[{"data":"REJEVAAAAAF81QAAeyJmcmFtZVJhdGUiOjMwLCJuYW1lIjoibWVsbG93ZHJhZ29uX3dhdGVyXzAzIiwic3RhZ2UiOiJhcm1hdHVyZU5hbWUiLCJ2ZXJzaW9uIjoiNS41IiwiY29tcGF0aWJsZVZlcnNpb24iOiI1LjUiLCJhcm1hdHVyZSI6W3sidHlwZSI6IkFybWF0dXJlIiwiZnJhbWVSYXRlIjozMCwibmFtZSI6ImFybWF0dXJlTmFtZSIsImFhYmIiOnsieCI6LTI0MS4zMiwieSI6LTMyOS40MSwid2lkdGgiOjEwNDEuMzMsImhlaWdodCI6NjIxLjM4fSwiYm9uZSI6W3sibmFtZSI6InJvb3QiLCJ0cmFuc2Zvcm0iOnsic2NYIjowLjgsInNjWSI6MC44fX0seyJuYW1lIjoiYXR0YWNrIiwicGFyZW50Ijoicm9vdCIsInRyYW5zZm9ybSI6eyJ4IjozMTcuODgsInkiOi0xMjguNzN9fSx7Im5hbWUiOiJib25lIiwicGFyZW50Ijoicm9vdCIsInRyYW5zZm9ybSI6eyJ4IjozODIuNjEsInkiOi0yNTkuOTd9fSx7Im5hbWUiOiJidXR0b25fYnV0dG9uIiwicGFyZW50Ijoicm9vdCIsInRyYW5zZm9ybSI6eyJ4IjoyNy45MSwieSI6MTM2LjE2LCJzY1giOjEuNiwic2NZIjoxLjZ9fSx7Im5hbWUiOiJlZmZlY3QiLCJwYXJlbnQiOiJyb290IiwidHJhbnNmb3JtIjp7IngiOjQ1NC4xOSwieSI6LTk3LjE2fX0seyJsZW5ndGgiOjUzLCJuYW1lIjoiZWZmZWN0X2JsdWUiLCJwYXJlbnQiOiJyb290IiwidHJhbnNmb3JtIjp7IngiOjE0LjA0LCJ5IjotMjc3Ljk2LCJza1giOjIuMjUsInNrWSI6Mi4yNX19LHsibGVuZ3RoIjo1MiwibmFtZSI6ImVmZmVjdF9ib3R0b21fMSIsInBhcmVudCI6InJvb3QiLCJ0cmFuc2Zvcm0iOnsieCI6NS42OSwieSI6MjcyLjUzLCJza1giOi05MS4zNiwic2tZIjotOTEuMzZ9fSx7Imxlbmd0aCI6NTIsIm5hbWUiOiJlZmZlY3RfYm90dG9tXzIiLCJwYXJlbnQiOiJyb290IiwidHJhbnNmb3JtIjp7IngiOjUuNjksInkiOjI2MC40Mywic2tYIjotOTEuMzYsInNrWSI6LTkxLjM2LCJzY1giOjAuNjc3LCJzY1kiOjAuNjc3fX0seyJsZW5ndGgiOjYwLCJuYW1lIjoiZWZmZWN0X2Rvd25fMSIsInBhcmVudCI6InJvb3QiLCJ0cmFuc2Zvcm0iOnsieCI6LTAuOTQsInkiOjkyLjM5LCJza1giOjkyLjcyLCJza1kiOjkyLjcyfX0seyJsZW5ndGgiOjYwLCJuYW1lIjoiZWZmZWN0X2Rvd25fMiIsInBhcmVudCI6InJvb3QiLCJ0cmFuc2Zvcm0iOnsieCI6LTAuOTQsInkiOjcyLjI4LCJza1giOjkyLjcyLCJza1kiOjkyLjcyLCJzY1giOjAuNzM2LCJzY1kiOjAuNzM2fX0seyJuYW1lIjoiaGlwIiwicGFyZW50Ijoicm9vdCIsInRyYW5zZm9ybSI6eyJ4Ijo0Ni4zMiwieSI6LTE2LjY2fX0seyJuYW1lIjoibGVnX2wiLCJwYXJlbnQiOiJyb290IiwidHJhbnNmb3JtIjp7IngiOjcuOTMsInkiOjM4Ljg0fX0seyJuYW1lIjoibGVnX3IiLCJwYXJlbnQiOiJyb290IiwidHJhbnNmb3JtIjp7IngiOi00Ljg3LCJ5IjoxLjUxfX0seyJuYW1lIjoibWVsbG93ZHJhZ29uX3dhdGVyXzAzX3JvY2tldF8wMSIsInBhcmVudCI6InJvb3QiLCJ0cmFuc2Zvcm0iOnsieCI6LTE0NS44MSwieSI6LTE0My4yfX0seyJuYW1lIjoibWVsbG93ZHJhZ29uX3dhdGVyXzAzX3JvY2tldF8wMiIsInBhcmVudCI6InJvb3QiLCJ0cmFuc2Zvcm0iOnsieCI6MTcyLjgyLCJ5IjotMTI5LjA3fX0seyJuYW1lIjoibWVsbG93ZHJhZ29uX3dhdGVyXzAzX3JvY2tldF8wMyIsInBhcmVudCI6InJvb3QiLCJ0cmFuc2Zvcm0iOnsieCI6LTIuNiwieSI6NTEuODd9fSx7Im5hbWUiOiJhcnJvdyIsInBhcmVudCI6ImJ1dHRvbl9idXR0b24iLCJ0cmFuc2Zvcm0iOnsieCI6MjYuOSwieSI6NDEuMjEsInNrWCI6MTgwLCJza1kiOjE4MH19LHsibmFtZSI6ImFycm93MiIsInBhcmVudCI6ImJ1dHRvbl9idXR0b24iLCJ0cmFuc2Zvcm0iOnsieCI6LTMwLjE1LCJ5Ijo0MS4yMSwic2tYIjo5MCwic2tZIjo5MH19LHsibmFtZSI6ImFycm93MyIsInBhcmVudCI6ImJ1dHRvbl9idXR0b24iLCJ0cmFuc2Zvcm0iOnsieCI6LTkwLjA0LCJ5Ijo0MS4yMX19LHsibGVuZ3RoIjoyMywibmFtZSI6ImJvbmU0OSIsInBhcmVudCI6Im1lbGxvd2RyYWdvbl93YXRlcl8wM19yb2NrZXRfMDMiLCJ0cmFuc2Zvcm0iOnsieCI6OTcuOCwieSI6MzMuMDYsInNrWCI6OTEuOCwic2tZIjo5MS44fX0seyJuYW1lIjoiYnV0dG9uIiwicGFyZW50IjoiYnV0dG9uX2J1dHRvbiIsInRyYW5zZm9ybSI6eyJ4Ijo5MC4wOSwieSI6NDEuMjF9fSx7Im5hbWUiOiJlZmZlY3RfMDIiLCJwYXJlbnQiOiJlZmZlY3QiLCJ0cmFuc2Zvcm0iOnsieCI6LTEuOTcsInkiOjI2LjQ5fX0seyJuYW1lIjoiZWZmZWN0XzAzIiwicGFyZW50IjoiZWZmZWN0IiwidHJhbnNmb3JtIjp7IngiOi0wLjczLCJ5IjoyNS4yfX0seyJuYW1lIjoiZWZmZWN0XzA0IiwicGFyZW50IjoiZWZmZWN0IiwidHJhbnNmb3JtIjp7IngiOi0xLjQ4LCJ5IjoyNC42NH19LHsibGVuZ3RoIjoxMCwibmFtZSI6ImVmZmVjdF8wNF8wMSIsInBhcmVudCI6ImJvbmUiLCJ0cmFuc2Zvcm0iOnsieCI6LTEwMi44LCJ5IjotMC4zOCwic2tYIjotMTc0LjU1LCJza1kiOi0xNzQuNTV9fSx7Imxlbmd0aCI6NTUsIm5hbWUiOiJlZmZlY3RfZmlyZSIsInBhcmVudCI6ImVmZmVjdCIsInRyYW5zZm9ybSI6eyJ4IjotMzYuMTIsInkiOjI3Ljg2LCJza1giOjEuMTQsInNrWSI6MS4xNH19LHsibmFtZSI6ImVmZmVjdF9saWdodDMiLCJwYXJlbnQiOiJlZmZlY3QiLCJ0cmFuc2Zvcm0iOnsieCI6LTQuMTQsInkiOjI2LjE2fX0seyJsZW5ndGgiOjM3LCJuYW1lIjoiZWZmZWN0X2xpZ2h0ZHVzdDMiLCJwYXJlbnQiOiJlZmZlY3QiLCJ0cmFuc2Zvcm0iOnsieCI6NC43MywieSI6MjEuNTQsInNrWCI6LTEwLjA1LCJza1kiOi0xMC4wNSwic2NYIjowLjc4Mywic2NZIjowLjc4M319LHsibmFtZSI6ImVmZmVjdF9yZWQiLCJwYXJlbnQiOiJlZmZlY3QiLCJ0cmFuc2Zvcm0iOnsieCI6NS4xOSwieSI6MjYuODh9fSx7Imxlbmd0aCI6NTcsIm5hbWUiOiJsaWdodGluZyIsInBhcmVudCI6ImJvbmUiLCJ0cmFuc2Zvcm0iOnsieCI6MTUzLjExLCJ5Ijo1Ny4wNCwic2tYIjotODkuMDksInNrWSI6LTg5LjA5LCJzY1giOjAuMzQ2LCJzY1kiOjAuMzQ2fX0seyJsZW5ndGgiOjU5LCJuYW1lIjoibWVsbG93ZHJhZ29uX3dhdGVyXzAzX2JvZHlfMDEiLCJwYXJlbnQiOiJoaXAiLCJ0cmFuc2Zvcm0iOnsieCI6NC4yLCJ5IjotNS42LCJza1giOi02OC4xMiwic2tZIjotNjguMTJ9fSx7Im5hbWUiOiJtZWxsb3dkcmFnb25fd2F0ZXJfMDNfZWZmZWN0X2xpZ2h0IiwicGFyZW50IjoibWVsbG93ZHJhZ29uX3dhdGVyXzAzX3JvY2tldF8wMSIsInRyYW5zZm9ybSI6eyJ4IjotNTIuNzMsInkiOi0zMC4yMX19LHsibmFtZSI6Im1lbGxvd2RyYWdvbl93YXRlcl8wM19lZmZlY3RfbGlnaHQyIiwicGFyZW50IjoibWVsbG93ZHJhZ29uX3dhdGVyXzAzX3JvY2tldF8wMiIsInRyYW5zZm9ybSI6eyJ4IjotNDMuNjEsInkiOi0yMC4zNn19LHsibGVuZ3RoIjozNywibmFtZSI6Im1lbGxvd2RyYWdvbl93YXRlcl8wM19lZmZlY3RfbGlnaHRkdXN0IiwicGFyZW50IjoibWVsbG93ZHJhZ29uX3dhdGVyXzAzX3JvY2tldF8wMSIsInRyYW5zZm9ybSI6eyJ4IjotNDIuMjcsInkiOi0xNy4wNCwic2tYIjotMTUzLjk3LCJza1kiOi0xNTMuOTcsInNjWCI6MC43ODMsInNjWSI6MC43ODN9fSx7Imxlbmd0aCI6MzYsIm5hbWUiOiJtZWxsb3dkcmFnb25fd2F0ZXJfMDNfZWZmZWN0X2xpZ2h0ZHVzdDIiLCJwYXJlbnQiOiJtZWxsb3dkcmFnb25fd2F0ZXJfMDNfcm9ja2V0XzAyIiwidHJhbnNmb3JtIjp7IngiOi00Mi45NiwieSI6LTIxLjE0LCJza1giOi0xNTcuOTIsInNrWSI6LTE1Ny45Miwic2NYIjowLjUzMSwic2NZIjowLjUzMX19LHsibGVuZ3RoIjo0NCwibmFtZSI6Im1lbGxvd2RyYWdvbl93YXRlcl8wM19sZWdfMDEiLCJwYXJlbnQiOiJoaXAiLCJ0cmFuc2Zvcm0iOnsieCI6MjAuMjcsInkiOjguODEsInNrWCI6MTUwLjQ0LCJza1kiOjE1MC40NH19LHsibGVuZ3RoIjozNSwibmFtZSI6Im1lbGxvd2RyYWdvbl93YXRlcl8wM19sZWdfMDIiLCJwYXJlbnQiOiJoaXAiLCJ0cmFuc2Zvcm0iOnsieCI6LTQyLjY1LCJ5IjotMTkuMjYsInNrWCI6MTUzLjYxLCJza1kiOjE1My42MX19LHsibGVuZ3RoIjoxOSwibmFtZSI6Im1lbGxvd2RyYWdvbl93YXRlcl8wM19yb2NrZXRfMDFfMDEiLCJwYXJlbnQiOiJtZWxsb3dkcmFnb25fd2F0ZXJfMDNfcm9ja2V0XzAxIiwidHJhbnNmb3JtIjp7IngiOi0xNy4xMSwieSI6LTMwLjQ5LCJza1giOi0xMzguODcsInNrWSI6LTEzOC44N319LHsibGVuZ3RoIjoxOCwibmFtZSI6Im1lbGxvd2RyYWdvbl93YXRlcl8wM19yb2NrZXRfMDFfMDIiLCJwYXJlbnQiOiJtZWxsb3dkcmFnb25fd2F0ZXJfMDNfcm9ja2V0XzAxIiwidHJhbnNmb3JtIjp7IngiOi00OS41MSwieSI6LTE1LjAzLCJza1giOi0xNTcuNzMsInNrWSI6LTE1Ny43M319LHsibGVuZ3RoIjozNiwibmFtZSI6Im1lbGxvd2RyYWdvbl93YXRlcl8wM19yb2NrZXRfMDFfMDMiLCJwYXJlbnQiOiJtZWxsb3dkcmFnb25fd2F0ZXJfMDNfcm9ja2V0XzAxIiwidHJhbnNmb3JtIjp7IngiOi0zOS43MywieSI6LTIwLjE1LCJza1giOi0xNTEuOTcsInNrWSI6LTE1MS45N319LHsibGVuZ3RoIjozMywibmFtZSI6Im1lbGxvd2RyYWdvbl93YXRlcl8wM19yb2NrZXRfMDJfMDEiLCJwYXJlbnQiOiJtZWxsb3dkcmFnb25fd2F0ZXJfMDNfcm9ja2V0XzAyIiwidHJhbnNmb3JtIjp7IngiOi0zNC4xNiwieSI6LTE1LjA1LCJza1giOi0xNTAuNDQsInNrWSI6LTE1MC40NH19LHsibGVuZ3RoIjoyOSwibmFtZSI6Im1lbGxvd2RyYWdvbl93YXRlcl8wM19yb2NrZXRfMDNfMDEiLCJwYXJlbnQiOiJtZWxsb3dkcmFnb25fd2F0ZXJfMDNfcm9ja2V0XzAzIiwidHJhbnNmb3JtIjp7IngiOi0zNy4zLCJ5IjozNS4xMSwic2tYIjo5My4xNSwic2tZIjo5My4xNX19LHsibGVuZ3RoIjoyOCwibmFtZSI6Im1lbGxvd2RyYWdvbl93YXRlcl8wM19yb2NrZXRfMDNfMDMiLCJwYXJlbnQiOiJtZWxsb3dkcmFnb25fd2F0ZXJfMDNfcm9ja2V0XzAzIiwidHJhbnNmb3JtIjp7IngiOi0xMjQuMDksInkiOi0xNy43LCJza1giOjkzLjE1LCJza1kiOjkzLjE1fX0seyJsZW5ndGgiOjI2LCJuYW1lIjoibWVsbG93ZHJhZ29uX3dhdGVyXzAzX3RhaWxfMDEiLCJwYXJlbnQiOiJoaXAiLCJ0cmFuc2Zvcm0iOnsieCI6MTMuOTQsInkiOjQuMSwic2tYIjo2Ni41OCwic2tZIjo2Ni41OH19LHsibmFtZSI6Im1vbnN0ZXJlZmZlY3QiLCJwYXJlbnQiOiJoaXAiLCJ0cmFuc2Zvcm0iOnsieCI6OC43OCwieSI6LTMwLjk0fX0seyJsZW5ndGgiOjExLCJuYW1lIjoicm9ja2V0XzA0XzAyIiwicGFyZW50IjoiYm9uZSIsInRyYW5zZm9ybSI6eyJ4IjoxMzAuMjIsInkiOjQ4LjQsInNrWCI6OC41LCJza1kiOjguNX19LHsibGVuZ3RoIjoxMCwibmFtZSI6InJvY2tldF8wNF8wMyIsInBhcmVudCI6ImJvbmUiLCJ0cmFuc2Zvcm0iOnsieCI6MTM1LjAxLCJ5IjozOC44NCwic2tYIjoxOC4yOSwic2tZIjoxOC4yOX19LHsibGVuZ3RoIjo5LCJuYW1lIjoicm9ja2V0XzA0XzA0IiwicGFyZW50IjoiYm9uZSIsInRyYW5zZm9ybSI6eyJ4IjoxMzEuMjIsInkiOjUxLjE5LCJza1giOjYuNzMsInNrWSI6Ni43M319LHsibGVuZ3RoIjoxMCwibmFtZSI6InJvY2tldF8wNF8wNSIsInBhcmVudCI6ImJvbmUiLCJ0cmFuc2Zvcm0iOnsieCI6MTMzLjA4LCJ5Ijo0NC41Nywic2tYIjoxOC43LCJza1kiOjE4Ljd9fSx7Im5hbWUiOiJyb2NrZXRfbGlnaHQiLCJwYXJlbnQiOiJib25lIiwidHJhbnNmb3JtIjp7IngiOjE0MS4yNiwieSI6NDYuOTl9fSx7Imxlbmd0aCI6MzMsIm5hbWUiOiJib25lMjYiLCJwYXJlbnQiOiJtZWxsb3dkcmFnb25fd2F0ZXJfMDNfbGVnXzAxIiwidHJhbnNmb3JtIjp7IngiOjQzLjQ3LCJ5IjowLjY3LCJza1giOi0yMC4zLCJza1kiOi0yMC4zfX0seyJsZW5ndGgiOjIzLCJuYW1lIjoiYm9uZTM0IiwicGFyZW50IjoibWVsbG93ZHJhZ29uX3dhdGVyXzAzX3RhaWxfMDEiLCJ0cmFuc2Zvcm0iOnsieCI6MjYuMjQsInkiOi0wLjEzLCJza1giOi0zNS4wMiwic2tZIjotMzUuMDJ9fSx7Im5hbWUiOiJlZmZlY3RfMDEiLCJwYXJlbnQiOiJidXR0b24iLCJ0cmFuc2Zvcm0iOnsieCI6LTAuODgsInkiOjAuOTMsInNjWCI6MC42MjUsInNjWSI6MC42MjV9fSx7Imxlbmd0aCI6NDIsIm5hbWUiOiJtZWxsb3dkcmFnb25fd2F0ZXJfMDNfYXJtXzAxIiwicGFyZW50IjoibWVsbG93ZHJhZ29uX3dhdGVyXzAzX2JvZHlfMDEiLCJ0cmFuc2Zvcm0iOnsieCI6NTcuOTQsInkiOjEyLjUxLCJza1giOjEyNi40Mywic2tZIjoxMjYuNDN9fSx7Imxlbmd0aCI6MzQsIm5hbWUiOiJtZWxsb3dkcmFnb25fd2F0ZXJfMDNfYXJtXzAyIGNvcHkiLCJwYXJlbnQiOiJtZWxsb3dkcmFnb25fd2F0ZXJfMDNfYm9keV8wMSIsInRyYW5zZm9ybSI6eyJ4Ijo1NS4zLCJ5IjotMjkuNzEsInNrWCI6LTEyOS44NCwic2tZIjotMTI5Ljg0fX0seyJsZW5ndGgiOjMxLCJuYW1lIjoibWVsbG93ZHJhZ29uX3dhdGVyXzAzX2Zvb3RfMDIiLCJwYXJlbnQiOiJtZWxsb3dkcmFnb25fd2F0ZXJfMDNfbGVnXzAyIiwidHJhbnNmb3JtIjp7IngiOjM0Ljk4LCJ5IjowLjE2LCJza1giOi0xMDkuOTEsInNrWSI6LTEwOS45MX19LHsibGVuZ3RoIjozMCwibmFtZSI6Im1lbGxvd2RyYWdvbl93YXRlcl8wM19oZWFkXzAxIiwicGFyZW50IjoibWVsbG93ZHJhZ29uX3dhdGVyXzAzX2JvZHlfMDEiLCJ0cmFuc2Zvcm0iOnsieCI6NTkuOTIsInkiOjAuMDksInNrWCI6LTExLjIyLCJza1kiOi0xMS4yMn19LHsibGVuZ3RoIjoxMiwibmFtZSI6Im1lbGxvd2RyYWdvbl93YXRlcl8wM19zY2FyZl8wMiIsInBhcmVudCI6Im1lbGxvd2RyYWdvbl93YXRlcl8wM19ib2R5XzAxIiwidHJhbnNmb3JtIjp7IngiOjY2Ljc3LCJ5IjoyMi45OCwic2tYIjo3OC4zNCwic2tZIjo3OC4zNH19LHsibGVuZ3RoIjozMSwibmFtZSI6Im1lbGxvd2RyYWdvbl93YXRlcl8wM193aW5nXzAxIiwicGFyZW50IjoibWVsbG93ZHJhZ29uX3dhdGVyXzAzX2JvZHlfMDEiLCJ0cmFuc2Zvcm0iOnsieCI6NDguNzcsInkiOjEzLjExLCJza1giOjY3LjczLCJza1kiOjY3LjczfX0seyJsZW5ndGgiOjIwLCJuYW1lIjoibWVsbG93ZHJhZ29uX3dhdGVyXzAzX3dpbmdfMDIiLCJwYXJlbnQiOiJtZWxsb3dkcmFnb25fd2F0ZXJfMDNfYm9keV8wMSIsInRyYW5zZm9ybSI6eyJ4Ijo1Mi42MiwieSI6LTI1Ljc5LCJza1giOi03Ny45OSwic2tZIjotNzcuOTl9fSx7Imxlbmd0aCI6MjUsIm5hbWUiOiJib25lMTkiLCJwYXJlbnQiOiJtZWxsb3dkcmFnb25fd2F0ZXJfMDNfd2luZ18wMSIsInRyYW5zZm9ybSI6eyJ4IjozMS4zMiwieSI6LTAuMTQsInNrWCI6LTM2LjcyLCJza1kiOi0zNi43Mn19LHsibGVuZ3RoIjo4LCJuYW1lIjoiYm9uZTI3IiwicGFyZW50IjoiYm9uZTI2IiwidHJhbnNmb3JtIjp7IngiOjMyLjg4LCJ5IjotMC40Miwic2tYIjoxNS40LCJza1kiOjE1LjR9fSx7Imxlbmd0aCI6MTEsIm5hbWUiOiJib25lMzEiLCJwYXJlbnQiOiJtZWxsb3dkcmFnb25fd2F0ZXJfMDNfZm9vdF8wMiIsInRyYW5zZm9ybSI6eyJ4IjozMS44NCwieSI6LTAuMzQsInNrWCI6MjAuNywic2tZIjoyMC43fX0seyJsZW5ndGgiOjE5LCJuYW1lIjoiYm9uZTM1IiwicGFyZW50IjoiYm9uZTM0IiwidHJhbnNmb3JtIjp7IngiOjIyLjkyLCJ5IjowLjM2LCJza1giOi0yOS43NCwic2tZIjotMjkuNzR9fSx7Imxlbmd0aCI6MjIsIm5hbWUiOiJib25lMzciLCJwYXJlbnQiOiJtZWxsb3dkcmFnb25fd2F0ZXJfMDNfd2luZ18wMiIsInRyYW5zZm9ybSI6eyJ4IjoyMC43MiwieSI6MC4wOCwic2tYIjo0MS4xNSwic2tZIjo0MS4xNX19LHsibGVuZ3RoIjo0MSwibmFtZSI6Im1lbGxvd2RyYWdvbl93YXRlcl8wM19lYXJfMDEiLCJwYXJlbnQiOiJtZWxsb3dkcmFnb25fd2F0ZXJfMDNfaGVhZF8wMSIsInRyYW5zZm9ybSI6eyJ4Ijo3Ny4yOSwieSI6LTM4Ljc2LCJza1giOi0xNTEuNDgsInNrWSI6LTE1MS40OH19LHsibGVuZ3RoIjo0OCwibmFtZSI6Im1lbGxvd2RyYWdvbl93YXRlcl8wM19lYXJfMDIiLCJwYXJlbnQiOiJtZWxsb3dkcmFnb25fd2F0ZXJfMDNfaGVhZF8wMSIsInRyYW5zZm9ybSI6eyJ4Ijo2NS44MiwieSI6MzQuMTksInNrWCI6MTUwLjQ0LCJza1kiOjE1MC40NH19LHsibmFtZSI6Im1lbGxvd2RyYWdvbl93YXRlcl8wM19leWVfMDEiLCJwYXJlbnQiOiJtZWxsb3dkcmFnb25fd2F0ZXJfMDNfaGVhZF8wMSIsInRyYW5zZm9ybSI6eyJ4IjoyNC40NSwieSI6MjEuMzh9fSx7Imxlbmd0aCI6MTUsIm5hbWUiOiJtZWxsb3dkcmFnb25fd2F0ZXJfMDNfZ2xvdmVzXzAxIiwicGFyZW50IjoibWVsbG93ZHJhZ29uX3dhdGVyXzAzX2FybV8wMSIsInRyYW5zZm9ybSI6eyJ4Ijo0Mi44NSwieSI6LTAuMDQsInNrWCI6MTE4Ljg2LCJza1kiOjExOC44Nn19LHsibGVuZ3RoIjoyOSwibmFtZSI6Im1lbGxvd2RyYWdvbl93YXRlcl8wM19nb2dnbGVzXzAxIiwicGFyZW50IjoibWVsbG93ZHJhZ29uX3dhdGVyXzAzX2hlYWRfMDEiLCJ0cmFuc2Zvcm0iOnsieCI6NzkuMTMsInkiOi02Mi45NCwic2tYIjo3NS4zMiwic2tZIjo3NS4zMn19LHsibGVuZ3RoIjozMSwibmFtZSI6Im1lbGxvd2RyYWdvbl93YXRlcl8wM19oYW5kXzAxIiwicGFyZW50IjoibWVsbG93ZHJhZ29uX3dhdGVyXzAzX2FybV8wMiBjb3B5IiwidHJhbnNmb3JtIjp7IngiOjM0LjU3LCJ5IjotMC4wMiwic2tYIjotMTU4LjEyLCJza1kiOi0xNTguMTJ9fSx7Imxlbmd0aCI6MjAsIm5hbWUiOiJtZWxsb3dkcmFnb25fd2F0ZXJfMDNfaG9ybl8wMSIsInBhcmVudCI6Im1lbGxvd2RyYWdvbl93YXRlcl8wM19oZWFkXzAxIiwidHJhbnNmb3JtIjp7IngiOjk1Ljk5LCJ5IjotMTkuNjUsInNrWCI6LTE4Ljg0LCJza1kiOi0xOC44NH19LHsibGVuZ3RoIjoyMiwibmFtZSI6Im1lbGxvd2RyYWdvbl93YXRlcl8wM19ob3JuXzAyIiwicGFyZW50IjoibWVsbG93ZHJhZ29uX3dhdGVyXzAzX2hlYWRfMDEiLCJ0cmFuc2Zvcm0iOnsieCI6OTMuMTEsInkiOjM1LjEsInNrWCI6LTAuOSwic2tZIjotMC45fX0seyJsZW5ndGgiOjE5LCJuYW1lIjoiYm9uZTEyIiwicGFyZW50IjoibWVsbG93ZHJhZ29uX3dhdGVyXzAzX2dsb3Zlc18wMSIsInRyYW5zZm9ybSI6eyJ4IjoxNS42MywieSI6MC4wOCwic2tYIjo2LjczLCJza1kiOjYuNzN9fSx7Imxlbmd0aCI6OSwibmFtZSI6ImJvbmUxNSIsInBhcmVudCI6Im1lbGxvd2RyYWdvbl93YXRlcl8wM19oYW5kXzAxIiwidHJhbnNmb3JtIjp7IngiOjMxLjMxLCJ5IjowLjA2LCJza1giOi03NS44NSwic2tZIjotNzUuODV9fSx7Imxlbmd0aCI6NTIsIm5hbWUiOiJib25lMjAiLCJwYXJlbnQiOiJib25lMTkiLCJ0cmFuc2Zvcm0iOnsieCI6MjYuNjgsInkiOjAuMzEsInNrWCI6NzcuNTYsInNrWSI6NzcuNTZ9fSx7Imxlbmd0aCI6MTIsIm5hbWUiOiJib25lMjgiLCJwYXJlbnQiOiJib25lMjciLCJ0cmFuc2Zvcm0iOnsieCI6OC42OCwieSI6MC4wMiwic2tYIjoyOC4xNiwic2tZIjoyOC4xNn19LHsibmFtZSI6ImJvbmUzIiwicGFyZW50IjoibWVsbG93ZHJhZ29uX3dhdGVyXzAzX2V5ZV8wMSIsInRyYW5zZm9ybSI6eyJ4IjoxNC41NywieSI6MC42fX0seyJsZW5ndGgiOjEwLCJuYW1lIjoiYm9uZTMyIiwicGFyZW50IjoiYm9uZTMxIiwidHJhbnNmb3JtIjp7IngiOjExLjM0LCJ5IjowLjA3LCJza1giOjM5LjI2LCJza1kiOjM5LjI2fX0seyJsZW5ndGgiOjI2LCJuYW1lIjoiYm9uZTM4IiwicGFyZW50IjoiYm9uZTM3IiwidHJhbnNmb3JtIjp7IngiOjIyLjg4LCJ5IjowLjEsInNrWCI6LTg1LjQ5LCJza1kiOi04NS40OX19LHsibGVuZ3RoIjozMiwibmFtZSI6ImJvbmU1IiwicGFyZW50IjoibWVsbG93ZHJhZ29uX3dhdGVyXzAzX2Vhcl8wMiIsInRyYW5zZm9ybSI6eyJ4Ijo0OC4zLCJ5IjotMS4yNCwic2tYIjotMjQuMTcsInNrWSI6LTI0LjE3fX0seyJsZW5ndGgiOjQ2LCJuYW1lIjoiYm9uZTgiLCJwYXJlbnQiOiJtZWxsb3dkcmFnb25fd2F0ZXJfMDNfZWFyXzAxIiwidHJhbnNmb3JtIjp7IngiOjQwLjc3LCJ5IjowLjUxLCJza1giOjI4LjUxLCJza1kiOjI4LjUxfX0seyJuYW1lIjoibW9uc3RlcmV5ZV8xIiwicGFyZW50IjoibWVsbG93ZHJhZ29uX3dhdGVyXzAzX2V5ZV8wMSIsInRyYW5zZm9ybSI6eyJ4IjoxMy40NywieSI6LTI2LjY5fX0seyJuYW1lIjoibW9uc3RlcmV5ZV8yIiwicGFyZW50IjoibWVsbG93ZHJhZ29uX3dhdGVyXzAzX2V5ZV8wMSIsInRyYW5zZm9ybSI6eyJ4IjoxMC45OSwieSI6MTcuODd9fSx7Imxlbmd0aCI6MzYsIm5hbWUiOiJib25lMjEiLCJwYXJlbnQiOiJib25lMjAiLCJ0cmFuc2Zvcm0iOnsieCI6NTIuMiwieSI6LTAuMDksInNrWCI6MjEuNDgsInNrWSI6MjEuNDh9fSx7Imxlbmd0aCI6MzAsIm5hbWUiOiJib25lMjMiLCJwYXJlbnQiOiJib25lMjAiLCJ0cmFuc2Zvcm0iOnsieCI6NS42MywieSI6NC40NCwic2tYIjozOS41OCwic2tZIjozOS41OH19LHsibGVuZ3RoIjozMSwibmFtZSI6ImJvbmUzOSIsInBhcmVudCI6ImJvbmUzOCIsInRyYW5zZm9ybSI6eyJ4IjoyNi4xNiwieSI6MC4wNSwic2tYIjotMjIuMjYsInNrWSI6LTIyLjI2fX0seyJsZW5ndGgiOjIxLCJuYW1lIjoiYm9uZTQxIiwicGFyZW50IjoiYm9uZTM4IiwidHJhbnNmb3JtIjp7IngiOjIuMDYsInkiOi0zLjU1LCJza1giOi00My42LCJza1kiOi00My42fX0seyJsZW5ndGgiOjI3LCJuYW1lIjoiYm9uZTYiLCJwYXJlbnQiOiJib25lNSIsInRyYW5zZm9ybSI6eyJ4IjozMi4wNSwieSI6LTAuMDksInNrWCI6LTE5LjEsInNrWSI6LTE5LjF9fSx7Imxlbmd0aCI6NDYsIm5hbWUiOiJib25lOSIsInBhcmVudCI6ImJvbmU4IiwidHJhbnNmb3JtIjp7IngiOjQ2LjkxLCJ5IjowLjA3LCJza1giOjE3LjE5LCJza1kiOjE3LjE5fX0seyJuYW1lIjoibWVsbG93ZHJhZ29uX3dhdGVyXzAzX2pveV8wNSIsInBhcmVudCI6ImJvbmUxMiIsInRyYW5zZm9ybSI6eyJ4Ijo1Ni