0RZAAAAAgAAgDEBF8RYRFsEXYRgBGLEZURnBFkAAAACAACANQEnhGgEasRtRG/EcoR1BHbEWQAAAAIAAIA5ATdEd8R6hH1Ef4RCRIUEhsSZAAAAAgAAgD0BB0SHxIqEjUSPhJJElQSWxJkAAAABwACAAQFXRJfEmsScRJ+EooSkBJkAAAABwACABIFkhKUEqASphKzEr8SxRJkAAAACQACACAFxxLSEtwS4xLqEvUS/xIGEw0TZAAAAAkAAgAyBQ8TGhMkEysTMhM9E0cTThNVE2QAAAAJAAIARAVXE2ITbBNzE3oThROPE5YTnRNkAAAACQACAFYFnxOqE7QTuxPCE80T1xPeE+UTZAAAAAkAAgBoBecT8hP8EwMUChQVFB8UJhQtFGQAAAAIAAIAegUvFDEUPBRHFFAUWxRmFG0UZAAAAAkAAgCKBW8UehSEFIsUkhSdFKcUrhS1FGQAAAAJAAIAnAW3FMIUzBTTFNoU5RTvFPYU/RRkAAAAAwACAK4F/xQBFQMVZAAAAAMAAgC0BQUVHhUzFWQAAAADAAIAugU1FUoVYxVkAAAAAwACAMAFZRV8FZMVZAAAAAMAAgDGBZUVsRXDFWQAAAADAAIAzAXFFdcV8xVkAAAABAABAAAA9RX3FfkV+xVkAAAABAABAAQA/RX/FQEWAxZkAAAABAABAAgABRYHFgkWCxZkAAAABAABAAwADRYPFhEWExZkAAAAAwABABAAFRYXFhkWZAAAAAQAAQATABsWHRYfFiEWZAAAAAUAAAAAACMWJRYnFikWKxZkAAAABQAAAAAALRYvFjEWMxY1FmQAAAACAAAAAAA3FjkWZAAAAAIAAQAXADsWPRZkAAAAAgAAAAAAPxZBFmQAAAACAAEAGQBDFkUWZAAAAAIAAAAAAAAAAwBkAAAAAwACAAAABwARACEAZAAAAAMAAgAGACMALQA9AGQAAAADAAIADAA/AEkAWQBkAAAAAwACABIAWwBlAHUAZAAAAAMAAgAYAHcAgQCRAGQAAAADAAIAHgCTAJ0ArQBkAAAAAgACACQArwDFAGQAAAACAAIAKADHANEAZAAAAAMAAgAsANMA3QDtAGQAAAADAAIAMgDvAPkACQFkAAAAAgACADgACwEVAWQAAAACAAIAPAAXASEBZAAAAAMAAgBAACMBJQE1AWQAAAAEAAIARgA3AT4BRQFVAWQAAAAEAAIATgBXAV4BZQF1AWQAAAADAAIAVgB3AYEBkQFkAAAAAwACAFwAkwGdAa0BZAAAAAMAAgBiAK8BuQHJAWQAAAADAAIAaADLAdUB5QFkAAAAAwACAG4A5wHxAQECZAAAAAMAAgB0AAMCDQIdAmQAAAADAAIAegAfAikCOQJkAAAAAwACAIAAOwJFAlUCZAAAAAMAAgCGAFcCYQJxAmQAAAADAAIAjABzAn0CjQJkAAAAAwACAJIAjwKaAqkCZAAAAAMAAgCYAKsCrQK9AmQAAAADAAIAngC/AsEC0QJkAAAAAgACAKQA0wLVAmQAAAADAAIAqADXAuEC8QJkAAAAAwACAK4A8wL9Ag0DZAAAAAMAAgC0AA8DEQMhA2QAAAADAAIAugAjAy0DPQNkAAAAAwACAMAAPwNJA1kDZAAAAAMAAgDGAFsDXQNtA2QAAAADAAIAzABvA3kDiQNkAAAAAgACANIAiwOTA2QAAAAEAAIA1gCVA50DnwOhA2QAAAACAAIA3gCjA60DZAAAAAMAAgDiAK8DsQPBA2QAAAADAAIA6ADDA80D3QNkAAAAAgACAO4A3wPpA2QAAAACAAIA8gDrA/UDZAAAAAMAAgD2APcDAQQRBGQAAAADAAIA/AATBBUEFwRkAAAAAwACAAIBGQQbBB0EZAAAAAMAAgAIAR8EKQQ5BGQAAAACAAIADgE7BFEEZAAAAAMAAgASAVMEXQRtBGQAAAADAAIAGAFvBHkEiQRkAAAAAwACAB4BiwSVBKUEZAAAAAMAAgAkAacEsQTBBGQAAAACAAIAKgHDBNkEZAAAAAIAAgAuAdsE5QRkAAAAAQACADIB5wRkAAAAAQACADQB6QRkAAAAAgACADYB6wTtBGQAAAADAAIAOgHvBPkECQVkAAAAAwACAEABCwUVBSUFZAAAAAMAAgBGAScFMgVBBWQAAAADAAIATAFDBU0FXQVkAAAAAwACAFIBXwVpBXkFZAAAAAIAAgBYAXsFkQVkAAAAAgACAFwBkwWbBWQAAAAEAAIAYAGdBaUFpwWpBWQAAAADAAIAaAGrBbYFxQVkAAAAAwACAG4BxwXSBeEFZAAAAAMAAgB0AeMF7QX9BWQAAAADAAIAegH/BQkGGQZkAAAAAwACAIABGwYlBjUGZAAAAAMAAgCGATcGQQZRBmQAAAADAAIAjAFTBl0GbQZkAAAAAwACAJIBbwZ5BokGZAAAAAMAAgCYAYsGjQadBmQAAAACAAIAngGfBrUGZAAAAAIAAgCiAbcGwQZkAAAAAwACAKYBwwbNBt0GZAAAAAMAAgCsAd8G6Qb5BmQAAAADAAIAsgH7Bv0GDQdkAAAAAwACALgBDwcZBykHZAAAAAMAAgC+ASsHNQdFB2QAAAADAAIAxAFHB1EHYQdkAAAAAwACAMoBYwdtB30HZAAAAAIAAgDQAX8HiQdkAAAAAwACANQBiweVB6UHZAAAAAIAAgDaAacHsQdkAAAAAwACAN4Bswe9B80HZAAAAAIAAgDkAc8H2QdkAAAAAwACAOgB2wflB/UHZAAAAAMAAgDuAfcHAQgRCGQAAAADAAIA9AETCB0ILQhkAAAAAwACAPoBLwg5CEkIZAAAAAMAAgAAAksIVQhlCGQAAAADAAIABgJnCHEIgQhkAAAAAwACAAwCgwiNCJ0IZAAAAAIAAQAAAJ8IoQhkAAAAAgABAAIAowilCGQAAAACAAEABACnCKkIZAAAAAIAAAAAAKsIrQhkAAAAAgABAAYArwixCGQAAAACAAEACACzCLUIZAAAAAEAAAAAALcIZAAAAAEAAQAKALkIZAAAAAEAAAAAALsIZAAAAAEAAQALAL0IAAA=","textureAtlases":["iVBORw0KGgoAAAANSUhEUgAABAAAAAQACAYAAAB/HSuDAAKDXUlEQVR4Aez9D9B921nXCd77o/t21c/ien5mokOpTZsOOPZIteOATqMOatutASfdKJAEM+k4ts0fmVATuNcpBrrIDYykMyYaw5gxdnACyVxpAjaaSCINVHeGApOUOkZCCSbVhi6GAamh23RPQXvf2Z9zz+fwfZ937T/nvOd933POu3bVOs9aa6+99trPWnvv9XnW2us89ljfuga6BroGuga6BroGuga6BroGuga6BroGuga6BroGugZuRAMPhlx3cTdSiJ5p10DXQNdA10DXQNdA18AJa4C+VN+6BroGuga6BroGbkUDuwD8MaS9FaX0k3QNdA10DXQNdA10DXQNHFgD9qOeGPKtzn3IvnUNdA10DXQNdA3srYF8odxX/97K6wd2DXQNdA10DXQNdA10DRxAA/TBKvQ/bMSRphsBDqDwnkXXQNdA18B90MB9BfxDXvd9aCf9GrsGuga6BroGuga6Bm5HAwn+AL9uNfjTGZ9Ggm4IGJTUt66BroGuga6Byxo4JPz2vPqaBpdbVw91DXQNdA10DXQNdA3sq4EK/6tf82se+/WPHj32m6sjfjjJanDVELDvuftxXQNdA10DXQNnpIFjAPW0UN+U/xiu8xBlOKOm1y+la6BroGuga6BroGtgoQbsHz0U/P8nv+Wxz/7X/o3Hfsdv+/zHfp+OMI59xRDA8fRD+tY10DXQNdA1cE81cAgYXZqHL60pSV6+nKbkWB5zx48dtyR+6XXeZbp72oz7ZXcNdA10DXQNdA2cvQbs46zhP8H/877w0/7o7//yB38iHXEYBEjH7IBBO6vBMRvA/tXg7VvXQNdA10DXwH3RwE1C6hhM++JSjqU7lnjLqVxaLtIfk7svbbpfZ9dA10DXQNdA18C5asC+yCX4B/K/6Csf+6ove+qxp//0f/L4G3Wvet1jzxCHQWDCCHCuuurX1TXQNdA10DUQGrgJMG2BsS8qZSvNucUtvdabqINd8ozm0L1dA10DXQNdA10DXQMnoAH7GCtG85neL/wD/U+/8/F3PvM3Hv/+N/7Q4z+M+4ZnH//rX/OXHv/2agTYfA7QZwGcQIX3InYNdA10DVxXA7sA4lzaFrj7Ymrtu+9x6kY5pY853R9y/3XbVD++a6BroGuga6BroGvg5jVg/2E7+s+oPiP/wD/g/+0fevzD7/jY4z/57n/64JM4/BgCXvv2x/8qRgCMBRgN4lMA+yI3X/p+hq6BroGuga6BW9fAIaDRF4XSl5HS+NuWrmxb5W2X4zrnU4fKmhfxN+1uvVH2E3YNdA10DXQNdA10DSzSgP2Dhzn6D9gz8g/8A/1/858/+JTuPb/w4J9hBMA4gJEAY4GfAgxnXA3OWQCLCtATdQ10DXQNdA2cjgauC47CqC8fpfGHlBXijyF8yOtbmpc6VtbjiL8pdzotu5e0a6BroGuga6Br4H5owP7Aevo/IM+3/XznD+AD+oD/D/zyg1/5wYtPu0ASxiiAcSBnAcS/AmgAIO++dQ10DXQNdA2ciQauA4kJnb54Mu46/mMA+0OW4Tq62OXYsXq4Tj23jj2T5t8vo2uga6BroGuga+AsNOD7/5IBwOn/jv4D/zqMAMwCwADAegD5GUBfB+As2kS/iK6BroGugSsaaIHdkrgEUl84GbeP/5CwfWp57aOvuWOsF2WmX1LHS9NcaVQ9omuga6BroGuga6Br4NY14Pu+aQCoMwCcBaABgM8EugHg1uusn7BroGuga+BWNbAU8DJdhcgM7+O/CVBfDVok35uWN1H2muc+Op06xs5Bpsn63dc/qLtvXQNdA10DXQNdA10Dd6gB3/GX1gDgEwBG9xnlB/b9DCA/AWAhQP4NgDUAWAiwfwJwh7XYT9010DXQNXBDGtgH9IRGXzCGd5UVcncNrwadcExK/Hfpanl2vaZd0u+q75re+lO6f582UY8ZqqFvXQNdA10DXQNdA10Dd6QB3unbfwHwLwCBe9cB4FMADAE4v//HQIChgDUDWDsg/gWA/gl59q1roGuga6Br4IQ1UKFtLiwgIkmb4aX+XQC3pl0N5yQOearO8qes17lPeKn+p9LVOp1rD3P7h2rqW9dA10DXQNdA10DXwB1owPf9pc8AmNqvEYCZADpG/oF//wGg/w3gHdRYP2XXQNdA18ANa2AO3up+XyTE699F7gK1q+EcCciED+I2C9msdpWHOv9MPnnNu+irlXaXuqlpax3XtrBLeLjkvnUNdA10DXQNdA10DdyyBnyXb2cB+G8AGAEAfVb753t/HEYBRv6d+v+v/RuP/Q5G//sCgLdca/10XQNdA10DN6SBXQDOFwiQmP4KjWPhCqekq3EZXm32I3d2Cfb4b8NRzjzvPuUeOQa9rAaXMnW11D9WN3Pxtb53bTemHy6hb10DXQNdA10DXQNdA7esAd/z634K3/NjBPBzAGAfYwAOP9P+Hfnv3/7fck3103UNdA10DdywBgSzJdKXx65yKZwm3K6G697J3QbgH+IcXJdGgl2vMdKnrpbolzrLdLvWoelpJ+lf0m5qmiGLvnUNdA10DXQNdA10DdyiBnx/r/sP9EMAe0b3NQQA/DjCuJGRf/oA5NW3roGuga6BroET1EAFs6lwQp/+JbJCZ4arfzXocJE7BIibh9PadpUefyjJtZPXUh2UdOsX+hBXdToXXlKHc2mm2s3YvqGofesa6BroGuga6BroGrhFDfBO5p2+7hvQ56DvgyGg5dg3pF1t0tsXII++dQ10DXQNdA2coAbGwKwV70N/FzkHnuxfDU6Jf9LtCtoJ9Pjvwu1a5lb6Ob2M7F+i/0yzS93agVBybKvdTMUNh/Sta6BroGuga6BroGvgljWQ7+5tH6z2P4YyrQZnP8E+Asf2rWuga6BroGvgRDUwBWe5Lx/6+uekL4w5uRp0N+nqC2kqPAf4HDuX5lD75841dR1T+9AX++f0Fvt9uc/Vhfvn6nZqf7abJf6hmH3rGuga6BroGuga6Bq4ZQ34js53uv0AZe4z/S0Xs5+ua6BroGuga+BQGvBBPifz4b/E70tjSq6Gi2A/ctRNQbD7DgXr5MPUt33kIctAXl7bUjmlw8a+qXqp+5bUt2loR+mfa1e5fzi0b10DJ6OBhzwr+DYWOZSatty3roGuga6BU9VAvo99jyvdd6rX1svdNXCKGqiMRLj3NU6xJo+szD7Q52S+APRPyQqQrfBq0MWkmwPffYA74R5/ywn/rX27xpnXPmWtx8zpI/fP6Xaz3wdLq35acVN1PrZvrm3l/qFYfesaOGoNPMGiWE899bXf9z3vfP0/fN+z33rxI3/rrWv3ile+7B1HXfJeuK6BroGugeUayHcz/r51DXQN3I4GnoA1XvSiF70G9/n/1ue9UWfcp3/6p/8eGGEoDn31vnUN7KyB+oAfC4/BXSu+BY7GrYYS4keOugTZ6q9QPBXmBmL/FLTP7Z86trVv1/xMj9zVVd2Mhad0Hfusoyqp44xr1XkrjrZk/Fi7asUPh/Wta+D4NMBIP9D/4z/01y5wgn9KjAMjJX/wH331K7/pDW945r0YD/CTlnt2JH2P7hroGuga6BroGugauD8aeMA/bQD5f+QPfMG7vuTLXvqjX/WaP/lPnv76P/OcjjDx7McoQFpY5P6oqF/pITTQgq9WXEKc/jGZoDjmXw2Fb7oxgCV+CRy3gPyY44T/Wkbjl1yzaaZ0574xvUc8dUbdjNVdxo+1gbH4VtsaixuK0LeugePRALAu+FeZBgBmBGAoqCUH+OtxGhEwCGwMB9w7fesa6BroGuga6BroGrhHGoADBH8g/43f9g0Xf/HN39x07Hv9N3/dBUaBl77qpZ/EEMCMgEFdq3uksn6pe2pgDLxq/BjMteITDlt+GuaoE1KrFHBbkhuG+AToGs591Y+ljbiWJG4fN5ZfPfcuYa+ppYNWXNVhDU/Vw2Zfq/5aca12UONoU8bV9jUWHg7pW9fAcWiAe+z7v/c7nhsD+DQA4CcdwD+UnntmvQH5Y8cbz+yC3//lD/7EcAD3S9+6BroGuga6BroGzkkD9vnO6ZqufS3AOxAP+Av9QP6UMx2GgFd/zSueY1bAkc0GsO9PP0gGuLauegbX14A34ZS0wqxEwy3ZgsOMWw1FbroKp4ZbYJtxADThJSCdgL8P1B/yGMqb5VlS/prG6059jPnVZ0uO1ckmnvqjzrIeW/5We5iKm2pzuW84dd+6Bu5eA63Re0EfeNcA4HoAAj1GA47F5acD7q95mBdpJz4luHuF9BJ0DXQNdA10DXQNjGsg+3Ithqj7x3M68z3CPyAP1E9Bf2sfx2gEYDbAHRsB1gsjc02Uo+XgmaFKYYm+3YEG6o3XCk8BXN3XgsKMWw3XeMW1gJS4MZCl0Qi+FYhrOAH7kPB+6Lwod+ZpuF7PVFidjOnN+DF9E9+qn4jLuhzz1zbRCudLoNXmatxQhL51Ddy9BvhuX2hvSQ0ACfSmIw7DQDUOZFr9SB3HM2tguHrupb51DXQNdA10DXQNHLsG7Me1+oBTcRx37zb6/4z8L4F/0uhcD8CwRgA/CQC8N33729LpE1wL52Vtgle//Evfz2yG6ly7gHT9k4XbqppfPY8355T0JiWN/jE5BoTEr8bcGIwKqy05BcEJzgnUu/j5bpf0h5K7nHssbV7X3PWzH70pWzokbkz3Y3W1ibc+p+p7rI204qfaX+4bTt+3roG70wD3y3ve/lc+JdBXKbArW/s1ALiPtPjzGP3uc/9bnnndJ4ar577rW9dA10DXQNdA18AxaqDywlRfMfdl/9C+3zFe38HLRN8CEHbaf2t0nzghv0qNAErT+jnAo0ePXnLwQjcyhDkEf8pCOfw8oSXZTzqMAbF2QSPnHnVIDXhzTcm8Gef8eRNX/2ooeNO1ALQFq4IscswBzuwbA+ix+IR8/BnmGOP2ka3jjUuJfx83pgvjNQIQbunVuFY9EDdWb5v4Ws81PNdmcv9UO8x9w6n71jVwNxrgHhXclRXSW/AuwAv/eYz7lOyrMwTcR3z/e8G7qft+1q6BroGuga6BRRrIvp39wtVw5KrV1yR+40ybx9P/O/uNEXAgGEgGiluuQn8rrAFA+CYNRgBG4uGAG1TkE36+oBFj6lry+jQMUFbKuZkNQBvo24E1kDA15fcGJI3+lvSGHZOr4fgrrvUQEEZbUqBtyaXgnGA/BvPkNbbvJuLr+QwvvSbToRf8Lf0Qh06rrHpu1ckRGgGG5tS3roG70QDPAGB8zI3BfwJ8wr/p3W8407hP48G3PP3UR+/m6vtZuwa6BroGuga6BpoakCfkBJlgNaReg7/90NpPtS8a/U2PNS/zbp741CO5fka/E4qrvwX7rbg0AGgEQLIewE3OAgDagXfKvRT86zV6XDcC3EyL9iaak950c9KbdEyuhsu44lqg6QOgyvqgMCzsCsBjkg47+1JWP+G7dpaxVQ73jV1jK149jcmq5wy36icezFfqc6jjsfo3fq4d5f65tsn+vnUN3IUGHrAqf8J/C9SF+EyHX4DPeNOmzP362e/xm7UA7uL6+zm7BroGuga6BroGWhqw70Z/zr7fJfC3r1r7ucTbV6UvGv1N8rF/eLZ9v7nR/xboT8WlEYB0gDZxgDX6bVXedeKWwP9YeRcYAa5TtH7soAFvzCUybzb9LekNPiZXw3kvuTGwTPjU78OgJX2IjEkeLuyrD5mlYVbcJu0SSRrdkmOWloF0eQ0t/9j1G4/u8Ld0aBz6xq/eU7bqq9ZphGkH1PdYe2i1oVbckjY6nKZvXQPX1sBD2vums7Eos7m/7xsDeQEemVBveuNa0mM1APCvAENhV4sK3BPdNw08QXv22U/HDMfID84wkncD7X9Q0GpwZ9u5vm8NoF9v18AdaMB+G306+4Arni8+i+wf01/GkK7L/rP91Xgvrzb5ka/nGLxntT3km3kA3RHwCsWExwC6xif86/d4PjHg2X9I7VG/zl5old/yWZaWJE1es/lgsKBNHLK89y0vb5olsgVkrThv8DG5GpR8ybVgkpu85WhQY47G0HIVmOdAm4eOafTng6jGua8l88HW2j+Wl8eltExzEh2QJmVLLxk3plPiW/XgQ7jWXa3bCI+1B+NbbakVt6StDqftW9fAMg3Qlv0LPlbxf9vb3vrDgDR/zQdgE0eHhPtlyJH2WrcnOD4BfgzWW2mE9zyGdK20mQY/aTzeY7j3awF7+H5ogOcxnbgnn3zy5Z/14he/6dELX/iu3/Abn/yg7oW/47FPjrnPedWveU6XaTyWvHAvePToafLfdBZX90Oz/Sq7BroG9tQAfTb7crw/L8G//eIv+srHvgr3ZU899nQ64nj/2lfmPWz/k7wGR57mz7nOZuM6BeiE4PQL0YK84QRn48YAG6jm23yMDYPy0OUhtgfk5zf/WWb9lKtVphqX18KxlJc0m/KuDlHY+5THEojKNHlz6W9JYa4lqaQrrgIkYRp9dWOAmhBb/QnBc9DswyWlD6bblJQzz2e4Jeeuyf3oBX/VTw2P6VgjgDLrplV/rXrexK0f/oO/1T6Ia7WpVly2zZZ/yKpvXQPzGuBe+/g//tEL3U/9xHdf/N0fe+92JL4CN4YBDAKM9uuIE75Nbxj5D/72N21X8SdsmgT4jPfYTNfyk67CP3H9M4D5ej+TFENH+tFLAHJBX3AX5L/gtZ9+8Ye+8dde/Muvffzi1739wcWLPvj41n3uJx67mHKZFj/H48jL/DkfBgINAxujAM/yvnUNdA10DdA/sw+37v/Rf6QvSf+T9y9wD+S/6nWPPfOn/5PH3/g1f+nxb3/t2x//q0gc8RgESEN6+7LkM+S9Glz2HTnf2WzoyG/nheaWTMDXX9ONwTbxADUSYwN9+kMo0LI7Yl/LQ3isTNUAQJi0mQf53sSshUNc+7Hm0YKluThv3jnJTTjmVsO+K67CY4Jl+sfAtAKsYR8QAvCY9GGSEv8hnZbLQ+bJ9Zif/rFrHItXV2NyTOdZL+mvdbl5iFyp86EdjLUR4+faGfvn2uxZvQSG6+3bDWiAe+PnfvajFzgNAMg5I8AYjAPfwD7u733Xl4w69if8A/E1T/KqcTVc4d/9HMv9ewMq61nerQbWKykzsg90J+wL+v/eX3jBxZe/8zMu/vTf+syL137osy++5ZO/6+JNP/cFk6A/ZQSY26eRIA0DGgXWMxCe/3spnu196xroGrh/GqAvZp9u+80//U76sPSPgXvA/+l3Pv7OZ/7G49+Pe+MPPf7DOPzf8Ozjf11DQBoBeMfRBx3yXw2OZ4znOZv+H3raxQBQITmBGf8YWAvpBzQAPDE3+r+rAYCy5/VQZuIo86YNDKJvYxpYAk01Td5Q+ltSeGvJ1VCgK64CY8Kk/jEIHYNW4seA13geOvgF6F2lQJ8S/5jzITe333S7lqem99q83ipTR1N6ZN+Y/q2fKmudzhgBaBOt9pIP8lZbM6621Roesu9b18CoBp74wAfe/7GWAYAZAK1ZADUuQf/vf9tnXPzj/8uDi3/8+scuO+JGHMd88Jnf/hzGggR+/BkW7FOyPw0AuQ8/nySMXnnfcUoaGNaiGL7RH6beV+D/wj/36ALg/+N/+YVr92V/9TdcAX/gH/fH/98P1kYAgB2oV1b/FPCTB3m95pOfPWlQyNkCzBSg3JSfDiHvjFNSfi9r10DXwN4aoE9mf41+3Xrqv31Q+sTCP5AP8H/7hx7/8Ds+9vhP6ghrCGBWALMBNALYR930M7PfyHnPYXvANb765V/6fgE9AXgffx1x12Bg/ocyAPCcJ68lZaxlahkpjLO8mS8Gkj7gMd7cKxgtDXvjzskxiFvf8EOxVulakFhBkvAYfHJDVAfkEldh1zCQjD9lBedWmAcU8WPwbvySNKZVto6ZimPflPP6TGNYHczJqtMMj9VFq95a9Zv1H/6pdjPX5tw/15aH0/Wta+CqBrhPhH/lklkAQv8W+Efgvgn9GAdaRoJNPHliDADs5wwACf9jabnn88p9rmZc9x+nBphKL/T/q3/w034FkFYK/sC//v/gu3/TesT/Gz/+ORc6R/+XQPsU+LMP6P8rv/CFa0d+c+lzvwYBPx1g9gLGgE3H/TgroJeqa6Br4LoaoH9mX+0h9zvvIPqWvH+d9s/IP5AP9L/7nz745Ht+4cE/0xEmHkMAswGYCYDRgH407zf6ppvniP1Jzsd5z2JDV4c0AADOQLQuQZq4Q42mU27AXMNCnqfltzxKgb9K9tfj+2cA4019DpDG9nvT5g1sXEpvupZcDcW65Fpw2ILIFnAmkKafhwDhKcAViqckDxT2C+h3LcfKYvzUtbT2oR/iW3pSf6nX6m/VCXGt+mvVc20Lm3Cr3RiX7WzMP9Z+M344Vd+6Bi5r4Nln3/2hX/xn//RXWvDf+gxA8G+C/RIjQJ0ZMBPGGOCnAnV0f2703/SkYyYA9yj3vmsV8Gy7rI0eOhINrJg2z4j5v/R5j11MOY0Bjvoz5f+rf+T5af9M/ddpBJgbtU9gT3+CvwYApDMKMu1Sv58L+KkACwoO+ueZ3beuga6B89GA/ECfbj39nz4jfVDeQYA8QA/YA/jA/t/85w8+hfuBX37wKzj8GAMwAmAkwFjALACOJx/6qbzfyH9wnMe+4lk8T7i+JZ8AVCjeNex0+s2ieujwWhsGbMB8qQEgy+sxwj/Qj1/jQKYljvMwS+5aBT7DgxOCdvF7A81JQa0lV4M+L7kKhS1wJK4FmhVGDbdgljhBtwXCNY4HCXHIfRxWTI6bklP78th9zu8x9brGwqmfMf0Rr46rbNVPqy5rfROubWITbrUf4+baIPvn2vaQpG9dA7+qAdo08J8GAAwBOQNAIwAQvtdov0aBGdBvfjKwmRHAPmcFJNQvGf03PTINBh7bPxH41fZw1761IXUzxX8K+us+RtRd3I/PAJgF0DIEaARYCuikc7q/0P9dv/THL3TE7WtQqGXAGOBnAs+vGdA/Ebjr9tjP3zVwIA3QN6OPRn/uigEAkM/Rf0Af6P/Bi0+70GkEwDjgLADWC6BPTR+Xd/k5GwC4NkblWyPfCcLX9QPdrNZ/KJAmn30NAF6LwD8G/6QjzUtf9dJPbgwXtLO+DRqYg6LW/oQtb9yMS7+A1pKr4fyXXIXBFjC2wJK4CqCEp8CVh4KQ24JggXkXmQCP/zYc5fO8c2XlOk2jv3XtxqmfMT2q45buiWvVVatOa73fkBGg1ZZr3NAk+9Y18LwGgF8NAGNGABYCZDp+jvh/4tsfXOAy7pI/wH0bv6sBYCS9MwIEeKAel6Df8pse6THKbgS42zuCZynT4RnNr3DfCv/a1Wo9K+DTXvE8+GsAqJLPAvwkgJkAfBKQ6wBUCM8wYE9aYB/Qb0ni/AzAmQBVakTIvKf8fCbAdaALPn1AN3dbO/3sXQNdA9fUgByxNgDQR+S+pt9JfxUDAN/+5+h/NQBgCMhZAH4GQN+Y/iz5ke+mb8l55BTOfQ7bosX0hOZ9JQYAPjXY/IvLtfUGkE/9/d/ScmoEaBlAKHM3AFytqgo/S8LeNEtkC/qNWw3FueQqBLZAsQWULfjnweEDpMIrDwPihNyW5KFDvLDckkL3bUD+LuegrJatVe4a53W29NCKq/rMMDpvuVa9teq3toHaRjZh21CVS9rkkjY+nKZvXQOPPfGRj3z4k2MGAGYCMOov6Av9VW4Bf+ybfo0B+84E8PhiEGDRwIT5FvQbJ/yPGQqI51nQ28TtamD9jBwgdyn4awyYA38NAZmOEXZmB2AImBq1d6q/o/xLpNA/BfZThgCO97zmlYYAjCOH6pDebg33s3UNdA0MGqBfRv+NPt16AUD6jPQt6a8eygBAnuS/OY/9Rc59Fht9712+p18K15kOkD7U9/+D0m/FaEH5NQAcaubCqTeYJSBU0+QNo39MVjjL8GpQ3iVXwa8Fhy2IbMEmDw3iE0z1t4DWuArGNbwLhLfS8h0T8cilzvSt/HaJ41pIX6+pFVYfVaJD4lKqV6Q6b9VJq+6Ia9VzbQu1rWzC2Z7SP9YeM7626xoeTtG3+64B2jrw/z986uefq0YApv0z6l9hP8OLwL9A+/aYGr9nuH4WIPCnnIN/07IuAPfrfW8Xt3T9TzC6vSv4YwBgmvwf+sZfux4lT8AX+qvMNBgBcGOgzicCS4C/pgHeAfeWa4G/kI/8hv/uxdsZBuSbxgmMANUQwPvnluqon6ZroGvgMBqgD0Yfjb5c0wBwQ58AcN5z2h4yos5UeL+PT3i/rp88D7yQ3oPrrAGw9HqcAXDgsp9su6nAsyScADXnTyCr/tWgtUuuAl8LClsA2QLNBNLqr0Cb4RYIGydoE9bfkvsA/lJDwFy6Vnnm4ry+KZk6Sj+6JVx1nOFW/bTqsVXftU3UNrMJ17ZleK59Lmnvwyn6dp818IY3PPNeF/5LA8Av/cx7Ln7mrz0/xT+BP/1bkN9nVH9qpsCehgCMFYJ8yqXw7zFPPfW133ef28RtXDsduCWL+znan/ILXvvpF1/+zs+4wAAA2CfcV/AfC2MAAKqrESDhHQh3vQCn/1foz7CfFWQec37AP/PQz3mzbJRVwwXXiz4wnnRj1W201n6OroGDaCD7bOt/AaCvSH+S/in9XxcB9B8AcgFAv/9vLQJIP5i+Kv3RzTNhNZSYviLnPDcDwGNc500sBihEM/pP/3zQ3UE2y3sTBgsNBJYdvXC+gxT8RDNZAj81jTcn8frHpBDWkqvh+Euugl4LBis0UoHVJXimP6G1+qfAdw6e2T8H5Xe53/ItuY4pPbAPvSmrDgmnvvVTP/hrPRGu9Um4Ve+1bdS2M4Rbbcy4sfZpfG3jrfBwir7dVw2w+r8GACRGAOA/QX/Kf8kIsA+4H9gQ4NoAwvyu8M9xfArAPXxf28RNXjfPQKayJ9Dv4mfkn5X++ab/EAYAAV3YJuxovfuUX/nPHl+P1AP6YwaBqVkAmY/rCgj8VZK/ZUI6C0AjgDpj9gSLBQ51xjO/b10DXQPHq4Fki60BgHcNfUz6sSzoxzoAY38DKPy7AODE3wCuBjVkP/B4tbJfyZ44xMJ6wjNSOAegD/2pFf18jAp5vkP7KT+zIig/vLGfWs/jqBbojMV5kyyVwldLrgb1XXIV8FoQ2ILFFlQSJ3xWWaFVmG2BLw8a4lvgDNATvwvY8+0S6ZGHdruUw7K3rqvGtfSCDtVb1afhqnfDrfpq1Wut/9o+avvZhFttjbglbXas3Wf8kFXf7qEGnvjAB97/MQ0ArvSfwC/gZ1ydGWCaKyv4LzUIHNgIQDlYt2Af+NcA0BcEPPzdwKg/wArEO4otyC6RHPPv/YUXrEf/MQCwuB9xurHR/rF4oBrQdgG/MfAX3FsS4GcUX6Anv1Y64kg7ZjioBgDCpNcIUA0AXjPxXB+zKfp3n4dvsz3HroEDa8A+G/239WcA9uvpe9KHBeo1AgD6zAZIJ/y/9u2P/1X62/Rt6Z+SD/1L+pRD3tk/pK93dhvXeqjF9YT/m5w+z/P5EAsBThkO+j8A7LbivzcjNwh+pfFVjoHY+mYejl+lq3BX4a8FiC2QFDKrFEpbsgW4PCiIrzBseA62Dw33++ZHOTl2rrxeV5XqoKUj41o6Na7Wg+FW3bXquLaD2k6yDYV/rO3VNlrDCfpT/uFUfbtPGqDdAf0aAFzsD9jfQv0A5wn/+DEA6Ny3Tr8U+FvpbsAI8L43v+y5sQX/nCEwJvtnAAe9Ex66uj/QDsQDsEugnzQYDZj2z+J9TP3HtQwA5DkG+zWeMrAQoEA+Bu27xjNLoB4zNs2/Bf0Zx3EaAOosAK8VA4D70BN63gDAQSuwZ9Y1cEcaoM9yTlsyxvavAOk70r+k/0m/lpkArAfAKv/MBtARxjiAkSDhnz4ofU36loOyVoM7ewMAjYJrTiOAID8FyXWfx8TIP/o7+EZZOUc9/yHD5E9bOnjhTyjDKcip+yosTYXHAOyo4F+ArbJCsOE5iF4K6TywSIu8rjOfpecm3dx1sN9rbsmqrwwL/lUK/lVWQ0A3ApzQ0+MeFZX2LPzzN38V/IF6AT+l8K/cHtcC+13iDm0EGPIbWxdgDPyNZzHAoSnwPujbNTTAs4/RaafuM30fI8BS+Oc4YJ3jcBoAkBoSHA1XVtiv4fxLQA0AS6buV7BfEsYg4OyA7//Uq9bf+4/JhH/8zibQCJCzALwmDQCm4RMBDAFPPvnky69Rbf3QroHb1kD2zWs/PPfhP+WN8nt9a3YA2nlO0o9MIwD9WkCfkX4dYfrX9mdJz3H0OclnY/y7F/BvI+C6MQIAv6yCD9AL9VNwbTpG5Zmev5n2f5Pt68b+DYBr4To2s8Bu8hpU+1FKLnyp8yYkvf4xeevwX6HScIVQwwms6W/BLnFTwDwH3vsAvg+uKnfNa65sS4wBYzohPnWH3weyek5pnaTkQUz4howAY+1wrN1m/NL74ihv7F6o/TVAm2Wq/2Za+2rI6QHtk7//Y/V/v/nPUf+l8I8RQOPA3rMAAP90uxgNTJvGA/2bPPcxAmwMAOiqb3tqgDaWo/dCPN/uzxkAgHlG/cfgHwMAMwKE/ioF5Cr/9N/6zPXIP6P/OQOA0fYlQL8kTWsWAMftYwzwfAI+wA/ke13VAFBnAwxVxzujb10Dx6gB+yTZT8Ff+zl1P8ed8pbMwbWuPwWoRoCxfrr9VN7r9jU5dgP/qyE/8kRnp66n4RIWb08A8BgCXv3yL30/38IL/4K+0niAGaMBxlLeVYvPdI2E1BPGBg0VluU6kuvybwvJ/xrFO+lDfZgskfWBMhWuD6MMrwaNXXLchOmwTqWjgqqrsGg4wRK/N3xCqP4KroTHQHcM/ltwDaAD7TiskAJ8C9xNd12Z52ydp8a1ym3c2LVqQa06Um8tfRKnvlPWeqL+fDBbl8ha74SzbeDPthMP9Gxj2f7SP9WG3bfk3rhPL43h9j3vDeh3lB8J9Av+F//jf3uBAQCIvwTgAzgL9UpH+1vSNNs8hPKlcgPql44X4pfmMZNuVyMAnw5wf55367i5q3vBo0dPA//APqAu/CMB+ykDAKP+rePqDADCFfwzLCQrK/ynAYBRemF7XwngV/ivYfMmHqMDo/zMCKizApwN4MyElgEAQ0DLAGBarpvZF7x7bq6me85dA3tpgH6G/RJk9mVWm7Ay93mMfZkh6cltlt3rXn8KQP+Pd479R/uYtS9KvH1O+5TRV0RXqaOTU841C/xQQwBwjzEAx7f9OuKBcIwFd/GOp35dEBB4vy78czzXdOiFC69ZD7d+uDfVnMybQ/+YzAdP9a+GK7zkKrxVuPNmTUljSOeNXaUPgyrrw4FwhVrCYyAsKKcEsPnOyL8iefc/ffDJdMTzTRJpNAoshX7TK5ceZzqNA9UIYDivI/1j1z9mCEBnVbfonrhaB4RrfRHOetWfda+/tpPajmo7G8K1LRoea8fGz90b7h9O0bdT1wBtkFX90wCgH/DHAAAYA/Bb+J6B///Pex7ffv+vMeCKASCBfgbMRxcOPLABwIUBneK/RKK/U28Dd1F+/p4O+Pd7/6UGAI4B/jmuHpMGhPwMIIG/5U/4/+of+dXRf/5mLw0ATrcX0HeVwDwQn4YE4b/KmncaAwB/jQH4M78//A/+lSv/BqABgDwFf/yUB+OBnwRgkLmLttDP2TXQ0AD9DPsk9l1WQ9wahGv/J+CWNKb3ePI6xa2pA40A9A3pM071K0lD+tAPujlmvVC2VbibrLuH6Aco1jE9Hj963egMfd3JRjmA9uvMBNB40OF/92n/3iRT0gdNlauhxRCH3Lr60KpQJ+ylFAqrrDe9gFnBswKq4aUGgARk/EA0i4wA+PzdCP87+oMXn3ZRXf4fKYYBjgHoD+2A/iWGAuG/ynp9hseMAS29tQwBY0YA66nWX63fbAP4a1vxoW6bynYW/touDU+1afbx0F3ihmR9O2UNvO1tb/1hIH/MCJCL/mkEEOaVQj7gX537PDaNCGv/vvDvcfsaASaO45qXwD9puM9Puf7voOwPcrE/DQBM48cRZmQfyK8zAID3JfBfZwFwTAv8jcMAwMg/8J8GAOAfI4BrAADbgnoF9BomXTog3VF88st9c/5W3sC7eVIu02AA0AgA2DsDwP3OKOAYHGXJTwIwzNxBm+in7BpQA/Y76IfYX1kN/ksj4LV/lH2kCdi9SZi0/IeWTX1wjfYJd9AF+rTvdzS64FqAXeCbEXdGvh19J0w8/eOh7JT/Xm3oBV3wKQKj+AL93IwA05W1C+6V7urFeiNNybw59E9JH1AtuRoKsHWCmtKbN2W9kSsUVmg0XKGfsKBfZQXYMdAVhJWAsyP+f/OfP/hUBf65MMYC/prEGQGsXrqvW2JEcDZAS1YjgGGvNWVLP1WHUwaAagigzlpGgFrXhGt7yLaC37akzPa28bfaJXFTbdp9U/dJ7huy69spaoB28/GP//QvOs3fkX+li/4J+lUK9xX6a5h0TQOAEH+EcqkBoP8V4PKWT3tjurmj+IB5OoG8gn+GPbZO/2/NBnAWAJ8TmHeV5AP8jxkAcgYAwAxAC9NVJsizzzDHCf+O3LtvV9k6J2UiH/a1DABPf+yzLhkxhH8lxzkzwE8ChlpdLa/ZnrJr4GAaoG9hH4S+yiXwt59k3zelfSb7SRw7OPtA5Enep7jZ30q9rHUzXMzSGREeezR6eN5o8+glr3jly97xhjc8817WIPq7P/beC/51SPeDP/DsBWvt8I87GAMA4uGaufZ7s6EnDSMaAjQGAPrpNAy4dgHGE46/N8qauFBvoimZN8mc3wdLS66GclxyQhrSB1TKCns+6JQ86PDnAw//GPy3jAAtcK2Am/CrH0BmBJ+R/DnQn9rPrADy4NOACv8YBoibk/W4Gh4zDrQMARmnEQDpdaeseiLc0mc1uFQDgPVV69Gw9a2s7SLbDP5sV/hruxvCrfZJ3Fz7Zv/UvZL7hqR9OzUN0MaAf12dBQC4M0o/Bv7sF/b/v+9//KI6910yABwb7I/MBPj73/YZi2YB9L8CXNzqnwD+gflfu1pd+b4fME/QX+rnOAC/9UmABgD2VfAnTLzwr5ybAZDT7YXxMYhn9kCCf/qF9rFjp+I975jECODshTqDQehPSVk0ACCZNUBd9Y7j4rbdEx5GA/Qp7JfQR1nDLe3Qvq/9p9rPMp5+FGk5xv7RkE/2dzjHqW6pH/SUfbvVENZlvPpUHsP1rwB5wP/ZZ9/9IWEfiQGg5TAEfP/3fsdzGgKo4+F679X2fJt+9BJmBLhWAaCvI461DJw90Z/fv9o8aPRzLm8Q/WMyb7DqXw3nuuQqpFWIo6LS0birExCVPvCqrA9Gwi1QrUCbsKtfKAbYGcGfgvtd9mkEAPYP5aohwHA1CBCPMYNrqusXEMZRJowD6kFZdXZoIwB17gss6z/bBv7afmr7qu1vCNc2anisfRs/d8/k/uE0fRvTAPXGaDGOuh3Sobs73Xh2CP9KjQBMg98V/gH+NAIsMgCMAPjod/9jBoTr5tM4fmpRQBYAZJbA5p8A1vVI3VLPd1qpR3pypv0D/roW4O9rBMi8yINZBRoF+BxgzADA6D+fHWAoWGoAAJwdbQfAx0CddAn81X8dA0Ces2UEcBaARoD8hCHBX7+fAVQjALMtNiNuR9qqerHOTAO8E+l70D9pwr/92bG+GPt5r9GPsq9EXps8s18zRJ3kpo68lpRT/bo772+g7ef7ro9ewoh/BX8gX9AH9nXGK4nHeHBfn03okGvHMcKfjrjNQOBR1Pex3GEoY87ljTTl9yZrydVwnkuuwlmFNx5S6RL89Av9Vbbgn7hqBKgGgPrwFHCVgj8SWD4k/GsoSCOAQA6U85mATiCv0v1IjsGRRzUmaARQko7z8gkDsxFa6xcQx/WSjjzvyhBg3SOzfeiv7SjbWW2Dm3CrvU61c/fN3Te5fzhV31ID1AsvOwFbyXQ37udMe9v+lgGAhf/4BKCO+hNmJF8n3Av9yk/9Px+/wGkIIP6oZwCMGRQ28RgBgP0pxz061N0DDAJ9RsDVVsx35YL/IUf/E/yn/BoWkGPOhQCdSfAffPdv2o6iJ0AD8sD7GPxPjfqnEUBDQsL8dfxpCNAAwOJ/OBb6y2sQ/FNyfBoAnAmAEYAO5tVa7TFdAwfVAP0I+xxX4F/wp49Kv9SBHfp2+O2n0betRoANEK2G/OkDcQ7Odcpb9rn0qzul8UdzrcI/RnPhn9H+hH4hf4m8z0aAU268d1H2vBlafm+aOdmCKONWw4Vdcgll+Cu0CXMpE/wq8BOu0G+4Qr8PzIT/Cv6EhX5lwj8PV0BYaD+kBLQBe6Ac4MYB5gnnFdINK03v8RoEqjEgwX+XayB/DQHqR9nSZeoaf60T6yplq46Jy3ZwICOA7bTKuTbP/tY904obkvZto4EnGBFmRB2odkV9DQBKFuHbdFBuXXG0M8uR8pd+5j2TBgDhX8hXCv9K40/GCNCYBcBMhPc9+62XHMYA4pRAP/c6YYwAPM9vvTKP9ISsLA+cTxkAKrwL7DX+OuEx8M94jQApmQ7PN/Q5lZ7PACqsYxQAqBPy5/yHmAVAHsA95alGAA0AGAQ0WFD2BH/95AP0pyGA49EFeu9GgCO9wc6nWPZD6J+s//Oefg/vKPuy9L2A/Rwwom+HI47+Kv3XNAKQB/3uzTuWvD0P/Zdz2uyPHes1PeQZUuF/bJR/iQGANN0IcKzVfTzl8saYkj4UpmQFJ8Or4VLXD61B4l+768K/ANgCxARI/BU0fWBWIK3QKswiE/zxY1HlwQps7wLNu6YV5nc9rqYnH4Dd0XuMCxgEkMTV9LuEOR5doJfUGf6q06rzliGA+ql1SLjWtW1AmYYi/NWgVNucbTGkbbbKqXbvvqn7J/cNp7vfG/X4kY98+JNz8C90k476v22tUU7LoMRQAch+8Jnf/lydBZCj/8K9sI/85b//vMs40p2UAQAjgI5ZAIOf9QAEfqG/GgXcjwEAw89t1+Uxno8OHyPIu8K/i/ZdB/jrsQn6U/6Ef/wYAARoZAV/wgD4HOy39gPfrfyWxFWDg8YEjQCUtRoA3If0eA0AXEPCv7MB0gjw5JNPvvwY21kv08lrgP6D/Yzt6D/vJ96L9KHoawn/9utyZqiDP8wCTSMAedhXGs6xGhx9H87FOft2SxpgajqGcr/zB96B/6WgP5aOPFgg764GUW5Jff0019BAwknL74NnTlZoyvBqKN8llzBWQY1wwpyAl5IHV3UtaFwC/xVSK8S24J8H6XXBeRfIvom0hzReYFzY1whQ66hVj7WuDWebwJ/txhdbtq9sd7VNbsLZbvXPtX33t+6fVtxwqpPbHqJz6wad7nMF1BEQDdQvNQAI37c9G4BrrTMTCL/vzS97DuitawBgAMjRf0Ff8E/pPg0FHIdBYQ3XM9Pud/7+/xD5Cf0jkk8BWtCf4A/84/jkY5+2c07HcP+wkNwu8A+0A/+s6M93/BXi9w2TF1P6x9YCSIPAmAEAoNYQACgnpAPTOEfXE/Y/8N9/+do4oGSffqTgnvmN+Uk7ZmxwVoKQb3kBeONa0jwxBOA3jQYApEaA/jnAOd2hR3Ut9CHoY9AfuTL6T/814Z9ZmfRN0xHnjFJmAtDHxXDAO453Ms+jDSRyDs7FOft2CxpA7yxM5+J+YzC/b/y3PP3URzEw3MKl9FOcoAZagJJxws2UFJRacjXo5JJLCMOfgIa/QlyFPOEvpWCSsoIl4ToCXeGfcBoAEv4Z9dfdxuj/TUD/TeaZRoA6G6DqudYD4VpfWZf6s8711/ZR209tX9n+atscwq027Etx6h7wpZn3zph/OM1pbOhyvSDN5u/whHFAmBVq2b/DlTxk5F8DAN/SC9hK829J0mAhp75HzrmirBgKkLSPkXSLohmpzjJSJl7SGADm4B+wz1H/537ywQVOI4AGAOStzgIA4Dcj95cMCXPxHpMGgDQsDPHoRSOA0/2F/pTs27HdLKqvE0q0XvF/F/gHwoV/Fu5jgT6Ac1/o9zjgn0X+MACw4F/C/pg/jQDOABCoBWTkFKgnWLcMAsY5fX8qr5ZhweOVOZuAslneOQOA10N50wBAvEYA1hDgMwjqhTqZeD6dUBPtRT0iDdCPoH9BP2RrAKBPRL+JvhYDUozyC//0xZw96uxP9pHGtZvok5EH70mex/SLNufgXDjO27cb1gBwTn/F7/33Bf2p4zAwbOr3hq+mZ39qGhiDFB86PgzG5BgwrR9WgzJW6RK+8Fc440GUrsKd0JdSOExZYXIJ/Cf44x+D/5v89v8mAf028sbqzAtG3aVO54wArTrLOvVllXVP+yCc7STbD/7axmobzPa58Y+16bF7IOOn7qfcN5zquLcl3+gzio/+l1wJYA5EawBwBoBxLejPONID5BgBqNd6ToGdNII7Rooh3aqmXRKmvJkXZeHcjP7n9P+pqf8Av/CvrEYAZwHc6GKACe4tf8L8nN/jS7qlfw2IMYB7fUkdnGOa/Ls/jADC+JgExAF1Rv6BTBywft1ZAMK/BgDyHYP+Gq8RoBoAxmYBjAE88cJ1a/S+NQvA9EC9gL9EWgahXiMAYfYZv1Sy7gFloNw4wl/05168NgK0nk/n2Jb7Nd2KBuyLr/vUtC36O/SHMAAwKEWfSwOA8J/9PYwA9M2cBcCMAfpjPId5f5PnBhA5h/0Zztu3m9XAQ6boA+/OAFBOAf2u+/i8oM8CuNmKPMXcE0hafh8EU7IFS6tBGeuH1SDxr10FrwpmPISqS7AT9hIA8VdIbIFkHXGuMJqgKrwqHfXnoelUKx6m+YDt/k+7UAdYmtGT+kvd4k/d13ohXOuv1u+YISDbSm1Hta1lW7R9Ftlq11P3Qe5r3Us1bjjd0W4PgF+AW0gH2nUV2ImfMwII/x5r3kjjkGOOcwjjSGYSUN9qkPMD55mGY8iPtJvOjclnJfllXvjJiwUA50b/c3Rf2F/D/3/9/CyA1kyAK7MAClxfGq3fdR/AzjEtcDfONEvz9riSnr9HzNH+Mf89/TeAJ1jxH9CfGv0XtknXgn8MAThmBIwZDebigX+AH/jXMQsAsPf8c5K0jKAL0khGw7/x45+zhWmhexcJ4DOqL9Q7/T5H+v1MwDTIjEu/acg3Qd9yZ9mWwj/pLI9GAMJcO/WCkWd4yPBOONetvs8I9+1mNIBuaUsPeY/Rt7HfS19KA4DrObU+7cxZAMxe9TOAhgFgtTkX5+t1OijhJjfqkoX6hP6bmgXwHW9+08/3NUpupCbXa3IMOa8Gl8azGznZoTNtPcSNS6AZ87cgyTgUcskldFUgI5zQljC3FPwBwwqPhCtkJoDiT0AVWpGCP1L4R/IAxcoq8Hb5q/CPLuqnAOgydVz1X+un1mE1APjyQ6arbSbbE/7a5rI91rY6hG3HVY7dCxnvPTQnh9Mc34Yehd8xAwAwLGDjJx3HNa7mIaPwpEl3XQOA5cOwoLHCOGWWj78VHMpGHS3ayNN8KCt+JN+6pwFg7Lv/nP7fMgIYh7z1zwAKtDcNAzVNDWsAKIaDpbMAWO14qIjF9bGo0o44Ec+ez3rxi9809d1/BW4NAIz2O/KP1ADAN/v7fAbAMeaX8I8BAHit5RgLawDQCMA0eGAYEBakE6738QPtrZkBCfwJ++kX/JXkYxkoX8sAwH7LvlRSxjQCvPZDn72enfEbfuOTHzziJrlP0Xif5Xuu5SdN3w6ngdT5bRkA6PNQt70uD1ePzZxy+r9GgF1H900/t2hg/wygWQX7RD7xPE88egk61TGTQ7fpC6/2yfw2j+EGH3Oth3uNq3BkmAu/5BK28FcYq7BWYY5wwp6jwBUOKzxWuKzwmWA6B/9YTXFMteoGgMvQX40gdRZANQLMzQSo9Ui41nW2B/213dR2le2utsnaZoew7bnKeh+0wmP3VcYPpzjKbcWoudAL+ALTAnX1C/akp442V7TC//GydoBpyUMjQObn/iqFcKEcaXlIO7efNHxnt0TbtBGuv+b5Uz/x3ZdW/8+p/yziV7/7B+5ztH87C2AzE0AjgDMGrswCKHB9rVkAFeAzPALzs+cbOQ4jydjIf8ZvXpJLquSk09DJAwZxQL2j/3WUPkFb+AfyhXWlBgDkrp8BAP8cZ17VALBkIUDLyfR/4B8H/APYgnDCs9B9XenMAM4h1KchYC6O/ZZBAwDSuCrzGsb8rAPgPv8KEfnVP/KZa+MMMz5OuvE+X3jeWb7j6rtwNewzzjRIjunb9TVwSff0WejT8Ozk/Ur/lr7V1CcAjv4v/ARgNRS519/1621RDv7133XhXyPAlGSmAX2bRQXriVoaeMh9B+T/kT/wBe/6qtf8yX+Ce/rr/8xzr//mr7vAGffql3/p+zEMUL/HrPOEkerPh3nL70O/JVeD9rauglZCGP4KaRXihLuUFQZbwHgT8O9iK61pVhWC73PYtQCYPZGGlTS4VGNMra+sU+p7zghQ2w3h2rZq28u2mW02/K323bofaly9n8bCw6mOa0NHOZ0eEBbShe4pCTyPgb9gz/Hk28rbNCkT/PFzXO4nv5rGMmY62tGctknjOTiPfqa3v+Wrfv2/8Pv/NAAI/3XkPw0AGgSewwDQMAKQB+7SWgAjkD0L5wn4S/37GBxGypegP+a/D38HyPOHUX/gn9F1ALz13b9QnZKF/gR1ZcI//l1nAaRBQfhHMvqPI88sw5RfA4DwjwFAJxQjK1gfItwyBjj6r9QgkGFmJ3B+ysUMgLmyWH6O45x5XdWvMYDPAJgFgD6pbzqMc8+cI97Pe4t3m+/B9ZRX3pu+S32HDmlWm3S+Czm2b9fTgPq3Dq4sAkifin4pM1P9DMB1ABL+cxFA+mT0t3jX0a/mOUU9DkWlnjlXr7vr1duSox+0DACM5OumgH7XfRgAqOclBetpLmsgwR/gf+O3fcPFX3zzN68dfp1xSAwCX/JlL/1RDAGb9Re4t45q4yZvOR4Ac84XQpWr4dhLzhdEvjR8eVRAI1xBLsEfPw+tdIJhAmOFyQqbCaIJqK1p/47885DtBoDpkX+NHrx4eCGpz9Rx6r7WS623rFPrOeveF1htI9mGahuz7Smzfda2O4Rr+zY8d3+wv3Vv1bgh2XFt6BRoFn4FYIB6zCVkk0awz/jqJ006jAa6PJ785uCe9HNpvCbaypTG62KC5s0q9x985rc/lwaA+rd/jupvYf8nL3/3v54FQFwYATQSjH4KsA+YL4X+66ZLA0CUc8ksgPuwDoAj/8A/QN8asW9Btt/oC/5I4T/9xLXyrLMLCFOGzK9lAABaW+WpcUz/B6Ad9Rb8nQXAWgAC8hxkX3f/LsYAZwEsLRt5O+OAa/O4Mek/A6CbP/23PnO7KCDvmqlnzpHu413Fe4x33hr8uY5WH4049m0gcrU5xnfgEOzbnhqwv7CtB+uA9xh9IvpQ9LOcBYARANhnEEYn/NMn4zNW+mAaAOgrbdrnaigjdd3rbc/K2vWwbgDYVWO3nv4J4J0Rf8BfwBf456SGAI7HELx5Pt76RYyd0IdLlTwAppwQVOVqOO6SS7jCz4MmXcJZQhv+CnWEK/wRrpBYIbJCZgJogqmwivSb/wr/GgD6JwDThgAMAHwqgR7Va+o666DWT62/rN9a/7aJbCu1HWUbs6OSbbC20dqGh3Bt54an7hH31Xurhofs73RbsTjMxkK5Lkh+s5/wLZRrBACo8acU8ok3vXGmY4YA5+A78O/9y7/7v8AB1i3nfiTpOY7jPa95E15iACAdsxtoLyNaf8h6ARo9Mk/Kx/fyjvwjc+p/jv5vQT8MAOs4wb/KIR1GA40AV2YBXBfUb/L4NALEecZG/o3frAPAvXSW2wsePXqa0X/AWwMAklFhAb2CtWHAPmG9Qr/GACSGBfMbky2DwpgBgDJaDiSwrzOe0X+AmJHxhH/9GAaAYED5uoC/6/GUSWh3FkBK9gvwY3kn+OexpPfYltQAwGcR6Eijz2ZRwFNr57zDuD/Xo868O33fZr8LP/G8d0mz6eSuNseSB++8vu2vAfRnf2K7DgD6Rvf0l+hP0dfCCADk0/fCEKAjzD76s/TDhH/qrdfZ/hVzzSPXMwDe8szrPsFovgsAOvr/7u9868Xcd/27zALonwDsXlvCP6APzM8Bf2u/RgNmAxyTEaCCSIZ92IxJAajK1aDiratgldCFnwdPugpuhHlApasAmHCoPwGywmWCZwKpkDoF/zxAfcD2TwCmDQDMBMDqzAtnVyNA1h9+6zVlbQfZRvRne8p2hr+2xWyr2YY3/trODY/dHxmf99WYfzjN7W/ogO/iv+Xppz6KhRK9oDuhWplwLdQThxPqM+xxjpwjAXdBv7noXELkjJ+F5jQIAOuWKWEdv+WzPEjLxH4W+tt0VrfKRx/sI11Nn+Av/KcB4NKofwX8uXAxAJDvJSNAgPWNTP+/Tv61vjZ5LZkFwD26Vf4ZebiXEv41ADAFXyOAMF0laYDzlgGgZQiY+0vA+t2/+Y4ZAMgvyyT8I4kX/oX9agSo6wCMQfaSeEEcuSR9pvHYBHj8lC/TpZ9rqekNcxx5tsA/49IIoM6ogxNbD4B3GO+57ZRz3g28g3kn06+yL4WfOA0BtP0wAvguPKO7+04uhb7DpTrxfZ1GAPqvDFJlXxU/cfTD6PNSX9Qj9cnzl34A9Tw46tv64nx9u2ENAJjMhBPkAX7AX3dIAwBT0YfLWd3wJZ1N9oeAfw0CaQTYDLZxr93pNgYjPmh8EFQp/FS5Gq7mkkuoqsDFwytdwhp+IU5ZgY9wAqEvpgqPaQDwhYVswT8PSF0d+c8HKtOqnOre5bghAAOAL55DGwFqe7CdKG1D2a6yveHPNpltNTov2Z5rezdc749WeOpeu5MXLXoRcgFdXjQ8rJiC3wLnhGGBO6HfYzKOkfot9AOFFRR3CU8AKiPznAcjQxoBLBNl16UBgLQYENDF8Ox6zKn/qRevm1kDGB40ArSm/k+O8KcBwFkBJS5nAJyUAaBVt0Mc+vqRv/XWS87RfyX3Mbo/t42p/0AfsJ/wD1wD+IzIJ2TrZ8R4DP5z1L/6OS5nFuRMAM5peuEfOWYA4DMAwZVypQEAf2vaP+D8xve9djsbAFi+zt8BAtoYGITvfQwAgn3Nizy5Bvcjp8DfMiApU8L+mB8jgLMA0KH14bPmyNu7fcD1tH/elbxX6WPRn6qQSV+JuARLjtm8R3lP8k68k/fcket5l+JZJ+hyPQuA/gvtibrhOaphhr4t9ZFO8CdNwn/U04p8B9fralDCbW3on5H5mzYA9L8B3K1GqRcMJnzHv+vIvwsCInOBQI0ADLZtjAC7FerAqXmgtFwLYDJO8KlyNeS3dRWoErbwo+B0PMjSCXIpK/TNGQCuA/+Aq074ZzpVn/o/DvzVGIK+NKRoWPGllAaYNMxknVVjTq3v2h4IZ3vBn20q2xv+2iazzWZbDn9t874w8/5o+Vv3WcYNp7i9DZ20IFd4FvCF5pRAtemEfUHbMC+zP/+6F/8jAPDSaPUuwG/aBH/ihM2U+of9GAOYWg6w12vkOiw70uvECAD8u3BhXs8F23AcwMoCgGkAcOG/7ch/An31C/0tuUmrAcDPAM7BCMAsgGoEIHzOBgBe7jn6D5zjAH9BHKOA0K9swT/pAXgNB6TRqIARoTpBU5n7PY48yE8jAMCv47t1HGW1XBoAOI7F7YBgR/nHZgEYLyAnbE/5gXXyTuhmET/ymzpuyT7yxgH7uNa58rzVb7k4l9c1JussAOqDxR9P5FMA3k2829aj/7xHhX/e43WKudPLNQLwHuYdw/uVPAbnO3Hw9u0aGqBe0OW6buiv0I9B19QReqee7DfVvhT77CNxjH2gIb/VJs9eT4Mibnl7yLTwHOl39F+Z+zQU7CqZZXAM0HnLut33dOtPM1jR/7rwjwFAl8aE5/8h4G7XhUkASb8PgTHZgqDVoOlLLmGqglYFMR5G6SrE8dBKV0EwH3qth18CZoKnMCqcIgFWwR8p/DOa3af9L4d/PwFAh7sYAfKlhd/6VGbdZ5vwxVbbTrYrX3rZ/mrbzHZb2/QQbrV94sbulYzPe6z6hyxuZ+P6BN0W2APOOABZoM90+IkXpIVo0wrK6+/lK7wL9bvKzGfMn3kOaTA+YAignJY/y60BgH1eq+mUaUDgupwBMDr634L7kbit0YD9GgsGv0YA/xHgpIwAWQf4N/Ug7LfkOf4TAKP/gHcCN0DtSDwj7wnYgDaQXSGfPNjHyP7Y6L6gv6sU7pEaCSgvkI/RIctH2TAWYBhg5LzCv7D/gb/3Oc/pR5Ju6SyACuOu3K8ExpdA/i5p6jkr8I+FMR6Mgb/xGgCQfDKBDjUCfNaLX/ym23na730W3lvbb815t/L+pb8E/GPYd3E5JH0j4ugr0b8iLe9h3rNDPivyGhx58t7r2/4aQH/2KdDplYUZNQRQZwK//ST7RvaDwkBj/fQ62r9u9j4SMB/7DAD4P4QBAOCk77d3Ie/RgdwfjNI7fX8XmaP/zgDQAOBsAIwKrAfAApB3qdYKIYZ9wLQkD4qWWw3xW5cQhb9CVgIY/gppPqiUPsBSJggKh8oKkRoA9oF/rNt9yv9u4O9MAGZLoL9DGgGy3vVnu8Bvu1HW9lXbX7bP2nazXW/8rfbfuldqnPfXmByyv/mNafLCOlLYNQ7o1QjgKLr7TKskrSBNGvyHAn9W2h/9ZAAjwAYwL0kBNIwEGgIoq2WknJbba2lJ0nAM+37pZ95zafq/gJ4L/12C+hHwn10csBgBNDZcWg/Aa4/rvDTT4lDx+5zHOlAOZeHvE1vwTxxrLtx8q7+9M9TRf6E6DQCCPlCYIJ7+XYF+3/R5zpafMuKcNcDq/hgBHEVP4K9+DQVCMbIC+hSEC/9K0tbjDxEmX8o+Bvw1nuvivHldLb9GAD8F0ADALIANfN1ew1x+Jt5PvLseUkbenbxT6UPxHrc/xGCIjvc8RgD2Yeyn/8UxHLuBDgGTvPt2PQ1YP+s6GrK6ZASwP23fR2kfiP3U66ZeVsPx9mfIr9fPoIQ72FYAeoK+4K/cdcQ/07PGUx/9X16rgPk+o/8aChL89Ss1AhC+a6MMN3vLVXDJsA+LlKshn0suISrhCn+FLx9MSB9WKSvcCX1KoV+Z8C/4I1vwj0Xb0f/WyD8vtD7lfz/438cIkPWV9WjdKq17ZG0fhLP94M82hr+2wdpGs/3Wtj2Es+2nP++Tlr91r2XckPXNboy2CvNjEthl31JDgOn4i7z1lH/Bb0ROgv3mGP9mb0napgGAfAoEY5hYskaAwI9MIwEQy7nyE4Drwv8Vg8EuMwEa11iv+U7Cmzpc18vGP7UYIJ8DcD/ebMu/vdzrt/8YABxhT9mCbeL2Bfmx45w9QN55/louQV9p+TIMyAK1rO5fHZ8G4BjxxzigMWBsFkALugV9gDv9hsn3EMA/lQfnqMDfClP+FvRnnAaAnAXgTA7aye21yp3OxDuJ99fWAMB7lnczI/x+BpmzIfEzSMI+jATdALCTvvdJbL9hXU9DBisc/Rb7MmN9nAB/jqH/Yl+FPPt2RxqoswAAeOE/DQMJ9kv8HHtMK8/fkXoXn5b7AzAX5veRLdgnLuPJl1kG8Mjiwh04oQ+RlD4MWjJhJ/2roVxbl/CUD6QW/POQqnBW4a0CXsIffqEQmdCIP4FSA4DT/ufg3xedINvl/oaAOhNAo4t1Yd0gs86yPrOe8dd2UNtJbUfVEDD2gqSd1jac7Xvjz/avv3XP1Li816p/yPrmNq7LEe0x+M94R8QFfGcFOJIuKJPnEvgfg/qMT78j3hmnP+Fy1F8MAGsYHoCUxQL9mz+vwWvV+KHk2tQZ16gBwFF5DQCjo/r7zgIYDAEYB6Y+B0AX62tvXeeh48aMDQ3YH6uPsRkAxHMv31zLv72ceaYwuito469gLlgrAWz9So7Hbz7Img8g6f6cZaDftQZSthYA9Nt/JdP88bsQIbMVGP1nGrtwW+E/wxgJcMRhEGC2AM5j/YSgBdWtuDQEOPI+BfCH2gfgt8pjHGXxmsYk4M8+pLMA0C1191t+02dcHOmoHO8l3lvdAHB7j459zmQ92cewH7IaMlsbA7IfQ1w40nockrz6drcaWP/fPKP1S8B+aRpg9i4h825VuvvZeYfvO/0/jQUCf0syC4C0d/0ZQAWQ+kDJBwR+HzApV0P8JZcPHa2RyoSuXcEfwKvQV6EwgTFBUsAUOJfAf1q4O/zvD//qjhGC/BxgiREg6xN/1ndtC3MGgNresi3it40qsx3XNj6E8x5If71narh1zxk3ZHtzG1OtE/DH/BXwXQQvDQFAseHtlP8CgxXWDS+RjrIrOWbKIFDzHIPQjGd9gDQA6FdyfRoA8DOKbTmaBgBG73cF/iH93CyAMSOA+the06GhP/Mrdbs95w7xU58B8P3jzbX828uZv3lzhBfAY9E3HPBOvFAvpPNZgJ8GuD6AMsGdOI7BtfZn2pY/wV+//wAg+CtdBLDKHNVndJ8wDqDnswCchoA0AhiHBIYBa/MCogXqlAn9xhvH8YeC/CX5UFbLoLTcu8wC0CCCXjGo0C6OeBbAur/Hu5D3Ju9W+lP9E4Dbe5bscKbab8/+SMvf6pPscLqe9KY0QJ+T6edveeZ1n1gK+FPp+HeBIzUy3pQKr50vz7tXv/xL37/r4n8J/+kfMwAQz2cGGGiGQq+uXfAdMxA6qqwPhwy3HiYUfOsSmp5vzI/9ZoGqAlcFMsJ11DahrgJfwiD+hMUW/GME0AAgfLo4HS82nFPcOvxfH/gF/5QaAdS79WC9aKjJmQBZr7XOa5vI9oK/tqfa5mqbtK0ia1vOdr7xt+6HvF9a/nq/ZXjI9mY2rhOITQfoZrj62S8Mr0fIB0sAYWYC/N0fe+/6m+41/DcgEFBOSKyAXsOCvlLAJow/4/WnFMyJq3kbzvLoZzYA1+2Iv5LrFP41dlQDwOg/AOxhBLhkOPAzgI1BIWcC5L8DqJdL15fQfih/o37V3y5y6jMAjDFDy+d+OuVtxYi/0P/CX/eCT+B3pB54B/YBcOBb4EYK4466C+nIFtDvE5d5WoZaDspSwZ8wkO+UfiQA3HIaBvgMgNH/hH8NAI6WC99AtPkL2FMSIPfYXSTHUeZdjsm0LUMA1+v1jElnAagb9ILeaRtHPAuAd9fsIoDM7OOdvsMigKd8fx9z2elHtPobU3Ec07cj08DzfdBHL8lFAacgv7XvPW//K58CLDv871656IyR+UMZADAGjBkBmAlAPVHnu5f0ekckeKR/7IHRgh3iVukSmhKm8FfYShiroFZBjnDCXgXBhMQO/zcD7wny1/HTWWAl4TkjQNZj1m+t+2wXtd3UdkU4211tk7XNZnvOdr7xj90TY/eQ8Xm/Vf+Q9eE3v/0X8oVbw8J+lcLx2gAwrA3ARhqmbfOXePnN/yUQ3UCjcUqhnbD+KoX/pZLjhWFlzdPzt4CVa6jXSVgdKTF2mI/n5HxXDAHXNQBw/AIjAOfN66Vs6+s7BPjPQf/Sc5R8pv4OkHvz8C3/9nJ8waNHTwP7gB2GAD8FcPE8oL2CtwCOxFVI3wf06zHk6bkzf89pGTRIpAGAOIAVeG25lhGAuJoWeAbyMQwwUwCwBpgTsPVjEOD4KSOAaZdKymR+151BUMtGGcbgn3iuN3WCHtAxn2/QVo50FgDvqnX/jnck9ybvWd7JvLf3/BtA3nV9uzkN1L4EYfscyNx/c6XoOR9CAw8BUeBwl9kAfO+P4YBv/unnHqIg9y2P6y4AmKP/+jEAVEMA8H9sMwDyYVH9LdhZDY1j6xKW8CdMVdBKCBPKkOkS5hLy8CcEJhziFxxzNNkRZkechc8+8n83xgIXC7IeqBfrKOvNuqx1nPVf20a2G/3ZrrLt4a9tM9ttbdPZ3jf+1n1R750azhdx9Q/ZHnx78JGPfPiTW4gH5DcL/QHzNT7D7AeGM92nfva9TfivcC0sKyuUZxiQTecK+/vIzCcBmfNZllZZWeXfa60GgJ/6ie9e/7uBx1t2z5VrAThir7w0ur+LcWAHI4DXaflGDQEAufBe4HyrE/a7byyt8XPSfDaSdRTe9+y3XmgIyHUBTv3vAF38r/VdfgK44C1wG0YmoCe4V6jfJ5x55zktBzLhXz/wXoFeoEWO+VvHmN5jyHsKyMeMARy3BP5JJ/grlx47lT/l4hrIk/zGDADAfuuaMap80Z978THPAhAet7MAeIfyruVdzLvaGZPMmuQ9znubfaQhLe9V3p/D24x3JO/Avt2+BqjHvp2oBp7viz56CYYAwP473vymn2d0PxcHJI51A5juD/hvRv255/q2hwYwANzUDIBqBHjpq176SepsKOatPx8rePjAr7BiuAU6q6HgW5ewlBCFv0JWhbAENKEtZUJewh/+hEOBESlICpYJ/7y00gGkfdr/7RkD0PV11gOobSDbB/5sO9m29Gf7q22ztt1s19neN/7WfWGHx3unyta9Z9yQ7WE3rlmwTbhf6heGMQL88i/+yAUj5lMj/0JoSoG5SgE6pdDvdPcME6cTsJXGe1zmKSB7/izbFnYHSGWaOtfrNTv6D6hyzR5HPuZP+SxDwj5xGd7ZnwaA8jkAeXu96sfy5DXmtTX9LdifgnqBvqYh3rj0Z/4b/QL/Cf76T3kdAJ4hjPj7nT6SkX+/79cA0ALvjEtI1wCwD+znMeZT887zphFAQwASgAVwK8wbFuQTcjOOdBmu6YRyJPs415hBoBoDxtIB7gK66wYoPc8U3E/tc9aCwO95OMY4pGX1elMP+J0FwNoQpzALgHci70zeJbxf7XfZ36IPRhzvXdJwP3DM8CZbDc7332FfbD23roF7ogH6oIA9cAowYhDA4ccRzz03qIN7rW/X0ADPORYBPOQnAAn++pkBcJeLAAocKX1QV9mCnNWg461LSMKfEFUBK+HLl4pgpkyAq3CX8DcH/xgBtFYzbQ3QZwo6363p+I6tw//twb+fDyxdD8BOBjLrO9tBbSPZfvTbtpC1DdY2mu23tu1s94O/dW8clQGAkVW+2wdm9zUEcCx5MA0+v/sXiJEAZobTL5QKqS0pyCKF25RCtmCd4ZZ/X0MARgCMHcI/khkAAC7XlNeSZbVcgr5hpfE7yTQClNkDec3qSR2qX8tq/VwxAgjtSyVwn27H4851HYDPevGL38T0f4BfI8CcASABXH+FdA0HCfT7+mvenhOpAcBRf8KMUgPkOqG/ygq5hpEJvhmPXxhPvwYB4jjvGIyPGQoEcvMZk6Qby3tJfMK+6Sv01+tNXVB+9Etb8ZORDTAPr5Sj2ugL8j5bUT7ek7w/faf63iXse5U0m2tZbY4lD/qZfesa6Bq4vga4n1Ybx73Z761BCYfaNAAA6odyrU8AiMMAsJmxcajiL84nwV9/BX/DLchZDWfauoSkhCdfGglYCV8JZfliqS8YXzQJffgTCAVFR/6RjPIz0gxsdsi/fcgX9sckxhinEDKN8KY+BajtzM6KbTHbpx2YbMfZvrPdb/yt+8N7Z0x6z1U5ZHnYjXvJv/C7jiEAeOO7f/9Obwr4hX8BFCmUVim0KoXZBFz9LXh2HzL3EzYv885zZ9ksr5IV69MAQDgNAOZDvpzDMmzPvxmx34YLvM/Ge3waAFr+Tb6eP6/XMnqdXtteAC/oJ/zjN35Obo5jFoUj/lUyM4B777Ct/3ZyY/o/U/9ztf6WAQAIF7hTCuMV0veF/TyOPAnXvD2n5dAI0IJ/gLWCfw0LvIKuYWQrjniNACkrtJNuCbCTph7bCjMbYMq4INCPyYT/9Nfp/q3rV2ecn/UQqBMMADiMSLfTWnc6C+8n3mFrI4CDO9ynvjuVvjdJM6RfbY7hWPLoW9dA10DXwNFrgH4/MwAA9EPNAkgDgDMAiOM8PD/vQikVPHzQ88CurgU4qyHd1iUgJThVA4Avi5QVzoR/pfCPTANAC/4xAgD+gCQj/oD/GHz2+Ls3CNzkpwC2n5TZ1rIN4qcDky7bcbbvbPcbf+v+IK7eRxlu3X831lF629ve+sNpBNjVEMDUf0b+W1P/BcsqBU+lQJpSMFcKsAItsgXLxpuONMatF9DbhN1vvp4ny2D5kHkNGgH4xwNnPbCfYyv4XzECbADeMim317IU8FvQb1wYFcauk3J6rXmdea1rg8AcwOf+KSNAGgXSz/Gb4yr4E3ZNAO6/4b45qY3nhNP/5wwACd0tf0J6Qvwh/Jk3/jx/wv9X/8jzq/4DqTrAFb8AW2VCPvta4QTi6k8DAPta4E4ceU8ZAyzj2PEZPwb4U/ECP2n0V9kyBKRO1B3p0HUuHHmkDd++4doIMJRx/R/zrfcj+wbn+5D33Y2904a8+9Y10DXQNXBoDTzBZxUs0HcoA4DQn5L8Oc9QeJ6Xt761ACQBJf0+0FOuhhKvXcJRvhTwJ1DhT+hKGMOfoIY/wX8K/jEE5Og/i9Mw6t9H/O8e8JcYWTDSHOpfAWqbyTZV2xvhbI+1rda2nO3cth8y7w39eQ9Vf+v+u7HOEtcm9DuyrUGA8NynAXXq/9zof4VNIVQAr1JAF2QTmPXnPuO2QB0wvF1BvxgBOMbzeH7LhbTMaQRg1gML160NHxuI5VjL4vkNb8vVgHTTbstnmn1kXG+eW7/XiZy6Vg0BOxkBpgwAaSio/s1xGFaqEQADwKn+FSAvcaf/awBg9H9qBkDCt/4K6IeAfvMgb/z1HJ5bAwCfAACmOOG/SgF2TAr3Qu9YWNB3f4YB9RpOeMdP/nPGgHpMhrmuKdhv7RP2OS/OcEumIUBdpM44P58B0E6YAcB6AHzLO7xTjnHj3eQ7zPcbcrVxxpkGeWPvsyHvvnUNdA10DdyIBuj7Mzp/qE8AWvncu9H/agAAviqUJbBVI8Dc6D8j/0wj7/B/GuCfxoHr/CtAtgv8aQSo7am2tzQA4E8jwDkZAHhKMgtA2M9F7jQEaCDQGODK/6yOX//yb8oAIEgrhWxBNKWgKrgqt7DcgHj3kVb/JSlQN471fErLYhktsxJjwHaa+wZgSdsqZ7MMluU6Etivx4cBwPNappReJ9JrRXq9SK51fZ1cX4X2sfA1jADVAODo/6n+C4Cr/wNyN2EAEN6F+V2lx1f4J6wBAAn8My19zAAAvAKtCbHVD7QTJ9Sn37gxCZyzryUzLiFeP+cZMwZQZtOl5FwtyB+LE/LZ7zWgK+Or/NxPPLbex/lJX3VFPMejdxcDfPTCF77rRnq0h8s0DQEJ+/rZ38H/cPruOXUNdA3cgQb4Nv/Q/waAIYBZBTH6z3Pz1jcf0il9gFepZTflaijx1uXIaEJTwtQc/FdQS4ibGv135N+p/4wk95H/0zMAsBDjkn8FyPrOT0DSCFDbTratXQwAtNlsz9nO8ec9MPjz/kh/vZ8ynPef/iGrm9nQA1CfDtjXGDBmCGD0f/3tf4G+HClPv/CMTNBMABVME1b1C7Q5lZ849m/3NQB4uy9heXOceSM9t9JyZVm9hi0Yb66dMPs4dns+ypLnvI5/6XVxjkZadZTXu+SauSan6I8aAdJAUNrC9piaphoQhv1pADh1+B/u1CeY/s/3/ywA6CKAjv7XfwGo0J0AXgF9V9CfSk/e7K/n8PzEO/VfAwASSK0OkCWuAm0rLPi2pBA9JoF19i2RCfaUo2UMIM78TN9K1zIAJNyTf5aZPHJ/+jECaAho6Qc9MguA9uNigEOb4v1x7JvvqyqPvdy9fF0DXQNdA7MaoI9/6E8B/KSAf3CAL2YLcUMJ6kObcIJJ+hNm9K+G9GuXUJSwhH/KAFBBjHCCGv4EuQS8BD+BkNF/4B+QzJHl7j8dYwALAvL5BrM4dl0QMNvHdWYB1DZb23S2d++BkN4fKfNeqv7WfUjcjWxcW8J/9bcMAa5+vwa8gL4E/vQLzkqhWsgWupEVUjO8htuAXPa1gLcZlwBeDACeN8th2ZCWF+k1tK6P/esy5bn28TcgvnlNpstzGFdk6ip1qt9r97q9Vq7zyqcACfQNmN8aDebSeeyQjs8qAH+//Y+Rf+6P1Y00/hvKlFlDfv8v7OdfABqX8C10V1nhfArod9k3Bv/EWwb8fAYwNQNA6Ncg0ALajAOShWVlgvOYX+B3v+GUY36OYZ/7W4CfhgDK1QJ+4gT59HPt5m35yMO0KYX/lK/55GdfMpyQHzpn5oifATz55JMvv6Hm2rPtGuga6BroGlioAfrMhzICCP9M/b+rlf+97BZ4VDgxnDCDf5UugajCUsJUnWpdDQDXgX+MACz6B0B24D8d4K91dVOzAGrbqm2vts1st/izXWd7z/tg46/3CmHvo5Zs3Yc3ZgAYyvLwIx/58Ccv/sf/9kJXjQCENQTwuQCwdgnyNkaAhOL0C81IYVrQFDyFcIG0JbcGAIC3AO5suAHJrXMQl2XCb1mVXgOSONO7/1I587wt/67X0Upf822lGYmrOsjr1QiwrWuBfUpu2sLsMSUdbcpZABgCuKf49vmPfe7v/PFXv/xL38/9OLTVk9joHKQBYGoGgEYAobvKlgFAeN8F+MfSmlc9T5aD0eicAbBkFoCGAUB4zAHL7EspQI/JCtqkyzj9KfHXMMdNGQJa+xLk9Vf49zzkn0YC0wv+hPUjCaszJDp2MUA+BeCTkpNo/L2QXQNdA7ehAfqE9h/tY95kP/E2rulkzkF/hBH76ywKCPy76v8G/u+0/jh5dTawKm1wytVw7NYlECUoVYiqkFUhrELaPqP/fer/6cK/xoDWLAD/GpBZHjpnfuRskJwFkO0Hf21ftf1l+6xtN9t1tnf8eS8Mfu+RlPV+ynC9Bw0PWd3M9uyz7/6Q8J+yGgL8NCAXv9uC3gB0Cf36d4F/4FMAr2C6BXxhdwRot+nqfo9D1n07hC2f4H8J9od8BGjS+bnCpfNlOfTvcP5LeeVx5qXMfQv86juNGRoAqMt1PY+BPzCf+wrc15ki2Wb0pwHgDW945r1A9Bd/8R+9wPGifOqpr/2+m2n9h8+Vb7ZZAJBRf+B/iQEAAE/oxl+hXFgfg/ld4jOv1nksC/vqZwACKrLlgHrix8C/Qn8Nj8F/xido618iM43+hH1A3NF/oX1Mco3mQdnSTxiIz2MT+Mf8zgYg77oY4NBSeYf0rWuga+D+amBFX5T3Y8thNN8Yy/uz4obbiPXAmgB+x++IfmuBP+NM4zf/dz3yr5oEjZQJJvoTZPSvhkzWrsJQglKFqASsCl8Vziq8Jdgl8AmBX/OXHv/2Pvp/+vCPEeAYZwFku8af7d57IaT3SUrvpyrz/kv/kN3NbCwEmOCf/moEYAbAPgYAR80dJRegBU6lIKoEeNcwDcQKt8gFUHspTR5bj6/7xsKbMlAeynsp/0152Oc1bstdy1rzr/v3CR8gT8rrtXkNGgEE9S3oV+jHAFDBf4cwBoD3Pfut688AWPkf6/rnftG/85PMACCeTwN4f9zMHXDYXBmt5fvtNADw/X9rDQCgXQAXupXGpzT9LrA/lZa8zTPPg18jBJ8BLJkBkMaANALMGQM0FADN+xgD0jBQQTyhXD+y5ccQkMA+5eeaPK95GVZyLeYh8BPG/4f/wb9yaQaA+5GkIX8+A0D3zADA9c8ADnuf9ty6Bk5IAytAkfci08W/7iu+4sfe8szrPoF7+uv/zHPAJA4YZT/GgQ1Y0ufs2w1pgH6/9YLuGdFP0Af2dcSzn3qijjDWwA43VLSds03YwF/BxHBCjP7VkH7tEoQqJKUBIOEf/y4GgDn4Z0SY78b5KzlHkbs8bWNAaxYARh6cMwCQGoDSKJTtpRqSqqGptsNsp9l+8Wf7znbvvRDS+ySl91OV9T40PGR30O0Jy/zxj//0Lyb0j/kxBrD6/yUIDMhz1F/p6L/wjxQs0wAgdAqgKa9AtqC7KyR73HUk5+T4ODdlzTB+rwcjgddS01wyZpQ8r6SN803uq9e29LhIZ3kpO3WkAWA7CyDBP+r+OvBPe9IAAOzjvuXppz4K/PPC9O8BY12Ag94IB85suwDgdQ0AAniC+RTML92X0C/8K/NcaYhY+hlAGgEq+New4J/Qn35A2rBQvYtMMJ/zs980U4YAZgfsUiaBPwF/yv+iDz6+NQw8/bHPWs++wJiEAeAE/g3gwLdSz65roGuAPihAz6dw7/7Ot1784A88e/F3f+y9Wwdg8p6soEl6juP4rsWb1UAaAoB7dI9BQEeYeAw41MkxDmYIGsoKJoYTYvCv0gkVyASkCk8JVhW6CCeYVWhLoEvQE/4Awb7y/2kDfzXY8CkHBh3+FeCZv/H49/MJgJ8BpBHANpDtItsL/mxP2c5qO8w2ir+24Wzf2e7zftj46z1D2PupSu+/KodDDrY94IHES4MXCWA/Bv01fmwBQABQ8EcK//ndf8sAIHC2ZBN2hdyA1ma63O8x+8rMK/3kl+Hwcz11VsOVtFmeOPZKuqX7Mj/9S4+NdNbFpBFgH/jPzwSKPw0AdGQ0BAj/SGYGHOwOuKGMeEb4DwAaAFjM7VAzAAT0pbA/ly6NAeadEiMAefC3dDkLAJg3XKFf0K/xgPNSl/AvcCt3MQLUtEI+8fqVpiXMuZiO7wi+kmvKdC2/cUjycFQfOTbyn+BPOsI49E4duBjg0Gx5L/Sta6Br4Pw18JDRZcDxPW//K58S+jEApPv+7/2O5xx1VmoMYHYAx/fZALfWWFZwAfp+foSfUf7nP8ugbwAnDCWhz390WwWOCiaGK8yshivZugShBKQKTxWuEr4SyvQLbRXmBD3BD4kBAFDs3/+flxEAo0A1BFx3FoDtK2W2xdpOsx1n+8afbT/vicFf75kpAwD3Wb0XD9rpYyTVv/djSn91fOvv1P+mAWAE/jQAJPxXA0AaAXKEXOhUAsH4L8GwUKsMaJ1MZ/olcizPVjz5teI3cZQ/r/FK2lqeibyuHDuW9oB5Wv46E+DSbICRtnBlRkAB/u0skk38+978sueEfqT/CJAGAPzcf8P9cbQbL3sXAJwzAGAYyJF3R9yVgDj+BHL8Qn36jdtXmlc9l2HKkf8GAPwDw8oK+xkGpgm3JHFjDoBmX8rqJ7zEVchvHdNK05oNQFzr+FYc+pka8a/7NARoAPh1b3+wXkOCNSWYBbDpyB9t++8F6xroGjiIBtZT/hmooa8G/Cf0p599zAxgQEcDgBJDAP5uBDhInZxtJi3gEPirrDCzGrSydUJQhaMEJ/wJVglc+BPGBH9lGgCEf6QGAKeDYwCoo8g9fD4GAQ0BzPRwJoB1b1vI9pHtxrakzPZW22K2U/zZjmsbt+0j857Y+Ot9U++rDLfuxyGb62+UjRdKhf4argYCjQKs1L6GtwJ+wn8d/dcYAPjr/Awg4VjwF/qVV8A3AbdCcO5b4q/HLwyvy2b+M8fU69rpembyvpKX6S2bcize/WNyOI7yL5oJ0AL80ka20E98ST8F/WkE4F4d7oLV9e+EG8nhwQsePXp6XwMAsJ3wL3y35L6gz3Hk5/H6WzLPS/rWZwA5C2CJMUBDQBoDxgwArXggu2UUaMH3krgW9LeOo9zOAlAS10qbcWkAWDL63zIA/MuvffxCA8BnvfjFb7qRltsz7RroGjgaDWDo4zt/4Z9R/oT+lh/YbxkBMACwL4wAR3OdvSDHoYEWcCSQ6K8QQ3ilSwCqcJTgVKGqQlcCGX5BDZkgl4An9AmB3QBwPrA/ZbhhgcB3fOzxn2TNB+vetoC0jWS7wZ9tqra32h6zvWY7xp/tPNu/90TI1r3jfVVl634csrr+xrUK+0J9HeV39J/9pE1jACO11QCQ8K9f8FdW+HcNgATk9C+CW8B2DF7n4oXiPSTl3J53j+MvXVst53Xz4/ia577hIS/rZNIIUGB+C/djBoBGeg0AYyP/GgGYvcJ9d/074fA5rJ8Fwz8AHMoA0Br9F9QryAv015HmneCvn3zrZwACfxoBgGLj8Vcn+BOvPyX+lgOqjdffkgnfh/RzbvJjFoQGACRT/FvnMX0aAOpo/1jY0X8kMwAwADD6T7vqfwd4+Pu259g1cEwaoL/Jt+K7wD8GgbFZABoAnAlA/sd0vb0sd6+BFnBUKCHcgpjVEL92CUAJRhWaEqgqbFUYS1AbMwAIfAIgsn8CcD8MAH4WgBHg6Xc+/k7bgG1CAwBSI0BtU7XN1TaZ7bW25Wzn2f69J0K27p3WPUZc634coq+9rQAowL5C/1QYg4DGgGoAEPhbUvhHVgMAQOkMAIBY0FzDNRA75naF2cynHpv79vGb3z7Heox5KI1fKj3ukDLOnfVybSNAA/wxFvCvEmkAmDIC0H65P699J9xABmuD4B4GAGFe2F4iE/RJn+E5f02fYf3IdJaRhekE/pSC/xT8V2OAYWBZg4CQv0QC3qbT35ItQL9OHOdMIwB+yl/zJJ0GgLHRf4wAOepvWCMAx/lPAL/lN33G2hDAO+cGmm/Psmuga+DuNfCQReL45h8DwJKR/5wNMDcLwL+eGy6T/mjfugbWGmgBRwtOEmJWw5GEkWuXAJRgVKEpgQp/Ba4EsoQ1AQ6ZYCfsCX98F94XAbw/BgCNANS5CwLaJrKdZPvJdoU/21xtj7W9ZnvOdo4/7wHvi43Me0d/6x67MQMA5Qagdln0rxoGWKztyvfdm5HeagSYMwAkXOrXGHDFALAL4AbATuYzlW5uX5ZnLu3c/swL/1T6mva6Yc41c07rBrmzEWDBLAAMAED/FPjnDIBjNQAwbZMRWqZr8/0/jsX/AOnWIoCuASBcC9yO/CuNT+kxc7A/tZ/8cr/hliSO8n71j1xeDDCNAMJ/lYJ+lQCycdVPeBc3Bv7kkfsqpF8n7CKBjuQzO8BzWXYNAKZJKfhnHH7yJS90w/F8esE/AbgQIOtMDO+UvnUNdA2cmQboa/rdf8L/2AKACf+k4ZixzwCcCUD+nOfMVNcv5xoa2McAcAn+h3OvEn4SjBKYKkxV2EoQw5+glgCXYCfspQGAleKZHj41fbzvOy8jAfWNEYB2YJvIdpLtJ9tVbXO1TdY2m+052/kpGADe8IZn3ruvAYDjgPpdDQCO/iPr9/8Cf0LmJQBeCrhT0Jz7Mr+M38d/G3nlOQ7h3+c6h2OoH+tKIwBtAaPPtj20RvgXGAAwKgn4cxID1rF2XgCzQxgAgO0xV8G/wnoC/VK/ebTyznKwH6MEULrUCbGC/pwEnE2jX5jeVwrlU3IXQwDlMD1lZQaAEI8/y8l+9ykr+BsG/L12ZcsAwDoT1+jr9UO7BroGjlMD29H/uuifnwMk8I/5+yyA46zcYy5VNQCMjUw6cqlcDRe1dRoAKhQlMFWYqrBVYSxBLQFOsBP0kGkAYGE4/ju+Q/55Qf5cffJXgX4KYNuwrSCzDWXbqu2utstst9me8Wd79x5A5r0x+L1nUo7dZ/V+JHztjWu4jgGAlxCjtVvgK3A3NgNgygCQYKl/bQBYCru7Am3mu+uxNf1N5ZX57urPMraOzf07+jXSaACgXmcNABgFSjvZrhGwMRjsYgDgnuV+u/bNcAMZPPnkky/nO21Ga50BgASax2YAjM0CSPCufsE+wd24Q8nM2/Ob99RigAAr8DomBduWBJyJn5IJ12P+Cvqkq3EC/Ni+XeJJC7wL+Ezb5/qJx6WBgDRO71eSvqUP8sChb9rPdgbA8JnJDTTfnmXXQNfAHWqAvuQrXvmyd1T4J0zfawz4a/zcLABmArDGwLG+R++wCu7tqStwjIFJwgv+lS7BJ4EIfwJTglSFrAphCWgJbviFOiEv4Z9p4BgA+joA9wv+MQ7w7wA3PQsg2/MOBgDulXr/jN1n9X48iAGAsl7HAMAU7Q8+89ufuwJ0G8C7jgFgO+rfglbjAFb9yh0h9tLxux5b01sGZN23JJzH7+Pf9xxLjmukuSkDAP8sMTXy7+cByM3foHHfHN02ZgAAoKsB4Av/3KP1lPpdDQBAeIXzGieo7yJrnoaR6SgviwH6l4BKYXVMArjsS9mC3rE4QJp9KQXs68hqGCAv48x3ibGAtGkEAPQJE4+ONA4ogX8W+MM4BODjnPavDtQl+6hLDAA4jExD4+dd0reuga6BM9GAK/9f1wCAQWBqFgAGgC/5spf+6OZdeiba65dxHQ1U4BgDkwowq+GkazdmAKiwlAYA/FNGgDQA4NcIIPwjpwwArAzPiPDcqHHff16GAmZ+YACybWR7sQ0ha/tKA1Rtl7XdZrtOg1feB94bIev9M3af1fvxEAYA8lgvArjvJwAA2HoGQGtUdzACXNsA0ILgBoheC+LzHK28d40zv6XHmX5XuTT/Vrp6rlaaBXE7GQAwCuUnATkLIOJpTy34F/pZHDDdMY9ajBkAgDeAHyMAUgdMLzUAkIdQLtjXsPHXkTVP4T/PTxywqhNUWxKYNV5/SmF3TALQ7tPfksQtdRXwPa7G17DppiRlzRF//GkYcLo/hgD0gg5ZV4GF/nAYVzQGqDfCGArSANA778PbrG9dA2ekAe7pb3n6qY8ewgDALABAv+UwDrAYYF9LZO/G8wT9kGQCeWAz8/cQ/fW9C7fPgRU4xsCkAsxqONnaJfgkEKkYZSqtQlYCGP4EtAS3BDohrzUDgKngzALoawGcF+DPGWyob9aAsG1ke8l2lO2rtr3aNrPd4rc9I7O9533gvRGy3j9j91m9Hw/2QOG6dv0XABcC/Kmf+O5xqNvBAMAUcpxAufPoeQLtAnC9kr/H73NsPca8kHUf4dy/q7+V375xee498rCunP7PWg6XPgEIqL8E/sanASCMAzn9H+hP2K9+OkfDvXS0G6s3tz4BEPTnDABCttBdpWBPvH6PSZn79vXnOfRbHq5HSE0jAH6hdU4CyqRJKegvlYA4aVtyCtLn9rXAP+PSP5ZXQr+j/so65R89oE8NAcA+xgDCxPPPCxgG+CtAZwDQ1o72RugF6xroGthVA09wT7/lmdd9ohoAGNHf5RMA0pPH2CyAbgDYtWq26R/S96ee+ITij/yBL3hXdcSzn3TDUfT3T2KrwDEGJhVgVsPVrV2CTwJRghL+BKkKWRXCEtAS3BLohLw0ADD6i8MAwCyA/inA/TIATH0GkO0o2xf+2v5q+8y2m+062zt+7wXvjZD1/hm7z+r9eDADwFCWxz7wgfd/bJ9ZAL/0M+953gAgwBWom5sBUBcABCoTmoXMjGv6rwmzl6B8Dxi+VKYsyz7+ev6aR92/bzjzHcmj1kdep3WjAQD4v7QIoKA/Jktb0UjA9P858NcQwAKAtN9j3XjxtwwAjPgD4vsaAKbgXjjfF/Rr3jU/wykxAACowr8SkF1iBBD6qwHA8BIDgNBvWsMtOQbpNxnvNQr9fu+PYcAyV6khANhHvxoCCOP8JwDa2KO+DsCxPgZ6uboG9tFA0wDASD4OoG8ZBur3/xkemwXQDQA7V89DZmfwfgf4mT2RMyvQp2H+gYH9pAtDwM4nvO0DKnC0wKTCC+GVTuhBJhAlKCVA4U/AqvBV4SzBTQNAC/79/j8NAHwT3hcEvF9GAOqbtmAbsc0gsy1lO8s2mG0Tf2272a6zvacBgHvB+2Mj6z3Uus+Iq/fjQQ0AXOc+BgCmam8/AQD0CtQtMQA4+l9nAAiYQqgyIXTrXwCz27Qt2L3u8Zln5rXEn8eO+TOfsTT7xJd81bm6mtI5+6w7R/9HDQAaiGwjGgVKe6H9CPdLJPfWcG8c7db6BMBv/wHoMQNAfgYgkJM+XQK+MJ5x+qf2mWaJHMvHeMrMCLXwL/hXCdQucQJzygrIrbDAz76W37iU+G/KWY48H58BaADAIDBnBECHzgbQEIDeNQAwC4B/mzjaG6EXrGuga2BXDYwaAN79nW9dLwC4qwEAY0BrFkA3ACyvGvr9gj9wj+4S+AX/lKZ5+uv/zHMaAo6971KBowUmCS+rQYUHNQAAWQlg+BPOhLYEOeEuR/9bBgBmAbzjY4//JCPDc9PH+/7zMBSw9sOu6wDU9jdlBEgDAP40AqQxbLhPuFd0eQ/pb91r9X48qAFgKM9jzz777g85tX+p5BOApQYA4BDX+gcAAFKYTOgUSDNOOL0ihdl9QJhj9j3e45bK65aP8+ybR+s4yz3sS33P6Zz91FnC/yUDQEK/wF9lMQCwoOQS8CfNsY/+c0/5N4D1XwAAf0ZzlxoAAHSAT9hWGp8An/sy/pB+z1El56ifAmgQEPo1CBieksAz+1uSuKVO+Ca9/imZ+/AvcUvztsx+EqAhoH4GQLq8dvzolpF/2g665x8lch2AocmtaHd96xroGjh5Daz/ArCuAcAoPgYAjQA5wr/Ez/GAawVUFgHsawBMtxngnyn9jOgL9anHOb+GAo7HiAAnTJ/x7vZW4GhBicCiXA3F3TqhJ0EIf4JSjqJWuKrw1YJ/jABLDQBM//cTAA0AHe7PA+6X1ONtzgA4RQMA9+JS8Ge2AOsGzBkAGNF1FkDLAIAxID8DcBYAgNuC0YTS9K+BWJAtgFzT1fAWpj2+BckZZ7qlMo+9jj/Pd5186rElX/SDaxlk1FWmSQOAdb2dCTID/Nt0m3bC9/9LDAB8Fzm8a3jvHPXGNEFGZv/VP/hpv5J/Awj4A3B1IUBG0XUCu5BteBd5nWM9T+aRfvcr2efMBb5RF/xTCvu7GAE8JoG4+oXqfWUCP3kk8JtnK41plR5nOCX+6rg2wF8jALMBiDOd154S3WEEQN+0ozQA9IUAj/px0AvXNbCTBuiTvfrlX/r+OtKvAWBfIwAgmkYAwpyH8+1UwHuUmD498M8oviA/B/xj+zn+mI0AFf4J37gBgMY3ZQRIAwD+XWcApAGABeH6JwD3B/4xEDDjg5khzhJJw5FtCVnbWRqiavukzerSsHWKBgCe5fwl4JgRAOgX/H/uZz96gVsvApgjvWVEVyBEagBQOhNAAwByzACgQSABVP9WFpDdxlfgHQtPHZ/7pvyZt+kirmV8yLgx//ZazBM5k2/un/Wb75CncI9MI0Atm/snDQClPSTwVz9thG//+axE2fo3AOJOYfSf+2nKAAA4A8xjswAEa2XCt36laW5Let6W5JoYoU7wr36Adh8jgCAMIONvSeF5Tgr0mc44Jfv0j8lM08rLOI83nJLZABoBkIS91pTq0UUAMSBpAGBBQD45od31rWuga+D0NcCAKdBZR/ZzFgD+un8qjDEBw0EaAABVzrP5RPX0FXf4K1gxYu/I/xjY7xKfRoBj0/udGAAqXCV44U8wS2BLkBPu8hOAugAgo/8YAPrfAd4fAwCferDw464GgNoGaxsV/pHnYADgGupaABX6hX8kK9ECbi7gtpYBfWkAqEYADQB1FoAACrTqVxon0BKvfzuFP+DY/XNynYcQvFQGgG/LkHHmk3Ebv+VpHtdIv01nnsipdAv2WQblWn9RPuKrAYA4HfuEf+rQ6f/r9hBtoIL+WDhX/x8Df+O5Lw//jj98jmtD4LA4W2sGgKPlSw0AtwX31z0PRgGurbUooACb8K9fmcC7xA9Ik64lE7Jvyl/BvoaXnpdrmDMCqD//IQA9/5bf9PzfAa4XAnz06CWHb8U9x66BroE70kBzHQAAvxoBCGsMUE4ZAgBQv2EHbPv0//EaxpDPJxLXHfmvBgLyI99jm7l1bQOA0/+R+QlAhaQEqApXFb4OaQBgEcD+V4D3ywBAne9qAKDN1XaY7TTbbzUCZLvP+2F4zKzC+flMytZsm9Y9Of7EusYeRledBcA0/wT+6mcGAN9tbw0AAX4V/g3XGQBjBgBBs0rAl7gmAAvIjTSjxwC9HjclN3DcPG+c79J5zG9kv2nHZPNazRNZymQ+zeM2aZemEf6VHJfuIAYAPhEY2gxtY27UX/hHnooBYLgNH37Wi1/8JuCsfgLA6C0j5ch0QJ3GgevC+E0d78g/+etXek6uganqQuuYBHwT/tM/ZwAQ+scMAMYvhfBMlyCvv8qx9Mab3nBLWkavNT8JwG986s+1ANA1xiVmAXQDwDVeev3QroEj1QD9ShaOa8H8mBFAY8CUISBnAZA/bHakKrjTYqEX9FPhfZ8wBpeceaFBgdkX8MKdXmicvAUbLShJaMG/0iXwJAjtawBI+MffmgFQR/+BvbEFABkN7gaA+2MAoK6Z9ZEGANqLs0eyPWVbm4J/DAFpAKhtO9t93g/eIxtZ7yHCrXutdU8OSQ+/cR1zo/6M/AP/wNhbvurX/4s68p+jvIK/UgMA0lkAfgaQsCnEJnQa15LEbUG+wG5C7zpdpk2gTv8mj236kTybeXus+RkueeR1eJ7Mr+k3T2QjP+OUmYdxSvbp1nGbPImzLgR9pGndb73lDICs+62/rgVgeGMwYvQfA8BSIwD33uFb/s3kyNTBlgGAkf8pA8CxGwEE/ZbUGMA1sHr92JoAQi2Qm37Dwu+uEtDmmCnZgvHbjJsqX8sIoH7QZRoA/CcA2lj/BOBm7uGea9fAHWrgAe+QuhigBoE0AgD1Cf9TBgD2OQLdR//HaxfdHGLqv/CfEiPCMdZBCzZaUFLhZTWoce0SeBKEKiQlQOXIKv4KXwlmCWxCXDUAAP9TBoD+DwD3xwDAeg98CoIBII0Atp1sT9nO8Gc7rG00229t29nu837wHtnIeg/dtQHgIQ+8D3zg/R/L0X6AX+jX7/73vfllz88AiNH/LfhtRneFf6VGgGoAACgraCZ0pl+IvSSF4wLczTSmbck4nnNyvLL6M2wa5ZxBYptuIv9Ms70OyxzlbJVjmz7SmZ/S41phjQCCvmHS4ic+4Z/6zbrf+gX+zYh/Gow45h/87W/ayQDAvTbcPyexMb1vzAAAKAPJrRkAx24AEPKr1CDgtREGWAXYKQkUs78liZtzAn+mM25K3jT4Ux7PoT9llld/XRdAvVUDAIYkjAC0MUDhJG6KXsiuga6BxRrgfccoMYBfFwT0c4AK/oY1FFRJPgDosY0+L1bKLSSk345+9hntr8ck+LOQoDMBMADg5zzDJa1u4bJmT3ErBoCEJ/wJVwld+CuUJbAJcbsYAPpfAN4f+Hf0H2PQrgaA2g6zjeLPNnzqBgCuFfDnYcTLQ9BP8Af66xoBwNsW9BpGAKE/ZTUAAJEJmQDmmKvAmuC6Bt4Kx4arDCi+BMqmi/2ewzKZ3njLlNI0S40A5lVl5um+bZ6UdSjnNr5R5tyf6fC3nOnZJ/An7KfRZhT+Bf1sDxoBIo42scu3/8w4+Z53vv4fDm8wDGUnsWEIBM7yrwCBNhyQDyifogFA0K9SgwDx+xgBBF1A+DrGAEG6JaeMAaRv7Rfgl8qaTytPy+Y+w0quP9cFwJDSMgDweUk3AJzE46AXsmtgLw3Q12QqOn2zlhFAwJ8Df9JxPOmATvLdq0D34CB17lT9CvVLwwn/+tMIQD7H9BnGrRgAAKYEqApXFb7SCLCrASD/AcC/AOwzAM7fCEAd+/d/+xgA6gwA2qTtlLY7ZQQ4tRkAfvvvi4Qp/sA/0M9aAK4LUOWnfva9kwYAjAMJ//g1AMx9BtACVOISUvUjL4GxIF9lA5LN81IeG7C+tG8Tt063yccyWo6aflumODbT6F8qt+fO64qyWA7TmW/GZ5zpUrIfpwFA40wFfuov63ZrCGoZAAL8s01gQMrv++f8/FPFqfU9+CvANAAAbBgAAP/6GQBGAV2F6wwnaGf8Mfo1dAiwQv4SCQybLsFY/66ywnaG9SPH/Jwv982FTZvplpaZ6yatRoBf9/YH608q8hMA2lE3AJzaE6GXt2tgdw0wmwxoH5sJYN9tSgL/3/HmN/08+Rzb4nO7a+Rmj0A/h1r8T/BHAv9pAPAzgGOpj1sxACT8C1PCFTINAGPwjyFgyQyAlgFgyX/H9zSnbSTgnx749t/PQfoMgPEHJvcgcO/Cf8g62l/h3/R//9s+Y/SfABL2EhY1AjiijBQ0AU8hVBDNsP6E1rU/oVj/Bo5N67FK4tNfgd19ykxP3FTYc67zjPPU40xnvHlOyfUxjWts5WH+VyTHT+jHkX+n+qcBQNinTvVfkhNGANvBrqP/GAdO5S8A80579ML2PwEAb3MzAIDnhPpjB/8sn36kRg0WBmQUW6hfIoHgms64lPj3cWOQnvHka1jZinOfMtNk2XJ/xusX/r1u1gXAAIDjHxbQI+2iGwDyTuv+roHz1oBGgK/7iq/4MUfzp4Dffc4a4Dg+FaK/d96auv7VHer7f0b40wCgEQDJPgwArDOw+YSLz+3vdKsGgNb3/8TV75dXQ9za5TfPORJap0mnESDhvxoAMAa0jADCP3LqE4BuADhtkN/HEMPUfxZ75Nv/XQwAGJWyraUhqrbRbL+1bWe7z/vBe2Qj6z00dq/Ve5LwobcHH/nIhz/Zgvy5uO0/ATDK2wA/gS/lnAFAI4ASsE13CVwF4ZQBtvU4IXksXmDnHJl2abgeM5Zfnt9jPEfu81ozzTrO691cq/uVHreVpk8Zx+Y50bsGAI001pn1uAZ+6xupGxnt9zgkeb3v2W9dvPCfMwNOsePCPwG0/goQeAPiAGQ/AxCUlQn/x+wX9i3jWJjrYtbD0nUBBOAEYiB5LixIX1cK6krzq2HjUy5Jk+nx53XlteNPIwDtBV12A8ChX4M9v66B49bA833LRy9h2jiLAzKdX2MAoJ+OePYD/oz6A7Ucf9xXeBSlW/8F4yEWAOwGgKHB0egSkhKeKlgldI3Bf47+dwPA/QP8KaOA8I/hZ1cDwBj80w5rO802nG0b/wkaAB5jevUc7Lf2M5J7aRbAQgAUKAXMsVkAaQTYwizg2gDZbdwG3oVajtOvNE5J/Dp/820cU481rMy8pvIzXZUek3Jp3uuyoxed11Gl+8v1Cf0p6+g/dQbAb0f7hf6W3LSDBH+Pw2iEAUAjgP8CoBT4Uz711Nd+31F0DXYsBKuzjy0ECMgxorvEAFChWtg+ZlnLTBhwpcz8QwBgu+uMgATjCs0CdabBb/x1ZQvqMy79u57LcqbM60BP6IxZAJ/2isfXi/9hAHARwP4vADvemD1518AJa4B+JqPGgD3GgFe//EvfD+jrCBPfwX+vSn6Ibg9lAKhGgPoJAOfBOLNXSQ98UB1tHBuVrKOXq6Eca5cjnglCCUkJT/grXC0xAvQZAB380xDAN/9M+2fkX/i/jgEAY0Bth9lOaxvO9p3tPu8H75GNrPfQ2L1W78mbmAHwGNfWAvy5ONYLuGQAAAZ3MAKMGQAS/BOCt4DbANn1PoB3A7fKBOqMM1/l+njybeTROs44ZebjOdd5Rn6mmZLmNyW3+Qr46sNwSvdtZOvcCf76NQBorBHmt/VrXbcMAO4rbYFjBX2NAFOStCz+xz013Dcnt/FcGFsIEIBjRBwgbhkBjhnudymbhgAlx2IIqJ8EHMIYMAbQuwL5baUfK6/wj050fv+PAeDXrlYXzCzRAHAsHciTu0F7gbsGTlcDT/BepC/K5wE4wFVH/HBpq9O9vDsr+YNDGgCc7u+nANUAwFoDx7oGwBiUVHihka1dAk+CUAJShacEqwpdOSrbWgCwzwDohgAMASz498YfevyHWejxEAaA2g6zjeLPNpxtG3+2+7wfvEc2st5DY/farRgAhjLt/RkAswDGpoADfIJjSqESWY0AAmgLVKfitlA8AbpTx7Mv85hLu2R/5offY/RX6f4xuc5PoE/IT7/7Q47lp66VrsWgpG6sK+vvkgEg4R/Yz3DDCFC//QfwpwwAb3nmdZ/YdGSGJnqa29hCgBgAnBZfDQC7APappuXamQEh4Aq9+0qg3WPTX+Pcd1uQX89DebIMtXyGleoHAwCzADAaAf8YAXAYmE79HjnNO3unUud7nHf9jRjydypRT3yuGuht65o1C5AfahHA1gwA4nCsAcBMjWN5fudDCv8YlFR4WQ1p1y6BJ0EoISnhCX+FqwpfLSPAvjMAAMUcOe7+0zcgMO1f+G8ZAFwAEOl6EbafNCplO6szAGobzTacbfuEDQCP+W8Ac6P+7GeRQBwLBq7/DjDBr4z6Co5VCpYaAYROYRQJuCrHIDbj14AMDAds5379Y/svAfZMHuY1JffJz7KlrPmsw0I/oL+5ZtNNlanuS33jtx6Q1QCwhf+E/fRnO2gYAHJav/6xGQGveOXL3rF5rwzidLe6ECDgr/MzACAeP1CsO1Wwr+V25F/Jfv0aQFwXANgVfA8lybMC91S4Avt1w1zH2PmmrlHwR6IfZwD47xEaATAw8d453Tvk7Ete+9L0n+1bd1g7++rvF3hiGlivAYABQFDfV06N/psnBoBjeX7fugGggtUS+BfahDihTtBz4TemgLsIICvCMz28/wXg6QN/Gm2c+r/EAGA7sd0gbUvINADUdljb6TkaAHgILV39n78I5K8Ccdc1ADgDIMGzQmmGAVjCFWQJb8H4GvB+iDyybPvmJ8xvpcCvFPwD/ut5M5z+1Kf+1L/wrwFA403TAJDQrzGgGIE4bsnf/jEbgO/9j+WFeIiOy9Q6ABgCAGKhLo0AFaTPISz457VgBCAM4Cb0AseEpyB5yb6xPBLKhXzyy/i5cKZN/9xxuR9/OsubumgZAGg7GAEwAAztdHWIttrzOLgGAH2Af5WDY/iJ2+wjTd+6BroGjkQDDF6zfoIAL6zvI536j6zT/4njPJvnwZ1f/a0YAOjcJUBVuKrwlWCWwCbICXYtAwBGgA7/5wX9LQMAdczo/9QMANuJ7aYbAK4+b5599t0fGpsB4Ig/8J8OI8DSdQAAQWHSGQAaAJSCqGDaksIs+/Qjt7B8XQMAcH2NPPYtU5Z/60/g35TLsl1Ksymv+7IMY/7UrXpP+NcAQF1Rb6MGgAbwZ9o69d/R/5bk3XC1ZZ5uDC/3qXUAgH7BOA0AgnHC8jn4vVauRb/XyhT3BF/AWCBOSF7qN6+aXlifizcdUscx1V/jzNfjDc9Jr9VyI4V/dMO6CeiMdvIFr/30tQGAGSane3ecdcnpTz/k/rfPa1+XZxxxm46/MwLOWhn94s5GA+s2TdvV0c4Hd0yGLO69FSDPfYbDT9zglmzX/icAjQfKhH8MCUz/Z7HGY/n+H6XcigEg4R+/D0VlGgAS/vFrAEiIE+zGDAB95P98DQCu+n+TBgDbpbK2Xx8wPmTy05d4QK6G+ysdD8x0PDyrq/ej4SHpzWzcey0DgPDPlH/8OVMA/6VZAA0YFPpTagBQagBACqMAKv4E1fQLtsTpF4oN7yMPkUeedyo/912SjuorJ4wR6+M26fKcY/7Un371XeF/0gDQqOeE/vQzsu9U/xb0Zxxt8GZa993lyigto7VAG85PAJROhUdWBygLyOdgAEjw93qAWq9bIwCwLAjrTzkH06Ylj7G0Y4Ce8eknnwzrV+Z+45SWIa8p4/C7L2UaAFgzAZ3RbmhHGJb4q8m7a9n9zCMa4F3N+31Fv4BnGn1X+634iaMv0Y0AIxrs0cekgYe0VRYbZYE8Rq3TlYUHafd3snEvuRgi5eMzwnSUk2vgWoYCTpaT+5Y8AHhgfd/Rf44jjzQAkB9xlGeuHLepSAFDWYHEcILL+iE3FHKFE3iQCUIJSfgTogQrJQ/GdGkE0ACQD9MpAwBTw1kdPkeNu/98DALULXXcMgD4KYiGIduJL+GbmAGQbR6/94P3R8h6D3lvpfQ+rHLI5sa2Jz7ykQ9/Mo0ACf8Zn/5f/sUfeX50uE4H30Bign/6hX9lywggnAqrLZmwK0hn3K7+Q+SR5zQ/pPEZt/YH7LvPtFPStK4DMJUW3bk/9aiOqwHAekFSbwn1s/5NW2D0vy70hzEgoT/9PPtvrHXfUcYvePTo6TQAVCMAI7rCcJ0FkPCfftOfunQWgJJr1AggvM9JQVpZAdrj3d+SFdRJk3G7+lvnME6oz3JlmfGbRolOMACgnzQA9L8AvKObevq0vMe38E9fg89R6av4uSL9EY0ApB0cx/Cu71vXwLFo4AlYDVDlW3W+i0+QTbjl7+xIQ9rNqPYkYB/yAp/vdz96CcDOJ4Tveftf+dQP/sCzF9V9//d+x3Pf8eY3/TxplpRz38UAgft0VWfo7ZgW/7MuKmgkjKS/wstqyGDtBJ4pA0DCP37BH5ngjz/hP2cAtAwAPFCFPeCPB25f9O98YL9luKF+K/z7LwCHMgBk+8Rf228at9IAkPeC98dG1vuHcN5f+uv9aHhIfnNbLgaY8J+j/gn/+NkH6F1aBb6MECf4V3+CpkaAhFL9Ca36AdoEW8JAsaCrrGlq2HRKwdowMo9Jf92Xx+A3rylZj9klnPlOHWeZkTp1OwX/GgCst0n4DyMQn4Y48j8l0wDA/XVzrftucuYZwWitMwCqAQCgA+RZCwDAG3OnDvtLy8/1+zeBCcYAtNC8RArSphXA71paLqAewLd8SPcp2U869GH7SAPAMU0hvZu76+jOynv6Cd7/9Bfoq9InecfHHv9JBixw+Om3YBggDf2G4Rj6ARzbt66BO9cA7yzBH4AFWsdGwol3H+DL1HaOvY13Oc8/wJ9/DKrAPxXGGKAhYKKcw2cEj16yzz8CaACo8I+eyO8Yn9sChlIQqbICzGporWuX0JMwlJCEPyGqAhbhNASkEaA1A4CHqKO7aQDA0soU8RY49rjzMAz4Is3v/w9tAKAt1jaa7Tfbdrb5vBe8Pzay3j9HZQCg3B//+E//omAP3E/Bv8aAX/qZ9zxvACjgLyxWeDSsXGoEAFSF1yqFX4BYP5J0hlt+45SkFarr8TWcx3iOKs2rJWvafcLbfIdZBK3jLSOyun0MANSZ9bqVAf4agvg0xNH+MQNAwj9pNp3h4VY5r23q7wABOqCXUfCcDq8hYCk4n1O6agSYgv/cpz8BGv9dQ7/npyw64T5nPGS5c/RfAwAzRGgvn/OqX/McRqXhLlmd151y8ldD//khzzH6DfRN6YsC/i5C7aeL9FfpX9CH4JjB0dfuW9fAnWqA/i1Qzag+4L+L0xgA+JLHTYIueTPFfwr05/YxW2CqnNzHGDPQhdc2pw/hX6nxhOPJh/zoZ99pJTdOLvgrK/gbrgCzGvJau4SehKGEpDkDQMI//n0MACz+10f/zwPyx4w1vExZ36HOAKDucXMzANKYlG2str+l8E+7zjaf94L3x0bW+8f7qkrvw5RDFje/OQtgCfhrAEA2wXDEIAA4Cv/KagRIOE1/hdgMC8BAMX72pZzy133mkfHml3H4022BfChD9We6MX+eYyxNjc/z1H3mh0yXOnXmRcqsD+voSh0n+FPXMfU/4X6J/3ve+fp/OLRu7o+z23jpz30GAPQ6zVv4T3lOgL/kWjQCCMpAsA5oFpyF64T/BGn8meau/JYDmeXjmryWjE8DAO0C45ALAGIA2PwDwLncK633HHGntlHmtQGAvkQaAOzLYABg8II+CmnCAHCK13tq9dPLO6EBR9SB1Xd/51vXI/v4hV6hFmlcS3IMaZjqfhNGgEPAv8YBZgMsMQL414BcW+qkdf3GZVo/kYATJqrgznblAxh/BRLDFWBWQ9q1S+hJGJoyAGBtqpCVEJZwltDGyL+uzgAACvvo/3kbAKa+/9cA4IwQ2wfSNpNtKdsY/mx/tW2Ojf6fkwFguJ8f+8AH3v+xhPsxP0YCFgfknwHWnwHMAP92xHiTLsESv9ApiAKp+BNW9SfM6q/wS5h9u0jzSAOAceZlOKUQTlzr2IwznzFpvu4nnH73p8zzG+8xyOrUY0r1jrQukNZTrb818Af4E2bq/xLgr2ne8IZn3kvbO9NtNfVvAIzqAndjswCA4SXQfI5pmPquXvCnA4wBaGBZsFYK0ISFfv1KjQbuP6T0HMjqNy6NGxoBLHfu4zqpW6f/Y0w68X8AyP6mfcuWNN2pPBbWfWf6wvQd6G/QH2VAij5p/nUx/RH6GhsgoF/NsX3rGrgTDdCHBYQB/7/7Y+9tfkPPPg0DQO6UQUBIJk/6zYe6qEPCfxoBMNJvjHFXisr9zH4gnlF8DSACvhKd6Pf6SR8GBp5xR7n5oFW2HsbE7WwA4AGXRoCEqApYCV/4E84S2gQ5pIAn8DHlyulWWl27PC+DgN//T80AsD3YPrLNZFvKNlbbX7bPbLf4s03jT6NXGsOGe2YVrt4/Y/eZ92HKIZvb2ZwFsAT8+StA3PrfANIA4OhwxjX8wqVS8EwY1Z+wir9CrcArACONm5I1nzw+88h4gb4F3qbznIY9JvM0jTL3VX+GMz3xtRzuR1ZX9UhYHSf8WyfKKwaAhP+Nn3ZQ4Z6wnwO09hHHvXc7rftuzgKwzc0CwAgA7CFz9P8+GwCA/4T+MX81BAjSCd8J/MYn9Gdc+jPNEr/HpsRfnWWk7NQ7RgDj8OPYxzXTBjQAYEyiQ3o3LflaZ/V9lu+9+k4knPvxc9ypbJR3RR+BvgX9EPqkjPrj8DNIQR+ENPQVhvSndo2nUhe9nMs08IDnybc8/dRHW/AvKKdk5DwNAhoDHP0Whv0cYGPoWlaakVTcK8A0586yHMLPOgJ88z9y6nU096uGAGYEAPd+5+/1Eyae/Y76jxkWps512/t8MCt5ILVcfVivhnRrl9CTMDRlAEChCVn4K4QloAluCXMCnsDXDQDnBfvVeINx59i+/z83AwDX04L/HPEX/JW8OD74zG9/zmnga1jECNCA/honYCp3MQK0DAEAsa7Cr2FhmrD+lPgT2Mf8pNNlXul3f5U1zdJw5uMxxLWMAOwfc2kI0ACg7q2LKi/VnUaejWQWyBjgT8Wf+ej/8Ip87DFGLuYWAwT8gT2ne6cR4BxH95de0xj01/gWRAvdCf/pT0gX7o1bms709VyGW1LQRwL6lD3LnwYA20N+/38Kncp1w7/8Y5/SfuSlf4+yDzkcshqcaTzmVIwAlHO7DgD9V/qoTPkH/Omn0o+lr7upQ66Va+xb18CdaAAOA1aXwr/AnenrzAANAYyEA8NzcL3kwnmHYqTw/LvKNFpQXsI6wqwpsOC5+gRpuB6MARgk0J2OMPG4jdHjJJ5bgr/Sh26VPpSVq6Hits4H+L4GgCn450GqAQCpEUADAJKHK3BYobGHz8cowFQ6jDxTo/+8bDUI2T5sL8hsR2lgyvZXDVM8JNPxENDV9u59kPfGxu99o6z3l2Hvw5RDFre3Pfvsuz+kEQDwF/4F/p/6ie9ej/wbRq5nARQo3E4TnzAEVMgkDIgKpSkTWtOfkFsBWUjONNWfx6Q/wT/j9Wc+xBmufsKZF+lMs6scO7Z1DstTZepO/Qr/yFadEHfFALAZ+d936v/m2//V7bXsuzsT321PzQLwUwBAMOFf/1JgPrd0S2YBCNAJ0cB1wvkU0I+ly2M0ELTixo5P+Lc8KTUAONJv+R39J0x9YhxKA8DdteK9z8y7jPcb7741+Ds41HqvbjrPq036fC8OUUe/Ud5hFfHHfjPXRr/Cfgb+Dv9HX3/3qYAPgVVAOIF+V7j2WCHbEXGnwgPGm3t6L93SpyaPXcplWZypkEYKDBRZRvZhXNjxr1Wf4JpwzxsF1t/3r4YL5P7neXcyW4KGD2ofuikFF+VquMKtE3yQKkblCEvIfOBX0EoIywfnmAEAoBPyugHgfEB/zGizZPr/lAFgDP5pX7Xt1baZ7Tbbc7b1vAfy3tj4vW+UeW/pr/ei4SGL29v4DADoxwgg/Pu9P9/8J/gTJg0SENxnFgBgmdApjAqnVSbApl/QBYYFa+OqdL9p5yTHe0zm1YrL/R6X+bu/Hmt4Srb2ETfnPKf6Sp2q7xb8Z91sDQDF0DM29X9s5J9PAvgrnqFFr26vVd/tmehcLDEAALyO+gr/yHMD+12uZ84IkAYAIVrQnoJzYd40FfKNF+RNr5yLd3+WBX+6hH2u0/JrFKDunf5P+/msF7/4TXfbknc+u31K3ntrMLYfyDu29d7lXct7lffpcAzH8X4kn1PZKO+l67XPsLmm1bD/1K7pVHTfy7lQA9xn/HUf/bmEa4BeqM/4JX6OA76BfyDbWQCM4C8s1pVkHEt/Yer8Ffg575ijXK/+mlc8l+6QnytcuYAjjxAylDyYWk5wUa6GdFuX8JNQ5IPPh36CVIWsfBloNVUmvOWIbjcAnD/4YxDI6f9TMwCuO/pPG6ztMttstmf82dbzHsh7Y/B7z6Rs3WPeg1UOWdzexnVM/SWgwJ+GgOYsgLGRfwCysW/MCACYJrDiF2RTCrlCd4b1z4Fya7/HXkdmvjUf9o3FuU9JOv0p8bdc5quuqi7HDABZR5dmAFh/g+TTjzHQb8Uz6s89dnut+XjOVBcD/ILXfvoa7gA8nWsBJPx3A8D8WgBpBACeAWsBfEwK8krStfzGjcmx/I1P4K9+DQACP0YA/DgNQRoAaD+HmE57i3cE7zHec7z3tqPivF8d1Mm+HH08jfG8c3m/boCZ48mH/E5h87q31z4UejU4r+OUruUU9N3LuLsGHjD6/x1vftPP03cDoAHs68C/gK7xAABntJ3v4jnXUETa/a7bA555lNP8q6TsjuoD8nMuwR//F3/xH73A8bnCdQwVu17YsaSvsEEltVzCi/7VkHbtEn4SiiowJUzhr7CVRgD8GgB8YfCSyJdGGgAYIe6LAJ6nQYB6bf3939PvfPydrv4/NfpPm0kjUrar2uZqm8w2W9tztvW8B7wvNtL7JWXrHqv3ouEhm9vd+DbbWQB+DlClswHyk4DtLIDN9PCEyEt+IbIYAlpGAAG1gusSQ0ACcAuQE6LH0mb8vv567rF8LM/c/ppfK5x5CP/I1KO6RabuLwF/qaN1PQ71R10zmp8O6G8t+gf4cx/dbis+rrO94NGjp5fMAmB0nG/cxxYEvI8GgfrNf4YT/vUD0AK4sgK88Uj3GZfh9Lt/iRT2Sas/JfCvo7yUnbp3JgD+xvR/3gmnsvmOW38Xb3+Pdy/vY97XvL+/4dnH/zqSMP053tO8k0nP+/VEjQDUke9v9XBKdXcqbayXcz8NrKf/C/2HNACYF3ljBGDE/RqfAazL6VR+8sYZdmo/5xD8gXr8KSv0E/7Kf/ff/hUk8I/8Y5/7O3/8xAys+9V8OcqHlNKHVZUJL/pXQ15rl/CTUFSBKWGqglYFsYS0hLc0AmgAQDIy3P8G8DwNAMwC8C8A6TDYaQD+D2kAqG0y2yv+2p6zrec94H2xkd4vynpvGfYeTDlkcfsbepgzAOQnAqTFXVkLYAQeLxkDShpBNOFUf8Kr/oRb/Am+ArUy9835heq5dEv3m9/SspguZeYx5bdMVTfqTKleqwFgqn40ALDwH7D/vme/de3SEJB+4J/75PZb8fGdcZdZAAJgnw3wPBQn9Fe/4I90BB3YngP1CvcZTr/5tOLcJ+hXKfQL+zVseSk78K+BB+noP4ajE/v7P95hvNce8l7kvck7hT4dfTWAn/V8MOrrCPNeZxZfGgFO2ABwfA+gXqKugec1sALKGf132r7GAEfw60j7rmHyAdCBcxbK4xmwq/K59ynn2HR+49MAoCGgGgFqOOEfI8BLX/VS/2GFZ9e92RI2fGgLJCmFF+RqcEr8l1Z0TSjCn9BUgaoC11IjQGsWAC8VIHHsG/Ief/rGAdcBaBkAnP6P1DBkO0kDUhqW8Nc2V9tkttlsy7Wdn5MBYLinH/vAB97/sSVGgAu2Yb0AHGsFAIbbtQBaI/0Zl/4wBEwZAYBVARaZkCv4HkoK34fIL4F9l/zyuDF/5pdlTt3gT72Nwf/s6P9QT62p/wn96b+P0+q4f1pbay2A1qcAwB9A2JoFICBiILgvDjCu0F/D1QiwxACQ8H4ov+cV9JUaAKpsGQCod0f/aR9rA8DMX1W12tsdxtmX3I7+857lfYzBHthn0Wb6azre7RgDeLfz/ubdzLt4YzxcDddif/ReddDvsA77qc9UA9xTN20AwGCQBgD60buq03IK+mOSTwAEf8B+zrXShgGA58y92aoBwAe3D1tlGgD0rwYtbZ0AVMEooQl/AlWFrYSxCmoJcYIdUtgD/Po/AZw+5E8ZavwUAGMP7pCj/7S92h6zreLPtpzt3LaPzHti4/d+UXpPVdm6F4cs7mZDHwD9IiPAxgCAEeCXfuY9lw0ALchvxYUBgFHmNALgT2BNkK2QSziBGL9xYzLT5LECd8Zdx59wPpaP55yTY8dnfOomdZa6xK+ul8D/Lqv+s6Dk3bTe4z0rswDmPgVg5FfoHTMC3CdDgLqo0N8KOwsA0N4F6uvofg0vyUvYr1LoF/YNI4nTeOEMAOGfdvA5r/o1z9FmjrdFN0tmP3L97T/vVfpz9NGYqSn8M2OTdzoOP0YAjAN8DkB/j+N4527eq7w/eWeSd9+6BroG9tSAYM1nnDkDwFkAu472mz6n/xNHGDhnBsBNGgAwDHAe1wJQMjNgypHOmQHdAHD1m6UKKAKMcjW0v61LCEo4SmiqBgAaRYWuNALgT0OARoCWAQBDQP8M4LwNAH4KQD0fevr/nAGgtuNs49n2857Y+L1flPW+MnxUBoCh7I+97W1v/WGNAHOGAPbjeKnkLID1ugAD0CudQj45SyAMABX+AdaEWf0Ju/qBYf1Vui9l9ROu0E4+mW4uTNp0NT/3Gd8Cf9K43/RLpNesjpRpAEj4X2IAWLrqf4d/7qCrG98ZVgNAaxYAEAgYAvotI8B9Gf33OoX9OWNAGgAA8QT313zycjj37eM3/wR+8jEM4OMX+KcMAFwf10p9A/45/f/EVv8X/nnfrXhv0sej7wbYA/iAfv1cEyMAswGYBcC7nT4e72SO7waAq8+RHtM1sK8GNADUTwA0AOzzGYDwj9SvEeBQnwD4zT/An/6cGdCKB/TTSJAGAo0AGAD6GgDPGwEEkioFGOVqaIBblxCUcJTgVEdU94H/KSOAswB4mUyNJPd9p2sooG7tJDgDgHrXOSMkjUS2GWQalNLYVNtibavZjvFnG8+2n/fE4PdeSVnvK8It+D+GkY4nNAJgCGgZAwT/lCwGxzTxNfQPo/0J/8ZtDQGM/DsjQEncjBFgzBAg5Aq/UxKI3gXgTSt8z4Uzf48ZA/kEf9MulZZD6XGE1Ycy4R9/GgDWdbLRfcvfmvrfWu2fNjO06b6NaOA3/MYnP7jECAAMzhkB7stMgDHwJ14HRGsAALYB7xbYX9cQkOCfwC/4C/3KNABYPuI0CCA1ADj6j1GI0f/np/+f1Boa1zYAMLuvGwBGHh49umvgmhqgv8onAIB+nQHgaP5SKewL/so8nnPRX96j2E/wDwKM4ifkL/ED9lPOmQHm1f8F4FchpAUoxCXE6F8N8WuXEJRwhD/hqYJVBa+EMvwJbAlyCXhCHxDIN2RYmDvkny7kz9UdIwXUMyMKuH3gn3ZV21pti9lWsw3X9p1t3/thI71PUrbur2M1AAyX8dgD9ICuGNX9yEc+/Elg32/+0yhAPGEsy+9788suGQAAfw0BGgEuyQZ4Jpymv0JsyxgA/O7jgOcK0gnUud90S6X5IDUECP65b6m/dd6Mwy/4K1N3qVP8LejPOL7tbwF/jeM+ouH0ra0Bnh+AHYAH6KVz9Fcp+AKG93kmgHoAlAX+ltQIIGi3DAD7xC2B/gT+9FcDgGVLAwDX4myPHP0/scX/aPCXDAC0dZ4HvG95T/sJgNP/edfPfQIw5LkaHO9QjeWDt29dA10De2pgDdYs0Jt/A5jQvtSfwK9fiXGBEXkMAEM5V/uUlVF54FxQryP8NUy6KfBnn/CfhoV9P1PY55qO6ZgWeLQA5WAGAEAqwapCV4WyMQMAxgCNABoAkL5kgMQ5kOz7T9NIQOeBjsR1DAC1ndV2mG0U/xIDwHBjr4pL8LcD07q/WvfhMT0nHuNBzIP8677iK37s4x//6V/EAMB0fw0ASML8LaBAyKcAgn/Cv+C/HfnfwL9pEjorpGY4YVa/oIsEgHdxgHemb4F47sfvMVMy8xH8iUt/phnz1/ORLuNq2QinPtSRMnWZOm/5qUvrdUo+9dTXft9RNdwjLQzTupfMAgD6gVrcmBHgPswCSNivRgA/EyBNNQAI7vtAv8eYR0r81QH6xAn8VQL8wL9l1ABgHPUr/Dv6z7vnSJvwVLE0AqzXAOAa6MfRP8Nwzww+Bmnoo/EuxxEmnvc66UjPOxkDwnCi1eB8b5J337oGugauoQEW56UvR59tKezXdIA+cQI/EiA3HgMA57jO1Hr63cA5YJ+wn36NA8olBgC+/U8DADMNBnXSR79XWws8fNBWWWGG8CpdjoTmKGnCUzUA8HKo8FXhbMwIoAEAyUsD52gw35p1I8BpAv6cYYYRAxcLsr6RtoFsFzlrJNtRbWO1DdIudbX9ZtvONp/3wsZf75l6Txlu3YdDFsexveKVL3tHWk15+DrSzwsEKzLgzwMfSZh43JQRQOMAwCn8K1sQalyCK36BVpnQKxS34tw3JSuMZ1oBPOP01+OWhDnWPKdk3ec5WzKvW/0gqw5rWF1bN67sPwX/7ONeOY5We/ylaC0I2FoPACgEEgHdMSOAEHwXEvC+6fOmAUB/PWc1AKAzoV2YXyI9piWJq24K/IV8pbCPEUCDAHGUPQ0AGIf4VOT4W3GzhBoAtn8DyPuWd7EDNMA+iwHqhH+M+qQjPe/fbgBo6rdHdg1cSwP0WxnQoa+262cAAr5SIwD9QlzG7/v9f1zcA+D8q17zJ/9JC/pbcVMGgOzHajDASHFf/62oBR5CSZUVZhYbAHiIJ0QJVsqELx78hAW0hDb8CXQJesJfNQJgWe5rApyfIYB63Xf6v21Lme0Pv+1SmW0X/0IDQOt+qfeU4dZ9GM/Au/XyTTcvCR+ePGAJpxP6MQw4G4A4/ife9QAEfqVwKfSvJesAlHUDSAegJpRWYCWcgIs/4bf6gWXiWtBc4xLe6z7CCeSZdonf/DKPmmcr7HFz0utO3bR0l3GpZ/wYcTQATH0G0Bf+2+0+pdPxL33eY+tvvfMzgJYRADgEFJ0mjqwOID7X2QBCv7LCP2ENAMC1rkL8lAHAtKTRnxJ/uinwZx+Ar6wGAMpKfWoQoN4c/af+MQCceKeUd9u6j8j7kncp71uNAHznz2i/jpkBGAfo09HP4z3MuxZQ2eRDfrwn+9Y10DVwfQ084PnyLU8/9VH6aXV0fyyccC/4Eyf8I4mnb0jem5H1a923PDucBSC0V5mGgDEDgP1XJGnMA0PI5jlzfa2eWA4t8BBKWrJCzWq43q3L0dCEpGoA4MEuXCkTwgSzlGkImDMC5KiwU86YZjY3stz3n4ahAIPOdQwAtKVsW/iz/dkmlWkAqO0623zeC4O/3iuEW/eUHZt6Lw7Jj2NDN37z7wuAlwaj/YzyuwCg4O+sANLwIpgyAmgMUG7hf2MIAEA1EFQwJZzguqsRQAOAcgymE+TH0hCf6Vr+sTQ1zzljgPnU4wgL/FUuNQBc0vHGEMPIvgaA6ndGwBve8Mx7j6O1nlYp+Ma79SlAywgA5AKMY7MA7gr+gdkWkB8yTvBXmndeM/sEfyUALtAL82kEMK4lE/arfwn8C/3KBH7Kb3nxn9Hovzcg7zPebdtZALxHeNfSf3PWpjP3CBPvu7jDv2rssmvgZjRA3xX4pU9HP61Cv329liQOl+CPnzjzIm/u40OUns8IxmYBCPItqTFgDP5f/fIvff+JG1qvpd4KHT60x0ClBTWroQRbl0CUsJQQhV+4QiZ86U9AS/jHP2cAyFkAfieOpRlo9LszILLPDDgN4K+GGeqNKYMaenL2h7NCso3U9pNty/aWMttmbbfZpvHb3vMe2PjrvTJ2T7XuQeKOZuM6gXuMADiB38UAXfzPaf+AfzpeCIBi/RxA6FcK/2vgdxYAhoAB9KdcNQJUQ0CF4VZYeE5ZAVswz/gW6BuX6dLvfqX7CLf8xs3J1nUZlwYA/am3K/rdGGDyb/+mjAB99H//23XsU4CWEcAR4ykjQEKxoHzqsoI/18N15rUK1MI/4ZYBoMJ+NRAI+xlvHJI8x5ywr6S+8Av/1p/1QRm5Bkb/cSf+7X+9CXznbY0A9vd4B+d7WfBnP+9c3qtDZqvBaTg/qndivdAe7ho4RQ0Av4yuO2qfRgAhP2UF/gwL//T3Dg3W9EGZTfAdb37Tz1NGz9uC/hqnESBH/UkTZby3z5Yx+PDBXWWFGsKrdAIRssJSwlRCli+FhLCEtPqyWGIEEA6RGgGcdsb34wAkrs8MOD0jAAYA6tA61gAg/DuaoBGgdjRq28p2V9tltln82aazrec9sPHXe6XeS4Zb9+CQxXFtH/jA+z+mAaBKDQBO/69SwwAvBv8dQOhfKgHUtWEgZIXWBFr9wi4gnH7BeEwC2+xL6E5AJ16AN16Zx4z567FT6TzXWBriLevY9XjtSvVTdbgNx+i/o/zKliGAFYWHFkub7tuOGuC5wiyA1r8CtIwAACXQOGUEEJAFzVORCfT6lcByXgfxuS8NAPhxGgAE9oT69Cfgp5/j5qCfNAJ/lQn++jFQWD+Uv47+n+DK/1Mt3vfc2gjA+5P27nvWdy9h368d/qfU2fd1DRxWAxgBgOFqBEjwxy90V8k+jy3wf9D+AM8IjQCch3NmuSr4T4Xju//VYbV5Wrm14IM4H9pVVqjZ2wCQL4H6MvClkKCWELfEANCaBcD/xuMwBOD4PKAvFnh6BgCMNszowAAg/CN3NQDYzlLaFpW0U13CP/4JA0DrPqn3kuHWPXh0TxFGeCv4G3ZGgGGl8X4awKwAIBIjwNi6AGkQyBkBLfg3bgutCz4JEICRY7BsfIJ1wregr8x9S/1jBoBd89wX/DEApN6u+AcDwNT3/i0jAPfJ0TXcEynQk08++fKx9QCqEQBoBCY1ACCF4SoTmE/dnwaAvE6uS/gX/JUJ8IL9EvAX+pUaEKqswG9Y2E8J+BOmbJRf8PfbfwxAzAYZmizvj3PafNet+4u+N1vv0+GiV4Mjncfwfuxb10DXwM1p4KEzAQBq4VrAJi6dBgDiSCP8I5lNsJlSv7qJ4tLHwAjA+gKeW0l5LNsU/LOo9U2W8Sau+6bybMHHlAGAh3ILblZD/Nb5gEfmQ16QUgpZygQx/GkAqLMAHN1VJvwJhY4Q5yyANAJgAHCNgP45wOkYAviMg3pLA0DWv20CWQ1HtU3VNmdbRNpOldmW75sBgOvNzwCE/CmpAcAZAq4NADxqBMAQoDFAmUaA6gdUjRNa5wwBCf1jfqG/JZdC/a7pxowAS/JJ8Cd9q9zG5TXPjvwP+sXwsuRv/zQCKGkjw3ugb3tqYGo9gGoEcJr7nBHAkeabhn+g9tDnAJLHyq8BwHMK/FW2DAAaAqrMtBX0a1jQT5mwn37rSkmZK/xTv8wC2SyatWcLOtrD7GcK9fYhV0OJdcZ1+D/aauwFO2cNAMV8ty9cpyFAyE7JftO85ZnXfYJjN2DNfX5jG1xpWTlvlkm/BgsMAhoDmOXA83VTxhsr3yll7IO5Sh/ULZkPav2r4aK3bswAQAdRmFImcFUYq7BWYS5BLwEQ/5wRIGcBMJrM39HUb817+DiNAqzlgCHHOt5n9J+2VdtbtsU5A0C28Wz7G7/3RcrWvVTvO8NDNse3sdDbFPCP7dMA4KKATiV3ccBdjQAC/y6GgITgMb/ArJwDcdMhhfCU1d/Kb9cR/8zD8+Z5skz1OpfCPwYAoN56mpOk7YsAHuZ+nVoPoBoBHE1OIwB+4TjlGEgL0MckBf+pMmWaCv0ZTnCvwO/ofpV5TPUn8Kc/gV+/wJ+SslF2v/mnToX/E/7bv6WN3/db612YcaTrW9dA18AtawBGA5IZyWeaPAAtVCMFfvzsw1hAWo6B6W6zuJSVxQE5N6P6lAWDAOsE4PA/9dTXfh/7AvxXt1nGYz+XD+Qq82Fc/Qk1+lHq1iUc4X++oqisaQMA0FWhbF8jQMKhMwFcCyBnAfRPAY4T8seML63p/2n8SaNQNRjVtlTb2pQBINsw/mzj2fY3fu8LZb2HDNf77qg7Plz30lkAQr/f/7soIP8cwEvEMHCpASAlcL9oRsDmW3VnBqR0hgBS+AWK018hOQG65RfAx/YRn0A+5WffrgYA87ccyixPvSbDXnfq5Yp/0Cd638UAQB1yrw1tv2/X18ATS40AwD4QWg0AU0aAKajeZx9AO3WcoK5spc19LX/GtY5P4NdPOvwV4DUCGC/8G27JBP30C/pVJvDrz3JRP077B/6Z+s/nHzxfr998TiKH1nvvqN99J6HVXsiugcNo4AEwDzQzqo8D8hlB1xEmHgDfPLfu8v59SN+dkX3Kw+d0z5fr0UuI2xgm6HP3raGB1sNYQGlJoabK1ZD31iUg0UDSOfqvTPCqUFahrUJdAh/+hEGNABoAlnwK0BcFPG6DgH//Z93exeg/bTnbd7b7wV/vC8Kt+4i41r03RB/vNrcWQH7vL+RXiVEg0wGQ9ZMA4V/paP+UdM0AoZa0+oXfKoVjZYL0vn6hX1iv0v3Ce5WmN76GM5596bwOZF5rhtXJFTnAPzpk5X+n9S8xBGBlP94We3ol4704tR5AzgQAjgHQpUYAYVrZAuolcQDtknSkGTvXWHw9ZiqdZRCwlcQD3wC90J6wn/4x6M9jzUNZoZ+wsJ8yy8N1VPinLqlrOtun11J7ibsGugbOWANXFu4EqOG1DVSvzvja782ltSCEuDFoIT4hZ7UJI7cuASnhH7/gr0wDAP5qBCCchoApI0DLAAAk7mIE6OsBHKcR4K5G/2mn2YazbWeb3/jz3tA/di+17r0hm+Pe3va2t/6w0/1zpL+Cfg0D/qRvHcOsgDFDAEYA3ZQBIPcBtxoAUragOKF5zp+wvasfcOeYlMK80v2Gx2Q9d6vcea3pvwL+fPe/+fYfXVEPuDQCjBkCWP2f++G4W+zplY6O1pQRwCnkSIGzZQQgDvCsTnC+rhwzBAjtyqnzmKYlidNN5cG+hG3CGgCAc8C9Bfo1TsBvyV2hP3XDNQj/OfrPd//3YOr/6d2AvcRdA10DXQP3QAMtCNnFACDkrAZdXXIJSglQc0aAagBI+NefRoAlswDSCDD1KYDrAXQjwHEZAfKv/xz9T2MP/mwH2T5sM8ravqoBSsOUsrbdbNe1zQ9h7wflGPwT37r3hujj3zACuKhfgn4rjv356UAaAEivI92YEQAw3dUIwDHCv9CbIDzld8S8gnUF733DgP1S2NcIMHauWsap62KfurgkGf0fjABjoJ/GAA0ESO6l42+tp1nCuX8GyJkAwC6AuosRoAL3EsCeS+N+8yacfve34knXcqbNfZkP/oRt9wn+6GbKANCC/Yyr4K/BpcpqgLDc1olGG+oNB/xvVv3nXdC3roGuga6BroGugVvVQAtC9jEAADyrdAlKFaKEK2WFsAppwpsyAQ9/wl8FQ4FxbhZArgfQFwU8HgMA8E997LPwH23DNqOsbYtwtj/bpDLbbrZp/NneB7/Qn3LMADB23w3ZnMbGwm8Cf0J8NQgA/M4YQGoAwCigy+OZDcACga3PAjQCIDUKCPpzEvjNNIYF4TFwroBNOGHcsDL3LfEL+FVyrIaCmo/nQlY3dh3Ge71buZn6v2Tl/4R/Pgc5jZZ6uqVkavjUTICWEQAQBZYFz5QJ0foFVcH5OpI8Mz/D5jkWNr4liWvFm+eYFNyrASDhvuX3uCor8BMW+tMAYXnVewV/6szv/nnvnG7r7CXvGuga6BroGjhlDYyByBi4GJ+Qo381KOKSS2BKkMIvYCkTwlqQJsAp0wiQBgD8hzAC8L352GJ0Pf52DARM+wf+l/7tH3Wf7cK2oqztKtscftuisrbZbM+1rQ9h74OU3i9Vtu67IYvT2oDAhPeE/xz11wCgMQCZjrQaE4BMR5zrPwWkAaAaAQwn5Lf8Cf7sB4SV+AXllqywnWEgnXDKCu6GBfsK/cabbkzmefW3ykucoO9+w2u5gX/8Y6P/Cf36+Zsd7o3Taq2nWdoXPHr09FIjADAM1AKvgKgQijQsoKbkOMIpx8B6Kj7zMP+aPtN4PtPuI1v5A+ToQEBvgX7GVdg3vBT68zpS51PwzwyP02yRvdRdA10DXQNdA+eggRaIEFeBpYYTctK/Go7dugSmClNClrLCWMIaAEdYkFMm7OFPQ0AaAZwFkJ8CzC0K+MYfevyHuxHgeqDP6P0+n1NwzHt+4cE/ow6cuWEdZr3izzqv7cF2osw2pT/bnW1RWdtstuds5xt/3gf6631juHXfDdmc3oau+CRA+AfkBX3Bf0xWIwB55L8ELJ0NoGEAkF9qCBD6x6SgLDinFLqXyhbIJ+ynv5WWOM6lbJ03y6ffa0ASl+G1f2MAcOE/AX9Ocp+dXks93RLvYgQAOgHplhEg4XQMtoXZlBWyW2Hy8xjzbqUzjTLT6t9Veh6PA/yBd8LsWwL76GsX4K/nTN0K/kin/Csx5nzWi1/8ptNtjb3kXQNdA10DXQPnoIEWiBgnrLSkgFPlalDKJZfQVIFK0FImjOEX0pSCnLICX8Ig/oRFATKNAK4HgMy/B2TEGdeNAPsbAAB4Ru+//UOPfxg/o/lzxgDBn+NYj6HCP3WXdVrrO9uDbURpG1LWtmYbVNa2mu24tvEhXO8Dwq37xjjvsZTDIae7oTc+C9gF/v0kgGOYBZBGBGcEuEAgI9RznwUI/0rgfqkDiKsxQGAWqFNWCGdfjRPYx6B+Ln4O+tmfZUq/ZR+VMfXfGRdLZgH0Vf/v5h5dsiZAfhIAkM4ZAUgjNFcpoKdMv3Cd0jxMV8Nj8aY7lHRKPvlxTkf0x2QFf2cOKMlDV8u4FPypG777f/TCF77rblpQP2vXQNdA10DXQNfAr2ogAaT6hZUx2YIe4lbpEpzwJ1gJW8oKZcJaSoFOmdCHP6EwYRH/lBEgDQCuB6ARACCdg9f+WcDzxgL0xMwJwB8DCiCPI4we2adBAKMAfuJw7EfnGGSuA/+0A9uHMtuQ/mxvtkFltlP82Y6zfW/8rXth7L6p95nhIavT38b+KnDKMMA+gB/YR/pJgEYAZwa4NsASQ4CzApRLDQGm0yDQMgokaFcIX2oEyHTVEJD78GtIqPFZjvSPQv9g5Mh9XFvCf/pbswA6/N/t/cn/G899DjBmBGA0OmFVP0A7ZQgQeIX3Kt3fkplWP+nG/JmHZVK29hlnfqTFX8MJ/hX2CQv6SvNQeh4l59HlaL9+R/tT9hX/7/be6WfvGuga6BroGrisAeGjJccAxvgW9FwxAAynWyU8VbASuJQJZfiFNaQwl3LKAFBnAaQRQMBEOhOgGwH2H/HHAOI3+4B/wr9GAGdWEM79GFzQfYI/9ZIGm2rMSUNPbQPZPvBnG8Jf25htT1nbaLZf/LTp4lr3gvdJla17jbiz2ZgJMDbtv8YL/47+E8ZVIwBACqCujQCbRQLnDAEArrMBqhT056SGAMGZ9PgTuNNfIX1pOI0Ac8fk+arfci6RCfzVnwYAvvnnHjubBnrCF+JfBAKUCZjVL4wCqs4EGDMCCLMALn5B9yakcD6Xt+WwbBn2WOMIm878DQP1LehP8Bf0leaf0vyU6jdlrQPDHf5P+IbrRe8a6BroGjhjDYwBCfEVXmq4BT5XjAAVoBKwhK6UCWgV3vYxBCQ8JlTuYgQAWhmhBnL7aP9VQwEj+XXUX/BHCv9IgF/oF/z3hX8MAWkAqPB/aAPAcE+simvdA/U+yXDrfhuyPK/t2Wff/aEK+zWc0/4xABAmTTUCOAMgobQaAxzpn5Mto8CcESD3A9ZpBMBfIZwwEJ8y/XOA39qfx+NvuSXQbxq++9eokvCPgeUtz7zuE4z2v+KVL3vHBvxX59U6T/tqeFfyF3JzRgAAVEAVggHYmzQECMgJz/qFc8NVcixxmcdYXKbxGPNzH9JR/SqF/bEyZR761WWVgn5Ldvg/7Xutl75roGuga+CcNdACEuMSXFr+FvxcMQAMyls8CyDhX381AlTISwDUnyPEdSbAvkYA4LV/DnAV/pn2j15yVP868J+j/2m8wZ/1al2nzLZR2w1h25QyDU/40ziFvxqvaMvFte6B1r1inPdWyiHLs9sefOAD7/9YhX7DFf6Z7u8+DQBIPwNwcUCkToPA1hjw5pc9N2cAyP3AO+GU+Jc6IJy0VQLwxrdA3bg0EsxBv2k9tkrBfomsf/mH/pi1wX1Emz+7lnieF/TEb/iNT35wFyMAgOzIN1A7ZwgQfAVswvqrNG2m0U/aOZfH7+K3HJ6rHpugX/1Zpnqc4Qr7GW4Bf8bxuQZ1dJ7Nr19V10DXQNdA18CpayBBpPqFlinZAqArRoAKUhW0KogJaMoWzCXs4U8QxJ+weCgjAGDLaHefBXDZEIABIKFfvyP/jvrPjfwn/GOoSQNArc9a37U9EK7txvakrO2utstst8ONvipurO2P3S/1/jJ86s+QsfI/wT8ECPbKCv85+m8aZBoANAT4qYCzAjAGXNcQUI0AhpcaAoT9OVmhvYarEaDub4WXAH+mIQ/1peQ+GqvAHn/cGmBRuSXrAgCmwivgiyEAIAZ0lxoChOLryAT26+QzdqzX6DUl5Fd/K488vuVPwB/zf86rfs1z1Elf8O+4751euq6BroGugfuuASFkTI7BjPFjEDRpBKigVUFMQFNWkGvBXgXCCowJk/j3mQnQDQCXwV9DCEYRoR8p+Lem/C+Z9n9d+K/thbBtSVnbXG2TCf/4hwfFqrhW2/e+aMmxe+ysn0Hcqx//+E//olCfEI8/R/81AAD/GArY13Lm8VM/8d3rGQHCrNPZXTAwR/x38QPzpt/FEJBpAW/CSuCbcAvkjdMIYLglE+h39Tv1X30x8n/Wje8eXBz/EMBMgF1mAwC3ALFT4wVzwbkFxzcd57mVu56P49Ll8Qn/GZ/px/xjoN+KF/77X/3dgxuvX2LXQNdA18CJa2AMSoxvgUyNqyC0GnRyxQAwxC3+FAA4E9SULajb1RBwXSNANwC0DQCs4q8BYAr+XXBx6pv/OfjHsFONPa12kO3FNqSs8E94ygBA2y2utnnD9d7IsPdUlUPWZ789pI74lwCgE4efOqr/HOAnABgAdBoE0iigEWD0kwAWC9Tt+HlAwn/1J+Qv9WsEaEniWqBvnPuROvbpXyrr1H+MAH1l//O473h2uS4AENqC04xL2AWIAWSnyBOu+wkLzuk3bZV5/JjfY6b2e86W9LiaD9fpPuTUsZkOv8emrpb6McAw8o9B5jxaVb+KroGT0wB9q751DXQN7KCBCiQZToAZ8ws/LbkayrF1dVS1QlcFM4FNmVCHv4JfBUPCh5oJwMh1NwBMGwCE/6kp/1PwXw00te5q/db6J1zbiG0nZW1ntR3WdppteOOnrdOus82P3R/G532V/iGb+73legEaAKrUGKB0ZgCGgJwJ4JoAzgZQOitg7t8DBP6WBPiN17/UCEA6YB0JwFfJPqFfWeG+gr/hKutxLfjHAIDx5X63vPO6+l0+CRB2E4KBZQ0BOSsg01S/AD4ma/pdwpknfsM1j4T0us/jlO7PY67rB/4xwPCOOa8W1a+ma+AoNZD9pyn/URa+F6pr4Jg0MHUDuU+IGZMJQulfDRd6ySVcVfCqYJbQpr8C3j6GgAqaSz8H6AaAtgGANQAq/GMw0S0Z+a91UuG/NfKPQSCNAK22QZxtB1nbWG2D2T7x1/Y7hLN9p3/s3iDe+6jKYVffqAM/E/BTAT8HUKZBoGUEcD0AgN8p7kgNAMqcFXAdYwCGACC+SuKWOg0CKYV/ob7CPGH3KVtp/vHrH7vAjcF/NwCc533HXwXuMhtA+BWMlQBzTp03/hCSc5KP51a28h6DftN6bJXub8madt+wU/43i/3xLuhb10DXwM1pIPtPU/2t3Mcxfesa6BoY0UDeVC1/3kxT/oSh9K+G815yCVkVwCqgJbzhr5CXAJj+OlpcgbIC55wRAIgFcvsigJeNAPwLAH8B2Br1H/vef2qxP+ql1lWtywr+jvwrbSO17dS2Rbi2v2ybtd1uwrRt2nO2cfxT90brvuovpkFpbtQVkC/wt2QaAfD7SQCzAPwUQLnICBCfCBzKGKBBYB8jgCDfAnvjqvSYrdyA/xz8ox/uF/Xf5XlpgO/Ql64NUAG4QnMaA+aAvB5L3sbp93zE1zjDHjMmzWNKto6dSr/Lvj7l/7zul341R60B+0+1j1X7YIZrut7XOurq7YW7Sw14c83JelPVsDdfS66GC9y6hCz8FcIqqFWQE/BSJvzrr+BYwXJXIwBAy/fuLn7X5add/M1//uBT/AVgrvCf4F+n/O8K/62Rf+s3ZbYF/bXd1HZV211tl9lmN/5W2yau3gs1PHZvDYf2TQ1Qb7sYAdIAgBGAzwKm1gZwFgDSmQBX4ob1AjAG7GsQcFbAvp8KAPLkgRT2hfsaNn4tA/yFf68tjSHpR9/qvsvz0wDPO/8ucMnaAC0ATkgH/jUGzBkCyEsAz3zNL+PS7/4xmWnn/J5fOZd+yf4c9ef9cX6tpl9R18DRaYD+U/ap7IethvgxZ5o8jnz61jXQNVA0MAYoxudNNOX3pqtyNZzvkkvYqiBWQY1whTkhL2UCIf5qACB8XSMAsAv0dvh/fiYABhFmRjjdfwr+c5ZFXezvOiP/2Qbw17ZCuLap2uayPeKv7XUTpl3Tjmv7nron2Od9VOWwq2+pAerp2Wff/aGcAZAj/0A/nwsk/AP+hDOurg0A+ArELfh3n/KQawZoFJiaFQDEC/5IYN/wJdAf0m2BH3+C/2afq/17LQn96ee+SN13/3lqgIXp9vksYAyIAWqNAWkIIP0YuBs/ludNxAv+hzq3o/4vetGLXnOeLaVfVdfA0Wgg+0r2r+x3bRcUr/04wvblhitZDc5jzMN8j+ZCe0G6Bu5aA94Uc9KbaEp6w1W5Gi7ykvNGRdYbuQJbC+oS/AB+wtUI0DIE7GsEYPS6fwbwq58AOP1f+B/71n9u1L8F/0tH/q33bAvVCFDbEuHa3rIt4q9tdQjX9mx46l5g39Q9NezuW0sD3O8sUve2t731h3H+cwB1N6R/SB2zH2MB4O8nAdUI4OcBgq9QDODrT2l8GgkOYQzw04CcGTBmEKjGgAyvgV/wV2IEGPzkx7XUazXOdRLY/z3vfP0/HPRI++zb/dDAgxc8evT0oQwBCddpBEjYTv+ugH+dY3c911R6yiH4b771X92P5tKvsmvgTjVgv8n+Ff2tFU5esF9X2cB4jQGb4zjevMx7iOpb10DXgDfElPTmmZOCUUuuBlVvXYWuCmXeyMp6o1foI7zEAHCdmQDALLMAgN9jnQVA2ZilgLvJcjr6n+Bfp/zvOurfAn/qq1WvrfqvbcS2k7K2s9oOs42G3xdQbddz98PUPTVk37fraoD6pH1gJHA2QP5LQBoBEvbH/An/mcZ4PxFIKdjPSSBdY8CYAYB4gR55ZZQ/R/03/rrYn7BPmTUAaBhAoq/r6r0ff5IaeMj6AIcyBCQ8A8u4Ojsg0xy7P6+B6f7AP+DP4oonWdu90F0Dp6cB+0z2rdZ9rwR/+nn2/7JvaBz77fNx3KCC1eDIxzw5R9+6BroGNhrwppuT3kBTskJShlfD+bauwleFM29iZQW8fBB48yPzoYD/up8DALLAP47v3W9yLYAK8IR1Gh0MpxT6WaiQhfkwVLBCv8ccUnIu8k/4Vz/KOfhvjfy36qnWJeGsa/2ttmG7Udb2Vdtfts3wZ/tN/9Q94L6x+2nIvm83oIEVMwPqZwItIwAgnICvX9DPMH7jU2aadfwO6wcsMQZsDQED6K8NA5vRfmcCEOeU/wR8/ZQPY4DlxEjCfXIDeu9ZnpYGVocwBADMFeo1AuS/COQsgZo+wwJ4ytx/KH/mnwYL/II/RhI+nzitau2l7Ro4eQ3QZ7L/RH9rPepPH87+fvbpc0av/Uf7iKTnOPp95DM48jNvztO3roGugUEDY6BS47l58gb1ZqoyQSn9q+H4Sy4hrAKa4JYyQU/4S9kCxnxg+JBA5sMD/9TCgGkEuKm/BATogXbgGojHEZ5yphP6OZby4fAf2lhBGRP+BX7locCf+mnVJXXtA956zzahP9uML4HavrLt4a9tcwhn263+2uZruN47GR6y7tsNamBtCOATgbo4oHDcMgAI9wJzSvelzP36t/tnjAFTBoAt+G+m9l+aBbAxBtRR/7wu/Rg+8D/11Nd+H/fFDeq7Z32aGniYnwYw4p0LBqZ/X/huGQSqcaBCeAK6x9e4uTDlzTT1HITdT1quHdfB/zQbci/1WWjAPhJ9KfpbTfi3r25fk76nfgeW6D/SP+S9R/8v+nfka1+N8/Wta6BrYNCAN9+U9MZZIiswGV4N57rkEsQqpFWQIyzkKQXBKitAJvzrnzMC8EDx4YIUdIFgRsIPNbIOWAPxgDtrDQjx6TduSpoeiSPPQxkBhH9mQaiHlKkn/NWg4sM5dU49ELY+lLXuKvRb17QBH/S2h1abqe0q21y8HC61y6Gd2marXNL+p+6jIeu+3YYG/DQAGHYmgFPkqxFAeBfmkcQp3a/MdGP+ddoRY8CUEYB9uPwMgM8HAH/PJegT5r6h3XOfMAtCx71xG3ru5zhpDTxgtJvp7q3PAw5hCNCAIHRX6f6WzLQJ7hmPn2OVrXxqnKP9TvV/9OjRS066FnvhuwZOWwP0mexbPaRfRr/NPp59RfqWzD5l/Sn7uUj6pcSz3z4l70OO590Y/TzPwfn61jXQNTBoYApYch83T96o3kwtWcHJ8GrIY+sqjFVYq0An6KUUCJUtgCROwEyZQIq/Ba4VbnnQHMoIgCEh4T8faofwOxMAgN/XYOG0fx66Cf34q25a+qs69gGd9YB/rN6oV/ZZv8psAz7oa3up7am2t2yL4bettmSrrde4vGeqfzhN325DA7SJuiaAhoAEaCBa2BewUwr9KXP/mD/Tr/2DMWBsrQChPyVpv+blqx9k4b5qsPCc3Au3oct+jvPXAM/O/DygzgqoEH1q4YR+jB2PXvjCd3HN51+z/QoPrAHf6a1s2de33TSgPulH0eda0W/j3rTvR5+RviZ9UAbB6NfSb9YRJt4BKvuYHE8/gPzId5O//bVeV4NC+tY1gAa8CeekN8+cbMGTcavhfFtXoaxCW4W6Cn6EhcIqK1RW6DRcIbUFshV2eeAwwr4vXPvNPg+t6vaF/5oPYcrJg5Lz7VJW0nJ9PFz3Af/WqL8PZvWu1EBT66vWp+HaBmobIVzbUW1n2QbDbxttybk2z/65+2dI0rfb0oCzAPJzgDQCCNJj8grED7MCiBtLn/F57Fh8Lij451/34n+kY+q+4K+xIo0A5M29cFt67Oe5Xxpg8TsAGVDOmQGHnBFwGwaECv3MdNh838+zum9dA3MamHuf5377B8T1bbkG0Je6uzT6b78w4Z++LJ/G0jfVESaevip9XtLT1+R4+or0B+n/DeehX+e5ej0tr6Oe8sw1kA+yOT83UN603lBVtiCKuFV1Fc4qvFXAqwDYMgJUmDQsdCqF0n2MADxsePgshWugmrSCtX+lh2zB+3XiMm8tpzwkOTej+tUYQLhVvoT/agQh3DKWVF2qY3We0nqpUthP2ar32jZa8E97qm2stsFN2PbZaru1fbfCU/fOcIq+3bIGnuDvBJ0JoCHgp37iu9eL5AnVygR1/Anx6a/pWuEl6TON/lZeGgHcxzT/W9ZjP9091QDGAGYG+JlAGgRuA+J3OQfAL/RrvAjoX93TKuyXvb8GfJ/7rl/S7yWtxyH7Nq0Bdbruc9FPow9Hv48+If1L+qAOZNF/pQ9NH1Znn5r+LemYpctx9DPJxz7hUIzV4DiPdTR4+9Y10DWABvKhNef3gTgnWyBF3Kq6BLRqACBcQa8FgwmL6a9wSTghFH8LWolrAW4FYUbstUryMFrygPJbpgrqNxHmXDqNAXUalRZUrmUO+sfAH11VParbqm/CrXohLutOv0aeWu+1XbTaTrYt/LXtbcJjbdUXxlxbn7tnhtP07S40QBvCEMDov0aAXA9gzAAAcAvm3/L0Ux99xStf9g7aLSP0wnhK0hr2uIwzP9MYHkub6TQCMDNg0OHqLvTYz3m/NcCzlRF0ZgdUg4CfDNzWLIGEfRfxA/opFwaLzV/48czuW9fArhrId/nYez/7C2NpiM+8di3HfUiPftDTmgvSAMC7lj4lfVb6qw62OYDloBVh+tzsJx19WPqo9EXpT9Jn5Nk1nGO1OY/1xbn71jXQNTBoIB9US/w+3LyZxmQ+KNO/Gs55ySWoVZCroEe4wqCQKDQixyCzBaTEVYAdMwLwYEpDANDMg4pRex5AWCJ1hNknhE9J0yGXuqn8WvsS8Mf8eW36W8aQFvSnDlt6HquTrLfqb9V1bRO1zRDONnWD8O+9MHXfDM29b3esgYe0K0bQMQBUI0A1BADmYyvpk0cCevUvgfp9DAB99P+OW1A//VYDPE9ZQI9/FKhGAWcKpGFAaK+SUf4al2Hy0DmyL+xzXs6/AX76F33rGthXA7y/W/3Y7LdW/2o4psYRrvnYNxh29S00oM7R2fr7f/vx9B3pe9Knnpu9ihGA2QHOAqBf2w0AoeXu7RpYoAEfUktkfcBNhVsPyPUNP5RppauwVoGuAt9SI4Aw2QLPFqBexxAgLCPH4DrjW4B+qDjOQ155vjF/lrv6x8B/Cv7H9NqqA+KoI6X1pbxD+G+9yFvtfMn9suD260luSwM8W4DpsW/tWT+A9jdVnrGZABXs0ziAYYDzcn8gyeMtz7zuExoMMm36MU784A88e0G5p8rU93UN3KUGeIfzvGamACPxGgYYmc9ZAwnyU36PIx/yI1/yH65xdZfX2c99lhoQRn3HZ7+V9rZ1ta+a+wZ/HmdeSPsJg7dvGw2o8zUP8H7TAADA0xdlAG3KAMAC1zkLgIE3+rnVAECdDefMPh3n7lvXQNdAaMCH1BLpQy0fcmP+fCimfzWce+vqg/VQRgDhsgWgLVjNUezqHwPiCs41PAbfU/EJ8GP+qePH9tWy1fDYNU5BP3pq6ZK4lt6tE0G/yiXgjxGothHCtR1lGwt/tsOWf6wt1/i5e2U4Zd+OVQO0Idqi7ZTw0rJiKEhQ1y/QIzNuxKjwBPdOpvUYpNP/++j/0lrp6Y5YAzwredaucDynfX5vOujE83ztW9fAbWkg39++2+0PrIZCrNtptlXbbEr7HKTfOPMwT6XnG5Ld+w1doJf1MwF9agDgfUy/dM4AwKcAGgB2mAHQ6+DeN72ugDENeHMskT7U5qQPw5ZcDQXZOh+kynzI4qeDXl0LFitQGh6D0TF4rQYAw1OQzL4K1RkGzAmPAfoh4/O8U/656/G6x+SY/sb0TX2MGQFa9VnrnHBtG4RtN8psW+FvtcOMm2vP7l9yjwyn7duZauAhI/gJ7PirAYAwbXpKB7RX1hkwL45hhgDgz30ydWzf1zXQNdA10DWwswZ8f/s+zz7AJQOV/Y+pvon9EZ7lQ0lWG0ee5o/0nIP33m+pl4f27+kb0p+kT8qnsK01APxr61y8GgMABgP6z/RTeW9SX+Q7aHo1OOuCOuhb10DXwIgGfEgtkT7U8mZu+fPhmv7VUIZLTnhT+mBV+jBO2XowC/1KgRPZcmMQOwa9xM+BM9A9ZxCoYK6BgHj9Y7IeOxe2LHPlZv/UdY/pyviWftX/GPy36pA46llpnfuysE0gbS/K2q4iTPujzWU71N9qu2NxS+6P4TR9O1cN0NaqEUADAPGbkfvV0uunfXMPIW3jw7G0zb51DXQNdA10DRxGA7y7873u+/8K+NsvsR/ZkqbxuW1/ZDjHanDm7fnsNwy77vWWdbD+G0D0Z/+QPigzX5nW72cAY4tsuwggBgP6wLxDyYd6oS4GLa8GRz1QB5y3b10DXQMjGvABtVT6YJuTPgirXA3luOSEOCU3cToeFNX5EK6y9cD2IdMCVSG2JaegeAlUm4aHFP45YL/OfvP3nEvk1PWxD50oW/pp6dM4dd6qD+qM+Fp3tY4JZzvQbztR1vYU4dr2MjzXfn15KOfuj+G0fbsHGnjIvQDsI2nDtMvhumknfesa6BroGugaOC4N8O72fW8fYAv/9DPsi9hvsR+T/R7jkPZrOM5+Cv2R4TyrwXkOz8n57/tW62C7ECD6pJ9J/xeo1wiQ/7jFwn844b+O/lMf1EPUQdf9fW9x/fp30sAc4OR+bq68ob3ZqvRBWOVqOP6SE+aUwp6Sm7s6H9pKodKHs9IHdj7A9fOAx58Pev3CL3LKLYHtqTQaCEizxD+V19g+ys++qetgH9euVA8p1duYVOdj0rqqstYtYes+pe1DWdtRhGuby3Btp3PhbPtj/uHUfbsnGljRPodrXd2T6+2X2TXQNdA1cIoaqP1U+gFX4J/+in0a+0D2mexT2Xdiv2k5jr6M/RX6JeQ/OM6T/QrKcd8362JbB+hN3aPfNALM/YU19UJdWAf0EwcFrwaXuu96v++trl//Yg1wsyx1+XCb8nMzttxqiL/khDplgh9+HhbVVZA0zENhzPnwrjJBd8zvS2BKCtq+OG5bUjbLMFVO93Gt+Meu2Xj0hb/qzbAP8qp36oQ46yZlrU/Dte4J2y6Utf1EuNXejJtqq7nPl9XS+2E4fd+6BroGuga6BroGugaOQAO+u32vr/sA9B/sT9o3sW9j3wkQ5VPM6hygsb/EcfZt6LvYTxmufTU4zue5LcsQdW83+1ToZP0ZAPqyDuyHomM+B6h/tc2oPzMEqBP6t/ZFOR7dU69DvivyHhzn6DoflNC3roFdNOBNs0R6kyGnnPBV5Wo47pIT7pQ8INIJiFUmVOqvIErYB7bQ2pICb5U+9FPiX+IE8n2NAZzDY/UvOe9YGh+29RpruKWfjGvpOON8uFsnKWsdGs761m97UNZ2E+HaxjI81UZb+5bcA6TpW9dA10DXQNdA10DXwPFowPc373b7Aeup5/Q17JvQn6HfQ/9K8Ac0BVDAE0dYANUQwHEcT5+H/MiXPstwvlWck/NblsF7rzf0YF9rPRMj6wJ92r+1LjTCqHP2p94bOu/6vtdNrF/8dTXgw2qJ9Gaekj58W3I1FPaSE/KUQqCSGz6dD96Ey/QnkFZ/wmzLz4NmzvlAGoPtu473oTp3HblfXRCnPyV6JJyy6jbroPqz/vRbv1XaDpS1vUS41b6Mm2qfuc8X1JK2b5qhCH3rGuga6BroGuga6Bo4Ag34HvfdTj9gO/Wf/oh9F/o4wj8jz8A+36EzBb064tlPOoHUPhL5kS/9F/oqnG9wnNcyUKb7vtlnQifrOkFf9AFrnbT6zVXXHBf6zr5e1/V9b2n9+q+lAW/UJZKbmXQ+6FrSm7MlV8Oxl5ywp6xQ6ENDeFRW0PShokxITYBNuG35efAsdXdlEKB8njvL2orL/fi5ZmXr+o3zpZl6rP5WHRhnPVXZql8f7LaBeKleaiubttNqV8a12uNU3JI2b5rh9H3rGuga6BroGuga6Bo4Eg1kf9R+wKXRf/s8wj+j+8C9356z4Fx1rFDPftKRHiOA/Svyo59D34a+y6CH1eA4t32N3mcYlDFstW62MwHQnX11+5wp7Wumnjf9QusYXXc9r9Xcf7oGrqcBb6Ql0ofclPQmbcnVUNRLLsEPfwsSK0j6ABE4U/rwmJL5sJnyV4BeGvZl0ZIZN+bnPO5bes6pdFPXmPvQGeEx3fnQTn2nv1VPxrXqtdb95iF/qX1s2kurLWXcVHus+3wxLWnvpOlb10DXQNdA10DXQNfAcWnAdznv+HV/wD6kfRX6M/SlgHhH/hP+WXWev6LTuQq9RgBmAzgTgHzsH5G/gxfDuVeb89vX6P2GQSHDVutnOzvDfmH2H9PP/oZ+qWN0TL5dx4MS+tY1cAgNeEMtkT7kpmTCWfWvhgJfchUEW7DoA6PKfGikvwWxPrwFXcItB0xnvOEpyD6GfZTZsmb5p/zqoqWvjEO3hFPH6adeCNf6adWlD/Za77VdbMK2H9qM/pRT7XBs35J2bprhtH3rGuga6BroGuga6Bo4Ig3wjvYdT59gO8psf4X+EKP/fGPO9/3Cv+D/N//5g09VhzGA/RoBOC4XpbMfRF8nBi04v2WhXH17XgNX6miIXteTxppWHzH0uhrSp27RcdfvoIS+dQ0cWgPcWEucD7opmZC2fjgPeStXg/+SqzDYeihUuBQ4E0SrPyG25QeOiZ+CZPclXOtH3pWjXJbDMi6VXnNLJ8b5Eq06zXCtkwy36rAF/7UtRLi2oRqean91ny+iJe3bNENR+tY10DXQNdA10DXQNXBEGvAdzXvefsHo9H9G8fO/54F8wP8HfvnBr1RHPPv5NAAjgLMAMCTY36IP1A0Ai1uDfS/7ZKMcMOS4Cme9epx1vvjEPWHXQNfAbhrwJpuS3JD1pvYmTekNXOVqOP6KW2oEACITNPUnmKYfoCUs2FYJNBOXcilI13S+IFLiX+LIK4/LcD3PruG8vnr9NayuUofVr85bcin4FytvbQ+1zdRwtrMl/qn23No3NNG+dQ10DXQNdA10DXQNHJkGsv9p32BrALC/4/R/vuXXAODov+D/gxefdqEzLmcBcFyuBUDfi/zp+9DXGfSyGhxlsB9C2fp2VQNZZ+jKemtJdYnM/tnVXHtM10DXwEE1kDfcmD9v0DF/68Y2bjWU+IpbYgRoGQAAVB7IFVQN88DGX2G3hn24p1wC24J7pm3F5f6Wf+yYsfhWHsRxXVXWa22F1ZF6q7IF/Bl3ZPDvC2esDU/FH/SG6pl1DXQNdA10DXQNdA0cRAO+2+l7bvuU9g3t/2gAcPo/o/oYABz9F/xTYgRgP+lIz2cDHO9igParugFgr3rMehvjBuOzf7bXyfpBXQNdA/tpIG++MT836twN7cO5JVfD8VdcNQIQboFlgmf1V3DNMC8Hwi0ArnE+7FPiPzbnC8/yW17DY1I9pH5a/qrfDLfqxrhWXbbqfBPXaiMZ54thFznWdqfih+L0rWuga6BroGuga6Br4Eg1YN/TPsLoDIBuADiqGpzqe9V9R1XwXpiugfukgXoztsJLYMwHdEuuBoVecS1wFCqrTBit/hbMVugdg+NWfIK1/pT4b8JRljxPLZv7avxYuOpgTE9VnzVc6yLDrTps1fUmrtU2Mm5JOzMN7RR/q73OxQ2H9a1roGuga6BroGuga+CINeB7ft1PcKCIPor9pV1nAPgJQJ0BsPATAMphv+OI1XaURaMu+9Y10DVwZBqYAyYfwsLXmEyYq/7VcM1XXAsgEzDTX8G0hscAlxeF+/SPQXMrXvBWZhrjdpWZh37zGAsbPyaXAr+6qPrLcOq95W/VW6t+I662hxoea1Ot+CXtdSzNUKS+dQ10DXQNdA10DXQNHLkGsu9Jn2F0BkBrDQA/AwD6+QQg4b+uAdD6K0D6RPR/OO/gOL/9EcrVt66BroGugbPQwBgwGe+Db05WsMvwatDUFdeCSS29LfhMUNUP1KZfyG1JAJr4lGNQPRZfYb2VbiyN8VW28piKy2toXWcrTh1NSXTO/pbux+qqVa+buKz/Mf9cm3K/nQHb5K5yKFLfuga6BroGuga6BroGTkADvvPpA9B/uPQ3gPShWDvJvwH8hmcf/+t8z+86AK1/AsAoIPz7/T/H5d8Aki/9J/pB9Hk47+b82RcZovrWNdA10DVw+hpYAlM8/PKB7MOwyjHQWz/AhzxWLdeCyxaEGjcFsexrAXCNA7CN0z8F3Xexj/JZNsu6i5zTE/vV6Zhs1U28GJv1OdTxVDtgX203c+ElbXQszXC6vnUNdA10DXQNdA10DZyIBrK/ue4/0u+gn2K/CAOAnwHkLIA0AgD86Vz8z78AbE3/J3/OE/2c7LNQrr51DXQNdA2cjQbG4Cnj5yDN/XPwtxq0dsW1QHMMSo1fArhLgbkF2salxH8I50usJS1znjfTub8lUyfsz3D1q8eWbNWHca3628TN1X2+SG0vY9IOQLbBXf1DsfrWNdA10DXQNdA10DVwQhrw/U//wH7Flc8AchYAiwH6d4AYATQEAP2CvyP/pCN9Hf2nz0U/iT7RcN5VnJtyUKa+dQ10DXQNnJ0G5uBqDNRa8T6wq1wNWiMOecUJmFW2ANW4CrUZrgDcAuZWnODtvho2Xun+MWm6lDVta1/GTfmnrjn34VdvY7LqPsOtOos465p61V9lq61Mxc21ybH9QxH61jXQNdA10DXQNdA1cKIa4P1u/2Ddb6Q/Qj+G/hB9KKbsMwvATwE0AvA5AKP86YjDAf+M/Av/HO9nmeRL34jzDOdeDY7zWgbK07euga6BroGz08AYTNV4H4ZzssJfDa8GDTZdQmf6x6DV+Aq7hnmo6085BdVj+wR39qd/LH2mW5p+Ki/25TXM+dENadTRmEw9V/9YPW3ia722wnNtxf2+8Gub2yU8FKtvXQNdA10DXQNdA10DJ6wB+wP0D9b9Cvom9mnoC7kWQBoBWNRPQwCwr+N7f+LZPwb/9pWG860258y+CeXpW9dA10DXwFlqYAlo8UDMB7MPyJZswWDGrYa8mq5CaIbHINZ4H+JjcDwG0cYj79qNlX1pvLqYk6nX6h+rm4jPuhzzt9rFVNySNthKMxSrb10DXQNdA10DXQNdA2egAd/z9hfoY6wXA6RfQ1/IWQCuB8BMgFe97rFnAHxAPx1xOPaTzpF/R//Jj3zpB3GewXE+z21Zhqi+dQ10DXQNnJ8GfMjNSR+KS+QYGGb8alBl01UozfAU3Pow90UxBc6CP2nSX49xX0r8S1zmbfqaf4bzHBk/5Z/SR+5LHbb8Y3UR8Vl3Y/4lbcM0tDf8c+2utX84rG9dA10DXQNdA10DXQNnpgH7BvYV6G9cMQJUQ4AzAgD9dMTjMBgI/va16CPRHyL/wXEez2nfZIjqW9dA10DXwPlqoAVZNc4HYj4gp/xjkLh+mA+qVK4Gf9O1QNW4hNspP/DM/imIrvt8OdT4fcM1vxpemu/UdY7tU19jckz3ET9Vj7lvqi209tX2tSQ8FKtvXQNdA10DXQNdA10DZ6oB+wL2G7Z9Rfox9ufoR2kE8LMAIL/l2L8A/jmP56QMfesa6BroGjh7DfjAnZM+HJfKBMQx/2rQ7qgbA1fjx8B3Lh7o9kWyFMBvK53lal2D5W7tM07djMkpfce+sfqq8UvbAuloX8q5tlb3D4f2rWuga6BroGuga6Br4Mw14Pvf/oX9jkszATACaAhIY0ACP/E409qHon806HA1OPP2XJ77zFXcL69roGuga+B5DfjQm5MCnA/LOenDdU6uhmJMujGgNV4AnpI+/Ftp3Ie8Sce581ytsuwS5/XPyTn9bvZbT9SF/jE5V/et/XPtq+4fitG3roGuga6BroGuga6Be6QB+wL2I+yHbI0A9qXoTwn4LWl/zn4VfaVBj6vBmafn8Jz3SM39UrsGuga6BpZ/j+3Dcqn0ITsmV4Py3Yd/0s2Brvt92J+j9Brn5JwuY7/6XyKX1jvpeKEqfbkukcNhfesa6BroGuga6BroGrinGrCvYJ/D/slq0MclQ0AaAwR+B1rsA9Jf4rjBmQ/SvD3XENW3roGuga6B+6UBH4BLpFDnw3OJzIduy78a1G08/kk3B791vy+BfWV9mRiuMvN3X8bt4q/XsCQ8p7eyX30vkUvquJVmSXvKNEMR+9Y10DXQNdA10DXQNdA1sB1IsH9hf2U16GbtpvpGphmkxyHNC0n/o29dA/dNA7T7FUwCqzB75tM//dN/D+7Ro0cvaTn3k5bjOH5w3EN9OwMNJIjN+fMButSfD+Ax/2rQo/vwz7qph/+SfbtA+U2lbZWTc7Xia9wSHUUadbtULq1b09Fu8M+1n7p/OKRvXQNdA10DXQNdA10DXQNbDdhXsI+hrH2Y1XBEy2U6j619lO3Juqdr4Mw1sAL4X/SiF73m8/+tz3sj7hWvfNk7nnrqa7/vDW945r3f887X/8Mxx37SkR7HseRDfnDJoDfuq76dqAZ80C6VPkSRu7h8II/5V0Oe7sO/2FVAngovhWzzmDMAmO4m5S662KRVj7vIWp8cW+PGwkvbj+mGrPvWNdA10DXQNdA10DXQNTCqAfoMrX7HVN+mld6+B7JvXQPnrIHV8yP2j14i9L/65V/6/m95+qmPAvo//kN/7eKnfuK7Lz71s++9uPjnH551v/yLP7JOz3Ecj1EgjQHMHOB8MNA5K/Vcry0fjEv8rYdrK64C5NQD232rQcn6lcTt7PYF8l0NBHme6xy7uXl2vs7QjfpSkpf+KdmquyVxtBXSLWkzmWY4pG9dA10DXQNdA10DXQNdA7MayP7Dkr6JaTxu9gQ9QdfAiWtgDf1PPvnkyxml/7qv+IofA9YB/SWQv28a8uc8zBLgvJz/+U8K1p8LnLhK70/xfVAulYKfD9pd5BSM5r7VoP4M4ydu0s2BdAL7Xfjnys/+uWuIPFI/6CXDc/5aZ6SvcVPhpW0l0w2n6FvXQNdA10DXQNdA10DXwE4ayL5E9dtXqfE7naAn7ho4IQ08wcg7o/x/5A98wbsY4WeUfl+YP8RxnJ8ZAhoDKN+gz9UJ6fTeFrU+OOfCPHBJ44N3HzkHqe5fDefRryRukdsBqBflt/S8U+n2LJPXnpIyZ3jOv089eYz1Pdc2WvuHYvata6BroGuga6BroGuga2BvDdi/aGUwta+Vvsd1DZyaBlaMtH/Wi1/8Jkb67xr6xwwHlMuZAXwmsGGeU9P1vSmvD85dZAVDw7vKOWjN/auhRjKcfvbt7RLKD+W/RnnyutLP9WV4iX/X+mil36Vd1LRDkfvWNdA10DXQNdA10DXQNdA10DXQNbCLBvjEmNH+P/a5v/PHmXa/9Bv+MUC/rXjWEKC8zAp4/p8G+ucBu9T7baat4LY0DDCStgWOU3HAa92/BGhrmtWQT43LMPuP0WUZq5/yEqes++fCVa/7hq3XpW2hphsuoW9dA10DXQNdA10DXQNdA10DXQNdA0s1wIr7L3j06GnA/33PfusFQH1b8H7o83RDwNJav7t0FeCWhgVM0uu/rpyD3LH9q6EM7FOOpdslnrwOmZ/nNk+l8fvI6+o7j7cel9Z/K92gsr51DXQNdA10DXQNdA10DXQNnIkG7O+dyeUc32WcE/hXQ4KGABYMHDQP6/TtiDTgzb2PFCI5Vv+ukgZRj9kHiMeOWQ35u0//nNw1vflxXPrN5xCy6ugQYettn7rPY4bL7lvXQNdA10DXQNdA10DXQNfAGWmA/iv9zb4dWAM51f99b37Zc6cy1b9C/lyYmQwsGMhnDZvFAg+syZ7ddTSQMLePXxjlWP2HloeA6FPI49B6q/lZR/vUc+uY67S7fmzXQNdA18CdaIARCRZXevTCF76LEZg7KUQ/addA10DXwHFroBsADlw/rDvG+4ep/m/5ql//L276L/zmAP229rNYIOsDbGYDrA6s1p7dNTXQArxd4oBN0qesAHro8ClAfS3joXWwJL+sl13qdCztNZtaP7xroGuga+BuNMACRb/lN33Ghe6Fv+4FnxhKsrqb0vSzdg10DXQNHKcGMI52A+nh6kbD89e8fPWDjPqf8nf++xoOmA3Avxv0dnW4dnWonMaAb9d4oZTj9B+TrFC+NHxM1zBVFvW+a70tSX+ottbz6RroGugauFUNJPz/z37riy7+zc/8kq0hoHdIbrUq+sm6BroGjlwDv+3zH/t9v//LH/yJIy/m0ReP6f68ewB/Rv3/wd/+ppNd4G9f8M/jymyAo6+/+1TAJRC4SxpAlfQpp+C179vdaFL1u0v9LE17n+6Bfq1dA10DZ6gBRv0B/z/8u15zyRHHvjO85H5JXQNdA10De2kA+P/ev/y7/4u9Du4HrTXAd++s7g/8v+NN//rFL/3Me+41/GsIYPbDK175sndsPgmA+/p2RBpYCoa7pktDAMd24N9NB+os5a51sGv6I2qWvShdA10DXQO7a+A3/MYnPwjkV/g3zL7N5wC7Z35kRzjitOlc8bzvW9dA10DXwE4aeOab/9U/9//71O+74Lv1nQ7sidHAE075Z9T/vk75F/jH5FNPfe33oafexo7zptkVFvdJ340CV40A6LHqZR/d7nvMcbbGXqquga6BroEdNcAKxAD+/+J3/BujBoDf/Xlftp4FcMorFXOdn//v/+Ff+H0vf+lFus/5g7/vv2IK6o5q68m7BroG7rEGGP3HANA/A9itEbjQn6P+wP8YAPf4D1/wd4G8nzBc76bpnvq2NLAvSF73uArBhM/BoZe8Nurxuro6xPGUo29dA10DXQNnoQFH/jEA/P7f+78bNQAwE4BPAU5xFgAdTsEfQ8b/9Le+7OLXv+DVa0lYYwD/fHAWldovomuga+BGNcCaKMA/rn8GsFzV6M3v/Znyf9+/919q4OhGgOVt7C5THgIybzKPhGrOc9vhm7y2m8r7LttTP3fXQNdA18DBNcBKw0A/DrD/vb/nfzkJ/xgAmCFA+oMX5gYzpMMp4Av+L/rNX3dRnYaAbgS4wcroWXcNnIkGnP6PAeADf+9znhsui7503yY0wOwxZmH9+de9+B/dNfzzjf33f+pVFx/4p3/x4lT+baAbASYa15Huuiko7fne3IyAI21KvVhdA10DXQPX0wDgL8gzmv+/+d9/6cUf+kP/69nRfwwA/isAizZdrxS3czRTJoV/Rvxxgv9nv+hbLqpjBgTpN2sD3E4h+1m6BroGTk0DTwD9zgBAnvKnUbehfBf7Owb4Z9T9TT/3BRev+eRnr903fvxzLv7r/+6vn8Tig90IcBut9ebO0cH95sB9V93eXC33nLsGuga6Bo5IA5//b33eGxnlB/4B/le+8f+4lktG/oF/4Nh1APhs4IgubawoD532n/B/Cfp/61+++OziuM7P/aJ/5yfHMu3xXQNdA/dbA1/0lY99VcI/fuLut1bGr174Z9Qf9/e+60vuFLYZ+Rf+UzIbYOmU/LtMpxFg0PhqXOt9z6lpYFeA7enbxoRTq/de3q6BroGugRvRAAvcCf6Mbv+pt/+fLl77f3v9eqR7atE/oD/BH/jHcQz53UhhD5jp//z3/K/+M66XMjvyv4X/Av0tI8DzCwP2RZcOWCU9qzPSAN9x87kM98nv+FNf+T9WhxGNfUz5PrPFy1Z19B8DQF8HoN24+QSLGWPC/10v+MdIf0J/9X/XL/3xkzACvOENz7y3z1Rrt7n7EHsf4P8+1GO/xq6BroGugUNp4Amm+DNCz3f9fK8PrDPNH/DHAfBAsYA/JR31F/6RQDV5HnPnAzihnLj87n9tAAj4/6zf9j0XLffZv/d1a51xPABzqMrp+XQNnLIGWEwTw1qF/SVhDALMQhqu/6S/lc9v/+ssgP4ZwOXWjeGH95HT/jEC3OXIeZ36X+HfMJ8HnMK6AK945cvecczv4cutoYe6BroGuga6BroGugYOpgGBH9j/tavV1mEAEPwZ8f8Pv+7Prhf7Ix6wnwL/1si/RoAv/N9++XMYAP7IH/iCdx3sIg6cESOPwDtldvSfb//TANACf+M+73P/7xeved03XXzVa/7kP+F6gZfeuT9wJfXsTkoDLfD/Q1//NRf//uteuzYsfv17/uMLHM8aDI3rT4yG/S3jAHmd4v+a8wyo0J9hjAMnVak3W9gVhljg/z/7G5/93Fu+6tf/i0/97Hvv1ADwo//Nd02O/msAQH7LJ3/XSawLgFGtGwFutiH33LsGuga6BroGugaOQgOMSrOAXwK/o/1f/rqXrzvhdMQxABAPCAv1c+Dv/tboP/mwfgDuWL+TBywc/b/y7f9m9F/QH5MYAL7yT/35i//zf/rU2mEIQJfdEHAUzb8X4hY1wLOmQjxw/80/8K0Xb/ov33jFvf3vvvWiOtJxTM0HQ8AtXsq1T/U9f/O3/XQCf8t/Zp877K0zoPRrXr76QeCfkf+f+onvvlP4Xzr6n0YA/Me+OCB6PcPPbPZud/3AroGuga6BroGugbPSAGDL1H6hvwX8jr59+Vf9mYuXveKb1qv2s3K/UL+LdMQ/JSP/wD+AzQJ7x6hgoILyYcDYZ/Q/jQLOBHjLu//jCxwGgVd/zSue+5Ive+mP8m3rMV5/L1PXwAE0sP7EtH7fz8h+C/qJq9BP+Hv+0f91697zyXdf/J2f/s614YCZA2kMYBbTAcp8o1lMTf1PQ0CfBfDYY8A/M8RYK+EYFv0D/lngr8L90vCxGQHq5wmxKOCN3gM9866BroGuga6BroGugVvSANMombYv+APhjKYB+wI/UM5UXKb5840/6XeB/VbaBP/0MxJ+zAYADBNAOmVuzQBIwF/qx5gC/FdDwEtf9dJPUj+31BT6aboGblIDfJv/cHArFvdLQOfZsg/4A/2C/9/5b7774r/6hfdcfPhT33/xj37lvRdv+s/+0iUjwDHPBviypx57OiF/zv/bPv+x33eTFXXMebviP/Dv6P9df/e/7+h/GgiOwQhQwT/12tcDOOa7opeta6BroGuga6BrYKEGAEu/60cC3kI/0/yJwxDAN+qHAP5qBEjoTz8wgAEAo8PCS7m1ZHQ+Kdufef1/uDUA8O3/Lt//jxkF+KcADCwaAZB/9q1fv54RgCHgHBY4u7WK6ic6Jg08wX3DNOI64o8RgO/6E/5bI/2t0f41+A/QX8Ef+E+Xnwbwic2xrQ3ATJ854K/7+VRgqOCTXuxwzwa6YjYH1+/o/y/9zHvufOr/x35ueuX/BP0p/zEYAYT+agxgfYX+KcCerbYf1jXQNdA10DXQNXDXGqDD6Yh/gj/Q78i/AP7FX/Rnrz3SX8HfMFPo6zoAzD7A4IAx4hgNAIxcUrYpA4CA/zt+5/ev/wFAafycZCFBPrFozQjg3Ex9ZQpsgAzTqfvWNXBMGqBNPsH36hiu6pR8wjxrBP8x6Df+ylT/BeCfRoA3/cjbLs0GOLZFzfiLvwr5c+H7+CmA3/0L/3/vu77kzuEfYOav/abAfpd9t2kESMhPv0YAZMb3TwGO6RHby9I10DXQNdA10DWwUAO5sF9dzA+jAPB9k9Av/CNbBgCgH8g9VgMAI4gaAPj7v0uj/wO4M4rPd/1C/q7w73Hk85m/8zVNQwDGB92rX/6l72dUho5xLA7WDQIL74ee7KAaWH/XP+T48PO+8NP+KP8jzjR8vuvXAID0O3/hfkwC/X/tp961/sZ/aqp/gv6Un5kC+dnBMX1aw5T+OeBv7f/9X/7gTxy0Bo84M2aRYEzKqf8Jpwmtt+kH2HcB/Lm0/DvAMVzXWBmoA+riiJtKL1rXQNdA10DXQNdA1wAaYOTab/wZ3WeqPyNw+JF8g55wfht+DACcJ6f/YwDAMHGMBgBX/6d8AHh+/5+fAAjxwj9Sv/umJPDvfmYDkPcX/sH/w/pvA/ks4C9/37euZwfweUA6/kmA7zQBmzAG9Buga+CmNbAe6f+PvvqV3/SBD7z/Yx//xz96wd+hfdcH33nxjW97Zv184bMenjlji/mlESBH+/GPfeM/BftT+zRGYAw4JiPAPrMAMArcl/UA6tT/f/C3v+koRv+vs/jfmDHgr/zCF97JtbWg3zjlj//QX7s4hUU1b/qh1/PvGuga6BpYooEVL2k6SHTQdU899bXf93Vf8RU/1nKm4RgcIyq9U79E1T1N0cBDp/sD137jjzzUYn7XMRbUWQDMQGCEEHlsnwAACxhMvu4//dOTBoAE+AT/9Av4UzLzwY8xAIexBiPAuz7y+ov3fPAvPYcfwwCfDGgQSGPA0B5YeK1vXQOH0sB6ev+Q2YqRwLe97a0//HM/+9GLX/xn//RXkPxtGPD/be/81u1f+SXgt/w52i/0Hxr80yiQRoBj+Rxg31kA98EAkFP/j2nhP2YavOnnvuCgMwA0Cnz/p151a0YA4T5nTmRc+klD/7TPAjjU47Tn0zXQNXAuGlgB60zN9b+9gYZdHKOfrDKejriMZ1EwzoFxIL4FPhcd9us4gAZe8OjR0476M8oPWPv3fdeB9uscy0h2Hq8BAMlMAA0AX/zFf/To1gBAn9zHgPZrXvdN6yn6S/4GsM4A2NUQoJFgbQTAELAxBvjPARgBqtMgQFl5DvXFmw5wQ93vLFhwboURWmM2o/1A///wqZ9/Tvhnmj2An9/2T436t0b7bxL8x4wAx/KXmyxu15rqPxZ3H+Cfdsezl6n/fvuPkSlh9a78h57+L/wrWVxw7tqAcxbooyzVVXDPvMb21fgM60f/fRbAHb8QeBhTCUzv5P+bq3v0whe+ixvnWB5ud6yufvqugZvSwHplWv5miL8IAxKAdaYKMyL3zT/wrdv/MLbDw7QxHFMldTzs6wPcMPtIx/FOAcZAkIYF/jscg0CfKXBT1Xw6+fqtv6P+tEeMAf/mZ37JJQBPGL8Jv8Cv9BxO/yesEQADAOC//mZ4mK3AvXRMGuc9mwYA1gAYMwCwDkCCv/594V8jALIaAtDtG7/tG9azAX7s733Xhc7ZARgBnB3AyE3vDxxTqzrqsjjS/5DRPt4tzz777g99/OM//YuCv/DPtH9G/RP8WyP9xvEe8/t+5PYb/x0X90ug38efMwGOoSZ2+TtABhqOocw3XYZjHv1nlF5YvwnJegD0Aen70V/kfCw4yCcCOGYfkGbs3N/48c9Zp+EYjievNAKkX7gfi3O/ss8CuOmWP5L/esGfAe7p5DG9U8eUzurYRzqMAccy1Wnksnp018ApaeABoM2CKPy1EWDgAkd0bv7Rr7xrL8cDmmMF/yWSjj6GhjQG4O8P6FNqTocpKx11/9rP7275azneA7cN/8K+ElDVJfiPGQC4rw6jlcPkogGA75qf+rY3rvXJ9/kaAdZT9B2hH6TQXqG/hk23j9waAzZrBTDDg2cBz4Q0BBDOWQHdEHCYNnGGuQj96+n9QP/6u/4C/Qn+//n/6zuvjPoL+lUK/RrC7wr8NRZ8+FPD+hzDWgA4Fvi86/rk+T022p/x9+gfAK6M/h/Lt/+A8hR8j0H5XcdTZgwJY7MLBHwl16k/ZV8L4BafFoz0M8KfgM9fJtVO/1iYtHQCGQUinz5t+BYrr5/qrDTACBowQIfBKcvP/Jf/6QXurR99517gP2UwwAjw0//9f741CuhXppGAjj6jfYz45rMAQ8VQCffxf4PPqu1NXYxT/nnO840/9c/7QgC/C+nIv9IyZDgNALRbZwBwj01d723vqwYAZiwI/9tFAPlOf2MEAOhz5F+/8fsA/9QxfhpAWfg8gGcBjhlD+t/+t9+yXS+A50Q3BNx2KzrK8wH9D+kTOtIP9PM9P6BfHfGM+P9Xv/CeiyXwL+wrhf71VP9hxJ98PvKL77kAxgXz25R/56e/c2sEOIZnztxnAOw/ylZ0A4XK0X+n/+cI9V366XfdNcxf9/zOMEjIT50m8Gca4nH0K/uM0xto+GTJA/mPfe7v/PGv/Hf/7V/BMT0yO/X6gRBe+NUxGoBjv2mRTAtllIiZAd0QcEOV17M9Rw2seOAB/txHgIrgr/w7/+3/42AGAAA/DQOEW9BvnFKDANPG6PznpwKsHUAn7xwr5z5fE0ZdjLu0S+CfZz7PeCBV6L4rKewjdZZF+EdSVtYqYOYC76hjm7GmAYBFAJ/5S39h/ekCBoArRoAwACTsH3Lkf9YQQBkwRvze110wAwTYxwiAAYBnAs4ZAUgWJO3PhXv1BFlDP513viPnL/s+8pEPf3IM+v3GH/DH8a3/Evh3xF+5hv4BuDke8L8r6K8GBv6u0JkAd/3cYXQ/R/ur/55898/N+ER++8/if8c0+s+U+usC+DEcXxcbnIJ+jQAaAL7nna//h8f0Txpn8wSnsyH4J7wL+1/5p/78xVNf+b07OY6pxgBGi/g84GwU1y+ka+DwGnjIIlqCP6OUX/99334F/unkJLDr/7F/8Wwz3v1VAvLG6VdmfJ0ZUMN5DC+r/EwAQ8Bdd3QOX033M0e/96ddAv8YggFqIfuuZMJ+GgEoD2HKqPT7fwwArJ1xbP8AQMviGcC7mPsIoP7iL/qzl+B/OwtgYwBgHQBBXfiv0v03JZ2NgDGA8rIyu/AP+Ou4HhwLi3ZDwNk+R5rQ//9n799jrdvO8k7w5ET6/vhaVLahnVBKWVblAiFVUQHBnQp3CjfFrY4gMfgS5CIBUhC7QG374JYB4wumTR9yHGwDDsbGGJ8TB3AMJDbYWAQRyzIEC4Xg0ARi1DgIIYilpJqO1A5n9/rNvX77PPv9xpxrrrXX2ntdxpbGfsf98s655hzPM94xZu7nz9X+CvoF/3Xlv5r5E3a1H+mKPyvt+wb8kwiAeJQEuM07gL39FfQb5lOBt9m3m2yb59Bzn3H2njz87z/++7eN7mHPleub8LOvfh8A/HX7wNxQfQn+Bfo1XuBvOmFImsV90b80s60fh6v+ueLPpO65X/fDawH+KYIgyQC2BzCJ7BdxW1ew13MkGrgfc39WR/jkFpN/wImr/VUy0RGgbyITsFM+w/qRAH3TK+g3bP7aD0wtmfRLKnLQWj8U7HDvVvf7Y43CBJbwbQH+sXYlAsakVgAeAAiRsY8EANvwkgDAuk4LAK0AhlX35TYAQX0F/YZNvymZZIBWARIASEmA57z8ax/7ws/7nEc6EXC4z4XS8ztYenp6Pyv9gv7z//KfznECf0G/Zv6CfuUq8A/gd7Vf8L/vwD9JAAkADvQtOrzJ4BmgV9Cf8lQO/kPZPG/Z7oAuWP1/56ue/piA9LYl86xD3P/fIguwFE19VhLAcEr8um49tsVHQ131Z8V+m8BfUoA6IQGYCAgGBmuAxbeOtzicXlXXwKFq4H4mwJg48YBkFZ8TjvmtIF/8zh+8hwhomf+vu/ovYE8Arz+BvwRAlRIElqnS+pGsBPrb5wsCh3qhTrXfgH0c4J/P0rGKftsH/bm6X8F+xufKvxYAxEkAIPeRAMDUkd8LABmwjBT4s/pfLQAA3IJ7Qb/S+NuSnheA/l/+kudfbgeQBMDKga1DAKFOEB7kE2b4bB/vMA/yq6B/CvgnAfDBP37XPWb/ddU/V/y3Afzr1oBthxP0p//hn3/dpRXAbd73rPQn8Md/Snv/PWDZ1f99MP9n/oW5/LEAf8kA5oKu6K+Sgn7zEe6HAW7p/VDBP6v+AvZtS8A/kxkkdbs1gEOjYN62NKReTdfAIWrgCviHAMAB8Jkg87tpEQAJ9tOfoHvM3wLqruZTpoL/Gq7lM6yfetJPGIsAx8S4MHM+xAt2an0G+EPYYjKP3Ie9/oJ8LQEE95UMqGEtAPyKBgQAVnD7dk3ZMlMJAD4FCPDXEqCSAAnwBf9VZp7b8EsGYNEgAaD0/JDl4Wj9ENF9uymv9mcw8a+g31V+ZWu1fwD8i5P+kfpbq/4AfwjwJAAS/O/LwX4J6lv+SihkHj8NeJtfBfiSr7/vGyoBcEIn/98H2fr3X/oXPigB8MaH//zwrftcqb4pP3OtYzH3F/SnZHzqEkAvuK8y0yQClMtDps+uPo56aLYGKvgXmG8b+Gd9gn7jmAAwwWFLQCcBZl+6bWU8Y4KJ3gFhOB6C/YTNbal3dj2XZv+AfkAyYB7wr2Plj99O3QLQsgCg/CZOoF6BPmHSTEcal3kznfZrGePsG2NlXPz+b3PiM/sqnXBGV/5Z9ferMILufZEV5I+F0xoAMsMvACz3Fe7VVeZZzO8DUAxAZpUc4qVpBVC+BiCwF/wbvk2ZFgr0gzAERiUC8uyQThDu1S0J4IeUuctqda70C/aVY6BfwK8cVvsXRADgP839p4D/5R7/DQ/2mwLjCcxvys85BW4FuK1zciBxKgFA3F7dfbvrzB2eM4J/5G2Y/wNuWfFPsHxs/m/90F8Z5o8J9tMvwDfOcJV9G8A1fgzu+WdygduFyb8gP6VWAGlpkCTACT1wrnH1rl8U0M8KC9+9BnyxLxuHHxPMTsZcX8cza7ifvZLDRGpxMIrgGFlJAAgA9lwnCVA/AbiOFUAF7AnmaV+Qj38K9Gda+i1X2zFMOo5Twn0O3dbkZ+a1OslsnPQPAcBzGrAPgN4X0E8/EugL7jNuzK/5PyQA/ts0v524se7w2+CMAlfIeQ5IANxjBVDOAhDsSwIojd8XmUSABx4yXs4/Yfy8lzoxPXGX7DZpWOXnPSXof+tbH/2XmPdXsA/oJz739Qv0q/zQEvQD/AHAb3nvm4dVflb7x1b8d7Havy9kAM8hSYDdXs7R2u8AfCUBTs38nzNIJABuw/z/WE74X0VYsJ0BMA/AF+SPSfNV8E+4fw1g9Hc8ncCNzuo/L1YmEzcF/iUCaJO2s11JAFaXpnvfU6+jAcA9utcxsdTfkhAEHZRdR+Mry97lkB0+lyUgTpkkAGaPXKP6KcAxK4AxMqACcNozLmX6KxlAWiuu1pV1pD/z4ccaoJj+rlRcz7B7DWDqj8NCax/2+ifxALCv4TGw34xfvIf4Le3rFwC8uhCzSQB88wueMxAAgn/JgNZhgPsC8Of2QyKA8UoEpDXA0uxT1XS5Gw0MgH9R9Rmki+b92wL9rvjX1f6Wif8A+OMkf7aPbQLY55ap+bYdxqKg1qmVAfqQALitz5zlOQCnZP7PHLea///mv/nRS5AqWN2FZB718O9/zt6s+r/o//gLO+3LD/zhF1/qNQG+JEAL7Lfi+DrD0jqsbxOb+x7gBSr4B0wAwgXiSoH6riTttL4wIDHA96Xnjqfnm62BMyaSXHMmVy3HRFhHehICEAGsAMxurWeco4E7TK5e97rX/nNN/wHDOgF8kgB8Uotrk58ErFYAlldaj2HlGCAX3JNPP7L6MywZUOOsg3j9LUkcjlU/7jvutzkK7Hl2pwGAPyv/XA/8+7byL/hvgvsFOXBP/ALwZ5zm/7x3eDbuTpPXq5nfAtdACwAAMdciCYA5JICr/1XOBec3mQ8yg60Obn1IawCu1Z5aa1zvQt9e6Sbg50s0gH5W6lnZZ7Vfs/6plf7W6r+r/YJ+V/sF/e7pd4U/P90HYB4DzYLnY5FaAdzWljhAvxYAfMHh9m7Jm20Zi1dP/8cKgP3/gtNdgH7B7r7t8xf8I/WvWtFfN50xp04T3KsXZaa1/ODZbhk287cCq5jgH3N8CQDBv3JX4H9VvYLOfdyPOVPNe5fNfaQt0G+cwP/p3/n083SVCOj7Mbd2ea+Y/idITz+gmDDO8wC4VrkVgMMBtQKwrNLyAmykYDz9CdyNT1BvXObLdOIzzbAyy+tHXkzcrvbJLwXc1iRoa1f4gCviE62Y/u+j2T8gvoL/MdN/vkOfoP/Sv1z9xwIA8//lgXN7ecXoWxIAgGGAsaBfIuDyMMCRbQA3CeC30ZbWABABfgXh+W/4uktiulsDbHy7Dnv4F6WHFX4/1cc2NAA/n+wDsAPkW4C/BfBbcdTBaj+gH0D/k7/6I+cAfWTdw08egb5yU1C/iixYlb5pu9sol2cB3MZ2WKwRIQAAwYv741RWVs94lqT5/673/++juT+A/29+/xOHM34+53kfM1gB7IIEYOwSAJIsKVtAfyyunwMw/x1wBvhnssNkghV4CIBKAkgAKFcB9k3Tab+1/YB26d/yk0x35w+v5xzRwOUeUsE+UsCvTNBf/ZUEuOXv1Y4M8+CiB9N/9jEB3gX5FbhnPH7yMoniuuVWAKwAsuwFuH7cmqCGAeYJxDNcgb1hpaAeaZzStAyn3zazvcf79o6hT4Td7rDPK7MHd8fN7DAWWIB/nsH7ctK/gH9MXgL71so/cWX139P/IdJ4J+6zdROrU7wTNYmHAAAQexigBICEwKqtAFoAbAOk77oOSADGw9i4hurA7UJLkvBUgMrMX3Az2wD6WQwQ8GN59u53v+vXBfzs0R9W6tmbH05w35LG5f5+ADZAdnBL833DAH3N+AX6uwTkc+pu5WnFJcDfNH1VOdrwiwC3YQUH6QABcErm/4z5uc84e08SAP/qp7/tEqQKVrch/+j33rFX5v6u3gP0v/nX/+IA/j3wl21/pG+bBJAASFCfK/7pzzwtfz8HoPmsvzcywT8vUsF/SsC3DmC/SxKAdpnUICuJADlAWt8KcO91XDemZfYv6E9ZQX8NJ3nAtekkwLpX4kr+y1P/B5PH5Wn/CfYBwYbTLwnwkp+5uhUAAmDKCkCQLfAmrL8lMy4BvP4qyY8z3nBL2jZp1X8xybogLnhRcK91EuDKvbPTAGAT8M87ArP/fSMAWqv/K8F/gxRI8/8l2bxTvV6ncsgJfgeugkMAAIR5Jif4bxEAAOgxkC4RoBzLd9vxAwmw/FoAlh7qAYlecP2cmuYdNpj2J+ivK/wAeEF8gv4E9PjNU+MNA2wB9+laQH8OAE6gPeWvddXwVNl10lbVu2n6WLmHf/51l2cBLK4q1/DG/njWQAB87rPu/1s31ugtN9Ta/78LAoBtngLuXct1QXsSALz3OYsNIuCvPPv/9Ni6da0aG3PEBPPrAP4sh/8Xf+5NngNwo7+TW75l12s+T/xnYgfA1o0RAEkEVIC+rTAvbvrTqq+/2Ne7xq3c7h1N8J6gX38F+6vCWgTss9lsSx97FHfGC5b9j0kAVEsACYCWJK8TYL4KQFgCQLA/JhN4C8ATuOtXCuJr2HhkTTOszLzVf9HPi9V/0jLcSYAbvWvvuvIPqN438L/R6v/i/ZIEwbAlYBGH9cwhmP979SHBeO4C/nX8/j/+E59+hQRgG8DUVoApsD+VJgkwJ495tyklAVrWAP195F0ygMVhpR8g50r/GOhfBeoF91Vi1g94XeUA2WMgdx0Avq28+9SXVWPyMMBb2HJ5xkGAp7SvurX/f9sHAN70p/2+7p89ee3Ve4D+l/w//sIA/P3ULyQAcdsiAfwCAOA9gX/6K8hvhbGkIJ6DAJdbwc4un4Ld87gGeIDkvn/2dOIkAJRziIBtWwTQ9hgBoIVAtwJ4/Fqu4+O8B0iUVeB/UxKgEzTrXI0reYeD/57zvd/+G2/6zUcu90KOEQGA4RYBQBxlvA4A5SQASL8A0o9vA3gcXF9d/Tce2QLsU3E1rYapc6xe+mc68mJS9HjfDEsC9DMBrtxHWw+w758XPqZ/Y2D7puPrir/tC+oJ65+UQQRg9g/459l3KFvNWucAYAXA+3MTK4ApIG9aldsE9JvUVUkACCrmMujhRLcEeHjfXQA/ByOyh5u9/Jr3s6oPgJ8C++YZLAAWn+Tjs3y5kl/9Y8Cf5/U2QXbWlf5V4HlOequ+Vlyta1WeVem1PsKtMrd1GCD30XL1/1S21dzhvLE0/2f/P8ASUHpdxxyH796vWhXfVjpAnf37vMfX3ccvyOf9T3lIAKwB3AqwjT7ytYMK6NcF/7U8BAD37dYnRIdeIS+EFviXAFACtgHjSQLg1wpAyUr9tkmA1uq/cUxuADjdvG/9O3Ed8M9EeNWqv+nkhVQgLPhcv3cnW+Ly4D/M/DDbhwRIIsCVfOQY8M94SABWAl/wthdfIQAq+Dd8AbQfB9kZFowL4pXGj8lWvlbcWHnikwy4mCRJXFxYBngmwG3sizyFuxWi1Zf+vn3uT9DfknNBP/laq/9Yxx3C9eUdyPOW37oWAEjClQBYZysAIH8u0K/5DAvma9j4bcokAbB0gARAL5AA6AI/1hInsIJ5l/kdYB/nif25n9+VewB9OvbjcxBfyw1E9HL/PsAfM/4xU36Aq64FbDeJa4HhWk/NU8OZfyot87X81ynbqo+4sTprPF9J0Apg8Xy6MTAOkLqNwwdv6xnMeOsBgL/ylqddG/gDalm42AZonlsHAJ6Vf0A7jvf5uqv31MFZAJIA1ME2gLl9WJUPSwgB/CbA35V/JXU986ue/sb+VZjGLyj3/XOwyNc+/4X3OIA+8RX8Z1gCoEqB+nWk7bTqII0Xep/0Ny7uRJSrRbtc/aduyIB+fSYuxL1Jd5jIs/oP+E+3KREAUcCkje0ETIJ56Qj2r8oLIC3QViYoXxe0Z1n9rTpaceZvSft2MYmSCHhkGCP3W996cu+NdZ0YTCB50fOb3mezf0C8K/7KJADGvgSQedz7z7OLw/8Weju7ju5usiz3PqR4EgD85omvJEBrKwDgOcF4AvY5/jllyZN1ZZlt+QcSgC8dLBzjZOyQVlgB8JUAFw5u61vqO74nAINngDRW+zHvvzzIrwB9QL9gH8L54V946JyzY5A43hkQqz+7PKhPwA8YxQH82bc8pC/yGD8GbqfiK8Ct4amy66Ttqt5WH1a1tSqdOjOPfqUEwA1vAxisSXZ8D+9N9TwjdnEA4E2b/AO8Ae8AfvfwIzcB71oCUBdWBH/v55+8tS0AzE8B7Qn+0y85sEpKACD7lwAaP6e675+JD+4bX/pt5w++8qGmE4yPyUoAbMMawJd1iwAgzvTFEPsXARrXuRXFhHAu+F9n9V8rAOtOK4DOwLWuxJW4+1mVgq1kz/53v/+RKwTAdawBIAEgEAADXJsxEgCwLbhOf8YJ1pUtgP7rv/+Pr5jut/K0yrfisiwToot+XZAVF/7HCQD6+epHXzwAHkDrFe32wMYacOUfIri1yn4bcRXsj/Uhwf2ofwGaWf3H4g3Tf96DgP9DWf33wmKqyrMdkCsJ4Mp3JQDmWgFUsJ5h/VUmkDdtDPibrsyym/qrFYBj5zwE9eOWgGN7TvAO8XN9gP9fev87ztMB1l3ZB+BXVwE/YHPMtUDvOnEC2VVl5uZbVc+c9LG2xuKt87rptZ6sb8zPcwoSoC+A+QTcurzzYz/xCY/9+D/9pN/KLQCtAwAFrYBVAWvLDyC9DfDvyjuAPwkAALyA3jxzJGXSzSkzJw9zwFXgvpWegJ/0DGP91K3E47dR9/2z57EF/l/2mn9wjluXEGgRAZuSAWw94KU9Vl4rgL7qFxd4wsvp/EkAAPDHHAB+EwJAIgAJ4KS9vj974qJcJA2f/WP1XwIAEqASAWOWAGn2X/1aAWAJICBg5QbAXJ2gOoE3/lXgPPMzmSHMChFyDiGQ5ee2ddF3yIALQkCpqe9CrTdmGrny6h5oBkz/mTBg8neopv+u/CsviYAF8L/0L6wHfA/yzNr3k/9HbqfLT7pKACDXtQJoWQIA0AXp1Z/gvpVW0w1nfcalxL+pkwTQ0iFJAKxYIAB4t/FuWh4SNaLSw4qGAPjqZ3zFu170hofPH/6x11w4VvcXDrAP+Ndkv4JOw7uUCWav006tp4avU7dld1Gndaecase0lPhxXF+tAA7rLj2M3mJBI/BXQggkATAF/CUAUt4WAQBY13RfAmCTLQAJ4pMAqP7MN9fPWQgJ7iVSMq7lF+ybZhiJ41OAnQB4/Dd3N/f9O+nJlX+Bv/I7XvMD5ziIAKWkAMB8lxYB1M9LGiJgzApgeIkv9vU9PsTuG9MAunKFHjkG/o1PML+u33ZoE3cC+y7H1L4q/nL1/8Xv/MFzCIBKAiQRsAkJAPjXPe8fvnww9TTckn6XGanpZ4L0OX4nKspWmblgP8syeSL8uITIkATA/8hgGdRJp1W33XQ6ZsRMEgDDHPgztsp+0/GA9tqmcUrSBfzKS7BfgL97/yHBeR8e4uq/VxJyn2ftOlYAgGTM5Qe32AZQCYAE4YL2BOrGKWua8VVmvfrNU8M13vQxKQGQ2wCSBMCP9SB6Ql9HtIBwhlWD8zqe9S94+/deEgA8z3keJwDdln8b9W6jDsaT9aS/prXCc/VR67XcWPzcdPOtklxLCYB+yJlPwO1JDjsU+Cvf+PCfHz4tl6BeoJpxgNGMN0wcc565oHjb+bAA4J2Ogwh43r+82BqwbjsAfkz/sSCgThz+r/zBP7P21wVs+wf+8IsvCQB1J6hfJRP0kzfDEABHut1r/Zsds0YmOLz02Pfvi0JAL+hXEo9f8C8BUKXl55ABAPmxFf0WyKevvKxbacRpJdBZnun7Af2gS4G5IH9Krgv6zU+dtoOk3W6qNnp9Lvf+J/jXn2SA5wKsSwJoBWA56tHCYK6s2xAgBhKYt/xMhnSt9IzblAy4mChJAlwQAR4KeEQT+9GbZ1cJTBJ89u7D3v8E9xIArTjBP8BfR757iIBFHPEQAAn+D3T1//I2gPjimZtWAPgZvyBY6Qp5JQAA0E/5tB++sgIvCEemHxBuXJUC9FX5raPmN6y0HsNTciABlucAeBaA48aaBT/3tRZDWMddKvFwPXch2hkL87uc40EGsGqMFQDP7lVAdRUAnUrfdt3brm+q71NpN9GPddqQADi2rSx78PO78yVff983CPyVEABTnwBMoJ+EgIDWuNvYBiBoB6xj0fe//uh/s7H5P0CfRQHqAfjjCDNnQG5CLOQBgKsAv+kC/Qr6idd1AmD5a2KPoKv/AGrBv6v/gv6WBPAnEVAJAQkA5JhVAPHpxgB9jbdMjTdMOhPVI3mB7+zZh34SlE8Bf9IE8+vKrFfCAYnb2eAOt+Lh5H/2/ufqv6BfmSA9SQBX7wH4uGr+T5gJhenklwRgQsie56wbv+SAsqYbph7q09Q/wbx+2tYZt0rOIQKYpFmP/ouJm0TAIwMA4p7rlifr/zggTlgh4D0BcBRw77sU8I+RAAD+e9zyXcizEfB/6O8RLDe479MKAAIAoPuxT/r8tUgAAbbAW0k8fp1h8ytb6VlH5rMO08ek+Sw7JtMKoGUJIAGAriQBjoCkHj79xzOPsQgQJQKc82EVwJYALQLWAZ0C5FaZVtxUftLGyozFW99U2cyzrn9Ou7XOVWXG0sfia/1jYa4n1/jQn1nrv6F2XuLsKx+87/Lzf2MEgIBfKcA3XKVEAPF8897V75uSkAC2lX7jVknKQBwA8vmiAGHAfvpJY+7AloN12mCrKHqZ48aAP2VN6wRA/EYwERL888LzRTAH/Av8JQYkA9IKAL9hyYA51gCrwL0gf5VkTLgYcvcWDfD5IwmABOlT/nXBv/mt0/a8Pp2pLhdlsU8dywz3/gP4x5zAW5DuivwUCcAEI0kA8wLe2RfK9WG/aNa9jp8+uKI0RQQI1lPygDY8B/Sbt0omR8SlvJgwPTKMr28FuOeeWxnBC5zfLC/z2yYAAOyVeMg4+yf4b0nyGz8QAAvQj8QajmeV4P/QV/+9sIA/xlStACB01iEBKrgW0CsF4wnWTVOaR2l8StOQ6SdPhtNvmmXGpJYAUyQAFgGSAEcCpu7n4F3GIgngnE9rF8I8+z0b4DpkwBhAHYu/DvAdKzsWbx9a6a048yNXpWfe9G9aLuuY44fA5/r2d5xPvq3J+1dZAAA2BfRzZObBzzlMqwD3vqUD6LEg8POBhD1bwDj6jCWAYdJXjQMyZA7wr3kS7Av+Bf7KbgGw+E1U039eAjjBuuB+Eynwr9K65xABUwDfFf6pcwDcBnBK3yhd91HHhF5ALkBfJQX068qs1zZpv7+orl41iLnW6r8kAGAcf0r8AG+dK/GAe1f6tQRgIqLD7JN08lGG8q988yuG089boJ/0VnzGebgU9TGBbJEAtF9B+5zwKlKACZL16L+YND1uBeBWgBv+VNLVi3xgIQ7+A/jze92ng/8S9CchILBPiWl3hvVLBAwkANYAC0Cc4P+I9gqecf0AtUkCcCBgJQA0j5/aDpDAW6A9BuATmGce41sy47JMtmse21eOxZuOTGsAx+t2gJSSAEeydWgglyUAkIB+QCPWX54PgDUAcTg+A5iWAQlCNwG165ZZN3/2r+Xfdn22sYt6W3VmXPrtB9fO63tgr5m97u4nffp9n/W81/+JH3TlX9k6A2CMCEjAP5bnprYCANTXWY2fAuzMDXL7APVyHkCCfs8G8FOBq9p+y3/8m7MIgAr4Bf3KTO8EwPInlqf+p+m/AH0T0D9WJkkA/bSDpcEcIgCw3yIDmMzQ91YacdRNniN5cW/94cgqs0A8wfkq/7rA3/xZL3G0zfXBbX1wh1vh/RBWc1b/W4RAEgCSABIASFf+mTjgIAAGEmAB1JMEABRABADsJRsS5E/5yQ8JQF+mSACB+pRcBfhbZZkIGa/fyZHSSf3h3iY323Ne5PxeE2Tvk79FBAjwkYJ/ZabhvyQBluCfZxJ7GSE+blbTu22N0+25jkkA4OcE/EoCCILHSIAE0/gF3SnxV1fz1nTD5iNsWzUt85hmfsNZVr/ykgRYnG/gOFPymUDumW/4xr/977gnjsQS4A5Wd4JEJNsBWPwZCIC3vXiQWgW4VeAFi3g+Gei7w2fpmGyB07G8xs8tMzef9W4qV7WzKn1Vu9ct36ofssZru9unyWnVzgGAL/uJP/FTAn8lBEDrKwBjAN/4KTLg4d//nJUr5FOAfE4aQNwV+VVgfFV9EADWZV7qJO5PnZ0NWwKe9eaLQwaxJMS/qs11zP8F+0qBfg0bf/IWANcx/R8D+lPxAn8leSUb5pAALZAP+OelPEYQUIZ0zNxP61E1b7QQI+sSAIL5TWQSAPiTAOiHNV5es7u8aGDxBfgC8AzXuATkSQJo3p8kAJMOwkhcywqA+jgciroA87ad7czxU54+0EbLEkCg3pI8rFvxq+KYFGUeJ0nE+ZlA+nJEE/rLm2cXnid+7Mf9Ni94LKpuG/QL9JW1PwnsAW7VJRmQefFj6s89gQP843ahz9uu84FnP/BhrQC+51UvuSQDsOyoJIAr44LiejCghwJW0C34noo3jyC+yppuXear6YJ60w1nPuNSriIBvIf8dOKRfCLwDpYtrTMBtATVAkAiAAm4xIJKiwCeo75HfM4S1r9KrpN3VV2mt+psxZk/5dx8Wab6ax2rwqvK1/RVYUiaIADObvt5c0ztt74C4GcAAZs4gf2Uv+a1jJK5D5/AE0xvWwK+WZEHnCOpn7hVoLzVD8oA9FkkYNXfOqyPuQPvUrYJ0F4lClp1Evfu3/meSQsAdIQelek3Dtly3/VdL3vHyWKOlun/3H3/UyB/bhokAHklAyQCkC0ywDMBKtDXxJ8yLYKAuGd9w3OGCd0xPYS2NRb3hALEKzifCm8C/i2T9Uo+dCB2eUWbn/4TfM+RgvJKAiQBABhnUpJyIAGWVgCUpR7aY9UHE1AcYetfR65jBbDJin8F+xdA/4IEYLJkuhMn01n55N5baJ9DsvpfWwNnvNghWyvY3odwJQIE+IK2ljRPJQD8Eo4TFvZLt1Vy2LFYGLHiD6BNS4DWVgCsAAT/ykoCAKAF1IJ0Qfd1JHVm+anwqjTTlfaTsG4gAuILAY4XHXAfcb/4zDiSbSH3nAmgNYBnA0gCKHkP8E6ADHB7AISAW714r1THc7eCYJ/F68ixOsbiV9W9brl1869qf276uu3yLpcA6Ntft/eszi0AP/5PP+m3tABIAkAAPwX+zaOUDFAazwr4GDjeVrzA3VV56hW4C+RXtWV+AD5zBVf3LS/RQJrg37Sputc9A0CgLxFguCUffPCb3n6SBAAvLlf/d236v4oQgADQbUoCjAF/4yUJjuSFvb2n2aImDwBMUL7KL5DfVGb9SQB0K43h0s4+/E8yQKCeEn8SAHUrANsABP9MLvBXAoBVfyZ7TPK4ZlMkwBxiwEMBBeMprwv6sy7BfcY50TLtIvzIQAx08mn6keLqP5/Fu03AX4F+qy8C+xboF8CZp4J/rckE/0944hMfmdbMYaeyis3vGkD7ra972SURAGGOFUC1BKhEwCUJsADMrqALpBO078IviJ8jzSPgV9pXpWOYIgHQAfcJFhQ8N44EXA0kANaAgkZJAE3/Bfu8CwD/SK0CzMPWAd4ZPufz/cI7ZsrxPG6B3Facz/Lbltvu29z6ar4aVpdeyz7v3d5zGkL42S+972UA/0oA/MpbnnZltVoQL6hXtuKNU5oXuUsSQODOqj0r9KzO8/4DpHOCPyf5V0LAMmNSEgAJ8IdYwFEvnwm03BTwzzQORUx96AfU429JAb/phlNyxtaRPL/Xu8EF/7zAZHlvcvW/kgIAf60B0iJASwAAvH5ktQYwLOCvkvQ+yW/fIwLwBOVz/JuCf8pl/Ya5Prh2L08q9uzv/r2v+rZq/i/YXyWnSICxrQBO1CoBQFuu9vicIDwH7NOP6rQCSGDe8vOQbsXPjWMCRF4niFku04x/9aMv9t67e1J32rzB3uXlvU+r/xIBSomABPQtAkDgn0SAcZr+M0nBHdu+/7FL/bSvfOB9bgVISwD0IgGgrAQAq+MtEsAtAQm8d0ECjNVpu8oE/PqzrAQAchUJwJi5f/g9cHDt8p11NqbfA4ofLM84F4pxCR4lAnz+A/wlASQCCJMuEUA82wPcKoBlAO8WXG4XALiucoJZn+XryjFw3Kqn5q3hVhnjxvKOxVtul9Jr2AmA7f8KIU///kv/wgfTAuCdr3r6Y8xdBKgpW8A+01v+LLNLEiABPiv3EAG881mtF7gD5P/m9z9xWNknD0AeRxxkAQ7Aj+P9aXn8lIVMsJ0E93P8cw4CVO8CfPSpf0xCAJzcp6C5cSUAeGDD4u4K/APmBfur/KZDBiQJ4CGBUySAKzcV+Ge4A8zmQ/DuJgTAdcC/gL+SAF6fYzW5bWr/3shhEoZp0iqgP5WeJMCUFQBbApyY6Ud6EKD1QEYwqWOSN0z+lmcTVIBv/lY8cRIA654DIFBfRzKxIr8y/U66rI8zAbj/juRwr3vvqmvEsPrPhKCCbUH3PknBfAv8Zxz5dMQzPpzgnzFfQ2WHVvQOh9th+p9WAJAB6Ebwr4QEqERAiwQASN80EZCAX4Bf4wwjq7sC/hf9H7MEkARAZ7w/j8xy7WyKBEgigHdCuiQHtBzTcoCw1gHbIgTGwPVYvM/9TeQ268y60t/q16r0VhnjOgGwu0cxpuPPfcbZeyQAkBwE+Jv/5kebBEAL4K8bh5UkJvFzQPOmeVydZ+WfE/0F9oJ6gP2YIw/vUcmCBP3Wu0m/WtsAEvAL9qscA/7E/8d//7bz5TkuZ7u7S/awZsE/E14f5preC9avIwXyq6Qr/rWtLGe/IAG+9vkvHA6gahEBxDGeej5AEgDm6d+bf/ym5CG2CQEAeN8WCWD7SK7hxz3hCd/8eA9Pzre2+X8SAQJw4wTiSQK0rAAgAZhoXJIBixUbwLrnALz4nT94DgmQEzziaMc25kjqo/0WAcBDWUC+DckkSNDvhMiw9We8+3pP7o6bGDCfouRlvy+r/5IQSsgHVxoAq4B6Vi1whpmUZFjgjxT8O7lB4iZUcpRJvAewAgDQ5oGAlQQQ/CvdH69cRQQIynctBfm2Y7hK05GSAfeQAGxvaJwJwJi5DzFP5b3FWTpHdHOcMU9qWQK4yi+wHwjhQgRICpCmZYDliHv4Fx66tBBguwAH1q0iBXhWJxge8/tMv02ZfdukH3PLr8rXCYDd/SJZqLppAkDCgBXxTYD0OmUE7ErKQgqwVaDlprYKrNPuWF7ID8evbJEAU6A/037x5950vvwE9J3d3SV7VvMXft7nPOIhR9dZ/U+Qjn9TJwmQ9RmnnEMCCO6RCfrT7zaA/r35x29KXvIC8FyRX+W/LvivVgD0gTaZSJ349Vlp/l9BvmA/pXkE5S0CACDuoYBJAGgJoBXAFRJgMdGrJIBtzJVjBICgfEzOJQiYcFlHnXxlfPqZSDmRX7LCj/9ITtiHGfy+r/4D4jm5XmBPWPAvyAfUZxxjMp/gHyLhFMG/tzeTIUmA3AqAHz1iAVCtANYhArAG0CIggfcu/QL+VhumKcnTBP9YAixJgEoEMP6Xv+T5524hOrLFhbuYjucXAgSUzB0F9BIBgv6W5J1BPhecqnUAZSQFOExweDctSOjrkAL12U94DDCPxbfqqHFzy87NV+uv4XXq8Xr1LQA+5bYnMR1nrpAWAHkQoCB1V5L5yi6/ENAC4pIBU7JVbhtx+TUAgT+61S+4N87wmDy5TwDCWLn6z4oOD2ScALuuxE+FBfyCdMPbkNaZEj/9rJYAAH7PBgA8Mq6p8wDcKsDK1vYeBYdbEw+wTQiAbVoAUBd9gBTgGuIOV6PX6zkvFcz/XV1PUL+uP0mAJAA8DJBJ1jDRim0ATC60AkCSriUA7acVAJM6zymYC/7JR30tCwAB+bYkEyfrchJlGGm6kjgA0JGZ817rhgQQ3/bqf672u92gFWeaRMCUFPQrTx38e5NMkQC8ayUB1iYCNKdfbgu4aSIgCYAE/MYTp7uHBCgEQCUDIJIkTnh3Hdme0rtYh8wlAYZ3wog1QCUGyFutA5JMyDME1iEFBMhV+g5YJS03lm9V+li5VfG7qFcC4CQPOvOhtjt5hrVqJQA4B2BXoL9V70/90bN3bg2wDQB/3ToYp+OvoL8VHgP+xp/cJwDzs38yseuC/20A/HXrSCJgigSQDJAAaG0HgCzgJc1pt7t7LhxOzex53oQA2LYFgIQCfTnCSdTcG+IOL+rnfO+3/8ZcsM+eyqm8CcyTBBD8SwC46s8k5Io1wPKTgIB26hq2AiwmeDw/nOwRl+2s8lMXbSQYT/82vgbAZEuQXydextumeQljisr9x6R37kU71nycgH+bq/8V5BtWAvjTLwGAnAL/pgHcAP64Uznwb869CiksoK2WAPXrAHOIgATMCa7TIgC/YLwlP/Oz3j2Z3iqzKk4iQGn+7ONl3wsJgPl/WgPwzMAKgM8q8nWAOXo+oDzDe4m5goAypZYAzil5L/huqKC/FSav1gFaFiC1ErCutBCQEBjeX8VSQAJ76rBBnvkCbmV9TxhelW6+rDPjxvzr1DtWRyveehm/16kveO3m14bFT34JwHMABKpKASph/evKVl3GMWf6gT/84qMmAupBgC39ETfXcQDgyZw3xoS2rv578B+gGpC9jlsXxG8rv5YA9DnPBBD8aw2QJIB+tgPg52XdV/kuHogw+5sQAAL26xIB1KMFgH6uz4kSNIPJpavqFdivAvuZHxBuWECeBAAgvJIATpyYQOhHYoZJXspTJ5M4J2xMzrZBAGwD9AvoE+C3JkjEmbflZ8X7yPbzbjT7AfzzW0xgvU9+wT+y5QD6kgFj6VoA9Any1VtkyhLgm1/wnMfYcjEG/t0WgPRsAAHzJaCOzwZKBCgF4i25CyLAdiQCkFdIgAL+r4xheTbAx3/i0wdLmff/ysV5AMu9pVeVetihO/xG6mcCBZgC9zkkAMCed0hK/bxPdMRRX617+NRgnCEAGaDzncY7S5fvMv1zyYF8fwisM26V3zJVripnuuUMK41PiT8dZyt4fRa3Xv+6zQ5+f2ytyC8BSABwwJzgXKA6B/xnnjn+rJv8bAvY9SGB113J37T8w7//OVd06tjnAv6ab3nW2NkObov9q5LVfyZzOB/Sh7D6n8RBtQSQBJAIYHWC8UkGCPyRgn/85uv7ou67j/32+0AASAK4DeBECZqV+/8F9VUm4G+lQR5IACAhAJIEyL2WTCKYKCnxM7EiP/W4DYD7BiJAwkKiYZWkfeoUhKfkIZ3hdf1MkCjjRGlMmsf6LUf4+9/+iuE5sn9P8ZvrEWbMgGNB9G0D/wT79CXD1d8C+8R9+Ze88NKZh/FxQCDWDjen3cNoCRDLijYHA1ZLAOLQnWB/igxIEkB/BdECbkkApeC8ykoE1HDNvyos+Def/bnsZ4MEkNRwTOiCOQm6Yh5yjKQSY+K+qIcDCjQrWBfMt1b+jQPojznyUIeEM/UTxhrAeAgBylcLgXtIgeVBgxIDSkmBlFMEAe9F3heCbf0tSdwql/WN1WFbVdLP7Ldj4n2NTrwuh/HEObxesrBaDwKs5wAkUE1Q34pvxU2VaaURd4zbAiA20E/LqYdWWiuOAwCP7LyW8R8PQNfVfx6gPEw3Xf1PQH6bfq0VJAEA9e7vR2oJgEwiAL/bACBFxrV2Gin7RABAAkgAMIFaXIHTOZ1zMVgmV5glzdn/PwX4JQAyj6B8kgSIswCYVDjZcIKhFQATCyZmEIk4JmLrWAHQByYqgu9tSiZQ1JeyNQHLNjMv8UyquP+OcBVv9kMNk3hM428T+AvsW30wLaWgPmWC/pafvFg6MNaFcs5mK+hEMjJJggRgS4AkQBICvHfTGgAioJIBAORqDSBovgTYccjeJfhegG6JAKTgPOV1gX/WhV8i4IoVQPZtxO942Fbyyje/4li3AnDX379wZ8wpW+cCADiTBPD9wDsCJ+hH+h5JiX/MZVkJANuSGKAsZwdYP4Q1YckApFYCSL8+cCnDcoB3lO++lLwfVhEEvjuvIyu4pw8CfKTjcGyemaBkns/1OPFDlXf6pB47CJBzAFrAkzjBqjLzteIyveW3TEosKjddad/Xchx4iGXFKh22dGSc5U9q//82Vv+H1fc3vmbj0/63TRZIACCTBGDiDgGgFYBEQCUBJAt4me30CbHnlbPSvi8WABIA9IfreGqfA9zmAYCSAEiJgEoCtKwA8iwAJi9MOpT4mXQMVgCxMuPEzrZsZ0wyQdk2ASCInwP+JQQybxIC+LkHT3niBCAG2LXA903HJcin7VY4Qb9+AD/+FvCvcVg7PPWpn32yh49OvaZY5eL34LkASQDgR8daAlQpMFZmunHKKTJgLhEgIaCsAH+d8CURAehvWADQX/quxP/kT/3G4d31tve+5jHeYUf8RZG7nFczdi5AJQIAoy0SQFC/igQA8FdnGSwArFvyAEJAgpq2eedQnvRKCgikJQSUCbbH/IJy5HXdPW0sLBbsmyAfKcBP2dINOuA69O1sU0+3a6fdqQcBug1A0JnA3LiUprfiMk2/kvz6q/z13z8+AgBignGlnjb181w+ssNa2zfy1Op/gugp/3csgT95tg3kr1ufBIAkAMBeAqCSAGkNQBov6BPda355s1yHABCwX+ccAOpIx0SzWAFc9vXYPRxIMnYAoCA+gf0mfurZxArAlYxLEmAxmWLyxuTKVZ45WwHo8y4IAAG8RIAgf1L+8bsurRCyHHWd8jYAVn1vc/UfQDlGMpiGnOMq0B8LUxeWAItnzElZHc19pvJs8rwYiAAc71m2ASSAF6gDtAHh6Ygj/RJML0E15SUGBNT3kAHkLRYBY1YB64B88rrqbznDl1YAI6v+tY/qARKAuYZbAY74nrrDJHrOlgAB+RQRIKAXxLdkBbpjYUkB30+8c4hLUoD3F4C6kgIJuvVjIVD9V6wGWtsLjEu5rMf6lPSD+hPoj4F9xtIat/qSVAH8446YhJr7+NppPjBW6xyA3/w3PzoKVgXsmwLYVeWOnQDYRH+u/nNdltadx/+uv+7qP+B/AP7K1/zAXpAA3/2m158nMQEBIAmAWSIAX6cVQJUDQ79YAd/p02HPK78OAXAd4J9lWwSAVgBxSiemh8f8d/91vwDAykaLFCBeAsFVeUmAagXAJEQrAMC+q/9VkkZZJhtcKyZa+N2+YDtVThEAeRAgLzhB/ZT84BLEJ4AX9FNOv/IDf/zOK3HmqW1wmA7Ph5PZJxa/rCd+7Mf9NiviYyD8puIT7LdW/o1LIgCAT3gM6BPPe8F03xGEGfMpb/uIW6Dp5VnMbwIzd8HuAIIXwDyB/nVW3yUQrqy+C8AnSIBtkQGSAMoxEqASFYbVC/LRH3nt8Ax52lc+8L6mQo8jctgSgJXIXGsAQPguiYAEyIJi4vBjKSApgCQ+w6QTZx0DOYD1wXIrgWmCcwE770L9Fchnmnla0rpbMgG/Y1Ly3tUCwrGgYwkArs1x3Gr7OQrmba1zAH7lLU8bJQBWAfhN0hMUA3Yxmd9Xc/5N+/Xu3/metXUq8FenP/7ml//rk/hNMMixvf9TK/4J+M0n2B6A9z6RAMu+0E8JAFYmKgnARK8SAOQ71Um+j9IkAAByCcbn+BPIb+rPdrQAoC6uTZivHTsBcIff65gFQAvYrxs3lwQYTBHjPABX/1sSsoCJCNdtWHl4+/c2SQD7CkHABIc2KuheJyzgt4zhlIL+VZI6spx18nyI+8+fzNFLVv8BeTcF9Oe00yIDEvhXvwB/TCbwlxDohwGO39qs9HLSPSv1rHAL/AXKm8hVRIFkQEqJAeJaFgESAcpV/ar5cvXfskObkhANmeAfvUgCcE9qSRRE9riSDzvl/lXWAABSLAHmWAMM75IFsBXkjskExtXfAtLEkc/6CGMZkMCZdPNpMSBpQT6c5QTe1IGDKKDuF73h4Yv34WIMxDMeyjgurOX02xfDKUmjP7aT/TQffVOv6jYJgMO+rQ6i92dj2wAq+BSE3oTk1PxNgfa+lluHAKi6N3wy5v/bWP0H8AOukfsE/ltbB+gnXwQAOEIA6JzsVRKAMHlPea8vBAA6AMCtSwBsCvhb5ZIEMJ1+4RavgOM31VmMEVOyJABcTRc8j0mBvek1bDwyV+TnWgGMWQJACLCijnPiw4SFyU3tO2HiSWciRJ0C7XWkK/6C9gTuU0Dflf8qLd/qA/ub+X0cxBRkS528TfP/Fsh3lV+SoAJ9wwB9/GOA33jfBTVMPAQA1g9bUuUxVXMXQgjwL9gFOLvqL1C+CUm76zr6JdBXtvo6lTZGAqiPlBIASBYleK8+8OwHPnxMN8TEWO5CZE9ZA2xCBAB2BcpjshIAGRbQI1vOvL6fzA94T/CdBECCcQkCypE/ATl+SYMK1kljbLRfy1gu0yhvWxIA9i8lZdHzKc9tJ+7RrSfx3vzxf/pJv8X+f90bH/7z5//qp79t7RXrbZEDb/mPf/OkCQD0KOhXnszp/7Cxrv6zksUDyJP/XdVvyWryT55h9X+xBeAQSABeuIBGxgwZIAlQLQK0BtAK4AQY+uZDjxfEpgSAoF3Afh1pXUrqwk/fmEwsO48VQLrmmA408q4EAGC5AugE8Zv4KykgETBGAqxjBSAJwOQHUgCTR/roOAT+TtzMR94W8G7FJfAX/JtP4G+84Sor+DdsuawPvwd58Sw90Htq7W5z+v8+mP8n4JcEEOxPSYG9EmCffsPI6uJrAGvr7VgLcO/n5/4gAQDKc8G/q/zmTwkIb4Vb4LwVRz/WcdQhyK8y6zetxrX2/Lvir2wRAVoBnITZ6cUP4Q5ftAEUTREBCXgFtYJYwW1K3h+EfY+0JGCZeAF9lQJ75CYOops6MeG3rewHdRLOfttn0vBrLaC0v449JXlop9ZnnbZd0zX/7/v/b+bJPLYNYOprAAn0BahVJojN/HP8rJbf9Er+D/zhF+906wGfN5wz9jG9PfjgN72da3Uzd8UttvKFn/c5j3z5l3/pAKB8uAKOcXOA/7DaH6D/EMC/VgGCfsaaJECd8BEmbwGZt3jVbr5pTJyvQwBcB/RnWYG/klUT0ukbbqGZBP7pv3ml7abFM/YfYzoocBZEI7flBP5KCQAkwN2DjjwLoJ4H0NoGIAFAmqAbP3UwYcrJCRMWyAXrEXTPkdRNPskA2xriJr63nP0S9FPWfluv9Sg/+NFHhnvvlPaFY/4PEBaA37QE3Av4bVvAb7xhJOBeKdBvSZ71xLfeAcZBBjP+3fy8D7NW3g8e0IcE6AraEyATR9i0lhxLH4u3DtORq9y6hID1tUC/2wHMM2YFIPhXpgUAfu4vDk08ISsAb/bhkMC5RECubguC892hX4At+G1JwTlylduECNhWGfpGXWN9ZGyktcZY49QPupMAgIjxYnS5Uw3cHdsGkIcBJsBPfwJW42uc8WOyAuObPggQ8M85BPRvV9YH1FvHmeGqm6rD5Vzu7k7vhH2ofN3V/1z5zxV//IL/gRTYk/3/gv0xCckBAYDVQ5IAkgNO+pABMvfh0t1oH2Do94EAcMU/CQD99C/2Yif4x38sfwMBoPn8KhKgruhXggDgXeNquJIAEABTJABA2u0AAnikQBoJuBeYC7KJ+8lf/ZHBtcpTB6B7zCXgF5xXmW1Wv6Bfab9SWmYYy+I7zxwCSBsQUXHvHcu91hwHq723tf8fEJ+AP8F+xif4T38L9Av4lTzr05/vAN8DnQB4/NbAKk7Tf0kAQLDAfEwCmEmr0vzGGx6TY/mMR85xgvuWNI56xvy2MRwIWM4AEOwL/pXGK1/96IuHeQZg+HENn4SPd/TddSwC5hIBAN4KgsfCYwA747cF6lfVQ5uCfmX2Qz9jwT82JuIF/SnRXzf/v/nfVutrAD/2E5/wmFYAFZy2whmHXyfIzfQKblvh7/jw/+VGrAA4cNC+2VcOdd42EbCKALDtli6+67te9o6TsMLC7MfVf/cRtVb/54J+CYAxsL1v8YwVoO+YJQEkApgEJhHgNoBTNJfiM4j7SAAA/rUQAITRx8Uj/WzhmFBwJsCxnQtw9nf/3ld921wCIMH8XLBPGYkDwT9SK4AmAbAA7+tYAbDq/4EFgBZQt2SSB+k3r+A+wzXOtClZAf8A7pdnFlBuKswY+ETTKZ0DwLMAACzg3heZQL/6eZa3nGBfwK+soD/DbH3gHIDFs6X/LTTA/SDwRwJmAckCdoCxfmQNZ9o2/HPrNx9yjkvgvyo/eQH51Qn0xyT3H8+SE7QCyN/SWlsD1iECpsiACqIF2FNSYL4KzM9Np62sc6pt0uaC/xYJ4Or/Kc5n82a7aT8EOjr3DAAlZwFgBSCYFygbrmA1000by2t6Svw6VuVvYhsACya2mV8jsF9sR9jGoYTZju3ZRksah/6w0DgJixhX/wFNY3v/1wX/h0QCAPwB9QB/LQGIgwCQBIAA4KUsEUD+UzvwiwckJjHXJQASrAvaN5Wu+iupB/NJ+hjXB/B/TKv/XIomAeBZAMoE/i2/AL+VZpx5ZpMAi5P+JQEA7K1V/ATTTHSmgHmC/vRThrBlx0D/WLzlEvgTZ9i+03/HYL9J0//+P37r4Ee6cscFOva/m/z8H0BegqH6DVewX8M8v4lDjrkE+Kv8kB+dALi8y+/cs/q/AL6C5W0A+uvWkUC/VVemrwL266TXrQCA/rGV/yQEXvnmV5zclqLLu+mqZ+tbAxII4x9zgmvSV4Hwml4BfAv8U6bmy7haZw3bb+L1V5mr/dXPfF8CYKHy4zd1vnpf3XqodRigVgAVxCfQN22duCzTKgf4Zc/8rgmAsZP5KxFAf7AKID/9gpzAQqH1uULiIQx05Bnb/+/YqT+d8Ug+/YeFxq3fILvuACYOc1f/p0z9BfzKfVvln+oPoF+wT74kAbQGEPhLBEAA4E7NRI/7JQkAVtsF33PlpmB/qly2TT7C9JNVqcVvSCuAoyEBYCaf+VVPf2O1AMitAAL4bchKAlQrgNwKsOpAQIDzANz/+F0DcKYsAFtAnlKAj2y5Vt6MW8cvoKeMfWQs9C/HC7lBX8yPJI587KfkvjsF07HbMv8fIwKIr6Df8BTgJ02wn37jxiTj718BuJihQAz72T+tAAC5WgAIrlvA+7bi5vbJfIJ++tvyG1dlbgVI8L+KBOB+xgqAecau54EHUv9gEcDEnK2IHEgseE3pYYFYBABwcWNnBACWBcUVOLfCAu0KxFeFBfmtfFNprfzE2bf0G6fUyiGlY1Wqt1PZtrZv9znbpjaxAgCkVgeYHYszTWk+w0riWwB7W6TAGPin/bnOvle5qjz5zaO/JYk7mdX/sU//AYJ1Y6v/gP2Hf+zqnv8kAPBPAe99SgPoA+4lAFokQFoDkBfwe4ImemcAnCQBEnzP8U8B+euk2bakhP2MUzwhAI6CBFhFAGyDCEjQD4mQFgD4ExQnATAcCLhiK0CCZ8A0kyCBdwXtY8CfePIqq7/W0wrTD+KV+u0fdTM2xg/ZgsNPHHlY9UcPpnEKM/cdL5B9m2xssz+3sf8fML8p+F+18r8O8IcQIH8nAB6/owBkAn9lEgC3BfLntgtoF9hPyUzT3ypbSYC0AshV/lV+rRNP6WDRx++qUR/v8DNIVgj+uUSAJABSAKwENONPKZBuSYH3GEDfRTz9yHZb/TIux+IYq0QPEgCn+lWr0TvsBhPmWAEASqsDzNa4bYQB6dsC/FnPNsC/AH4diU4yf4b1p+Tk/1NYwBlucc3/YZlhSt0HL/hHuvKPFOCvkoL7QyEBGLcEgH1XB+pEa4AkAgCbJ3OzLB+KAmvGLtgWfM+R1wH5U2VbbdvXRdfdBnASBAAgde42APLiBPyGU5omCSD4RwKGdYB/3WAJsCAC0oQ+wbwge0wKxrMMfvIrzZMSP+nI6s981GN4rA/E03/Ghz4F+hIBw6RqSQyYxj0HILrBOcSNNwXBAQAWkN+klAhwdZ+29acEpBNGtpxAfmyFfyqe9yXj5zOIN678PWywRQAAbln9FigjD9kJ6h1PAn/TpiSEiC4tAaZIgCd/6jcOW9qe9pUPvG8PL/ttd+l+iPB1LQKmiACBM0A6/QLrMZnAfFvgn7ast/rH+mGfU+JvOcF/X/2/3dt4ygrgX/30t+0E5AN4dS0iYZuHAWJRwBcGEoTfhF9Q7/hWSfJz9sLJnPzPQFvm/wLfXPknbgDzCxJAIsDVf6WkAAC6+gXV+yoZH0C/9k9dJAmQRAAAGCuK232E3Gzr7K0H5GxKAADUp4D8ddIqCUAfgwRAUSdBAAj+lQnmV4H9zJvA33KSAMgWESABcGkJECSAe+kF9Qm8IQwIC+4zLf1T6QJ6vgRAGcL4L+OXq/2mWe+Qb5lm3pqH8TBmgf6Y5J5jVSp+lUdxz8V47gP43iQBAJAX6FeyIUF/9U8Bf9I2JQEgANj/v9xilKo5Sf8TnvjER1z5VwJs3QJwqMA/Qb5jME4iwHilJIDphtHFXOCfpIDWhosb6+ieI1v6sVxuDZhrEeD2AMmAFkAWZAumDVcpSFeSrh8519VyrXBtO8P2szWWGper/1hzbek69Go21MDYFwE4EFCgvmspQKadbZ3GD5HAPv6bAPzZBmMwvMpvOpJttSezoJvm/3NW/wX+gvspKQmQsoLrfQ87PvpZiQAJAV/Op/QQhTG+DgFwHYA/p+wYCVAOBdzwUb03xc6mzgAA+I+B/wT