45NSwieSI6LTQuNzQsInNrWCI6MTc2LjA5LCJza1kiOjE3Ni4wOX19LHsibGVuZ3RoIjozNywibmFtZSI6ImJvbmUyMiIsInBhcmVudCI6ImJvbmUyMSIsInRyYW5zZm9ybSI6eyJ4IjozNi42OSwic2tYIjoxMC4yNiwic2tZIjoxMC4yNn19LHsibGVuZ3RoIjozMywibmFtZSI6ImJvbmUyNCIsInBhcmVudCI6ImJvbmUyMyIsInRyYW5zZm9ybSI6eyJ4IjozMC43MywieSI6MC4wMywic2tYIjoxNy4xOSwic2tZIjoxNy4xOX19LHsibGVuZ3RoIjoyNSwibmFtZSI6ImJvbmU0MCIsInBhcmVudCI6ImJvbmUzOSIsInRyYW5zZm9ybSI6eyJ4IjozMS4yNCwieSI6MC4wMSwic2tYIjotMTkuNTEsInNrWSI6LTE5LjUxfX0seyJsZW5ndGgiOjIxLCJuYW1lIjoiYm9uZTQyIiwicGFyZW50IjoiYm9uZTQxIiwidHJhbnNmb3JtIjp7IngiOjIxLjU4LCJ5IjowLjA3LCJza1giOi0xOS41MSwic2tZIjotMTkuNTF9fSx7Imxlbmd0aCI6MTMsIm5hbWUiOiJtZWxsb3dkcmFnb25fd2F0ZXJfMDNfam95XzAxIiwicGFyZW50IjoibWVsbG93ZHJhZ29uX3dhdGVyXzAzX2pveV8wNSIsInRyYW5zZm9ybSI6eyJ4IjoxMS41NSwieSI6LTguOTgsInNrWCI6LTkwLjksInNrWSI6LTkwLjl9fSx7Imxlbmd0aCI6MTAsIm5hbWUiOiJtZWxsb3dkcmFnb25fd2F0ZXJfMDNfaGFuZF8wMV8wMSIsInBhcmVudCI6Im1lbGxvd2RyYWdvbl93YXRlcl8wM19qb3lfMDEiLCJ0cmFuc2Zvcm0iOnsieCI6MjguODYsInkiOjAuMjksInNrWCI6LTM4LjIxLCJza1kiOi0zOC4yMX19XSwic2xvdCI6W3siYmxlbmRNb2RlIjoiYWRkIiwibmFtZSI6ImVmZmVjdF9kb3duXzEiLCJwYXJlbnQiOiJlZmZlY3RfZG93bl8xIiwiY29sb3IiOnsiYU0iOjU5fX0seyJibGVuZE1vZGUiOiJhZGQiLCJuYW1lIjoiZWZmZWN0X2Rvd25fMiIsInBhcmVudCI6ImVmZmVjdF9kb3duXzIiLCJjb2xvciI6eyJhTSI6ODh9fSx7ImJsZW5kTW9kZSI6ImFkZCIsIm5hbWUiOiJlZmZlY3RfZG93bl8zIiwicGFyZW50IjoiZWZmZWN0X2JvdHRvbV8xIiwiY29sb3IiOnsiYU0iOjUyfX0seyJibGVuZE1vZGUiOiJhZGQiLCJuYW1lIjoiZWZmZWN0X2Rvd25fNCIsInBhcmVudCI6ImVmZmVjdF9ib3R0b21fMiIsImNvbG9yIjp7ImFNIjo1Mn19LHsiYmxlbmRNb2RlIjoiYWRkIiwibmFtZSI6ImVmZmVjdF9saWdodGR1c3QyIiwicGFyZW50IjoibWVsbG93ZHJhZ29uX3dhdGVyXzAzX2VmZmVjdF9saWdodGR1c3QyIn0seyJibGVuZE1vZGUiOiJhZGQiLCJuYW1lIjoiZWZmZWN0XzAxIiwicGFyZW50IjoiZWZmZWN0XzAxIn0seyJuYW1lIjoibWVsbG93ZHJhZ29uX3dhdGVyXzAzX3JvY2tldF8wM18wMyIsInBhcmVudCI6Im1lbGxvd2RyYWdvbl93YXRlcl8wM19yb2NrZXRfMDNfMDMifSx7Im5hbWUiOiJtZWxsb3dkcmFnb25fd2F0ZXJfMDNfcm9ja2V0XzAzXzAyIiwicGFyZW50IjoiYm9uZTQ5In0seyJuYW1lIjoibWVsbG93ZHJhZ29uX3dhdGVyXzAzX3JvY2tldF8wM18wMSIsInBhcmVudCI6Im1lbGxvd2RyYWdvbl93YXRlcl8wM19yb2NrZXRfMDNfMDEifSx7Im5hbWUiOiJtZWxsb3dkcmFnb25fd2F0ZXJfMDNfcm9ja2V0XzAzIiwicGFyZW50IjoibWVsbG93ZHJhZ29uX3dhdGVyXzAzX3JvY2tldF8wMyJ9LHsiYmxlbmRNb2RlIjoiYWRkIiwibmFtZSI6Im1lbGxvd2RyYWdvbl93YXRlcl8wM19yb2NrZXRfMDJfMDEiLCJwYXJlbnQiOiJtZWxsb3dkcmFnb25fd2F0ZXJfMDNfcm9ja2V0XzAyXzAxIn0seyJibGVuZE1vZGUiOiJhZGQiLCJuYW1lIjoiZWZmZWN0X2xpZ2h0MiIsInBhcmVudCI6Im1lbGxvd2RyYWdvbl93YXRlcl8wM19lZmZlY3RfbGlnaHQyIn0seyJibGVuZE1vZGUiOiJhZGQiLCJuYW1lIjoiZWZmZWN0X2xpZ2h0IiwicGFyZW50IjoibWVsbG93ZHJhZ29uX3dhdGVyXzAzX2VmZmVjdF9saWdodCJ9LHsibmFtZSI6Im1lbGxvd2RyYWdvbl93YXRlcl8wM19yb2NrZXRfMDIiLCJwYXJlbnQiOiJtZWxsb3dkcmFnb25fd2F0ZXJfMDNfcm9ja2V0XzAyIn0seyJuYW1lIjoibWVsbG93ZHJhZ29uX3dhdGVyXzAzX3dpbmdfMDIiLCJwYXJlbnQiOiJtZWxsb3dkcmFnb25fd2F0ZXJfMDNfd2luZ18wMiJ9LHsibmFtZSI6Im1lbGxvd2RyYWdvbl93YXRlcl8wM193aW5nXzAxIiwicGFyZW50IjoibWVsbG93ZHJhZ29uX3dhdGVyXzAzX3dpbmdfMDEifSx7Im5hbWUiOiJtZWxsb3dkcmFnb25fd2F0ZXJfMDNfdGFpbF8wMSIsInBhcmVudCI6Im1lbGxvd2RyYWdvbl93YXRlcl8wM190YWlsXzAxIn0seyJuYW1lIjoibWVsbG93ZHJhZ29uX3dhdGVyXzAzX3NjYXJmXzAyIiwicGFyZW50IjoibWVsbG93ZHJhZ29uX3dhdGVyXzAzX3NjYXJmXzAyIn0seyJuYW1lIjoibWVsbG93ZHJhZ29uX3dhdGVyXzAzX2Vhcl8wMiIsInBhcmVudCI6Im1lbGxvd2RyYWdvbl93YXRlcl8wM19lYXJfMDIifSx7Im5hbWUiOiJtZWxsb3dkcmFnb25fd2F0ZXJfMDNfYXJtXzAyIiwicGFyZW50IjoibWVsbG93ZHJhZ29uX3dhdGVyXzAzX2FybV8wMiBjb3B5In0seyJuYW1lIjoibWVsbG93ZHJhZ29uX3dhdGVyXzAzX2Zvb3RfMDIiLCJwYXJlbnQiOiJtZWxsb3dkcmFnb25fd2F0ZXJfMDNfZm9vdF8wMiJ9LHsibmFtZSI6Im1lbGxvd2RyYWdvbl93YXRlcl8wM19sZWdfMDIiLCJwYXJlbnQiOiJtZWxsb3dkcmFnb25fd2F0ZXJfMDNfbGVnXzAyIn0seyJuYW1lIjoibWVsbG93ZHJhZ29uX3dhdGVyXzAzX2JvZHlfMDEiLCJwYXJlbnQiOiJtZWxsb3dkcmFnb25fd2F0ZXJfMDNfYm9keV8wMSJ9LHsibmFtZSI6Im1lbGxvd2RyYWdvbl93YXRlcl8wM19hcm1fMDEiLCJwYXJlbnQiOiJtZWxsb3dkcmFnb25fd2F0ZXJfMDNfYXJtXzAxIn0seyJuYW1lIjoibWVsbG93ZHJhZ29uX3dhdGVyXzAzX2xlZ18wMSIsInBhcmVudCI6Im1lbGxvd2RyYWdvbl93YXRlcl8wM19sZWdfMDEifSx7Im5hbWUiOiJtZWxsb3dkcmFnb25fd2F0ZXJfMDNfc2NhcmZfMDEiLCJwYXJlbnQiOiJtZWxsb3dkcmFnb25fd2F0ZXJfMDNfYm9keV8wMSJ9LHsibmFtZSI6Im1lbGxvd2RyYWdvbl93YXRlcl8wM19ob3JuXzAyIiwicGFyZW50IjoibWVsbG93ZHJhZ29uX3dhdGVyXzAzX2hvcm5fMDIifSx7Im5hbWUiOiJtZWxsb3dkcmFnb25fd2F0ZXJfMDNfaGVhZF8wMSIsInBhcmVudCI6Im1lbGxvd2RyYWdvbl93YXRlcl8wM19oZWFkXzAxIn0seyJuYW1lIjoibWVsbG93ZHJhZ29uX3dhdGVyXzAzX2pveV8wNSIsInBhcmVudCI6Im1lbGxvd2RyYWdvbl93YXRlcl8wM19qb3lfMDUifSx7Im5hbWUiOiJtZWxsb3dkcmFnb25fd2F0ZXJfMDNfam95XzA0XzAxIiwicGFyZW50IjoibWVsbG93ZHJhZ29uX3dhdGVyXzAzX2pveV8wNSJ9LHsibmFtZSI6Im1lbGxvd2RyYWdvbl93YXRlcl8wM19qb3lfMDQiLCJwYXJlbnQiOiJtZWxsb3dkcmFnb25fd2F0ZXJfMDNfam95XzA1In0seyJuYW1lIjoibWVsbG93ZHJhZ29uX3dhdGVyXzAzX2hhbmRfMDEiLCJwYXJlbnQiOiJtZWxsb3dkcmFnb25fd2F0ZXJfMDNfaGFuZF8wMSJ9LHsibmFtZSI6Im1lbGxvd2RyYWdvbl93YXRlcl8wM19qb3lfMDNfMDEiLCJwYXJlbnQiOiJtZWxsb3dkcmFnb25fd2F0ZXJfMDNfam95XzA1In0seyJuYW1lIjoibWVsbG93ZHJhZ29uX3dhdGVyXzAzX2pveV8wMyIsInBhcmVudCI6Im1lbGxvd2RyYWdvbl93YXRlcl8wM19qb3lfMDUifSx7Im5hbWUiOiJtZWxsb3dkcmFnb25fd2F0ZXJfMDNfam95XzAyIiwicGFyZW50IjoibWVsbG93ZHJhZ29uX3dhdGVyXzAzX2pveV8wNSJ9LHsibmFtZSI6Im1lbGxvd2RyYWdvbl93YXRlcl8wM19qb3lfMDEiLCJwYXJlbnQiOiJtZWxsb3dkcmFnb25fd2F0ZXJfMDNfam95XzAxIn0seyJuYW1lIjoibWVsbG93ZHJhZ29uX3dhdGVyXzAzX2hvcm5fMDEiLCJwYXJlbnQiOiJtZWxsb3dkcmFnb25fd2F0ZXJfMDNfaG9ybl8wMSJ9LHsibmFtZSI6Im1lbGxvd2RyYWdvbl93YXRlcl8wM19leWVfMDEiLCJwYXJlbnQiOiJtZWxsb3dkcmFnb25fd2F0ZXJfMDNfZXllXzAxIn0seyJuYW1lIjoibWVsbG93ZHJhZ29uX3dhdGVyXzAzX2Vhcl8wMSIsInBhcmVudCI6Im1lbGxvd2RyYWdvbl93YXRlcl8wM19lYXJfMDEifSx7Im5hbWUiOiJtZWxsb3dkcmFnb25fd2F0ZXJfMDNfZ2xvdmVzXzAxIiwicGFyZW50IjoibWVsbG93ZHJhZ29uX3dhdGVyXzAzX2dsb3Zlc18wMSJ9LHsibmFtZSI6Im1lbGxvd2RyYWdvbl93YXRlcl8wM19nb2dnbGVzXzAxIiwicGFyZW50IjoibWVsbG93ZHJhZ29uX3dhdGVyXzAzX2dvZ2dsZXNfMDEifSx7Im5hbWUiOiJtZWxsb3dkcmFnb25fd2F0ZXJfMDNfaGFuZF8wMV8wMSIsInBhcmVudCI6Im1lbGxvd2RyYWdvbl93YXRlcl8wM19oYW5kXzAxXzAxIn0seyJibGVuZE1vZGUiOiJhZGQiLCJuYW1lIjoibWVsbG93ZHJhZ29uX3dhdGVyXzAzX3JvY2tldF8wMV8wMyIsInBhcmVudCI6Im1lbGxvd2RyYWdvbl93YXRlcl8wM19yb2NrZXRfMDFfMDMifSx7Im5hbWUiOiJtZWxsb3dkcmFnb25fd2F0ZXJfMDNfcm9ja2V0XzAxXzAyIiwicGFyZW50IjoibWVsbG93ZHJhZ29uX3dhdGVyXzAzX3JvY2tldF8wMV8wMiJ9LHsibmFtZSI6Im1lbGxvd2RyYWdvbl93YXRlcl8wM19yb2NrZXRfMDEiLCJwYXJlbnQiOiJtZWxsb3dkcmFnb25fd2F0ZXJfMDNfcm9ja2V0XzAxIn0seyJuYW1lIjoibWVsbG93ZHJhZ29uX3dhdGVyXzAzX3JvY2tldF8wMV8wMSIsInBhcmVudCI6Im1lbGxvd2RyYWdvbl93YXRlcl8wM19yb2NrZXRfMDFfMDEifSx7Im5hbWUiOiJtZWxsb3dkcmFnb25fd2F0ZXJfMDNfZWZmZWN0XzA4IiwicGFyZW50IjoiYnV0dG9uIn0seyJuYW1lIjoibWVsbG93ZHJhZ29uX3dhdGVyXzAzX3JvY2tldF8wNF8wNSIsInBhcmVudCI6InJvY2tldF8wNF8wNSJ9LHsibmFtZSI6Im1lbGxvd2RyYWdvbl93YXRlcl8wM19yb2NrZXRfMDRfMDQiLCJwYXJlbnQiOiJyb2NrZXRfMDRfMDQifSx7Im5hbWUiOiJtZWxsb3dkcmFnb25fd2F0ZXJfMDNfcm9ja2V0XzA0IiwicGFyZW50IjoiYm9uZSJ9LHsiYmxlbmRNb2RlIjoiYWRkIiwibmFtZSI6InJvY2tldF9saWdodCIsInBhcmVudCI6InJvY2tldF9saWdodCJ9LHsiYmxlbmRNb2RlIjoiYWRkIiwibmFtZSI6ImVmZmVjdF8wNF8wMSIsInBhcmVudCI6ImVmZmVjdF8wNF8wMSJ9LHsibmFtZSI6Im1lbGxvd2RyYWdvbl93YXRlcl8wM19yb2NrZXRfMDRfMDMiLCJwYXJlbnQiOiJyb2NrZXRfMDRfMDMifSx7Im5hbWUiOiJtZWxsb3dkcmFnb25fd2F0ZXJfMDNfcm9ja2V0XzA0XzAyIiwicGFyZW50Ijoicm9ja2V0XzA0XzAyIn0seyJibGVuZE1vZGUiOiJhZGQiLCJkaXNwbGF5SW5kZXgiOjEsIm5hbWUiOiJlZmZlY3RfbGlnaHRpbmciLCJwYXJlbnQiOiJsaWdodGluZyJ9LHsiYmxlbmRNb2RlIjoiYWRkIiwibmFtZSI6ImVmZmVjdF9saWdodGR1c3QiLCJwYXJlbnQiOiJtZWxsb3dkcmFnb25fd2F0ZXJfMDNfZWZmZWN0X2xpZ2h0ZHVzdCJ9LHsiYmxlbmRNb2RlIjoiYWRkIiwibmFtZSI6ImVmZmVjdF9saWdodGR1c3QzIiwicGFyZW50IjoiZWZmZWN0X2xpZ2h0ZHVzdDMifSx7ImJsZW5kTW9kZSI6ImFkZCIsIm5hbWUiOiJlZmZlY3RfbGlnaHQzIiwicGFyZW50IjoiZWZmZWN0X2xpZ2h0MyJ9LHsiYmxlbmRNb2RlIjoiYWRkIiwibmFtZSI6ImVmZmVjdF8wMiIsInBhcmVudCI6ImVmZmVjdF8wMiJ9LHsiYmxlbmRNb2RlIjoiYWRkIiwibmFtZSI6ImVmZmVjdF8wMyIsInBhcmVudCI6ImVmZmVjdF8wMyJ9LHsiYmxlbmRNb2RlIjoiYWRkIiwibmFtZSI6ImVmZmVjdF8wNCIsInBhcmVudCI6ImVmZmVjdF8wNCJ9LHsiYmxlbmRNb2RlIjoiYWRkIiwiZGlzcGxheUluZGV4IjoxLCJuYW1lIjoiZWZmZWN0XzA1IiwicGFyZW50IjoiYXJyb3cifSx7ImJsZW5kTW9kZSI6ImFkZCIsImRpc3BsYXlJbmRleCI6MSwibmFtZSI6ImVmZmVjdF81IiwicGFyZW50IjoiYXJyb3cyIn0seyJibGVuZE1vZGUiOiJhZGQiLCJkaXNwbGF5SW5kZXgiOjEsIm5hbWUiOiJlZmZlY3RfNiIsInBhcmVudCI6ImFycm93MyJ9LHsiYmxlbmRNb2RlIjoiYWRkIiwibmFtZSI6ImVmZmVjdF9maXJlIiwicGFyZW50IjoiZWZmZWN0X2ZpcmUifSx7ImJsZW5kTW9kZSI6ImFkZCIsIm5hbWUiOiJlZmZlY3RfcmVkIiwicGFyZW50IjoiZWZmZWN0X3JlZCJ9LHsiYmxlbmRNb2RlIjoiYWRkIiwibmFtZSI6ImVmZmVjdF8wNyIsInBhcmVudCI6ImJ1dHRvbiJ9LHsiYmxlbmRNb2RlIjoiYWRkIiwibmFtZSI6ImVmZmVjdF9ibHVlIiwicGFyZW50IjoiZWZmZWN0X2JsdWUifV0sImlrIjpbeyJiZW5kUG9zaXRpdmUiOmZhbHNlLCJjaGFpbiI6MSwibmFtZSI6ImxlZ19sIiwiYm9uZSI6ImJvbmUyNiIsInRhcmdldCI6ImxlZ19sIn0seyJiZW5kUG9zaXRpdmUiOmZhbHNlLCJjaGFpbiI6MSwibmFtZSI6ImxlZ19yIiwiYm9uZSI6Im1lbGxvd2RyYWdvbl93YXRlcl8wM19mb290XzAyIiwidGFyZ2V0IjoibGVnX3IifV0sInNraW4iOlt7InNsb3QiOlt7Im5hbWUiOiJlZmZlY3RfYmx1ZSIsImRpc3BsYXkiOlt7Im5hbWUiOiJtZWxsb3dkcmFnb25fd2F0ZXJfMDNfZWZmZWN0X2JsdWUiLCJ0cmFuc2Zvcm0iOnsieCI6MTIuMzgsInkiOjAuMzUsInNrWCI6LTIuMjUsInNrWSI6LTIuMjV9fV19LHsibmFtZSI6Im1lbGxvd2RyYWdvbl93YXRlcl8wM19yb2NrZXRfMDFfMDEiLCJkaXNwbGF5IjpbeyJuYW1lIjoibWVsbG93ZHJhZ29uX3dhdGVyXzAzX3JvY2tldF8wMV8wMSIsInRyYW5zZm9ybSI6eyJ4IjoxOC44NCwieSI6LTEuNTksInNrWCI6MTM4Ljg3LCJza1kiOjEzOC44N319XX0seyJuYW1lIjoibWVsbG93ZHJhZ29uX3dhdGVyXzAzX2Vhcl8wMSIsImRpc3BsYXkiOlt7InR5cGUiOiJtZXNoIiwibmFtZSI6Im1lbGxvd2RyYWdvbl93YXRlcl8wM19lYXJfMDEiLCJvZmZzZXQiOjAsInVzZXJFZGdlcyI6W119XX0seyJuYW1lIjoibWVsbG93ZHJhZ29uX3dhdGVyXzAzX3dpbmdfMDEiLCJkaXNwbGF5IjpbeyJ0eXBlIjoibWVzaCIsIm5hbWUiOiJtZWxsb3dkcmFnb25fd2F0ZXJfMDNfd2luZ18wMSIsIm9mZnNldCI6Mjk2LCJ1c2VyRWRnZXMiOltdfV19LHsibmFtZSI6Im1lbGxvd2RyYWdvbl93YXRlcl8wM19yb2NrZXRfMDRfMDIiLCJkaXNwbGF5IjpbeyJuYW1lIjoibWVsbG93ZHJhZ29uX3dhdGVyXzAzX3JvY2tldF8wNF8wMiIsInRyYW5zZm9ybSI6eyJ4IjoyMS41NiwieSI6MC42Mywic2tYIjotOC41LCJza1kiOi04LjV9fV19LHsibmFtZSI6Im1lbGxvd2RyYWdvbl93YXRlcl8wM19lZmZlY3RfMDgiLCJkaXNwbGF5IjpbeyJuYW1lIjoibWVsbG93ZHJhZ29uX3dhdGVyXzAzX2VmZmVjdF8wOCJ9LHsibmFtZSI6Im1lbGxvd2RyYWdvbl93YXRlcl8wM19lZmZlY3RfMDkifV19LHsibmFtZSI6Im1lbGxvd2RyYWdvbl93YXRlcl8wM19yb2NrZXRfMDNfMDMiLCJkaXNwbGF5IjpbeyJuYW1lIjoibWVsbG93ZHJhZ29uX3dhdGVyXzAzX3JvY2tldF8wM18wMyIsInRyYW5zZm9ybSI6eyJ4IjoyOS45MywieSI6LTAuNjYsInNrWCI6LTkzLjE1LCJza1kiOi05My4xNX19XX0seyJuYW1lIjoiZWZmZWN0XzA0IiwiZGlzcGxheSI6W3sibmFtZSI6Im1lbGxvd2RyYWdvbl93YXRlcl8wM19lZmZlY3RfMDQifV19LHsibmFtZSI6Im1lbGxvd2RyYWdvbl93YXRlcl8wM19oZWFkXzAxIiwiZGlzcGxheSI6W3sibmFtZSI6Im1lbGxvd2RyYWdvbl93YXRlcl8wM19oZWFkXzAxIiwidHJhbnNmb3JtIjp7IngiOjY3Ljg3LCJ5IjotNy4yNywic2tYIjo3OS4zNCwic2tZIjo3OS4zNH19XX0seyJuYW1lIjoibWVsbG93ZHJhZ29uX3dhdGVyXzAzX2pveV8wMiIsImRpc3BsYXkiOlt7Im5hbWUiOiJtZWxsb3dkcmFnb25fd2F0ZXJfMDNfam95XzAyIiwidHJhbnNmb3JtIjp7IngiOjExLjMsInkiOi05LjUyfX1dfSx7Im5hbWUiOiJtZWxsb3dkcmFnb25fd2F0ZXJfMDNfam95XzAzIiwiZGlzcGxheSI6W3sibmFtZSI6Im1lbGxvd2RyYWdvbl93YXRlcl8wM19qb3lfMDMiLCJ0cmFuc2Zvcm0iOnsieCI6LTI0LjY5LCJ5IjotMTIuMDJ9fV19LHsibmFtZSI6Im1lbGxvd2RyYWdvbl93YXRlcl8wM19leWVfMDEiLCJkaXNwbGF5IjpbeyJ0eXBlIjoibWVzaCIsIm5hbWUiOiJtZWxsb3dkcmFnb25fd2F0ZXJfMDNfZXllXzAxIiwib2Zmc2V0IjoxMjM0LCJ1c2VyRWRnZXMiOltdfSx7Im5hbWUiOiJtZWxsb3dkcmFnb25fd2F0ZXJfMDNfZXllXzAyIiwidHJhbnNmb3JtIjp7IngiOjE2LjAyLCJ5IjotMTEuNjMsInNrWCI6NzkuMzQsInNrWSI6NzkuMzR9fSx7Im5hbWUiOiJtZWxsb3dkcmFnb25fd2F0ZXJfMDNfZXllXzAzIiwidHJhbnNmb3JtIjp7IngiOjE0Ljk3LCJ5IjotMTEuNTYsInNrWCI6NzkuMzQsInNrWSI6NzkuMzR9fSx7Im5hbWUiOiJtZWxsb3dkcmFnb25fd2F0ZXJfMDNfZXllXzA0IiwidHJhbnNmb3JtIjp7IngiOjE0Ljk3LCJ5IjotMTEuNTYsInNrWCI6NzkuMzQsInNrWSI6NzkuMzR9fV19LHsibmFtZSI6Im1lbGxvd2RyYWdvbl93YXRlcl8wM193aW5nXzAyIiwiZGlzcGxheSI6W3sidHlwZSI6Im1lc2giLCJuYW1lIjoibWVsbG93ZHJhZ29uX3dhdGVyXzAzX3dpbmdfMDIiLCJvZmZzZXQiOjEzOTIsInVzZXJFZGdlcyI6W119XX0seyJuYW1lIjoibWVsbG93ZHJhZ29uX3dhdGVyXzAzX3JvY2tldF8wNF8wNSIsImRpc3BsYXkiOlt7Im5hbWUiOiJtZWxsb3dkcmFnb25fd2F0ZXJfMDNfcm9ja2V0XzA0XzA1IiwidHJhbnNmb3JtIjp7IngiOjEzLjkyLCJ5IjowLjU4LCJza1giOi0yMy41MSwic2tZIjotMjMuNTF9fV19LHsibmFtZSI6ImVmZmVjdF8wMSIsImRpc3BsYXkiOlt7Im5hbWUiOiJtZWxsb3dkcmFnb25fd2F0ZXJfMDNfZWZmZWN0XzAxIn1dfSx7Im5hbWUiOiJlZmZlY3RfMDUiLCJkaXNwbGF5IjpbeyJuYW1lIjoibWVsbG93ZHJhZ29uX3dhdGVyXzAzX2VmZmVjdF8wNSJ9LHsibmFtZSI6Im1lbGxvd2RyYWdvbl93YXRlcl8wM19lZmZlY3RfMDYifV19LHsibmFtZSI6Im1lbGxvd2RyYWdvbl93YXRlcl8wM19yb2NrZXRfMDEiLCJkaXNwbGF5IjpbeyJuYW1lIjoibWVsbG93ZHJhZ29uX3dhdGVyXzAzX3JvY2tldF8wMSIsInRyYW5zZm9ybSI6eyJ4Ijo3LjE0LCJ5IjoxMS4zMX19XX0seyJuYW1lIjoibWVsbG93ZHJhZ29uX3dhdGVyXzAzX2hvcm5fMDIiLCJkaXNwbGF5IjpbeyJuYW1lIjoibWVsbG93ZHJhZ29uX3dhdGVyXzAzX2hvcm5fMDIiLCJ0cmFuc2Zvcm0iOnsieCI6MTYuMzgsInkiOi01LjE2LCJza1giOjgwLjI0LCJza1kiOjgwLjI0fX1dfSx7Im5hbWUiOiJtZWxsb3dkcmFnb25fd2F0ZXJfMDNfbGVnXzAyIiwiZGlzcGxheSI6W3sidHlwZSI6Im1lc2giLCJuYW1lIjoibWVsbG93ZHJhZ29uX3dhdGVyXzAzX2xlZ18wMiIsIm9mZnNldCI6MjA1MCwidXNlckVkZ2VzIjpbXX1dfSx7Im5hbWUiOiJtZWxsb3dkcmFnb25fd2F0ZXJfMDNfam95XzAzXzAxIiwiZGlzcGxheSI6W3sibmFtZSI6Im1lbGxvd2RyYWdvbl93YXRlcl8wM19qb3lfMDNfMDEiLCJ0cmFuc2Zvcm0iOnsieCI6LTI0LjY5LCJ5IjotMTQuNTJ9fV19LHsibmFtZSI6ImVmZmVjdF81IiwiZGlzcGxheSI6W3sibmFtZSI6Im1lbGxvd2RyYWdvbl93YXRlcl8wM19lZmZlY3RfMDUifSx7Im5hbWUiOiJtZWxsb3dkcmFnb25fd2F0ZXJfMDNfZWZmZWN0XzA2In1dfSx7Im5hbWUiOiJlZmZlY3RfbGlnaHRpbmciLCJkaXNwbGF5IjpbeyJuYW1lIjoibWVsbG93ZHJhZ29uX3dhdGVyXzAzX3JvY2tldF8wNF8wNyIsInRyYW5zZm9ybSI6eyJ4Ijo0MS4xNCwieSI6LTI3LjQyLCJza1giOjg5LjA5LCJza1kiOjg5LjA5fX0seyJuYW1lIjoibWVsbG93ZHJhZ29uX3dhdGVyXzAzX3JvY2tldF8wNF8wOCIsInRyYW5zZm9ybSI6eyJ4Ijo0Ni4yNiwieSI6LTYwLjYxLCJza1giOi04NS40Nywic2tZIjotODUuNDcsInNjWCI6MC43Niwic2NZIjowLjc2fX1dfSx7Im5hbWUiOiJtZWxsb3dkcmFnb25fd2F0ZXJfMDNfcm9ja2V0XzAxXzAyIiwiZGlzcGxheSI6W3sibmFtZSI6Im1lbGxvd2RyYWdvbl93YXRlcl8wM19yb2NrZXRfMDFfMDIiLCJ0cmFuc2Zvcm0iOnsieCI6NDQuMSwieSI6LTAuMDYsInNrWCI6MTU3LjczLCJza1kiOjE1Ny43M319XX0seyJuYW1lIjoibWVsbG93ZHJhZ29uX3dhdGVyXzAzX3NjYXJmXzAxIiwiZGlzcGxheSI6W3sibmFtZSI6Im1lbGxvd2RyYWdvbl93YXRlcl8wM19zY2FyZl8wMSIsInRyYW5zZm9ybSI6eyJ4Ijo1NC44MSwieSI6LTYuMDUsInNrWCI6NjguMTIsInNrWSI6NjguMTJ9fV19LHsibmFtZSI6Im1lbGxvd2RyYWdvbl93YXRlcl8wM19mb290XzAyIiwiZGlzcGxheSI6W3sidHlwZSI6Im1lc2giLCJuYW1lIjoibWVsbG93ZHJhZ29uX3dhdGVyXzAzX2Zvb3RfMDIiLCJvZmZzZXQiOjIzNDAsInVzZXJFZGdlcyI6W119XX0seyJuYW1lIjoiZWZmZWN0X2xpZ2h0ZHVzdCIsImRpc3BsYXkiOlt7Im5hbWUiOiJtZWxsb3dkcmFnb25fd2F0ZXJfMDNfZWZmZWN0X2xpZ2h0ZHVzdCIsInRyYW5zZm9ybSI6eyJ4IjozNC41MywieSI6My4xMywic2tYIjo5MCwic2tZIjo5MH19XX0seyJuYW1lIjoibWVsbG93ZHJhZ29uX3dhdGVyXzAzX3JvY2tldF8wNF8wNCIsImRpc3BsYXkiOlt7Im5hbWUiOiJtZWxsb3dkcmFnb25fd2F0ZXJfMDNfcm9ja2V0XzA0XzA0IiwidHJhbnNmb3JtIjp7IngiOjE2LjI5LCJ5IjoxLjMyLCJza1giOi0xMS41NCwic2tZIjotMTEuNTR9fV19LHsibmFtZSI6ImVmZmVjdF9saWdodGR1c3QyIiwiZGlzcGxheSI6W3sibmFtZSI6Im1lbGxvd2RyYWdvbl93YXRlcl8wM19lZmZlY3RfbGlnaHRkdXN0IiwidHJhbnNmb3JtIjp7IngiOjMyLjY3LCJ5IjotMC42Mywic2tYIjo5OC45NCwic2tZIjo5OC45NH19XX0seyJuYW1lIjoibWVsbG93ZHJhZ29uX3dhdGVyXzAzX2FybV8wMiIsImRpc3BsYXkiOlt7Im5hbWUiOiJtZWxsb3dkcmFnb25fd2F0ZXJfMDNfYXJtXzAyIiwidHJhbnNmb3JtIjp7IngiOjE2LjY3LCJ5IjotMS45OCwic2tYIjoxNjguNywic2tZIjoxNjguN319XX0seyJuYW1lIjoiZWZmZWN0XzYiLCJkaXNwbGF5IjpbeyJuYW1lIjoibWVsbG93ZHJhZ29uX3dhdGVyXzAzX2VmZmVjdF8wNSJ9LHsibmFtZSI6Im1lbGxvd2RyYWdvbl93YXRlcl8wM19lZmZlY3RfMDYifV19LHsibmFtZSI6Im1lbGxvd2RyYWdvbl93YXRlcl8wM19yb2NrZXRfMDIiLCJkaXNwbGF5IjpbeyJuYW1lIjoibWVsbG93ZHJhZ29uX3dhdGVyXzAzX3JvY2tldF8wMiIsInRyYW5zZm9ybSI6eyJ4IjotMS45OSwieSI6Ny42OH19XX0seyJuYW1lIjoiZWZmZWN0X2xpZ2h0IiwiZGlzcGxheSI6W3sibmFtZSI6Im1lbGxvd2RyYWdvbl93YXRlcl8wM19lZmZlY3RfbGlnaHQifV19LHsibmFtZSI6Im1lbGxvd2RyYWdvbl93YXRlcl8wM19sZWdfMDEiLCJkaXNwbGF5IjpbeyJ0eXBlIjoibWVzaCIsIm5hbWUiOiJtZWxsb3dkcmFnb25fd2F0ZXJfMDNfbGVnXzAxIiwib2Zmc2V0IjoyNjY4LCJ1c2VyRWRnZXMiOltdfV19LHsibmFtZSI6ImVmZmVjdF9kb3duXzQiLCJkaXNwbGF5IjpbeyJuYW1lIjoibWVsbG93ZHJhZ29uX3dhdGVyXzAzX3JvY2tldF8wM18wNSIsInRyYW5zZm9ybSI6eyJ4Ijo0NC4zMiwieSI6LTguOTQsInNrWCI6OTEuMzYsInNrWSI6OTEuMzZ9fV19LHsibmFtZSI6Im1lbGxvd2RyYWdvbl93YXRlcl8wM19ob3JuXzAxIiwiZGlzcGxheSI6W3sibmFtZSI6Im1lbGxvd2RyYWdvbl93YXRlcl8wM19ob3JuXzAxIiwidHJhbnNmb3JtIjp7IngiOjIyLjEzLCJ5IjoxLjEyLCJza1giOjk4LjE4LCJza1kiOjk4LjE4fX1dfSx7Im5hbWUiOiJlZmZlY3RfbGlnaHRkdXN0MyIsImRpc3BsYXkiOlt7Im5hbWUiOiJtZWxsb3dkcmFnb25fd2F0ZXJfMDNfZWZmZWN0X2xpZ2h0ZHVzdCIsInRyYW5zZm9ybSI6eyJ4IjozNC41MywieSI6My4xMywic2tYIjo5MCwic2tZIjo5MH19XX0seyJuYW1lIjoibWVsbG93ZHJhZ29uX3dhdGVyXzAzX3JvY2tldF8wNCIsImRpc3BsYXkiOlt7Im5hbWUiOiJtZWxsb3dkcmFnb25fd2F0ZXJfMDNfcm9ja2V0XzA0IiwidHJhbnNmb3JtIjp7IngiOi0xMC40MSwieSI6NS4zOH19XX0seyJuYW1lIjoibWVsbG93ZHJhZ29uX3dhdGVyXzAzX2hhbmRfMDEiLCJkaXNwbGF5IjpbeyJuYW1lIjoibWVsbG93ZHJhZ29uX3dhdGVyXzAzX2hhbmRfMDEiLCJ0cmFuc2Zvcm0iOnsieCI6MTYuODIsInkiOjEuOTQsInNrWCI6LTMuOSwic2tZIjotMy45fX1dfSx7Im5hbWUiOiJtZWxsb3dkcmFnb25fd2F0ZXJfMDNfam95XzA0IiwiZGlzcGxheSI6W3sibmFtZSI6Im1lbGxvd2RyYWdvbl93YXRlcl8wM19qb3lfMDQiLCJ0cmFuc2Zvcm0iOnsieCI6LTcuNjksInkiOi0xOS41Mn19XX0seyJuYW1lIjoiZWZmZWN0X2ZpcmUiLCJkaXNwbGF5IjpbeyJuYW1lIjoibWVsbG93ZHJhZ29uX3dhdGVyXzAzX2VmZmVjdF9maXJlIiwidHJhbnNmb3JtIjp7IngiOjY3Ljc1LCJ5IjotNC4xNSwic2tYIjo5My4xNSwic2tZIjo5My4xNX19XX0seyJuYW1lIjoibWVsbG93ZHJhZ29uX3dhdGVyXzAzX3JvY2tldF8wMV8wMyIsImRpc3BsYXkiOlt7Im5hbWUiOiJtZWxsb3dkcmFnb25fd2F0ZXJfMDNfcm9ja2V0XzAxXzAzIiwidHJhbnNmb3JtIjp7IngiOjQ3LjY4LCJ5IjotMy4yNSwic2tYIjoxNTEuOTcsInNrWSI6MTUxLjk3fX1dfSx7Im5hbWUiOiJlZmZlY3RfbGlnaHQyIiwiZGlzcGxheSI6W3sibmFtZSI6Im1lbGxvd2RyYWdvbl93YXRlcl8wM19lZmZlY3RfbGlnaHQifV19LHsibmFtZSI6Im1lbGxvd2RyYWdvbl93YXRlcl8wM19hcm1fMDEiLCJkaXNwbGF5IjpbeyJuYW1lIjoibWVsbG93ZHJhZ29uX3dhdGVyXzAzX2FybV8wMSIsInRyYW5zZm9ybSI6eyJ4IjoxOS4zLCJ5IjoyLjk4LCJza1giOi01OC4zMSwic2tZIjotNTguMzF9fV19LHsibmFtZSI6Im1lbGxvd2RyYWdvbl93YXRlcl8wM19lYXJfMDIiLCJkaXNwbGF5IjpbeyJ0eXBlIjoibWVzaCIsIm5hbWUiOiJtZWxsb3dkcmFnb25fd2F0ZXJfMDNfZWFyXzAyIiwib2Zmc2V0IjozMDM4LCJ1c2VyRWRnZXMiOltdfV19LHsibmFtZSI6Im1lbGxvd2RyYWdvbl93YXRlcl8wM19yb2NrZXRfMDMiLCJkaXNwbGF5IjpbeyJuYW1lIjoibWVsbG93ZHJhZ29uX3dhdGVyXzAzX3JvY2tldF8wMyIsInRyYW5zZm9ybSI6eyJ4IjotNC41NiwieSI6LTQuMjZ9fV19LHsibmFtZSI6ImVmZmVjdF9saWdodDMiLCJkaXNwbGF5IjpbeyJuYW1lIjoibWVsbG93ZHJhZ29uX3dhdGVyXzAzX2VmZmVjdF9saWdodCJ9XX0seyJuYW1lIjoicm9ja2V0X2xpZ2h0IiwiZGlzcGxheSI6W3sibmFtZSI6Im1lbGxvd2RyYWdvbl93YXRlcl8wM19yb2NrZXRfMDRfMDYiLCJ0cmFuc2Zvcm0iOnsieCI6MC40NiwieSI6MC4zNH19XX0seyJuYW1lIjoiZWZmZWN0X2Rvd25fMyIsImRpc3BsYXkiOlt7Im5hbWUiOiJtZWxsb3dkcmFnb25fd2F0ZXJfMDNfcm9ja2V0XzAzXzA1IiwidHJhbnNmb3JtIjp7IngiOjQ0LjMyLCJ5IjotOC45NCwic2tYIjo5MS4zNiwic2tZIjo5MS4zNn19XX0seyJuYW1lIjoibWVsbG93ZHJhZ29uX3dhdGVyXzAzX2pveV8wNF8wMSIsImRpc3BsYXkiOlt7Im5hbWUiOiJtZWxsb3dkcmFnb25fd2F0ZXJfMDNfam95XzA0XzAxIiwidHJhbnNmb3JtIjp7IngiOi04LjE5LCJ5IjotMjIuNTJ9fV19LHsibmFtZSI6ImVmZmVjdF9yZWQiLCJkaXNwbGF5IjpbeyJuYW1lIjoibWVsbG93ZHJhZ29uX3dhdGVyXzAzX2VmZmVjdF9yZWQifV19LHsibmFtZSI6Im1lbGxvd2RyYWdvbl93YXRlcl8wM19oYW5kXzAxXzAxIiwiZGlzcGxheSI6W3sibmFtZSI6Im1lbGxvd2RyYWdvbl93YXRlcl8wM19oYW5kXzAxXzAxIiwidHJhbnNmb3JtIjp7IngiOjUuODYsInkiOjMuMzYsInNrWCI6MTI5LjExLCJza1kiOjEyOS4xMX19XX0seyJuYW1lIjoiZWZmZWN0XzAyIiwiZGlzcGxheSI6W3sibmFtZSI6Im1lbGxvd2RyYWdvbl93YXRlcl8wM19lZmZlY3RfMDIifV19LHsibmFtZSI6Im1lbGxvd2RyYWdvbl93YXRlcl8wM19ib2R5XzAxIiwiZGlzcGxheSI6W3sidHlwZSI6Im1lc2giLCJuYW1lIjoibWVsbG93ZHJhZ29uX3dhdGVyXzAzX2JvZHlfMDEiLCJvZmZzZXQiOjM4MzIsInVzZXJFZGdlcyI6W119XX0seyJuYW1lIjoibWVsbG93ZHJhZ29uX3dhdGVyXzAzX3JvY2tldF8wMl8wMSIsImRpc3BsYXkiOlt7Im5hbWUiOiJtZWxsb3dkcmFnb25fd2F0ZXJfMDNfcm9ja2V0XzAyXzAxIiwidHJhbnNmb3JtIjp7IngiOjQ1LjAxLCJ5IjotNy4xMiwic2tYIjoxMzguNTksInNrWSI6MTM4LjU5fX1dfSx7Im5hbWUiOiJtZWxsb3dkcmFnb25fd2F0ZXJfMDNfcm9ja2V0XzAzXzAxIiwiZGlzcGxheSI6W3sibmFtZSI6Im1lbGxvd2RyYWdvbl93YXRlcl8wM19yb2NrZXRfMDNfMDEiLCJ0cmFuc2Zvcm0iOnsieCI6MzMuNTUsInkiOi0yLjA3LCJza1giOi05My4xNSwic2tZIjotOTMuMTV9fV19LHsibmFtZSI6Im1lbGxvd2RyYWdvbl93YXRlcl8wM19nb2dnbGVzXzAxIiwiZGlzcGxheSI6W3sibmFtZSI6Im1lbGxvd2RyYWdvbl93YXRlcl8wM19nb2dnbGVzXzAxIiwidHJhbnNmb3JtIjp7IngiOjU3LjUxLCJ5IjoxNy45MSwic2tYIjo0LjAxLCJza1kiOjQuMDF9fV19LHsibmFtZSI6ImVmZmVjdF8wNF8wMSIsImRpc3BsYXkiOlt7Im5hbWUiOiJtZWxsb3dkcmFnb25fd2F0ZXJfMDNfcm9ja2V0XzA0XzAxIiwidHJhbnNmb3JtIjp7IngiOjYuNjEsInkiOi0yLjEsInNrWCI6MTc0LjU1LCJza1kiOjE3NC41NX19XX0seyJuYW1lIjoiZWZmZWN0X2Rvd25fMiIsImRpc3BsYXkiOlt7Im5hbWUiOiJtZWxsb3dkcmFnb25fd2F0ZXJfMDNfcm9ja2V0XzAzXzA0IiwidHJhbnNmb3JtIjp7IngiOjQ5LjIzLCJ5IjotMy42MSwic2tYIjotOTIuNzIsInNrWSI6LTkyLjcyfX1dfSx7Im5hbWUiOiJlZmZlY3RfZG93bl8xIiwiZGlzcGxheSI6W3sibmFtZSI6Im1lbGxvd2RyYWdvbl93YXRlcl8wM19yb2NrZXRfMDNfMDQiLCJ0cmFuc2Zvcm0iOnsieCI6NjkuNTMsInkiOi00LjU3LCJza1giOi05Mi43Miwic2tZIjotOTIuNzJ9fV19LHsibmFtZSI6Im1lbGxvd2RyYWdvbl93YXRlcl8wM19qb3lfMDEiLCJkaXNwbGF5IjpbeyJuYW1lIjoibWVsbG93ZHJhZ29uX3dhdGVyXzAzX2pveV8wMSIsInRyYW5zZm9ybSI6eyJ4IjoyMC41NSwieSI6LTAuOTIsInNrWCI6OTAuOSwic2tZIjo5MC45fX1dfSx7Im5hbWUiOiJtZWxsb3dkcmFnb25fd2F0ZXJfMDNfcm9ja2V0XzAzXzAyIiwiZGlzcGxheSI6W3sibmFtZSI6Im1lbGxvd2RyYWdvbl93YXRlcl8wM19yb2NrZXRfMDNfMDIiLCJ0cmFuc2Zvcm0iOnsieCI6MjcuNjEsInkiOi0xLjk5LCJza1giOi05MS44LCJza1kiOi05MS44fX1dfSx7Im5hbWUiOiJlZmZlY3RfMDMiLCJkaXNwbGF5IjpbeyJuYW1lIjoibWVsbG93ZHJhZ29uX3dhdGVyXzAzX2VmZmVjdF8wMyJ9XX0seyJuYW1lIjoibWVsbG93ZHJhZ29uX3dhdGVyXzAzX3RhaWxfMDEiLCJkaXNwbGF5IjpbeyJ0eXBlIjoibWVzaCIsIm5hbWUiOiJtZWxsb3dkcmFnb25fd2F0ZXJfMDNfdGFpbF8wMSIsIm9mZnNldCI6NDQ1NSwidXNlckVkZ2VzIjpbXX1dfSx7Im5hbWUiOiJtZWxsb3dkcmFnb25fd2F0ZXJfMDNfcm9ja2V0XzA0XzAzIiwiZGlzcGxheSI6W3sibmFtZSI6Im1lbGxvd2RyYWdvbl93YXRlcl8wM19yb2NrZXRfMDRfMDMiLCJ0cmFuc2Zvcm0iOnsieCI6MTYuNTcsInkiOi0wLjg0LCJza1giOi0xOC4yOSwic2tZIjotMTguMjl9fV19LHsibmFtZSI6Im1lbGxvd2RyYWdvbl93YXRlcl8wM19qb3lfMDUiLCJkaXNwbGF5IjpbeyJuYW1lIjoibWVsbG93ZHJhZ29uX3dhdGVyXzAzX2pveV8wNSIsInRyYW5zZm9ybSI6eyJ4IjotMC42OSwieSI6LTEuNTJ9fV19LHsibmFtZSI6ImVmZmVjdF8wNyIsImRpc3BsYXkiOlt7Im5hbWUiOiJtZWxsb3dkcmFnb25fd2F0ZXJfMDNfZWZmZWN0XzA3IiwidHJhbnNmb3JtIjp7IngiOjAuMjUsInkiOi0wLjA4fX1dfSx7Im5hbWUiOiJtZWxsb3dkcmFnb25fd2F0ZXJfMDNfZ2xvdmVzXzAxIiwiZGlzcGxheSI6W3sidHlwZSI6Im1lc2giLCJuYW1lIjoibWVsbG93ZHJhZ29uX3dhdGVyXzAzX2dsb3Zlc18wMSIsIm9mZnNldCI6NDY2NCwidXNlckVkZ2VzIjpbXX1dfSx7Im5hbWUiOiJtZWxsb3dkcmFnb25fd2F0ZXJfMDNfc2NhcmZfMDIiLCJkaXNwbGF5IjpbeyJuYW1lIjoibWVsbG93ZHJhZ29uX3dhdGVyXzAzX3NjYXJmXzAyIiwidHJhbnNmb3JtIjp7IngiOjguMzMsInkiOi0yLjIzLCJza1giOi0xMC4yMSwic2tZIjotMTAuMjF9fV19XX1dLCJhbmltYXRpb24iOlt7ImR1cmF0aW9uIjozNSwibmFtZSI6ImF0dGFjayIsImFjdGlvbiI6MCwib2Zmc2V0IjpbMCwwLDBdLCJib25lIjp7Im1lbGxvd2RyYWdvbl93YXRlcl8wM19lZmZlY3RfbGlnaHQiOlsxMyw3XSwibWVsbG93ZHJhZ29uX3dhdGVyXzAzX3JvY2tldF8wMiI6WzExLDI3LDEyLDM3XSwibWVsbG93ZHJhZ29uX3dhdGVyXzAzX3JvY2tldF8wMV8wMyI6WzEzLDQ2XSwibWVsbG93ZHJhZ29uX3dhdGVyXzAzX3dpbmdfMDIiOlsxMiw2NV0sIm1lbGxvd2RyYWdvbl93YXRlcl8wM19yb2NrZXRfMDEiOlsxMSw3NiwxMiw4NiwxMyw5NV0sIm1lbGxvd2RyYWdvbl93YXRlcl8wM19hcm1fMDEiOlsxMiwxMDVdLCJtZWxsb3dkcmFnb25fd2F0ZXJfMDNfZ29nZ2xlc18wMSI6WzEyLDExMV0sImJvbmUyNCI6WzEyLDEyMV0sIm1lbGxvd2RyYWdvbl93YXRlcl8wM19oYW5kXzAxIjpbMTEsMTMzLDEyLDE0M10sImJvbmU0MiI6WzEyLDE1M10sIm1lbGxvd2RyYWdvbl93YXRlcl8wM19qb3lfMDEiOlsxMiwxNjVdLCJib25lMzQiOlsxMiwxNzVdLCJtZWxsb3dkcmFnb25fd2F0ZXJfMDNfcm9ja2V0XzAxXzAyIjpbMTEsMTgxLDEzLDE5OF0sImJvbmUzOCI6WzEyLDIxNV0sImJvbmU0OSI6WzEzLDIyN10sIm1lbGxvd2RyYWdvbl93YXRlcl8wM19ib2R5XzAxIjpbMTEsMjUxLDEyLDI2MF0sImJvbmUyMiI6WzEyLDI3MF0sImJvbmUzNSI6WzEyLDI4Ml0sImJvbmUxMiI6WzEyLDI4OF0sImJvbmUyMyI6WzEyLDI5NF0sImJvbmU5IjpbMTIsMzA2XSwiYm9uZTM5IjpbMTIsMzE3XSwibWVsbG93ZHJhZ29uX3dhdGVyXzAzX2VmZmVjdF9saWdodDIiOlsxMywzMjldLCJtZWxsb3dkcmFnb25fd2F0ZXJfMDNfZWFyXzAyIjpbMTIsMzQ5XSwibWVsbG93ZHJhZ29uX3dhdGVyXzAzX3JvY2tldF8wM18wMyI6WzEzLDM2MF0sIm1lbGxvd2RyYWdvbl93YXRlcl8wM19ob3JuXzAxIjpbMTIsMzg0XSwibWVsbG93ZHJhZ29uX3dhdGVyXzAzX2hlYWRfMDEiOlsxMiwzOTBdLCJtZWxsb3dkcmFnb25fd2F0ZXJfMDNfcm9ja2V0XzAyXzAxIjpbMTMsMzk5XSwiYm9uZTIxIjpbMTIsNDI3XSwiYm9uZTgiOlsxMiw0MzldLCJib25lNDEiOlsxMiw0NTBdLCJtZWxsb3dkcmFnb25fd2F0ZXJfMDNfZWZmZWN0X2xpZ2h0ZHVzdDIiOlsxMyw0NjJdLCJoaXAiOlsxMSw0ODEsMTIsNDkxXSwibGVnX2wiOlsxMSw1MDEsMTIsNTExXSwibWVsbG93ZHJhZ29uX3dhdGVyXzAzX3NjYXJmXzAyIjpbMTIsNTIxXSwibGVnX3IiOlsxMSw1MjcsMTIsNTM3XSwibWVsbG93ZHJhZ29uX3dhdGVyXzAzX2hvcm5fMDIiOlsxMiw1NDddLCJtZWxsb3dkcmFnb25fd2F0ZXJfMDNfcm9ja2V0XzAzIjpbMTEsNTUzLDEyLDU2M10sImJvbmU2IjpbMTIsNTczXSwiYm9uZTQwIjpbMTIsNTg0XSwibWVsbG93ZHJhZ29uX3dhdGVyXzAzX2hhbmRfMDFfMDEiOlsxMSw1OTYsMTIsNjAyXSwibWVsbG93ZHJhZ29uX3dhdGVyXzAzX3RhaWxfMDEiOlsxMiw2MDhdLCJib25lMjAiOlsxMiw2MTRdLCJtZWxsb3dkcmFnb25fd2F0ZXJfMDNfYXJtXzAyIGNvcHkiOlsxMSw2MjYsMTIsNjM1XSwiYm9uZTE5IjpbMTIsNjQ0XSwiYm9uZTM3IjpbMTIsNjU2XSwiYm9uZTUiOlsxMiw2NjhdLCJtZWxsb3dkcmFnb25fd2F0ZXJfMDNfd2luZ18wMSI6WzEyLDY3OV0sIm1lbGxvd2RyYWdvbl93YXRlcl8wM19lYXJfMDEiOlsxMiw2OTFdLCJtZWxsb3dkcmFnb25fd2F0ZXJfMDNfcm9ja2V0XzAzXzAxIjpbMTMsNzAyXSwiYXR0YWNrIjpbMTEsNzI2XSwiZWZmZWN0X3JlZCI6WzEzLDczM10sImVmZmVjdCI6WzExLDc0MSwxMyw3NDhdLCJlZmZlY3RfYm90dG9tXzEiOlsxMSw3NTUsMTMsNzY0XSwiZWZmZWN0X2JvdHRvbV8yIjpbMTEsNzczLDEzLDc4NF0sImVmZmVjdF9maXJlIjpbMTEsNzk1LDEzLDgwM10sImVmZmVjdF9kb3duXzEiOlsxMSw4MTEsMTMsODIyXSwiZWZmZWN0X2Rvd25fMiI6WzExLDgzMywxMyw4NDZdLCJlZmZlY3RfbGlnaHQzIjpbMTEsODU5LDEzLDg2Nl0sImVmZmVjdF9saWdodGR1c3QzIjpbMTMsODczXX0sInNsb3QiOnsiZWZmZWN0XzAxIjpbMjEsODgxXSwiZWZmZWN0XzAyIjpbMjEsODg3XSwiZWZmZWN0XzAzIjpbMjEsODkzXSwiZWZmZWN0XzA0IjpbMjEsODk5XSwiZWZmZWN0XzA1IjpbMjEsOTA1XSwiZWZmZWN0XzUiOlsyMSw5MTFdLCJlZmZlY3RfNiI6WzIxLDkxN10sImVmZmVjdF8wNyI6WzIxLDkyM10sImVmZmVjdF8wNF8wMSI6WzIxLDkyOV0sImVmZmVjdF9ibHVlIjpbMjEsOTM1XSwiZWZmZWN0X2Rvd25fMSI6WzIwLDk0MSwyMSw5NTBdLCJlZmZlY3RfZG93bl8yIjpbMjAsOTY0LDIxLDk3NV0sImVmZmVjdF9kb3duXzMiOlsyMCw5OTIsMjEsOTk5XSwiZWZmZWN0X2Rvd25fNCI6WzIwLDEwMDksMjEsMTAxOF0sImVmZmVjdF9maXJlIjpbMjAsMTAzMiwyMSwxMDM5XSwiZWZmZWN0X2xpZ2h0MyI6WzIwLDEwNDgsMjEsMTA1NV0sImVmZmVjdF9saWdodGR1c3QiOlsyMSwxMDYyXSwiZWZmZWN0X2xpZ2h0ZHVzdDIiOlsyMSwxMDY4XSwiZWZmZWN0X2xpZ2h0ZHVzdDMiOlsyMCwxMDc0LDIxLDEwODFdLCJlZmZlY3RfbGlnaHRpbmciOlsyMCwxMDkwLDIxLDEwOTZdLCJlZmZlY3RfcmVkIjpbMjAsMTEwMiwyMSwxMTA5XSwibWVsbG93ZHJhZ29uX3dhdGVyXzAzX2VmZmVjdF8wOCI6WzIxLDExMThdLCJtZWxsb3dkcmFnb25fd2F0ZXJfMDNfcm9ja2V0XzA0IjpbMjEsMTEyNF0sIm1lbGxvd2RyYWdvbl93YXRlcl8wM19yb2NrZXRfMDFfMDIiOlsyMCwxMTMwLDIxLDExNDJdLCJtZWxsb3dkcmFnb25fd2F0ZXJfMDNfcm9ja2V0XzA0XzAyIjpbMjEsMTE1N10sIm1lbGxvd2RyYWdvbl93YXRlcl8wM19yb2NrZXRfMDRfMDMiOlsyMSwxMTYzXSwibWVsbG93ZHJhZ29uX3dhdGVyXzAzX3JvY2tldF8wNF8wNCI6WzIxLDExNjldLCJtZWxsb3dkcmFnb25fd2F0ZXJfMDNfcm9ja2V0XzA0XzA1IjpbMjEsMTE3NV0sInJvY2tldF9saWdodCI6WzIxLDExODFdfX0seyJkdXJhdGlvbiI6NjAsIm5hbWUiOiJpZGxlIiwib2Zmc2V0IjpbNzksOTU4LDI4ODhdLCJib25lIjp7Im1lbGxvd2RyYWdvbl93YXRlcl8wM19ib2R5XzAxIjpbMTIsMTE4N10sIm1lbGxvd2RyYWdvbl93YXRlcl8wM19hcm1fMDEiOlsxMiwxMTk1XSwibWVsbG93ZHJhZ29uX3dhdGVyXzAzX2dsb3Zlc18wMSI6WzEyLDEyMDRdLCJtZWxsb3dkcmFnb25fd2F0ZXJfMDNfam95XzAxIjpbMTIsMTIxMl0sIm1lbGxvd2RyYWdvbl93YXRlcl8wM19oYW5kXzAxXzAxIjpbMTEsMTIyMSwxMiwxMjMwXSwibWVsbG93ZHJhZ29uX3dhdGVyXzAzX2FybV8wMiBjb3B5IjpbMTIsMTIzOV0sIm1lbGxvd2RyYWdvbl93YXRlcl8wM19oYW5kXzAxIjpbMTIsMTI0N10sIm1lbGxvd2RyYWdvbl93YXRlcl8wM19oZWFkXzAxIjpbMTIsMTI1Nl0sIm1lbGxvd2RyYWdvbl93YXRlcl8wM19lYXJfMDEiOlsxMiwxMjY1XSwibWVsbG93ZHJhZ29uX3dhdGVyXzAzX2Vhcl8wMiI6WzEyLDEyNzNdLCJtZWxsb3dkcmFnb25fd2F0ZXJfMDNfZ29nZ2xlc18wMSI6WzEyLDEyODFdLCJtZWxsb3dkcmFnb25fd2F0ZXJfMDNfaG9ybl8wMSI6WzEyLDEyOTBdLCJtZWxsb3dkcmFnb25fd2F0ZXJfMDNfaG9ybl8wMiI6WzEyLDEyOTldLCJtZWxsb3dkcmFnb25fd2F0ZXJfMDNfc2NhcmZfMDIiOlsxMiwxMzA4XSwibWVsbG93ZHJhZ29uX3dhdGVyXzAzX3dpbmdfMDEiOlsxMiwxMzE3XSwibWVsbG93ZHJhZ29uX3dhdGVyXzAzX3dpbmdfMDIiOlsxMiwxMzI5XSwibWVsbG93ZHJhZ29uX3dhdGVyXzAzX3RhaWxfMDEiOlsxMiwxMzQwXSwibWVsbG93ZHJhZ29uX3dhdGVyXzAzX3JvY2tldF8wMSI6WzExLDEzNDksMTMsMTM1N10sIm1lbGxvd2RyYWdvbl93YXRlcl8wM19lZmZlY3RfbGlnaHQiOlsxMywxMzY1XSwibWVsbG93ZHJhZ29uX3dhdGVyXzAzX3JvY2tldF8wMV8wMSI6WzEyLDEzOTFdLCJtZWxsb3dkcmFnb25fd2F0ZXJfMDNfcm9ja2V0XzAxXzAyIjpbMTEsMTQxNCwxMywxNDQxXSwibWVsbG93ZHJhZ29uX3dhdGVyXzAzX3JvY2tldF8wMV8wMyI6WzEzLDE0NjhdLCJtZWxsb3dkcmFnb25fd2F0ZXJfMDNfcm9ja2V0XzAyIjpbMTEsMTQ5Nl0sIm1lbGxvd2RyYWdvbl93YXRlcl8wM19lZmZlY3RfbGlnaHQyIjpbMTMsMTUwNF0sIm1lbGxvd2RyYWdvbl93YXRlcl8wM19lZmZlY3RfbGlnaHRkdXN0MiI6WzEzLDE1MzBdLCJtZWxsb3dkcmFnb25fd2F0ZXJfMDNfcm9ja2V0XzAyXzAxIjpbMTMsMTU1OF0sIm1lbGxvd2RyYWdvbl93YXRlcl8wM19yb2NrZXRfMDMiOlsxMSwxNTg2LDEyLDE1OTZdLCJib25lNDkiOlsxMywxNjA2XSwibWVsbG93ZHJhZ29uX3dhdGVyXzAzX3JvY2tldF8wM18wMSI6WzEzLDE2NDJdLCJtZWxsb3dkcmFnb25fd2F0ZXJfMDNfcm9ja2V0XzAzXzAzIjpbMTMsMTY3OF0sImxlZ19yIjpbMTEsMTcxNCwxMiwxNzI0XSwibGVnX2wiOlsxMSwxNzM0LDEyLDE3NDRdLCJib25lMzUiOlsxMiwxNzU0XSwiYm9uZTM0IjpbMTIsMTc2M10sImJvbmU0MiI6WzEyLDE3NzJdLCJib25lNDEiOlsxMiwxNzg0XSwiYm9uZTQwIjpbMTIsMTc5Nl0sImJvbmUzOSI6WzEyLDE4MDhdLCJib25lMzgiOlsxMiwxODIwXSwiYm9uZTM3IjpbMTIsMTgzMl0sImJvbmUyNCI6WzEyLDE4NDRdLCJib25lMjMiOlsxMiwxODU2XSwiYm9uZTIyIjpbMTIsMTg2OF0sImJvbmUyMSI6WzEyLDE4ODBdLCJib25lMjAiOlsxMiwxODkyXSwiYm9uZTE5IjpbMTIsMTkwNF0sImJvbmU2IjpbMTIsMTkxNl0sImJvbmU1IjpbMTIsMTkyNV0sImJvbmU5IjpbMTIsMTkzNF0sImJvbmU4IjpbMTIsMTk0M10sImJvbmUxMiI6WzEyLDE5NTJdLCJoaXAiOlsxMSwxOTYxLDEyLDE5NjldLCJlZmZlY3RfYm90dG9tXzIiOlsxMSwxOTc3LDEzLDE5ODddLCJlZmZlY3RfYm90dG9tXzEiOlsxMSwxOTk3LDEzLDIwMDVdLCJlZmZlY3RfZG93bl8xIjpbMTEsMjAxMywxMywyMDIzXSwiZWZmZWN0X2Rvd25fMiI6WzExLDIwMzMsMTMsMjA0NF19LCJzbG90Ijp7ImVmZmVjdF8wMSI6WzIxLDIwNTVdLCJlZmZlY3RfMDIiOlsyMSwyMDYxXSwiZWZmZWN0XzAzIjpbMjEsMjA2N10sImVmZmVjdF8wNCI6WzIxLDIwNzNdLCJlZmZlY3RfNSI6WzIwLDIwNzksMjEsMjA4NV0sImVmZmVjdF8wNSI6WzIwLDIwOTEsMjEsMjA5N10sImVmZmVjdF82IjpbMjAsMjEwMywyMSwyMTA5XSwiZWZmZWN0XzA3IjpbMjEsMjExNV0sImVmZmVjdF8wNF8wMSI6WzIxLDIxMjFdLCJlZmZlY3RfYmx1ZSI6WzIxLDIxMjddLCJlZmZlY3RfZG93bl8xIjpbMjAsMjEzMywyMSwyMTQyXSwiZWZmZWN0X2Rvd25fMiI6WzIwLDIxNTYsMjEsMjE2N10sImVmZmVjdF9kb3duXzMiOlsyMCwyMTg0LDIxLDIxOTFdLCJlZmZlY3RfZG93bl80IjpbMjAsMjIwMSwyMSwyMjEwXSwiZWZmZWN0X2ZpcmUiOlsyMSwyMjI0XSwiZWZmZWN0X2xpZ2h0MyI6WzIxLDIyMzBdLCJlZmZlY3RfbGlnaHRkdXN0IjpbMjEsMjIzNl0sImVmZmVjdF9saWdodGR1c3QyIjpbMjEsMjI0Ml0sImVmZmVjdF9saWdodGR1c3QzIjpbMjEsMjI0OF0sImVmZmVjdF9saWdodGluZyI6WzIwLDIyNTQsMjEsMjI2MF0sImVmZmVjdF9yZWQiOlsyMSwyMjY2XSwibWVsbG93ZHJhZ29uX3dhdGVyXzAzX2VmZmVjdF8wOCI6WzIxLDIyNzJdLCJtZWxsb3dkcmFnb25fd2F0ZXJfMDNfcm9ja2V0XzA0IjpbMjEsMjI3OF0sIm1lbGxvd2RyYWdvbl93YXRlcl8wM19yb2NrZXRfMDFfMDIiOlsyMCwyMjg0LDIxLDIzMDRdLCJtZWxsb3dkcmFnb25fd2F0ZXJfMDNfcm9ja2V0XzA0XzAyIjpbMjEsMjMzMV0sIm1lbGxvd2RyYWdvbl93YXRlcl8wM19yb2NrZXRfMDRfMDMiOlsyMSwyMzM3XSwibWVsbG93ZHJhZ29uX3dhdGVyXzAzX3JvY2tldF8wNF8wNCI6WzIxLDIzNDNdLCJtZWxsb3dkcmFnb25fd2F0ZXJfMDNfcm9ja2V0XzA0XzA1IjpbMjEsMjM0OV0sInJvY2tldF9saWdodCI6WzIxLDIzNTVdfX0seyJkdXJhdGlvbiI6MTQ5LCJuYW1lIjoicG9zZV8xIiwib2Zmc2V0IjpbMTYwLDIwMjQsNjg3Nl0sImJvbmUiOnsibWVsbG93ZHJhZ29uX3dhdGVyXzAzX2VmZmVjdF9saWdodCI6WzExLDIzNjEsMTIsMjM3MSwxMywyMzgxXSwibWVsbG93ZHJhZ29uX3dhdGVyXzAzX3JvY2tldF8wMiI6WzExLDI0MjEsMTIsMjQzM10sIm1lbGxvd2RyYWdvbl93YXRlcl8wM19yb2NrZXRfMDFfMDMiOlsxMiwyNDQzLDEzLDI0NTJdLCJtZWxsb3dkcmFnb25fd2F0ZXJfMDNfd2luZ18wMiI6WzEyLDI0OTVdLCJtZWxsb3dkcmFnb25fd2F0ZXJfMDNfcm9ja2V0XzAxIjpbMTEsMjUyNSwxMiwyNTUyLDEzLDI1NzFdLCJtZWxsb3dkcmFnb25fd2F0ZXJfMDNfYXJtXzAxIjpbMTIsMjU4MF0sIm1lbGxvd2RyYWdvbl93YXRlcl8wM19nb2dnbGVzXzAxIjpbMTIsMjU4Nl0sIm1lbGxvd2RyYWdvbl93YXRlcl8wM19leWVfMDEiOlsxMSwyNjAxLDEzLDI2MTNdLCJib25lMjQiOlsxMiwyNjM0XSwibWVsbG93ZHJhZ29uX3dhdGVyXzAzX2hhbmRfMDEiOlsxMSwyNjcwLDEyLDI2OTZdLCJib25lNDIiOlsxMiwyNzIyXSwibWVsbG93ZHJhZ29uX3dhdGVyXzAzX2pveV8wMSI6WzEyLDI3NThdLCJib25lMzQiOlsxMiwyNzg2XSwibWVsbG93ZHJhZ29uX3dhdGVyXzAzX3JvY2tldF8wMV8wMiI6WzExLDI3OTksMTIsMjg0OSwxMywyODU4XSwiYm9uZTM4IjpbMTIsMjkwOF0sImJvbmU0OSI6WzEyLDI5NDQsMTMsMjk1NF0sIm1lbGxvd2RyYWdvbl93YXRlcl8wM19ib2R5XzAxIjpbMTIsMzAzM10sImJvbmUyMiI6WzEyLDMwNDZdLCJtZWxsb3dkcmFnb25fd2F0ZXJfMDNfZWZmZWN0X2xpZ2h0ZHVzdCI6WzEyLDMwODJdLCJib25lMzUiOlsxMiwzMDkyXSwiYm9uZTEyIjpbMTIsMzEwNV0sImJvbmUyMyI6WzEyLDMxMTFdLCJib25lOSI6WzEyLDMxNDddLCJib25lMzkiOlsxMiwzMTY3XSwibWVsbG93ZHJhZ29uX3dhdGVyXzAzX2VmZmVjdF9saWdodDIiOlsxMywzMjAzXSwibWVsbG93ZHJhZ29uX3dhdGVyXzAzX2Vhcl8wMiI6WzEyLDMyNTddLCJtZWxsb3dkcmFnb25fd2F0ZXJfMDNfcm9ja2V0XzAzXzAzIjpbMTIsMzI3NywxMywzMjg3XSwibWVsbG93ZHJhZ29uX3dhdGVyXzAzX2hvcm5fMDEiOlsxMiwzMzY2XSwibWVsbG93ZHJhZ29uX3dhdGVyXzAzX2hlYWRfMDEiOlsxMiwzMzcyXSwibWVsbG93ZHJhZ29uX3dhdGVyXzAzX3JvY2tldF8wMl8wMSI6WzEzLDMzODZdLCJib25lMjEiOlsxMiwzNDQ1XSwiYm9uZTgiOlsxMiwzNDgxXSwiYm9uZTQxIjpbMTIsMzUwMV0sIm1lbGxvd2RyYWdvbl93YXRlcl8wM19lZmZlY3RfbGlnaHRkdXN0MiI6WzEzLDM1MzddLCJoaXAiOlsxMSwzNTk2LDEyLDM2MjRdLCJsZWdfbCI6WzExLDM2NDEsMTIsMzY2OV0sIm1lbGxvd2RyYWdvbl93YXRlcl8wM19zY2FyZl8wMiI6WzEyLDM2ODZdLCJsZWdfciI6WzExLDM3MDMsMTIsMzczMV0sImJvbmUzIjpbMTEsMzc0OF0sIm1lbGxvd2RyYWdvbl93YXRlcl8wM19ob3JuXzAyIjpbMTIsMzc1Nl0sIm1lbGxvd2RyYWdvbl93YXRlcl8wM19yb2NrZXRfMDMiOlsxMSwzNzYyLDEyLDM3OTBdLCJib25lNiI6WzExLDM4MDcsMTIsMzgxM10sImJvbmU0MCI6WzEyLDM4MzNdLCJtZWxsb3dkcmFnb25fd2F0ZXJfMDNfaGFuZF8wMV8wMSI6WzExLDM4NjksMTIsMzg3NV0sIm1lbGxvd2RyYWdvbl93YXRlcl8wM190YWlsXzAxIjpbMTIsMzg4MV0sImJvbmUyMCI6WzEyLDM4OTRdLCJtZWxsb3dkcmFnb25fd2F0ZXJfMDNfYXJtXzAyIGNvcHkiOlsxMiwzOTMwXSwiYm9uZTE5IjpbMTIsMzkzOF0sImJvbmUzNyI6WzEyLDM5NzRdLCJib25lNSI6WzEyLDQwMTBdLCJtZWxsb3dkcmFnb25fd2F0ZXJfMDNfd2luZ18wMSI6WzEyLDQwMzBdLCJtZWxsb3dkcmFnb25fd2F0ZXJfMDNfZWFyXzAxIjpbMTIsNDA2Nl0sIm1lbGxvd2RyYWdvbl93YXRlcl8wM19yb2NrZXRfMDNfMDEiOlsxMiw0MDg2LDEzLDQwOTZdLCJlZmZlY3RfYm90dG9tXzEiOlsxMSw0MTc1LDEzLDQxODldLCJlZmZlY3RfYm90dG9tXzIiOlsxMSw0MjAzLDEzLDQyMjJdLCJlZmZlY3RfZG93bl8xIjpbMTEsNDI0MSwxMyw0MjU3XSwiZWZmZWN0X2Rvd25fMiI6WzExLDQyNzEsMTMsNDI5M10sImVmZmVjdF9saWdodGR1c3QzIjpbMTEsNDMxNSwxMiw0MzI0LDEzLDQzMzFdLCJlZmZlY3RfYmx1ZSI6WzExLDQzNDAsMTIsNDM0OSwxMyw0MzU2XX0sInNsb3QiOnsiZWZmZWN0XzAxIjpbMjEsNDM2NV0sImVmZmVjdF8wMiI6WzIxLDQzNzFdLCJlZmZlY3RfMDMiOlsyMSw0Mzc3XSwiZWZmZWN0XzA0IjpbMjEsNDM4M10sImVmZmVjdF8wNSI6WzIxLDQzODldLCJlZmZlY3RfNSI6WzIxLDQzOTVdLCJlZmZlY3RfNiI6WzIxLDQ0MDFdLCJlZmZlY3RfMDciOlsyMSw0NDA3XSwiZWZmZWN0XzA0XzAxIjpbMjEsNDQxM10sImVmZmVjdF9ibHVlIjpbMjAsNDQxOSwyMSw0NDI2XSwiZWZmZWN0X2Rvd25fMSI6WzIwLDQ0MzUsMjEsNDQ1MF0sImVmZmVjdF9kb3duXzIiOlsyMCw0NDc1LDIxLDQ0OTRdLCJlZmZlY3RfZG93bl8zIjpbMjAsNDUyNywyMSw0NTM4XSwiZWZmZWN0X2Rvd25fNCI6WzIwLDQ1NTIsMjEsNDU2N10sImVmZmVjdF9maXJlIjpbMjEsNDU5Ml0sImVmZmVjdF9saWdodCI6WzIwLDQ1OTgsMjEsNDYwNl0sImVmZmVjdF9saWdodDMiOlsyMSw0NjE2XSwiZWZmZWN0X2xpZ2h0ZHVzdCI6WzIwLDQ2MjIsMjEsNDYyOV0sImVmZmVjdF9saWdodGR1c3QyIjpbMjEsNDYzN10sImVmZmVjdF9saWdodGR1c3QzIjpbMjAsNDY0MywyMSw0NjUwXSwiZWZmZWN0X2xpZ2h0aW5nIjpbMjAsNDY1OSwyMSw0NjY1XSwiZWZmZWN0X3JlZCI6WzIxLDQ2NzFdLCJtZWxsb3dkcmFnb25fd2F0ZXJfMDNfZWZmZWN0XzA4IjpbMjEsNDY3N10sIm1lbGxvd2RyYWdvbl93YXRlcl8wM19leWVfMDEiOlsyMCw0NjgzXSwibWVsbG93ZHJhZ29uX3dhdGVyXzAzX3JvY2tldF8wMSI6WzIwLDQ2OTcsMjEsNDcwNV0sIm1lbGxvd2RyYWdvbl93YXRlcl8wM19yb2NrZXRfMDQiOlsyMSw0NzE0XSwibWVsbG93ZHJhZ29uX3dhdGVyXzAzX3JvY2tldF8wMV8wMSI6WzIwLDQ3MjAsMjEsNDcyOF0sIm1lbGxvd2RyYWdvbl93YXRlcl8wM19yb2NrZXRfMDFfMDIiOlsyMCw0NzM3LDIxLDQ3NzFdLCJtZWxsb3dkcmFnb25fd2F0ZXJfMDNfcm9ja2V0XzAxXzAzIjpbMjAsNDgyMSwyMSw0ODI5XSwibWVsbG93ZHJhZ29uX3dhdGVyXzAzX3JvY2tldF8wNF8wMiI6WzIxLDQ4MzhdLCJtZWxsb3dkcmFnb25fd2F0ZXJfMDNfcm9ja2V0XzA0XzAzIjpbMjEsNDg0NF0sIm1lbGxvd2RyYWdvbl93YXRlcl8wM19yb2NrZXRfMDRfMDQiOlsyMSw0ODUwXSwibWVsbG93ZHJhZ29uX3dhdGVyXzAzX3JvY2tldF8wNF8wNSI6WzIxLDQ4NTZdLCJyb2NrZXRfbGlnaHQiOlsyMSw0ODYyXX19LHsiZHVyYXRpb24iOjYwLCJuYW1lIjoic2tpbGxfYXBwZWFyIiwib2Zmc2V0IjpbMzMxLDUxNzIsMTY5OTddLCJib25lIjp7Im1lbGxvd2RyYWdvbl93YXRlcl8wM19lZmZlY3RfbGlnaHQiOlsxMyw0ODY4XSwibWVsbG93ZHJhZ29uX3dhdGVyXzAzX3JvY2tldF8wMV8wMSI6WzEyLDQ4OTRdLCJtZWxsb3dkcmFnb25fd2F0ZXJfMDNfcm9ja2V0XzAyIjpbMTEsNDkxN10sIm1lbGxvd2RyYWdvbl93YXRlcl8wM19yb2NrZXRfMDFfMDMiOlsxMyw0OTI1XSwibWVsbG93ZHJhZ29uX3dhdGVyXzAzX3dpbmdfMDIiOlsxMiw0OTUzXSwibWVsbG93ZHJhZ29uX3dhdGVyXzAzX3JvY2tldF8wMSI6WzExLDQ5NjQsMTMsNDk3Ml0sIm1lbGxvd2RyYWdvbl93YXRlcl8wM19hcm1fMDEiOlsxMiw0OTgwXSwibWVsbG93ZHJhZ29uX3dhdGVyXzAzX2dvZ2dsZXNfMDEiOlsxMiw0OTg5XSwibWVsbG93ZHJhZ29uX3dhdGVyXzAzX2V5ZV8wMSI6WzEzLDQ5OThdLCJib25lMjQiOlsxMiw1MDA0XSwibWVsbG93ZHJhZ29uX3dhdGVyXzAzX2hhbmRfMDEiOlsxMiw1MDE2XSwiYm9uZTQyIjpbMTIsNTAyNV0sIm1lbGxvd2RyYWdvbl93YXRlcl8wM19qb3lfMDEiOlsxMiw1MDM3XSwibWVsbG93ZHJhZ29uX3dhdGVyXzAzX2dsb3Zlc18wMSI6WzEyLDUwNDZdLCJib25lMzQiOlsxMiw1MDU0XSwibWVsbG93ZHJhZ29uX3dhdGVyXzAzX3JvY2tldF8wMV8wMiI6WzExLDUwNjMsMTMsNTA5MF0sImJvbmUzOCI6WzEyLDUxMTddLCJib25lNDkiOlsxMyw1MTI5XSwibWVsbG93ZHJhZ29uX3dhdGVyXzAzX2JvZHlfMDEiOlsxMiw1MTY1XSwiYm9uZTIyIjpbMTIsNTE3M10sImJvbmUzNSI6WzEyLDUxODVdLCJib25lMTIiOlsxMiw1MTk0XSwiYm9uZTIzIjpbMTIsNTIwM10sImJvbmU5IjpbMTIsNTIxNV0sImJvbmUzOSI6WzEyLDUyMjRdLCJtZWxsb3dkcmFnb25fd2F0ZXJfMDNfZWZmZWN0X2xpZ2h0MiI6WzEzLDUyMzZdLCJtZWxsb3dkcmFnb25fd2F0ZXJfMDNfZWFyXzAyIjpbMTIsNTI2Ml0sIm1lbGxvd2RyYWdvbl93YXRlcl8wM19yb2NrZXRfMDNfMDMiOlsxMyw1MjcwXSwibWVsbG93ZHJhZ29uX3dhdGVyXzAzX2hvcm5fMDEiOlsxMiw1MzA2XSwibWVsbG93ZHJhZ29uX3dhdGVyXzAzX2hlYWRfMDEiOlsxMiw1MzE1XSwibWVsbG93ZHJhZ29uX3dhdGVyXzAzX3JvY2tldF8wMl8wMSI6WzEzLDUzMjRdLCJib25lMjEiOlsxMiw1MzUyXSwiYm9uZTgiOlsxMiw1MzY0XSwiYm9uZTQxIjpbMTIsNTM3M10sImhpcCI6WzExLDUzODUsMTIsNTM5M10sImxlZ19sIjpbMTEsNTQwMSwxMiw1NDExXSwibWVsbG93ZHJhZ29uX3dhdGVyXzAzX3NjYXJmXzAyIjpbMTIsNTQyMV0sImxlZ19yIjpbMTEsNTQzMCwxMiw1NDQwXSwiYm9uZTMiOlsxMSw1NDUwLDEzLDU0NThdLCJtZWxsb3dkcmFnb25fd2F0ZXJfMDNfaG9ybl8wMiI6WzEyLDU0NjZdLCJtZWxsb3dkcmFnb25fd2F0ZXJfMDNfcm9ja2V0XzAzIjpbMTEsNTQ3NSwxMiw1NDg1XSwiYm9uZTYiOlsxMiw1NDk1XSwiYm9uZTQwIjpbMTIsNTUwNF0sIm1lbGxvd2RyYWdvbl93YXRlcl8wM19oYW5kXzAxXzAxIjpbMTEsNTUxNiwxMiw1NTI1XSwibWVsbG93ZHJhZ29uX3dhdGVyXzAzX3RhaWxfMDEiOlsxMiw1NTM0XSwiYm9uZTIwIjpbMTIsNTU0M10sIm1lbGxvd2RyYWdvbl93YXRlcl8wM19hcm1fMDIgY29weSI6WzEyLDU1NTVdLCJib25lMTkiOlsxMiw1NTYzXSwiYm9uZTM3IjpbMTIsNTU3NV0sImJvbmU1IjpbMTIsNTU4N10sIm1lbGxvd2RyYWdvbl93YXRlcl8wM193aW5nXzAxIjpbMTIsNTU5Nl0sIm1lbGxvd2RyYWdvbl93YXRlcl8wM19lYXJfMDEiOlsxMiw1NjA4XSwibWVsbG93ZHJhZ29uX3dhdGVyXzAzX3JvY2tldF8wM18wMSI6WzEzLDU2MTZdLCJlZmZlY3RfYm90dG9tXzEiOlsxMSw1NjUyLDEzLDU2NjBdLCJlZmZlY3RfYm90dG9tXzIiOlsxMSw1NjY4LDEzLDU2NzhdLCJlZmZlY3RfZG93bl8xIjpbMTEsNTY4OCwxMyw1Njk4XSwiZWZmZWN0X2Rvd25fMiI6WzExLDU3MDgsMTMsNTcxOV19LCJzbG90Ijp7ImVmZmVjdF8wMSI6WzIxLDU3MzBdLCJlZmZlY3RfMDIiOlsyMSw1NzM2XSwiZWZmZWN0XzAzIjpbMjEsNTc0Ml0sImVmZmVjdF8wNCI6WzIxLDU3NDhdLCJlZmZlY3RfMDUiOlsyMCw1NzU0LDIxLDU3NjBdLCJlZmZlY3RfNSI6WzIwLDU3NjYsMjEsNTc3Ml0sImVmZmVjdF82IjpbMjAsNTc3OCwyMSw1Nzg0XSwiZWZmZWN0XzA3IjpbMjEsNTc5MF0sImVmZmVjdF8wNF8wMSI6WzIxLDU3OTZdLCJlZmZlY3RfYmx1ZSI6WzIxLDU4MDJdLCJlZmZlY3RfZG93bl8xIjpbMjAsNTgwOCwyMSw1ODE3XSwiZWZmZWN0X2Rvd25fMiI6WzIwLDU4MzEsMjEsNTg0Ml0sImVmZmVjdF9kb3duXzMiOlsyMCw1ODU5LDIxLDU4NjZdLCJlZmZlY3RfZG93bl80IjpbMjAsNTg3NiwyMSw1ODg1XSwiZWZmZWN0X2ZpcmUiOlsyMSw1ODk5XSwiZWZmZWN0X2xpZ2h0MyI6WzIxLDU5MDVdLCJlZmZlY3RfbGlnaHRkdXN0IjpbMjEsNTkxMV0sImVmZmVjdF9saWdodGR1c3QyIjpbMjEsNTkxN10sImVmZmVjdF9saWdodGR1c3QzIjpbMjEsNTkyM10sImVmZmVjdF9saWdodGluZyI6WzIwLDU5MjksMjEsNTkzNV0sImVmZmVjdF9yZWQiOlsyMSw1OTQxXSwibWVsbG93ZHJhZ29uX3dhdGVyXzAzX2VmZmVjdF8wOCI6WzIxLDU5NDddLCJtZWxsb3dkcmFnb25fd2F0ZXJfMDNfcm9ja2V0XzA0IjpbMjEsNTk1M10sIm1lbGxvd2RyYWdvbl93YXRlcl8wM19yb2NrZXRfMDFfMDIiOlsyMCw1OTU5LDIxLDU5NzldLCJtZWxsb3dkcmFnb25fd2F0ZXJfMDNfcm9ja2V0XzA0XzAyIjpbMjEsNjAwNl0sIm1lbGxvd2RyYWdvbl93YXRlcl8wM19yb2NrZXRfMDRfMDMiOlsyMSw2MDEyXSwibWVsbG93ZHJhZ29uX3dhdGVyXzAzX3JvY2tldF8wNF8wNCI6WzIxLDYwMThdLCJtZWxsb3dkcmFnb25fd2F0ZXJfMDNfcm9ja2V0XzA0XzA1IjpbMjEsNjAyNF0sInJvY2tldF9saWdodCI6WzIxLDYwMzBdfX0seyJkdXJhdGlvbiI6NzgsIm5hbWUiOiJza2lsbF9kaXNhcHBlYXIiLCJhY3Rpb24iOjYwMzYsIm9mZnNldCI6WzQxMiw2MjA2LDIxMDgxXSwiYm9uZSI6eyJtZWxsb3dkcmFnb25fd2F0ZXJfMDNfZWZmZWN0X2xpZ2h0IjpbMTEsNjA0MywxMyw2MDg2XSwibWVsbG93ZHJhZ29uX3dhdGVyXzAzX3JvY2tldF8wMiI6WzExLDYwOTUsMTIsNjEwM10sIm1lbGxvd2RyYWdvbl93YXRlcl8wM19yb2NrZXRfMDFfMDMiOlsxMSw2MTExLDEyLDYxNjgsMTMsNjE3Nl0sIm1lbGxvd2RyYWdvbl93YXRlcl8wM193aW5nXzAyIjpbMTIsNjIzM10sIm1lbGxvd2RyYWdvbl93YXRlcl8wM19yb2NrZXRfMDEiOlsxMSw2MjUwLDEyLDYyNThdLCJtZWxsb3dkcmFnb25fd2F0ZXJfMDNfYXJtXzAxIjpbMTIsNjI2Nl0sIm1lbGxvd2RyYWdvbl93YXRlcl8wM19nb2dnbGVzXzAxIjpbMTIsNjI3Ml0sImJvbmUyNCI6WzEyLDYyNzhdLCJtZWxsb3dkcmFnb25fd2F0ZXJfMDNfaGFuZF8wMSI6WzExLDYyOTcsMTIsNjMxM10sImJvbmU0MiI6WzEyLDYzNDddLCJtZWxsb3dkcmFnb25fd2F0ZXJfMDNfam95XzAxIjpbMTIsNjM2Nl0sImJvbmUzNCI6WzEyLDY0MDBdLCJib25lMzgiOlsxMiw2NDE2XSwiYm9uZTQ5IjpbMTIsNjQzNSwxMyw2NDQzXSwibWVsbG93ZHJhZ29uX3dhdGVyXzAzX2JvZHlfMDEiOlsxMiw2NDg5XSwiYm9uZTIyIjpbMTIsNjQ5N10sImJvbmUzNSI6WzEyLDY1MTZdLCJib25lMTIiOlsxMiw2NTMyXSwiYm9uZTIzIjpbMTIsNjUzOF0sImJvbmU5IjpbMTIsNjU1N10sImJvbmUzOSI6WzEyLDY1NjhdLCJtZWxsb3dkcmFnb25fd2F0ZXJfMDNfZWZmZWN0X2xpZ2h0MiI6WzExLDY1ODcsMTIsNjY0NSwxMyw2NjU0XSwibWVsbG93ZHJhZ29uX3dhdGVyXzAzX2Vhcl8wMiI6WzEyLDY3MDRdLCJtZWxsb3dkcmFnb25fd2F0ZXJfMDNfcm9ja2V0XzAzXzAzIjpbMTIsNjcxNCwxMyw2NzIyXSwibWVsbG93ZHJhZ29uX3dhdGVyXzAzX2hvcm5fMDEiOlsxMiw2NzY4XSwibWVsbG93ZHJhZ29uX3dhdGVyXzAzX2hlYWRfMDEiOlsxMiw2Nzc0XSwibWVsbG93ZHJhZ29uX3dhdGVyXzAzX3JvY2tldF8wMl8wMSI6WzExLDY3ODIsMTIsNjgzOSwxMyw2ODQ4XSwiYm9uZTIxIjpbMTIsNjg5Nl0sImJvbmU4IjpbMTIsNjkxNV0sImJvbmU0MSI6WzEyLDY5MjddLCJoaXAiOlsxMSw2OTQ2LDEyLDY5NTldLCJsZWdfbCI6WzExLDY5NjcsMTIsNjk4MF0sIm1lbGxvd2RyYWdvbl93YXRlcl8wM19zY2FyZl8wMiI6WzEyLDY5ODhdLCJsZWdfciI6WzExLDY5OTQsMTIsNzAwN10sImJvbmUzIjpbMTEsNzAxNV0sIm1lbGxvd2RyYWdvbl93YXRlcl8wM19ob3JuXzAyIjpbMTIsNzAyOF0sIm1lbGxvd2RyYWdvbl93YXRlcl8wM19yb2NrZXRfMDMiOlsxMSw3MDM0LDEyLDcwNDddLCJib25lNiI6WzEyLDcwNjBdLCJib25lNDAiOlsxMiw3MDcyXSwibWVsbG93ZHJhZ29uX3dhdGVyXzAzX2hhbmRfMDFfMDEiOlsxMSw3MDkxLDEyLDcwOTddLCJtZWxsb3dkcmFnb25fd2F0ZXJfMDNfdGFpbF8wMSI6WzEyLDcxMDNdLCJib25lMjAiOlsxMiw3MTE5XSwibWVsbG93ZHJhZ29uX3dhdGVyXzAzX2FybV8wMiBjb3B5IjpbMTEsNzEzOCwxMiw3MTQ2XSwiYm9uZTE5IjpbMTIsNzE1NV0sImJvbmUzNyI6WzEyLDcxNzRdLCJib25lNSI6WzEyLDcxOTNdLCJtZWxsb3dkcmFnb25fd2F0ZXJfMDNfd2luZ18wMSI6WzEyLDcyMDVdLCJtZWxsb3dkcmFnb25fd2F0ZXJfMDNfZWFyXzAxIjpbMTIsNzIyNF0sIm1lbGxvd2RyYWdvbl93YXRlcl8wM19yb2NrZXRfMDNfMDEiOlsxMiw3MjM0LDEzLDcyNDJdLCJhdHRhY2siOlsxMSw3Mjg4XSwiZWZmZWN0XzAzIjpbMTEsNzI5NSwxMyw3MzAxXSwiZWZmZWN0XzAyIjpbMTEsNzMwNywxMiw3MzE1LDEzLDczMjNdLCJlZmZlY3RfcmVkIjpbMTEsNzMzMSwxMyw3MzM3XSwiZWZmZWN0IjpbMTEsNzM0M10sImJ1dHRvbiI6WzEzLDczNDldLCJhcnJvdyI6WzEzLDc0MTBdLCJlZmZlY3RfYm90dG9tXzEiOlsxMSw3NDIwLDEzLDc0MzBdLCJlZmZlY3RfYm90dG9tXzIiOlsxMSw3NDQwLDEzLDc0NTJdLCJlZmZlY3RfMDQiOlsxMSw3NDY0LDEzLDc0NzBdLCJhcnJvdzIiOlsxMyw3NDc4XSwiYXJyb3czIjpbMTMsNzQ4OF0sImVmZmVjdF8wMSI6WzEzLDc0OThdLCJlZmZlY3RfZG93bl8xIjpbMTEsNzUzNywxMyw3NTQ5XSwiZWZmZWN0X2Rvd25fMiI6WzExLDc1NjEsMTMsNzU3NF0sImVmZmVjdF9saWdodDMiOlsxMyw3NTg3XSwiZWZmZWN0X2xpZ2h0ZHVzdDMiOlsxMSw3NTk1LDEyLDc2MDIsMTMsNzYwOV0sInJvY2tldF8wNF8wNSI6WzExLDc2MTddLCJyb2NrZXRfMDRfMDIiOlsxMSw3NjI1XSwicm9ja2V0XzA0XzAzIjpbMTEsNzYzMywxMiw3NjQxXSwicm9ja2V0XzA0XzA0IjpbMTEsNzY0OSwxMiw3NjU3XSwicm9ja2V0X2xpZ2h0IjpbMTMsNzY2NV0sImxpZ2h0aW5nIjpbMTEsNzY3MSwxMiw3NzExLDEzLDc3NTFdLCJib25lIjpbMTEsNzc5MSwxMiw3ODMzXX0sInNsb3QiOnsiZWZmZWN0XzAxIjpbMjAsNzg0MSwyMSw3ODY4XSwiZWZmZWN0XzAyIjpbMjAsNzkxNywyMSw3OTI1XSwiZWZmZWN0XzAzIjpbMjAsNzkzNCwyMSw3OTQwXSwiZWZmZWN0XzA0IjpbMjAsNzk0NiwyMSw3OTU0XSwiZWZmZWN0XzA1IjpbMjAsNzk2MywyMSw3OTY5XSwiZWZmZWN0XzUiOlsyMCw3OTc3LDIxLDc5ODNdLCJlZmZlY3RfNiI6WzIwLDc5OTEsMjEsNzk5N10sImVmZmVjdF8wNyI6WzIxLDgwMDVdLCJlZmZlY3RfMDRfMDEiOlsyMCw4MDEzLDIxLDgwMjBdLCJlZmZlY3RfYmx1ZSI6WzIxLDgwMjhdLCJlZmZlY3RfZG93bl8xIjpbMjAsODAzNCwyMSw4MDQ1XSwiZWZmZWN0X2Rvd25fMiI6WzIwLDgwNjMsMjEsODA3Nl0sImVmZmVjdF9kb3duXzMiOlsyMCw4MDk3LDIxLDgxMDZdLCJlZmZlY3RfZG93bl80IjpbMjAsODEyMCwyMSw4MTMxXSwiZWZmZWN0X2ZpcmUiOlsyMSw4MTQ5XSwiZWZmZWN0X2xpZ2h0MyI6WzIwLDgxNTUsMjEsODE2Ml0sImVmZmVjdF9saWdodGR1c3QiOlsyMSw4MTcxXSwiZWZmZWN0X2xpZ2h0ZHVzdDIiOlsyMSw4MTc3XSwiZWZmZWN0X2xpZ2h0ZHVzdDMiOlsyMCw4MTgzLDIxLDgxOTFdLCJlZmZlY3RfbGlnaHRpbmciOlsyMCw4MTk5XSwiZWZmZWN0X3JlZCI6WzIwLDgyNDAsMjEsODMxM10sIm1lbGxvd2RyYWdvbl93YXRlcl8wM19lZmZlY3RfMDgiOlsyMCw4MzIzLDIxLDgzMjldLCJtZWxsb3dkcmFnb25fd2F0ZXJfMDNfcm9ja2V0XzAxIjpbMjAsODMzN10sIm1lbGxvd2RyYWdvbl93YXRlcl8wM19yb2NrZXRfMDIiOlsyMCw4MzQ0XSwibWVsbG93ZHJhZ29uX3dhdGVyXzAzX3JvY2tldF8wNCI6WzIwLDgzNTFdLCJtZWxsb3dkcmFnb25fd2F0ZXJfMDNfcm9ja2V0XzAxXzAxIjpbMjAsODM1OF0sIm1lbGxvd2RyYWdvbl93YXRlcl8wM19yb2NrZXRfMDRfMDIiOlsyMSw4MzY1XSwibWVsbG93ZHJhZ29uX3dhdGVyXzAzX3JvY2tldF8wNF8wMyI6WzIxLDgzNzNdLCJtZWxsb3dkcmFnb25fd2F0ZXJfMDNfcm9ja2V0XzA0XzA0IjpbMjEsODM4MV0sIm1lbGxvd2RyYWdvbl93YXRlcl8wM19yb2NrZXRfMDRfMDUiOlsyMSw4Mzg5XSwicm9ja2V0X2xpZ2h0IjpbMjEsODM5N119fSx7ImR1cmF0aW9uIjo2MCwibmFtZSI6InNraWxsX2lkbGUiLCJvZmZzZXQiOls1NjUsODcyMiwyNjY2Nl0sImJvbmUiOnsibWVsbG93ZHJhZ29uX3dhdGVyXzAzX2VmZmVjdF9saWdodCI6WzExLDg0MDUsMTMsODQxOV0sIm1lbGxvd2RyYWdvbl93YXRlcl8wM19yb2NrZXRfMDIiOlsxMSw4NDQzLDEyLDg0NTNdLCJtZWxsb3dkcmFnb25fd2F0ZXJfMDNfcm9ja2V0XzAxXzAzIjpbMTEsODQ2MywxMiw4NDc3LDEzLDg0ODVdLCJtZWxsb3dkcmFnb25fd2F0ZXJfMDNfd2luZ18wMiI6WzEyLDg1MTVdLCJtZWxsb3dkcmFnb25fd2F0ZXJfMDNfcm9ja2V0XzAxIjpbMTEsODUzMSwxMiw4NTQxXSwibWVsbG93ZHJhZ29uX3dhdGVyXzAzX2FybV8wMSI6WzEyLDg1NTFdLCJtZWxsb3dkcmFnb25fd2F0ZXJfMDNfZ29nZ2xlc18wMSI6WzEyLDg1NTddLCJib25lMjQiOlsxMiw4NTYzXSwibWVsbG93ZHJhZ29uX3dhdGVyXzAzX2hhbmRfMDEiOlsxMSw4NTgxLDEyLDg1OTFdLCJib25lNDIiOlsxMiw4NjAxXSwibWVsbG93ZHJhZ29uX3dhdGVyXzAzX2pveV8wMSI6WzEyLDg2MTldLCJib25lMzQiOlsxMiw4NjI5XSwiYm9uZTM4IjpbMTIsODYzNV0sImJvbmU0OSI6WzEyLDg2NTMsMTMsODY2MV0sImJvbmUyMiI6WzEyLDg2OTddLCJib25lMzUiOlsxMiw4NzE1XSwiYm9uZTEyIjpbMTIsODcyMV0sImJvbmUyMyI6WzEyLDg3MjddLCJib25lOSI6WzEyLDg3NDVdLCJib25lMzkiOlsxMiw4NzU3XSwibWVsbG93ZHJhZ29uX3dhdGVyXzAzX2VmZmVjdF9saWdodDIiOlsxMSw4Nzc1LDEyLDg3ODksMTMsODc5N10sIm1lbGxvd2RyYWdvbl93YXRlcl8wM19lYXJfMDIiOlsxMiw4ODI1XSwibWVsbG93ZHJhZ29uX3dhdGVyXzAzX3JvY2tldF8wM18wMyI6WzEyLDg4MzcsMTMsODg0NV0sIm1lbGxvd2RyYWdvbl93YXRlcl8wM19ob3JuXzAxIjpbMTIsODg4MV0sIm1lbGxvd2RyYWdvbl93YXRlcl8wM19oZWFkXzAxIjpbMTIsODg4N10sIm1lbGxvd2RyYWdvbl93YXRlcl8wM19yb2NrZXRfMDJfMDEiOlsxMSw4ODkzLDEyLDg5MDcsMTMsODkxOF0sImJvbmUyMSI6WzEyLDg5NDhdLCJib25lOCI6WzEyLDg5NjZdLCJib25lNDEiOlsxMiw4OTc4XSwiaGlwIjpbMTEsODk5NiwxMiw5MDA2XSwibGVnX2wiOlsxMSw5MDE2LDEyLDkwMjZdLCJtZWxsb3dkcmFnb25fd2F0ZXJfMDNfc2NhcmZfMDIiOlsxMiw5MDMzXSwibGVnX3IiOlsxMSw5MDM5LDEyLDkwNDldLCJib25lMyI6WzExLDkwNTZdLCJtZWxsb3dkcmFnb25fd2F0ZXJfMDNfaG9ybl8wMiI6WzEyLDkwNjZdLCJtZWxsb3dkcmFnb25fd2F0ZXJfMDNfcm9ja2V0XzAzIjpbMTEsOTA3MiwxMiw5MDgyXSwiYm9uZTYiOlsxMiw5MDg5XSwiYm9uZTQwIjpbMTIsOTEwMV0sIm1lbGxvd2RyYWdvbl93YXRlcl8wM19oYW5kXzAxXzAxIjpbMTEsOTExOSwxMiw5MTI1XSwibWVsbG93ZHJhZ29uX3dhdGVyXzAzX3RhaWxfMDEiOlsxMiw5MTMxXSwiYm9uZTIwIjpbMTIsOTEzN10sIm1lbGxvd2RyYWdvbl93YXRlcl8wM19hcm1fMDIgY29weSI6WzEyLDkxNTVdLCJib25lMTkiOlsxMiw5MTYyXSwiYm9uZTM3IjpbMTIsOTE4MF0sImJvbmU1IjpbMTIsOTE5OF0sIm1lbGxvd2RyYWdvbl93YXRlcl8wM193aW5nXzAxIjpbMTIsOTIxMF0sIm1lbGxvd2RyYWdvbl93YXRlcl8wM19lYXJfMDEiOlsxMiw5MjI4XSwibWVsbG93ZHJhZ29uX3dhdGVyXzAzX3JvY2tldF8wM18wMSI6WzEyLDkyNDAsMTMsOTI0OF0sImVmZmVjdF8wMyI6WzExLDkyODQsMTMsOTI5NV0sImVmZmVjdF8wMiI6WzExLDkzMDgsMTMsOTMxNV0sImVmZmVjdF9yZWQiOlsxMSw5MzIzLDEzLDkzMzFdLCJlZmZlY3QiOlsxMSw5MzQxXSwiYnV0dG9uIjpbMTMsOTM0OF0sImFycm93IjpbMTMsOTM2MF0sImVmZmVjdF9ib3R0b21fMSI6WzExLDkzNzIsMTMsOTM4MF0sImVmZmVjdF9ib3R0b21fMiI6WzExLDkzODgsMTMsOTM5OF0sImVmZmVjdF8wNCI6WzExLDk0MDgsMTMsOTQxNl0sImFycm93MiI6WzEzLDk0MjVdLCJhcnJvdzMiOlsxMyw5NDM3XSwiZWZmZWN0X2Rvd25fMSI6WzExLDk0NDYsMTMsOTQ1Nl0sImVmZmVjdF9kb3duXzIiOlsxMSw5NDY2LDEzLDk0ODBdLCJlZmZlY3RfbGlnaHQzIjpbMTMsOTQ5M10sImVmZmVjdF9saWdodGR1c3QzIjpbMTEsOTUwMSwxMiw5NTA4LDEzLDk1MTVdLCJib25lIjpbMTEsOTUyMywxMiw5NTMzXSwibGlnaHRpbmciOlsxMSw5NTQwLDEyLDk1NTUsMTMsOTU3MF0sInJvY2tldF8wNF8wMiI6WzExLDk1ODVdLCJyb2NrZXRfMDRfMDMiOlsxMSw5NTk0LDEyLDk2MDNdLCJyb2NrZXRfMDRfMDQiOlsxMSw5NjEwLDEyLDk2MTldLCJyb2NrZXRfMDRfMDUiOlsxMSw5NjI2XSwicm9ja2V0X2xpZ2h0IjpbMTMsOTYzNV19LCJzbG90Ijp7ImVmZmVjdF8wMSI6WzIxLDk2NDRdLCJlZmZlY3RfMDIiOlsyMCw5NjUxLDIxLDk2NThdLCJlZmZlY3RfMDMiOlsyMCw5NjY4LDIxLDk2NzldLCJlZmZlY3RfMDQiOlsyMCw5Njk0LDIxLDk3MDFdLCJlZmZlY3RfMDUiOlsyMCw5NzExLDIxLDk3MThdLCJlZmZlY3RfNSI6WzIwLDk3MjYsMjEsOTczM10sImVmZmVjdF82IjpbMjAsOTc0MSwyMSw5NzQ4XSwiZWZmZWN0XzA3IjpbMjEsOTc1Nl0sImVmZmVjdF8wNF8wMSI6WzIxLDk3NjRdLCJlZmZlY3RfYmx1ZSI6WzIxLDk3NzJdLCJlZmZlY3RfZG93bl8xIjpbMjAsOTc3OCwyMSw5Nzg3XSwiZWZmZWN0X2Rvd25fMiI6WzIwLDk4MDEsMjEsOTgxMl0sImVmZmVjdF9kb3duXzMiOlsyMCw5ODMwLDIxLDk4MzddLCJlZmZlY3RfZG93bl80IjpbMjAsOTg0OCwyMSw5ODU3XSwiZWZmZWN0X2ZpcmUiOlsyMSw5ODcyXSwiZWZmZWN0X2xpZ2h0MyI6WzIwLDk4NzksMjEsOTg4Nl0sImVmZmVjdF9saWdodGR1c3QiOlsyMSw5ODk1XSwiZWZmZWN0X2xpZ2h0ZHVzdDIiOlsyMSw5OTAyXSwiZWZmZWN0X2xpZ2h0ZHVzdDMiOlsyMCw5OTA5LDIxLDk5MTZdLCJlZmZlY3RfbGlnaHRpbmciOlsyMCw5OTI2LDIxLDk5NDldLCJlZmZlY3RfcmVkIjpbMjAsOTk1NiwyMSw5OTc0XSwibWVsbG93ZHJhZ29uX3dhdGVyXzAzX2VmZmVjdF8wOCI6WzIwLDk5ODcsMjEsOTk5NF0sIm1lbGxvd2RyYWdvbl93YXRlcl8wM19yb2NrZXRfMDEiOlsyMCwxMDAwMl0sIm1lbGxvd2RyYWdvbl93YXRlcl8wM19yb2NrZXRfMDIiOlsyMCwxMDAwOV0sIm1lbGxvd2RyYWdvbl93YXRlcl8wM19yb2NrZXRfMDQiOlsyMSwxMDAxNl0sIm1lbGxvd2RyYWdvbl93YXRlcl8wM19yb2NrZXRfMDFfMDEiOlsyMCwxMDAyM10sIm1lbGxvd2RyYWdvbl93YXRlcl8wM19yb2NrZXRfMDRfMDIiOlsyMSwxMDAzMF0sIm1lbGxvd2RyYWdvbl93YXRlcl8wM19yb2NrZXRfMDRfMDMiOlsyMSwxMDAzN10sIm1lbGxvd2RyYWdvbl93YXRlcl8wM19yb2NrZXRfMDRfMDQiOlsyMSwxMDA0NF0sIm1lbGxvd2RyYWdvbl93YXRlcl8wM19yb2NrZXRfMDRfMDUiOlsyMSwxMDA1MV0sInJvY2tldF9saWdodCI6WzIxLDEwMDU4XX19XSwiZGVmYXVsdEFjdGlvbnMiOlt7Im5hbWUiOiJhdHRhY2sifV0sImFjdGlvbnMiOlt7InR5cGUiOjEwLCJuYW1lIjoiYXR0YWNrIn0seyJ0eXBlIjoxMCwibmFtZSI6ImF0dGFjayJ9XX1dLCJvZmZzZXQiOlswLDEwMTQ0LDEwMTQ0LDM0MjAwLDQ0MzQ0LDEzNjQsNDU3MDgsNDA2ODAsODYzODgsNjEwNjQsMTQ3NDUyLDIwMTMyXSwidGV4dHVyZUF0bGFzIjpbeyJ3aWR0aCI6MTAyNCwiaGVpZ2h0IjoxMDI0LCJuYW1lIjoibWVsbG93ZHJhZ29uX3dhdGVyXzAzIiwiaW1hZ2VQYXRoIjoibWVsbG93ZHJhZ29uX3dhdGVyXzAzX3RleC5wbmciLCJTdWJUZXh0dXJlIjpbeyJ4Ijo2MDgsInkiOjEsIndpZHRoIjoyMzMsImhlaWdodCI6MjYyLCJmcmFtZVgiOi0xNywiZnJhbWVZIjotMSwiZnJhbWVXaWR0aCI6MjY2LCJmcmFtZUhlaWdodCI6Mjk0LCJuYW1lIjoibWVsbG93ZHJhZ29uX3dhdGVyXzAzX3JvY2tldF8wM18wNCJ9LHsieCI6NTQ2LCJ5Ijo1NjIsIndpZHRoIjo0MTEsImhlaWdodCI6MTQ2LCJmcmFtZVkiOi0yNCwiZnJhbWVXaWR0aCI6NDI1LCJmcmFtZUhlaWdodCI6MjE1LCJuYW1lIjoibWVsbG93ZHJhZ29uX3dhdGVyXzAzX3JvY2tldF8wM18wNSJ9LHsieCI6NzY3LCJ5Ijo4NDcsIndpZHRoIjoxMjUsImhlaWdodCI6OTYsImZyYW1lWCI6LTEsImZyYW1lWSI6LTEsImZyYW1lV2lkdGgiOjEyNywiZnJhbWVIZWlnaHQiOjk5LCJuYW1lIjoibWVsbG93ZHJhZ29uX3dhdGVyXzAzX2VmZmVjdF9saWdodGR1c3QifSx7IngiOjg0MywieSI6MSwid2lkdGgiOjEyOCwiaGVpZ2h0IjoxMjgsIm5hbWUiOiJtZWxsb3dkcmFnb25fd2F0ZXJfMDNfZWZmZWN0XzAxIn0seyJ4IjoyOTksInkiOjkyOCwid2lkdGgiOjI1LCJoZWlnaHQiOjYwLCJmcmFtZVgiOi02LCJmcmFtZVkiOi02LCJmcmFtZVdpZHRoIjozNywiZnJhbWVIZWlnaHQiOjczLCJuYW1lIjoibWVsbG93ZHJhZ29uX3dhdGVyXzAzX3JvY2tldF8wM18wMyJ9LHsieCI6OTk2LCJ5Ijo3MzMsIndpZHRoIjoyNiwiaGVpZ2h0Ijo1OSwiZnJhbWVYIjotNiwiZnJhbWVZIjotNywiZnJhbWVXaWR0aCI6MzcsImZyYW1lSGVpZ2h0Ijo3NCwibmFtZSI6Im1lbGxvd2RyYWdvbl93YXRlcl8wM19yb2NrZXRfMDNfMDIifSx7IngiOjk5NiwieSI6NjcyLCJ3aWR0aCI6MjcsImhlaWdodCI6NTksImZyYW1lWCI6LTUsImZyYW1lWSI6LTcsImZyYW1lV2lkdGgiOjM3LCJmcmFtZUhlaWdodCI6NzQsIm5hbWUiOiJtZWxsb3dkcmFnb25fd2F0ZXJfMDNfcm9ja2V0XzAzXzAxIn0seyJ4IjoxLCJ5Ijo2OTksIndpZHRoIjoyNTgsImhlaWdodCI6MTQyLCJmcmFtZVgiOi00LCJmcmFtZVkiOi00LCJmcmFtZVdpZHRoIjoyNjYsImZyYW1lSGVpZ2h0IjoxNTAsIm5hbWUiOiJtZWxsb3dkcmFnb25fd2F0ZXJfMDNfcm9ja2V0XzAzIn0seyJ4IjoxLCJ5Ijo5MjgsIndpZHRoIjo5NiwiaGVpZ2h0Ijo4OCwiZnJhbWVYIjotOCwiZnJhbWVZIjotOCwiZnJhbWVXaWR0aCI6MTA5LCJmcmFtZUhlaWdodCI6MTA0LCJuYW1lIjoibWVsbG93ZHJhZ29uX3dhdGVyXzAzX3JvY2tldF8wMl8wMSJ9LHsieCI6OTU5LCJ5Ijo2MTcsIndpZHRoIjo1NCwiaGVpZ2h0Ijo1MywiZnJhbWVYIjotMzcsImZyYW1lWSI6LTM3LCJmcmFtZVdpZHRoIjoxMjgsImZyYW1lSGVpZ2h0IjoxMjgsIm5hbWUiOiJtZWxsb3dkcmFnb25fd2F0ZXJfMDNfZWZmZWN0X2xpZ2h0In0seyJ4Ijo2MjksInkiOjg0Nywid2lkdGgiOjEzNiwiaGVpZ2h0Ijo5NiwiZnJhbWVYIjotNCwiZnJhbWVZIjotNCwiZnJhbWVXaWR0aCI6MTQ0LCJmcmFtZUhlaWdodCI6MTA0LCJuYW1lIjoibWVsbG93ZHJhZ29uX3dhdGVyXzAzX3JvY2tldF8wMiJ9LHsieCI6NzM0LCJ5Ijo5NDUsIndpZHRoIjoxMDksImhlaWdodCI6NjcsIm5hbWUiOiJtZWxsb3dkcmFnb25fd2F0ZXJfMDNfd2luZ18wMiJ9LHsieCI6MzMwLCJ5Ijo1NjQsIndpZHRoIjoxMzYsImhlaWdodCI6MTMxLCJuYW1lIjoibWVsbG93ZHJhZ29uX3dhdGVyXzAzX3dpbmdfMDEifSx7IngiOjcxNSwieSI6NzEwLCJ3aWR0aCI6NzgsImhlaWdodCI6NjYsIm5hbWUiOiJtZWxsb3dkcmFnb25fd2F0ZXJfMDNfdGFpbF8wMSJ9LHsieCI6OTczLCJ5Ijo3OSwid2lkdGgiOjM3LCJoZWlnaHQiOjIyLCJmcmFtZVgiOi00LCJmcmFtZVkiOi00LCJmcmFtZVdpZHRoIjo0NSwiZnJhbWVIZWlnaHQiOjMwLCJuYW1lIjoibWVsbG93ZHJhZ29uX3dhdGVyXzAzX3NjYXJmXzAyIn0seyJ4Ijo4OTQsInkiOjcxMCwid2lkdGgiOjEwMCwiaGVpZ2h0IjoxMDIsIm5hbWUiOiJtZWxsb3dkcmFnb25fd2F0ZXJfMDNfZWFyXzAyIn0seyJ4Ijo4MDQsInkiOjUzNCwid2lkdGgiOjM1LCJoZWlnaHQiOjI1LCJmcmFtZVgiOi00LCJmcmFtZVkiOi00LCJmcmFtZVdpZHRoIjo0MywiZnJhbWVIZWlnaHQiOjMzLCJuYW1lIjoibWVsbG93ZHJhZ29uX3dhdGVyXzAzX2FybV8wMiJ9LHsieCI6NDY4LCJ5Ijo1NjQsIndpZHRoIjo1NSwiaGVpZ2h0Ijo1MCwibmFtZSI6Im1lbGxvd2RyYWdvbl93YXRlcl8wM19mb290XzAyIn0seyJ4Ijo2MzYsInkiOjcxMCwid2lkdGgiOjc3LCJoZWlnaHQiOjY4LCJuYW1lIjoibWVsbG93ZHJhZ29uX3dhdGVyXzAzX2xlZ18wMiJ9LHsieCI6NTIxLCJ5Ijo4NDcsIndpZHRoIjoxMDYsImhlaWdodCI6MTMwLCJuYW1lIjoibWVsbG93ZHJhZ29uX3dhdGVyXzAzX2JvZHlfMDEifSx7IngiOjg0NSwieSI6OTQ1LCJ3aWR0aCI6NDUsImhlaWdodCI6NDYsImZyYW1lWCI6LTQsImZyYW1lWSI6LTQsImZyYW1lV2lkdGgiOjUzLCJmcmFtZUhlaWdodCI6NTQsIm5hbWUiOiJtZWxsb3dkcmFnb25fd2F0ZXJfMDNfYXJtXzAxIn0seyJ4Ijo5OSwieSI6OTI4LCJ3aWR0aCI6OTQsImhlaWdodCI6NjQsIm5hbWUiOiJtZWxsb3dkcmFnb25fd2F0ZXJfMDNfbGVnXzAxIn0seyJ4Ijo3OTUsInkiOjcxMCwid2lkdGgiOjczLCJoZWlnaHQiOjQ2LCJmcmFtZVgiOi00LCJmcmFtZVkiOi00LCJmcmFtZVdpZHRoIjo4MSwiZnJhbWVIZWlnaHQiOjU0LCJuYW1lIjoibWVsbG93ZHJhZ29uX3dhdGVyXzAzX3NjYXJmXzAxIn0seyJ4Ijo5ODcsInkiOjgxNCwid2lkdGgiOjMzLCJoZWlnaHQiOjg4LCJmcmFtZVgiOi00LCJmcmFtZVkiOi00LCJmcmFtZVdpZHRoIjo0MSwiZnJhbWVIZWlnaHQiOjk3LCJuYW1lIjoibWVsbG93ZHJhZ29uX3dhdGVyXzAzX2hvcm5fMDIifSx7IngiOjUyMSwieSI6NzEwLCJ3aWR0aCI6MTEzLCJoZWlnaHQiOjEzNSwiZnJhbWVYIjotNCwiZnJhbWVZIjotNCwiZnJhbWVXaWR0aCI6MTIxLCJmcmFtZUhlaWdodCI6MTQzLCJuYW1lIjoibWVsbG93ZHJhZ29uX3dhdGVyXzAzX2hlYWRfMDEifSx7IngiOjE5NSwieSI6OTI4LCJ3aWR0aCI6MTAyLCJoZWlnaHQiOjU1LCJmcmFtZVgiOi00LCJmcmFtZVkiOi00LCJmcmFtZVdpZHRoIjoxMTAsImZyYW1lSGVpZ2h0Ijo2MywibmFtZSI6Im1lbGxvd2RyYWdvbl93YXRlcl8wM19qb3lfMDUifSx7IngiOjg3MCwieSI6NzM3LCJ3aWR0aCI6MTksImhlaWdodCI6OSwiZnJhbWVYIjotNCwiZnJhbWVZIjotNCwiZnJhbWVXaWR0aCI6MjcsImZyYW1lSGVpZ2h0IjoxNywibmFtZSI6Im1lbGxvd2RyYWdvbl93YXRlcl8wM19qb3lfMDRfMDEifSx7IngiOjg3MCwieSI6NzQ4LCJ3aWR0aCI6MjAsImhlaWdodCI6NywiZnJhbWVYIjotNCwiZnJhbWVZIjotNCwiZnJhbWVXaWR0aCI6MjgsImZyYW1lSGVpZ2h0IjoxNSwibmFtZSI6Im1lbGxvd2RyYWdvbl93YXRlcl8wM19qb3lfMDQifSx7IngiOjk3MywieSI6MSwid2lkdGgiOjQ1LCJoZWlnaHQiOjM3LCJmcmFtZVgiOi00LCJmcmFtZVkiOi00LCJmcmFtZVdpZHRoIjo1MywiZnJhbWVIZWlnaHQiOjQ1LCJuYW1lIjoibWVsbG93ZHJhZ29uX3dhdGVyXzAzX2hhbmRfMDEifSx7IngiOjk4MCwieSI6MTAxMywid2lkdGgiOjE4LCJoZWlnaHQiOjksImZyYW1lWCI6LTQsImZyYW1lWSI6LTQsImZyYW1lV2lkdGgiOjI2LCJmcmFtZUhlaWdodCI6MTcsIm5hbWUiOiJtZWxsb3dkcmFnb25fd2F0ZXJfMDNfam95XzAzXzAxIn0seyJ4Ijo5NTksInkiOjcwMiwid2lkdGgiOjIwLCJoZWlnaHQiOjYsImZyYW1lWCI6LTQsImZyYW1lWSI6LTQsImZyYW1lV2lkdGgiOjI4LCJmcmFtZUhlaWdodCI6MTQsIm5hbWUiOiJtZWxsb3dkcmFnb25fd2F0ZXJfMDNfam95XzAzIn0seyJ4Ijo5OTYsInkiOjc5NCwid2lkdGgiOjI2LCJoZWlnaHQiOjExLCJmcmFtZVgiOi00LCJmcmFtZVkiOi00LCJmcmFtZVdpZHRoIjozNCwiZnJhbWVIZWlnaHQiOjE5LCJuYW1lIjoibWVsbG93ZHJhZ29uX3dhdGVyXzAzX2pveV8wMiJ9LHsieCI6ODYzLCJ5Ijo3NTgsIndpZHRoIjoyOCwiaGVpZ2h0Ijo0MSwiZnJhbWVYIjotNCwiZnJhbWVZIjotNCwiZnJhbWVXaWR0aCI6MzYsImZyYW1lSGVpZ2h0Ijo0OSwibmFtZSI6Im1lbGxvd2RyYWdvbl93YXRlcl8wM19qb3lfMDEifSx7IngiOjgwNCwieSI6NDIyLCJ3aWR0aCI6MzcsImhlaWdodCI6ODEsImZyYW1lWCI6LTQsImZyYW1lWSI6LTQsImZyYW1lV2lkdGgiOjQ1LCJmcmFtZUhlaWdodCI6ODksIm5hbWUiOiJtZWxsb3dkcmFnb25fd2F0ZXJfMDNfaG9ybl8wMSJ9LHsieCI6NDY4LCJ5Ijo2NTUsIndpZHRoIjo3MCwiaGVpZ2h0IjoyOCwiZnJhbWVYIjotNywiZnJhbWVZIjotMTIsImZyYW1lV2lkdGgiOjgyLCJmcmFtZUhlaWdodCI6NDUsIm5hbWUiOiJtZWxsb3dkcmFnb25fd2F0ZXJfMDNfZXllXzAzIn0seyJ4Ijo3MTUsInkiOjc3OCwid2lkdGgiOjgyLCJoZWlnaHQiOjQ1LCJuYW1lIjoibWVsbG93ZHJhZ29uX3dhdGVyXzAzX2V5ZV8wMSJ9LHsieCI6NDY4LCJ5Ijo2MTYsIndpZHRoIjo3NCwiaGVpZ2h0IjozNywiZnJhbWVYIjotNCwiZnJhbWVZIjotNCwiZnJhbWVXaWR0aCI6ODIsImZyYW1lSGVpZ2h0Ijo0NSwibmFtZSI6Im1lbGxvd2RyYWdvbl93YXRlcl8wM19leWVfMDQifSx7IngiOjc5OSwieSI6ODEyLCJ3aWR0aCI6NjcsImhlaWdodCI6MzIsImZyYW1lWCI6LTExLCJmcmFtZVkiOi04LCJmcmFtZVdpZHRoIjo4MiwiZnJhbWVIZWlnaHQiOjQ1LCJuYW1lIjoibWVsbG93ZHJhZ29uX3dhdGVyXzAzX2V5ZV8wMiJ9LHsieCI6ODQzLCJ5IjoxMzEsIndpZHRoIjoxNDksImhlaWdodCI6MTAyLCJuYW1lIjoibWVsbG93ZHJhZ29uX3dhdGVyXzAzX2Vhcl8wMSJ9LHsieCI6Nzk5LCJ5Ijo3NTgsIndpZHRoIjo2MiwiaGVpZ2h0Ijo1MiwibmFtZSI6Im1lbGxvd2RyYWdvbl93YXRlcl8wM19nbG92ZXNfMDEifSx7IngiOjg5NCwieSI6OTEwLCJ3aWR0aCI6MTI1LCJoZWlnaHQiOjY4LCJmcmFtZVgiOi00LCJmcmFtZVkiOi00LCJmcmFtZVdpZHRoIjoxMzMsImZyYW1lSGVpZ2h0Ijo3NiwibmFtZSI6Im1lbGxvd2RyYWdvbl93YXRlcl8wM19nb2dnbGVzXzAxIn0seyJ4Ijo5ODAsInkiOjk4MCwid2lkdGgiOjM4LCJoZWlnaHQiOjMxLCJmcmFtZVgiOi00LCJmcmFtZVkiOi00LCJmcmFtZVdpZHRoIjo0NiwiZnJhbWVIZWlnaHQiOjM5LCJuYW1lIjoibWVsbG93ZHJhZ29uX3dhdGVyXzAzX2hhbmRfMDFfMDEifSx7IngiOjYyOSwieSI6OTQ1LCJ3aWR0aCI6MTAzLCJoZWlnaHQiOjc1LCJmcmFtZVgiOi04LCJmcmFtZVkiOi03LCJmcmFtZVdpZHRoIjoxMTYsImZyYW1lSGVpZ2h0Ijo4OSwibmFtZSI6Im1lbGxvd2RyYWdvbl93YXRlcl8wM19yb2NrZXRfMDFfMDMifSx7IngiOjk3MywieSI6NDAsIndpZHRoIjo0NSwiaGVpZ2h0IjozNywiZnJhbWVYIjotOCwiZnJhbWVZIjotNCwiZnJhbWVXaWR0aCI6NjIsImZyYW1lSGVpZ2h0Ijo0NSwibmFtZSI6Im1lbGxvd2RyYWdvbl93YXRlcl8wM19yb2NrZXRfMDFfMDIifSx7IngiOjMyNiwieSI6ODI3LCJ3aWR0aCI6MTkzLCJoZWlnaHQiOjEzNiwiZnJhbWVYIjotMywiZnJhbWVZIjotNCwiZnJhbWVXaWR0aCI6MjAxLCJmcmFtZUhlaWdodCI6MTQzLCJuYW1lIjoibWVsbG93ZHJhZ29uX3dhdGVyXzAzX3JvY2tldF8wMSJ9LHsieCI6ODA0LCJ5Ijo1MDUsIndpZHRoIjozNiwiaGVpZ2h0IjoyNywiZnJhbWVYIjotNCwiZnJhbWVZIjotNCwiZnJhbWVXaWR0aCI6NDQsImZyYW1lSGVpZ2h0IjozNSwibmFtZSI6Im1lbGxvd2RyYWdvbl93YXRlcl8wM19yb2NrZXRfMDFfMDEifSx7IngiOjg5MiwieSI6OTgwLCJ3aWR0aCI6NDIsImhlaWdodCI6NDIsImZyYW1lWCI6LTgsImZyYW1lWSI6LTExLCJmcmFtZVdpZHRoIjo1OCwiZnJhbWVIZWlnaHQiOjYzLCJuYW1lIjoibWVsbG93ZHJhZ29uX3dhdGVyXzAzX2VmZmVjdF8wOSJ9LHsieCI6OTM2LCJ5Ijo5ODAsIndpZHRoIjo0MiwiaGVpZ2h0Ijo0MiwiZnJhbWVYIjotOCwiZnJhbWVZIjotMTEsImZyYW1lV2lkdGgiOjU4LCJmcmFtZUhlaWdodCI6NjMsIm5hbWUiOiJtZWxsb3dkcmFnb25fd2F0ZXJfMDNfZWZmZWN0XzA4In0seyJ4Ijo0NzMsInkiOjY4NSwid2lkdGgiOjQyLCJoZWlnaHQiOjIwLCJmcmFtZVgiOi03LCJmcmFtZVkiOi05LCJmcmFtZVdpZHRoIjo0OSwiZnJhbWVIZWlnaHQiOjM1LCJuYW1lIjoibWVsbG93ZHJhZ29uX3dhdGVyXzAzX3JvY2tldF8wNF8wNSJ9LHsieCI6Njk2LCJ5Ijo4MjUsIndpZHRoIjo0NCwiaGVpZ2h0IjoxNSwiZnJhbWVYIjotNCwiZnJhbWVZIjotOSwiZnJhbWVXaWR0aCI6NTEsImZyYW1lSGVpZ2h0IjozMywibmFtZSI6Im1lbGxvd2RyYWdvbl93YXRlcl8wM19yb2NrZXRfMDRfMDQifSx7IngiOjEsInkiOjU2NCwid2lkdGgiOjMyNywiaGVpZ2h0IjoxMzMsImZyYW1lWCI6LTksImZyYW1lWSI6LTgsImZyYW1lV2lkdGgiOjM0NywiZnJhbWVIZWlnaHQiOjE3MCwibmFtZSI6Im1lbGxvd2RyYWdvbl93YXRlcl8wM19yb2NrZXRfMDQifSx7IngiOjg3MCwieSI6NzEwLCJ3aWR0aCI6MjEsImhlaWdodCI6MjUsImZyYW1lWCI6LTE2LCJmcmFtZVkiOi01LCJmcmFtZVdpZHRoIjo0OSwiZnJhbWVIZWlnaHQiOjM1LCJuYW1lIjoibWVsbG93ZHJhZ29uX3dhdGVyXzAzX3JvY2tldF8wNF8wNiJ9LHsieCI6ODY4LCJ5Ijo4MDEsIndpZHRoIjoyMywiaGVpZ2h0Ijo0MCwiZnJhbWVYIjotMTcsImZyYW1lWSI6LTE0LCJmcmFtZVdpZHRoIjo1OCwiZnJhbWVIZWlnaHQiOjczLCJuYW1lIjoibWVsbG93ZHJhZ29uX3dhdGVyXzAzX3JvY2tldF8wNF8wMSJ9LHsieCI6ODQ1LCJ5Ijo5OTMsIndpZHRoIjo0MSwiaGVpZ2h0IjoyNywiZnJhbWVYIjotNCwiZnJhbWVZIjotOSwiZnJhbWVXaWR0aCI6NTAsImZyYW1lSGVpZ2h0Ijo0MywibmFtZSI6Im1lbGxvd2RyYWdvbl93YXRlcl8wM19yb2NrZXRfMDRfMDMifSx7IngiOjk3MywieSI6MTAzLCJ3aWR0aCI6NDUsImhlaWdodCI6MTUsImZyYW1lWCI6LTIsImZyYW1lWSI6LTMsImZyYW1lV2lkdGgiOjUyLCJmcmFtZUhlaWdodCI6MjIsIm5hbWUiOiJtZWxsb3dkcmFnb25fd2F0ZXJfMDNfcm9ja2V0XzA0XzAyIn0seyJ4IjoxLCJ5IjoxLCJ3aWR0aCI6NjA1LCJoZWlnaHQiOjMwMSwiZnJhbWVYIjotMiwiZnJhbWVZIjotNSwiZnJhbWVXaWR0aCI6Nzc2LCJmcmFtZUhlaWdodCI6MzA4LCJuYW1lIjoibWVsbG93ZHJhZ29uX3dhdGVyXzAzX3JvY2tldF8wNF8wOCJ9LHsieCI6MSwieSI6MzA0LCJ3aWR0aCI6NTQzLCJoZWlnaHQiOjI1OCwiZnJhbWVYIjotMTUsImZyYW1lWSI6LTI3LCJmcmFtZVdpZHRoIjo2MDksImZyYW1lSGVpZ2h0IjozMDgsIm5hbWUiOiJtZWxsb3dkcmFnb25fd2F0ZXJfMDNfcm9ja2V0XzA0XzA3In0seyJ4Ijo1NDYsInkiOjMwNCwid2lkdGgiOjI1NiwiaGVpZ2h0IjoyNTYsIm5hbWUiOiJtZWxsb3dkcmFnb25fd2F0ZXJfMDNfZWZmZWN0XzAyIn0seyJ4Ijo4NDMsInkiOjQyMiwid2lkdGgiOjE0NSwiaGVpZ2h0IjoxMzUsImZyYW1lWCI6LTQsImZyYW1lWSI6LTYsImZyYW1lV2lkdGgiOjE1NywiZnJhbWVIZWlnaHQiOjE1NCwibmFtZSI6Im1lbGxvd2RyYWdvbl93YXRlcl8wM19lZmZlY3RfMDMifSx7IngiOjgwNCwieSI6MjY1LCJ3aWR0aCI6MTQ5LCJoZWlnaHQiOjE1NSwibmFtZSI6Im1lbGxvd2RyYWdvbl93YXRlcl8wM19lZmZlY3RfMDQifSx7IngiOjk1OSwieSI6NjcyLCJ3aWR0aCI6MzUsImhlaWdodCI6MjgsImZyYW1lWCI6LTEyLCJmcmFtZVkiOi0xOCwiZnJhbWVXaWR0aCI6NTgsImZyYW1lSGVpZ2h0Ijo2MywibmFtZSI6Im1lbGxvd2RyYWdvbl93YXRlcl8wM19lZmZlY3RfMDUifSx7IngiOjYzNiwieSI6NzgwLCJ3aWR0aCI6NTgsImhlaWdodCI6NTksImZyYW1lWSI6LTIsImZyYW1lV2lkdGgiOjU4LCJmcmFtZUhlaWdodCI6NjMsIm5hbWUiOiJtZWxsb3dkcmFnb25fd2F0ZXJfMDNfZWZmZWN0XzA2In0seyJ4IjoyNjEsInkiOjY5OSwid2lkdGgiOjIxMCwiaGVpZ2h0IjoxMjYsIm5hbWUiOiJtZWxsb3dkcmFnb25fd2F0ZXJfMDNfZWZmZWN0X2ZpcmUifSx7IngiOjg5NCwieSI6ODE0LCJ3aWR0aCI6OTEsImhlaWdodCI6OTQsIm5hbWUiOiJtZWxsb3dkcmFnb25fd2F0ZXJfMDNfZWZmZWN0X3JlZCJ9LHsieCI6OTU5LCJ5Ijo1NTksIndpZHRoIjo1NiwiaGVpZ2h0Ijo1NiwiZnJhbWVYIjotMSwiZnJhbWVZIjotNCwiZnJhbWVXaWR0aCI6NTgsImZyYW1lSGVpZ2h0Ijo2MywibmFtZSI6Im1lbGxvd2RyYWdvbl93YXRlcl8wM19lZmZlY3RfMDcifSx7IngiOjEsInkiOjg0Mywid2lkdGgiOjMyMywiaGVpZ2h0Ijo4MywiZnJhbWVYIjotMywiZnJhbWVZIjotMywiZnJhbWVXaWR0aCI6MzI4LCJmcmFtZUhlaWdodCI6ODcsIm5hbWUiOiJtZWxsb3dkcmFnb25fd2F0ZXJfMDNfZWZmZWN0X2JsdWUifV19XX0gIGkAAAAAAAQAAwCkAUEAUQBZAAEAAAABAAAAAQAAAAEAAAABAAAAAQAAAAEAAAACAAAAAQACAAAAAQACAAAAAQACAAAAAQACAAAAAQACAAAAAQACAAAAAQACAAAAAQACAAAAAQACAAAAAQACAAAAAQACAAAAAQADAAAAAQACAAMAAAABAAIAAwAAAAEAAgADAAAAAQACAAMAAAABAAIAAgABAAIAAgABAAIAAgABAAIAAgABAAIAAgABAAIAAgABAAIAAgABAAIAAgABAAIAAgABAAIAAgABAAIAAgABAAIAAgABAAIAAQACAAEAAgABAAIAAQACAAEAAgABAAIAAQACAAEAAgABAAIAAQACAAEAAgABAAIAAQACAAEAAgABAAIAAQACAAEAAgABAAIAAQACAAEAAgABAAIAAQACAAEAAgACAAEAAgACAAEAAgACAAEAAgACAAEAAgACAAEAAgACAAEAAgADAAAAAQACAAMAAAABAAIAAwAAAAEAAgADAAAAAQACAAMAAAABAAIAAwAAAAEAAgADAAAAAQACAAMAAAABAAIAAwAAAAEAAgADAAAAAQACAAMAAAABAAIAAgAAAAEAAgAAAAEAAgAAAAEAAgAAAAEAAgAAAAEAAgAAAAEAAgAAAAEAAgAAAAEAAgAAAAEAAQAAAAEAAAABAAAAAgABAAIAAgABAAIAAgABAAIAAgABAAIAAQACAAEAAgABAAIAAQACAAEAAAABAAAAAQAAAAIAAAABAAEAAQACAAEAAgABAAIAAQACAAEAAgCKAJsAxgP9AkoASQBDAEoAQwBCAEsASgBCAEgARwBEAEMASQBEAEkASABEAEYARQBEAEcARgBEAEEASwBCAIEATABBAEwASwBBAIEAQQBAAD8AgQBAAD4AgQA/AD0AgAA+AIAAgQA+AE0ATACBADwAgAA9AIAATwCBADsAgAA8ADoAgAA7AFAATwCAAH8AgAA6AH8AOgA5AE8ATgCBAE4ATQCBADgAfwA5ADcAfwA4ADYAfwA3AH8AUwCAAFMAUgCAAFEAUACAADUAfwA2AH4AfwA1AFIAUQCAADQAfgA1AFcAVgB+ADMAfgA0AH4AVgB/AFYAVQB/AFUAVAB/AFQAUwB/ADIAfgAzADEAfgAyAFgAVwB+ADAAfgAxAC8AfQAwAH0AfgAwAIYAWAB+AH0AhgB+AC4AfQAvAC0AfQAuAIYAWQBYAHwAfQAsACwAfQAtAHwAhgB9ACsAfAAsACoAfAArAFoAWQCGAIcAhgB8ACkAfAAqACgAfAApAFsAWgCGACgAewB8ACcAewAoAHsAhwB8AIUAXABbAIUAWwCGAIQAhQCGAIcAhACGACYAewAnACUAewAmAHsAgwCHACQAewAlACMAewAkAIIAewAjAIMAhACHAIUAXQBcACIAggAjAHoAggAiAIIAgwB7ACEAegAiAIUAXgBdAIUAZgBeACAAegAhAGYAZQBeAF4AZQBfAGUAYABfAGcAZgCFAIgAhQCEAIMAiQCEAB8AegAgAGQAYQBgAGUAZABgAGQAYgBhAIgAaQCFAIIAeQCDAHkAiQCDAIkAiACEABoAegAeAGkAaACFAGgAZwCFAB4AegAfAGQAYwBiABkAGAB6ABoAGQB6ABwAGwAdABsAGgAdAB0AGgAeAHoAeQCCABcAFgB6ABYAeQB6ABgAFwB6AIgAagBpAHgAiQB5ABUAeQAWABUAFAB5AGsAagCIABQAEwB5ABMAEgB5ABIAeAB5AHgAiACJABIAEQB4AHgAdwCIAHcAbgCIAGwAawCIABEAEAB4AG4AbQCIABAADwB4AG0AbACIAA8AdwB4AA4AdwAPAHEAcAB3AG8AbgB3AHAAbwB3AA0AdwAOAHIAcQB3AAwAdwANAHYAcgB3AAsAdwAMAAsACgB3AAoAdgB3AAkAdgAKAHMAcgB2AAgAdgAJAAAAcwB2AAYABAB2AAYAdgAHAAcAdgAIAAAAdABzAAUABAAGAAEAAAB2AAQAAwB2AAMAAgB2AAIAAQB2AAcA7gU6AFwAPABLAFUAVABbAAIAAAABAAIAAAABAAIAAAABAAEAAAABAAAAAQAAAAEAAAABAAAAAQAAAAIAAAACAAIAAAACAAIAAAACAAIAAAACAAIAAAACAAIAAAACAAIAAAACAAMAAAACAAMAAwAAAAIAAwADAAAAAgADAAMAAAACAAMAAwAAAAIAAwADAAAAAgADAAMAAAACAAMAAwAAAAIAAwADAAAAAgADAAIAAgADAAIAAgADAAIAAgADAAIAAgADAAIAAgADAAIAAgADAAMAAgADAAQAAwACAAMABAADAAIAAwAEAAMAAgADAAQAAwACAAMABAADAAIAAwAEAAIAAgADAAEAAwABAAMAAQADAAIAAwAFAAIAAwAFAAIAAwAFAAIAAwAFAAIAAwAFAAIAAwAFAAIAAwAFAAIAAwAFAAIAAwAFAAMAAwAFAAYAAwADAAUABgACAAUABgACAAUABgADAAMABQAGAAMAAwAFAAYAAgAFAAYAAgAFAAYAAgAFAAYAAgAFAAYAAgAFAAYAAgAFAAYAAQAGAAEABgABAAYAAQAGAAEABgABAAYAAQAGAAEABgABAAYAAQAGAAEABgABAAYAAQAGAAEABgABAAYAAQAGAAMABQAGAAEAAwAFAAYAAQADAAUABgABAAMABQAGAAEAAwAFAAYAAQADAAUABgABAAMABQAGAAEAAwAFAAYAAQADAAUABgABAAQAAwAFAAYAAQAEAAMABQAGAAEABQADAAUABgAEAAEABQADAAUABgAEAAEABQADAAUABgAEAAEABAADAAUABgABAAQAAwAFAAYAAQADAAMABQABAAIABQABAAIABQABAAEAAQABAAEAAgAAAAEAAwAAAAQAAQAEAAAAAgAEAAEABAAAAAIABAABAAQAAAACAAQAAQAEAAAAAgAEAAEABAAAAAIABAABAAQAAAACAAQAAQAEAAAAAgAEAAEABAAAAAIABAABAAQAAAACAAQAAQAEAAAAAgAEAAEABAAAAAIABAABAAMAAAAEAAEAAwAAAAQAAQADAAAABAABAAMAAAAEAAEAAgAAAAEAAgADAAUAAQAAAAMAAAAEAAEAAgAAAAIAAQACAAIAAgADAAIAAwAEAAEAAwACAAMABQABAAUAAgAFAAYAAQAGAAEABgABAAQAAQAEAAIABAABAAEAAQAEAAMABQAEAAEABAADAAUABAABAAQAAAACAAQAAQAEAAAAAgAEAAEAGQAXALQJGwUFAAQABgADAAgABwAEAAMABwAGAAQABwAMAAsAAwALAAkACAADAAsACAACAAwAAwALAAoACQACABAADAARABAAAQABABAAAgAOAA0ADAAPAA4ADAAQAA8ADAAAABEAAQAVABQAEgAYABUAAAAVABIAAAASABEAAAAUABMAEgAWABUAGAAXABYAGAAEABgKTQBSAFMAQwACAAAAAQACAAAAAQADAAAAAQACAAIAAAACAAIAAAACAAIAAAACAAIAAAACAAEAAgACAAMAAgACAAMAAgADAAMAAAACAAMAAwAAAAIAAwADAAAAAgADAAMAAAACAAIAAwACAAIAAwABAAMAAwAAAAEAAwADAAAAAQADAAMAAAABAAIAAwABAAIAAwABAAEAAQABAAEAAQABAAIAAAABAGUAcwC6Cs0GVQAPAA4AVQARABAADwBVABAADQBVAA4AVQASABEADABVAA0AVQATABIACwBWAFUACwBVAAwAVQAUABMAVQAVABQAGAAWABUAGAAVAFUAVgAYAFUACgBWAAsACQBWAAoAGAAXABYAGQAYAFYACABWAAkACABXAFYABwBXAAgAGgAZAFYAVwAaAFYAXQAaAFcABgBXAAcAXQAbABoAXABdAFcABQBYAAYAWABXAAYABABYAAUAAwBaAAQAWgBYAAQAWABbAFcAAgBZAAMAWQBaAAMAWwBcAFcAAQBZAAIAAABZAAEAXQAcABsAWgBbAFgAVABZAAAAUwBZAFQAXQBeABwAUgBaAFkAUwBSAFkAUgBRAFoAUQBfAFoAXwBbAFoAXgAdABwAUABfAFEATwBfAFAAXgAeAB0AXwBgAFsAYABcAFsAXgAkAB4AJAAjAB8ATgBNAF8ATQBgAF8ATgBfAE8AJAAfAB4AIwAgAB8AYQBdAFwAYABhAFwAYQApAF0ATABgAE0AJQAkAF4AIgAhACAAIwAiACAAKQAoAF0AKAAnAF0AJwBeAF0AJwAmAF4AJgAlAF4ASwBgAEwAYQAqACkASABhAGAASwBKAGAASQBIAGAASgBJAGAAYQBiACoAYgArACoASABHAGEAYgAsACsARABiAGEARwBGAGEARQBEAGEARgBFAGEAQwBiAEQAYgAtACwAYgBjAC0AYwAuAC0AQABjAGIAQgBiAEMAYwAvAC4AQQBAAGIAQgBBAGIAPwBjAEAAYwBkADAAYwAwAC8APABkAD0APQBkAGMAZAAxADAAPwA+AGMAPgA9AGMAZAAyADEAZAAzADIAOQA0AGQAOgA5AGQAPAA7AGQAZAA0ADMAOQA1ADQAOwA6AGQAOQA4ADUANwA2ADUAOAA3ADUABwBODEAATwBXADsAXgBWAF0AAgAAAAEAAgAAAAEAAgAAAAEAAwAAAAEAAgADAAMAAAABAAMAAwAAAAEAAgADAAAAAgADAAAAAgADAAAAAgADAAAAAgADAAAAAgADAAAAAgADAAAAAgADAAAAAQADAAEAAwABAAMAAgADAAQAAgADAAQAAgADAAQAAgADAAQAAgADAAQAAgADAAQAAgADAAQAAgADAAQAAgADAAQAAwADAAAABAADAAMAAAAEAAIAAwAEAAIAAwAEAAIAAwAEAAIAAwAEAAIAAwAEAAIAAwAEAAEABAAEAAMABQAGAAQABAADAAUABgAEAAMABQAGAAQAAwAFAAYABAADAAUABgAEAAMABQAGAAQABAAFAAYAAgAEAAMABQAGAAQAAwAFAAYABAADAAUABgAEAAMABQAGAAQAAwAFAAYABAADAAUABgAEAAMABQAGAAQAAgAGAAQAAgAGAAQAAQAGAAEABgABAAYAAQAGAAEABgABAAYAAQAGAAEABgABAAYAAQAGAAEABgABAAYAAgAFAAYAAgAFAAYAAgAFAAYAAgAFAAYAAgAFAAYAAgAFAAYAAQAFAAEABQABAAUAAgABAAUAAgABAAUAAgABAAUAAgABAAUAAgABAAUAAgABAAUAAwAAAAEABQACAAAAAQACAAAAAQACAAAAAQACAAAAAQACAAAAAQACAAAAAQABAAMAAQADAAIAAwAAAAEAAAACAAAAAQABAAIAAQACAAIAAgAEAAMABQAGAAQAAQAEAAIAAQACAAIAAQAFAAEABQACAAUABgACAAYABAABAAYALwAyAKMOnAgqAAYABQAqAAUABAADACoABAAqAAcABgAqAAgABwACACoAAwAKAAkACAAuAAoACAAqAC4ACAABACoAAgArAC4AKgAuAAwACwAuAAsACgAAACoAAQApACoAAAAoACoAKQAuAA0ADAAuAA4ADQAnACYAKgAoACcAKgArAC0ALgAmACUAKgAlACsAKgAuAA8ADgAkACsAJQAuABAADwAkACMAKwASABEALgAtABIALgARABAALgAjACIAKwAtABMAEgAiACEAKwAsAC0AKwAhACwAKwAhACAALAAUABMALQAVABQALQAWABUALQAYABcALQAXABYALQAZABgALQAaABkALQAsABoALQAgAB8ALAAbABoALAAeAB0ALAAdABwALAAfAB4ALAAcABsALAADAF8PJAA+ADcAAgAAAAEAAgAAAAEAAgAAAAEAAgAAAAEAAgAAAAEAAgAAAAEAAgAAAAEAAgAAAAEAAgAAAAEAAgAAAAEAAgAAAAEAAgAAAAEAAgAAAAEAAgAAAAEAAgAAAAEAAgACAAEAAgACAAEAAgACAAEAAgACAAEAAgACAAEAAQACAAEAAgABAAIAAgAAAAIAAgAAAAIAAgAAAAIAAgAAAAIAAgAAAAIAAgAAAAIAAgAAAAIAAgAAAAIAAgAAAAIAAgAAAAIAAQAAAAEAAAABAAAAAQAAAAEAAAABAAAAAQAAAAEAAAACAAAAAQADAAAAAgABAAMAAAACAAEAAgAAAAIAAQACAAIAAgABADMAOQBbENMJJgArACcACwANAAwAMAAPAA4ADQALAA4ACwAwAA4AMAAQAA8AMQARABAAMAAxABAACgAvAAsALwAwAAsAMQASABEACQAuAAoALgAvAAoAMQAyABIAMgATABIALgAJAAgABwAuAAgABgAuAAcABQAtAAYALQAuAAYAMgAUABMALwAZADAAGAAyADEAMAAZADEAGQAYADEABAAtAAUAAwAtAAQAMgAVABQALgAbAC8AGwAaAC8AGgAZAC8AFgAVADIAFwAWADIAGAAXADIAAgAtAAMAHAAbAC4ALQAcAC4AHQAcAC0AAQAtAAIAHgAdAC0AAAAtAAEAHwAeAC0ALAAtAAAAKgAsAAAAJgAhACwALAAhAC0AIQAgAC0AIAAfAC0AKwAmACwAJgAiACEAKQAsACoAJQAiACYAKAAnACwAJwArACwAKQAoACwAJAAiACUAJAAjACIAAwAnETcAPgBOAAEAAAABAAAAAQAAAAIAAAABAAIAAAABAAIAAAABAAIAAAABAAIAAAABAAIAAAABAAMAAAABAAIAAwAAAAEAAgADAAAAAQACAAMAAAABAAIAAgABAAIAAgABAAIAAgABAAIAAgABAAIAAgABAAIAAQACAAEAAgABAAIAAQACAAMAAAABAAIAAwAAAAEAAgADAAAAAQACAAMAAAABAAIAAwAAAAEAAgADAAAAAQACAAMAAAABAAIAAwAAAAEAAgADAAAAAQACAAMAAAABAAIAAwAAAAEAAgADAAAAAQACAAIAAAABAAEAAAABAAAAAQAAAAEAAAABAAAAAQAAAAEAAAABAAAAAQAAAAEAAAABAAAAAgAAAAEAAQABAAIAAQACAAEAAgABAAIANgA9AEoSJwstAAYABQABAAAAAgAAAC4AAgAuAAMAAgAsAC4AAAArAC4ALAAuAAQAAwAuAC8ABQAuAAUABAAqAC4AKwAvAC0ABQAvAAYALQApAC4AKgAvADAACAAvAAgABwAvAAcABgAwAAkACAAoACcALgAnAC8ALgApACgALgAmAC8AJwAwAAoACQAwAAsACgAlAC8AJgAwADEACwAlACQALwAkACMALwAjADAALwAiADAAIwAxAAwACwAxADIADgAxAA4ADQAiACEAMAAxAA0ADAAhACAAMAAyAA8ADgAfADEAMAAgAB8AMAAfAB4AMQAeAB0AMQAyABAADwAcADIAMQAdABwAMQAyADMAEAAzABEAEAAcABsAMgAbABoAMwAzADQAEQA0ABIAEQAbADMAMgAaADQAMwAaABkANAAZADUANAA0ADUAEgA1ABMAEgAZABgANQAYABcANQAVABQANQA1ABQAEwAXABYANQAWABUANQAEACITIwBMADIAPQABAAAAAQAAAAIAAAACAAIAAAACAAIAAAACAAIAAAACAAIAAAACAAIAAAACAAMAAAACAAMAAwAAAAIAAwADAAAAAgADAAMAAAACAAMAAwAAAAIAAwADAAAAAgADAAMAAAACAAMABAAAAAIAAwABAAQAAAACAAMAAQADAAIAAwABAAIAAwABAAMAAgADAAEAAgADAAEAAQABAAEAAQACAAMAAQADAAIAAwABAAMAAgADAAEAAwACAAMAAQADAAIAAwABAAMAAgADAAEABAAAAAIAAwABAAMAAAACAAMABAAAAAIAAwABAAQAAAACAAMAAQAEAAAAAgADAAEABAAAAAIAAwABAAMAAAACAAMAAwAAAAIAAwACAAAAAwABAAAAAQAAAAEAAAABAAAAAQAAAAEAAAABAAAAAgAAAAIAAQAAAAEAAAACAAAAAgABAAIAAgACAAMAAQADAAIAAwABAAEAAQB3AJEAkxSVDWwAVABTAGsAUgBRAGIASQBIAGAARwBGAF8AYABGAFwAQgBBAFsAQAA/ADEAdgAyADIAdgAzAHYANQAzADMANQA0AHYANgA1ADAAdgAxAHYANwA2AC8AdgAwAC4AdgAvAC0AdQB2AHYAOAA3AC0AdgAuAHYAOQA4AF0ARQBEACwAdQAtADsAOgB2AHUAOwB2ADoAOQB2AHUAPAA7ACsAdQAsAHUAPQA8ACoAdQArAD4APQB1AHQAdQApACkAdQAqAFsAPwB1AD8APgB1ACgAdAApACcAdAAoAFwAQQB1AHQAXAB1AEEAQAB1AEAAWwB1AGEAYgBIAF4AXwBGAHQAQgBcACYAdAAnAEMAQgB0AHMAdAAlACUAdAAmAEQAQwB0ACQAcwAlAGMASgBJAF0ARAB0AEYARQB0AEUAXQB0ACMAcwAkACIAcwAjAF4ARgB0AHMAYAB0AGAAXwB0AF8AXgB0AEcAYABzACEAcwAiAGEASABzAEgARwBzAGIAYQBzACAAcgAhAHIAcwAhAEkAYgBzAGMASQBzAB8AcgAgAEoAYwBzAB4AcgAfAHIAHgAdAEsAZABzAEwASwBzAHIAZQBzAGUATABzAGQASgBzABwAcgAdABsAcQAcAHEAcgAcAE0AZQByABoAcQAbAE4ATQByABkAcQAaAGYATgByABgAcQAZAE8AZgByABcAcQAYAGYATwBOAGQASwBKAFAATwByAGcAUAByABYAcQAXAGUATQBMAGgAZwByABUAcAAWAHAAcQAWAFUAVABxAHEAVAByAFQAbAByAGkAaAByAGcAUQBQAFMAUgByAGwAUwByAFIAawByAGsAagByAGoAaQByABQAcAAVAFYAVQBxABMAcAAUAG0AVgBxAGgAUQBnABIAcAATAG4AbQBxAAIAAQBwABEAcAASAHAAAQBxAAEAAABxAG8AbgBxAFkAWABxAFoAWQBxAAAAWgBxAFgAVwBxAFcAbwBxAGoAawBRAAUABABwAAQAAgBwABAAcAARAA8AcAAQAAYABQBwAA4ADQBwAA0ADABwAAcABgBwAA8ADgBwAAgABwBwAAwACwBwAAoACQBwAAkACABwAAsACgBwAAMAAgAEAGgAagBRAGkAagBoAG4AVwBWAG0AbgBWAFcAbgBvAAMAbxZCAFAAWAACAAAAAQACAAAAAQABAAAAAQAAAAEAAAABAAAAAQAAAAEAAAABAAAAAQAAAAEAAAABAAAAAQAAAAEAAAABAAAAAQAAAAEAAAABAAAAAQAAAAEAAAABAAAAAQAAAAEAAAABAAAAAgAAAAEAAgAAAAEAAgAAAAEAAgAAAAEAAgAAAAEAAgAAAAEAAgAAAAEAAwAAAAEAAgADAAAAAQACAAMAAAABAAIAAwAAAAEAAgADAAAAAQACAAMAAAABAAIAAwAAAAEAAgADAAAAAQACAAMAAAABAAIAAgABAAIAAgABAAIAAgABAAIAAgABAAIAAgABAAIAAgABAAIAAgABAAIAAgABAAIAAQACAAEAAgABAAIAAQACAAEAAgABAAIAAQACAAEAAgABAAIAAQACAAIAAQACAAIAAQACAAIAAQACAAIAAQACAAIAAQACAAIAAQACAAIAAQACAAIAAQACAAIAAQACAAIAAQACAAIAAQACAAIAAQACAAMAAAABAAIAAwAAAAEAAgADAAAAAQACAAMAAAABAAIAAwAAAAEAAgADAAAAAQACAAMAAAABAAIAAwAAAAEAAgADAAAAAQACAAMAAAABAAIAAwAAAAEAAgACAAAAAQACAAAAAQACAAAAAQACAAAAAQACAAAAAQACAAAAAQACAAAAAQACAAAAAQACAAAAAQACAAAAAQACAAEAAgACAAEAAgACAAEAAgADAAAAAQACAAMAAAABAAIAAwAAAAEAAgADAAAAAQACAAMAAAABAAIAAwAAAAEAAgADAAAAAQACAAMAAAABAAIAAwAAAAEAAgADAAAAAQACAAIAAAABAAIAAAABAAIAAAABAAIAAAABAAIAAAABAAIAAAABAAIAAAABAAIAAAABAAEAAAABAAAAAgAAAAEAAQABAAIAAQACAAEAAgABAAIAWgBmACQZLhBOABgAFwBPABQAEwBQAE8AEwAKAFQACwAHAAYACQBUAAoACQAGAFQACQAIAAcACQARABMAEgBUAAwACwBUAA0ADABTAFAAEwARAFMAEwBTAA8ADgAQAFMAEQBTAA4ADQBUAFMADQBWAE8AUABTAFYAUABWABQATwBTABAADwBTAFIAVgAFAFQABgBWABUAFABWABYAFQBNACQAIwBWABcAFgAEAFQABQBWAE4AFwADAFQABABWABgATgACAFUAAwBVAFQAAwBKAAAASwAAAFUAAQBVAAIAAQBKAFUAAABWABkAGABEAFMAVABWABoAGQBGAFQAVQBHAEYAVQBKAEgAVQBIAEcAVQBEAEMAUwBWAFkAGwBWABsAGgBFAEQAVABGAEUAVABJAEgASgBCAEEAUwBDAEIAUwBZABwAGwBBAEAAUwBZAB0AHABSAFkAVgBAAD8AUwBZAB8AHgA7AFIAUwA8ADsAUwA9ADwAUwA+AD0AUwA/AD4AUwBZAB4AHQA7AFcAUgBZACAAHwAhACAAWQAiACEAWQBSAFgAWQBXAFgAUgAjACIAWQAkAE0AWQBYACQAWQBNACMAWQBYACUAJABYACYAJQBYACcAJgA6AFcAOwA5AFcAOgAoACcAWAA4AFcAOQApACgAWAA4ADcAVwAqACkAWAArACoAWABMACsAWAAvAC4AVwA3ADYAVwBXAC4AWAAuAFEAWAAsAEwAWAAtACwAWABRAC0AWAAwAC8AVwAxADAAVwA2ADUAVwA1ADQAVwAzADIAVwAyADEAVwA0ADMAVwBMACwAKwBRAC4ALQAFAIwaOAAeACMAJAAKAAEAAAABAAAAAgABAAAAAgABAAAAAgABAAAAAgABAAAAAwABAAAAAgADAAEAAAACAAMAAQAAAAIAAwABAAAAAgADAAEAAAACAAMAAQAAAAIAAwABAAAAAgADAAEAAAACAAMAAQAAAAIAAwABAAAAAgACAAEAAgACAAEAAgACAAEAAgACAAEAAgACAAEAAgACAAEAAgACAAEAAgACAAEAAgABAAIAAQACAAEAAgABAAIAAQACAAEAAgABAAIAAQACAAEAAgABAAIAAQACAAEAAgACAAIAAwADAAQAAgADAAMABAACAAMAAwAEAAIAAwADAAQAAgADAAMABAACAAMAAwAEAAIAAwADAAQAAgADAAMABAACAAMAAwAEAAIAAwADAAQAAgADAAMABAACAAMAAwAEAAIAAwACAAIAAwABAAMAAgABAAMAAgABAAMAAgABAAMAAwAEAAEAAwAEAAQAAQAAAAMABAAEAAEAAAADAAQABAABAAAAAwAEAAQAAQAAAAMABAAEAAEAAAADAAQABAABAAAAAwAEAAQAAQAAAAMABAAEAAEAAAADAAQABAABAAAAAwAEAAQAAQAAAAMABAAEAAEAAAADAAQABAABAAAAAwADAAEAAAADAAMAAQAAAAMAAwABAAAAAwADAAEAAAADAAMAAQAAAAMAAwABAAAAAwADAAEAAAADAAMAAQAAAAMAAQAAAAMABAACAAMAAgACAAMAAgABAAIAAgABAAIAAgABAAIAAwAEAAIAAwABAAQAAQABAAIAAQAAAAEAAAABAAIAAQADAAMABAACAAMAAQACAEQAAAAUHWsRAwAkHisAMwA/AAIAAAABAAIAAAABAAIAAAABAAIAAAABAAIAAAABAAMAAAABAAIAAwAAAAEAAgADAAAAAQACAAMAAAABAAIAAwAAAAEAAgADAAAAAQACAAMAAAABAAIAAwAAAAEAAgACAAEAAgACAAEAAgABAAIAAQACAAEAAgABAAIAAQACAAEAAgABAAIAAQACAAIAAQACAAIAAQACAAIAAQACAAIAAQACAAIAAQACAAIAAQACAAMAAAABAAIAAwAAAAEAAgADAAAAAQACAAMAAAABAAIAAwAAAAEAAgADAAAAAQACAAMAAAABAAIAAwAAAAEAAgADAAAAAQACAAIAAAABAAIAAAABAAIAAAABAAIAAAABAAIAAAABAAIAAAABAAIAAAABAAIAAAABAAIAAAABAAIAAAABAAIAAAABAAEAAAABAAAAAQAAAAEAAAABAAAAAQAAAAEAAAABAAAAAgAAAAEAAgABAAIAAgAAAAEAAgAAAAEAAQAAAAEAAAACAAAAAQABAAEAAgABAAIAAQACAAEAAgAwADcAsB/hEi8ABwAGAC8ACQAIAAcALwAIAC8ACgAJAAUALwAGAAQALwAFACoACwAKAC8AKgAKACkAKgAvAAMAKAAEACgALwAEACoADAALACoADgANACoADQAMAAIAKAADACoADwAOACgAKQAvAAEAKAACACcAKAAAACoAKwAPAAAAKAABACgALQApACsAEAAPAC0AKgApACYAJwAAAC0AKwAqAC4AKwAtAC4ALQAoACcALgAoAC4ALAArACsAEQAQACwAEgARACQALgAnACwAEQArACUAJwAmACMALgAkACUAJAAnAC4AFwAsABcAFgAVACIAHwAjABkAGAAuABgAFwAuACMAHwAuABcAFQAsABUAFAAsACwAEwASABoAGQAuABQAEwAsAB8AGgAuAB4AHAAaAB4AGgAfACEAIAAiACAAHwAiAB0AHAAeABwAGwAaAAIAcCBEAEkAAgAAAAEAAgAAAAEAAgAAAAEAAgAAAAEAAgAAAAEAAgAAAAEAAQAAAAEAAAABAAAAAQAAAAIAAAABAAIAAAABAAIAAAABAAIAAAABAAIAAAABAAIAAAABAAIAAAABAAIAAAABAAIAAAABAAIAAAABAAIAAAABAAIAAAABAAIAAAABAAIAAAABAAIAAAABAAEAAQABAAEAAQABAAEAAQABAAEAAQABAAEAAQACAAAAAQACAAAAAQACAAAAAQACAAAAAQACAAAAAQACAAAAAQACAAAAAQACAAAAAQACAAAAAQABAAAAAgAAAAEAAgAAAAEAAgAAAAEAAgAAAAEAAQABAAEAAAAAAGQAZABkAAAAAAAAAAAASwBkAGQAZAAAAAAAAAAAAGQAZABkAGQAAAAAAAAAAAA5AGQAZABkAAAAAAAAAAAAZAAUAEgAZAAAAAAAAAAAAGQAMgBbAGQAAAAAAAAAAAAAADIAWwBkAAAAAAAAAAAARwBkAGQAZAAAAAAAAAAAAGQAMgBDAGQAAAAAAAAAAAAAADIAQwBkAAAAAAAAAAAASAAwAEsAZAAAAAAAAAAAAEgAMgBDAGQAAAAAAAAAAABIAGQAZABkAAAAAAAAAAAAAADNzB1Ccb0Pw+xRKUJSeAzDexQvQqSwCcNI4TVC7NEBw0jhNUJSOPvCSOE1QgAA8sK4HjNCFC7pwoXrLUIAAN/C4XolQuxR18KkcB9ChevRws3MGELh+svCSOERQuH6xsJcjwpChWvBwh+FAkJxPbzChevxQVK4tcKkcOFBe5SwwoXrzUEzM6vCKVy3QVwPpsKPwqFBw3WiwvYoikHXo5/CXI9WQR+Fm8JI4RZBZmaXwj0Kz0BcD5TC7FFYQKRwkMLhepQ+KdyNwoXrIcDsUYzCXI9ewfYoiMIfhYvB7FGHwj0Kp8HXo4bC4Xq4wQCAhcJI4dLBPQqFwuF67ME9CoXCFK4LwgCAhcI9ChbCexSGwkjhH8KPQobC16Mqwh8Fh8IzMzzCzcyIwpqZRcKuR4rCcT1NwlyPi8LXo2XCpPCPwgAAbsLNzJHCw/V3wtcjlMLNzH/CXA+XwhQuhMLheprCAACIwpqZncKamYvCHwWhwh+FjsJSuKTCZmaQwsN1p8LsUZHCuJ6pwincjsJIYbDCZmaNwgrXssKamYvCCte1wo/CiMKambfCXA+FwmbmucJSuH7CZua8wuF6b8KkcMDCpHBiwqRww8KF61XChWvGwsP1ScL2KMnCmpk/wgpXy8JcjzLCPQrOwsP1JMKk8M/CAAAZwuxR0cK4Hg7CuB7SwgrXAcJ7FNPCmpnpwRQu1MIfhc/BZubWwtejuMHNzNvCSOGiwexR38IfhYXBFK7jwtejVMEAgOfC7FEgwY/C6sLsUdjAXI/uwuxRaMBcj/HC7FE4Pilc9cL2KFxAZub4wsP1wEDh+vzCCtcLQY9CAMMK1ztBzUwCwxSua0FSeATD16OMQY+CBsMpXKFBzYwIw8P1tEEp3ArD7FHGQYUrDcMpXN9BZuYRw9ej/