46/gT+Ke/RQKwYi4RUC0BIAHcR59gnm0ASQyYVqWgfUoK4qtMUN9Kyzpb6fSFsaG3MQLgm1/wnKP/hvdNHgC4CvBLDCT4B9wTbhEA1wH+PO8hDZ761M8+/1NnZ+exvWhvHgy30RHeCQJ/5QB2F58BFAALkA9BJsjP/hqfY9KfsoJ/09gKILifOgMAHZoPCeHUtwGsvLOx8lu5NYCVb84JaH01AGBcwTIgW3CdgHuVXxJgVb5MX7eM/UpZ+98K99X/lffSjWbACgCrOr8EoORAwF95y9NujAQABOM4PT/N9zfxc2if4FpyIaUA/brSNqqsbdX0DOM/mYP/vLM1/89P/wl0UwL8Bf+cTCswriv/xAv4zZNy3wE/oJ7VffvJ+N7y3jdfWD4sSADjn/+af3i5VcKzA07JCgCWPQkAVjwr6F4VngPkr5vHPqQVAP1e7ndjNUXnT+KQ5PAVgBe94eEB6Av4p+QY2J/6LCBAn3IpE/ynXyLA7QBKiYC0CIAAwEkGALxJTxJA4J+gfB2/AN4yhpXEj/kt05KSAOi6RQLwFQrc4mY6O6Qbap2+svr/Pzz5aTe2BQAwL9BPQiBBf/W3wL8r/pUEMDxl9m8aeRk/BMA6OjvmvC0CABALyAX8Jog+RP/YGKbiTUPqsAKYAv4J+tPPFxaCwD7mW2kbY+O9fgY5xwFr3JsC3irzwMB1rAIStK/yC+pXyVX1ZHoCfuJbIH8sjjGrh4WeIE363x5ogJXn5z7j7D2Cf2Xrs4AA1l2763yGjxP4E2DPBePrkAHWn2VqnOEpSRqm/xAwJ7OQm+b/PPgAsgDgFvBPAiAB/Vz/9/3UWy5JA0H0PspKANBvCABk7S8kgE4rgFNZDQJAa1YPuN43AgDw9fw3fN3lNgOIAPtpv4/gkLYzfsOVAPjOR//RPYTAGPBfN16wLyFgGAn4NzxGBKRVQJICAzGwJASYzEgKALSvSwIMIH+5HWAdwC8xoOSwP/3UUw//SyKAgwCPnQDA/B1QkmB82/4x0C8RkOkJ/lvAX4CfMv2C+1WSMp/7mX9nAP/9CwCPz5rZ8uLKf0rALqBXAHyI4D/7nKDeeMdWJek1jrBWAOsSAby7TmWO8fiddS3fQAQwX+FdOfXlAAGxlgGrvh4guE5QflP+64D/NP3vFiXXurd2Ufju2IGAN7kVAECM2+QwQPf7Wwcywb/xNU4Q38rfyjuWb27eLI//pEz/uXNb5v8J/vED/JWAfa0AxoA/IDnTAM7phjpiJb2C6n0Ia9pPXwD/OqwBHF/tJ2UgAU7JCkAgLbB2tX2OZGWffNdd4R8rD/jnRYfU+cIGmNl3Jq0H/K3Pu/S9EgCrLABIXxf4C/iVAv1VUiJAqUVAlZIBbBVglSQJAc8MaK3ErxuXAD79lRjIems+gL/p9BedJPjHz7331c995mMcULWLWcJt18l9BwEAEN426J+qLwF/kgAV/BMGqM9xqwB/TccU+1M++S8PBMDJ7BWcccONWQCwig3g9SwAALDAeaX8X39xdd45eXZ0+OCqsZieEj9uXfDvNoBjP1x0xq22SRaIgLseGLjKKmAVGdDaJiAo3wUJYN3OYWhD/1xpnx1bOaNmE532MjvQgFYrrv4r2Qrwzlc9/THA6k06zPjnmv9zbsCqvs0F6GOEQJY3T8bR/qpw5sH/Xd/1snec3Ls8zf/HVv8F/5tYAAj8BdCEJQcqgN6ncFoB2Hek/ZcEeMkP/9C5DksArQCOYGV51mONiQhAWgJgXSuAMfB+nXhY+wr4Wy9IyAdJACSmldc8zOs2thLc4aH1nO/99t+YAv01bR3wD8AX9Fe5CvyPpWspICmglBRgOwJuVyRABfsV4Gc6aQn4zfvBj7Y/ASgRcOwEAL+VXR8A2AL7gn5lAn9Bv3Id8E/eCvRrmOc7+bB6gPzoq/9XXxPcE7nyn/60AlgJ+ncE1nfZbgvgC/TH0jwQMM38V/m5B3lfXdV8D62pgeGcAEx9ITIhA9axDHCbAHMNnvO61jzDOAH7OuQAZbNcrSvTTWtJgT9p3fR/zTvllrJjmSHwTwkJcBNfBUgQz+n9qwgAtgqQL8slyBaQr0o331xpfavyt/piGfb9Y3WxuNRnt3S5b75ZBuzp/zzQAL119d+w4N/Vf6VgXikwNgxgTgBdQfQ+gf7sC+OWEKHPP/mrP3I5DsaU45QAQGoFwArRzV/Rm29xX7cBtAiAfJHmSxgiAOIiyYADMou7n2tQCYDWFoBKAmT4uoTAGNCfigfgk640r2QA8tIqIM4KuFx5X8Tp35UU7Gf9LTIAKwCBv/KYCQBW0W76CwDVKiDJgRYJMAf8Z54K9lth8mPx4N5/fns3/9Td3xYhIz/+E59+nsBff1oBAHy1BtglKL+JugX3q9qSDCCffuQqKwD0l6QAvwPeVQdstbZvN/BABvBMY+WVefEcMoBVdLcKSAhIBChbYPwm4xL440/w359d+3YbXu0P1yeBf/rZCnDTJAD7+VskAMCfbQIC8TlS4K3MMhnX8htXpXW04qfifvHn3jR88u/kfg9f+Hmf84igx9P/BfzIBP0J+NMv0E9AbFyCfwC0ThIgAfc++yUAkgRgjAB+JGALJxEAcQCgPJWtANf5HOB1VvpbZVur/xX4Y16O46A5/UhezEkEYM4aj2RX95WRdI+XPDf2x8RlzpcAKuAnDPCvcg4ZAFgnn6B9rqQMgH+qDeqSBMjzAvLAwOucCZCfBkxgr1/QrzQ+gT9+0pG45jaAxf10rFsAAHqsfu/aAiBBfwL+sdV/V/6VCfBbfkA+8YJ98xhOSRrg/zM/46/2vf/jT7e7WEcI+qvUCkACYOskwB5sBZAQSJBvXIL/9K8iAZIAwM8CQ98GMH4TXjOF9/dia919T+I5N/fcgCQEmIekkxAYk8w9BOvKVUSB+cbqzHgICs3+kdfUTy9+Qxp47mv+xPcm8NePFcBtHAoICcAn/XCY+rdW/AXi60gBumUyrF9JHv3KjEu/6cpMw4/D+uckz1TR/J+XiavdSQCkf4wMEOwjkwQA/EsAAJx/9rcunCCaNMvsM/hnRZ99/0leQAjg6D+gXwIgSQDM9NArL5AbelbcWjO8ICGSAM+6OWcAZJ4WmN80jtX/fHm62i/oB/j/+Ae/79IRlgwgb24NiBOXWSUQ/Kds6d30Vtou4ppfAuB+TNC/yg8oX5cMWIcIEPTbhuGWtF7IghYJkAQAxIAg/ToyAX/6K/CnDdonHkn7WCrQZ1f/lRAAiwt+touLfpt1skq2608AVsAv6FeSbh7AuaBfKZhfJSUByCfgT7/pgn9M//vJ/+N339g5AJIBG5MACe7TP7ZdIPOkfyz/FuMT8GsZICGQwN84DwSsQH8szNwi3k3jF6OnbEMDvM+Hrwnw3GOby9QXBRJos+KeVgIAca0FkiDYhd+2sj+dNNrG7XBzdUBCCfqrvA0SgFPyIQFw2wL/AvEKzhO0myfjWv5WnGVr/YQB/6eA0e65Y7mxNP/nAdUy/xf0D0B9cRBgSsF7Svy6BP+XBMDCTBYiQBLAsvtMAEiMSADYd60YqhWAJADnAfCSxt2j/COM0JJkXQJgU5DfKuep/xIAAn+k4B/gP5BR3Iu6xT0pIQAR8MLXvuCKJUBMtAT2VXpFiefP9IvQ7v8PBwHWbQBjgB9wOpZmPKBcoK6sQF2QnhJ/OsqYXstzXYhT1nTDWAO0SIBtHgzYIg4E/kkGAPhxtD18pWBxDwH+6R/jRFeCf0io5e//7u5vgZttgTNOIABu6hOAAn0tAgwjq1sF+MfSBfqmZxjw775/wD9A4GY1fjitYUo5ZgXA9gDumY1JgDGQfsMAX1BfZQJ//YL8BP76leRZxwqA+/FiG8B9TzqcO+NoejocJKh1AITA3C0DCcbTr2m+hEFLAuiNT79xKbNu/MvD/s6O5gqc0EA+91n3/60K/g3fBgmQgPom/AnqWyB+Kt00Zfb3ZME/vx1WbSUAYB9bBMA9FgCc3L8gAnKlX78SUN9c/RdsIReASwC9z+CfvqEXSAD6K3lRSQDGm1YAkgCUAwCw1eLYn1e8AK9jBdAC9JvEYfZWCYAr4H9x/wnelJUIgAQAlEIouCUgTsudsgRI4J/+XV/+O5gwVQJgzAKgEgCEAdvKdUgAQbqgn3D1m0cpoSDwt13D5lPO2Q4AKG+B+DlxCfD1KykvEeCKf943gn/6KNHBeAb3OAHAPXNUfxIAnIQvKN+FFOhbt+EK+g0D3vEL4qckz+ZWegJ/0iv45+yDo7qYOxgMK6RjZwFAAEgC+GUAtwRUQL0yvCfAf6yfkgACffNJCqT8i5/041f2+o+t/hvP+/aAzqrZwV22F1VC7p6xDQ/iC1IAcpDr4sGC/BaYP1RQfhNh2j1J8+a9uDW224nnvf5P/KDAP+UxkgAtwL4qLtPTL+jPuJMG/9yW+fk/V7kr4Cc8rNKX1X/BvtJVf2Wu/udqa06cAdHkG+rf0icBWXXHbZNUoD7088o3v+JixXhpwZAkgGQGgCvJAKwD3Apw7Af2YFGyiRXAJiB/rEwe/AeY1AHoh5X/Bvj3nkQORMDSGoAyOFdxGRtM/+KnA5jTCfKr5CcmUYB/53/o/8EHv+ntgveWBJQSL0DNPKZlHH5AeJUC85YUBCcJ0MpHHG2OpdX4VSQA129dEiBBPkA/w4L+JBBy9Z97pYJ/x4y+Bh0vCADum8XF5/44qj8muFgAfOyTPn8nBIBAvwJ/wqYpAemCfmUL2E/FtcgA6qpm/4z5qC7k7gZzl3t/FQkAmK3WAILkjaSEgFKLgQyn3/QtygT9jsE4AT/x+lNChAjwV0nuWcDl7i5hr3lDDfC8hxjAMQ+4JAl4T2s5sEuCAOB/7HPOhV5P7e8MsJ/gX/8xkgAC9yoTyNe0Gm7lPXnwz68m9/+Prf6z2g8JcCmXQD1Bu6BfCQBuEQAJtAawtbQCyLo2Be4Cf6V92bS+Wg4CAAfoTyuAJAEcdxIAEAL0iYkQL+tjf1oxGWGs624DYM/9GKhfJ94tAIB2wb+r/xJR9T6sYa0BuLaQBpAA1Mu4cMtrKAEgyOeFn36yGV4W2bk4A5S96A0PD4A9gXy1BBDsV5llWn5AufEVoNewRECNtw6kK/7KKUKA+pIEmNoSIFBP8D7lT+Dvp/0yP/Xl6n8F/67+O2Z0xFie9w9fnvfMzm+Am2zAMwB2fQgg9WNOXokAwHnLJRkwCfiXVgIt4G8dFfz3lf/17jCeRzwzWyQAxJGWAMitEwEC+lVgf1W69WwgE/QL+JWkafWQBAB+CBF1MkUCcO/G9rT1Lk7Pva8auKslgdYEPGu1KsDyit+VcUrystKPJcK+Dqz36/oaeMoX/8kvFfRXKQlw018HqKD7psIV3Gc4/faH0/47+L+4B+9KALBvqEUACPoB02kJADgWtAu0U7bAPxPmFtACZJHf+irwrmHANHEp8dN/JPW4Gj+3ztpGK+w2AA4DHIDkhBWARACgSwd5wETo2L8KwMtHoDyHBADcbwv8u/rfMv+fs/rfuj+51hAAnAnguIoVgMAfsC/gd7UXqf/6T/7VNdxhElC3AQjYUwJO0wlYW1LATpp+pXGE0wmEiUt/5q+g33DWk37qwY2RAKzG168EjFkECPiVCfb1A/hJF/hTF/cI7Yyt/NNfxohDv9w3xzpBZ3WJ1fBdEwBsMahtAPy1BEgSQOA+BfznpGnyT9se+PeEJz7x6LdxrX7ErJ+DlUienYJ9DwJEGqcU7H7CZ770EhzP/krAXCA/lW8qbQMCwNX/CvoF/xX4G55rBcB9im476Fv/vuwlugYOVQPbJAE41E+AjKzhTNtXfwvs177++Jtf/q8hzvp2mMVdD2vo/n8OE2kRAG4HkAhACo4TXOPXCf4B4a6Wt8C/YIu0VSQAwH7MCfwxtbe9XRAAtI8+qJs+j5EAgn+k4F/JVgBe1jC4h/rgmdNvADLjlABA5mn/Lf86q/xTeSUBHnrn8y4tAADwmxAA3KNca8oCThkH41oCOs37lGMEAPE39Xc/KwdJAHDvCUiR/E4MJwGQ/iHfYrzmSynArZI8NS6BP2k68xpO4K+f/pheZZIAkAFYAqQ1gEQA12/KEiBN/Mf8lvdemAv+GSNjwHLkWAmAxU19xop4Beeu1O9SJuiv/jkAfywPdQn+GReH/eGO/Zm94wfUsBWAZ6dAf5XUGmCj8wEE8UqB+6qw+bYsBfWCflf9lZmufy4BgJ7Qazf13vEd3KvvGtgzDXzd//NPPFQtAAxrCfDOVz39sQqE1w0fAyHwHd/84K/xjGR+vGeX8Xa6I0jj5TF2AOAl4Bf4L6XgP2UlAATjA1hurP5LADixJj/g2jor4BfoV0k+ylkPwHzbBABtaHVA3cPYNiABAF/oG7M99oHdzpW/mVYZJ04SoAX6jduWFYDgHwmQhATQ/L8SAB/4yMUJ7tw36c/7Mu8pSATqkgRYPkjOFtqcIgAkBW5G6YtWWAl65lc9/Y2AzwTu+OeA/0oECGQB4bVO4kiv0naJr2nGVSnwJ552anqGtQRYRQTMtQZwxR8p4He1//IeWPzeXfWHbEiTf4kOx61kHBAAx7xHF2DMCvkuwX7WzVYAADpAnfgW+DduDOS34hP4a3Eg+D/2Z/VNPJxYdfGdsAr8Z7pEgGBZmSvrK/0V+M8B+JuUKfUmmLffKU1HpoUAYfJpDbFKolfMWm/iOvY2uga6BvZDAzxTE/C3zgZ448N//hx3iCB+XaKilZ9xMx/GMnZx1c7248rtQS88ABAwOkYAXNn7X0iAtARI8K8FQBIAFVSNhQHvlKMOAbeAvxICAn8IButzZT6JBPu5DUmb3/q6lw3ukgRYEgGEcbQtAdGyAmA8vLCxvtiD22BnXYBtSwLgpqwANP8H/EsAPPKBl5+/+3e+5/x9v/uW4V5Ret9UWQkBtwFAAHgWwHJFUPCPFOxr9o+8ydV/r+VdrHta5wAITJUJ9sf85CXNMkjAeMpMa8UneDc949KfRED66UPm0y8Z4LaAlkVAPiO41gny05/3gcQlMlf9x8A//Uk9qE9IrmP/7jIEAKAtgfq2/An0qZN2AOYt8L8J8IdMcMVf4K/JP9IfVZfX1wDPpU1IAK75VogAAXqC+zG/eTeQAvsE+1gy6IxvAX+JgHUJgGN/xlz/7us1dA0cnwZYiHr2S+97GabtzEn//kv/wgclBZQQA6/+hj/9x6dyLoBEACb/fb//yD3v/n+AGfvTAaaa/CubFgALIsBVekC14B+Z4D8Bck6s5/iZdAumBdHUjzmzbdRJPfVmuezjtsD/YAmwGD8kwHAWAOB/BQFg/90GgHQrwLGfB+DezzlWAAClKdP+VWm5+o9/jAAA/LMyXEmACvq5n4yDAMCCAAKAfjKJXU64EvgD9hP8SwAgb/Kv+TlAwalgXoA6R1LWctUv8FXaDtK4liQuXYL9jE8/fciwfkmAtAhobgtY/l7rM2j4DftbXkgBf674t4D/1Mq/euXe5+V8kzfATbfFOQA3aQUAIMQSQMA/JlnpJ62u+BM3BfwhGPphf7u5iySGeYZyHdd1AxFQzgcQUK+0BNgAzK9Tp/1IOYD+xYF+HOqX2xkkCZS2Y3gdAoBFHN61u7livdauga6BQ9AAlmo8X5/7jLP3JPiHAHBLANYA1yECDsGSgD5+9TO+4l3oolvvjdy5EgAcANgiAHLfv5YAA6gOAoCwDqArOB/A/wI0ObGuE+51w9aDnCpLusTBtgkASQRIAMA/nwRMkkPrBdtPK4BKAmCKzUubSdCRkwBnjFECQKnpf0uuAvqr0iUCpgiAJAHS37q3BjPyIAAYgwTA8uClJAFaBMDIL3B30Tz0xrYBCEw3kRX8J9hPwD8WL2A33fCUnEMMZHnJAC0CJAKQCezH/JlffzX3t40kAOiD41K3X/P6b/G8iN1d7D2oGfM6QDNgblsr/67wt6Rt+GWASgAI+Cv4nwP8ITL6gWq7valYteIZiuMarksCkF8ioH4+MME3oPpTHnh0MK8XYG9bZnv6r4B+wX8QAIJ8+oJfmf51CADIrCM+Z2S3N2OvvWvguDRwP+9jVr6xBhD8KyEAsAbgbIBDAPOu5s+Vr37ZS3+b7e1Lk//jurLbGg17R/IAwBYBIOhHJvAXWAv8lYJ/gG8SAC1Qtas4CQD6Yj8F7tuQgH8c9UMAXLECYAVxARQZe4sESAsA/NTjJOiYVwgxS2Kcgn9kC/gTtwrcr0oX/FcLAFbv2QLgNgCllgCQALpWHOU9A8AtADxklkDhbPG7nCIBtvWzXaee0c8BCk43lYBcygp2kQl+Mz79mUc/suWwtGjFz4kTlAvSKxHA80lgrzQu5RTop27HRp/0I9Ur4J+tVacyMb9pKwBAj3v0OawvHQCR9CQA8AM2PdVfM3/roP/9dOB1HjHXznu/FmKbkgASAZABkEJ8OUAnGG9JSAHiAd7ryFZdxI0Bfrct5Op/gnzJiEoIEKbey3EtyAP8Yw798Y5dXBHeQ/2va6Br4MQ1AMnKliusAQT/KSUCfuUtT7vyBYC5QHvf8mHu/4Wf9zmPsOq/uPRnJ375p4ePkuYQAIJ/5bAlgLMAtAJYSgCxBIAA2FX764L9Vav+Wf+uCQBJBMiF1//0qwcSANDgWAe5Bgnwtc9/4fDiPvbzADgE7aZJAC0A2P/vGQCSAIJ8wvgv4xfXTnIAQgC/pv+sROMkAJakDRMunWcA8OPTEmD6h7i71OY2ACxPAKicD5BS0DolE9y2/AmC1/EnqH/45183AH8AtsAdmXnm+iUAWpLfLPFVtvLWOMZGnP3Isab+IACw8jmhvbl3AdO7+iIAAD6tAQD4kg6AeQmACuwJ1zj6SRzll5/268Bpd8+iyZr5fUiEb2IJkGUEyFqIrEMKjIF74weQzz7+XNEPv21XaX7qEfy3gL9WAEoJgFpfK/zkT/3GYR6xPJh2Ut89sWuga+BkNDB8FtqzAZIAwA8JkETAJhYBm5TZJnnwzre+4hzgD9nRLfdm3teYh/jS5ROAWAAA8tMJ9lvg37Rc/U8CgJVwQXEC9F36E3zTl11ZAEACsHoPeEhLB8drP7QGIB+OPlUrAMInshXgPld7VlkCrFrln0pvWQAA/scsAAT5yu98w4PnOMgDwP4L3vbi86yTtt0CsFwtBDgI/FtnAMz8RW4/Gw/Dug1A0C8BIGCtYeNXScAveVImIJ6Kz3yCaQgAAbcEAJYX+pGWs0xLCtCtSyngN1zl8NxYgHvjDStpmzT7kDJ1BfjHLVflzrZ/dfezRl7CuyQBEthxjspnfsZfHUB8Qxv30xf28QPyIQeQWO30PYENbd1yFAsSzkeuYw2QZIDWAXnPpB9gPhAEgHgtBwLQC9yRLdCdcbVd2yYP5Sv4nyICtAaQALAf1pXt6pcA6Gavt3wj9+a7BvZQA54NwPsvtwVIAEgCuDXgF3/uTXttFQDpwBYGtk+zENff6WvcdCjLLwDw0oUAaB0AKBkg2K+SdOIA2kyQBboJincJ+Ft1A75pf5iwL/rliv22pdsAAPmO+woBwHaAZV/ojwQA/aokQG4FWJqvrHE1DysrJEASAGPbAaZA/qo0AXtaACQB4Aq/q/5K8rzwtS8YDnj8/re/YpCs9uOoEyn4XwI7lH+2cBIArvorSb/Nv4H9fc73fvtvCFQBqYB9Ab8ywescP/XVfMa15Fgc8TqAvAQAQL8Cf0kA8tC2IL0SAMQTZ/qUFNgrMy+/U8O2QVg/0r5XXRDmuXqKB3PxQnaFPQHXpn5X/imf/uf9w5cP5vwA+9v8kfW2t6aBu5LE2yQBWuA8AbogusqxcnPirasF/l39d6W/FXYLwBj50IrnnQTptbWr0SvqGugaOCoNYCEExpAISAJAPyQAjjCHBd72Cn9aC9AfCAzwa1/x3/DWZOVSAoDV57FPAAr4h5X0pdk/+96JV6YFgED4tggAV95vigBg7LTFVgDOAsAPKUE/lMThpggAgMapbAXglq0kQOs8gFUgfywdoE4aktV7SIC6BcDV/pbpvyb/b3vvax7juqbDIoB6mWgFsEvzf4E/ch/+7ofsSysAAD/AKUmAFnhdJ05wn2WMS1n9hNMBqCUAANoCfvfpI43j2pKfsCB9rhTsKy0n4FcSb//Sb5wyx51+7pNjJ/TGbnIPBYQIAMxtCv7Hyj39md82WOJgxn+qOh7T/aHHMznlt4O7CSJgDqBfNw8EQAv858q//jHJlgProa7BSmHCGgF9HfNZQod+X/f+dw3siwbSIoAzAgT/KSUCJAM4K+A6Xw9IID/XD/mQoP/Cgm/Y49+37G16MzFhkgDgCwBjBIAr/LkFIMkAV/8Bv0ymAbkC3lwNb63U7yrOVfdhcr9DCwAtChgzVgDowAMBHZs6qAQAfQNkVOdWALZnbHptD6UcZwKkJcC2SQCAOg4CgAPl6jaAtAKQENASQIlFAM7D/6iLfjLRWq607JXJ/8i1v2IF0CIAtAJQJojdhh+gbD0JmvWnTBJAsI9MEgA/RAEu8wDSJQSUgvsxKdhX0n4F+zVMXvvsuFKSxjM1SKKRS3P00Xfcew+AGgPzc+Nz9Z/fIORCX/0/znuIlSoOz+Q649YF4DeR/2Of9PnnuNrWJWhfAHjM+HOFf8zfIgEoOwD/BugfswA4hbnDcd7xfVRdAzevAbaJQtZzRgBEwBwyAEIA83sJgW1aCAD2cdRPO+BUHMTmcsstc+7+dx0NoMz8BOAYAQDAlwQQ7LPyLwng6j/At7X670q4gHjXsgW4h74u9uwL2LcpcxsAIB89sGLsOO1PngUA+B8jANwKcOwHAnrvTpEAYyv8c+IF/0itAMZIgCkiAPAPcQABAPinPiekyzG44k9wX1b9Va/yfs8CEPxXC4BtAn/Ar2B4lV8QnVJgL2AX4FcCgDDXBasM84xJ61IO5OCCLDBcQT/x9Il4XPYv/Y5TmWncJ4sL0F9WCyWwD3+b5wJAlFIfru959md+nJK5is9c5L5YBGwL/Av8czuAcVNfFsgtBvrRT7cAOM7fQR9V18CONTAcGs3icJIBrv6PWQaQriMPwD3JAQF9lZAH5qWcdSAB/Kz08yzj/d4P9tvylUe5cwiABP8QAJIASgAvAJsJ9ZXV/8WK+CX4XZrDC4p3LYd2F+0DyIeJ/qJ/uyQBqJu2PAsAnRB2nOqBOHREn3B19d+wWwFO5eRwxjlmCTAH7I/lSRIA8J6WAIB6V/lb0pV/tw4I/l39h7iIn+S+Av/o4n3Dw/3BB7/p7ZB9uCQBJACUAtq5EuA7J2/NZ1jgLNhGtrYCAPCTCCDMPntIngr+AfHEISUnW3J4RizyCPaV9Mn+VL/9RTLuDFOGPp3K7zdvsik/kwpB+3W2BHz5l7zw/KlP/ewB/FPnVJs97Xg0kIcW3yYRAPD/0x/31YPLlX9BuCv2q1b+BfkJ/NNPeloAuOJv/VoZ2K6HAPYzAI7nnu8j6Rq4JQ2csdouGQBe1DpAoJ6EQAXw5pkjrZdT/Hmf8/wC9PdD/XZ45VH2KgIAkF8JAMAuAFfgb5hJ9BgBIBDelRTwI2ljDHDTV9w2LQCsi7FDANS+tPpD3ikCgM+0ueJxKj8CmL4WCTAG7ufEJwEAQNQSoBIBgn2loB+J1YDgv6z+H+L+ozMert/wjX/731UCABC7KfifA/xrHoFzBc/EC8CRYySARICk2re+7mWD5c3wG1ySf6Th3v8rbxkcZmqrHHmtk99p9iX9rX6aDrHC73eHj++DrRom3y0ByHWJAD77x2n+EAlMSg5WEb3jG2uAZ1huDZAM2LVlgCv+gH9AN1ICgDDbWAZwvjT7X0UAtLYCSAoopywAkhCgfQmA/hnAjW+tXrBroGvgXg3cAYdICPD8Bajz/k1iQCC/SoI9KUcdzPshGQD8y+fW2b3N95itawATC8zMeXnOOQPA1f8K/CUDkgC4BMILQC4o3xX4H6s3SQAn9PQRJxGwTTKAeh33APqXICQJANIBFRIAlHHVv0o+yci14Tpt/eLvb4V33RLA2CEE5gD9qTxJAuBPEkAiwK0Bgn0l6Qn+Xf0/YOBxeSBgJQAA/xIAygradxFOIkAywHbcCjA8YxZ7/fndtAC9AB/JwY0ZbgF+Dp/5/33k589///d+7fwj/+F3Pvqf/+gPHtOd/39+eUjzgBrKSwq4XQCZxATbELQ2wM+9y0tyf39mt98zXv5aAyAB9YApQBwOoA+gQuJIkzggP+VvfxS9B7epASaMPIv9agC/O533kQD9utIV/wr+XX2vwH8u+Bfo58q//ksLgAWh4OF/rv5X8E8/+J0w/tu8Jr3troGugZPQwF3IfJ7BEAMA+ItV+yd8EYC+5UgnL2WWC5tnC00dgvXs8V3QuQRAywpA0A+A1s++dybnOIGwIFwQPAbWdxVv+/THvlUAXgkBxkScLsmC6jcPknodN+NBH5yVIAEy9GUNAgBCwAMBT21PH+DJiRwS4D0F8lelrSIBAPmVGNBiAEl5wT8rTwf+NBgOBHzaVz7wvkoCALxb4L+CdAH6JtK6lFkHcThW0CF/IMH47CK/I0B4C8zXOPP9/D977TmfcTRMvj/6vXcMoB/gD9AX9Kc8/y//6RxHHOQAeSELIARsi2dJbkPQTzyfkOwH/83/hfBb5xC/JAPG/BAAT3jiEx9Z1N7PVZiv4pPJycSSd+UUIQAxwDulJYmTKNDvqr9AXyLAsIAcwK9LUN9a5W/FZRn8OuocswKwbckAxtWfPSdzu/eBdg3suwY6uN/XKzSXAMgtAPnZP4E/EgA8RQAIggX6GU6/6duWA/heWiMMID0IASbtkgJVShooLWt9U/2kDPqiTvINZZYEAPqqK/6t8IOvfGiYrJzKgYD1t8IeaomAXVgDaBEgyK9EAWEAKG3TjyMA/6iYh/IZE+UHnv3Ah+eQAC2wnsB9lX+qfKbh/5rXf8sA/AH/mPW/52feegm8BeBzJMD/nW99xfmrH33x+S/+3JuGOqZW/gH8An/9kgHGQwZAIuA+9G/fN/ym3/bhR89x/L5pi/ukH1hTf8nzwpABAHysgDg0MF1f8Z+nw57rcQ2w4sQ7BFDMs7s64jPNdw3g/+M/8emDST3nTQj2qwR4C/qRLWC/Ki6BP3kzjP+SABixAhD80zf6388defz6d1/XQNdA10DXQEMDcwkAQCwkgOAfi4AE//qnCAABcMoKnplA17hth21jAOMSAsgFMB/ikOnPPOGf2y90g97Ib/0QAnMJACwOTtUKwFsWkyEmbk7OrkMEAOixFqhAXwKAVX4Av8DfNpFHtrJyh9UyJotu/2kdCLgK2K+bXsF+Lc/BefxeNgX9LWIAIkACAAkJ0DL9F/Qj0y/4lwwY0hbWA9aB/MBHFr/vxXOjT8D91W5FnmEmuCRT+or/VlTaK1mhgeGegxyFBICUf/Dr/0mTANgG+E9yoAJ/yQAJhsEKABJgQTqkA/gTpr88f07lzKAV17Endw10DXQNdA2MaWAOAcAKHOBfB/iXCBD4K6cIAIF3Bc7GKwXKNd+uw7a/Sq7bD8A++sIagLoBCesQABwGqBXAkaw+j92OK+OZlFUiAPAKaMSt2gZQ01skgGb/rEJr8s+k6khXH++y4gqxgf4YsySAwDzPBTBulUyQ38rbSufTlzxbfuI97xjIMeQvvf8dw6q9MsF9muNn/Co/K/QQPBABAHfBfgL+9Av6kwTI9PR/9XOf+Rj3ysobuWfoGuga2HcN3OG3DAHw3K/74eGwP1f/PQOAPfmC8wTy1/EnCZAEwBj4B/jbL/p7ZCT1vt8jvX9dA10DXQOHqYEWAYDZLYATwC/4VwJkBf9Igb8SAgBwe8VcfrlqnsBekJ1g2jhl5s98h+YH8EsADGNakwBgAsJXBrQCwKTxMO+27fW6EgFMfJIIkBBYdW4ABACgtzrKU2dMqM621/u9qmn4LCCTxpYVQAu8rxsn2FdmeeMgubjPAf06QH8L+K8C+HPS2Rbw0CtfNJwNgCl/HgI4BvSTCMg8Gc9vFEJlr65w70zXQNfARhrguchcaI4FwHVAv0A/65AIcAvA5TaAxuq/pv+8rxYD7ZYyG13tXqhroGuga+CENLCKAGiRAJABEgHKSQJgAXiHle8FEbAK1JtPeWhgf1V/HRcEybpWACf6RYDJX6Or14J1JUBMB7CtToKgSvJZB/JIV/3v0Sl65IwJ9LGOFYAAHlA/5k/Arz/zAv7ZDlOB/zoEQFoDzPEnSQAZwEGB1RogV/bx6yr4z3yAhXuU2yO6BroGDlIDnGLNewRyktV+V/4B3BwUOJjhb9kKQOAvKaCFQcsCIFf+eV+xVe4gFd073TXQNdA10DVwsxrgW4z5GUAAQLUAAPCnA/RXEkACAIkVAN9Sb1kBAICTBDBc4wTKmb4KXO9Teu03YB+duQ1gHQKAMwCwAMAJTm/2Ltn/1tgjzKegcnuAuqpSYgD5yV/z9f8FWfMsD1E6qdNLeRagC54BbAOoWwEA762vAwjqlYJ7JfH6leYF/Av8kYJ+JUCdg/YSsG/bz/kAbAt4+UueP7SDNYAgv4L+Gnb1n3j6yW91/38tvYddA10DczWAFcDXPv+F92wDAHzziUpIAEE6Mlfxr+OHCJha/af9J3/qN17OCSAr5o6p5+sa6BroGugaOHENjBEACfi1Asg4/VoAKCUAALySAMOBemEFILhvAXbTUrby7XNcBf/0FX1ArPB9cPQBAcCqp44VhlUOAuBZ3/Cc4YV/KivTm/w8WQWZSwZU4E+5Tdo8ljJf/wWf/9EkAQT8AHVBu3GGpwB+BfyZl3qmwP82zf/TKiAJhCQXOBOAzwaSzif/BPtVSg6kxA9x8IEP/PKHj+Ve6OPoGugauO8+3ie8J9gGUK0AXIG/DgmQK/6u+lfwP5j/L03/bfNzP/PvXIL/vi2w36ldA10DXQNdA2tpAMDTsgAQ4K+SAn+lBABA923vfc1jUyQAwDjBsv5L8B+kwT4Dfvtm/1thQD8EAHrK1f/6JYAahhRICwC3AfSDfubf5kyOIExan4IijvMEFrWd1Gr/lPYgAfjKgpYAAv5VJICEAKBf4F8l9zP5PPCP+7218p8WAAnY5/jHwL5la/qv//4/vmJlgEUAhwQ++iOvbW4LkBCQADD8oQ/91kfe/e53/fqUbnta10DXwOFpwK0AHAYIAM+tAALy65AAFfjfs/K/PPmfFf8E/ktLtbuHp9He466BroGuga6BW9UA4KcSAH4TfBX4z3QJACT7adkGAAmAW4cEkBS4JAGWBwhWcC3I3gdZ+5bh9APecZUAAOC3gH+1CGhsAzi71ZvnwBrnk3fsdYcMwHWTyfELuMoSQFJAKfh/yc+84tJSQPCfq/76Bf5aAAj4qxS034Ss1gCc6A8RwNYAPkmYBwUK+pX0mzG99a2P/stxrfaUroGugUPVAO8LLAFWkQDs1V93S4BWAFluWPVfAv8E/fQB4N8/9Xeod1Lvd9dA10DXwB5ogNVRDgLkpcIBaKz6jREAL3ztC4Z97FV+5xsevOdMgIEAWJIAqywBAMkC5Sr3AeDbB/tGOP2r0smLgzDBhN/D/wAMAn9IgAr4jQP4pxWA2wCWK9d7cBf1LhyhBu6OkQCC/Qr+jRfkpzQNUiDBfwX8GRb0syKvf1NZV/3H6qnWAFgBfOZn/NXzv/SJf+78e171ksEiACIAx6GB9BdyAEe4WwAc4S+hD6lrYKkB5kucM/P0Z37b5HaAag0gsHelH0lcrvSb5xL4Lw4XTOBPu8t3fj/lv9+RXQNdA10DXQPX0wCronMJAABsBf+GSYMI0BLg0gpgSQJgBTBlCSBIHgPXgux9kpIALel4LuViCwC6AbyzTULwD7AX6Gvu3yICML/WAoCTxiFs/sr/9Fn/4npXv5fuGhjXAAcrYh3kmQB8HQDQL/CvUpCvBOxrBaDk3mbVXxIgAX/1A9K3Af7HwP7cePqANQAkwFOf+tnDYYGE8X/KJ//lc3RE37EG6ATA+P3UU7oGjkUDWJDxXMRhlo/jqwC5HQASoFoDJMhv+TljIEG/q/39dP9juXP6OLoGuga6BvZHA2eYk/GicaLfsgAQ6COrS2KgkgCXRMByK8A9JEDs8xcsJwkguM64XZMA2War3UzXjxx1izFi9g/wR3ctAqBFArjqr5QAQHK9WBHYn9uo9+RINTBYAnC/aR0kCVAJAMMtAoA4SCyB/9S+f8B0Bf8SAcq54H3TfLkdgM8EagUACZDuoVe+6NIqoBMAR/oL6MPqGmhr4A5bylpfnpEcAMwPXwpYAHvAPaD/v/+C1w5+wgL+Cvo544e6F8321f627nts10DXQNdA18B1NQCb3SIA+AwY4F43RQIA/E1vkgBxHsAcEkAwvWuwb/0CecNTwJ+87/vdt4wDfsmAJfB3z381/QfYC/z1GwbkaxGQq/+SAG4DuO617+W7BuZoIK2EJAglAgT8LQKANC0BkgCoq/01DNDXjZEBm4L7dcvxZQBW/NkCwGr/N7/gOY9h8k9ctQDoZwDMuZt6nq6B49IAWwM4UBmrvBYhwPxqylGGhRhAP5ZXx6WdPpquga6BroGugb3UAC8vX06u8nFYXYsAqKv/NQz4lzC4ZztAgwQAHF9+JrBhDSAwr7ICdNOnAHwtk3n113oIz3L2HdkA/oJ/gDu6TcCvH8APwDcs2E8pGQAI45px7fbypuqdOjoNfPpff8pDbgmoJIDgXykpoOk/0m0vrdV/QLkkgMDf1f4qKyGwLqC/Tn7GDyHggYD0mXMCsBjAAuApX/wnv/ToLnwfUNdA18C6GrjLIX2Y7nN44GApsHh+QhKwj5+4i7T7nrSo+Gzdynv+roGuga6BroGugWtrwL2+AMoxAsDVfSTEQAX+NQwJoCXAqx99cfPLAM1zAZYAegx0jwF141uygnryGFel5W3fvKMr/va3AP9c9edARMAPpv+YBkICCPJbUsAvISDoV/IJNc8B6AcBXvv27xWsoQEIJ0AwzwruY54FOK0B0i8JgHTv/9Sp/wn8x/wJ/isxYPg6AH+qLF8DYPVf8O8XAJQcAthP5l7jZupZuwZORwN3eDYsnw/9s32nc937SLsGuga6BvZbA07qJQBc4XM1H1lB/lj4BW978ZAXAkASgM+DcR7Aw7/w0OXnAf1E4DaIgArYBe4C+qlwkgDW05SAfCwCZoB+Vvwvv4SwIAAA/1MEgCv/gn/BPmH9KSEBAGGsKOz3ndV7d4wacEsAhJbWQpIBSgkAniVTq/+soo8BfuMF/oJ8pfEJ3DMt46/j/8Wfe9M5X0VwpV/Qn/K7vutl7zjGa93H1DXQNdA10DXQNdA10DXQNXCEGnDf2ioCgMn9GPB//hu+7p40yABJAAgASYC1iQDB94RJviBf8F7Dxq+UtlWAvsCf1f10EBgA/gr6IQAE/koA0//yv3/FFQuABP+C/DHgb7wEAPsGj/B27EM6AA1g1ipxmNYAEgBYBfDlAKxVVhEAm5IAgv0qkxhopa1LBrDfH1P/BPzpp//9pO4DuGl7F7sGuga6BroGuga6BroGugYuNOCXAJ76guees2KHY2VvEwuASgRAAEAEcCaA2wEgAAYSYPmZwGoN0DwoUEDuKvwEGbAS5GdZ6y3S8wkq2CdM/9723tc8NoB+zjZgHEsn2E+pqT9ACfcdb3zNQAIA6FtOImBMSgD0TwH2X/Bta0BrACxStBySBIDsAvxr+t/a/5/gn8P1AOxz3BTIF/S3gP5UWis/pv9T4B/T/y/8vM955LavQ2+/a6BroGuga6BroGuga6BroGtgtgbYS84EnhXqMQJAMmCuBUASAa3tAGPWAJUMEIC7Aj8qKzEAoK9A3zwF7FOn7VTpFoUrgL+A/tZqPwQAQD/dy17zD66EB/C/yDMG9IlPB/AnjORadQJg9i3eM+5QAxxqpTUAoF8CALKrrv4DwAH91Qn6JQEwuzdulVxFBlA+86TftBb45zN/U+Cf8wC+9vkvPN+hanvVXQNdA10DXQNdA10DXQNdA10D29cABwFCALiKpwUAE/lVwL8SAgn8STOc2wHSGmAuESAQT4A+SgY0AL4gX5n14Kd+VvSVEBGXK/zLLxi4yq/MVX78fvkACfBXjpIAa1gACP47AbD9+7/XuB0N5JcCIAIAxxwAqBWAq/0V/BvmdyjY178OESCYr3IV4Dd/kgAc+Mfqf5r6pz/Afz/Uazu3T6+la6BroGuga6BroGuga6Br4CY18NSnfvYkASARgKygnzD7fTNe4J9x+NMawC0B95wPEFsDAOKsvlfLgCQE8AvikS1nngT5+AX5ygHcN1b4iR/IiuWBfoL/BP0CfiX7oBP8A4hYFR0sAQL8A+rd368U6CNbrlsA3OSvo7e1jgbYFsD9WS0AWN3HCfhXScmAOVKQn3lrnOGWJA4H4YA1A27qxP/lyv/ZOnrpebsGuga6BroGuga6BroGuga6BvZGA+7l5SBAT/ZO0K+/AvoMC/qVpOlXagmgFED7pYArFgHurXcFfikhBCQA5koB/iXot+6GBNwD+AX5SvvakoB9dJQSPw7AjwQQ4TT9F+wP4SUh0AL7dfWfPACsfgjg3vx8ekcaGmBvPGb0/p6SmFsF/k0H0LstIMH9lF+Ab54M60+J/51vfcU5JOhf+sQ/d/4pn/yXz8dO/Kdf/PYaw+1RXQNdA10DXQNdA10DXQNdA10Dh6MBTvVmC4B7eAX8LQmwZ3tAgn/9bB/QL+g3jMw4SQC/FACwHrMKuHJoIKC9kAJpsp9gP+M13U8puK+yBfJbcS39jBEBWgAA+AH1SgC9ZECC/RYZQBx5ACH9M4CH8/s61Z5yPsADz37gw5yk/5yXf+1j/IYkAgDT+AX7U1Iwv+6WAMsJ+A0red4A+AH+rPpDAiDT3F8/h3l+2pf8X/9fp3ot+7i7BroGuga6BroGuga6BroGjksD93sOwBioNR4gjz+BvX4BPpP9BPzGZxx+vxKQUqDN5DwtA5rWAa7ga7ZfpelLmUCfdgjb3pRkvBAW6mBMpgWAK/9KCADcsOK/OCNAsC/4V44Bf+Mpx7Xi8MbjugX7aI5VAxABgGdJRn4/U4B/LE3gfl0i4Of/2WsHoC/wJwxJAAHA/n9BP/JDH/qtj2C50wm3Y707+7i6BvZaA3cWvWudNUK87v7wk/ds4ZB3nvCE+57EZ0qXnyol/sxwSp7RLAThiKfcx3zMx3wGEsdZUf/n//a+T7CMec1vmYv8F3URR3sLd5ey1Gd5wqSRnzjqX4T9u2Nbi4izhXOc+OufY6/xPdw10DXQNdA1MEcDn/5l//MfMkEHmFcw/D2veskV8EueKZeAP88HML5K62pZBdgXyAD8EAESA0rJgZSDP/bsW88qmWA/D0KsoN80ZaYnEYDfLQAQAAD4gQQIs/+54F8LAK4TL+w517Xn6RrYFw0wAYQIwIIFJxHwgQ/88ocF/Zjf6x+TEgHIdckAiEVW+bFKAPhbF/7P/Iy/emn+zxkArPrzXOy/tX25g3o/ugYOXgOA2bNwDmiIAwjreO583BOe8M04gDbPT5xxcyTEJduxcOTPsPHI5/9v/9v7X/2yl/42jjD5vvoZX/EupM78xJv3O775wV8jbBnyUtcPverhPyDePpJuPqX1EsYvCUEZ27K8fScP+qm6MCzBQDgIiEG3khkqvMuuga6BroGugYUGeMACLFm9Z5KcQDnBrX5Be0sK+gH61Cfgb+UlrqZDBBCPZQDtpcx+resHiFNGgO5YBPFK41OaNibNK+BHAvaVnK3w4Csfulz5F8znyr7+MUl9tM91WlwyJhL9r2vg4DTAxEyLAIgAgDZgn9V2CIA5JAD5Be9zJWQBz7YE/paF5OTMAlb9f+I9F3v9l5/aZIWp/3UNdA10DYxpYFihdvUb8CmI51kHaMWxqi2gBfDidyXdsKAYCZB+2+t/4I/e/eij5wBugDIOcE0cjnTC5hOQU9Y8Y5K8Y2nWR92C/Tl5a99oI+Oow7qzPuIkDoyn3ToOwugGPZif+tUNMskG9Y1Ut+jca5KS68M1lGDAP3bBS3x/RxSF9GDXQNfAYWngchsAk+RKAgCcBbkpx0C92wBMB+RDDAj2q6xEgCQA8YBeJO0axq9ZfpUCfOOzv+nPdIE96fptN8Om1zjjkwAQ/BsHgBfcp9+4OZJzFpYEwGHdXb23XQNFA0y4JAKwjgF4Yw0wEAGQAQs3ZgWQ8YD4tARIvwB/SibhgLl/X/UvF6oHuwZOVAOAQEA8zyrcQg1nAkSBpCBT0A4IFWwCRgGqOP0CXCQgV4AsCCYv8Zmv+ilT81A+gbBt2q5tZf/oJ+nmAbDjiGdcpiGNyzLEC65bea2DOk23PHH00Xrpl+MyjTCOsGOrulg3jB5oV2dbjpH+qCPIHEgCpZYY3AvcFzjGuLgvJAH6wsyJPiv6sLsGDloDf+bP/lfvBVyy4t4iARI8409Qjr86QT7xSQhkfFoLCLizHkC64UzXX/skEDe+AnXCrTjasM6Urby2kWmCfPf8u/ovCaAFQAX5c4kA8z31Bc89X65MHvS91jvfNaAGkgjgdwIRoCWAVgEJ+F39V/qlAA4VXBf8s/eftrDO4dnXv67hVemya+C4NSC4B9zxDDJ84b/Yxy5YFbwKdgGIAEecaRWQV2BKOvmNF9gC3HGEBaFKwXH2A79OUCzYz3xaF1BXpuOnnHGMCT+O8pwvlOMjjjzG4aduJONhXKTZHn6cfaFedUUc+ZC2h98yjps8xFGO9HSWo33Lortsk7CECvGUaV0fde81SUkZy+LPsdJPXZID6oY4yAHIosWvaDgDYWlR0AmC436s9NF1DRymBnjoMglmf6wEwBxLAAGzQL3KBPmmteIkBpTmRbaIANtNmaA8/S3QbrlMyzKmI6ujDOCe+JQCfqR+wAUrnEgJAAG94TmS+jCZ5iVzmHdY73XXwLgGmDB5RoBEwGARwLaA5faAJAJY1Rf8pxUARECmjZECPNt41vHMo93lBG28gz2la6Br4BA0cL8m+IvOntlhgD3ATHAGeATEAfIEnoI6AJ8gEpnAsPoFt0jyIq0TCfAUTGY7gkVBrHlYcSaOeojDT17qqnUDYOkP7Zpu/2g3+y5Qr+nWYXqGac/8KbNe44nLePqDq+m0Q5xjy/YoT7pjZ9zozDKWM159EEZPOPLTrrrOeHWpJI+OOnCOI8dinxyLkr7TFmMhD9I+2b59tU3vQeQIKdA69NHbuMuuga6BroHdaMDDAJMAkARgn2xrKwAAHUCcgH3MP3YmgKBfYqBVPgE56RlOv2kZhx8n2M88ptU482a5jCO+rvi78p8AXwIg4+YAfvN8x+KrAYB/2gOsdKCym3u/17ofGtAiALILIuCn/skPPQYRUF2SAemfMvfnM6A8g/gdCfxpbz9G3nvRNdA1sKkGAP28GxMM4gdQu+osKBX0AdgS6AnslAA8AB15kIA86gDMIYmjDsEe8TraZjWdtgWBlCEvUlBJHTjbxE8d1Gsc7QuUiSNPhkkXfFIveUiv46NdXKZnG6Y7bvpt35D0nTqzbdsgjrZrXwk7Ztsin/0kjrqthzBphHHWadmsn3TLqlPyqQ/L0Df6wHi8PoSrM534mo80HO3QZu0XbRFvm0r1kv1Uz7RBnZ5F4L2C7O+lTZ8EvVzXQNfARhrgYcTEmElyiwTIg/cAw+kE0MgxJ8AX8CuNz3LGAXyz7gxXP+FduAT+ru63pAQA4F3ADwEAkBHQryslANj/D0Gz0YXthboGDlADTKBZnWdvPr8hCLdHf+S1wzYBQL+kgAQAFgGAfBxfAuG5wSr///K/f8UA+Hm28RtamvqfHaBKepe7Bk5ZA/djKQRA4tlwsYr6OMAHUAHeAGcAL4FgC5glwASsUYZ8gDPrIUy8QC2lIFEQaVnD9oH6aIs2EgwaJi7BovGUxy8Ixk8bOPPbV/Madmz21z4INh0f0vrJI1niGEgnPtOog3TiSKcMcTjrNR1JvMCWsH3DT37TTVOPjtU+qCckbZPO9XXsqR91n2nqnjjT1SOSOPrmGJSOH+k47TPSfpPfMvTN/tqG9ZNmHNJ71OtAHHmoC73hLgiC4VDCO9z/uCVB4NkDp/xM6GPvGuga2JYGXB2rBMAqSwBAsgBeYG54HSnwp4z1pKx+wukE61Wuk8eyrrxPgf0E/Qn81wX65n948flC/EjBP+0DYngpbOs693q6Bg5IA/dz77tFgC01EAKQaxJskAQ+u6p84NkPfBjQ31dVDuiK966eogYwfx6+Yb+Q7Je+y6o+gCfBKaBJIJjACfBEPHEANkBXgi3BFenG409gx3MGB7AzXpAHMKNOgSdhnGHaFtDZR9sh3PLb15T4rXeqf/SLvtJPJGUYt/3PsHUi09kv8hJvv5HEOSb8qU/iiUtnXZaxHcqZjzz00b7TV8I42yev6UjHRN7qSM88AGbyq2vqsl/2g/6Rbjx+0uwDZXKs5KNvtkOaYeOyX8QR9v7B79hom/JZv321XvLizEd/rIu6dcTx21j8Ts4Wrp8vsFBC/+sa6Bq4hgZ4qDCBblkBSAJMWQIkEbAK+CfYT3+C/EoEtIA8cYL2TK/+Vh5BPnn1p6x+woJ+/An6XfXPOABKxgv0q+RzaMQhBf8SAPSNa7K4rH1/2DXu7V70KDSwAAVP+CJWAHGf/tef8hDgHscBmTomXcvJ0VEMug+ia+AINTCcqu9haYKclPyOBWYAMcElcS0QBZgyTwIrAZmrqoR1ACpBFxLAZZg2dQJH6iXO+pGCxhpvHuujLcYniEPSD55p9ofnGn7KUJ5xmt/+0Z5102aGjT8WKWhmjOoZqU7UITrDz71hWt5L+MmjrshnncrUWV7LvN/oj30iD37L2zZh/PYJaV/yHqSfluXaUl+2a39sw3TC5Kd81st9hGUMZHe3EjjCJ2YfUtfArjUwdhaAVgGeB9A6EwCQrUvwnmRAgv2Mz/yAXsMC+RaAJ63GJ2gnvRXOOPytsPECfmUC/ClwTxorlVN5qCtX/fFXAuDLXvq8fvr/rm/6Xn/XQNdA10DXwI1ogJV9QJEOEANgSsCjv0pAEHkFSgBkQBRgiPoA0NQnOAJwEU8Z8lEO8EQ4V1nxG2/9xNmOoIs6BGTkp3/kId7ytGd/bDvDgjbasV/UST3IOuZ1wtRhny1H2LGoK/qDI+zY6av9dYzmI57xEU+fzasOiHeMSOKpm7yEkbST+qKMfbOv15XUZ59pM519RnINtCxBUob+0EfLez0dI2k5DvpKGvE42qYOx0AaddEeMvviPYA0PdulvqwLP/WhU+tPSXzqm7qoe0mE18Ujtg90q4Ebedr1RroGDkgDvECnrACqJQAAHFJA4J8SEE9YMI9suQT85k1wTx2Ea9wYcCefAD79xqVspQv2leSfAv6CfCV5NU/G33J11V/wLwFAm/SNawGre0C3UO9q10DXQNdA18DpagBwcbZwmvSjiTPeYwBygEkFMgl2Eti0/AAtwQ51USd1A6QAWQAlwVaCKsrQTgI56rIN0shjHHVkPylH3aQLsGhTZ1v2w/gK5mxvXUlfbN8+2Ibjtg+E8TsG+65uTCNMveqE/DjqT11ZD33OvPgdh3WTF3+GiTMv8erI/tIHHenG47cvSJztbSJpI/tnX2yP+0kHMUBe26H/tI+kHGnUZ3pK0nGkk9+y5vFeoy2vIZI2JSao3/F6LZDWoVRvjs02kYzL34jWB45v8ZuUBFDyO+1/XQNdA6esAfbbAjy/8w0PnrvyX2VaAsyxBqhEAOAWJ+BvgXzSjUcKihPAz/VTVwJ6/WMS0E7dSIG9YQG98YZTsvqPyzj9gHz8Cfr1u8WCtjj8j2txyvdiH3vXQNdA10DXwMFo4I4Ao0oAjWBIAETcFJACxAi2yCegoW5BpMCn1gN4srzATdBEPwRT1k8c6cgEcLabQM32iaNP9oU6rde25sgsl+OhbdvPdoizj0rK2TaSMRue04ebzpNj1u/1ckxIdZD6Nw6d4Mh33f7ndaf+vMbZtteaNgXoXjPq8L5L3ROHs416/ShvOfxea9tlYQ4Aj6Ss7TBm8uuIr3qgH8Tr6Df1SjQwzv6FqYN5vvaOdg3sXANnEAAcPleBf4YFq5IBgPQxawDSqhPgJwlAHuPxA4SV+NdxFdxT1ripegDngnul4D3TMq76qb/GEWbl373+gv6U6hQd8Dm0vvq/83u9N9A10DXQNdA1sJ4GMCM+Y6/xEjwMe/oBFRUgAWwSDAlQACQAF2Smk18AliuiAjIBH2XJS33UQRlc1pV+8pCXOJ3lEkABkARgStrGr7Mux7KOpM846sBRZ45NP/1gPKRfp705fUMftJF6IUw/6YfXibj0GyYfZee0tWke6ldvXiOvh9deXRKmb45hkzbVideA+5pr470gOLdt+qSuLGtchvHjGEv2y7LE4Wcsxjku2uY3gaRd6iG/9Wd9Y37yWi/6wc9YlnPNul1gvadCz9010DVw+BrgAbNqKwBkgIBVCVjnk13IuU7ArwQ8rwv6BfZVJtA3jTiBfZWAdOMSwLfiMn2VP0F+9fPZMuLUIXroe/8P/zfUR9A10DVwmBrwBHr20C4Pqutmso9fyvuZH+AAJgIjJGACUAHI0AEYiQewIIlPcCLItC7BCCue+CknWKI8+XSZZp20LziiLUEj8TjCxJuPOomjDO25MoofR7p1byKtGz3YBrqzfiRp5LNvm7STZXKs6h+pn37oGB9+dKp+iCOvOqKP5CFO3esnLctZr3VaLtumjm2N1XHThxyL+vU+zTFZZq70XiY/fsZE/dTNfco9w5hog36oN/IZZ1nbZPz4keiGek2zfiR1GY+kPseGRQB+26EenHVnOeo3nTrNk/1lPJJ6Hia4JPj6Zwcff/51X9fA8WuAU7UhAVihn9oOIBGgJYBAdhMyAHAOAE7gPuUHeJOecgqMmzfzZ1wF+hlO/1Qbaf4/teIv8Efi1BvjR++LO6yzscf/M+sj7BroGtgDDbACxhcl+HQk1lc6wrwLmWj75Qn8TPyXp23vQe9vtAsDAZCgI8GLoIM4HEADV/MQB5gBdACgLoDH4xYEgJUEJ7SXbZJOeesmjfy2aT/MR7ogTRBF217LBFLUY/lNJf3Idmwr+7lp3Zajn7SBc3xI2hKo55jVqddEWa+N9a8r1b31Im3TftpX+4ve7au6WbfdVn7HRHu0gUMvONohnr6Zr1XHVBy6z7FRr6vztse40IH1mB+pn3T6gqQvOOpOR5z5KOeYHI8kBBLnGG3DMVJOR5r9UuY18bqot8UTppMAN/qY7Y11DdyyBvgqABMhCIApEkDwipQIgAAgXImAtBBogXvSM55P4gG4lVPgO4G9gF1Jmn5Bv2Glddew8aukh/9R/6bgn60XMLu3fOl7810DXQNdA0evAVb4PfeGd92zvuE551/7/BcOZ7ggiYOQxUkKZJzkwLFu13IlEIlFBOME2CQAAmAAHgQ++AUVSgAM5cyjpD4c4QRC1IEjDrCCow7rUwpuCOMX4AigKCN4so8ANdu0H5TLuqx/jrQc0jasFzB2nbpt37GhB+pTl0jaROIcr+X2VTIenOPJMaA7w8jWdd9kXLSlnmiD+wCJPrlfNqnTMpSnbuq7IAPuexK/F+Kon3EozWfb1oFUHxmHnqjf8tZlHvRDnGPimSYJ4Hgpa/6U1k27VQfEUS91UaeWUUvi8+zoXw59gF0Dp6wBHmBMfAClcy0BkgzAD6CvRIAkAEBZwK8U/AP4p0C/IH4VKL/JdFf/p/b5u+Kv1IICoqSb/p/yr62PvWtg/zQAGQlAhgwG7LJKfgyr37zbmDAL7AX9PMN5FhMW+EMK8P6r7zbyYiFgPvQEsNy/q7hWj+5nos8kn4m/AEIJIAA0VBABWNAlYCMvYQAI+gZI4NCTIIU6Wy4BiUCFOBxt0Qf9SOqgn7RlX/ATR1s4+qDMftbxZHjMT59w1E+91k39Ai7Sx8rPjWdstoFknNQ/1v+59WY+9YveaG9Ovy2zzX7QJ68pY2Ss6JVx4+b0K8c15qfPXi+JANryvhorNyeeOqyb54yEE/cFbahf+kDesTGRj/y42i5l1I/XjPqIo21+X/7G6INt17YoYxv2rbZFPHXivA7Ut3iqnK31ZOmZuwa6Bg5LAzy8mOA89QXPvSQBpqwBBLRaAiQJIBkg2EcC8gHzAn7lTQL367b1nY/+o2EfP/WMgX8Bf0p1xYSTU/+ZZB/W3dF72zXQNXCMGuC5z/PoqU/97OG5xDuAcDoAL2TAIY2fcUFiuIoPuJe4VQroSePZnMCf81ryGf76n371EH7Oy7/20lKANg5JJ9HXwby/TvYBAACFBAYACeIqoCCP4AQwIkgBOAAaIBcqGBGEkMcygBqdddAP4rIfgCTLIO0n+ajPsbh6Sdh6xvqe9bf8jk9gdDGuJ3wR7bfqbNUxFkd5x0B99Fd9GT9Wdp341C1+2kXSJnJOW+TJvFyLBLfr9GcqL31D1+gBx3Wl7Tl9nKqXNOpmzNaNvr0PSVtVfixdfXoPWj/Se5B20Rc61Nmmknjy4Yxj3OiDuq3fftsf9QWRB+Fmm9Rnm9ZnGSX157UknjB9oLz3PfXGs6N7uwa6Bo5RA6wCMSlihVpLgDkkQE6c9AP6p4C/BADyusB81+UB/oJ++9065C8njPoT/H/N679lWG3qD9Rj/PX0MXUNHJQGzjz/RSCs/PIv/9LLVXHjkJACTGwXo9zbw/KYCAv8NeXPVX/Av6v+pAv8E/AD9qt723tf85iOtGe99BkH+SxHPwkWWiAIEJDAA3+CMPyABMoKdAAe+C9WQu97EmFABKCC/IIYpPUBTHACFfInWDGN8tm+AMY+0i7AHydAIs32zb+uFAxRJzqz7uzjunWSX/3SRxxEEmNojXGT+inD2NU17dHn6/bbvlgXkrrV07bqpx30wsq29xFtXFc/9I96qVOiCB1to27q8HpS/+IZeeb9Qjy/F/JwXfDjiM97lP75u0Kmvhk7eSnjdbW8ZZi/axHAPeU5AerQ+pTWZX3ql37gaI+y1qlkbAvX/7oGugaOTQOSAFgCAFglAgCyU07gXyWAWSJA8KwcA+4CbuVYvl3EZ5v4Bfqs+GsyijQ+J46CfmWCfw79Y8LJQ/TY7pk+nq6BroHD0QAgjRX/BPeAfgFzSskApWWYGOIgEdIBvokH0DAB5XkHeFpo52zXGqKt7Dt+wT9SxxjY7sa7yuc4z2xBv0A/5U/+6o+cZxg/dWAdsetxbaH++yGdue5M9r12+JnkJwgBpAAocACEBCIAB0ACcdaBpG4AFdeZ605crcMwkjYEIUiBTY0nTB90liU/7XC9kTjaRzIm8mX96/oFYrTLWKw79bRunZmfenD0lTEw56LNzHNdv9fnuvXMKc9Y+K1vSz+2iX64Z/N+uo6euHe9p/K60s517xt/F9blM8/rgOR+on2vP2HuVYG34zYP0jjKmB9pO0h1giTM72DxzLgf3VnGdtSBZax/TKov60H6e1u00Q+w3sLDuVfRNbBXGuBhziSpkgCrrAEEvJIAAP30C/xTVhCfAJw0w3Nllql1j4Wt23TAPn4mh5r602dNR3PSKNivUl1AFkCkMBnlZb9XF7p3pmuga+CkNMDEVBCPHAP+FUgbtmxuEcDvFoKU+HXkASx7vsDFJPIJX7QtayierfVk/zHwj8m/4H8M+AP43/8rb7nH/exv/cg5aRIC6IP35R7fRJfm/oADJvACkAQeAoOUFRQIMBIMAGwWYz9buDvoQdBCXvLpKjgknTjyA04StNsH4mzLPEjBjyAOgI7f8eW46hjmhOmb/eI+5TdD3Y5tTh1TeRi342GlFkcc7U6VWyfNMVAv+iC8zfqp03GgG8azjfrtJ5JrKmnlfbSNNriO1LcEysNKvfVf596hLH3WWT/SuLyG9oO28eMcH3WhV3ScZfATZ31I73vqwe89y2/Stk0zr+1YN2HaRNY0+uXvznpodzm+TgIsFN3/ugaOSgNMqJjcsMrBvvXrWANIBCTwxy/QFngLxKsk3bjqt2yNN/8qaXlAPX7BfUrBPxNK4ivYN5wWEkwwWfXv4P+ofhZ9MF0DB6sBwLYAvgJ/QPGYE/xXaV1KwD5+QX/LX4mDJAaYVAKGFgpee1LJKmr2r4J/yFveZa78jwH/Cvrf97tvOU9HOiSADgs5xrmnN8VdABTvciQTdhwTeif+AgqAQbrMAyAAADjpt54lADhbjP0MP+AAEEFZHGEBA3W36rTN7A/tWRawk4AkwY/tI+mbZTJ/1jvXLzinPup2JZX+m3adNtAR40BSH21w36OLuX2cm49+4hLc0bbXgjT8OOLTEUc5HH76ik7MTxj/dXTRGgdteK9539huK/+6cfTXayu5w7gZD2Ndt77MTz3e08v78673J2MiTR2rT/pCPOHUJX0hb9bv9bIs5ajXuomnDOGlFcIdpH1Q0ma2RRu0R3kd9WQe022PupYE7trP6z19XvZudQ10DYQG7jJBY4KzLgkgGNYCQDlGAiQZkKC9+jOcoN/4jJvymybwd6VfmQQAq/g4xiDYrzLHS17Avwf+bWuVK65L93YNdA10DaylAZ/lCZTHQP9UfJbXX7cICP6RY84y1FGJAbYSLMmAlWNkgot1gX2p4D/DPsOruX8C/wT8+H/z3/zoFRLAdEkAxsekeGVHbzbDADwACAIMJIAtAQV+AQmSyX8LBAEEzEceJv+L4QwTfwgG6rZewWLWR3nBRPppK9sjzfLUSR2Wo37iBDv2Aek4x/pv3+ZI+kMfkI5VAsU+zalnKg9jom4kYxRUKWmftBz7VH3rpGW9+Gkrr61+deA1stwu+kQbglmuJ3qwfdoj/brtUt6xUr/tOF7kXD2O9YU6uEdweX/SHuPDZXvcA7ixtu2vusj+oRPrqnWQnzYXv9EzHjvMQQnTL/pA/qwLP2Oy76Tjz36pP8qru0//6095aDnOoR3a6n9dA10DR6QBD4vicMBVRADAWDCsBExLAOCXBABs6wDk+JGC85ZsxQn+lZkn/YL9lC3AT3q6CvYNOz4k4xP4s+qPrg5kf+gR3al9KF0DXQMtDTD5A6gKkpEV5AOU05FOuObLcNanX2Av8DeMJI/S/Cnto4QAz1BMy8dIVEiCLG+fcxys/j/4yoeuELgQAO7pr+D/13//H59POQkApV8GWOh9b1bCnPA7kUcCGHLST5h4JvkJNDIP8QAB7h8n/cjlpH+41aoJviBDwIOkHuulXcLI2ify2GYFI/SVuuiLzr4QJo0ytnMdCdhRd46dtgREY33fpE3GS3u26dhslzHRbktXm7S3D2UYi9fZa4rEqWP6uY0xo1fHjC55ZkBa4bZ9zzgG5PI3MmoBwPj97WUf7SvSe957wDT04v3pGMijI477h98mP1KfB6YjKd/SL32hb14j70/a/qX3v+P893/v187f/e53/fp3fdfL3vG61732n+OWYz0bHgg7/Iel19O+8oH3ffVzn/lYy33DN/7tf8fYl9uy9vaw2h2qqFfdNbB9DfDQZHLW2hLQOhtAIkApSAYoJ7gWgEsEAOLTL4AnjjRBfpWCeuMJ40faBnVlGP+Uo6+YeALsBf05HseUwB+CBB3x8N3+Veg1dg10DXQNrKcBn90C5QTwFTDXcALpTcgA29yG9AwBJoFMbJnkUS99tv7aX8IQABLQPL83Bf8AfokBwT+S+ng3Lied612c3eQeDgAD4HDtmZwzKU5gVcGFgECAoaQMZXXkK5P9K3uoyQ+wwOEHRIyBG+Kpl7y2hySeONqyXesinTTieccuiaFhCwJhy1F2rN1sa8ovQBMIXQCqC32igxZ4mqpvnTTqduyMhba9jsSjD92Ujtdpcxd56Zv9dBxeO8aEn3jcttvn+tN26pHfRL1PaPu690r2nTH7G/Ga0abtcl/pyIufPnDvZj/wE88Ysn79pFOWcjrCphO37MfwlOG3Qph+IHHkMb+SOPKk3gD8H/kPv/PR8+Uf4Wd+1dPfiAVAWAHsigC9C+h3C1eVlQiAkNVBCNC/3Txme61dAyemAa0BOCCwWgO0iIBcJRcwOxlL8C1IT4AOYE8ywDTzCugB+saZB2l6xuGfcgJ9Jo1OHsfGUIE/q/6sXC0nJSd2Z+x2uJhgMvHH8RLfbWu99q6Bo9HAHVfVBcsSAC2wPBWX5IB+66rStgTmSvKNpZlnjvTAP6R1tvrOc5znNO+cMfCfwF6APyXNLwnAVgB0zLaFPXj2D4f+JbACRAA0nOArBSHKsTyUtz7BweLXcbb8hQwEgHUiK+gSACa4IR9h6qPuTKMfONrFkcd0JPUJYAQzEELECVoSCGXfNvVnX2mDdxDtCeroE23az03byXJZF3WjB9pB4tCNQI0w/cr+mAepTq0nw+rKMZLffhBHXuJom/jMZ39sl3ypF/vodfT65Nhsa9uSNrxWXC8cYceyrT6oD68FbTBf0TLGsaMrXerf/iCzT14r4qmDMOWsw3jLE28erxnXYvE7vZ/fKuOnHtLM19I5abihLwug/4EP/PKHE/zDAUgAUD8uSIAz2trWH893318AfTAGz3GttyBfCTNHJ40FO8D/GCkAkbAHz+htqafX0zVw8xpgz6X7SVvbAlpEgKC/JdkSICgXyCuNR7qin/6ar4az/Jhf0O+DpAX+7beg3wP+IEHQwZ6tAN38TbGjFlnBYmLt/Yae8RO3PORmRy33arsGDl8DTEoF1AnSW2B53Tjqs0zWval/DjFA3WP56IvPbvtFeAr8Y/4P2GeffwX9/+//Y/5WAJ5LkON78Ey63Psv2EICDupknzjAA44JP+lM+i8n/4swfoEG+QEQ3FMxiR4Ih6yfOshHu+TFEU5wYx7iBTCZTl8EMdlH+4zUb5+SBLAMaY6tjn/dMP3B0c8cGwAI6w8k8am/ddvYNL/69FqjG/ROn9QxOsk44slPHuLxp7Os+ciDox7zESbd68HYzc9Y3vMzb53lMC0nL3Ku+9CHfusjAFMdQBWz9LoyTX906Em3qa6znHVxX6ALgD/PAHSHI0w86ZbL3xR6RHemKcmPni1HO6QRJj91IB2X18Py5Kfd+J3eR7+4T71XvXbURTn0/6F/+77BxB9dAvJxb33ro/8S6ep/SvNwLdA9Y97WW5NnKqv9zMslXeszmrBErFu5JAeQEAOVFNA6ADJg0de+TWBbF6zXc1oaAJwJzMaIAMgAmTnN6QHRrsoIrJFjAH0TUD9WF/E8UJT4adtV/uyPfvuboF/gz2SUB+lpXfndj5YXCS+AVY77b5svnd2PrLfQNXBjGrizK/AvwE4pIbApAWA5AX6C/VaacVoDEE4CAL/vGVaKNP13ojg1qZwC/044lXtmAXCFAAAgACSc5CeIAEAIMAQOhCmT+fEn0OB9x2ri4i4+4052pZN2cOQVpFAWvwDGdqq0n7U/1Ed7ABzyWA/57BfpvAOYj9Cvi9XXi8/rkUYdtT3C1tVKWyeOftk+0v7SZ/VBnnXq3EbeqkvqJK6O22tEmoBdcAkYBxQObgHyAHwA7v/8R3/wmEAw/cbdhAR0PvjgN70dwI/Ma8CKNIAUIHv+X/7TOXnxIxmLhMOUnqueMi+64jrjuLZI7jsAN1JAjszr4D3r/Tx2b1KneSiTbev3uuU95u+ONtGHv1HAP330uuKnfn+bXlOuJYAfnerQJfv885oK+F35p61sj+fCdf6Y14EXfEZ/4CNvGwjaD370kXOezdVVYsBns896yADm+mCRtBCQDMCy9Dr97WW7Bk5WAzzw2J8JWMutAX46kB8yfkCz2wYIA6hxAmzki97w8ADIsQoAgKd1wBSon0oT8APyBfyCe2X2Qb/9o6/Zf8bIWPtDY/u3PDpN0P+slz5juA+YvL/lvW++dIS5r2CIeVlw/x3p9bjLBBvHS1xHmMnGkuHf1d677V/g06sR88vBBPOmh87voRIACdh36QeMW7/+lNVPeBOXbTBWwgB/XB78J/hnIsikkAlia9WfiWSC//SPTTL3iQDgeeCE3QO6kIAfDu/CCYaIBzi5wmc+AZIrsYAJwEKCBkHv4p4eVtB4LpEHUCJwEuyQN10FPQIYyuOnPetAEs66yGMZ/UqBE2AEXdhn6tZRlyBqG9I+Aqboq/2lbQgJVlzx2zf6gZ9+4Mg/1g/1MJY+N55r6kp5Sw4gfgGU9+1PcgHigfsaJ+BP8Ml97KF03N+OceV4FmOmDfOPSX4//k700w/mvlxj7jeuMQ6/93Lel15/pPdI3otca8Kke0/V+4N7zPvY9qyPNH8X9IG+Ld85Z/TR+84+8XtnvIzf649kfOhbPRLGn7okrlpbeD0WbV77fYcJP89VntOAf9z7//it5xAA6SoRkOHW85pnP+8A3gctMmBpFbBUWxddA10D62jgDNNsAByTMckAgf+YFFwnKSD4FowL1LchrRMAyYTRiWeSE/bJPmPhwJgw84wH6zq66XmnNXCmNQn3D3p/+Odfd/76X3rtJeiXAPjxD37fEPeTv/oj5zjih8NeFkQA12fRzLVfQNNd3Vnq8KIGuPFyZyx/5s/+V+/9zM/4q+djjm+ukwf3hCc+8REcL38mncv79Gxnve0Vz9EA+r8VM0NIMZ5ZPt8Ey7cp6Uu2bzil/Z2SWYd+xoqTAOA5z/uign8mgX7aLyeJ//HfX6wyVRIg8+B3dUnJhJJnFu++xbXmet/qH+Rgrt7hd0Kfk3gm9cQzmR8AwCLxEgxkxoWfPBIGSMHPYqBnCzfc3zxvABmCGwGPoIQwIAVQgxTcCnaQOIFKBcaEKWf9tQ7qpSzPP56hAm/BkKug9IeyOMrMBdHr5qOftsW4aI/+2Tf8POdTCs6U9A9HeduvejG+JVnRB+SVy3njQe+v2jD3H/cT4BqJA1iOAX3jyUdZ66sA1fgxOdafsfy053uV+wprE+537imk/aJPuLQw4Fp673KtCbeulffk2PXlHqAsv6N0lLM+8nBPLRcGeA4NZ3RQDpIE57OB3zTWEakL/FwLyQ7GkumpH6+ZY6ZedLRo81rzL+pgbi4BAPBvOYmABP2r/D7LeXZLBrAoWK0CmE+ivP7XNdA1sIEGeDBKBjA5ggwARKcD5Ll1QKBdJUC8RQxIECiZ7LX8xmmFILBncumEEX/2wz7SZ/IwDh74G6ihF5mhASZE3CM4VvwB/oJ/CQClJIDgX0k8E31IBNyi2bMZTd96Fn4njB/gDpgfA/qr4imrI++nfPJfPv9Ln/jnzp/4sR/325ADTAq4h2NicOtjP5EOnC3GeeMEACAwn2884wTKtyFXtZ/pLb9xyjoGQD9pjJk0wT+TOwC6K/+CfyeCLckkknhlzSPwRzJJ5bnDs4vf8eJaX2vyu4XfxLAnn8k4QCpX+Jmo5wQeP8CJiTxggHTz13yEEwQxVibqOp8rgCHiyEudgE+sDmgDYCMQAsAkqE0AA6AR6AiGWnnJI6CiPv0AZtvCTzwroPwm6BvPQZ0kQYIo+7Irad+oH799RKc4ntWOh77rJ159E8f4dYQZA3rCDXobAW9cG65HBc0DIGxceK7hWBp1CBDJJxCmDe4/7inKCjpdNeY+Iy/XAWnY8krKUgf9tR3kdUgNytax57BJsz/0G3+A2zP7Zjxp9BHH+OgrDh3oIAS43lzrel8R5/1e07mOXFfi/V3gxw3XeFGn9VEH9wf3+uI5csbcIvVLf+nPoLsl8E9dEo++cfhxjmUos1QS+iGe+rwf0Qn+bTz/mL/x3ObZ+i/+8GLlf1sEQBIEPteTDMAqwAMEIQU6EbCFN1Kv4rQ1wOSAB4TbBJikAa5bpIDgWzmHJKikQStMfQJ6J8aYj9sP0+gjgH85mTs77Su3+9Gzyi34Z9Iu+K8EAACflX+dwF8pMYDk+i5JgN0PYLMW7jLxXLW6vwr0T6UnGSAh8N/+N//1OU5CYDlRuHFwupnKDq/UJ336fZ/1d//eV33bbfSc5xe/A0DxGGiuIHrfwtnv9NNPV/mR9lsSgDDPEiaRrv4D/HFM9qrpv5PCKdBPWgJ/wT+TVLaW8Qxjsn0b17rR5iUJIPASyABSEuww2QcUkC6wAcQQJ+Aa8mMevnCCBNIEC+RdTv6HrUi+77MO8gqYaAdHOzjiqZc60xlHPTjCgA/G4PYEgFAFwwImwbB5BNACbPrMNUMSB9gmr8AcgFVBlmBrF/ISuC9BXYYZk0QA/bXPAkfjkPz2uZ7o1uuu7gk7Zq4B8egWyTvJe6CW85oRr8s6Tbd9gafXF8l1oy3z2D73Vevvyv3XynDNOO8lwCx+w/SRvnEfq1d0qt7UDWOiLPc2ZemvY1T3SNLtKnm4jylHmtttCA/32kJHxBnPNVdPXn8kutfZFv2D5Fo8D4bPYtJP6iUfdRBmbPTV/iiz3/iNp6+EcwxcL8LEOw70tGj32lsR+R3yLGUet4oAyC0BPsM3kRIBPuMhi3mmQwSAESAC+P01nrM9qmuga2ADDZzxsgFoA7gBa/zombBWUD6HJJAsUCao10/dtEFbtAnwpH0eXB0IbXAFt1DE6841HwP+ufIP2IcAePfvfM/geEFIAJhGOmW41svtAFvo6Xaq4OXMC45V+Snwvu20FhmAdQBkAH0Ztg5cgJejJQOGCVxskXDFcjtXtl0L4J+J1CL12hOjdgvjsdz7h04AAOQr8BfcY9oPyMex1z8JAfwt038BfE749DNx1I+sYdOsg2ePzx8miDxvWHEbvyI3nnI//WFFnvcb7zlAABP2ewDXYkIPMCDNiT2Te51gICV5qZP3OJJnGwCEtvDz+7Jd2waoUCdt6QAnxBMmjfYHgAIoXLokAgQ15DEv5QgLVsgDSEowzwReYkA/eQDQAH+ey1ov4Hdsjo+8N0kGrCIYIAfMAxmClYXjR5deK/UtUBNMkhedec3RJdeBcafj+pAPR73kwVmPaeSjLdqlbupF2o8qtwnu59TF+HDZD8bB9eW+Req4b7kXiGecjFHdImmP8XnvUg/3HI42yGN76sDylCEf9aLP2nfCxNMmdeBHr7SHsy9I6rn4vV1sR1i+03iHD1YK5Pf6I+1L6kC/bdkOspWfdh0D7TN28nLP0O51n3J/49M+9Rd5bzGfW0UAbLIFYBVBwHPeZzyEMUQA81PcQ6980Tljv+4Ye/muga6Btgau7IEGoOOYzEoUABpbjvQE9pTjRc7En4f58uF42+aZ7VGfYCzXikkzk+cE/678K13ZT6DPi4GHdCUCtA5AAgCof/lium0N3+VeBHRjmj8X4K+Td26dNZ9bBdwuQD+ZVNy2wrbY/h0IDogOLSAkPXgubLGde6piYsQE6ylf/Ce/9J7EHUfwjJQAcIX8GKTgnt83zsNf8UsCQAho+u/Kv6v/Anlla9//KvBPXYJ/Vov8VvWOL+km1Q9fBGDSKtDgnhSoOflXOrknD44JPmUBB6RJHAiAyANAAcyQF79h4pbP3ru8ewU8Qz3LBqlHMIGkbIapkzbsH4CEMKBD0EXfSCeNuq+AlgWBQD7q1LlinmAeQoDnngBQSf+JR/JMxE9eyAD8OuoUjI/JBOxjedaJB/QzXq+rOuryqga417n38poS9v7kHeC9izSN+4V7TUk93GsCae9j9K+few935Zos70HubdOph7px1st9av20STyOeGTe2+SjPu5LHIQb0jE5ViTx1HelT0sV0R/6QF3Uye/bfKT5e0fSB/L5u1NXF+1fWh5s8oy6UubLv/xLB7A9hwDQAmAVqF833XeDRACSrQHMJyEC3vnWV9wKqX9FUT3QNdA10DVwiBqA0OFhisVGgn9W83gBAEp1AFZMsTDlZdLtRJ6HsmytRIAEAGH8tnObOmLiCOAEYFfwve2wK/0tuaot9a1kmwAv94Xuzm5Tf5u2DehI0A/4/1NnZ/c44iEJN21nrByrr06gmDiN5dtFPGMX/LdW0A+VCBD8+wlXJc8GHGHAv+b/ue/f50U1/+cZIuCv0okg0kMDqUfwzySVNniW8azZxbW8Zp3DVgB+x07c8eOYwAMMhol/AAKABpN90sgjQEB6P1+FWBfnCAhSqI9yuHh+XO5H5rcGUOE3oRN0WYZyxNl+tkf9AqcEK4wPJ1Ain32yvGMhnnTHCIDHYTEAMYDECdpJo09aOVyYWj/hixiLIEtrAvJqUUAczn38awP85efqBrCPWfiS4HDcjutUZGvcXNO8b/BzXb2nkHk/4eeace2MJ4+/BXSsPgXItOH9RT7C5kGSj/tpAM2LsPco9zd5K5g2n3XQJv3G2W/uUcZr3bTvWOj/kqQ/WzwfLlf7vT8o6z1uXLbpvU+d/gZo299j5rWPlsl8+NEhfVi4rfytSwBAAqwL8Ofmz+c/fp79Wnu9/CXPH8jFrQy6V9I10DXQNXAKGmDVRCZV8M+EHeAJSAa88pCFceXgRsA/aQA1Xg4QAPXBzOScSblEgJKX221Oznk50m/BP2NbBcR3ld4iBVr9kQBIyTXbM/PmyZ8K/UXvOMbx9V/w+R9Fr3/tyR9/j5MUgCyYrHTNRCZTTp4ATjepPwDKMRIArvi7t1/gjwSI48gjAQBAr4RhPjsE/MSlP/PgZ+Knq6v/9IVnzC5IpDVvubHsWL0NlnXcg7layARewJOTfuKY8JvmfUwewUVNMw/PXEEW9yErrAAX2kJCTlUgTTzlaNN6kIIOgY+AjbwCK0ES+fETT1s4foPUQZ+Jr312LAJL8g75lsCbE/RZ8QfA0zbPFQA+cUgIAogC4iUFAGbqGT9gjTTyQAaQX5KAsKQAxAPxpOOnL3lNGN8x/+W14RpwjXVeO6T3EteXdCTXBoee0bnXAt3jSEtdqtu8N6zLe9E2vXeQEmDeZ8Thpx76gcxrRHrG0QfzZv8B4sTTJjJ1QR2O0fsKyTgvxnrfk/iNqQPGkX244l+8h/ijz5ITtEn7w/iuZL4g9mjb9mlD/SP5HfNsGXvwbBLPHI85H5afPL+nDgH0YEC2AswF9dfJ53tC0pfnPlsEFuNk20X/6xroGuga6BoY0wAvLB6auBe/8weH1X8e9gA1gS9hnIAVPwAOJ5jGBAvT3XSuzAn+kY984OW3ZgUgCBX8O759k+q51a8kARgHpvRcw7Hruw/x9JH7BLDvfSMBQDyAH5l5GLtxizGcXXccmPyXudQ5E67r1ju3PGD02AgAwX+C/gT+EgDEkRdZwX9d/Rf0K53gVQIgSQBX/20PkpLnGZPyudfnFvMNh4Mx6Xfiz+RfMFDvWcKAFtLNQzn8AAZcppEXJygiL4DEPICGC9BycQq/oCWBhWDIumiDOnCkWR9ScEL99p22AVAJokgnP/2hXkAWcUjLISlLOn4k7Ql4tAgQwOcWAvxuDXDFn+c/xAHxOMKAUX6b+HGOXz/AVdBqXttHD/SJMThuJOMirY6lXifyMD7G1vqjbvLoqI8441OflKcu8yLRFW3WusnntWIsOvtNWcoZjxTIc68AbtUL+vIewE88+W3TMXNt8dNn6kdP5EMSNr/p5GWcxDtm8xhHHsp6j9B/68z7z3Lmsw2k9x1joAz1IXGpI/2OkWcL/hyHZbIP1kvb9AOp37aom3yE6ZP9rVI90KZtX/TnvifRH4i8XTzH9pkAgGjId4TWAN/8gucM9/gu9NHr7BroGugaOAoNeOgfn2Zk9Z8HKMALAAbYdEUaP4BTRzovBoCccZUE4MHcsgIADDBBZ5J1U0pkkse46OsUwG6B7tuMs69eh+yLZABjYnvAHhIBd+mXwJ6+e78QR/+Jw49LIkCiwLTr3CesioxNrG7qLADu9WMhANLsP8G/AFzpaj9h8xEHMdgC9BknAaDMNFf+ka7+2ybS82iuc8/cZFlX353UCwiY6AMMADqCpwEULFYNuZ8BHKSTP8vgB0xUACqgIJ22BCqCFNrATzx9AlC4sgn4tX/UTV76Z9tI+mM/E1iRz7FQln4I7vATR1lc9tl46hxAU6yWUo4/8tgPrAMwzWfVnt8bYB9ywBV9rQMgBEh39d9tBeTLsoyX8ScBoA7QEX7eK4Be8ukAyOqLfOjmQqcXJEutjzSc14H8jIn6BdqWIQ5n/eRT7/jNh5TYsX7K4ScfkrrNU4E9fVH/tum1pjyOMNfm4kpc/KeM7ZGez13qpBxluP5ca8fsSr51US7vEcowTurnXvD+ImwZpb+NvKeII69t2vfsf/YVP3kYO78Frilu8Vw449nAb4NxZr+o37HZlyrJk/qjDZx9bY2HOug3dTsO8lGGPuwK+DNO/ioB8LO/+6PnrvSPyZuyAOD9UN8RWoDxvv2eV70Ea4D+1zXQNdA10DWQGnA/Pp9oBPxjpgvgApQBKpGCNAAZLwLBvuAzQR0glQn5KisAvwjARD37s0s/q9AATPrdAtOMY9+dZEDtp9dCImA5UdmlOmfV7co/95Sm/vjprwBfmemCftIYM2GIhFmNNjKNTaqYWDGZvAl9cQDqMRAA7OdvrfwnAAfkC/55HuBPAgAwX1f+iXMip0zQX/2SAHX138nfTZKLjVtuoyiBFvcjgEzwDVADNHC/5h/3NcBA58oikjTBCUAhy+FPcEWYvI8DnguguvxdaEp7FyBEvwCX9Il0AAht2TZ18UefqC/BDvnoC23hsv8Xpa6u9goSqUuASBnqrGMCGOEoQx7qpxwn8Q9piy0EkAH0N4kB4gin6T9EABYCXg/qs377iVRn6m1x0YdtHQJDyxCGKLA+JHpECtQdE5K85qdsliOestxgAD/S1CVgOvPq5zrhpy7y0C+uFzoUgCNp2/4QdqzkpYzXzngkY7fevAesj3TKWgZdkmYfuF55L+KnTL2+lCPestbnOEjPekinDnVAHwnTrvkoQ5yOutU3eki9ZTz3vvVyPdCb/UlJOzl207gvuWY42qQfpqW0TdvyGhpPP3YN/rnPkgDwU4BjwD/jJQGUgvVtSetF1vcD7x0sVVloggTg2cVY+l/XQNdA18DJa4AXFw9HTlDV9B9gKcDHD/gi7J5sDlnhoUocoMwVW4Ep8eSRAOBB3zoLAAJAU63FhbiRz7EJRukj/a0g2vBUmnluW6rv2g+JAK4N473Nlx6TVO+dCu65h3IbiSQA42GygfOeo6z3mhPfdX68TO5yUtXyM0kDbK1T77p5/WIKBwAe4iGArvoD/nO/fwv4C/4B50zEcOSDBCCtTtbGwi0iQOCPpH5c9sHnyhK8rnuZ9iG/gPtylVGQIKgGAAA6cBUQcX8DKIgHYFAmAUcCpQRs/i7IKyACcAE6BDy0S704/Dxf+N2YLkChHG3zu0LSJo66ibNPxNEW9QnuSKMv9A2/Y7B/lBfAIdGB7dbfOunUi8NPnTj8EAPUTxp10BfqxuFXx1VH9LW2Qxw6wGUadRFmDLZPm/TXfOZxfEjy2g/1ZnkkfeP+ru1Rlvw4/PxRD2AWl/EXqRckRsbjp376qN7Mq66R9MP6vUZVV5YzH3ry+hKHP+s0DUm/LY8/66btvK+owz4j6bd12TZhyqlX+kI53ik4dIlcAuqzxYPgjtfpsq6FBQp+dEQ91KejHfpIun0nH33xHqvjd3xKyjIu9YnMsdGnhTuLPi6Cu//jfcw8kee35wD87H/6RxtZAQjaeban/7qkAO+QSgTwjnA7GPPSz33W/X9r99rqLXQNdA10Dey5BgD/uBe94eF7Vv8BkoAxgBd+wRjhBGfEA/LIy54r8gJOAf2SADyYAQB5DgAEwEt+5mIbABOTm1AVgJi+4gTKjlMgvc/gv/aVPk8RAYyT67VcCb0RkiWvo4SL4N97iH67msdLWfDP/YOfyROO8VKGMVAH/nWtAP7u3/uqb3NytUoykdslaNQsXSuAQzr1X/DP4UoJ/pkQJvgG3Av6q9QKgGfBGOA3vgX8TUMysaMe2qBe+0B/1HPeiwfsHz4ZKLjhWck9ShgHOBAIcX9zD9f7HFABAAF8ADr1EwagCFqoR+CSdQhKqJu8ghra1+R9CUgAJ3cgBQSn9BdgJZgUHClth7bpG3XjGBdlcLRDunmR9oF8jIf6Mn3wL8Ea48QJICmr/rJe0ukDrlUfuiGeMtZlm9RJfNZHGn2jLdrPvPQ7de11I8668acOLI+kH9SBy7qpxzJZvzqt/aMu4qgH/5W/5TYT6sHZR/IQphxtp66Id8zUSbvWSXnC5DFOSR2Uy/6Rl/qJw48jH446SHP89s14dK4eqJe8SPIT733JfUqYeMoYj0xHun2dlAud2Q5lcI4BiWMcvv+yLq47aZTPOvTTz8Xv68bf4zw7mfPx3pIAGKwA1iAAAOYV7NfwHALAMlOS98MHPvK2y3cM7wqtwphjcE0YU//rGuga6Bo4SQ1U03/M/1mRFfALhAkLJAVwKU0nD+VZfaNsngXAA7kSAA//wkMD6cBLBdPom7gIAFJAJX2234THgLWkwD7KuX12vJymz4TmJvRMGwAD75skANA7YSYUTnQf/ZHXXpIAmOr5x30k8Fdy7y2qv1whnRrPOuDfNunTJ336fZ81Ve+GaWcAU+53CYBDsgKAABD8SwAIupGAcME/oFzH5AuXQH0OAZBgP/3WV+u0L54tgnXThtdpH4vdXQJsJv+XnxcTFAngKtD0nq6ScpTBCTaQgBN/k5QBTFWwBtACgAGSaU+QI+DiGSOgsm7ySAqQzrUhD2Xss8CHePIQT/9q3x0rddIH+0e/TbN9QWHWQd/JR1narONFB/SbfJYjH/2hzcxPOvnIX/vqeIb4BSj0jz7ZZ+OUpGWfCFMeR7z5UlIXfcixOkbKZDzlqMuxZz2My3ugVaY1Rtpp1UWfbOeesS50UeunH+RDx5UsYgwCZ9uqdRLG0SZ5uU4XdV2chg/IZ2UfyXuJ+4PxUB959dNWOsZnuNVn0ilrefvBeMhPWdqgX/W+IZ0+pvM3QZ8ch32n34vf/q2Afx6IvK9ZLOKTrizeQAC87cOPnq9rBQBw1wn4K5gnvsYZtsyUlACoJADvCMbQSQCuaP/rGugaOEkN8JLlQQgQ0fQfAgCgC2jD8cAnLFAmnMAfP/kAmFmGzwRS7qFXvmjSAoAvAWABgFnZTX2rm5Vw++u4COv2Eehv0ifJmyzLGLlmrKAzqdj1jY+uuS8E/EjalwxA0j8nVm4JYPLEH0QA6QJ/pHVw/071n0P9rPeitvX/Qx4s2uBTbVv5YwLnb+4QCQDMKAH+gv9c+a/gH4APQK/SlXrSEtS3/EzwWvESABIMP/7B77uy+s99hJ4XF+1sKxduDysBTPMbwAGWkdxfkASCCEAJIAIQAlBJ568BwEI6kjhAiqBIYEK4ghfLV0k9tIOkjACJPgHA6ONF3y8OF6S/hEljDIIdwoAgQSTjoB/URxx9rm0TRxnawpHPPPQHfTAmZB1PliXdckjaJN02KZvPFvz2KeOJoz36dBm/XB1Wt3UVmH7aDm0Tprz9Ji7/qBe94MibaZZDGm9f6VvNTx5BZyvNOi5lkBqXcQsP+rJt+k2dxJmH8Tn+vEakk4+xcA2QeZ0oR715f1OPYaS/Bwkm4riXWo6yjhNJ/al7+5uS/tI3+uE9ST/VG/F1TFleP+1xLaiLPuKWBN8Zvwd+Jxe/if3Zs/43Pu1Tf5Hn6nD2y2Ku+N3vf+T8Tb/5yGwCQNCfQN64CvgzTwX6pqWsfsKSALwvkgiQBOA9gf738PHeu9Q10DXQNbA7DbASycPcU/8B/0zoBcISADwkjRN8tUgACYBnvfQZ5xAAAFAIALcBIKsFAAQAbPKXvfR55+yN3t1oH6+ZCQLjsL/pd5yCZkG00vh9lPS99ot+Z9/xk8/riDXEQjM7W1Hw5H/aE7zrp6/E6dgG8FP/5Icec4IE+Hc7AHmSOMDPhOnxq3qvjxV867qOZAK6LWsAJnT85nCHSACM7fuv4B9gLkhPye9f1wL2q+KyLvxpUcCkjueXZp43RSjee+ftRcwdwIRgmt8KwITJLgBH0NP6XQDABDjm5TeAIyzQATxR56q6AEOU0VFG8Cd445mMs58CKsKmXYChC7KDeNunPsdGW/S/gk3SLZNpw/gXIJa+ka7lgiAQgGb9+MkvABzGvShLXvJYhjzkdbwZTxp/pKuDi5ir/6nbcaTfvtuXq6WuhtAhjvLWgTQXddQwfU3AzVjtJ3VZVkl/TM9xUgf5TUOiD8sNckmEoHcc9xz10S8c9VHGa+f1WRLXw0GU+AHLi1/csB+ePOSnnmEcizYYI32hfurDbxh5pU/LAG2r6yvpy/qyb/XaJ6FDHenQJ876s2/oaDmWvXiAtDqBfnl3QQQzX4QAeO2vvfl87tcAWiC9Av8E+zV/5jWfeUwzjNTle8N3jCQAcwzujdZ4e1zXQNdA18DRacAHOcCbB7lOAgBwDFBkxR8CoK78A+IEkZIBlAFgYiIMAUAZtgBUAoDVujwHgLb5+sBNEQBcTIEpfXYsSMddgfShhysJwHgYK9eObQFMsndxk6tndCuI1y/wV/IidrIFEVDPBMjrRL/nnO6+ifm/fVAyYVuuzFxbRUxYkwA4NBIgV/+ZQOmq2X9OuLQAMM5Veydi68paj31A8vw6gsP/rn2fRQV3BEUJPPADXABEgBGACKArwZ/3v1JQRzkmzNRhmQQygqqpuqwTCUCijPUZRxv0HeDvGARw9IEVUhy/KR3PMUE8eS5A1YVlBPVQJ+PV0aaOfhDPmOgD8bZLmD/S6KtjY9yCXMsRZ79pU31c1HDxn77RT9rIePymkY6r5ekn9TOWWpb+2x/axm8e9Ul54pC0Zdh+U7f9YpzkuQDaT/gi6jO/9RKmj7RtXErSSaNOAT116mhvcb8OX01gvLlyj5842ic/Y6APxFXntaeNbH/K7/Wk/14/JG3RL9rCrz5adQ33woIYqH/0tdVH+knd1Ev9hLlW+w7+eabwe2PhiGesBABynW0AgvIWYM+4BPIV7Ne0qTpN872RlgDMRXkff8M3/u1/xz3GGPtf10DXQNfAUWtAEPKCt3/vJfiXBAAsArYgAPBXAgDgKCAmXxIAgDbM+bECYEWXB7eHAGoBUAkA9pJBAPBiuSml82Km34wFl+CScK6mC56rVAf7KnMM9NH+21/C5PH67cIawAMA0S9A3/tF0K9ktZ+JF5NQzgIgjEsSoNbBNZxxv9ypE9Y6UZsKMzGc0cY6Wc7QO78/wP8hEQDs/9f0H8sdgTe/Z0F9XfkH3DPxUkIGmGcu8HfC5gQOaT20bT9y9f8mycR1Lv4t5L0fsMHEXYDE7wY/cQAPwuTRAUoAL4Aefo9Tvw/S+H0BZgRKAj5An+X5bVMfeSqgrfVTTnBEXwB01mNe6iKNPj8OoC6sCBiTgArijnHWMVqOsjjC1JftEg8oQBc6+sL4cIyDftBfwSN+6qIc7VKffVYCGClLXuNSkkY7OskG89AXxkc7xinRE22Sh/L0zzQkZXD2l7pTt/gdE2k+k9ENAJVxUZ767ScSR7vWn9L7zTjD1KXOSWNMi9/HGY4w/aB97wfaRO+Mw3vMa4Ekv+nkGf4WwNy8jpl4xoYjjXq9l5CMhTzoAn+2S3z9U+eOhTK2SVnGshhTtbK7w/2xHO9CHM4fllXMCbHcdM646TYAwXlKSYAqydOKM34sjfeM9fMu4f3hO4U03h+8j1lQ2BbRfzhXs/e0a6Br4KQ0wIOOBx6g2wc40hP5ebgDtgCKgGFW8nEAF/2kC5QFkBIGSOr4+X/22kvwz4NW099KAPAiYRvCTRIAiwt+h5Vvx1GlYxMsKwXRSuMPRdZ+E04SAJ0sJ2Jb+U0w+UG3OME+94t+2v6J97xjmJAB/AmTRhx/P/Sqh/9AEsA6vN8WHTyb00nOAqiTtjlhJpRz6l83D/c5rhIA+34YoPv/Af8SAPyWkwBIkK7fSRfPAOOQhOc681seEsGzBCQAICdc/d/mPbzu9d3D/HPOsLiz6DcgZfjagEDX34lgCJB3D8gy01ICtDKPIAswJDjKIuTnt7YKaGUZ/fQLgEh/qRuHn7oAZIBNJHlox3EIOAG1TPpx+HXGcR/lijTlqFMQK3lAvGlLYMdtcPnlBsEhUj/9tK/0F93iciyOJ+NoZ1H3sGJOfvVKXvy4zJ9xtM2YqIN4wvZ9lVy0yT3C3x2JAMugD8bt2JDE0RY6sk2uM9cAWe8l+k99lKX/eQ9xvSmH89q3JPXWstTrOJGEqQcCIOvgHrF/GY/fe1i9ItUr5bwH6b/3BG3Z7kJnlQAYFHmI/xgjizzM2172C28Y5pBsBVhlBQAIf/8fv/USjAvK50jBPXn1V1nrMb3G+z7yXYLkfcY7mXt2cU3mPC8P8dL1PncNdA2cuAbud/U/D/67JAIWD3Um0YAtwJhO4I8E3AMcAckAX0EkfvIjyefKP9LVfybtSQDw4P3W173sNgiA+3iRASYZK2NR4tc5HsY45g4F/DsWr5n9Zlz4Gb/gGt1s43fCpFDdCvolALhHmIgxMcf8n/bNQxknfPSbMBIygHwQFev0jwlandRNhWkbMLBOG3PzsjrNZGPfrABY4Z/6JCG/U8E/cgr8O8lK0F/9hHMlRjIg4/TnZE1rA9oX/OfqP7qdey16vns0MHxdQHADSAPECOYEfqQDpABM/LYASPyOW78p4ivYMp/Ainaor1WHYBGZ+6utY0pWEElewRogzvEJ1mqYPPadZwL5ALM69MEzDmkckjjJBcLWj+TZWvOTh3gcugZE6rJe/Isrdkb95keapxVHW7YXz7Qz4+wbY8dxbbNO6iav48FPH8mrbtApZYjzeqB7rqnOe8p0JNcbN/V8pg3Sp/JQF9fHvtM/xjXcM4s06sBPunGUaf3Rb+oyzbGpY6X6oy3G7rVdXB/A/h30tdT30YB/nhaQY7y7PAhQEmCbVgAVtM8JC/iVU2V4r+DyvcLWVd4d/O4YZ//rGuga6Bo4Kg3wqb3W6r8WAEhW+gCFAC2kYFjACBCrjjTjyM/DtEUAMGHfFwJgcWHPBLz0mfHiHG9KxsYYx0gAQbQ6um1pf+f2w/4zZnWy3BLgqs/Gv4N6DgAgnzbYIvJL73/HQBYJ/JVeC+8/woB/xoWfSdc6HVr3QECsBtapf528WOAwrhYBgBXAvloCMOGrBIBneQjKc0KF34mW0nTBvpL0SghknOVsJ1f/Bf88t9ApE/R1rkfPe48GBnAIwBH4lRyX4JHJMr9FQRAAcAyoAawAXzjyALIEgIKtlKRRH8AKIC4oQwIqqQNgR5h087VIAuqyvWxjHT/9pj+ASNrD4ScOV+MEhPQ12yGvur3Q7xO+iHrMw7gsC7BEt+iZ+xo/Fgm4Sz0vzNzJT54Et9RJeVzupSefgJU+225K9JXA3THSDvXSdiVXKEP7Xqesb8pPOfpBG9l/y3CN6YtjoX3KmN6S9IG66CPlM49ppDMOnH7uHe9T+kQ8jr7R/uJ3MAbmh0MIJ9LLT+iwgxIALCJJAMyxAsACYFMrgClAv2kaffHdwruMdwhbHCA5DvsK9d53DXQNdA0UDfDgxrX2/rMFAMdE320AgC1WagGS+CsoFvQryUPZBP9M7DX/57uxe0QA3AcYA4w6NmWOU7+gGvCWDv3giJsLuPc1H2NIEuDigMDrrYQzcUKvuAT46J22jGtJy6lvwuuu/vsTuJww52yw4WfiZ5ldSCbyjMffYt0KMLUKv4u0VSv/tomJvQQARJ7gX+lECslvviXNU8E+4XSCf/Mrq+m/4J++oc+++r+LO3Z2nZfbBwBZOMAU4A3gKJDleQCgIr3x87sS1cpDXP6WBWi0k8AwgSMAmD5YjnwCQ/MJciuwtUOtvpg2JrM/5uH5AojV0X/7Yh7LIWmXsVEOP3Gmm58+m25cSuonD23S3iZjyfr0UyduTn30z2vvdbAeJHVM6QRwTrlWWeuhDtqhT8YpGXfeh0le6Sed8vSDvhIvYUJ49i/hyDPyrAUsuw1AEuC2rQA2IQIkAXi3MDdl/spC2eIS9q0AR34f9+F1DZyMBtz7z8n/TfP/5TkAkAA83NnnJQADsCbIBQwLjJXk5eHpqf+SAJr/v+dn3npeCYCH3vm8YQvATR8C6EXHlNIVb8fKePA7rirRBQAugb/+1NG+gvxV/WJsXF90gG4A3OhJnW0iW1YA1i8BQxgSAGma/pRhxrpWV+acBcAEclHp2VoVr5/5zhQBoAWAUgB+E3KMDCBe8K9MIq9FAgjaBfYZFuAnEWBclZZz9Z92q+m/q/9M1te/HL3EljRwB5CUDtAP4cVvlmcIIBsAJ7Dl9yZBAPginbCgUrBLPoGcElBLXa008lAWMFeBPeUGAL0AlEjBHv0mb62PMH0jXfBpOcdjn2iPvIzBuJQC5oyrftqwL0M/S4bsf0m6J0jf1WVNBBALuHPMl/UvCuBP/VDGetSLVgmMmfymX8qFnv3zWlNna2zko17yZZ8sz1i85qTjiLMuJNfEexC/hIcEwNTqLmncr1hmLH4TCQDvbOk3chTVsI2N9xOLRYB/CQCtAFzpn5KbgPVaptZf0+eGeefwnuE9xvsFggPS8CguVh9E10DXQNeAK44cuFcJAFf/kYB0HJNqAC2AURDsSr9SsEyYT/4J+pVM8CsBIFhAAiZgkSElbuvkbkzdBaGOB8DpmFuS8SYJIPDfdyKAfq8iAEhnbEiBNzq4DgkAMEvd5mo/bUjCpLTtlEzOrvNLZrLoZLIl+WzgdeqfWxYzwzkkwK5Bv4BfOdZeJQDyN6xfoK7kt68faRiJE+hXv2EnZZSdAv9sN+LZdlvPj7nX/ETyAZSGPdALmaBp+BqBwEyZBAEkgSbxxOPIx0QcCbCWJFACuAV/rd/znDgBbxO8LirgmUF7gFbrE6QTL1ClH4RxrecMANRxJUFAOdumLsaKLnhmZj7apg70gcNvf67IANz02Tbpl+2QH3BMPaRnmvqwTsfvNXC8ptNH2hntjxknJHVyLVvAP/VjXxyTkr7RB64L/WA8gHn1SHq6xb2Z4P5EfprbGybvYZ65EABuA5AE2KUVQAX8Y+G5wD/zUdfP/qd/NBAAD//CQ8M7ZUkEbU9xvaauga6BroGb1gAveh7YT33Bc5vm/54BIAHgHltMa9mrzcq+oFAQSZh4gH9d9ecgFkgAwT9bALQAEDAgae/7fuotg7XB0uzqplVzHxMtgWeCTYE/cfqrBCQn6K9+dKTe5gDvfcpjvwXu190OwGTNulLPSQboJ11SRv1fF/xzYwHwx+ahTC4XWRK07Oxe5PeIfiXl6jYAVlduwwJgjAD4zjc8eI8FQP6O9Sfgr6DftAT+gv0qW+DfZxKr/2n678n/fbK2s9t1WxUDuiAHzhaO39kcEGYe8p9dALr7ngSYExwDWPntCvwAf4BbACEurQAEquTVVUDL84H6WvFjz4458fSTOqfqBcDybGB8jCEBO22QTjyOPq5qF/DsOClb89ufOXXVstRNncialuG8LlyLPKPB8TBenu+8i3lPMD7S6J/XD0ldXEPyl/tn+DIBZamD+2SRnn/cP9x7OO+pTO/+NTXAu4tFopf8zONWAJIAfBFgDJwbD/jGnyB8ym85JEA9Zaalf6q+mmY56uZ9xtiWpDL3Tv/rGuga6Bo4TA146vjXvP5b7ln9F/xjvuXqP5NtnHv3f/Hn3nTOZ/10hCvod9U/ZRIAP/VPfuixuneYhywWAGw3YOJzW9rFRF3AmSC1Av5WuGUN0CIC9gncr9sXdbLcf88kaqM/JmfomnqSBJjyLw8j3Ki9WoiJ4diE9aZW/5d9uis5NEYCjIHxbcW76l9lq/7c/y/Yb0lAPvGC/SoB+hXs13At4+q/Zv9I+oNjBQr9YVFRr3UPH60G7tlqACAM4Deckg8hBKjE4ceCCXmR72JvdwXZAG6AJkBSEC7wFEhDPOiI008+wCl1VpAPwCY981pvBfk8n3xGkQYQph3jElzrNx91ToF56hBE05fMW+unXeqzDaRxjBH9oCcJC8KQL+ptqG+5b584nr1cC/yOPcD8lXcK18prQH7ClOXaLYm+DuJv+ecNOGbeltsAIABwc6wAEoADvg2nP+ME6EhA+pjLfK26rLMlLUvdngfQ3y23fKP15rsGugY21wAvTCbJPKxbh/9JAOTqvwQAk28m6AD5KcD/R7/3juH7rEpIAMtJIkAA1H3Dz3rpMy4JgAZrv/mg1yzJZCOtAAS8rj4rWwQAcatIAMAepICr6usC8NvOz/jUCQB+TfXW7Pc7EQTcU596Vc/E7YoQYuKbk1r8TNgXnbwyCa2d3naYCdQ+WgFICEgEVPN/zwBoEQCrwD/g3tV9LQGQ+jMdv+C/te8f03+eaTzbpvb1bvu69fr2QgO5oot/XUA4kAhaCwBoBa88mxb1nS3cnQSeSRwIRltxAOx8vvBsoW7KWE4/750kCwDYkgj2xzYAwtnfWo66qBdZgbt1XQDxiy8KmJc4neSFRAFtEwdRgMNPOfSy0E8+L9HXpSOPddp25D8jnbqXYH5qhZW0qfRFcv+7DQ3wzOXZW7cBQAAwp9y2FYDAXzlGABhvPkF9C/DXOPNaB1sBeMdwv96GjnubXQNdA10D19JAfvpvHQKAyTfgHSCPA9Rr2p8S0J+r/vrJkxYA9QBAgAQggxcIJtDXGuT1C99hVbplBSAoFaROSYC6YL9lBUCa7rZB/brtJwnAgZLXV/l9dx7fp3mxOrScEJ5toe7RKlqHAd7w6v/QNybI3gtMpNwGgNz1FgBBfpWC/pRY6awC/ZIBgPYxEkDgz7NE0E9+w/jTrQL/mv7viigavYF6wrFo4A6kM2AWtySREtSuO87hKwgA3nT8zpfPtXvqI568AGuceYlv9Gd4XtJXy0EW4KgjCPShH9YpaF80zthaYFqQfSeBuwCetiAVcMYt6plDuNDe2dJdR6+LKvrfPmqA9xYHODOvdPVf+dpfe/PlKr3AOiXgm7AgvPpbeYkTnK8rrc/2xqT5hvp/90eHrQDL+Wnrt7OPl6X3qWuga6Br4EIDPKRxrcP/YGrTAsCVfyQTcCfoTNIF/QL8BP6k5eo/eSgDAUAdEAnUKVBAYsqL+T8gZB8O8GJyk1YAAP90U8CfNAEyshIBAr2U6wLw287PuBwj42VCeKC/sbNcPWO1brmidaPDYYLv/eBvVBJAAkCZgHxXfsmAWj8r7RIAyvwdVz+/d+ISzPscQVYiIOMsI/jnmaHpP/v+3fuv6f8+PDdu9Kbpje27Bu4CxHWLzp4t3CRwSBJikXc2UOb5ATgPsmBR/PJvsF7guRbEwGXiCo+EAH2pQJ9wjVtRXU8+Vg2wEMA7q7UNACIgrQAA1IJrpSCcMH7jp2QL+NMO8cpWnmzftqqs/aAM7zIsVbe06HGst0IfV9dA18C+aQCQBriYc/gfWwAwtZUEqASAwB8pGSDwzzTTAf+QAEzqWwQAe3ghAAA5t3UAYF4vJkpTBMA6lgASAnOIAEDgbYP7ue0nAcAYbwM45zXb1J/bADDZ3bSe65Zb9TWACsa3ERboV9mqmzwJ+vFXwN8KM7FqkQCC/yoF/kjBP88iTf8r+OfwUZ5rh3r/Xfe+6eW7BroGugb2QQM8h7ESa1kBuBVA8K1MgM+7Il2mjfmpJx3Af8xlvlXtt9qjDHNjxrkBmbYPl6j3oWuga+AUNcAKGQ8uzLTqp//q6r8Tblf/KwGQoF/ArxWARIB5SAf8JwFAfQkWMOHdhwMA874Y+yTgOpYAAGOdq+YSAa74VtBfw3MB+U3nczyObwvnAaT6b8yf2wBuw/zfgbIP1nuC3+kuLQAE/An0ifvmFzznMeNqnm993csuCYB1iQDAPL93JncCfJ8HEgDGKwX/PIME/1gA5Mo/k0101VdkvIu67BroGugauB0NQGKzT75+DWBsK0AF4bwfAN7KFggnLsvhx42B/rF4y2VdY+1lPPkhAR549gN8KahbwNzOrdZb7RroGlhHA0yUcbCzLQKAh5quEgBOygXyCe6rub9EgMQAebUAcLKfBABgIg8A3JeVPPqhFQAgV+Bf/QJgZF0Vr2mCZmQlAgTwEgBK4/dROh7HydaJde7JfcgLk+9BXZjQ3mafVhEAgvNtSUF+la368/R/V/+VSealn+cGYZ8fc6XgH9kC/2xF6Kb/t3mn9ra7BroGugbu1QBzTLaYtqwAIAL8KsAYABf8KxN8V3+Cd4A+Zw1UwE97uBpveKwfta0M817iUEBI+3s10GO6BroGugb2SAObmP9LAvCwc+LeIgAkAwT+hCspYLkxAgAAwgrj8oCVvdHcplYAc4mASgJU0F/D+0oCSAAcqhXA8AmsxWeqFjfe7H23u7hJOcSOay5Z17ICaIHz68S56i8JQF3pJ5yH/7VW/1cRAZIASp8nLSn49/mT+/4hIQT/nvq/L4ThLu6HFXWy+tTam72iWE/uGuga6BrYjQawNOXZ/KI3PHzPYYAQAHxiGvCdwDuBPEAb8L+KAMgy1gXQhwQQ8Av+jTNseosEyHoT9Kf/X/zh2wZi+jnf++2/sdDi5Lkeu9Fyr7VroGuga2CmBjDNAlSsY/7PBNzJuBN1gbygn1X+CvYlAtICwHISANTnSiFWB9/9ptcPoOPTv+x//sOZQ7qRbGNWAFoDKAXAKadIAPK5eo48ZCIgxwlhciMXZsuNcA4An93acrUbVcdvYJcEgOB+TLbIhLr6LwmQwD/9/rar9Hfv8yQleXneIFeBf03/T/jU/+HU+uUK1NlGN1ov1DXQNdA1sH0N3OH9xYJOWgFgdZpbAbZBAgDKK2CnXgE//gT9LX+LBEiwP+an3IUVwH1P2r4Ke41dA10DXQNb0oCAYuz0f03/kU6+ldUCAPCvA+RLBgj8CVdSAAIA8K8TCDDZ/843PDgQABwACFGxpSFvrZoxKwBA/BQBIBkgQFYa3yIBWkTAbVsB0L6uWiDUMR0qAcDef76XvbWb5hoVaa3Db3bXFgCVBJi7+p8EgMC/ygr+Dedv3zhkgn9X/XPPPyv/rv6jm318Vlzjss8tOqz684k2zj342Cd9/jluUfhWLVfmdr7n6xroGjh+DUBiawWQwD/9muu7eq9MwD3HEsD8SQTglwQQ9BPWGadskQBZn22kJJ05MmcILa5oPwvg+G/rPsKugcPTAKvYggkYWQ/8g43Vj5QEEPgjnZi7UgeQT/CvBYBEgCRAjZ8iADgAEAsAXhj78AWAeoWvYwWQYL/6Ac+6CqwF3C1Z8+4qvKpt+57jOtTD2HiJL1/k9fLfStgDOysB0FqdnxtXwT5hzP9rfK0P0I0FwJQVgIQAzwuJgAT3Lb9EQAJ/njmC/zztP8G/pv/Lb6PfyvW5pUaZZJ6x6g/RJvhHQgjcUp96s10DXQNdA/dogDln64sAkgBsBQCAA74B0+kSaOOfux0gQbsr9EkE6G8RAS0SoPajhinzuc+6/28tBt8JgHvugB7RNdA1cOsaAJTxMF7n83+SAFMEgCv/yrrqbzxkwBgBAFiQAADsfPpff8pDt66wRgfGrAC0AEAmEE5/XSUnTfCsFMQn6CYuw9VvepbVvyot02u9U2HK2WelY0UHh7ofm4MA9wlQchihpB2/C6xj0lWQvk64An7CrTjqZAIn+K9S0L9KtsB/xvmsEfi76u9p/wn+eVagF6wkGj/TY466n/uTcX/sn/2s30jwjz8O3+wT0WO+C/rYugYORAOQ2Ly72AoA6Bf4uw2ARScBeQXfFWivIgDMLwGA/MAfv3MgF2wDsiGBf8Zvagnws7/7o+fLLwf1cwAO5L7s3ewaOCkNuP//y176vGFPlqv+aQHg6n/dAjBFAADsc6U/w4B/rQHwVwIgV/1Y/f+ON75m+W3V/TxVlck3XwQQ8AN69acUDI9JQDNpCZ71IwHYX/7lX3rppsB4TUtQj19Hvkyr5eaEKZ/91O840UGAkEP8fe0dcJK4qwTAOmCfvBXcu+pPvH5lzfs9r3rJYHYvCK8kwByrAAgCQL4yAT9+AD9pSoE/ddsuJ/67738frYR2fMMP4J/zDlrgXzLgUMm3HeuuV9810DVwSxqArIW09UDAOSQAZIDWAAJ75NztAEkCUI5wAv8kAiQBlFokZB+sL/uin7SlBUAnAG7pHuvNdg10DUxowEPFvub139L8/J+EgCSAE3TkKgLAVX4Bv2HJAOUYAcDEHwIAlpiXxWIYZxNDudUkAG6SAAJ/QHD6BcUpAcytsEBaKVBPEkC/QN48c4B7LUNZ3Trl7b8yx8LYD/X0/1u9oWY0DnkHAVBJAK0BNiEDEvjjr04y4OUvef7wqT3AN04wrmyRAXMJAcE+v39dAv8E/7THOSE8H/btkNAZl/C6We7HOoVnzxT4hwQ4QauI6+q2l+8a6BrYoQZ4bvHcrgcCagWATHCuJYCyBb7nWAPUctRnWxIAygT/xK1DAtBOPwNghzdQr7proGvgehrgAYwbOwAw9/9f1wIgV/1zS0AlANz/6wGAD77yob37BGBD63ef+LEf99sAXgGwwD+laS2ZAFrQX6UAX+CfUtAuiE9p2pi03rF0463TfrXGYRzjhhTp38Nt3C3biboL6F1FAkAIjJEBuaovuBf0A/LxI9NP3EOvfNE5FgA6fqvXIQMq6CcM6IcAqGSCJAPt0T7j5xm2T9s0tnN5J2uZDf4hAA71/I1JDfTEroGugYPWQD0QML8MIBEwlwQQ/CtdiW9JwHkSAZAA2Y7+lBIAc0kALFk/6dPv+6yDvkC9810DXQNHq4H7JQAww3K1H8nD17Cr/3MIAMC8K/0tKQng6j+yEgBuAXD/P4DjEFb3MMMF8AKAE/SnX3A8Vwq0lQL1BP7pF6gjBevbkLaPnNt3xt1X/3f77AD0riIBJACULTJA8K+sgJ8wRBxS8K+UBEg5RgYA3iugnxsW+CtpjzHxDDvBFe6zqZX/j//Epw9fAHALwKF+gWO3v55ee9dA18Bta4DnN3M85qC5DeAlP/OKK58GBIwLwrUCQCaQF+xPbQnI/Om/Lglg20pI7L716rbvrt5+10DXQFMDPJwkAOZ8AWBdAgBwL+BXEle3BIwRAJzozf5/Xg4cGtMcxJ5FbmIFIKiekgLwVQQAZEAF/5RNEsC61pFzQb/5+ur/jd6YZx6qNLYdAKCsSwJAwM9vTJfgP0G/4B/grwOETxEBkgKtbQJzyADBPpK6lLTJOHh+neDq9v0cBFnN/ivoF/wPcnE44I3ekb2xroGuga6BGRrwPJuprQAsSDH/dEUef67Esx1V4D1XJvi3DHVKNNhWlZWEoJ501sWng9miNUMFPUvXQNdA18DNagDTbCbQgIYkAFz5T8kDd10CoGUBkKQAflwSAH5SkDMGACQP/9hrhon+oRAArERu0woAkA6oTrAOwM9V/+qvBIDg3zoI658rBfZzJTq4pdV/Dtw5xUN37uSZAG4LmCIEKhEAGYAD6OsA2hX4t0D/HBJAMkApmE+QX/0J+s1PWzwbeHYx5pt9au5Fa3eHE/8Xpv1XQP6KMKTBXvS+d6JroGugayA0oBWbJIBbAdIKQBLAuagkgEQAp+4nqHcrgFJgnrIF3K9DAlg39S6/AHA3htm9XQNdA10D+6EBJpFMollpTwIgzf8hAfKBu+oQwNwCIMB39V9ZiYEkAD7wkbedswUA8ynAP4cAsnJ5SBN9gC8r4IDllPh1Y0AaQE6aUn8C9XUJAMpKAmwC/rPtsX5nPOAfd4N7/4dvoC9+VUgJgL07uf8mfvWupvC7dlK1igwQ+CsB1xIAFfwDvhPsp19gv00p6LdO++X4ltf8JlS7T22cVeA/ufq/JAZOcJvEPl2z3peuga6BCQ3wTGeux1YACQDmorgkAnJhCr8r9m4LENQLxufKJA+ok3br6n+GpywB6Mty//9JzkMmLnNP6hroGtgHDbBnnYfuU1/w3CsEQH3AJglQCQBMr1y1B8jrBPmQANXkXyJAOUYAYP5/iATAlBUAQHmMBEjQL6DOOIE4IJ5Vf4BdXf0nDEGgFQBl5oB+2rP+lBmv3761JGMbwP8Tn/jITdzjH/MxH/MZbLtotHmKVgCq/KwSAZABlRD46uc+8zG3BSCxCJAEaFkCCP43Bf1zynmwn4BfSVnBP/c9z61TNa+EWKsEwJzwCW6V8PfQZddA18Cea4B3Oc91CGhJAM4EyHMBJARSMj/97vc/brrvuQAJ6KdIAPMlcYCfNqw3gb/+KQLgx9/88n/d9//v+Q3Xu9c1cMoa8DMslQDgwZckQMsCAODf+gygBICr/1UC+iUHlL/1//3Jc1b+dVgAcAI4oAQSAHlIFgDcU3kWAKAYsCzwV7YAtHGA8PQnKJcAaIF/CQDyCPz1K7OuKT/tZ7r9mZIAccZ3Eyeyc7BZ6hJ/P+zsyhNtOCkewMhv/b/7jP/xx9hKIxlQpZYCkgKSAQLvSgDMAfQA+MynXynAH5Pkw9kHwf8pT664xwX8Uyv/Na3/Nq78Nnqga6BrYM80IHFdSQDmpGkF0CIGBOtuCUgiQJA/RgQI/qsE7FuvwD/lGAmwNP8/2zP19u50DXQNdA1caGCMAEjwr18SYMoCAEsACQDBvYBfCSHgyr+yZQEAAcBknz1hrEweGgGAFQCAFLAsSK2yBaQB3K144gTjAHmAPvppkQCu/lcCwPKbyGzf/jm+DEMAcF/t+Dd2N7dZ0L66DUuAsx334ZCrv8t+cO5RJlwQA/y+khxgJQZXSQLCxkMUSBIoAepTYF5C4GWv+QcDsBfgtyR1eQgh9dunUwb/3HT18D/JgJXy4iDAvif1kH+5ve9dA0euAd5FPOshAdgKgNMKQODfkloFCNivQwRIHiCtL4G//mwjy3Tz/yO/SfvwugYOXQOyrdexAMgtAC0CIC0ABPySAyld/UdSD2cA8BlAgMIhWgBwb2gFIFBOKWAVPLekZEAF7BIALfBfLQAkAagj/bXOVpg+EZ+y1U/iGA/gmzHv+HdxR73aF9q2//hJ7/udN74K92O9AUGA5QDbhCB0JAokCwTjSsgothToAOyAegG/sgX0AfnG6xf4QwLw+6ed5UGgZxuP7DgK3lkF9OvKf+bvBwEex03QR9E1cMwa4FnPM/95//DlV0iAFvCvcS0ioAXU62p/hgHzOsoK+Kus9VKmm/8f853Zx9Y1cCQa2KUFAKv6CfAhAgxLBCiJTysACAAsDbACONQtANwi6FegPyYFsSkF3RmHX5ArAbArC4BsyzaNq30yDPjHARh3+fPIlX91ij5wf+3JHz8QERAAHejs8ircdx8kAdea1RqtBLgftQoAuCcBIMBPKdg3zjBlcZAI1MlEEAJityM6jNq5rxPQr+vvxNhhXOfey66BU9dAiwTQGqCC/lZYIgDpKn4LsCfwxy/wV44RAMTrzIvE/P8mtkCe+v3Rx9810DVwDQ1oAbDqKwBsA6hbADwDQAlo19VtAGn2n0SAhABnAFQCgHqxAsACgC0AgIxrDPW2ip5hritQVQKa9SMF0VVKBFQQTnhq9b+1BYAyYxYAtGsbSuPsE/H6a58J38TqP/dr6g1/An/70fc63+ztDiiF7HLCBmCXDJAIEOQjE+i70p9fHuD3LvCnzk7mXF7Pu1Pm/1Mr/xIFnUi51GX3dA10Dey5BtxyxlZQDwbMbQEA/zmkgGSARAAr+S3wLpA3DVlX/bNs5qMs4ad88Z/80oVa++n/e35v9e51DZy0BvwKAJNtHqLu929JCQCk5wAI/pGCf6QEAFKQn8DflX8k6dUCgG0A1PnIB15+zqnggANAxSFeLCbcTL4BzxW8GhZYr5KCc0CvBADXTr9SAoD8gn6ldYxJ+tBKm+qbq/+7XF3khGD1ZXv0k34Rxi8BcOp7xG/zd6JlgFsFAPBM4