EFm5hHDpHAOQmbmEcMzMzJCChcGw83MtMCuR4vCj8IBwexRisLhejDBrkeJwoXrAMLsUYXCheszwj0KiMKkcFXCuB6NwjMzXsL2qI7CXA+QwrgercLsUQxCmtkKw9ejGUIp3ADDPQrhQc3M5sLheoxB7FHNwtej0D+kcMHCKVx3wT2Ks8K4HgLCheuwws3MU8Jxva3CSOF4wgAArMLYDXM/ndfYPDI9eT9sIYg93lR8PyECzj0AAIA/GcpJPgAAgD9txX4+AACAP1lMnD7Th34/ufy3PuW4ez9O7tc+mC93P44G8D4483M/93UAP6ZhcD8hyAk/YKtsP+CcET+twGg/T1gaP3ZsZD9jeiI/H0tfP420LD+g4Fo/8MQ0P8uhVT82PD0/749PP5hMRT8zxEk/AvFKP+hqQz+/YE8/eSM7P5nTVT9ClTI/G0dcP588LD+hhGE//5UlP842Zz/t9R4//z5rPxHkGD+Or20/R3cAP3IzdD8Xt/E+44h1Pxzr4j5PknY/SpjZPiFZeD9JaMs+hxZ5PzSdvT6HFnk/w56mPiFZeD8DeJs+uHV3Pz7tkD6zKXc/8l6FPkT6dT/ACWU+BipzP0XYUD5F2HA/1H1APg7bbj/sFww+e/dnP18k9D1WDmU/PWHJPeVhYT9n1ac9LspcP/rygj2Dblc/MXxEPSeIUj9EbgY9fCxNP4FDqDzZWkc/Ug9RPMcRQz/RVxA8QKQ/P2AfnTzIBzU/1ZXPPL4wMT+xogY9eH8sP8dLNz1nuCk/tMh2PREZJj9Ldqw9I2chP0vl7T2h2xs/JvwSPrMpFz/P2i0+bHgSP5+ORz7wMw4/6MFdPljKCj9oy3k+24UGP+F/iz61iQM/yVmYPiNnAT/ZCKQ+dR8AP6Q2sT4TRP0+ZDu/PtPZ+T4lQM0+KlLxPqGE2T4B9uE+sTPlPq3d1j4F+vQ+/DXJPhnKAT8TRL0+ecwIP6MGsz7Zzg8/uhSnPiuHFj/esJ0+Y7QeP/W+kT7DtiU/oKaGPpZDKz+ns3M+HhsxP52FXT4SiDc/A+xDPgb1PT+inCg+RBdEPwgDDz4WpEk/3dLqPTLmTj/IzbA9OpJTP2iRbT3kSVo/AAAAANklYj8AAAAA7s5qPwAAAABxA34/8FAUPpwzEj9dUG8/ke0MP9HLcD9RpQY/oGxyPw4tsj5/pHg/TOB2PnVZdD+T4y4+4GdsP+IGHD6y9Gk/Z9VnPL8rOj9Lq2k/dAexPbfRcD+k5FU+5L1aPyJxvz4oCkQ/q7IHP5XUIT9pUho/TkX6PsUgMD9y4bA+YTc0P91eMj6kNjk/VoLFPZnwOz8AAIA/C+lpwWARO0EAAIA/lZpbweMzykAAAIA/BrNCwWqaLkAAAIA/FFa8wI1JpMAAAIA/mzHnv3dWB8EAAIA/tEgqQP6VQcEAAIA/UlHvQBmcbsHqyn8/Ev9WQV9ijcEXt1E65skCwoKiO8DqeHw/OpiWQa5JlcGRm2E8wXrjwTXhy8BNhHU/SxC1QeujmsG0sCc9m0LLweNuDMGUTWk/wJLWQSqJoMEijrU9z6CwwYvINsH92Vc/vuH0QV/rosFslSA++yGXweLnV8G37j4/Df8KQvtLpsHzH4I+a0x3wSRzfcHJqyM/RGIbQhoUp8Eep7g+jnE+wUgOj8Hzcf0+jZEvQr0lqcFfRgE/+/DywIIkpMFAwcU+WwlAQkxqqcG4Hh0/pl5/wEMZtMFAE5E+hCtSQtl+p8G4dTc/fC7dPe24w8G14EU+5QllQj/focErh04/ONaSQBjL0MFTIgk+O4t0QnNQmMHDtl0/2AoJQT4y18GInak946mBQsxaisHHnWo/v1RKQcUK2cE0gDc6Cxcjwlm9fcGTHRs9j8CLQiTlcsHaj3Q/OLKQQWFy3cGmft47pfIOwmDxj8G7fkE8wQeWQm04T8HQ1XY/RVa9QV5l4cG8XMQ8g2r0wajooMHNr2Y7DvGdQm9uNsEteHE/lA/fQfSb5cGzB1o9nnHVwY7mrsHDZCo6X1SmQlZlHcFXeGc/akIBQsaf6sE/48I9RQ21wbkrvsHF/lo/XQASQgrU6sFLAhQ+uB+VwQBDyMG0cUw/6oEgQiY/58GPNk4+0bJwwRRqzcGvJeQ+nRhZQgpKz8GB7A0/8LQkv7/518GSrqk+3ThqQjrGxcEPKCs/VBhzQDEC2cGX4mo+qsd6Qmjcu8GyRkU/9ecBQTZT2cG+EzM+FPmCQs/buMFpOlM/eFkuQYsO3cH7IuE93NKKQod1rsH52mM/JH9wQRNn3MF+xoU9jjmSQrNPosGIRm8/4h6YQQCM2cG9UpY8SWeeQgXWi8HCTHs/ME3NQQB50sGMvgI8WR6kQlukfsFe9H0/4NbmQdlFzcFivjw7B7mpQrFMasGaQn8/yUL/QVsuysGWJiU6bpWvQlfYTsEP1n8/ctsMQuD+w8EAAIA/j1IiQqA2t8FY/38/B7ItQue+rcEAAIA/9+s2Qq6qpcEAAIA/pVJUQgppisEAAIA/8FBeQoOQfsEAAIA/xTFqQkfQYsEAAIA/yE1zQlc7QsEAAIA/uDJ9QkNZHMEAAIA/yAGDQmy688AAAIA/hRuHQvksqcAAAIA/h1SKQrWENMAAAIA/e12MQhJKgb8AAIA/BUWNQsSOxT4AAIA/6XOJQv6djkAAAIA/U1yHQtUDvUAAAIA/88iEQhWQ9UAAAIA/hA2BQtbGCUEAAIA/HWF4QgliHUEAAIA/U4RpQiotNkEAAIA/y8BVQomiUkEAAIA/TdlEQlOyakEAAIA/r5g0QkNlgUEAAIA/QhglQl5fjEFSSR06pUibQpZ/6EEG2H8/xrUXQuzqlEHACYU7cHaSQsCc6EGd9H4/at8GQll0n0GB7HU8hLKJQoJ+5EGmJ3w/hQjrQeHhpUEL0gw9hiCCQvCG30GQMXc/BqPMQSIWqkE98oc9tOl2Qu/m2EERAW8/OTCxQaKkq0F2w/Y9Bs1nQkOw0UHpJmE/uS6SQSivrUGcUAg5NCaYQu7pQULF5mM+Va1XQrpmykF6/EY/iXFiQcFAsEEx68U6Zl2QQhaTOUIeFro+DwRGQpObykGskCI/hhMfQa7jukEErcA7kRmHQo86NkJPQAM/0CI0Qqpq1kEQevY+l3bDQEK90EFkXVw8UMl+Qvg+MUKu9R0/ojYkQqRf3EHLLb0+H6EhQHfX30EWMAE9ir5qQmroKULpmjk/ZRkPQhmc4kG3RXk+7lwSwIxH8kGI13U9AZpYQmvDIkK62ko/KX73QX5f50GXHBc+/HTXwG8iAUIuxdU9afRHQv08G0LufE8/iQ3TQRQK6kHpSK4938YvwfrKB0JpUio+AUs2QtGaFEKkGUs/M66tQdc970EhByU9nxt0weLMD0LwbXo+nJcmQiw2DUL76Dw/eweLQZg88UEwR488VJGawa7fFUKJJLo+cjETQklyBELc1yE/FiNBQdtZ9EHQm4o7FjbCwcKiHUJeovo+BwkCQvvN+kEXnwI/LcLuQLtZ+EHNr2Y5w0Lkwe3+JEKvzhk/BeXjQZ+d80FSYcw+rd9fQBeyAEJWtzI/tA3FQXbK6UEEkJo+/Jvzvki9A0Jk6Us/k0miQX5s30HRV1A+NTidwEl7B0LJ5V8/SCd9QZ301UGdYwA+pGgWwRfYC0LZd20/N4Q5QU/AzEH3O5Q9XKFawfveD0LHY3Y/SVTyQPOPxUEPuRk9RAWNwTVkFEJi1ns/T5VZQBYqwUG4HoU8q3SswTFtGkJioX4/xVwNv9vvvkEr+6477kzJwTv+IEL92X8/gG3zwHSOxEH3zBI6oTb4wYXuMEIAAIA/aPUnwXgvqEEAAIA/3eBawT/yiEEAAIA/LL4UwcjaXr+0cUw/Pe0vQp824MGPNk4+j54xwSvPz8G0cUw/kTc8QsJQ28GPNk4+loT/wA1l0sGvJeQ+DrZKQpgK1cGB7A0/5VOJwNX31MF+xoU9bUSYQl7hlsGIRm8/05ayQQrF1cEAAIA/8S4YQnXYvMEAAIA/ZchAQoARnMEAAIA/dFhLQtdxksEAAIA/ek+LQmajH0AAAIA/VMTNwAMIQUEAAIA/1bUeP9Hgcj8AAIA/4j2uQdR/jz4AAAA/KOMpQjY67D4AAAA/r3K8P/viWr8AAIA/3rO1QRIMKb4AAAA/tRg3QqHVvb0AAAA/0gyRv9SaOD4AAIA/UR+iQT006D4AAIA/l3Y3QnN6QD8AAIA/OgRmQgjrMz8UrnBCMzM4woXrcEJmZj/CrkdxQvYoSsJcj3FCMzNTwilcckKkcF7C4Xp0QlK4Z8LsUXxCrkduwhSugkIK13HCM7OGQqRwccIKV4tCKVxwwuH6j0LsUW/CFK6TQtejbcK4HphCZmZtwgCAnUKPwmzC1yOiQilcbMIUrqZCAABtwnuUqkI9Cm7C4fqtQrgeb8Ip3LFCZmZxwgrXtkLXo3XCKdy6QkjhecIAAL5CmhmAwq5HwUJcD4PCZmbDQpqZhcIpXMZCrseIwgAAyUJcj4zC16PLQlwPkMJxPc5C4fqSwoVr0UIKV5TCw/XVQgCAk8IKV9lCmpmRwj0K3UJxvY7C1yPhQkhhi8JxveRCrkeIwnE96kI9ioPCrkfvQmZmfsJxvfNCj8J2wuF690KuR3DC9qj7QvYoacKF6/9Chetgwq5HAkMAAFjCM3MEQ5qZT8LXowZDuB5HwsP1CENmZj3CXM8KQ1yPNMJczwxDw/UqwuH6D0MfhRvCAIARQ3sUE8KuRxNDexQJwsM1FUOkcPvBXE8WQ65H6cE9ChhDUrjSwZpZGUMzM73BUrgaQ9ejpsEULhxD16OOwT1KHUPD9XjBw3UeQwrXS8GFax9DUrgewexRIEPsUdjA1yMhQ5qZacBxfSFDSOG6vykcIkPhepQ/uN4iQ+F6ZEAzsyNDexTeQM3MJEPXoyxBhWslQxSuY0E9CiZDheuNQQqXJkMAAKpBM3MmQ3sUwkEKFyZDw/XUQexRJEMK191BpDAiQz0K20EAwCBDcT3SQXH9H0MAAMZBUrgeQ2ZmtkGuhx1DexSkQQoXHEO4HpFBXI8aQ0jhekGk8BhD16NQQXH9FkOuRyVBM/MUQ1K49kB71BJDFK6nQLjeEEPsUUhAAMAOQ+F6VD89ygxDCteDv5oZC0OamTnAUrgIQ3sUrsCPQgZDcT36wD2KA0OPwiHBZqYAQ83MOMEAgPlCCtdHwWbm80IK10vBrkftQgAATMEAAOdCuB45waRw40LhehjBexTiQilc18Azs99CH4V7wPao3UIUrse/UrjWQmZm5r72qNJCFK5Hv6Twz0IpXB/AM7PMQmZmrsCuR8dC9igIwVK4w0LXoyjBw/W+QqRwUcEpXLhCMzODwWbmsUJI4ZjBH4WrQh+FrcE9CqZCuB7Hwdejn0L2KNzBCteXQrge8cF7FJBCCtfzwXsUiELXowLCuB6CQqRwD8KamXtC9igdwq5HdEKkcCrCAABxQo/CMMJmZg5DcT0jwoXrgkJI4UnCHwWZQsP1SsJm5rNCZmZKws3MwkKkcGPCUrjWQsP1e8Ls0exCexRVwgqXAUNxPS7CPQoLQ6RwEMIUbhFDZmbGwdfjGEN7FBrB7NEbQ1yPQr4AgB9DUrgyQexR2EJcj2bCzczcQuxRNMIfhd9CcT0DwuxR3kIzM53B9qgAQ8P12MGPwvFC7FEiwgpXtUIK1wDCzUzBQq5HLsL9vCk8pMePPjPEMTxgAoc+pN8+PE2hcz7T2Uk8nYVdPqn2aTxeLkI+fcucPEF9Kz4r9hc9MIEbPvNxbT08vRI+2XycPQDGEz5lNsg9Ol0WPvLv8z1z9Bg+zF0LPoMXHT5LPCA+NJ0dPluUOT6qKx8+InFPPg03ID4U0GQ+NqsePi80dz47GRw+pI2DPkCHGT6xv4w++doTPnJtmD7OjQk+at6hPgd8/j0iVKk+CYrfPcQIsT6TqcI9eQG2Pu/mqT2+9rw+8fSKPfUtwz4zp0s9LGXJPt6TBz2ojM8+UkmdPBEB1z7yQU88irDhPni5iDzGouk+mxvTPGFU8j7sTCE9QwT8PnReYz1oPwI/sP6PPYC3CD9bQr49UaUOP1ys6D0m5BM/qBgHPrZKGD/Q1RY+cy4dPztTKD5VMCI/A2A8PoenJz9FR1I+qcEsP0m6Zj4t7DE/N2x7PnBfNz/pmok+Pbg7P9dplD7BbkA/FCKgPovgRz/o9rI+xXJLP85TvT7opE8/xHzJPuQsVD9NZ9c+dsNWP6J/4j5Gzlo/F0jwPvPlXT/idf0+vR1hP6eWBT/jjWQ/ie8MP3QkZz+zexI/UORpP+5fGT+mJ2w/KEQgP7NBbj9Y/yc/djJwP9WVLz/nAHE/vvY0P811cj/eWTs/nzx0P+I7QT9iLXY/LXhJP0zDeD/v4VI/izd6P9RIWz/Jq3s/odtjP772fD/Pa2w/26J8PwnEcz/3x3s/h4p5P32Wdz/3O3w/6pVyP6Fnez/XNG8/ibV4P8dobT8F+nQ/qWpqP701cD9RoGc/H51qP/c7ZD/EzmQ/f6RgP/vLXj/o2Vw/B19YP4FDWD9WvFE/U3lTP2FPSz8HfE4/8UtFP5/lST9+HUA/U+hEPziEOj9EUUA/XvQ1P49TPD8sZTE/kL02P6UsKz/L8zA/8l4lP6yQKj+sxR8/98cjP5Y+HD8xmRo/AfYZP/MCFD/BVhk/WDkMP3FVGT+h1gQ/9zscP3+kAD+tNCE/yhX+PiQLKD98fvg+nOEuP1ey8z5PrzQ/+FPjPhhgNz9Nvtk+Gos2P9Vb0z4TZjI/98fLPsgkKz+4Ab8+wa0jPxKgtj5jtB4/FXSrPt17GD9+45s+PGYQPyS5jD6Lwwk/FXR7Pgx2Az8wnmE+6UP3Pkp7Qz5iZ+o+Q+IePtuK3T47jfQ9odvbPq00qT3iO9E+xHdiPbSTwT4xthA9GM+wPkG3lzwLmKA+WDk0PGnjmD6mJ0Q/foypPu3TcT3NWHQ+OGckPhDMcT7vcpE+eSNzPv2HtD6VDjY+2IHjPnmS9D2Euws/2T1ZPhAGJj+LGpw+Pj88PwGHwD49REs/Osz3Pt7IXD9q9iA/eqpjPyQLOD8BTWw/jsxTP0pB5z4smi4+EMzxPj6zlD4uHPg+h6LQPrtE9T4+eQg/HNMjP71v7D6QiBE//aSqPvHXlD53hNM+JQaxPhb7mz74pX4/pdW1wL33oED3r6w7v/32wOM+hULRXH8/zvGywK34MUB/hyI7Z1wfwZOphUJO7n8/vpyuwPKyFL+cUIg55/VUwc1IhkIAAIA/cjKrwLzuWcAAAIA/pW6iwC5P3cAAAIA/4JmMwED7HMEAAIA/gAb3v4+DPcEAAIA/QRJnP4ABT8EAAIA/f4JaQHi7TMH4jX8/sfrJQEAER8ErweI62BNLwRN8xsEYeH4/a1oTQTyAQcH9n8M7QTYpweBptsEu4ns/kUs4QWrZOME8pYM8+sUQwfnmp8Fma3U/n69kQdxYN8EpPyk9vC3cwIoHmsFKJGk/RDuNQe/HM8Fv2LY9PjuKwACGiMGto1I/l2ykQRl3McGtbjU+EkcFwOV0c8Hf/TE/ciK7QS1bNMHzApw+ZSOaPtmdWsE7qhI/3abOQWRKOcFG09k+ODkcQKI7R8FF9dY6uXiNwbddp0F87ek+eavfQYV1PsGQiAk/P9uKQIgGN8E+BcA7aUmCwTlImkEAHaY+sRvzQT+YScEnoCk/QH/WQPe0KMFa2FM8pHFuwbFbiUHjGTQ+NQoGQo50XsH3AUg/AMEfQReRG8GDbi89O01WwTVGYkFn7bY9LyAQQpZhc8EA41E/f5pMQf83FMFa9bk9/HZFwX0POEG7uA09gQcYQiViicEvNE8/yLV4QVV5GsHYux8+YxJCwVekC0EHCOY7jUcgQkkSmMEmjUE//FySQR5KHsGJmHI+4FA8wY+sv0BlGWI7Yp8lQvGypMHWizE/oHqiQSfBJcHRIps+k6k8wTIEe0Cz7wo6mBMtQnd/tME66R0/+t+3QVdBLcHF5sM+2cQ6wSjPmj/2fw4/Dc7NQbh4O8HF/uI+CzQ/wQpV1L8lXQM/4uPiQXZ0R8EYQ/k+MdJBwWGbjMDU8fg+9hD2QeUNT8FuhgM/8vpAwdfI2sAVqfA+qWwDQqq2RsHOqgc/05oxwXJfDMHiAeU+dTULQm2fJMFnfg0/WZsJwXpvI8E2H9c+5BQPQtkTAcFlcBQ/Ox7HwOfnKsHB4sA+9CQSQkHkp8BzhR8/LGRTwKYlLcGCqPs4Td+EwdZFwsBDc50+GUAVQjqnAcBIpy4//9YaPLMtLsHYRyc8s41hwTKzA8H3AWg+csAXQtt2YD+Nlz4/WaI+QNDxLcGq1Ow89ck8wQrKIcEJ+eA9QpEbQvQGqkBApFc/YYfwQL+OLcFyv0M9GpUEwY3AT8EJ/jc9vxEfQmgIFkF5dW4/UcY6Qec6LcHYKsE8VDmiwIjgecFKRk48ATMiQuJnT0H8jHs/ZH91QcEYLcGMoZw7jxEPwE6Yj8ErweI6v8QkQi3Pf0H4jX8/Q32TQam0LMEAAIA/J/GuQfe7LMEAAIA/A4TMQTYFKcEAAIA/XKPsQT8vJcFpAH8/SmMFQoRhIcFf73472qGpwb2AGcBpxno//ZgUQkyIHcHnHac88p6MwRhKZMBWSHE/wU4lQhinFsEmcGs9YYZYwaBKlsAcsVY/BIQzQtEFDcHvOCU+Gx0gwZP9rcDElDg/LOlCQohyAsEo1Y4+J+DFwFlox8Dl1ek+aH5bQpeq4cBmFAs/zll8vcCj7sDrHKM+MR9oQufiyMA7cC4/bjhKQNSS/MDJPDI+GgF3QoP7qsAmcFM/xdneQPkrBsFyp3Q9vMeDQkGfhsDhtHA/FLUzQRCBDcGkpXI8A46JQv0kPMB/9ns/gh5mQayNC8FVanY69gi8wV1/k8CCqPs5fWuRQn2F1L/ovH4/QRWUQWWLD8GJKZE7I+WbwUrhssD7Ong/qfuxQd1YDcGXi/g8DI58wbDbw8Ai4Gg/AFDRQTL8CsGx+bg9KXo+weGH1cCsxSc3TRmnQq3uREBrt00/WqfyQXiECMEVHUk+zNf4wL5t6MCsxSc3c+SsQqnBikA50S4/D/QFQkK+BsGfWaI+cdCUwLzt9sC+9gQ/xCUVQgraAMHkD/Y+l9hYvwp+AMGbILo+/tgjQjGC7sAL7yI/JBE4QImFAcHvIFY+FugzQujL0sAdd0o/C2PfQDqo/sB/MLA9h45DQrUztcBI+Wk/v+0vQQrW98BGtvM8zQpOQsZVmMCmYXg/ScVbQSlf6sAhdqY7Ww9bQgDPecBssn4/37mIQdDt4cAAAIA/4v6hQRZj4cAAAIA/hp7EQRHE18AAAIA/fqPsQfuN0sAAAIA/qKQHQmEUwMAAAIA/4EwZQom/rMAAAIA/sNkqQj7AlsAAAIA/Cvc4QvEvWcAAAIA/IaZDQlkFBMAAAIA/4TlGQtmg7z4AAIA/c01BQoifN0AAAIA/Kd05QnoxhUAAAIA/E2sxQu1qj0AAAIA/fDEmQgztp0AAAIA/33gZQlg6uUAAAIA/5PwLQmQS00AAAIA//t/7Qf4970AXt9E68+V5QnwtU0EtlX8/BMndQaFRBkGsxSc3y+9LQgzQZsLfNz48r1ppQiEWXEFT6Hw/CAW+QUbfGkH67es5Mrg/QuJvW8J1HwA92/5YQjJuZ0GynXc/8NWeQZKwMUHtDb46XQE0QuirT8KYo8c9QxxJQhGZdUEctmU/ztWAQb7ySkHDZKo74RUpQnqaQ8J1sD4+ojA7QjUqgkFma00/w4BNQbxcY0Foyzk8zdkfQiKOOMJTs5c+Cw4sQm0MikHCFy4/Lb0UQSGpfUGsqME8McYVQgyYLMIofsw+xzwfQkGXkkEQdQ8/+anKQFDNi0FFniQ9k8cNQuyzIcKZgfo+1gITQiO0mEEE4uU+gItdQCgslkGZ2Hw905AFQg0lGMLDuxQ/lTQCQo/AoUE1DJ8+GDnxviIQpUFd4d09juz0QTK+CsIHQrI6IqKNQt8A80H8GCM/tdXjQW1CrEFvgUQ+kc+HwGA0tUE+ri0+jWfgQfwW+sFoBQY8k76EQls580FkzB0/WtTCQQR8uUG9UtY9OyYAwcoYyEFvnoo+xRrNQTc63MHEX5M8UdJ5QhIE+0HHnQo/QYaoQYg1zEHk2lA9dj8twRo130Fivrw4Z9dzQvkfd8GuZMc+b3PCQS2/vcEmqrc87e5nQimVBkIp0Mc+8uCNQdAy6kHmP6Q8DAFXwU27AEIXt1E6GdZrQsaOLcHnABE/5wa+QejflcGVSKI8/HdcQuW2DkLwM44+p/58QUHdAEJV3g48iORswautDUKWJqU6bC5oQsSJ7sAYQzE/2hC/QZ+Qc8FQjRc8mNdPQuxpGUK+vCA++qpdQaxxD0IUXCw7YqqAwYJrHUKgw1Q/aiDDQV/dMcGMoRw7A7lHQuMWKEJhiYc9/fBUQdMSIEKCqPs5+RF+wRAsLkLGUG4/h8fSQbkO7cCsxac4UZFHQiGgNUIFi8M8zDBoQey5LEIa3Xk/N0HpQXatsMArpPw7HpqJQWRQNkIQBn4/lPECQvjEo8C9Osc5fLWcQd8mQkJx5n8/mJQRQn2fgsAAAIA/OvodQjkfTMAAAIA/+6klQjR3cD9YcwA6ZoZJQrIAeEI7338/f00lQu6LYECPNg47ichCQhhob0KsxSc34IuFQj4yh0HSb38/1qwdQqTWrkAhdiY8xcg6QkSNYEKsxac3fJeqwTY3WUJblFk6KR17QuMGkkEjLX0/sQIQQk4B/kCHbQs9tVYtQvIoUUIRAYc6sb2twcLWRELgufc787JpQndrp0HkFHU/6IgCQuF2PEEId2c9C4IkQhnzRkKfqy07KrCvwexfN0LPvYc8UyleQrdvtUGmm2w/7CrzQXviZEEx68U97bEYQnAeOkLKVME7ZEizwesGJkKcUAg9L4tPQkx2yEFHOF0/bdzcQSpCjUGmuCo+3E4IQvt0KULja08896C5wZ/fDkJGzoI9DmM8Qqo740FnuEE/wyvAQSMoskHYKoE+U4DwQR/MG0J3vp88XwnDwbSl9EG+pLE91z4sQnda/kG5NiQ/ZlipQUmb1UHPMbA+EMfQQQHKDkIr3sg86ejMwVjTzEHuJc09YcccQgSnDEIa+gc/U8KTQQV/+EEE5+w+lJi1QXNk/UE8TtE8H3TPwUjGokHri8Q9BqYKQhpgF0Iv3dQ+tOluQa/ZC0Ll1Rk/lsaVQQzg4kE4Fak82RrZwc38dEG1VJ49oNr1QWrbJEJnLJo+BcZCQUtgHUIvbkM/7ehdQQtpyEExJRI8GmbowXkjHEEOLTI9KUzVQWnLNULRkTw+kZcYQTBeMkL5FFg/n1sQQQ+/xEGWJiU7EqUCwrzKz0A7cM48NzvLQXabSEI9RAM+RpkbQefTRUL0T2g/G1CBQLCsrkHlRDs80tWuQQhrWkKEEqY9Nsz0QAAKW0IcCHE/98mvPvN4jkFv2LY7vSiKQa1SZkI3jlg9MsuEQPHUa0KTxng/cfQUwGwNWEGz74o6YkZJQZv9bUKtad48CktxPpqzeEIIrHw/m8WSwKNnFUGsxSc5gYoBQeMgdELsNFI8eANmwMLugUIn2n0/GSSzwElj60BTIgk8VZWtwHx2hELElDg/qThPQgtp88Ao1Y4+q6hHwDoz28AAAIA/UrZ3P4w15r7/CX4/h4NsQYpvMb+P/ME5+uC2P3UOIUIuOe4738+AwehiPEIAAAA/86T8QY66zr4AAAA/HKm7Ps7tY70AAIA/TDpIQd1fLb8AAAA/I4fYQblHOT8AAAA/2G/5PvRak77zcXU/+QuXQcQbWbtN1ig9yzfsQCHhPcEAAIA/bI8VQlE6Kj4AAAA/9K5RQtpp0r4AAAA/Sya0PU5Vwr4AAIA/eJGCQQluRr8AAAA/fMMVQtbBpL0AAAA/Nn45PzcEWr4AAIA/y0RRQR3Nub0AAIA/vwvgQeMXAr4AAIA/laZdvo7ZRr4AAIA/E7N7Qb5Vb74AAAA/Jw35QWBTPz8AAAA/QXMYPygSET8AAIA/GhOIQfi2Qb+c+XU+DVpHQrF3hEFr1OM+7Hx5QDXbgkGJ6i09/SwnQh+elsGHbYs+U+SfQBJHqsF90Cs/aiz8QTAIIUE+Pww9YGF4wT8riEHDDTg+gFC8QaaXQsE8Mes9SZAnwSdbGMFjnL8+10sBQvi2tEHeyLw9IZBMwSGOlkFenUM+eHLaQZi71kEYYK8+uOOUQM0B1UGHilE+CZUfQnEMB0FIp04+wCrfP2gVQEFZNM0+/9RpQQMriEGiXUU+JvwlwV71p0GkcI5CuB7OwincnEKux8LCHwWoQgCAvcJm5rRCXA+/wlyPwkLNzMLCpPDMQincw8KuR9FCpHC+wq5H0UJ7lKvCCtfJQkjhoMIUrsBCAICYwq7HuELsUZbCexSwQvaomMIzM6pCheubwsP1qEI9CpjC9qijQs3Mk8KamZlC7NGTwmbmkEJ7FJzCzUyJQgpXocJxPW9CZuagwuxRSkJcD6HCXI85QhSuqsIzMyxCpPC2wq5HHEKPwsjCrkccQs3M28J7FH9Czczbws78+j5yUEI+rKgZPwa7sT5gdi8/SkHXPluZSD+wOMw+T0BjPwa7sT6xinc/JgGqPgAAgD+HotA+AACAP5hpKz90e3E/a31RP7KdXz93Sm8/QStQP7ADdz9+NT8/6LxuP6ezMz8YJmM/rkcxP9TxcD8r+yY/AACAPxtMEz8AAIA/WFYCP4mYYj/B/+Y+v9RPPxPyoT7EfFE/I74zPjXvUD/BqOQ9qrcuP3P0eD3iHgM/AAAAALVPhz4AAAAAAAAAAPXWwD4AAAAAdEbEPj4kYUGhlnnBd9sdP8e9ckEwDTtBVmVPP2tfDEHwzK3ACmhCPvT4HUGt3q5BEhRfP2NB2kCqKQJAS+VtPHR0/UAel+pBiJ3pPWtoJkF6x3PBtwvdPq5IFEFwOxxBfXkRP2eQTUHpLPDApvL2PYVOUkE7x41BBCFhPx/LhUFBkuc+VRhbPbnsb0Fbzb9B001yPzmalEGjkdZAaHkePS6wQkEAJNpBwhd2P+j3e0Ec9h9BAACAPxc/hUA82UJB48IBOx0Y90AFudVBlX1/P7crUcCChg1BVdl3PUH+wT+8drBBw4FwPzSXF8HfA4ZAdCQXPtSbPL9qqYtB9fMmPHPodMGY3IZBa5pXP7mgO8GOFtO+mpmpPgFTnL4Xfz1BpRR0PU4BbsF05TNBQfEbP5S5NMHh2MDAt+4ePxo0gj+bXPtATzu8PTPYWMFUKehAHxGTPnmQH8E7PSDBhuZSP4wwwb8cWPFAr+sXPWSigMHWJN5AXmgOPg79R8F6PyXBTfh1P+c9l8Ac3JhAuXAgPfB1e8F6fVHBm1V/PxERvMB/xLO//bwpO9vGmsHPSMpB2NhFP+Od579pf/bAc7rsPTkJg8FY2QTBknnkPep4dME95ZdBmiXhPhvoCj/Nqk/B7zhFPjRwYMFwRFnBnzy8PqzWTsFhX1tBqvHSPVnG4r8RTb7B3uUiPcC7gsHiGcPBxXJbP/jdc8EywDlAowZTPOCvc8D8kwzCPrN8P5M4isHARQfBF7fROgnvkD+DnSXCfZZ/P0xnRcHca2vBAACAP06NssCf36HBAACAP54/jkDnd9nBAACAP4IegUEVFOvB1/riPWQCpkE/qdLB/Z9jPynPrkFBFXU/exSkQdejwcLXo7JBzcy+wuF6uEGambjCzcy+QXE9s8IUrsNB9qitwsP1ykHNTKjCj8LTQRSuo8JmZuBBzUyfwsP17kH2qJvC4XoAQo9CmMJxPQpCw3WVwh+FEUIfBZPCPQoZQsP1kMKuRyJCSGGPwrgeJ0LDdYzCXI8pQlK4h8IzMylCj0KCwq5HJ0K4HnjChesiQuF6bcLsUR1C16Nnwh+FFUKuR2HCH4UMQnE9W8J7FAJCZmZVwlK47kEzM1PCw/XYQXsUWMJSuLxBzcxYwgAAoEF7FFfCFK6HQfYoVMJI4VZBPQpPwoXrMUEUrkrC7FEAQbgeRMJSuLZArkc/wsP1WECF6zrC7FG4PoXrOcIfhWu/rkc/wsP1aL/hekrCCteDv7geVsIfhau/uB5fwh+FG8DNzGnCexSGwLgeccJmZs7AMzN3wrgeCcEK13vCuB4xwXsUfMJSuGLBZmZ4whSuicHsUXPCZmaewZqZbsKuR7PBH4Vpwq5Hx8GF62PC16PcwQrXXcIUru3B4XpYwlK4/sFI4VPCuB4Iwo/CTsJI4RDCFK5KwqRwF8IzM0jCcT0fwlyPRMJcjyTCw/VIwsP1JsIUrlHCmpkiwrgeXcJSuB3CCtdmwrgeGMI9CnHC7FERwnE9e8KuRwrCUriCwsP1AsLs0YfC7FH2wUhhjcLNzOTBcb2SwjMz18FSOJfCMzPHwSlcm8K4HrnB4XqfwsP1qMFIYaPCKVyZwa7HpsIfhYfBPYqqwkjhasHsUa7CpHA5weH6scKamRHBHwW1wj0K18AzM7fCmpmBwB8FucIAAMC/Kdy6