h549gMfxmEhAMDHCfqRxHMvO+Gj3C7vp9vU0aZt8xsQyM+VlRTAgmbT9nu5roGuga6Bm9aAhHIlASr4X5cIaJEBLbA/FZcEAP7Xve61/7zPP276DuntdQ10DaytAT+7UgkA2NJKAmxKAAD8dQJ/SQHBf4sA4EsAEAAvfO0LhhVDXgKH+GBl9RKAWkkAgKuAtoJrgW1LEocT7LekBICgv0rrmJL0iXT7ln7jkILuXe/9d9+/7WHuT5/YW/71X/D5H2VlGT3vuh9r/8hOvAC/WYA8ZGMlBQD7OMA+jnTyHeLv/IYu81kL+FeQT55W3FC2HwSYl4pVur5Slxrp/q6BPdQA8z9cJQEE/Sn1120BzGuJ0xogJWRAuinQX9OSBOin/+/hzdO71DXQNXCvBlit88GKeRUPxwr8MywJoAUAsmUFwAp+ywpA4O/Kv1YBdQuABwFS//Pf8HWXFgCYGd87iv2Pcd96JQEkAJAJqlt+ATgSQA/Ib63+QwhIAJg3Jf4pR9um62/1xzhX4zkwbldXAgCprmiPtg3/0Kse/oO3vf4H/og+k9bB466uwtbqvSsp8Ol//SkPYSED6H/CE+570tZaONKK+B20CIB14yB+j1RFY8O6w/3FuHlOSUghCS/1cTZWuMd3DXQN3L4GnKuyKFS3A7RAfytujABIMkC/hEAC/rQayHhIAObH/fT/279Peg+6BroGZmrAhyqnrU4RAIJ/pARAC/y7FSAJAC0AkBX8u/pPfoC/jnqo/6F3Pm8gAAC7rBLOHNZeZQPoAE4BrS0SQEArqEYCaFPqF5y3Vv4F/0kAkF8LAMtWWevOdNOQOgkLJOPa8Z77M1f/1SHtMib3lXPy/A30Y6/uqd6Z09MAv7ME+61V/rG4jIdwOWLt3VmM7QzLqwHgL3QGAcszpDqeGTji0e0JEiNHfBv0oR2jBtwixraxljUAoF/HfFYSQEmcDqCPX8DfkkkCkJ6gv/qf873f/hsnsgBxF0KVsS7He3aM91ofU9fA0WtAAuBrXv8tkwQAlgCSABIAYxYAgPe0AnDlXykhIBmABQBO8K+EAKCNh3/sNZeHgh3iBeFQmM/9zL8zTDbHSABBtSA7JYDcMP5dWQDQhuA/29NfpRPoXb70sPqgHckGTP8hON796KPDSfHG973Nh/jL6H1eQwN3pg4ATGIg/QB/nfE7JuzWGNL2sgL4/Wwl4xP0+7x17EieJ8g//XFfPTifYxABnQTY3jXpNXUN7EIDLAQxb50iARL8C/irbAH+VlySAPpblgDHbv6PxTDP2Gd+1dPf+NXP+Ip36VjggmxdXOu7u7jevc6uga6BHWlARvWrHvq/D2xpmvy3/JUESCsA/FoAIMesACACBP9aALQIAK0A+BoAh4bx0OcBtCNV7LLas1e/7KW/7USzgn3CNS5Bv8BbcI5cZQFAnlUr/1lf+mnPsG1XSX8Zz65PFWcyn3qDAJAAsQ8d/O/y1u1174MGAKaC2FzNXxVH3id/6jcOzrwQCfswpmv24QydDNtHFs8IwLvPictxLkB+9QP6jfuEP/cd55/wid9//uee9PzLMxN4lvRPeF3zyvTiXQM71gCfn2U+yLxwlSVAyyIgyYAW6DcOoI+f1X5kAv/0M1c+VvN/wP03fOPf/ndgBBz6xmJYP2G2ZRCGFOhf7dnxzd+r7xrYlgYkAL7spc/biACYsgJIEsDVf2VuB2iB/1/+o58aLAIkAfgaAA98HvzbGvtN1sPpsH/tKV85gOYK9iu4zjBAnLASvwC4dQYAq+M4ATx5x4gA67XuKk1H1j472d71ZBnrAoE+4B9H2LhjXM28yfuyt3UYGvBrIoLXKSlBgPyEz3zp4CABjKfsrn+3W9Qqh/QNJv2Qv1gEubrvMyh1kQBfv/kIA/YF/oD/dKSTd7matcUh9Kq6BroGtq0BngXMCfmMtSRA62wACYDWNoA5RECSAPh1kAKSAJj/H9s5NpCrgn7B/i+9/x3n//mP/uCx3/+9XzvHj/vIf/idj+J+4j3vGL7aJRFwQO+Ybd+avb6ugcPQgEwqBMCqgwCH1f+ffvWwFWDdbQBYAwj+Xf1HAv7r/n+3AEgC8DWA73zDgwMBwAP/MDR7tZdvfeuj//LLv+SFl6tPCagF3gBt3Vgc8ThAfssKIAmAMeBvHaukfalS8L3r1X81yMSfiXkCf8IHag3isLrsGpitgTHz/wT1CYQF/5/ywKNNAuBQfjusJvGcEfTzDMhx4ge46wjzbMj4Cvr/4if9+OPAHyuApSMfZW/quTb74veMXQNdA2MauMucEMeqNHPYVSSAhECC//S7+p9SEkDAn+CfuM991v1/a9HBYzGBv+OK/+sX832APZKtuD/5qz9y/rO/+6NX3L/4w4uzu97y3jef48gDIQMRwPaAsQvX47sGugZuWQNMdnh4PvUFzx0eoDwIW6b/xrkFACkJMLUNIK0AkgRIC4AxAgAiABKA+iEAnvPyr32Mvh7iCg0EAHvWnJgyQRfUCrAF5IaVxKd/lQVAAn/8GbaNlNRdw8bZbkoJgJtkvGGTBQGs+t9k27f8E+3Nn7gGuNd5bujGQH+ms/IP+Mf991/w2mELQJY7hC+qsAJVAb9AX8mYE/Crgwr6c6X/0r8A/uTTUSd1HYJuTvwn0YffNXBFA54LAOhchwRIqwAAP/PfBP74Bf+CfsISAciX/Mwrzpdm78fwSdE7zLPRI8Df8TH/d+7PFw/e9uFHBxJA8M9cHWIATAAJ8KF/+75BUs8Xft7nPHLlYvVA10DXwH5oABNrGVQOAuSBKNivcmAB40EgAYBMEgDQr3M1H5AvAVAtAVYRAB/86DuGrwFIAhziNgAIgO9+0+svCQAmoS0SQKCdoN84JWlTFgACfmWC+yk/9We67SmZjONnktxN7/fj99t7cfwagPAU2K6SmPoD+HWSABACpFl+33+/gHD6KtBPaTwywb+m/azwX1nlL6b+AwEQ4N+6rW+Xh5oe/93aR9g1cDsagDDMxSxX+ufKuVYAlQh48MFvevuRmLsPK/9YUgDi0RvkhjgAAgDgD+hnTt5ybuclD4QAmAES4BAX7W7nLu6tdg3csAY8B0D2FFMff/QtyY9aNlASIAkA/BIASogASQCJAKwAIAMkCcYkDxrq5JOAD//CQ+fPeukzDu1773fe/e53/TqM6v/w5KcNk1omq5/8qT81TMpdURdgC7iRAPKU+iEAxs4ASOCf/gruDVtnholrOft6KCbEN/xT6s11DWxdA4B1wOmUg0x01b+C/6YVwP4eBHiHyaLPScE5UoAO6Cc8a5W/gv8w96d81h/E5jGs5G39PuwVdg3skwawXnUb5Nd/wed/9G982qf+onNZiADms3PBv/nWJQGwEOArTwu98PnRg/572lc+8D50xpx/AP6Lubbzf+b7APoPfvSRS+AP2GduXqVxzP3dDtCtAA761uidP2YN/Hef8T/+WGVO/eGnvLQAWJMASGBfSQAZw8xT/WwD4KHy/W9/xUACQATsoxUALDCTV1avcJ6GymnVH/rQb33kAx/45Q9/8f/0f3t88rqYnH7mZ717WK1zcgvA1rUAuGB9rgXAGAEg2E9p3cTVtiUnkJy4vfg9HPwL75h/031sx6OBsf3/EgKu+rvaDwGA/6995TsutwEQhiDIbQB7uI3mfp6VCf4ZoyDd8Q7AfwnsZ632SwLEqn8F/z5/af947pw+kq6B49OAK/0sgHAAoI4wTotWJGlatgryxyTgn7QxEgBzeLcE4Mdx+J/zvAPW9P3olIW1K/P9BegnDPhnRV+gz1xckK9/TFIGMoFPBx6wfnrXuwaOVwNMenxo8rBkD9WurAAA90kC6K+gv4Y9CwDwz6GA7FPap8kawJ8VpOoAyw++8qFzCADc13/N378kAFzBesqn/fAwUWeC7kR0igQAoMt8p/QAQED/XOAv6E9ZwX+GGV8/JOt4nwV9ZPulASaXAt8qc9XfVX7Bf4sAIO3KNoD9+6TqGdYOudrPmDde7Q/gj8UVz1udpIKS5xpnjCyufic29+sn0HvTNXCpAQ6VY646Bur9PB2HWicZ4FeuxsC/8UkC1LMAMiwBALA9dPN/5tEPPPuBD2NdWwkA9vszFxfgVxKgEgGtdBYO+2GAl7dw93QN7J8GNJ3iQclDtEUAfN9PveXiNFBYwWtYAbRIgAr4x8JuNYAE4KG1D5pkJU3gn2AZP/F8/o/VfwiA537dD1+d0C5NUtmXijUAE3cm6RAAlHXlPesdW/2HDCDNVf0pIoD6zNeSpNe27VPfI7sPd13vwylowL3wFfyPrfpLALD6Xy0AfLZoBbBvRB5kB6v/9M8+SpJeHtwnqJ8rC/CnPkG/Et3yrN0nQvkU7u0+xq6BdTUA+Besj0kWsJjD4iAKJANWWQMk+B+zAkgLAPxHYP5/B9P/F7ztxRfgf0kCsOoP+He/fwvYt+IkClLyCe9+BsC6d3rP3zVwgxrwawCwprKrLRJgMAlagH/lOmcBtEA9FgCt+BrnJwHZVyQJwKGAbF+4QTU1m2LlCHAskE6wLoj+zkf/0fC91O94zQ9cEgDD5LZMZDkXgIk7E3kmwZTXWS/APlf+9WsBQD+0AFDatyolAlLajtIx2A9W6RhzOuKWD/m+gta8S3pk18D6Gqj7/3kmuNe/tepfCYBKAlzZBrBn5wDwLIcshdzwQL+NgT/P1QL+BfxVAv6XZEh/dq1/i/YSXQM3ogGeD3NX8pMEgAiALJAIWFVHJQJy5T/9mP8f+mIIK/Poo678P77n/6q5fwv0t+IkAJi380nBQ7eSuJEbvDfSNXBbGmAV220AU4cB5jkAAwmwYAp5WHgY4JwvAiS4n0sAUEYSwAMBsQJg39JtrmSxd0qA7Ip7Bd1MMDH95xBAiAAmoJcrW1gAFBKAfa1M7nFuC6AN6sHhb1kBEFfbrmEJAAG/YaRxAv+U2b59IE5HHNsd0MfiHu6HaN3WD7m3e1QayP3/gH8BvuBfSbxprv5X8G/e3AawL8pi9Z3zURwHsj4XZ4cL8G+t+ksC8Nxamv6f7Ysuej+6BroG7tUAVqouTo2t/tf41icB+eQ1oHeqrrQAwJ/AX/9yX/vZvT09jBjIC6xoL1f/l/v9WfmvB/7l4X/V7F+w/8E/ftfFOQELadzb3vuax7r5/2HcD72XJ64Bv6XKA1LWtGUFwFaASwuANbYCAOJZwU8CAP86JIBlAf86TLtu61R6VugAwQBoCQBX4g0Lrln9f/Dr/8mwwnWFBCgEgBNdzwYYJsNxgBeTVsC5gD/bS0C/yp+A37wJ+tNPmzpBv+mGkZAA3ZT2xB8kffhb0QC/o7/25I+/NIkX4CdINg5wr0sCQD9pEgJpBbAvBwFiPcRYnv7Mb7skAXj++SycLdcA/5r+H8EhXlu533olXQP7rAGsU52XVqC/bhjwP0YAtCwAKglAeDnPOdjFDiwqIAAuP/W3MP9nMY9P/THPFsS7wq80PuWQFsDftK9+xle869CtJPb5N9H71jWwNQ2wetu0AiifBbzHCmBJAsD2aQmgmT7STwG2wL+A/v/f3v/H2tbf9WHn1Y10/7jW8+RcGzOpqAU8IqQ4E9XJ4JLaPCUQUrAhFhlhbFwnhQkkcQxGxb8qyi/bGNkyY6WxIaauHTDY8QSoEyRnCkRKFBByyEQjJUGNZ8JEDYqqatL80VFVqWl8Z7/3s9/H3/u9a++zz7nnxz7nvK609F177bXXXvu19z53vz/f71pr3yJARwGMhwLkxIDZ73ODOMWGxuH/DeQN/nOb+zMSoD1S62GuCyMA5h+7+SGcH+9f/Z/+/ePDA9KLl+GyLS40jLdtoN/WZr3xvj5ubHvccYJ/5xPyx3Xm+WwzRZEV4f1TMFqVAIFJIH+P830ah/038I9t5nu7gX9Xm3WzzXynNyN2pme+/Jsp4Cb8d5RCX9P8t3Dn7Sn8t5d/qW34zzkWLv/VekYCBE4rkN9451UA2KdgMBYC2uvf9gYM/7+XDr8c/39cAFiNAMjv9+eO++/l/j7+2Nn/E+4b+I+LAgvhP0ZX1TF32s+W9QkQWA3dbgHgpFEAYxFg6YSAJx0KsKsY0KLArrZFhY4CyFUBLvvSgOk9a+93fqgvFQDGZVkngfmR3v+pAJDh//mRO7Y5L0BOENgiwLPf+9sPM6UgkB/M7dFrGO8+LbVdZ1vbx+T+/EhOUEixob1xfVxfS2+nzbIUPTJU77pXx/0xIHDVAimk9fvXgD8H5N5Ouyv0j/dlWz0MYFOsu+qXeie98CkAzEWAnYG/I6cWgn+LrEvhP8tS1Ny89qMrf/F2gACBEwVOUwAYw/s+YX9cp4/NssyPUwoAuX3dh//n91l+L2cURM/+v9T73578Bv22XZ5h/8fzm8sD5nY66jZD/6/tCIkTP5BWIHDTBHoywPyxfeRcANMogB4C0LZFgG2jAMaRALuC/T73zaMAMgLgr3zq3etrvl7mkNb8EW1gbgGggb9tRwH0dtbLY9a9elP4b8gef/Qm/I8FgLkIMBcD8uM+BYH8wM9zdGoPfm+nzTrzlMdmag/cenubH9r5UZ3tjKG/8w3/fZ1OqnXT/jJ4PZctkMNp8j3N97FBP9/Hzo/taQoAWbd/H3KOgct+XUvPl5NENfy3EJDXuvQ3cfz7OJ/oL3+j9gn/Gbl1mf9XLL1mywgQ2F+gv0nHsL5tvqH9R3/2rx4H+G3rbluebeS+bittCgBZtunZvrbhNiO/jo//35z5f+79fy7sdyTAcycDXAr7x8tWxYD/7V//3XX4z9B/vf/7f7atSeBgBHpJwI4CyIlUls4FkPDfSwO2ALCuIg6HAmwbCZCgf56jAFIEePsH33KpVwXIsU3pSUqgbwGggb9tA3FuZz5TiwAJ0/kBm97+scc/P3pzO20LAGMPXnr+G/w7EiDLehnBcd3O50f/PI0hv/OP/LhO8J9615YKAHP4z2vND2zHfh3MV9qOXDOBfHfyXUtQz/e238+247LM93u+T5v1jwsAq+c4kCB8N8ektggwvr7H/iYt/F3aJ/in5z+mKaw47v+afSHs7q0XaAEgv0e3hfZx+Rjcx0JAl4/rjvO5f77dx6S9AcP/76z/1v74ax6uTwD42LH/j4b+sdd/nD8O/u35z2iA1RSfbP/Wf2ABELiOAqnc5Y/t+Ad3XQDYcxTAeFWA8VwAv/bPfm59Cb8O39+nt39pnY4A6H15jhQAMqWqeZnm+TG5qwDQ4N+CQG+3CJDH5sfrWAQYf/COvf89B8C2AkB+/Gf9FA7G4kGLCFl2vO2MPtgx9Qd12647FwD6esbX12Wu/XqZn0TPdZMEcmx6ev8b+Le1CcpnKQCMo4QOpacmQ0bb+5+2r/n4b9aWIf/9G7VtuH+XN/wfyuu9SZ9Xr4XARQukY+q73vz2h0sFgIb2nvW/62R5wv8Y6DPf9dN2flyny9r2Mbmd4f/X/LJ2dzP8/zVDAeCD/+Rj6zP/57d1g/3OsN/Q33YT/n/wQ+9cj8TNpf8yCiBW+R2Yv7ltr7ndRX/MbZ/A1QvkD0QKABkFkOOE8gf1NEWA8VCAbaMAnrQQkAJATliS7eQ5elnAy+x5zlD3FgAagtvr37aBuPePt/PYTPlxmh+6CestBqSdCwDrnv4tIwBaAGjgH7eT+fUP6SH094fzUtue/7n997/4W48PARhfR19bX3PaTRXYtbWv/utsD66ZQEbQzIfiNBCP7WnDf/5G5DFjAeBQToSXH4hLIwDyese/XUt/rxryt7X5+5rRWody0sNr9nG0uwSuXCAnrXvdG974WAEgoTxTLrHcwJ6TBeYQ1p40cCwCjPNdf253FQM2BcRr+7smI77y+z4+HQGQS//lt3QLAHP4n2+3SNA29+dcArm8YsJ/RgHMU4oDGaWb5VknxQEjsa78a2UHCDwukD8S4yiA/CHdVgB45DwAC5cFnAsAGQlwHuG/IwC6rTxP/sBc5g/aOCXA51j4XYF4DsjjukujARri5wJAfsDvMwIgj2sBoCMCjnvSpiJAe/f7w7qhP7c737YFgHH/+9rmNiHmwKq9OWYv/3EvTbnv2h7T9/g32JLrLJDv2Rj0l+bP0vvfAkC218MADu1EgLlSSkcC9HX370//Ro3tttDf5Q3/l/n/wnX+7Nl3AocokO9vLgWYIDkH9Ib/BPlO+c2aQNoOrI4OGB/b+RYAcrvzbcd1El6ve2jN/vcEgCkAPHryvw7/b7vfsf/57R2nn/+Njz38H/+Hf7Ke/vX/9C/+zTj/v/4v/9/PZcqyv/G3P73OE3mPUgzI6K8DORTtED/69onA5QukB3ffUQApAjxSCFhdTzR/WNIrnz8OncZDAhrc0zbMn7XNNrLtyz4PQN6V/MfUAkBDcHvCx6DcZW17X29nGx0RkB+vCew5rn+8AsAc/sdzACyNAEj4TyFgafj/GPA73x/aaTvf+9ImmHS/59fa19E292+uBnD5H96FZ0wxIj2AGbXx3HC0Oy9ardZiQC5beLSZMp/lCgIrBP8uVyDfmX17/886AiDBOs+RwwwO5USAK+Wjb/zar/l4CgAtbpxHAWA4479Lk17uR9mzEThXgfweTQFgHOLf8D+3OT9VevsTMju1CNC24X5ux/A/zt+A4f938v9LDpVNYWR7AeC54H9Sz3+vApCTI/7EZz5+POWQgkwpCGR0Qdq8H7/1mU8/TGGgxYC0WZbOxfx2z2ED+W22+tD4W32u3xwbI3AGgZ4QMJXU/BH9sY9+4LmRAJvA3+Dfdn0ywGEUwHwoQAoBLQLsOxJgPuZ/vp2iQQoA2fabP/LdHXp+hld79oektzs9+WP43Ta/FKCzbqfcn0LAesjqKnSviwA5yd9mWjwB4Oq+uQDQ8N+RAPMIgAT6hvulsN/7xvarXvptj7zGFgG2tYc05DaV74Sd9AgeT6vb6QHNsL7NaIUWAhQBzv518MgnEEiB6jILACkCHMhInbv5cTqPAIhFpv69atse/l1t/obmb7PepSf4QHoogQMR6HkAxlEACeidWgTo7bQtBCTwjqMBEvp3FQK6jayX+bTXffh/3sa8hrkA8Gv/8q+vjv3/fK//icF/c+x/fosn6Df8Jwf86H/77uPbWZ5lyQ6xz3ye6//z//rNR0YKPPzf/+eHmVIMyHvbUQGr3T3KPvtHgMAVCOSPxXgoQP5g7joUIF/wuQgwjwIYRwPsWwRIyF8K/h0xcNUFgITLjgI4a/DP4/7Un/rmh9/xPd/+ubS5nW0mrCagpxAwhv+x9z/FgQ7vTeDvIQAd/v/IKIDhEIA5+Pd22nk+P7TnoN/Xuq3dXA7wIHrS12dWnwsAYzEg86v7U4HO+5lQtAkOKQYcxGu4gj8BnvKSBfIZbM93e+rH25lvD3m+82eZut2E/0yHNFInowB6EsBXft1/tg7/3/AfvOmRIsCu0N/7Gv4v85wwl/xR8XQEbpVA/k71MID8Fm04H4N/59s2yGc0QI577+Wtx/DfbWV789Twn+H/N+FvSTplcgLABPKE9YzUnQsAPbZ/Z7s68V8e197+Bv1ss8vS+z9Pf/Mf/dx62S/97iceZj55IZki4b+FgBQIeq6AQ+pEulVfNi+WQATGQwEeGQWwcFWA/BFYFwE2hwDkj8v6GKPp0oBzEaCFgAb6uU1FsstSCPjv/sf/2yMFgRYAruIQgH5K8odq6ZJ4S+F4XJb5Ti0AvO0tb/xcphYDst0UAvJjPT/ex0MBGv7nEQDt+W971hEALQTk+Zde31wUGG8fUAEgAf7osREAcwFgvL0KYjm8I8WA1WMVAfpB116kwP0cm9+AnrbTOCrgPAoA2W7PA7AZdnmRr2vvbedHdv7PSREgBYAWAfL6s78N+Lva/K1yub+9ya1I4NoIpEPqje/6ruNzATTgp23on9txnfZGz6F/PDngXATI7Zsw/D9v8vpqKzsKADt7/1ehf33/qk2AH4N+fvfndgN/7p+nFAzmZVk/RYP3fOzd64JAzhEwFwJyaMBq1/MbzD8CBC5bYOuhALuKAMOhAC0EbBsNkALASUWAFgCW2pzBNEWF/MewOfv8ZROtny+BsQG4IT+3O992XGcM/y0A5HI3LQK0zX15XEYFZMqP4QSB9aEBm3MFtOe/Pf5tz3oOgI4EyA/qTN3vuV16XVlnc4KxQ+g9zz7cP1UBYCgG5H3N41dTzg3gH4ELEUgPVwsAS8E/y540/KdQ2G23ALAp1F3IazrLRjPyLGf9/lPf9PbjAkBGAWR/M+UwgG0FgIb/QxrVcBYDjyFA4HGBjMrLKIB09jTEj+F/DPudb0Ggt/O48XCAbeE/67cYcBOG/0ezBYAc/98RAPn9PB4CcFLPfzrhGvTHdgz3CfuZsu1OXda262cbKR70kIGcM6AjAnKegBQHcljATRiB8fgn2hICBy6QH1OnPRRgPRIgRYCpELB0XoCOCGghIH8wEvR3DfsfCwEdAfC6d7z2yi/1lB/TY0BeCscN/Vmv82kT8nOpm4b+tHMxoKMC8tj0yOe4/P4wXgf21ckD2+vf9rj3P9fSHg4B6PH97eUf78t8RhzkB3WG07b3v/s8tpkfb+e1ZP1NcD6ET3cKAPdSkMjr6evK/D7TppChAHAI7+QN3od8X8ae/qX58ygAZBvjCIDN5/uQZO/lB3cLABkF8Me++v9y/Hcuf+9yQtJ8j8dCQL7Lev4P6W20LwTOXyAdUvmd1BMCNtinTdjPcf8N/W17X9rcnyJADwdoyN9WCLgJZ//vu5CRqvmdPF8CcGfo3xzz35P+jaE/8w3yCfaZb/DP7/dO24oAYzGghYBkh+xf3qcUAHp+gBQBFHb7TmoJXKJAfpy2CLDvoQAtArQdiwEJ/UvFgBwXlPtSDNi3CJD1/8qn3v3wT37vqx+uSK58qFB+UM+BuEG/Ybn3d3kLAA3/c/Dv8rFtMSCP7XYTvPNDOD+SjwN9gv84DUWA43WG4/7zw7onIpzDf59nbMfn7+vKfhzY8Vv3UpyZA/9YDBjnH1lvdTjA6nN1tJoOYTTDajf8u4kC+bsxhv721HfZeYT/cQRAtrv+zD/3+T440vzYaxEgBYBOKXpmShEgU4oA+b7mhH96iQ7ubbRDBM5dIL9F3/SOH1oXARLgx6DfgsC4rPNt5yJAwn8e12LA2L71rd/3qZtyItGlAkB+Z28tAKyG+6/vS7uaGv7H0N8Q3zZhf91592//1nEBYC4ELBUEus0+R3JD8kAPC0j73ve+89ObwzLP/TNlgwQI7BDI9UPzhzdB+zRFgBYA2vaQgLTt/U+bKwSkzZe+xYGOBhh7/Duf+1IoyFCmDP/PsNEdu3+pd81FgAbjMfB3Pvel97/hPv+xzfPbCgIpArQQkG1kmwnfPVTgkSC7+pG8NeSu7su6Df5ps41sawz7fR3zsvF29iE9cQdWrb2X//xmj31vb16LAsClfotu15PlEJWG/YT/cT63z6sA0BEAUwHg6BC188M7/+80/KdtASBtbuc7nL+3mx+GvqOH+EbaJwLnKJBifg8F6FUBxl7+Meh3voWBti0C9FCCMfSP85uOjCvvWDoPvoysmkcAJJw/UgAYQn+P+U/bYN6g3p7+hvm047b+4UIBoIWAtOPjWjzotvtcaXN4QE4UmJMDZjTAJz/5iX9wYL8tz+OtOZht3M2HJB/6TOn57ZSTBamwH8z7dCU70vMBfP1bvmc9jOr4qgA5H8DmnADrM3tuTgiY0N8pf3Az9XYLAWMRYJxvESBD/PPHosE/bf5grM8iuioi5A9aihL5nF4JypYnzY/SBOgx6Hd+bhPiE/ob/tu2EDC2LQbM4b8FgGw7gbyFgIT5TunR3zbtCv0nFQL6nG3TG7diOaT/NNeXGds38M+Fks1x0gkX1zZgJEwdyCXftnxjbu/ivC8ZtTP3+rcIsBT+s2y+CkCXtV26P/f1efKc+awfeA/XuniX87ukGDAWBFI0yXfzwPf/9n6wvXICFySQ36L53ZfzAaRDqsF+KfB32dzmMWPYn+cz/P8mFf+T33IZwPEQgDG0HxcCWgTo8P9VmzDegD6H/wb79WECw2NbBOh2e7vr7yoC5LlaCEhmyLkAWgT41V/9lf9uc16GC/p03dzNHuUD3WkM9DlBRELESdP/+Sv/yN+Hf3M/ICe9sp1FgAb+niBw0x4H/02h4Pj2av15JEBHA/ScAGNRIKMEsjzL8rj8Ych/AhmZsNrvgztJ21wEaPCfv2NjwB/nG/bnNsfAzT3/3XbbsVe+BYEG+bTjNK+7dLuPHe9r4O+y3M7IgSEwn/Rxuqz77+Zv3XgiwDHkj/OLRYLnhklfywJACrcpyLTwk3kV9Mv62O33PHk/WgBo6G9Ib+//HOZ7e1vY7/1zu1QAuC7DKvMdzr6mzaSgtd/ny1oEbqJAfvflt9C2IkACf35rJugvhf/c19C/NBJgOP7/4H5bnvH9vD+OAEjIfqwAMAT4BvcG8aw/hv8G+fU2Fh7Xx7edCwDj4/ctBqQIkHMD/MN/+P/43UO6gs0Z348Lf9j99IwmtM+hI0NosiwVod6XZe/60Tc//Muf+OH1cdU5tnqccl8fl8dszrp+SD19Fw56258gvS35w5vpW97x/VtHAnREQEJ6/gC353/dToWApSLAWAjIfD+TDf7dTgoA6RU6xPclP1BzaEJCcUJyw3nbfIca+Nvrv63temkT/sfvYbbTbaYdA/nSfJft07ZQcNK6fd6MJDjAgLka2XTnRWMBYDHobw6FWLpv9fnKj4BrVQRIISbBP6+nJ0zLfJZtijSH+LW5dfuU0XYtADT4txCQwL4U8nctW7qvhYDc1+f4/AiAB6/YfL5vnb0XTIDA9RXI79AcAtorAyyNBGgRYOm+FACWwn+WDyMAbkoB4F5eUw6bff/fe9+6R/+RAsBCiE8wb+9/w/8Y3B97fLYxTAn9KQC07fy8jd4eCwGZz3Nm6oiA/v7/1//Tv/g3f+Nvf/rQzjV1GF+k/AAfQ3/CQkJDQlSGVn/m//nzDzu1JzFBP8OtO+V6651yDMg4ZZ33vecHjkcLXOXl1w5D/HbtRXpfWgTI4QCPnRNgHAGwml8XALYs62iAfLG3FQLS658h/7lESIJ/ni9TzuSaz/Yh92BltEz2s0WAhPXs83zG/zHgL813FMDc+z+H/wbxkwL7rvvb2z+G/3F+fGyfL21e42b4/9GhfSNSjDmpADCOBBjnE5qHosa1+DGQwm97/XMSyFwVIm2u/tAiQM7VkO/yob1Xt21/Uoxp4E84H+cb5nPJz4b4trmvU5ftarvuXABIT4re9Nv2qfN6CVx/gRRP5yJAwvsc9ucRALmdqQWA/qYciwE3sABwJ2fTT/hfLAAMQ/7ba5/gPfb8N6i37XrHoT/baCGh7Wa7YxHg+HHDc3abaRP+x9stAmRf1vu/yhM5MWDyg5EAw/d4DP4JEgn8CfIN8GOoT+hPr37W6dTCwFwI6OPnNsd8J4RkaPhqN46GXTF7gwWWigD54/nYeQES/MciwGa+Vdnj9VfBPuF+qRCQZQn/LQBkvYTo/OG/Dj2Z+Y8k/9FkfxOSE5bzncn3Mz3++Q52fmwz3+A/zrdoty38j6F8DOsnzY/BP+uOtzvfbfQ5crvz6f3fvB+HeKz8UQ7JSPgdpznoj/c9Mv/cYQAJ/9ehAHAv4T4FgPT8v+SP/PJzV4IYrvbQs6dnHf+BXu0f6nwux9DfgN7wP4f6Bvml5Vm27XG9r9vPc+bznx/RjqO/2s+AZydA4GwC+c0xFwFaABjbFgHGZfnN2vCf32jjlN9tm8Odb8wo529//Ws+OhYAHgviQ2jP+bbG8D+G8uMwP/T2HxcBuqzFgNXt9frDtheLBJv7s+4Y/jvfEQHZp2SCn/jMx9fnBRjep7N9gG7CoxLI/sJ//Mf/TUJBAkICfML6UvjPsgT+hIoE+AylaAEg7VgEaMGg2/nv/3+fLyaMxYBsK8+tR+kmfJr2ew3pNcof3kwJ5Onpzh/TH/vo5qSAm/DfAkD/APd22xYD2q6H928KAp3vfWnzPHnOQx36P+vlP5H+p5N9b296gnO+q/nuvPU97zsuBOR2ph4O0NttdxUAGsbbNrCfte2+5vFzEaDhP8+V8H+AZ/8f34p7SwWAR0L+VByY71tt7Gg1HXwBIKMVGv7T858CQEcA5NKPGQXQKa9REWD8mFz+fEamNJSPbYP8Uu9/w/y2YsBcHBjX73O0AJDRIv7fvvz33TMSIHA+Ai0CZIRkfje1Jz+/u/q7c5zvsrEA0Pk+dgiWN6YA8Of+4ut/aGcBYOiRb6972jH8J5AfFw4a6pfaLBunbntc1vnet9C2ANA2+9IiQN7T3/rMp9eHgdza/8PSg5PwnSnD/BvWx/De+YT2FAcSJn7iZz78MCdTSAHgl/+bv/q58Xj/FgSybh/bdgz+43wPC7i1b8T5/C27blu51xMDJpTnvAAJufkjOhYC+sc3f3gzJfxnnUy9L22W94/zGPpzX8N/ig2HdNm/fd6wVF7zGjrl3AUN1wnQeU0N/RkRMIf/jgRo2yJAHjtODeVnDfx9XPctt3cF/2sS/vMW3c2PhJN6/Mf7x/kE5U1P+cGPAkiPbgsAGfafAsA4CqDhv60iwD7f4ItbZ6kA0PC/K8g31I/tPD8/PtsdCwA5D0C+F4d8GNXFydsyAQI3RSCF7/wGzW+rsQiQXv3+7prbdFj92Q//F+uOq/4e7SiAm1gAeOkrf883pwCQHvSE6OMgn+CdMD4E8AT/Ofwf9/wP6x0/rmG+21lqu878fF133O4w3/DftkWAXNEg71eyQc4FcVM+y3u/jjH8J7Q3pGf4Ro+b7vDp3E6gT69/AsQnfu6D697/FAAS/lM8+PGPvHV9Vs20PWfAUhEgzzOG/87ncUYC7P323ZgV0xufP76Zcl6AFALyh3UsBDTYt/3Rn/2r62JB/ghnWacUAVI8yP2ZcjtTqrvZ/uZwk2tXlU31df7PqKMZGrjz3emogPwntlQMmEcCNLSnTSAf2/G+fecb+LtPeVyXtdjQZen131yC8eB7xjMSo72ec+/+XrevyWEACXR9PRnq/9XP/uojBYB5FEAKAYoAV/an+P5SASDBPT3/S73/LQ4s9f73vjn4tzCwrQAwnOPiyiA8MQECBJ5UoL9D8xs0vy3zmyu/Ixv++/szt5cKAPnNmsfcwALA3a942Z1nWwBIuB8D/zifoN3wP/b+j+sc9+43zDfEr9rjIf8N/GO7sP56u/M6q/XGgkPDf9vsV05Q2CJA3stcze5JPz/X5vH5T7s9/wn3vVZ6An9695em3JfhxgkZCeu5vuIPfuidx1OqKJkSPrI8QSwFgxwWMBcCEvqXCgEdCXBtIO3ouQgkCPaP71gISMjNlzOfpf7xHdvclz+6+SOd5WmzbosHDcnZ5nXr+Z9h09P21rd+36f6n1Hb/IeTwkmC9XjCwBYDOjqg4T9tTwiYdfJ3YN+Af9J6Y/BfWjf7Nxzvf20KMTnOub2fc+/+fLsBem5X7+fRajroqwGMhzrkdXUEwLbDAOaRAMLg/K29uNv5TOY96ucybUL6UvBvqG/wb9tw3/t3tUsFgHxeNse6XtwLtWUCBAhckkBHpeY3VUekzp0v+Z2Z3579fZr5rHODCwB3WgDIlbUSoB8J9FOPewsADdyL6za0j6G+y3a18/rj7WE/+pwtBHRfsu+dUgTI7+i8d3kvVx+xo0v6mF3t0/SY//T8J/znbOlLoX9elgJAh8jM4T/Lc/+bP/DTj0zpge35AZYKAR0B0DYB5bqHtat9d6/ns+e8AP3j22JARwT0D22Dff4Aj2G/hw/kD3E+hxnK1W2k3fQ0X0+Yaa/zgzsV5hYAxjavP6+9vfkJ4S30Jex3ymEDWT6utxTYn3RZCwIJ/Rlanvc3hzRcw6B4rydb22ckwFJRYDgM4BBPdLj+lLUAkN7/hPueB+D4XADDyQAb/tt2JIAh4dMX9oJu5u/AWABIQE+AH3v/52JAg//YNvT38b09tl2/xYZ8B3IIgALABb25NkuAwJUJ5Opk+d04np8qvz0zjYExvzuTd3pf2xs4AuC4AJBw31DdkD22DddpE7rH+9bzDfdzcM/ycdl4e1h+PEJgWLbtUIJxPzM/FwHyWj74Tz62HgmQjHErRgH0bP/pxW/4T0gfe/Tf+YG/9PDHPvBfrYsCYzuH/BQBEvqXgv9YCMh620YDzCMBUiTIFy/Ho17ZXwBPfGUCCUpzIaBhPp+Lpan3z+3mMpPXpqf5FOhH+X7kP5pMqWB2akEgt3Moxeve8drnDq8YhviPw/GfNOT38R3q39Df3v4E/zxf/sB2f69jr2HCTgNQr4O+FPTnnv/j258/DOBQCwD3cinG7G8KAJkeKwCszguQwwCWDgVIISCPzaEdzgx/im/yGVdNUTOfv4bzMfzPwT/3db2xbcjPss5va/vZTzsWADaFrTO+Cg8jQIDA4QmkkN3fkx0NkA6Whvz8numhAl2e31y5P79zNp0cB394477y8cghAAn2x0E9IXyaWgBo2J7vf+SxY8ifCwNzwO/9m8ccFwKm5ceHF4zrDfuY/eo+ps35DH70v333c79PnzsXwI15zx57b8eh/z3WP8E/UwoC45TQnkLAOAogBYAx2O87n8e9/YNv2VoEmA8JSLEgIXD1AvJmHOoP5sd8LThfgYTcjAbpH+JtbT4rOZdAAn8ec1uuTZ3XmTCdKd/tnEQzbZeltz3/GbUokP+o8h9XR0h0BEBDe0N8Q/22dly/8wn8Y+jPfN6vFCH6H2P2I/u0+pRcu6JMgk5HASQEJXx1Og75qwC8a37zuTzUv2nHBYC+hvFEgNtGAXS0wDgSIIWE1Xt8c/8jPd8/c2faWgpS+fzls5gA357/uW2gH4N/53Nfw3/brj+2Xb9FAAWAM71lHkSAwDUTaGdUfjONI037Wyq/b8ZRAPmtk/s2nRw35v/A/Lb80Ic++HfWvfpz6B4CdkJ1suV6vWH5Y730Y8DfzC+G+vG5TjF/vK0+z2ZfOhJgLgLkfAD5bXyjC9rj0P8My5/DfwsBY5sRAB0F0BEAJ/X4LxUGTlMEyKiADFdOoLstYe6a/V28it09GsNt/sBurhpxY/7IXgRqemM7WiD/ObUY0Lb/YeU/svwHt6s4MIf9hv60uS8FhTw+f0iz3XHK86UYcY2v9HGUnv+GoI4CSNv5Budt7eY/l0MtANzvCIDsf0ZuLBYAThgFkIJAHpuAehGfZ9t8TiCfpZwEMGG8AX0O8S0GNOiP63W+941tw3+3l7af+7QKAD6FBAjcFoH8rW3n03hY6lgQ6MiAtpuOjhvz2zS/I9/73nd++rECwKanvT39CdZZZ7EAMK7b+VOE+kd69/u4BvzeXmjXxYCut2pzeywA9FCA/G791m971W/e1M/1UY8HTg97Qn5OmDaG/YwA6Bn9x+UZBZAiQC4lliCfkQFnKQLkJIEZCdBzAiToj1NHAmRZ9jHDvb/xa78mPyRvzBfppn64vK6DF7ifoklHBTSctxAwtrlvvr1ef1UlTXV7npa21WVp859invcah//1m5tQuzQKYO8iwOcPAzjIERB5fQn/PQQgQ/17IsC2KQrMhwHMowBaBLhJ59441G93hmamwJcrOKRgPn4+G/LbLgX7MeT3/rkdCwDZvgLAoX4a7BcBAhcl0NEAySUpBORkyu3wyG+i/M7p7550dtywzsv7uRpVgvNxEB9CdQsAj/X+J5CP620L6F3edXt7bk+6P+tvWyfLN1MKFHMRIKMAUtS5kYcw5kdCCgDpWU+479D+zCf0d1q63XMCtAAwh//cXn8pNscZ53my7jwSIOulCJBCQ4oA80kBE/xbBMh9uZRZtrs5OYNDAS7qL5vt3iqBBPFUtRPKc2WB/GeV/7jG0P8k89lWtplt5zkycmMFfO2LeCmgNGAlFLXnP+0YjNqDvjQSYPOfSywOziMhMr33Hc6/VAAYrwiw7VwAPR9AtrUZ9XCrvl9X/WLzGctnNQWYXUWBBv0WCOZiQJePvf8dAZDDD/J52Xy3r/ole34CBAhcuMB4boBkk4wMWDpHQIoBWffCd+jynuBergSQq8YdFwA2YTuhfwzWW3v/x3C+CenHQ/XnoH/a29tC/7Cd45EAm3XnIkCuCpACQLLy5bFe0jP15H/pwe9l1VIEmAN/CwFtc38LAHlsRwAk3CfQ51wBGfqbM31n+qov/n3HU5Zn/bEQ0CJAtt9LBOYDNIb/jgrIhy0Fg3zR8oPmkqg8DYHbJHCU/6jy/UpYS5U3oX0sDiTMnzQ17OePZ7a1+c/v6KZBjsOuE4Z6HoAWBto7uq0IsOkVT/g/uFEA2beE9vTgZ/8T5NvzP7ZLowCy7jwSoAZC4pV/C+7l+5jv5j4FgbkwsK0AkM/LdR/Vc+XvjB0gQODaCeScUz0sIPkkwTGHUXYkQAoAm8xyYzouU1j+xY+96x8/1sM+9Kovhv+G87YN5ePtcb73X0DbgkPaTHMR4MYeBpACQAN5LqGW66ZnOqkAkKCegkEOAUh4T6Bv8E9PfkYUJPSP4X88eVifcy4CnDQKoCMBcihAigAZfnPDKmrX7o+eHb5VAvmP636GseV7lxC3NOW+TJue7YMLtef9jqXXs2E/PaSZXyoCZHkDcEJ15tfTc4cBxOngRgCkANQCQPd5DP6d33cUQEcC5MoAN2w45Hl/rC59ex0FlM9zfsz2Mz2G/SxbmjryJY/1f/Klv3WekACBAxFIrko2GUcB9BDJTU/yTfpNtD4MIKOzHxkFkKC+CvAJ0zsLAPsE+j0LAWOQf2xfTnqePseqzXbGQwFyRYBcOetAPl7ntxtjASBhvAWAXAIwIf+vfOrzhwKM87kvRYIUAXrsfwoAmU+Iz8m/5vCf0N8pJx7M/FgAyHy2kefJKID2+I9tCgCZ8mHLei0C+CF5fp8JWyJA4HQCCU4JQAlKKQCMowC6vCGqRYAWAloEGHoGDqoIkP1qAaD72tA/t+MogF2HArQIsLkywOmwrX2ZAvcT5lMEyg/XhPuMFtg15fPi/+PLfIs8FwECByZwP38zU0R91Z951e+mBzkFgIyY3By6fJMKAOuRZDl8e2kUwGPH/ydoN2xvigTrsN5lbU8K7Od8/yPFg9U+tAiQkwFm1HkKAJsOrQP7qJ1xdzJUL8flJ4jnxBVzAaCBP7356b3PeplP+O/UIkCCe6YUBBLKO/S/RYA8PqG/beczTGYsAmQbS6MAGvzbpijwa//s59ZFgOxTLgu3YrhJX6ozvqseRoDAVQj0MIAWARL0Owqg5wMYiwC5bywCDJfJO6i/Y+MIgA7nT2//HP5ze9sogD5uPCQgy1JYSKi8ivfLcxIgQIAAgQsSuJ/Rkfn/LWeRf8ObvvN3cgjlptB/UP/HP+nrT8E3VwNYH/c/BfMsWy9PsO/U4L8r7O+6b36OVY/93OPfQD8v33U7jxmnHgqQIkAO57gxhy3mDUv4TwDP8P2enK+HAeQ8ACkAJPSPIb6FgJy1v6MAUgTIMf/ZTh6XQN4CQI/9z3Ya/ruNtBkpMBcAUkDItudRAAn/Cf7bigCptq0+yAfVe/akXyyPJ0DgegikhzShvwWAjARI8E/IT9jfVgRoISDrDT8ODuYYwXEEQAP8WAAY51ME2GcUQAsCLQLcmP9Yr8dH1V4SIECAwOUI3M8IwR4quRkddTD/v58Twf0/9rq7/0k6ZR8J2KsQnxD9SAGg4b8hvkG/bZefsV0K/kvLHtnPzXN1vbEIkEMBUgBILk1nyDl5Xe1mMvQ/4T897n/jb3/6+Dj+FgByKEB78hPix9Ce+Uw5G3+KBCkAZOpJAVNYaAFgLB601z9t57Ptjj5IISCFhDxvLwvY4f9j+B+LAFnewwHyehQBrvZz5dkJ3FaBDA8bh/vnpGnjKIC5CJD7OrUIkOPiV35Hq+lgegjyunrsfwP70pUAOiJg2yiAFA/GqUWAFD42r/tgXvNt/Qx73QQIECBw7gIJ/J3OfeMHsMG7KXJ88pOf+AePDO9fBevHCgAN+m2Xgv5wX0P5UmAfl83rzbfHdef5cd1xPutl/1sA2Jy/4QC4n2AXUsXoJfnSY/9Tv/zz6/DeIN7zACRQjwG+wX9sE9RzvoCxAJDttAAwnggwj+tIgMyPowNydsyE/0zZ5tIogF1FgFSYMmog++zygE/w4fBQAgTOLPDghS/8+NIogAT8ceo6GS2Q+RQOcn/+bg6jAM68H+f8wKME9AT1FgAS5Bv4l9rTjALItrJthwKc87tmcwQIECBA4BIEth4GsArzW0cANOjP7VJRYFg2h/Qx0O+6b1zvpPlxOxkFkPM33IgRAOl9T0jPGfwT/hPg0+YwgAzjz3yKAO3J3zYCoMs7CqCHAWRUQQsAY9vAv9Q2/Of4/xQAWgTI2f47CqA9/2Pb+RQH8iHL43P2zU2l5qYNs7mEr7GnIEDgrALjYQAJ9xkFkHYM/wm7uT2OFkgRIMtyX4oIq+c/pEOZ7rYAkLCe0QBLBYDxUIB5FMC2EwJ2FEALC84ef9ZPnscRIECAAIErEzjK5aKXrgaQXvTj4//nsN/bQ8Bfh/PN8jGIz6F9vG+cz3rz7fGx2+7r8rbdTm6nALDpnLky4Cd+4vxATbBv0E/4T4BP6M9ogIT3tHMBoGE/Pfjtxc+yBPwc8z+PAvj3/sAzx0WArrerGJDDCTKKIAF+LAJk/qRzAST8d0oR4G1veeP6pICOK33ij4sNECBwCoEMl0+Ybw9/zgOQIkDCfoN/g35uz0WALDvEKvNYAEhY33UIQEcEzKMAlooA2VaLAHHZFD9OIW5VAgQIECBA4IoF7r/0lb/nmx85D0DDfdpxStjvffP8XAiYbo/hfAz1TzK/zzaTT699psyx/+np79D/FgA6CiDH8WfKuQDGEQBjr31O3JfbDfm53QJALwvYywAuhf4uGwsDKQD0ygJjESCHAqRAMY4CaK9/2/HQgMynApWiRC5VdKMu23DF325PT4DAyQLz9dOXRgEk7LYQ0GJBRwoc4lD4XKEgxYn0/De0jz3+Cf1Lt+ciQB4/Ty0AxOGrXvptD3Ms4cnK1iBAgAABAgQORGB9HoBtlwN8pADQ8N92DPlLy8b7N/NzaD/p9lKBYNtj5uV57LUvAOSHVYb/p5e/Pf4J152yLOE/BYKMAOg5ABL0xwLAPJ9APwb4FBf62Ib9tNnOvK3en9DfAkDasQiQwwHyoRqLAO3xn8N/l6cKletvbs4HcHQgXxC7QeCqBXoimrQZZn6UIlmGXqe6mSFO89Sz12ad/A3ZnMU2j3WIzcK7mQA/hvqOAsiycRRACwBpE/475fahFS7TM98CQNocBpBw397+be1cAFgaBZCCQEZCfMN/8KaHr/y6/+z6V9kXPhMWESBAgACBmyyQ3y0f+tAH/856yH9D+xzoe7tt1hvn+7gLapfC/dKyuWCQQwCu9SGKL3jw4G3pGe+x/wnqCf8dBZDj7VsEyDo5TGBbcO8ogPbiZ7RAtpXwnu1l2znRXx/foD+2fWzWaxFiWxEgy9OzPxYBxhEAcyEghwJkm1/5TX/in26O2zikY2pv8t8Ar+0wBe4lvGd4ea5F+9a3ft+n8gctU77rGfGzz5R1c7WOPC7byCFFm2FRR4f5si9/r2KcsD8WATIKIIWAMfR3PuE393XK7fytvvw93/6MYwEgPfbrAsAzP7ZYABhHAiydC2AuAjT8twBwaMWP7SruIUCAAAECBDYCy+cBaMDf1o5hv+sMhYExoI/zY0hfWr60bHzMOD+uuzSf37zX+rdJhv/n5H/z8P/0tmeofdoUAFoEyHo53j+hPYG/PfhjL37mc3/WG0N8igAJ7ePjxvk+Lo9ND38f27aFgHEkwDgKoD39LQj0dtqE/7Y5H8BwKIAeS3+nbqPA/RTB8gesIb9X+njSttvLtlNY2BQDcjm3W/tdS6EloXYsAsyjANKL3inrtUCQ9XL70I6FnwsA2ff5PABj8B9HBOwaBVCjhv/8rb6NX1CvmQABAgQIXHOB7ecBaMhvwG87BP3jQD7e18cttGNQP37swnon3XfSdjKi4Tte++pfWb031/dSxePx/wn36fFPz3164hPO0xOfEQIpAOR4h/T2ZZqDf243zLcXPwWAhPYG+LYJ8NluH5PHJfSnByltnq/rzu1YBEiRINvK0P6l0J/AP48IyLKMGsihAJsTa13fN++a/1Ww+1cmcBz+nzTs7/P4FARSDMjZYBOEV6/6No68uff8L3r2swm3GdaftgWAtCkONPxnFECWjVMek8df2Sdm4Ykz0qNn/+95AFIA2Bb6xwLAtlEAeXwLABn6n2lzyNbCHlhEgAABAgQIHLDA+jwAn/zkJ/7BI8P6G+i3tWMRoOucIsjPAX7X7V33pVDQ+9tm2a/9y79+/X+b5Pj/DOtP+P8bf/vT617/MfwnnGfqcP4O5R9HASTMd70WBhLkx8csBfmMMMg6eXymzGfZUtFgfPxcBMh9DfotBPR2e/3HNvN5THqWNoHk1vZMHvAfDbt2MQL30iOfQL5PeD+PdTqCKG3+fuQwga942Z1nVy/vVhUC0mPecNtCQEN+iwJzYaD3p01hYDOa4mI+Gafcav52pgDQE/a1XSoAzMseKwCszh0wGjT8/6lvevvq3AcPXnHKXbM6AQIECBAgcAACGSb/3ve+89MZif1Iz/sY7Ds/t0PoHwP4I9sZ1rmI5UvPmw7xdIIcAO/Zd6EFgP5ITxBPAaChvO1cBEgvfXvsG/7TpgCQ8L/Uk39SsB9D/knzYxEgowC2HQqQsD+G//FQgDe86Tt/Z/MGHp1d0CMJXBuBezlhSQL4eQT7fbbRvytpf/43Prae/uY/+rn19zX/IWxOoHIrCnA5EeDSYQBjyB+H/Y/LM5/HHuJ5ABr8O4JhPBHgUvDvSICXfuXPPsyU4D9OCf2dcvWEa/PtsqMECBAgQIDALPD4eQAa9BPeO5+28/PypdsnBP85uM+3txULul7brjfezvD/Q+qQmcH3ut0rAKT3PyMBGuAb/Mc2hYFxeP5YBGjob5tiwEkh/knunwsAuZ2h/Qn7HQXQsN8iQNscu5H5BJFv/bZX/eYmhNyq3si9PhxWujECOUt/DnnZ1fOfofpzqF9aNq8z307Yz7Ix/M8FgBy2kymHHOXQgM2JVG50ISD+YwFgHgUwB/75dtbPpfcO6UOZ9y0jE3oZvx4S0JA/tl/97K8+7JRCR4sdY/jP/Gu+/YeOp80IrUN6yfaFAAECBAgQ2F/g8fMAjIG+8y0AbNoE7uS1Tr/+r37p4bap67Qdw/o43zB/mnZ+fJ7jG7/2az6+evlH+xMc4JopAOQyfykA5GSAY4Afw3/mc18KBOlxb3jPcfgJ+7mvIwKy7rhO1z3vdi4CJEw0/Dfsp00hoMWAvHG9nTbbyDGmm8uY3egAcoAfP7t0OQL3Ej5T4Puxj35gfWb/ObTve/s0BYGxADD2/qfw1gJA2ozeyaiEFOJu8vcw1eK5ANAh/3PYX7qdcJxe9kM762yG6LcA0GJAevbnsN/QP7d5rXPwTxHg0F7n5XxVPQsBAgQIELhRAuvzAOS33iM9/O3Bn4J/Q3zCfo61z/Qz/++PH08f/Ccfe5hpXJb5X/rdTxxPeUwen209SdgfH9tCQLLstR/+n49XTgL41ve877ECQAJ9zwWQgJ/5jg4YRwEEIiE6x+5n+sEPvXPdq7ct7GfdFAdSOMj6PZHftvVPWj4XARIuEvpTCEjAn88FMIb/zGfUQA4FcFnAG/XHxot5VOBuRrqkAPADH3n/ExUA9ikUjMF/7PlPESDfz7kAkO9gluWQgJe+8vd8800dkZPe7KUCQMLvUuBfWpaAvTl56aPv8BXfyqEJLQK0qDEH/W23v+e7f/Zhpr/wZ/+v62lTWXdy1it+Tz09AQIECBA4D4EU9H/xY+/6x48E8g733xQA5uCfQJ9gn7D/E5/5+MN3/r2PPDL98N/6r49v5/5M+Z3ZAkFuv//vfui5aXX+qZyDqrez3RQJGurHoJ/5cXnmx9sZ/n8jRiemAJBgkBEA3/Xmtx/34jfsp83UAkB6+cfL+40BPT3wAR6XZT4hPUWDjAyYzxPQEQd5jpwEMAWB+fEn3Z6LAD0UIAG/IwBaEJgLALmdqlR+dG56nIwCOI9vu20cksBRrnqxbwHgNL38Y0EgYb+3xyLArt7/jADI93UuAgzfxZv0fbyfM/mnCDAXAuawn7A8L8vtPC7nEjikD1f3pYc4ZB+zr2PgT8DP7bFt8G+bAsCNqKoXREuAAAECBAjcyW+6D33og3/nkQLAMAIgy9vj3578Ofwn8Gd6y6d+ct32dtss/7Mf/i8evv59//nDb3nH9z/8+rd8z8M/+b2vXl/1Lb+Bv/Kb/sQ/TWdY5jNlnaz/ll/64Ycf/q0PrgsC4/4l9Lco0Tad3IfYCXOmj1iGv7/tLW9cX+avl/drKG9YH4sAKQAkyDeUJ3x3fm7H4N9tdNu5Pc/3EII87zzKYN72fDvP1ZEFKUTMowCWgn+XJXzk2OjNKAA9T2f6JHnQoQqkRz3fp4y4OesIgNMUBcbwP44A2Nb7nypsvoM9HCAjATbfxaNDNT3rfuVKAOnFn4sA+44CSO96tnHW57/ox+UQjpy4L6+ngX8p9L/1L/w3Dzvlfidjveh3xvYJECBAgMDVCOS3wWNXAhh6/hP+x+Cf8L+tADAH/gT9hPv89sjV3TIiMSE9vyM3I0qPVq862S7nekt7lP3JfVknOTiPy3ZSPEghIaMI8ts0U/Yjow9SMNhclvhmnDMuLz7nAUj4zyiAV/7p163P7t/wn7bzCe27RgCMoTw9+eN5A8bAn9EEnVoYWGpPWwhoESCFgISJsQiQsJ+QsdRmWUYBDMM6blKv4+qz7t8tFlgf/58CwL4jANqLf5b2NOE/39GG/3UBIH9sV8syYiAFuc0ZVm/GH9rNBzC99z1b/lwIWOrxn5elAJBRBIf+eU6gz3H86dUfe/jzN7ZT/iPdFHoUXQ/9DbV/BAgQIEDg7AKPXglgFf7bq77U879UAEgIT/hPr31Df35T5fdGfi9uRo7u85sxGS/rPTKlKJDfJSkmZPsJ/CkIZD7Fhc3vlRuVD4/GKwH8xM98eB34E/TH4N/e+rTpSRzD/jwKIGFjXD/zDfxLbcJ/lo9FgDwmt7MPOeRgfo7x+TufdVoEyLL28LcdCwCZ75T7EzxSONATdfZvt0cepMBR/qCdVABY6uFfWrZPUWAsAuwa/t/vX9t1tXVTAMg2cmLAzR/0g4Q9y07luLF1EWAV4udCwEmjAHJ/pn//i7/1Op0gL//Brqvtq3af/5jPwuoxBAgQIECAwOEK3Ptjr7v7nyRrrY+33xQA5vC/NAqgx/d//0+/6zj4J6ttjsM/OoeXnFDfosA64GfbeY4WFzb3n8NTHdgmch6AXAEg4T+jADIaIME7RYAxlGc+QaKBe2xz7H+G3p82/C8VBPLcY/Eh8/teWaAFgIT5X/ztn1qPAkjASMhv0NjWdhTATT0J2YF97OzOJQikopnzW7QA8KRXAdhVABiDf+Z3hf917//qP4KlEQA5VCCPzd+Ub3/9az66YrpJPcT3UtTI8LRc0u8sRYAcPrCpRF/CJ8hTECBAgAABAgSeSODuV7zszrPrAsAU/vM7sME/bXr/22Y+BYD0xD/72lc9zPD+/K59oj3x4M8LpEcqJ+DL5QDzwz1FgBQDEhoSvHMShcxvO0FffqjncTmXwNjzn3Df3v+2S4G/y/Jc85T7OhIghYAE+7HwMM+PowAyv2/4z3pGAXz+M2HuZgikipmTnlxGASDFgbEIsLMAsPqD30JcKsCZX1eCV0WBsQCQQwE2BbmbNOwqr+Uor2seDdAT6M1D/8fbOQwg/wnejE+oV0GAAAECBAjccIH1pQDz+y6XAszw//zm2zYCoAWBHIufofg5Rv+mjQg9iPc7ISGHAeQqAPkBn/CfNj/oE7ATpOegPd5OASBTwnuDftuG+11tHpf7xzb702JA7sv2OjLgpP3J/SkUZEqv/j69/w0j61EMq+NUNx+0mxQ6DuKzZicuVyDHReVspy3gdQTAWYf3bxsBMAb/zu8sAEy9/y0CpAjXAkC2kzOubk66cpNGAfRDcDwaICf2y7H9PS/AGPjn+RwGcMgnAuyL0xIgQIAAAQIENgJHx1cC2KMIkN5/l2m/hM9ODgPIKIAM/88P7xQB8mM/wX4M+0vzWb+9/0tBPz34S8vHZQ3/Df65rwWA3teRALm9tB/jsrEIkHC/VAQYhx+3AJCCwXBFAMesXsJnz1NcnECGmrcAkOOnWgAYg/xcDJhvj+suzef7n+VpMzX4p02Y73Q87H8V8vt9S9vw30pwCwD525MCQEYwbI71ujioq9tyioz3x9EALQJsOydAlmekwOpxR1e3256ZAAECBAgQILC3wL0/9xdf/0P53ddRANtGAiT85xDQzW8/WWxv4jOsmKCQAsA4CqBFgATrbb3u+ZGeH/05Ud8Y6M8y36CfNoWAsQjQ7bUIkH0dA/883wJADltIr/5SAaAhJMGk8zlvQB6bXkfHmZzhg+QhByWQE5ikAJATd+a70AJAQn6npVC/77I5/G8rAMzhfyy+Jfjn+zkXALKtFAAyeuEmnn11+qA8NhogIT/D/ecRALm9vhzg6gou0zbcJECAAAECBAgcosD6MIBPfvIT/yDBfy4C5HdhpmS2FAo2h3/exNGfh/feJHTnMoCnGQWQNypFgAzPb0h/knYM/+NogHGbea4UAhIM5uDf2wnxLQLkUIAEkPY0JuyPob/hP8tSAMg2cqkqx5sc3mfUHp1OoCcAbAHgBz7y/keKAAn6p+3xn4sDCeqdlnr/x/Df+X7nxvC/rQCQfb/BhwGMb+h6NEAq3jnGfzwkYC4E5HbOHzA+2DwBAgQIECBA4IAF1lcDyEjPFABaBOjvv/e+952fztUCNj3/Cf8Oxb6MNzNhYRwFMP7QTyhOoG7AbpsCwPve8wPrY/RPc9z/GOiX5juioKMCxnUS/jst7VP3rQWAjgJo6GjbMDK2KQDkNeW4k5t4HfLL+Bx5jsMRyIlTUih73Tte+zDfg/d87N3rAkBGAoyjAcZCwGkKAg3+afcJ//nutfc/f/A77RoBkAJA/jbdovNyZLjb0fq6ttO5ARL8cwhA2hQIDueTZk8IECBAgAABArsFMro6PfwZCZBCQM4LkNsJ/rlSwOa3np7/3Yzne2/elBQAMnUUQIsA284FkLCcgHGe4X8M+9vm83wpAqRQ0MA/tykAtAjQUQAN/2M7FgByDoC8poSlDJ9eCR+dr7KtEbgUgbsZNt/j/zsCIN+DFAG2FQLGwwLGQsA4n7Cfvwtj+B8LAD3mP+343VoP7xoOt0n4T/Afp6yTx6WYkG1mxEL2fTgPwG06Fmx9WED+Dq0vGTicJDCHB+RcAUYpXcp3yZMQIECAAAEC5yOQXv2j9PJnmH/a/JbZHHad4H+bfuedj+h5bKUnA3zdG954/AM/P/ZzPoA5YPd2CgaXXQBIYaCjABLWuy9z2wJA10kgWfdCrtpHwsnqdsN/tpFjj3MCCucBOI9PlW1cssD9nNOjl/9LgS4h+s0f+e7jq2O0CDAXAuaRAWNBoMXAtmMBoL3/W8P/5vs2Ft4a/FsISJv7WwBI0XEsAGzC7m37j2H9H+V8ksCE/+e/6I8/zPt8yZ8tT0eAAAECBAgQeFKB/L7pb7q0uZ3Jv6sSyLH36Vl/8wd+el0E6A/+jgJIqB6Ddtb9vUdH53IOgG09/kvLUwBI4SGHCYz7M86PowBSBEjIn4N/AkeH/uexCUUpAOQwgM1xKFf1VnheAqcRWPX633lReowT/tv7n+H/Y/jPKIBO+Zx36vkBWgRom+JfCgFp8zcg02nD/3HRbdXDn/lx6H8LAWm7XkcA5LvYEQCbYlz/sziNy01Y99GTBK7CfwoAzgNwE95ar4EAAQIECBAgcMUC+VGZXv2MAkj4z4/9tNtGAaQAcBUjAFIU6KEA7eEfw3/nx1EACT4pAiTwZ8r82POfwJEglCmXTbsFZx+/4k+bpz8ngfv5rOaY/wb/sef/fX/r+x92avhv2wLA2M7FgIb//B344b/1X+8sAMwFtob6tOOUwJ9CQM4G2yJAbufxKQCk0JAixJve8UMPcw6AldPRarqtBYB8TFIZv59zA+RvdM4BkEMDcod/BAgQIECAAAECBJ5E4H4KAAn247G/+fGfUN0RAG17CMBVFAF6GED2tYF/qR2LAN3vHOs/rpvlYwEgISiHAawgnYziST5NHntRAutAmFEqOUv+HPwT8BP6P/4P33Uc/lsE6Pdh3yJAe/7H3v98f/Yd+r/P8f8tCIwFgHwfUwDYXAXgaAVpiNiqCJKRHhn+/2B1kkCHKV3U18t2CRAgQIAAAQK3SGA8F0CCf6cEgDE0Z/4qTgI4HhLQIkDCzLxvvd3Ak5ECWS/BYpyWwn8OgXjjT/7IZx0GcIs++Nfnpd5N8JuH+7fXP5/xBP9Mv/ov/sv1lBEvXdZCQAsAY9uRAP1+pBd+qQDQ8J+2x/7v0/vfY/3TNvS3zbLxHAAtAOSQhs05ABwf9txn9Lj4s3G5Pp9ce0qAAAECBAgQIHB4AgkXORdAeveXRgEkWCc0p014SO9/pzGcX8Z8nzf72sC/1GZ/UwDIlJDTgDO26fVP8B+nzWEAh/cm2aPbKnBvW69/D4Vp8B+H3CecpxjQQkC/I/leZMr3ePwudH4M/+n179QCQMN/2rkAkNs9BKCX/8vthv8E/x4C0MJAtvPh3/rguuiQfchrSgEgJ8JbveG3+RCApc97CgFMlmQsI0CAAAECBAgQOJ1ARgG88k+/7nOZOgIg7dIogJyIr4cAtL2M8J/n6MkA//BLXnxiASAhpwWAFAES+Dv19hj+M7+5HODp8KxN4GIE1sO/xyH/Pclfh/s3dCdcd5oLAT0HRkcEzIfDtDjQtqG/7WnC//jcnW+Pf/ev7XgZwPydaQEgJ+TMse8rUofjXMznylYJECBAgAABAgQI3LmbUQApACQIj0WABIOOAMj8eBjAVRQAWgTIGcMbWua2vZxjAaChv0WApREAm/MA6GXzhbhqgcd6/vN5b/BP734CdsP0UtsAnnbsrW9BYGzXJ8dc9cSnNz5TQn9Pmrmr17/bbjv3/Gf5OAKg82mXCgA5B0AKAJuROAoAV/0p9PwECBAgQIAAAQI3V6BXBDhpFEB61hvC0yt/FUWAPOeuwwBSAEiPYkJ/zvCfaVfwPx4J8Of//GdW7/DRzX2XvbJrILA6y/+dF409/w3/24J/h9QvBe7cN0/rwL66TF9C+HpaDd9vkWBX4D9ef3OJv9zuttIuTSlO5PnnIkUeu3QIQAoAm2veK8Rdgw+rXSRAgAABAgQIELjGAh0F8F1vfvvOUQDz1QASyC+rENDiQw5FmHv+ezsFgEwtACT8twhwHPan4/+z3IkAr/GH92bs+vqEfwnAOdP/n/zeVz/MsP/0/Cf8LwXphu7xvhxrP04N3+Oy8Xj8sUAwhvyl+T5fw39vp52XjeE/z9d9TJt1UwDIaIP5EIDNoTgKADfjM+1VECBAgAABAgQIHLDAUU8IuHQoQAN2htY39F9W8O95BloAyO2MRug+zW0LAG99z/seZloa8p/XmBMftiiQAsDmBGQH/BbZtZsqkBNy5vj3nAhvDv8N8W0bvBuqs3wO+Ke53bA+FgN2zY/P3/mlttvtfvd2CwA518BYAMghRptLASoA3NQPutdFgAABAgQIECBwOAIvePDgbenhP+lQgK//+v/okSJACwIN6hfVjgWAk84DkMMAeghAQ/5J7eYEZIfzhtiT2yKwHvqfQ3Ha+//mj3z3uuc/wXoM0BkNMI4IOE3Q37buuP2G9LkAsLQ8+5b1xvDf2/M2ezv355CDpUMAFABuy8fd6yRAgAABAgQIEDgYgVwVIEWA173hjY8cCjBeFWBpFMBljQbo8+wqAGREQPZ327H/Y8//WBRwKcCD+Rjeph15bOh/Ptu9xF+C82f+7SfXRYAE/5zAr0WBbYH+LMsb0PdpWxwYCwAN/t23bCfL5vaRAoARALfpc+61EiBAgAABAgQIHKrA0qEAYwEgAXtpFEB6/hvQL2oUQLeb3sJ56P98uwWAMeTvmlcAONRP5I3er6Mv+NI7X/6NX/s1H0/v/3jc/ximE/7z+U7veUL1WUL+SY9p+M9643wf12VpWwTofNtxeZaN28rtDP/Pa8jx/z0EIOfrSFHRCIAb/Tn34ggQIECAAAECBA5VICfiyiiAhPxeFvCnfvnn173qDdkZYt8h+T0EoOG/bcP6RbT7FAB+7KPPjQLYFfrH+xwCcKifyBu7X4/1/mfo/9z7n0JALwPYUN1QfhFtnmPb8/S+fdtxFMC69384AWAKAPl7kr8lGfWgAHBjP+deGAECBAgQIECAwKEL9FCAng8gBYCG/7b50T6G/84n8F9kESDbbgGgISL7NM7n9j4FgB4OkJMFOgngoX8qb9z+3c/J/3rZv7H3/9f+57+2DuEJ/ykIpAAwjgi4qOA/9uCf9BxLRYA8psvH+SwbCwAf/q0Prr+vCf85oacCwI37bHtBBAgQIECAAAEC100ghwJkFEDOB5Aw3eA/tuNlAVsAGMP/OH+eIwESGLIf86EJWdZCQM8DMPbyj/MN/1nmMoDX7dN5/fc34f/Bgzsv+oMv/6O/kDP/5zPd3v8WAHLMfwJylidEnxTKz3p/A3p77M+6nYb+tt1ew//xCQBXvf/5nioAXP/PsVdAgAABAgQIECBwcwTutwjwXW9++zpsLwXur375/+n4qgDt/W8xoKE/hwtkvm2Xn7ZtQSFhKQGiYX9uWxwYA//SfIoAmRQAbs6H9rq8koT/jDrppf/Sy9+z/Ke3v0P/e0WAiyoAjOH/SYL/+Njua9pufz7+P9/RFABy/L8RANflU2s/CRAgQIAAAQIEbrRAjovv+QAyTL5BOz/eO6WH8g+/5MXHRYCG9LkIMIf9sRiwbb7b6mN/79HRupCQ0NACQIsS3be2WT6H/vb6j20LAOmRvdFvphd3UAI5+V++X3/o65799XH4f4oAGQGQNuG/w//bqz4G7SedT898pyfd1vz4MfyvRwAMl//rd7QFgBzSk5Mg5vwjqzfp/kG9UXaGAAECBAgQIECAwG0SePrpp1+bQwFSCHjnB/7S4rD7BPKE+Ib+tPPthPgx6DfUn9S2CNDtZf2//IkfXhcAtoX/9i7uKgAk+HfKCIDVe3rvNr2vXuvVCrQAkBEAKQB0+H8LAAn+LQAkQM8B+0lvt2f+orad/etztPf/l37jA+uRO/1+jsf/pwCQvzWrd+Xoat8Zz06AAAECBAgQIEDglgvkRGUpAuSkgCkCtPd/bOciQAJ7pxYGGvZbCJjbhv25zXpdlkJEehAT/tO2N3Fuc96CFgDmHv8G/7Z5fbf8LfbyL1fgbg4BSI93L/83FgDa+58CwPv/3vuOj/9PoH7S4N9gnkMMEv7Pa5vzfjX853ly7H/OZ5CT//Vvxnz8fwohmytxGAFwuZ9Fz0aAAAECBAgQIEDgcYFcGeCkkwKmCJDDATJUP4E9wT2350MEGuZbEDipzfp9zLt+9M2PBP8Eijn8pziQgDEWABr25zaHNqxe7dHjr9gSAhcmcHe15aPxCgBjASDzCf+ZMn+evfQJ5utQvrok30WF/xYZst9j+O/3NCN40vufvxcZ/ZAiSCxSFFm5xMY/AgQIECBAgAABAgSuWqAnBdx1ZYAE75wYcKkIkEJAe/Mb6tumCNCQn/V6e7w/xwonRGQaRwB0WYoBWZ6A0REAc+Afbyf8f+PXfs3Hr9rV899KgXstAORznSH/LQKkzYnxWgDoVQH2Cezb1snyz/zbT67PL5De+BQBtq079+af9na2m/Cf58hz5fUshf+e/C+9/5vLcAr/t/Kr4EUTIECAAAECBAgcrECLALkywLbLAyaIJ9SkCJCpIwFSGMjUUQFtc3/X6bIE/7FYkKH/CfeZlnr9GzByX4oQP/CR9y+OAPjxT/y19bH/Cf/f8o7vf7jpdTxYbzt2YwXu5pj39H63APDL/8ufWYflFAMSjlsUSJDucP2E6wb3ticF9AT/dW/85uSCCeTZ5kmPO+v9c/jPdzJTe/7nY/83h+AY+n9jP+peGAECBAgQIECAwLUW2FUEaEDPD/6eF2AsBLQIMBYCuqzhP217/tMmIGW77enf1madhP/2/ucQgLHHP/NZ9vr3/ecPv/4t3/Mw12BfvRF6Ha/1p/H67nyKT+n9ThGgvf0J5+MJAHM75wRoESDhOsF8Dv/j7c6nzTSH/4ssAOT5sq/Z5zxPzmGQ17MU/vO9zuvPCRF9D6/v59ieEyBAgAABAgQI3AKBnhMgIwFyYsAE7/b0jW2W59wBCfItBLR3P0E/4b89/R0J0Nt5XIoICfYtALQdiwB5vtxuAaC9/0vhP73+Cf8JXau36egWvFVe4uEK3MshKPksjj3+cwEgw+hbBBgLAQ36u3rqG/57acFxVMGux532vo4yGMN/nitTevw7ddh/wn9e9+bSf67AcbifUXtGgAABAgQIECBA4DmBFgFyToAUAX7wQ+88LgIkjLcQkHCeIJ9h/A33LQikHQsCKQpkvQSFFA+ynaXQPxYAxvC/rfc/Pf8pVmRfEzw2lxzzVhK4UoEeBpDPZEYBNPzn85/Q3MCeIkCmnFRvLAIk4LcQ0LbL5vCfHvmONMh9pw3529bP82Z7Y/jPc43hP887h/8UP573vDtfeKVvwMU/eUYYGWV08c6egQABAgQIECBA4DIEdhUBWgBom6CeUJ8z+acHcJwSDlIkSOhp6N8n+Df8Z91su73/Hf6f9k3v+KH18f4J/7mU4e//si97/2XY3KTnSFjL9B2vffWvLE3f/vrXfDRh1jkVTv2uH+VQlBQAckb8BOWG5bQtACRQZ2oRYC4ENIQniHdqIM/ogQ7J7zZzXwsG24L9Scvz+D7v+BwN/y1m9PWM3/e85ls09L9FAIWAU389PIAAAQIECBAgQODgBFoESLjOSICcYC9hvMF/qW0P/njfUvDfpwjQ8J/nTODvlP3I8f7p+c++ZdoMOT44w0PboQcPHrwigf8Nb/rO32lxJgWafaasn4LALejdPY+37ZGTAbYIkDaOHQWQ70mLAC0EjMWAX1td1i9Tgv16fjVSoKE862U+gTzbTNsCwFmKAA3+OaygRYY8R/cv22/4z/NlGsN/jvt/6qmnXr7Cuy1D/5cKAIoB5/HtsQ0CBAgQIECAAIGrEXjBgwdvyzH7Gb6f4J2h+OmNHwP+0nwLAU/StgDQ3v8G/xzv317/l33LN/wrvdMnfzbGS9M1vO0T+retkwJCigknP/PtXaMnA2xITvjv1B77hup+hxq2f+k3PvC5hO9tU9dLm221wJCCQMJ7Rgs00C8VA7qs64xD/bONMfjnObqfS73+GeWQotItC/+394PtlRMgQIAAAQIECNx4gaOOBkjwThDPeQES0Btc0ibs93aD/z49/V13bMfwn+ebh/un1z+h48bLP+ELTAEnxZt4JYgm/G8L9WdZrhCw8w269yUvvvOSDIv/k9/76oeZWgBoYO9IgAbstP0OpR2D/rb5hPJuO+t0hMB61MCqNz89+u3Vn9v29Pcx83N0v/IcS+E/vf4ZfbMpwt2Wnv+db7o7CRAgQIAAAQIECNwIgYSZFAISKFMISCjP8PyxEDCG+LPON/x//0+/az3Uf+zxT5BNj2P25UagXuCL+Mpv+hP/dAz+5x3+x4JBCgHek8U3814OmUhITiFgPC9AigB5TxquUwxYKgg0hI/tGNTHAkDme1968Rvst7VzT38eOz5P9y372ZEMadvrn1Egm0NChP/Ft99CAgQIECBAgAABAtdcIGGmhwWMhYCx57LzpykCJPhnyuiCHOM/B/+E2Qxlv+Z8l7H79y4y/Of9Sfif2yzLiQQv4wVe0+dYHzOeofIJ0A3ULQSMxYAE79MUBLKNjAJ4zY+/5pEA32LArnYM/J0fg3+23X3NfqeIkb8Bm4LP/dV74bj3a/qBtNsECBAgQIAAAQIE9hZIEGghIOE8xYD02ndUQML8tgJAw37PKZAwmcdmVEEv65dtZsqIA8F/v7clPbI5L0LcEtoSKjO1t36c77J92qWw32V5/Dif2y7HuPv9SnjO96fBuu1YDJgLAg3lbcew3gJA2tzf+/Ztu822ee45+He4fwoYmzP96/Xf/Ta7lwABAgQIECBAgMCNEzg+P0CLAT3mPAWBFgUSEDsl6DfsLwX+Bv8cbuBEc/t9XnIMdi6DWPul8L9P0J/XmYN9b4/tPJ/bmXLFgP32/laudXc8NGAcEdBiQNqE8KWpAb339RwDaU8qHDTkz20el2l8/uxXphTghuB/tHrH9Prfyo+tF02AAAECBAgQIEBgI5BhwT1HQIJop/bij7cb8sc29+fx2Q7UvQTup0Dyh77u2V9vr388zyv8txgwBvwsG2/vms99OTfAXq/k9q60PkdARgSMV2oYQ/iu+TH4Z73cTpvCwFgIaLjf1i49R4f7ZzSHk/zd3g+oV06AAAECBAgQIEBgL4EOc06oX5oyBDq91gkYri2/F2lXupch2An+KZq0iNIQN4a8hvgs6/y+7Rjul4J/7t9nUgTo23Zym+9Bvg+5wkWG3LcHvm3f47QJ+13edcf7zzrf4J9C3ObSfkcn77k1CBAgQIAAAQIECBAgQOA8BTLs+n6C2dzj37DX8L9vyJ/X2yf0n6UYoAhw6o9Bjq8/Ss97CmkZ6ZHCQN77TJlPOM+06Z3PE6w/GymstTDQz8WutuvmcRmFkOfKNvX6n/o98wACBAgQIECAAAECBAicj0B6/RPS2uvfUNfQ33YO9We9PRYD5vl9ev7ndRQBzudzsNnKrmPw14cVpDiwLhatQn2CfaaMLMjU2y0mpMiwGYVztNp+zuzvBH8baA0BAgQIECBAgAABAgQuU+Beenx7ab8e558CQEN/2jnoLy2b1+ntOeBneQP8ON9lZ22dGPAyPzbr50qQT6A/SsAfQv7RZvlS0N9VXFg9zD8CBAgQIECAAAECBAgQOG+BuxmGnfMkdMj/Uq9/Q/yTti0CNPC3PWvY3/a49DqfN5TtnUpAwD8Vl5UJECBAgAABAgQIECBwsQL3eob/XUP+G/rH3v5xvvdva9/3nh942KDfdg7u25bP6+26/QMfef/xiIKsNxy3frGKtk6AAAECBAgQIECAAAECBA5Y4Oiyev1bGEgob9Cf213B/qT75uDf22/8yR/57AH72zUCBAgQIECAAAECBAgQIHChAndz4rZc3u8sl/abe/7f9aNvXof6hvy5vezQ3/Df1qEAF/pZsnECBAgQIECAAAECBAgQOFCBo/UZ27/lG/7Vvif5a6Cfg3+Xv/kj372zAND1xkLAST36p7m/QT+P6fzcHuh7YbcIECBAgAABAgQIECBAgMD5C+QSbO31P+kkf9vCfsN82pN6/peO+8/jnqQQMAf7Fgq6/J0f+Evr7ef2OLkqwPl/nmyRAAECBAgQIECAAAECBA5P4H56/V/1Z171uycF/zHgj/P7FATG9ef5Jwn9Dflz29C/1I7LWgg4vLfFHhEgQIAAAQIECBAgQIAAgXMSyFnw/+DL/+gvNPinTZhfCvTblv34R9661xD/XaE/9521CDCG+bkI0NvzOj/20Q+sRwC0zf0v+w9f+r5zYrUZAgQIECBAgAABAgQIECBwOAI50d9Sr/8c1C/69lmDf8P9UtvAPw75z3q5nft6f9qxCLB6d+4dzjtkTwgQIECAAAECBAgQIECAwJMJ3H3w4MErxt7+pd79iwz+Y+ife/97eynYj8sa4rOs8227Xm+nHedbCGj4T5vp6aeffu2T0Xo0AQIECBAgQIAAAQIECBA4DIF7Cf9veNN3/k6H+l92+G9hISG9Yb9tg/uTtGPQz3Z6+z0fe/d6vsWAtmMR4I0/+SOfPYy3yV4QIECAAAECBAgQIECAAIGzC9zNmf6/9dte9ZtXEfrnwN/Q33bf0N9AP4b7cdm4fDwEIOss9fxneUcApM15Ec5O7JEECBAgQIAAAQIECBAgQODqBY5ytv8E7ouaGvIb6sd223wfM7aZP2naFvq7vG1CfbaV253GXv8x/GfeJQGv/oNqDwgQIECAAAECBAgQIEDg7ALr3v8M/T9r+O/Z/segPob6Ll9a1jDf+7pul5/UNsxnvaX5LmvYn3v+c/8Y+nt7DP8/+rN/db2OwwDO/iHzSAIECBAgQIAAAQIECBC4eoH7Z+39H8N6iwfzsvH2ON/Av61dWjfLlqaG/N7X22PYz31Z3uP9c7tFgSzPNBYClgoAWbZ6u+5f/VtmDwgQIECAAAECBAgQIECAwCkFvuBL73z5d7z21b/SAL+tTWDeFta7fFwn8/M0rjffN98+zbp9bIN/bs9hv/elHacx9Gf5UvDPCIBOKZacktjqBAgQIECAAAECBAgQIEDgygXWZ/5P2F6aEqTn5V02tvN8bl/0NAb6PFdv92R+47Lc157/zHedXeG/hYAO//+Jn/nwugjgMIAr/8zaAQIECBAgQIAAAQIECBA4rcDznnfnC3Niuznkz7cTprNsbDN/1VNDf/aj820T4LO8bZZnGgsBYwGggT9tQ//YZj5FgBQPTutsfQIECBAgQIAAAQIECBAgcKUCufTfrpP/JUCfJfg3hI9tA/g+bQN91+3tfdo58HcbaXf1/Of+bUWAhP9xcjnAK/3YenICBAgQIECAAAECBAgQOKXA4vD/04T+MVw3QKdtL3sC9bi8t/u4bbfH5eN8H5e2xYBxvgE/y7IPvd1ttM39nU/baezxz7KG/g7/z+0f/8Rfe/jUU0+9/JTWVidAgAABAgQIECBAgAABAlcjsGv4f8L1tinhudMYopdC9bystxu492mXHtNlaRvyM59pLAzkdosRmV/a33kfthUBEvxbAHjw4MErruZd86wECBAgQIAAAQIECBAgQOCUAjn7/zz8f9/Q39DcUN3b+7ZLj1sK3tlel3fb42M7P7dZd9eybqttn2NsM9+pIwBSBMikAHDKD5vVCRAgQIAAAQIECBAgQODKBO5mGHtP9nfa4N/gvE/7/l94boh92zym82PgzvIG7nG+y8Z2ft4x7Gd+vN11uyy3x/lt+5DlY/DP7RYAnn766dde2TvniQkQIECAAAECBAgQIECAwCkE7ud69j3B31gAaIAeQ3JD9Nw2yKc97ZRt5TEN2QnYuZ1232ncn237u7Q8289jx3bbc45D/xUATvEJsyoBAgQIECBAgAABAgQIXL1Aj/8/bfBPSE5Ib3jv7X3C/4f/7395Z5Eg2xqLAUu3s2xpGsN8A3/bFglyO4/t7fExXZ523Iel8J9lRgBc/WfYHhAgQIAAAQIECBAgQIDAHgK5jN13vPbVv5ICQIJxpzEcj/MJxmPwXwr8P/XLP/8wIf+R6bc++Ojt4f6s//6/+6FHigLtYc/zNXzP87k9TtuC/NLyLuvj59tdnrbPP+9TbisA7PEhswoBAgQIECBAgAABAgQIXL1ATgD45j//5z/T4J82YXieEoSzbN/A//O/8bGH4/RLv/GBz2XKsrbj/S0WpBiwLghsDiVIyG5P/BjEx2A+hvXON9Dv2/Zxc7v0nFnWSQHg6j/D9oAAAQIECBAgQIAAAQIE9hD4khffeckbf/JHPtsCwBz8t4X+FALGnv4xzDfs/81/9HMPf/G3f+ph2qUp920rBoyFgIbthPMG8gb1+XaXj+1cBBjvm+d3FRu6H2Ob8yfswWwVAgQIECBAgAABAgQIECBwtQItAGwL/gnIc69/e+vTjsF/KeT/2j/7uYcnTePjxu21CJA2oTv70fCdoJ757N/czqF+vN1iQJaN8+M6mZ+32eedW5cBvNrPr2cnQIAAAQIECBAgQIAAgT0FcgnAHP+/rQAwhv8G/zGkj+E989vC/m/+y59f39d2Xm/eTp9jLAK0ALAr/De4z4F+2+2uP7bzfG5vm+K3J7XVCBAgQIAAAQIECBAgQIDA1QkkwC4d978U/Mce/zGwz2G+txP295m6ftpxuy0CpG0hoEWABvKl3vpty1oEmIf5L63f7Z/UKgBc3WfXMxMgQIAAAQIECBAgQIDAKQTmEQBj8M/83Os/BvQxuGd+V9if7x9vz9vJ7T7PriLAPBJgDOsN+21z37agPy8ft3PSfK6icApuqxIgQIAAAQIECBAgQIAAgasRGEcAjOF/DP45UV8Dedo5sI/Bfwz24/J95uft9jmXigAZEdDRAG13BfnxvnF+LAw07Pf+3t7WvvkDP/3wat41z0qAAAECBAgQIECAAAECBE4pkALAez727uMT/TX4d7j/GP7ngL5PqN+1zq/9y7++HjXQosG8/dxuESBtCwE9HCDttnCeED9OXW9XuN91Xx8/trl6wim5rU6AAAECBAgQIECAAAECBK5GYCwANPwnaG8L/mOgb3DPsob5XfPjY8f58bHrx6+C/1gMaBGgBYC0YxFgHA0wBvRxfgz3nZ/bcf195r/99a/56NW8a56VAAECBAgQIECAAAECBAicUiAFgL/yqXevj/XfFfwfCfsnHO8/hvvOjyF/nD++f7PNPs9YAMh8iwD7jATYFex73z4B/6R1vuBL73z5KbmtToAAAQIECBAgQIAAAQIErkbgS1585yXp+d/W499A3qB+3u1YDOh8n3MsAiwVAOaRAEuBvYG/7dI6Z1n21rd+36eu5h3zrAQIECBAgAABAgQIECBA4AwCKQD84sfe9Y8bsMfQPYb9hvJxWeYb2uflp709bn/ch3G++7g0CmApxJ9n6J+39bzn3fnCM3B7CAECBAgQIECAAAECBAgQuBqBXMbuve9956fHoH3a8N7152LAfLvrje28zmO3T3E+gKUiQJfNAX6+3fX2aR37fzWfVc9KgAABAgQIECBAgAABAk8mcPTn/uLrf6gFgIbzOYh3+VnbcXvjfLc3Llvvy+oKAWlzf/ctbUcBLJ0QcJ/w/qTrOPP/k33YPJoAAQIECBAgQIAAAQIErk7g7le87M6zv/jbP7UO2w3kT9KOYf4021l63Bj+xwJADwMYrwbwJOF+nxEBWefq3ibPTIAAAQIECBAgQIAAAQIEnlAgZ7PPeQB2hfU5nM+3lx6bwD4uf+z2qpd/vD/zXWds81y53WkeBdAiwJMUAHY9NsE/U86X8ITUHk6AAAECBAgQIECAAAECBK5U4PgwgDmQX8XtFhfm4J8CQMP/PAJgW4Dfp2d/22OzPI9/8wd++qHj/q/08+nJCRAgQIAAAQIECBAgQOCcBO6mdzuXAjxr4G9oP8vj+9jjdtPbn22117/taQsAu8L9Sfc1/L/hTd/5O+fkbDMECBAgQIAAAQIECBAgQOBqBXJZu54M8Cwhft/HNOSvw/1wCEACfgN/24b+tnP4z4kAL2L4f4J/w/93vfnthv5f7UfTsxMgQIAAAQIECBAgQIDAOQusRwGcdC6AfYP+YwH/hLC/LfQn/Cf4t20RoFcBOK8CQAL/OOT/re9538OE/2/9tlf95jk72xwBAgQIECBAgAABAgQIELhygfsZBZCQvS3ojz34XWdeNt5OcD9er73800n92sPfdinwN/inPY/w38Df0N8e/wT/N73jh9bh/1V/5lW/e+XviB0gQIAAAQIECBAgQIAAAQIXIHD3wYM7LzrroQBLwX8d6p8w8I+hfw7/GQGwz7H8XafBP21Df07yNwb/173hjXr+L+DDZZMECBAgQIAAAQIECBAgcFgCd3NZwPe+952fbu/9GOyPe/NPGNKfx7RHf2xP6t1vT3+D/tx2yH/bsQe/of6kNoG/oX8O/gn/L/sPX/q+w3pL7A0BAgQIECBAgAABAgQIELgYgXspArz1rd/3qRYBGvzHtve1QDAG/XG+oX6pnQP+eLshv+37f+EDDzP92Ec/P/3AR97/SJhPoJ+nMew38HeYfwJ/pz/0dc/++orz3sWQ2ioBAgQIECBAgAABAgQIEDhMgXURYD4nwBj2UwwYg/44vxT2s2wM+ON8Q37bBP2f+JkPH4f9H/zQO4+DfcJ7p5yob5wa5tOOyzs/3p/5V/7p130uwT+HPhzm22CvCBAgQIAAAQIECBAgQIDAxQvc7eUBf+k3PvC5BPzThv4x5He+IT9te/Ub9tOj/84P/KXjY/LbU58AvxTeE+BPO+Xkfn/w5X/0F55++unXXjyhZyBAgAABAgQIECBAgAABAtdH4Oilr/w935xLBI69/J1f6u1v2B/bBv8O498n7Dfcf+U3/Yl/mtCe4/OfeeaZNy1NL3jw4G2//8u+7P1Zr1NuZ90vefGdl6y4j64PuT0lQIAAAQIECBAgQIAAAQJXI3AvITrnBchogNOG/oT/HLs/9u4vDctP4E8PfQN/AvyDBw9ekefOaITVSz9aTfe3TLkvU47jv7ua/CNAgAABAgQIECBAgAABAgTOILA+JCCjAXKVgLF3f5xvT3/bDu/PCfjGofzt3U/7sm/5hn+VY/HTW//UU0+9PCch3ByXf7TaTyfmO8Ob5SEECBAgQIAAAQIECBAgQOBJBe4noH/Fy+48m5MEZlTAG3/yRz6bof0N/Wl7ib72+if8N/Q38Geo/hj6VzuW3n3/CBAgQIAAAQIECBAgQIAAgQMSyDD7o/TUpyCQYfoZrp+iwLe//jUfzfQdr331r2T61m971W8m7Oc4/azTXv7NsP6EfkP2D+iNtSsECBAgQIAAAQIECBAgQOAkgQzXP0qwT2GgxYFpSL+wf5Ki+wkQIECAAAECBAgQIECAAAECBAgQIECAAAECBAgQIECAAAECBAgQIECAAAECBAgQIECAAAECBAgQIECAAAECBAgQIECAAAECBAgQIECAAAECBAgQIECAAAECBAgQIECAAAECBAgQIECAAAECBAgQIECAAAECBAgQIECAAAECBAgQIECAAAECBAgQIECAAAECBAgQIECAAAECBAgQIECAAAECBAgQIECAAAECBAgQODyBe1/y4jsvWe3WvcPbNXtEgAABAgQIECBAgAABAgQInIvAgwcPXvGCBw/elna1wfvnslEbIUCAAAECBAgQIECAAAECBA5H4Kmnnnr5V33x73s4Tg9e+MKPb4oBdw9nT+0JAQIECBAgQIAAAQIECBAgcGaBFz7/Bf/8+S/64w/nKQWB3Pf7v+zL3v8FX3rny8/8BB5IgAABAgQIECBAgAABAgQIXK3A008//doE/Tn8z7ezzjAq4Gp32rMTIECAAAECBAgQIECAAAECpxP4P3zR078xhv3f9wde87DTuLzzKQTkMZvDA073ZNYmQIAAAQIECBAgQIAAAQIELl/gec+784Vj73+C/xf/kTc9/PKvfscjU5Zlyv1jISAjAlZ77RwBl//WeUYCBAgQIECAAAECBAgQILC/QIb//3t/4JnjUN+gnwLA//E//uDilPvGYkBGAzx39YA7L9r/ma/vmg8e3HlR3HJehLz2TM8888ybru8rsucECBAgQIAAAQIECBAgcOMFEmLbo7+t938uBvzhV33iYaYUCFoIyCiCG3yOgKMc7tDA39ea9kv/3X9nPaWI4pCIG/918QIJECBAgAABAgQIECBwfQXSez0XABLq50MAthUBWgzI/T08IME4Vw7IqIDrfOWABPoc4jAH/nqlzWvu9Pwvevaz1/eTYM8JECBAgAABAgQIECBA4CYL3O/l/xpiG/7bjoWA8ZCABv+v+rZPP/zq//TvH09ZnscmHKd3POE5Ifqpp556+TWBvJfh/CmMNPgvBf68xnmKoVEA1+RdtpsECBAgQIAAAQIECBC4TQLpnU/IbcBtoB1Df+cT/jPfIkCCfsL/WAB49nt/+2GnLM/6CcXZfp4nofqAA/JRRiykIJJ9TfGiLnkNtdnVZr28xtv0GfJaCRAgQIAAAQIECBAgQOAaCCSM9wSASyG34b9tw3/abSMAOhpgVyHgwEYE3E3wb29/g388lkxOKgCkaPAlL77zkmvw9ttFAgQIECBAgAABAgQIELgtAhnqvtTL3cA/ty0AnBT+WwRI20LAeGhARwTkpHor66Or8s6Z/Oce/9OG/rkgkNe2uTTiVb0sz0uAAAECBAgQIECAAAECBB4VWLoCQAJtgn/bpSLAaQoALQakEJD5FBESslt4SAC/7MMC0kPfk/uNPf5zmN/ndkcKtHDQ17aSPnpU2y0CBAgQIECAAAECBAgQIHBFAgnBCeINsQ39c9siwLYRAA33Dfvb2m2jARLCN6MBLlxiHO7fIsQ+QX9ep2ZLbbab0QUX/mI8AQECBAgQIECAAAECBAgQ2EfgNJcAXCoCjCcA3Bb65+UtAvQkgQ3haZ87SeCdF+2z76ddJyc8zPbHkx4mvM/B/jS3l8J/lzkM4LTvkPUJECBAgAABAgQIECBA4KIEjhqGG4Qb8ue2Pf9jm8MAxgLA0iiApWVjQaBFgDx/CwHZp/O+ZGB643uSvzxPX+9pwv64bkP+rjbPs3rj7l/Um2e7BAgQIECAAAECBAgQIEBgL4EcBz9fAWAM+J0fiwFd1vA/FgDGYH9S8O+6eXy2le0mYLcIkEMCzuu8AB3y/6TH+rcAsCv0j/fltZx3IWOvN9ZKBAgQIECAAAECBAgQIEBgFOglABtaG/Qb8ns7bZa17f0J79sKAA34J7UtALQIkOfI/iQ8J7A/aYDOeQU6yiHbbIg/a1urfdo8X4oPo7l5AgQIECBAgAABAgQIECBw6QIZFp+Q2jDbwN+w39ttG/zTdgTAroDfUQBj2/k8bgz/2V6LANl+RwOkCJCRCmfBac9/X+NZQ38eV6PTts4DcJZ3zmMIECBAgAABAgQIECBA4FwFthUAxsCf+RYE9ikAjAF/V3FgWwGghYC0ee6E91wmMGH+ec+784X7AvSY/6sM/ykW5KSD++6z9QgQIECAAAECBAgQIECAwIUItADQkNzgv9SO4T/z+w79H3v5522MYX/bfB6TIJ2RABnKnyH9+xwW0GH/eexZe/5P29u/tP7zv+jZz67evHsX8gbaKAECBAgQIECAAAECBAgQ2EegBYAG16Xgn2VLwX0uAIw9/5lv8J8f29t9rtzeFv7H5dnHFCpaCEjPekYF5PCAvI4Mtc+yTlkv6581/LcoUpuztikAnGbkwj7vm3UIECBAgAABAgQIECBAgMCpBFoAaNhNWG4wH9uG9rYJ5ruG958U/rudtC0wZJt93Bj8s05up81+jlOuYNBL+/VqBrl/nG9w37cQ0EJDTfr4s7bZzoMHd150qjfGygQIECBAgAABAgQIECBA4DwFchWABuoE3ITxpSLAGNhPCv8pDDSwj4/bNd9iQ9YZw3/nuzzrdX/3befgvqsQkHWz3fkxT3I72/uCL73z5ef5vtkWAQIECBAgQIAAAQIECBA4lUCCaYN0Qu5S+G8PfQN8eunH4f4J/OPtMbT3Mfu0LQKMz9dttc1zZx/HfZ7Dee9L2/u6rLf7WlsMyO2ldcb1zzqf7Z71KganejOtTIAAAQIECBAgQIAAAQIEtglkaHqHy8+heAzkDeUJ4PsM/W9g3yf4z+vkuRrM+7zdXp4/UwN71xvbBvV9CgDdzkWF/25fAWDbJ9ByAgQIECBAgAABAgQIELgUgZycLpfYa1hOkJ6Df28nqCeIzz3+Y0GgAT3rzcH+NLdbBGiYbyEg289og2wr96XtumMRIPN9bNsx5He+bde5iDbPoQBwKR9nT0KAAAECBAgQIECAAAECOwTuzQWAMUg3/LdN4E4IH0P/OD8WAMYiwDh/2kJAQ3mLE32OLM+2uu1xv8f5Pr5hf2x730W2CgA7Pn3uIkCAAAECBAgQIECAAIHLE8hl8xJSE4Ibshv459tZ3iLAeNz/tiLAacL+rnWzHw3p2YcUAXI783nu3G4hIMvGAkDnx+Df+W7zIts8l5MAXt7n2TMRIECAAAECBAgQIECAwBaBuQDQwJw2YXppahFgDP7jfHvpE8o75THj/K7A3/W6nbRZv/uWfUpo736M62U+j899LQZ0/Qb/tBcZ+sdt57lcBnDLh89iAgQIECBAgAABAgQIELg8gQcvfOHHG4jHgN3wvK0QkJA9hv7Oz2G8gbyh/LTBv9vL9jOf/WnA3lYAGPelz5vHXUkB4Iue/ezq3bx3ee+oZyJAgAABAgQIECBAgAABAgsCzzzzzJvmAsBSISAFgU5jiG/YntsG97FNGN81jesuzec5sg/d3xYAuj/Z9tLjsqxFg7GA0GVpu81x2XnMp8CywG4RAQIECBAgQIAAAQIECBC4XIEHDx68oj3jCbwN/2Pb0QAtAKQdQ/cc/nt7WxifiwBL62WdPsfcZt+yz2m7T+M63X63m9t9beN6ne/ra+B/kmJA9qnbSfv7v+zL3n+576hnI0CAAAECBAgQIECAAAECCwI5Qd1JBYAxaI/hvwE6Abuh/6S2oXxsx7DfQD8+5zif58w68z7P+9UiQNo8fqlg0HX6OtJm3Qb4fQsB3b++jm4jj3/66adfu8BuEQECBAgQIECAAAECBAgQuHSBRy4F2PCbELttakgfQ3fCb8J/gv1JRYCul3Ub6Bui5202pPc5s17Df9txn7te26yf+9POzzUG/3k+j8/jTioCZL3sYwsame9z5rGrd/Po0t9RT0iAAAECBAgQIECAAAECBJYEeiWAMew2xKbt1FA9tmNw3jf8twDQQJ7tZb5hf6nN/d2n7Oe4z7mdKcfbZ2pBoAG+Ib3b7bbG582y7sPYZp0+bx3S9rEN/mOb+/Lcjv9f+rRZRoAAAQIECBAgQIAAAQJXJpDj1Buix/A8zs/hNyG30xieT+r9b1DOYxqiG8zHttvseg3h2c8XPHjwtmDl8npPPfXUyzPMPm0Bc3/W6/5nG+O2M59lY5Afn6/zfUxuz691XKevKW0ek3Xz3Ib/9x3REiBAgAABAgQIECBAgMBBCCSotgAwBueE2AbvFgAahBueezuBOOE3BYBnv/e3HzkMYAzImc+6fXxD9tg2XGfbff7sS/Zt3171FjX6PN1mn2fcj6V1uv6udtxWX2OWZb+f7/J/B/HZthMECBAgQIAAAQIECBAg8KjA0bYCQHvRWwxoWG7wT9uQnPA7jwBoME6b+7NuH5v5hui24/15rk4tADzveXe+8NFd33pr/ZryXN3G/Ly7igB9Tbva7nNfY2/n+TpKYeveuYMAAQIECBAgQIAAAQIECFyFQHrWTyoCJNg2UI9tg3yC8DgCoME4bcLxGO77mIbmtA3oS232bRzmv4/RM88886Zxnzvf7Xcf0ua+Trl/vC/z4zTeP77Gvs4UK1b7d7TPPlqHAAECBAgQIECAAAECBAhcqsCDBw9ecVIBIMG24XlsG5bH3v8xGDfkLz1mLAw0oI9hu4WBM/ao38/JArvfY8Cf9yW3e//SfnSfsl7n+7r6Wvtazrivl/p+ezICBAgQIECAAAECBAgQuMUCOW69RYCE5nlqQB7DcwPxtvDfXvGE5vFxDc/z8obrtA3UOZ7/rG9LDhnI4xvqsw99HW3H/eqyrj/uT+ezfve/4b+vc3Ps/1l31+MIECBAgAABAgQIECBAgMDFC+w6GWCLAQ3GCcENxAm/2woADfFZt0E78+Pybqdtw3Vu73vSvxN07q1f26rA0f0fg37nu39puyxt92tsu48tAPT1nPYwhRP2290ECBAgQIAAAQIECBAgQOBCBO698Pkv+Oe7RgGMITmBOMG34b9huG1DctZbetwYqHN/t5fH5fY596bfyzkBss2E+u5P58fAP97X+7uv836Or/UPfd2zv34h74qNEiBAgAABAgQIECBAgACB8xbo5fO2FQEaiBuEE4DHAkDmx1A8BucG67Ew0Psb/tPmOXLs/uq13T/n13c8EqDnBeg+pe1rSzvOd515X/M6+lpz3zmNVjjnl2xzBAgQIECAAAECBAgQIEBgQeBLXnznJQ3/aTv0v22DcQN7A3ALAb2dcNzA3ACdto9rEaBtluf+PM8mSN9d2L3zWHS3hwPk9fX1dB/H8N9lY9vX1P3O6818HqcAcB5vj20QIECAAAECBAgQIECAwKUJpPe9RYAG/7YNzAm9Dfv7hv8E6bEA0PCc5dlunvOSzqB/d33Vg81JD/PaxpDfIkBf63jfUgEgy7KNJzlZ4aW9uZ6IAAECBAgQIECAAAECBAhUYNclAROKG+LHAkDnUxhoSE47hufM97FdL9tLeM6x+Xne7sMltHdzwr4875f+u//OuvgwB/75dvd/fA15HVme13BJxYtLoPEUBAgQIECAAAECBAgQIHBrBLaNAkjYPWvvfwP0HP43PedHV4H7BV9658szdL8jHpYOC8h+d2pxI6+hU+5LAeCSCxhXweU5CRAgQIAAAQIECBAgQOCmCWwbBZCw2+DbXv+2DfZLPf/pTW+Petr2+ud4/Cu2Wx0OcOdFLQL83qOj9WiA7F+mcb/HIkAN8lqzzuaKBed90sIrpvH0BAgQIECAAAECBAgQIHArBOZRAA3wHQLf4J92DP9zAaCBv23C8ma4/NEBQd7PPmUEQIoALQTk9lgMSBEgr2+c8rqcAPCA3km7QoAAAQIECBAgQIAAAQKnE1gfI78KwB0ePxcAEvpbBGgBIAE563VqeE6bkPzMM8+8abUXh9pTfnyFgLEA0NffYsBYBOjrjdXpdK1NgAABAgQIECBAgAABAgQOSGDXKID2gicENwg38K9P6rcK/Dm+P4cTZJj9Ab2snbvS8wLk5IA9QeC2IkBe92b4/85tupMAAQIECBAgQIAAAQIECBy0QMLwHH4T8tPD37CftoE/w+jTG/685935woN+YSfv3FGKF3ntHQ0wFgNqEIcDOI/Bya/GGgQIECBAgAABAgQIECBA4CSB9OAn2CfoPtebnx79B69I0P+SF995SYoEq23cO2k71/D+e3nNL3z+C/75WAR5ZH51PoMb+tqv4dtllwkQIECAAAECBAgQIEDgvAQO9dj983p9S9u5myJHzl8wjgBoESCFkKUHWUaAAAECBAgQIECAAAECBAhcQ4Gcw2B9SMCqx38d/j9/JYNr+GrsMgECBAgQIECAAAECBAgQILBN4O7qjkz3N+c3uI2jIbbZWE6AAAECBAgQIECAAAECBAgQIECAAAECBAgQIECAAAECBAgQIECAAAECBAgQIECAAAECBAgQIECAAAECBAgQIECAAAECBAgQIECAAAECBAgQIECAAAECBAgQIECAAAECBAgQIECAAAECBAgQIECAAAECBAgQIECAAAECBAgQIECAAAECBAgQIECAAAECBAgQIECAAAECBAgQIECAAAECBAgQIECAAAECBAgQIECAAAECBAgQIECAAAECBAgQIECAAAECBAgQIECAAAECBAgQIECAAAECBAgQIECAAAECBAgQIECAAAECBAgQIECAAAECBAgQIECAAAECBAgQIECAAAECBAgQIECAAAECBAgQIECAAAECBAgQIECAAAECBAgQIECAAAECBAgQIECAAAECBAgQIECAAAECBAgQIECAAAECBAgQIECAAAECBAgQIECAAAECBAgQIECAAAECBAgQIECAAAECBAgQIECAAAECBAgQIECAAAECBAgQIECAAAECBAgQIECAAAECBAgQIECAAAECBAgQIECAAAECBAgQIECAAAECBAgQIECAAAECBAgQIECAAAECBAgQIECAAAECBAgQIECAAAECBAgQIECAAAECBAgQIECAAAECBAgQIECAAAECBAgQIECAAAECBAgQIECAAAECBAgQIECAAAECBAgQIECAAAECBAgQIECAAAECBAgQIECAAAECBAgQIECAAAECBAgQIECAAAECBAgQIECAAAECBAgQIECAAAECBAgQIECAAAECBAgQIECAAAECBAgQIECAAAECBAgQIECAAAECBAgQIECAAAECBAgQIECAAAECBAgQIECAAAECBAgQIECAAAECBAgQIECAAAECBAgQIECAAAECBAgQIECAAAECBAgQIECAAAECBAgQIECAAAECBAgQIECAAAECBAgQIECAAAECBAgQIECAAAECBAgQIECAAAECBAgQIECAAAECBAgQIECAAAECBAgQIECAAAECBAgQIECAAAECBAgQIECAAAECBAgQIECAAAECBAgQIECAAAECBAgQIECAAAECBAgQIECAAAECBAgQIECAAAECBAgQIECAAAECBAgQIECAAAECBAgQIECAAAECBAgQIECAAAECBAgQIECAAAECBAgQIECAAAECBAgQIECAAAECBAgQIECAAAECBAgQIECAAAECBAgQIECAAAECBAgQIECAAAECBAgQIECAAAECBAgQIECAAAECBAgQIECAAAECBAgQIECAAAECBAgQIECAAAECBAgQIECAAAECBAgQIECAAAECBAgQIECAAAECBAgQIECAAAECBAgQIECAAAECBAgQIECAAAECBAgQIECAAAECBAgQIECAAAECBAgQIECAAAECBAgQIECAAAECBAgQIECAAAECBAgQIECAAAECBAgQIECAAAECBAgQIECAAAECBAgQIECAAAECBAgQIECAAAECBAgQIECAAAECBAgQIECAAAECBAgQIECAAAECBAgQIECAAAECBAgQIECAAAECBAgQIECAAAECBAgQIECAAAECBAgQIECAAAECBAgQIECAAAECBAgQIECAAAECBAgQIECAAAECBAgQIECAAAECBAgQIECAAAECBAgQIECAAAECBAgQIECAAAECBAgQIECAAAECBAgQIECAAAECBAgQIECAAAECBAgQIECAAAECBAgQIECAAAECBAgQIECAAAECBAgQIECAAAECBAgQIECAAAECBAgQIECAAAECBAgQIECAAAECBAgQIECAAAECBAgQIECAAAECBAgQIECAAAECBAgQIECAAAECBAgQIECAAAECBAgQIECAAAECBAgQIECAAAECBAgQIECAAAECBAgQIECAAAECBAgQIECAAAECBAgQIECAAAECBAgQIECAAAECBAgQIECAAAECBAgQIECAAAECBAgQIECAAAECBAgQIECAAAECBAgQIECAAAECBAgQIECAAAECBAgQIECAAAECBAgQIECAAAECBAgQIECAAAECBAgQIECAAAECBAgQIECAAAECBAgQIECAAAECBAgQIECAAAECBAgQIECAAAECBAgQIECAAAECBAgQIECAAAECBAgQIECAAAECBAgQIECAAAECBAgQIECAAAECBAgQIECAAAECBAgQIECAAAECBAgQIECAAAECBAgQIECAAAECBAgQIECAAAECBAgQIECAAAECBAgQIECAAAECBAgQIECAAAECBAgQIECAAAECBAgQIECAAAECBAgQIECAAAECBAgQIECAAAECBAgQIECAAAECBAgQIECAAAECBAgQIECAAAECBAgQIECAAAECBAgQIECAAAECBAgQIECAAAECBAgQIECAAAECBAgQIECAAAECBAgQIECAAAECBAgQIECAAAECBAgQIECAAAECBAgQIECAAAECBAgQIECAAAECBAgQIECAAAECBAgQIECAAAECBAgQIECAAAECBAgQIECAAAECBAgQIECAAAECBAgQIECAAAECBAgQIECAAAECBAgQIECAAAECBAgQIECAAAECBAgQIECAAAECBAgQIECAAAECBAgQIECAAAECBAgQIECAAAECBAgQIECAAAECBAgQIECAAAECBAgQIECAAAECBAgQIECAAAECBAgQIECAAAECBAgQIECAAAECBAgQIECAAAECBAgQIECAAAECBAgQIECAAAECBAgQIECAAAECBAgQIECAAAECBAgQIECAAAECBAgQIECAAAECBAgQIECAAAECBAgQIECAAAECBAgQIECAAAECBAgQIECAAAECBAgQIECAAAECBAgQIECAAAECBAgQIECAAAECBAgQIECAAAECBAgQIECAAAECBAgQIECAAAECBAgQIECAAAECBAgQIECAAAECBAgQIECAAAECBAgQIECAAAECBAgQIECAAAECBAgQIECAAAECBAgQIECAAAECBAgQIECAAAECBAgQIECAAAECBAgQIECAAAECBAgQIECAAAECBAgQIECAAAECBAgQIECAAAECBAgQIECAAAECBAgQIECAAAECBAgQIECAAAECBAgQIECAAAECBAgQIECAAAECBAgQIECAAAECBAgQIECAAAECBAgQIECAAAECBAgQIECAAAECBAgQIECAAAECBAgQIECAAAECBAgQIECAAAECBAgQIECAAAECBAgQIECAAAECBAgQIECAAAECBAgQIECAAAECBAgQIECAAAECBAgQIECAAAECBAgQIECAAAECBAgQIECAAAECBAgQIECAAAECBAgQIECAAAECBAgQIECAAAECBAgQIECAAAECBAgQIECAAAECBAgQIECAAAECBAgQIECAAAECBAgQIECAAAECBAgQIECAAAECBAgQIECAAAECBAgQIECAAAECBAgQIECAAAECBAgQIECAAAECBAgQIECAAAECBAgQIECAAAECBAgQIECAAAECBAgQIECAAAECBAgQIECAAAECBAgQIECAAAECBAgQIECAAAECBAgQIECAAAECBAgQIECAAAECBAgQIECAAAECBAgQIECAAAECBAgQIECAAAECBAgQIECAAAECBAgQIECAAAECBAgQIECAAAECBAgQIECAAAECBAgQIECAAAECBAgQIECAAAECBAgQIECAAAECBAgQIECAAAECBAgQIECAAAECBAgQIECAAAECBAgQIECAAAECBAgQIECAAAECBAgQIECAAAECBAgQIECAAAECBAgQIECAAAECBAgQIECAAAECBAgQIECAAAECBAgQIECAAAECBAgQIECAAAECBAgQIECAAAECBAgQIECAAAECBAgQIECAAAECBAgQIECAAAECBAgQIECAAAECBAgQIECAAAECBAgQIECAAAECBAgQIECAAAECBAgQIECAAAECBAgQIECAAAECBAgQIECAAAECBAgQIECAAAECBAgQIECAAAECBAgQIECAAAECBAgQIECAAAECBAgQIECAAAECBAgQIECAAAECBAgQIECAAAECBAgQIECAAAECBAgQIECAAAECBAgQIECAAAECBAgQIECAAAECBAgQIECAAAECBAgQIECAAAECBAgQIECAAAECBAgQIECAAAECBAgQIECAAAECBAgQIECAAAECBAgQIECAAAECBAgQIECAAAECBAgQIECAAAECBAgQIECAAAECBAgQIECAAAECBAgQIECAAAECBAgQIECAAAECBAgQIECAAAECBAgQIECAAAECBAgQIECAAAECBAgQIECAAAECBAgQIECAAAECBAgQIECAAAECBAgQIECAAAECBAgQIECAAAECBAgQIECAAAECBAgQIECAAAECBAgQIECAAAECBAgQIECAAAECBAgQIECAAAECBAgQIECAAAECBAgQIECAAAECBAgQIECAAAECBAgQIECAAAECBAgQIECAAAECBAgQIECAAAECBAgQIECAAAECBAgQIECAAAECBAgQIECAAAECBAgQIECAAAECBAgQIECAAAECBAgQIECAAAECBAgQIECAAAECBAgQIECAAAECBAgQIECAAAECBAgQIECAAAECBAgQIECAAAECBAgQIECAAAECBAgQIECAAAECBAgQIECAAAECBAgQIECAAAECBAgQIECAAAECBAgQIECAAAECBAgQIECAAAECBAgQIECAAAECBAgQIECAAAECBAgQIECAAAECBAgQIECAAAECBAgQIECAAAECBAgQIECAAAECBAgQIECAAAECBAgQIECAAAECBAgQIECAAAECBAgQIECAAAECBAgQIECAAAECBAgQIECAAAECBAgQIECAAAECBAgQIECAAAECBAgQIECAAAECBAgQIECAAAECBAgQIECAAAECBAgQIECAAAECBAgQIECAAAECBAgQIECAAAECBAgQIECAAAECBAgQIECAAAECBAgQIECAAAECBAgQIECAAAECBAgQIECAAAECBAgQIECAAAECBAgQIECAAAECBAgQIECAAAECBAgQIECAAAECBAgQIECAAAECBAgQIECAAAECBAgQIECAAAECBAgQIECAAAECBAgQIECAAAECBAgQIECAAAECBAgQIECAAAECBAgQIECAAAECBAgQIECAAAECBAgQIECAAAECBAgQIECAAAECBAgQIECAAAECBAgQIECAAAECBAgQIECAAAECBAgQIECAAAECBAgQIECAAAECBAgQIECAAAECBAgQIECAAAECBAgQIECAAAECBAgQIECAAAECBAgQIECAAAECBAgQIECAAAECBAgQIECAAAECBAgQIECAAAECBAgQIECAAAECBAgQIECAAAECBAgQIECAAAECBAgQIECAAAECBAgQIECAAAECBAgQIECAAAECBAgQIECAAAECBAgQIECAAAECBAgQIECAAAECBAgQIECAAAECBAgQIECAAAECBAgQIECAAAECBAgQIECAAAECBAgQIECAAAECBAgQIECAAAECBAgQIECAAAECBAgQIECAAAECBAgQIECAAAECBAgQIECAAAECBAgQIECAAAECBAgQIECAAAECBAgQIECAAAECBAgQIECAAAECBAgQIECAAAECBAgQIECAAAECBAgQIECAAAECBAgQIECAAAECBAgQIECAAAECBAgQIECAAAECBAgQIECAAAECBAgQIECAAAECBAgQIECAAAECBAgQIECAAAECBAgQIECAAAECBAgQIECAAAECBAgQIECAAAECBAgQIECAAAECBAgQIECAAAECBAgQIECAAAECBAgQIECAAAECBAgQIECAAAECBAgQIECAAAECBAgQIECAAAECBAgQIECAAAECBAgQIECAAAECBAgQIECAAAECBAgQIECAAAECBAgQIECAAAECBAgQIECAAAECBAgQIECAAAECBAgQIECAAAECBAgQIECAAAECBAgQIECAAAECBAgQIECAAAECBAgQIECAAAECBAgQIECAAAECBAgQIECAAAECBAgQIECAAAECBAgQIECAAAECBAgQIECAAAECBAgQIECAAAECBAgQIECAAAECBAgQIECAAAECBAgQIECAAAECBAgQIECAAAECBAgQIECAAAECBAgQIECAAAECBAgQIECAAAECBAgQIECAAAECBAgQIECAAAECBAgQIECAAAECBAgQIECAAAECBAgQIECAAAECBAgQIECAAAECBAgQIECAAAECBAgQIECAAAECBAgQIECAAAECBAgQIECAAAECBAgQIECAAAECBAgQIECAAAECBAgQIECAAAECBAgQIECAAAECBAgQIECAAAECBAgQIECAAAECBAgQIECAAAECBAgQIECAAAECBAgQIECAAAECBAgQIECAAAECBAgQIECAAAECBAgQIECAAAECBAgQIECAAAECBAgQIECAAAECBAgQIECAAAECBAgQIECAAAECBAgQIECAAAECBAgQIECAAAECBAgQIECAAAECBAgQIECAAAECBAgQIECAAAECBAgQIECAAAECBAgQIECAAAECBAgQIECAAAECBAgQIECAAAECBAgQIECAAAECBAgQIECAAAECBAgQIECAAAECBAgQIECAAAECBAgQIECAAAECBAgQIECAAAECBAgQIECAAAECBAgQIECAAAECBAgQIECAAAECBAgQIECAAAECBAgQIECAAAECBAgQIECAAAECBAgQIECAAAECBAgQIECAAAECBAgQIECAAAECBAgQIECAAAECBAgQIECAAAECBAgQIECAAAECBAgQIECAAAECBAgQIECAAAECBAgQIECAAAECBAgQIECAAAECBAgQIECAAAECBAgQIECAAAECBAgQIECAAAECBAgQIECAAAECBAgQIECAAAECBAgQIECAAAECBAgQIECAAAECBAgQIECAAAECBAgQIECAAAECBAgQIECAAAECBAgQIECAAAECBAgQIECAAAECBAgQIECAAAECBAgQIECAAAECBAgQIECAAAECBAgQIECAAAECBAgQIECAAAECBAgQIECAAAECBAgQIECAAAECBAgQIECAAAECBAgQIECAAAECBAgQIECAAAECBAgQIECAAAECBAgQIECAAAECBAgQIECAAAECBAgQIECAAAECBAgQIECAAAECBAgQIECAAAECBAgQIECAAAECBAgQIECAAAECBAgQIECAAAECBAgQIECAAAECBAgQIECAAAECBAgQIECAAAECBAgQIECAAAECBAgQIECAAAECBAgQIECAAAECBAgQIECAAAECBAgQIECAAAECBAgQIECAAAECBAgQIECAAAECBAgQIECAAAECBAgQIECAAAECBAgQIECAAAECBAgQIECAAAECBAgQIECAAAECBAgQIECAAAECBAgQIECAAAECBAgQIECAAAECBAgQIECAAAECBAgQIECAAAECBAgQIECAAAECBAgQIECAAAECBAgQIECAAAECBAgQIECAAAECBAgQIECAAAECBAgQIECAAAECBAgQIECAAAECBAgQIECAAAECBAgQIECAAAECBAgQIECAAAECBAgQIECAAAECBAgQIECAAAECBAgQIECAAAECBAgQIECAAAECBAgQIECAAAECBAgQIECAAAECBAgQIECAAAECBAgQIECAAAECBAgQIECAAAECBAgQIECAAAECBAgQIECAAAECBAgQIECAAAECBAgQIECAAAECBAgQIECAAAECBAgQIECAAAECBAgQIECAAAECBAgQIECAAAECBAgQIECAAAECBAgQIECAAAECBAgQIECAAAECBAgQIECAAAECBAgQIECAAAECBAgQIECAAAECBAgQIECAAAECBAgQIECAAAECBAgQIECAAAECBAgQIECAAAECBAgQIECAAAECBAgQIECAAAECBAgQIECAAAECBAgQIECAAAECBAgQIECAAAECBAgQIECAAAECBAgQIECAAAECBAgQIECAAAECBAgQIECAAAECBAgQIECAAAECBAgQIECAAAECBAgQIECAAAECBAgQIECAAAECBAgQIECAAAECBAgQIECAAAECBAgQIECAAAECBAgQIECAAAECBAgQIECAAAECBAgQIECAAAECBAgQIECAAAECBAgQIECAAAECBAgQIECAAAECBAgQIECAAAECBAgQIECAAAECBAgQIECAAAECBAgQIECAAAECBAgQIECAAAECBAgQIECAAAECBAgQIECAAAECBAgQIECAAAECBAgQIECAAAECBAgQIECAAAECBAgQIECAAAECBAgQIECAAAECBAgQIECAAAECBAgQIECAAAECBAgQIECAAAECBAgQIECAAAECBAgQIECAAAECBAgQIECAAAECBAgQIECAAAECBAgQIECAAAECBAgQIECAAAECBAgQIECAAAECBAgQIECAAAECBAgQIECAAAECBAgQIECAAAECBAgQIECAAAECBAgQIECAAAECBAgQIEDglgv8/wGhc38j/VBY6AAAAABJRU5ErkJggg=="]}]
DragonBones Name
Armature Name
Skin Name
Animation Name
X 1.00
Background Color
Show Grid
Show Bone