wo/C1T/sUbzCw/WIQGZmvcIUrv9ASGG+wo/CIUGaGb/CPQpDQezRv8JmZmJB4XrAwmZmfkE9CsHCexSSQa7HwcJ7FBVCw3WBwgAA7EHheovCrke9QexRlcLNzKhBZualwlK4lkFm5rbCFK6JQY/Cr8K4HjFBAAChwgrX20B7FJPCheuJQEhhhsJmZsY/XI9pws3MBEFxPbTCmpkJwNcjr8J7FEbBXA+jwoXrtcFSuJTCPQrrwSlchcKPwg3Cj8Jowrx0Oz+XkA89GM9APyS5fD368kI/4Nv0PRNERT8qjC0+NQxHP9f6Yj4PuUk/iQyLPuHuTD8MH6E+vJFRPwcItj4Y7FY/CHfHPkSGXT8wu9c+EapkP3oZ5T5sBGo/0LjwPqiMbz+Amvo+tVR2P5AUAT9H5nk/Gw0IP2iuez8TYRM/fm97P4NpID8mAXo/xTgvPwTKdj8E/zs/Ka5yP0D2Qj8O+Gw/QYJKP5JcZj+Lw1E/za9eP8e6WD+A1FY/l1ZbP6PMTj9EhlU/XHJEP3qlVD826jk/hqxWP6D9MD8oJ1o/WaMmP0I+YD/92R8/MndlP4e/Fj9ATW0/0/YPP/Qacz8fLgk/41N4P9BEAD90e3k/LgT5Pq0Xcz99Bfk+ArxlP5xQ+D6Sy1c/e4j2PgYNTT/WHPA+eEVAP9/D5T6fjjc/ho/YPl5LMD9eEcw+wcUqPwVuvT5jeio/GTmrPtjTLj+eXpk+mus0PzI4ij4vhjo/srp1PvGdQD8AdFg+d0pHP80GOT7Bi04/3QcgPjnuVD+NCwc+3nFaPzuq2j2giWA/XD2nPYF4ZT9CsoA9B19oP034JT0kuWw/QlvOPD1+Zz8cQpU8wAldP087/DyuZE8/SkE3PffHQz/v/ng91ZU3P9B+pD3OcCs/Ke3NPfs/Hz+Cyvg9gA4TP7A9Ez4dyQU/vvYsPgwH8j5q9kA+RIvcPviIWD5wzsg+JUBtPk0QtT4KaII+A32iPpHVjT55O5I+L/qaPoJWgD6BQ6g+2XxcPmJnuj5jfzk+CwzJPjp6HD7k99Y+fZYHPn2u5j4UXOw9R6z1Pm2QyT15HgQ/WrutPebLCz/b3Jg9Ja8WPw1Uhj1c5hw/W5lwPRUAIz9wCFU99MMoP3h/PD384y0/j6omPejZND+62go9cqdsP09YIj9T0FU/NV4KP0+vRD+PwuU+Iy09P9uFlj73kjY/66gKPjvCMT8/HU8+mrYfP1X2rT4TYRM/93XwPqHbCz9pjBY/3LoDP6qaQD+7mxc/mwMkPlji8T5A2VQ+ob61PpMYpD5+AHI+WYboPi3PIz6N7hg/taa5PVGDQT/sF+w+ReLkQUzdg0C78gk/U7FjwMvswEB/+wI/iHfSQcqIu0BkBvo+9yKvwMS5d0BpHSU/GKKyQRO8t0Dfw7U+iFy1wBgb2L3vIE4/wrOWQSmXukBEbiY+YP7AwGgPZcCMLQQ9Q9u6wMA5s8BVavY5tuvjQdFYZkHxY3Q/pVh0Qb9atUCbyTc9Sr/EwGO05MAKndc8TmzNQVoAREFTs3c/YN07Qf3YvEC9Osc7jRnVwEVdKsHfbPM9S2m3QeHqKUG8kWE/LI0JQfGAz0AP7p4+ihWeQcktF0FRiDA/QiiuQLby9UBHrA0/7NOEQW5CDUEipuQ+RRAqQGy+FEFaKkc/oldRQbQgCkH4U2M+F2D5vRJxN0H1LWs/XTgZQXYYDkEai6Y9A2MmwA9cX0GhoXc/KMzaQDMjDkF32wU93yGVwCU6fEECvH0/b2aFQMQAEkGm1RA8MFnQwBKejUGynX8/tE+cP/ylHkEbTMM6b10DwSrloUEAAIA/OKeGvzDnE0EAAIA/j45VwJu35kAAAIA/Ea6kwNYPikCPpX8/W+LZwPdgQz+SkbM6sjwxQFY6N8Ihdn4/IgXxwORsMMCmm8Q7BALLQMbDNcKLGnw/BRnjwKvqp8BdM3k8Om8JQe0dMcIahnc/AdDFwCsaBMHekwc9yvgyQfUDKsIGTHA/HMicwHZDNsErNXs9NaxcQbRcIcLIXmc/Nl1NwASca8GBBMU93rmDQWHpFsJRMV4/ILFPv2JQicF+NQc+/ZWQQXfWCsJCQ08/cSE3QHZajsFa8EI+JJWMQYEi+MGc+S0/ocrUQN6KoMF4C6Q+stiUQb/E1cHEXwM/yTMhQTchuMFivjw5UrW5wVQvJsFCJvk+eyGjQZ6NtMF7vbs+MYhLQf0jz8EXt9E4y+m4wWyxZMFlGSI/Y7yyQUd2mcFDBFw++dx3QQNz7cFI/kg/vQDJQZp0dsFubgw+fweJQWOwAcK941w/rf7ZQV5QUMG9b3w9OZ6ZQYIjEcJcOHA/aX/yQachHsH3deA88AumQeSZHMKp+3g//lECQplW8cAfuiA8MzqzQemXJ8JwfH0/ldQKQumrpMBo6J86VPzKQSQUMcJkr38/IlEQQtUGzb8AAIA/vrMLQvlP0D7T2Uk62ZzsQahvI8KcUIg5ab+/QUtjH8KCqHs4EaDOQPH8H8Katn8/SoX8QShVsT+9Osc5wNX9QVCxF8JV3g47OQixQS/SEsKWJiU6SCJrQJyZFsKhLX8/MfPgQUfCI0DN6TI8VnunQXuECMIuVlQ7HB/YP517DsJbX3w/Rz/MQbB8bkBtkEk9kTmiQdCt9MHCUXI8DebqvSn/AcIKnW8/Pbm1QWJJv0C6ZvI9DCWnQS3F28G/fR09GisTvy7f6sH92Vc/GiepQTDDC0FiEFg+Y/KxQZfEwsEr+649/Bixvo2yz8HaGzQ/YfigQdS3P0Ep0Jc+MIS9QSGNrcGrPhc+mLMGPsvVt8H3zJI5/bczQhSD9ECYNA4/JdibQVTzbkG+pLE+QDrSQWiJn8EjLYU+fk3+P1W1o8GAK8k+GViiQXyfj0GwVaI+c0jxQZiGlsHcRuM+pqCoQNXXkMGpwXQ+/fCzQX3AqkGg4GI+zNwIQrLIkMFzuiQ/G6MNQaeYgMFVMAo+x7nIQZdQxEH3AQg+dvIWQna3jMGH/kk/LgZAQae1ZsFh/Z89jl/bQQDR2UG5GW4961slQmtMicEDPmc/MRR0QV8DTcGU+x09zvDuQU9B70F5WKg806gzQpORh8E9D3Y/nmuUQf6lNsH4qpU8x7gBQqyiAUL9vCk71P9CQgruhcFkzH0/j8qwQRMRH8HDR8Q7DsoMQuxJDEJXeH8/Zm7IQcXQDcERAQc7vDoWQnCbFEJx5n8/zZHeQf149MC9Osc5KMIeQsgxHUIAAIA/Vhr2QWCazsAAAIA/Z8oFQrBcosAAAIA/rUMNQgxqe8AAAIA/bdUWQl23LMAAAIA/h48WQnvWCr8AAIA/lcgPQnAk3D8AAIA/dSQBQjFSNUAAAIA/0prnQc5GX0AAAIA/n9/KQbTdgUAAAIA/7E2sQf6bikAAAIA/H16NQa50kUAAAIA/EwFcQdQWlkAbTMM6glonQmQHuT+ynX8/xCoYQaSQnEAzMxM+G+YWQvo8MkCLMls/qPClQLYAmUCbrLE+ybEJQv2Gf0ALKSc/N9vVP0MmmkD7Ihk/5V/3QbEzmkC7uM0+tvTzv1WljUCpalI/Bm/dQch9uUC9UjY+oD6pwBR8iEB6jXU/R+bBQWB1z0DnHSc9bzIMwfXQcEBY/38/KU6oQUqG3kBY/38/6GGLQbWY7UBY/38/ZU5cQUdb/EDfFcE8PrUWQvida0Cp9nk/TYcUQQUo90Ab2Ao+BRYJQu2In0BSSV0/e2W0QOl99EDvrI0+L8r4QQIluUDhKDk/IncZQJK75UBkBvo+0uHcQdiRyUB/+wI/5zODv5mlykDjNjI/6yLCQUJC20DrkJs+7IKKwNB9skB96GI/XaOhQdD54EDYtug9vH0CwSiKhkC2EGQ6okz6QTtOgcFmFHs/2v2GQSFI40DMKJY80D80wXqYQECrsm88wnT1QXNlOMGOQHw/hzxDQeej20AwnkE9HnbzQSKTDcF15XM/2jsYQaxr2kAz4dc96ZHxQVoNx8AyA2U/KAncQLt92UCbj0s+z7LvQcjNb8BxG00/v4qMQJFA2EATSZQ+0+LtQXeIxb/P2jU/3lcLQO2R1kDecco+UF7rQQCNtj9pxho/osZOv6QA1EAAAIA/watSvt10yT4AAIA/LZQ1QXCTND4AAAA/pLOmQVoDmz8AAAA/yThVP2QxRj8AAIA/Srk6Qashtz4AAAA/o1C1QXEQvj4AAAA/eByTvkFHRr4AAIA/oVFLP5hnIr4AAIA/i0lMQaWEIz8AAAA/6yS3QaIPYL4AAAA/tcOqP5FEKj4mjVE8WiLpQLCPz8Gc3O86CJNewTTcAcKOQHw/wqQdQT8yfT8AAIA/AwmrQf+plz+MuWs/7IdPQbWjDz9eLqI9pR2iQJIFKEEAAAA/RCjTQeYyUb4AAAA/G4SgPmn3Fb4AAIA/33JyQZJ20j4AAAA/ECT3Qe9IB74AAAA/clmPvtv7f75Jun4/SEdGQdiN2z5/h6I7Ug+zQTnMJEIAAIA/9F3LQex9r70zM0dBPQowwq5Hi0EAACXCuB6tQRSuFsKPwsFB4XoGwnsU0kFxPeLBexTSQXsUqMH2KMZBhetFwXsUvkFxPQLB7FGyQVyPmsAAAJpBUrievsP1gEHXoxBApHBRQcP1iEApXANB7FG4QDMzc0DNzMxAw/WoP0jh0kBSuP6/SOHSQIXrqcCameFA9igUwa5H4UAzM1/BZmbeQOxRmsFmZt5Ampmzwc3M1EDsUcjB4Xq8QAAA3sHsUYhA9ijwwQAAAEAAAP7BmpkZvzMzBMKPwnXAPQoFwnsU5sCamQTChestwY/CA8IUrm/BUrgAwsP1lsFxPfbBw/WwwUjh5MEAAMrBZmbOwaRw4cEpXLXBCtf3wT0Kl8FI4QXCpHBxweF6C8IK1y/BH4URwmZm5sBI4RXC7FFowLgeHsKamRk+j8Imwh+Fe0B7FC7CzcwEQfYoMcI9CrdAuB7nwcP1GMEAALDBheuvwWZmgMEfhXvBpHAhwexRiMBxPQo/fJtGP1XeDj2nP1s/RGmvParUbD+ERxs+aod3P+V+Zz4AAIA/nPmlPgAAgD/UYOo+Gcp5PwTiHT8IlHU/EMwxP2l0bz89YUE/1NRiP+aWVj+Z01U/t7RiP600ST9YOWw/2PA0PyAkcz+SliI/Gyp2P4FDGD/3Bnc/on8KP/8Edz/VePk+Hy55P2OX2D4oLHk/opexPse6eD/ePIU+0Lh4P7/xVT6ASHc/PtAqPpW3cz/3x/s9/RNsP/RPsD3cY2E/YaZtPXwsVT9XeBc9kuhFP88sCT0+IjY/R3cQPVLVJD/A7B49Y38RP7hYUT2SXP4+GXOXPQ/W3z5WZd89sFXCPip0Hj6t3aY+iZhSPn9qjD6kwog+QQ5qPrU3qD6ynU8+hV/KPrcoMz7l1ek+KNUePnK/Az+vX/A9onoTP7gBnz3SNSM/hLszPc9mNT8w9fM8k6kqP+AtoD66LNY+zhnhPqm8XT62hAw/C++iPrKFKD+0HwE/L4ZaPx/0fD9+HZnBAhI9QUbOQjzjQyjC/IUpwtuFdj9cR7nBkg+/QMyXFz2qGhHCEO05wn7jaz8gQs/BNMHGvtPeoD0/pe/B80NFwrQ8Xz9HXtTBDmnLwJEKAz41+b/BOiZIwlDHSz896M7BooJXwSLgUD5GAIfBss9FwhakKT/yl67BCuGswYW2rD4x4ArB4Bo2wiBe5z7Ar3XBDqfzwUhQDD+ytYI+YLgcwvWctD4X/T3BEocKwt6wJT+XTY9AAAcPwjI9kT5XOgbBBRYWwr9gNz+LTO1Acz8BwpVlSD7uVB7AJZMjwvPlTT+A5y1BuozTwY51ET7jWx1ALCEowvWhWz+6NUFBvzeswXCZ0z3CKd9AdXEqwiqMZT+gdUtBAiqIwTTXaT3PKlRBDDomwuVhcT9r+ztBBoUrwT4FwDzAbpRB4Uofwi7/eT9jaiFBCeWswKzFJzwifqtByKEawkJgfT87aQ9BUkwgwNc07zt1eRhCMwFWQO8gfj8qneVAmgOdPySXvz7tDw5C2A3UQMYzID+c07xAm/emQEWBPj+Hf/9BTnYgQdf6gj59ZHBAVaQaQZ1LcT8d+NxBLPdfQbg7az2wj48/vnRuQe4Ifz/eXLZBOeCUQVVqdjvynOG/x2KnQQAAgD/BcZ1B8YmoQQAAgD8EeIVBKfC0QQAAgD/kOk1BbuC7QffMEjpz6ldC7diAwf3Zfz/yLQ1BfDi7QUinrjvc4llCFLxDwQqifj9XeqBAMmC0QQrcujwcglhCF0P8wHgoej+SYYU/3+6lQUaUdj34AFJCHH6AwBSWcD+XnALAICqPQec1Fj4rVUlCVLo0Pd5xWj+X0qPASplnQXUCqj4QQj9CN/KQQB7+Kj9VqgfB6UQpQeKSCz99NTNC0WgHQe3Y6D5IbTLBuQrNQO0qPD8ztyVCuzA1Qdaohz5VF0vByrsQQC0+ZT9KChVC9flZQVcJ1j2t9lbBCjwcwLthez9X8QFCbX11QaezkzyL0VbBEIHwwAAAgD/eZttBNuqFQQAAgD9EYq5B0V+LQQAAgD/xNYZB0BGHQQAAgD8bizVBU1+CQQAAgD/e589A1pR2QQAAgD+Mcq0/i8B7QQAAgD8MfILAfmyAQQAAgD9gOxXB9AOAQecdfz9zXmrBgvpmQZ9xYTtYfjLCT2oXwuC5dz99/EzApeqvvwEYTzofIWdBN4MNwqEQAT2zQOXBowXVwQEwdj/G4I1BcIsZv8KjDT3UydJAtkp/wQRzdDumI+nBLM61wAAAAD/q1QtC3lW2vgAAAD9IJfw+MqYfPgAAgD+M5DRB8EYCPgAAAD86vfZBqicnvgAAAD8s516/sZkEP7geQcHsUXjBZmYSwT0Kc8HheszAcT1qwdejgMAUrlfB9ij8v7gePcH2KNy+pHAdwT0KVz8zM+vApHDdP4XrqcAzMyNA7FEYwK5HUUB7FC6+heuJQAAAEECkcK1AexReQJqZ6UCPwpVAuB79QDMzy0BSuO5AzcwQQQAA2EBxPTpBheu5QLgeYUFxPYpA16OCQQAAIEAUrpVBzczMPilco0GF69G/9iisQYXrccA9Cq1BAACowMP1pEEzM7PA7FGWQT0Kz8B7FIJB16MAwT0Ka0GF6x3Bw/VYQVK4SsHsUUhBj8JxwRSuO0GPwo3BmpkpQUjhpsEpXBdBheu9wSlc/0BxPdTBhevBQArX58E9CldAuB73wc3MzD4fhQHC16NAwHE9AMKPwq3AAAD0wfYoAMEUrufBUrgawa5HycGamVHBPQqtwaRwacEK14/BcT1ywR+Fc8Fcj3bBuB7ZwexRNMEAAI7Bw/VAwT0KQ8E9Ct/ArkdBwClcjz+F65G/rkfBQMP1qD7D9RBBzczMvnE9UkGuRxHAj8KNQSGwAj/ByiE9RrYTP+/JQz0AxiM/QWV8PauVMT+8kbk9Mnc9P98yBz55dUY/bhc6PjDYTT/Qs3k+1/pSP8H/lj6Sy1c/+3S8Ps/3Wz94udg+iBFiP8jS9z7UfWg/uK8DP5hpcz8Mdgs//vF2P90kFj9bX3Q/aXQnPycxcD9iEDg/nbpqP7ubRz+ZDWI/whdWPxlzVz9SSWU/sD1LP0s8cD/ZWj8/Fk13PyzUMj9QAXg/GlEqP6qCcT8OSig/xcllP8o3Iz/tmVU/HhYaP/yMSz+Dbg8/CktEPyBj/j5Olz0/8PnhPi6QOD8Wh8M+lE0xPxn/nj76Cio/+wV7PueMID/PFDo+fEQUP3BCAT6Z9QI/6zmpPYT13z7Mf0g9J2u0PvFGZj23f5U+MiC7PcSUaD7WiwE+ATA+PoI5Wj7uJc09JTuWPjPcgD2HosA+BkdJPf3B4D5WDi09OPMrPgE1FT7mV8M+0T8BPvoKAj8DlYE+KVw3P5RN6T7TTUI//RMUP1DfSj8QdSc/7pRGP76kQT/9nzs/jPhePwAAgD+6ox5BedP9wAAAgD+wa01BLX0iwQAAgD+b7XxBS6xAwRjsfj/VnJdB46VQwSegiTuXXYTBfGXqwJVIej/v5rFBvvhUwW/YtjwmE1nB/NMLwQbYbz8at8pBD59NwZM6gT3TDSjBcH4WwUTdVz+SGeVBfSo7wVGIID7mVeDA7uEXwce6OD/YoPlBdPcpwSKJjj4gXYfAWU4WwU7R8T5V5glCZO4KwbEWBz8s8ve+nsYLwbq9hD78IhRCe9npwFxyPD++VhlA/akFwZm7ljvPGUTBosRcv+DWnT16QSBCZZvAwC7FXT8J8bVAWYIDwWDqZz1i+xnBYcI1wGACtzyMeyhCWwC8wAEwVj+2IvVAqPwMwXFaED7PgwfBY4yRwJNXZztWdTNC0PbMwIkMQz95oyBBeXAkweAtcD4OwvHALg3mwGL4MD/9B0RBkQIhwe0Nnj4cnLbAtsQGwdPeCD9k13BBlo8BwQtB7j7W0xLAkMYKwfFjnD7YtYxB4b68wGDNMT/x2Yc/2zUJwVN5+z0wkJ5BCa1hwC6QYD8KS4lAZmsCwQTKpjyugaxBtjkgvwjJej8VNu9AFUbgwAAAgD+adC5B8AOwwAAAgD9am1lB5RZdwAAAgD+ynnhBUJOmvwAAgD/DboJBtPuhPyQLmDnMJz1Co7SWQRe3UToz2KlBaatHQUG3fz8HLnhB1FhWQAqdVzuWkTVCtuSLQWVwFDwl1JdBBSs+QVLVfD+nRFZBfhCKQBNm2jwjrylC3Tl/QZKWij2igXpBEv83Qa7YZz9nNSlBjcfDQMO2xT3elR5C9Dd+QSBeNz4Rn1BBFL9GQVBwOT+5HBJBKNEHQXRBXT4YERRCOZWDQfVKiT70bCxBAv1dQYEJBD9/ywRBELgwQQfO2T5IWgZCo2iPQVABkD5+eAFBc8CDQQoulj7OnftAEQxsQaZhGD9hm/VBCY6aQYKQbD6XRbxAzleWQajjMT6h9fNAXZmPQRB1Pz847tpB1WqkQZfFJD5ozExAjP+oQZS8uj1wseBAIqGrQWGJXz9zWrxBg96xQc6luD19LmA+1mPAQVcJFj1uC9JAYNXMQVIncD+LTp1BEhG7QQX6RD12UUDAxvfTQWUZYjyNubNAZVDsQZuseT8AvndBGXbAQQ5PrzwApNXAO9XkQQqdVzvec4NAxvoFQo82fj9ZAi9BKd69QWwm3zsEsTDB8ULvQazFJznBmsY/PRIVQkq1fz+1+9RA8am1QYIclDrrlXbBXrLzQQAAgD/wUBdACE6nQQAAgD8FRxA/I5mTQQAAgD9Za4K+81VsQQAAgD8q25e+2A0/QQAAgD8GjTM+K+exQAAAgD/hCAVA5AuVPwAAgD8C35xAXwYfwAAAgD+kOeVACJijwAAAgD+cqAm9YsUOQQAAgD+bo/hA2tzMPQAAgD/MhYlBlFPQvQAAAD8E2wFCgb81vwAAAD+J2+c+LQ0RvwAAgD/sduBA0CfqvAAAAD8BaDNBF4pfvQAAAD9pgjW+2kGDvAAAgD+6zp9ASuGqvgAAgD/GvjFB5+oVP2ZmcEJxPYo+16N0QuxReEAzM3NCAADgQEjha0LXoyhBcT1kQlyPWkGkcFlCheuHQY/CQkLsUbpBpHA3Qj0K0UHD9ShCPQrnQdejG0JSuPRBj8INQvYoAUIfhfVB16MHQj0Ky0GuRxFCFK6rQexRGUKuR49BXI8dQqRwWUEpXCBCw/UYQexRIkK4HrVApHAlQo/CNb/heitCKVy3wB+FK0LhegTBuB4lQs3MGMGamRxCZmYuwUjhD0JI4TLB7FEAQrgeKcGuR+tBZmb2wJqZ2UGamYHArkfFQcP1iL8pXLVBcT3KP4/Cm0HhemRArkd9QaRwtUDNzDRBSOEGQY/CtUCPwi1BhesBQHE9dkFcj6K/9iigQUjhesAAAMBBuB69wPYo7EG4HgXBSOEHQrgeBcHhehVCZmb+wLgeJkIUru/APQoyQrge5cAK1z5ChevZwLgeTEIfhcPACtdaQlyPmsAzM2ZCKVw/wArXTUIpXKFBAAA+QkjhSsDNzA9CKVxPQI/Cs0EfhStBpHBlQT0KoUFmZsZAXI/wQYXrMUCF6wVCUrievilcDEL2KKTAMzMNQkuweD+SBSw+AU18PxNJdD6tF3s/5E6ZPmPRdD/Ut7w+f01uPy7i2z7/IWU/3Cn9Pj3VUT9qGB4/MC9IP91BLD+H4Ts/OBA6P5eLMD+0jkI/c7okPzANSz8qkRQ/7C9TP2N6Aj8dOF8/TkXqPg9FaT+BJtI+n5NuPxu7tD4EHHI/ijyZPhiVdD9ma30+lnh4PzWYJj4AAIA/+mHEPQAAgD866X091Ql4P917OD1uaW0/pn7ePIF4XT9Uxr88N/1JP/mDAT2dnTw/TfOOPQOVMT9NMvI9ZeQkPymzIT7o9ho/vMtFPpn1Cj/T3mA+u37xPuJ1fT5HPcQ+N4mRPjjziz53FaI+hA1PPk/pwD5J1ww+hXzgPqTHrz38jPs+gLdAPX2RED8AAAAAQbcfPwAAAADLSis/uYjvOz90OT+4HoU8Bp5DP3C2uTxOf04/3/3xPJXUWT8zxDE9iV5mP5nwiz1HA3A/+KrVPVc+Wz/kgw4/HclNPyntzT3RdCY/HThnPkok8T5MbL4+Ksa5PgtBDj8KaII+I/g/P0gzVj5AE1E/OPMrPi8XWT8C1NQ9gSZaPwAAgD82oljAlVE1wQAAgD/G6xPAa5R+wR2sfz/wh4g7IaeYwSF2pjqGpwfCL2sGwnQpfj9mqYVAyWquwVLy6jsCc+jBj9UKwjkLez/B1wJBKCLAweSDnjznSMTBFZcNwgT/cz+Qq1JBb8fPwT4FQD0QbJnB3AAOwu2ZVT8rvLlBWZvqwauVKT6oagnBJqMMwi6QQD+4XOBBUVn1wam8fT4sB2bAY/kKwkMEJD9itQZCKGn7waK0tz5+svk/VAAGwm8SAzrgaRrC5G69waoOCT/MaBlCY9v5wUME7D4klchAvpH9wUvlbTvy2AfCuLC4wVey0z7FsSxCiYb3wYofEz/HBStBVwDuwbt+QTwDd+nBpRKzwSgsgT5eWUVC/C7uwa8INj9YhIBB5CHUwVcJFj05IrnBl42lwcWs1z1UY2JCWvPowXztST8MLLVBQBO7wRni2D0fbn/B4GCbwYzzNz0WZXhCfRjnwQaeQz/7zt1BxxCqwWaIQz6TCijBTcWVweSDnjx/OYVCdc3ewYtPMT8azPxBmsKVwVx3kz5nAsPAc2yKwUjElDtxe49CU5TPwUATCT+4/w5CxX5ywb4w6T5swZK/tIBvwWVwlDuWy3vBVTwJwZxQCDmj2ZhC0fW/wfZFoj6Z3B1CSTI7weFFHz/doFZAIfpJwYLKeD1MmyrBxyEKwVrY0z36aS1C058JwerPJj/pl/1AbLQqwY3Rej5Qu7bAGRQRwf+VhT7E7XhBbgn3wFk0PT+bUBpAth0hwazFpzft71dC1GWHP/uWOT106aVBbr+FwJlkdD/zZApBLkwWwdvcGDxI4rFB9hs6vz2bfT8pkzlB8cnhwAAAgD+UJU5BZoeHwAAAgD8yAWJBYfnKvVMiCTwSvZVB8+UsQSfafT+YCF9BxbeYQKMG0zv/DDRCVkyEQa2GRD3umYFBRwZSQTgQcj8nDE1BARkAQWjLOT0/WiJCpzV5QXfzND6H3TpBWv1VQcQlRz/WJA9BZrslQaOSej704AxC2iZiQVYroz643MNA1JFWQQmK3z5EBYJA9TZQQc4ZCT9sVfdBJD9OQSUjlz4SKNI/fKlVQd9PLT6Tj7M99DtxQdEiWz+Dyc1B3fxOQadc4T2tklbAPnFsQS/6Cj1DM2nAEoSVQSegiTrWWYdCs4DTQABXej+3IaVBLH5fQRY1mDypTf/ARPmIQbnfITtWstPAK4O3QV4R/Dz+ZHpCuNYjQY8ZeD847WlBgsp5QazFpzi9i1XBKnGiQd0HQD4th2BCaGBqQWjoTz9y1OBAoAaMQffMkjlUVKHBxynBQYKo+ze8vGDBfogLQj1Esz7F9ExCC/OIQelIJj+gOco/rvqQQffMkjmjBMrBLoLRQYKo+zfzhozB9lYcQm6LGj9AHTFCWE6PQZ/Nyj58KqfAVJ+DQWK+PDlLBQHC5xXTQazFpze/LL3BLEEqQs+DUz/YcBZC8IOPQRDMMT6YyzfBHZ9iQc2v5jgImxvCxbzOQazFJzdmGu7BXOI0Qra5cT/qOABCwjCNQbYQZD2cxITBTm0/QYKoezjCpDHCEqDIQRU6fz9IisRB6euGQVWkQjvhxrrBERoKQYKo+zf4N0/CKkO9QbD+fz8T1Z1BsO9hQazFJzdwkGHCNxWkQVj/fz9IFYJB5vM5QVj/fz+WVUBBn+cIQVj/fz93vw9Br4XLQFj/fz8oELdAmTKAQAAAgD9EuSJAME+ZPwAAgD+jWyu/j6cdwAAAgD8d2SfA5uPGwO+PZz+bP5JBGyLdwUp7wz1s1VzBKCsNwgAAgD+BGQNBvC02PgAAgD+Uo8VB1GOpPgAAAD+55S9CHbICPwAAAD+dQgc/FTLQPAAAgD8Hk4BBwqVYPgAAAD/bhABCkD2ivAAAAD/x9h2/E8cVPwAAgD9vOqpAtLECvwAAAD8PShpBbzSAPAAAAD/m1lg/Cq3qvgAAgD+PqdtA4A9uvc3Mm0LXI7rCH4WbQgCAvsKuR5tCcb3Cwrgem0IK18bCcT2cQoVry8Ls0Z1CrsfPwq5Hn0LDddPCClehQmZm18JIYaNCmhnbwnE9pkK4Ht/CFC6pQlwP4sJSuKtCFC7kwo9CrkJm5uXCpHCxQkhh58LDdbVCPQrowh8FukK4HujCXA++Qrge6MJ7FMNCAIDmwqTwyELheuTCSGHPQsN14cIfBdRCw3XdwsN110Ls0djCFK7aQlyP0sKaGd5ChevLwuxR4UKPQsXC9ijkQh8Fv8Lh+uZCKVy4wjMz6UIfhbLCUjjrQkjhrMLs0exCCtenwtej7kJmZqLC16PwQilcncL2qPJC7FGYwnsU9ULhepTChev4QuzRkcL2KP1CmpmOwimcAEMp3IrC1yMCQ/YoiMKPQgRDj8KEwsM1BkMpXIHChWsIQ5qZe8IpHApDzcx0wlwPDEMUrm3CCtcNQzMzZsK4ng9Dj8JewuE6EUOF61bCChcTQ+F6T8I9yhRDKVxJwuxRFkOF60HCj4IXQ+F6O8I9ChlD16Mzwj1KGUPheinCrscYQxSuIsIUbhdD7FEewtfjFEOF6xrCH8USQ83MGcI9yhBDFK4ZwtfjDkMUrhnCAEANQ1K4GcJxfQtDUrgZwnvUCUOPwhnCjwIIQ4/CGcIKVwZDj8IZwgAABUPNzBnCAAACQ83MGcIAwABDMzMawmZm+0KF6xvCFC74Qj0KHcJxvfRCUrgewgrX7UIpXCLC16PqQhSuJMKux95CpHAuwjMz3EKF6zDCPQrVQnE9OMLNTNBCj8I9wuH6ykK4HkTCj0LIQlK4R8IzM8NCcT1PwgAAwUIUrlLCUji7QuxRXMKambhCSOFhwq7Hs0LD9WzChWuqQtcjhcI9iqhCFC6Iwj0KpUKF64/CXI+jQgCAlMJ7lKJCmpmYwlK4nkL2KKnCFK6dQincrcKux5xCw/WxwjMznELNzLXCSGEDQwrXGcLs0f5Cw/UawlI48ULNzCDCAIDnQh+FJ8IUruRCUrgpwjOz4UJ7FCzCAADaQq5HM8KamddCUrg1wq7H0kLD9TrC9qjNQvYoQcL2qMVCzcxLwnsUvkJSuFfCZma2QnsUZ8IfBbJCpHBzwvYosELXo3nCj0KuQo/CfsLNTKxCMzOCwuH6pkKamYvC9qihQlK4nMIUrqBC4fqgwincn0J7lKTCpPC8QuzR18IKV8lCFC60wgrX2ELD9ZDC4frsQoXre8LDdfxCCtdZwikcCEO4HkTCjwIRQ4/CMMKm1RA9nrWbPiegCT3KFY4+1VsDPW+7gD6SXP48rMVnPheCHD0MAks+P1JEPbmILz4eFmo9g2kYPrQ8jz1qh/89WW6pPf5I0T2l9809DMiePQex8z3RlnM9HhYKPmItPj25Uxo+4QsTPR7ELj55Htw8EXBIPuVEuzx+xmU+Uiy3PMSZfz5KQbc8V+yPPpMYBD1moKI+fa42PelDtz5NSoE9ERnGPjfgsz2hENE+/wnuPbth2z5+Oh4+S1nmPnv3Rz5lqvA+2bFxPjGx+T6sc4w+p1wBPypSoT5T6AQ/26ezPhQiCD9TXMU+rrYKP9Qr1T40nQ0/FD/mPvXWED9FDfY+DhAUP2PuAj/27hc/3e8IP/YLHj//IQ0/qtQkP1UwEj/mVys/JAsYP1Q6MD8BTRw/sAM3P4CfIT90QT0//vEmP6BPRD/9hyw//bxJP3vaMT/C+k8/InE3Pz6uVT9JSz0/E2FbPxgmQz/4iGA/D0VJP0WBZj82H08/ou5rP2TpUz8P0XA/i8NZP52ddD+J0l4/CoB5P3fzZD9yUHo/QuxsP6OveD/APnI/HVp0PyS0dT8JOGw/EF14PzJ3ZT+BPnk/Nh9fPxBYeT9sCVk/ylR5P33QUz8qUnk/si5OP+ROeT+M20g/REx5P6sEQz/+SHk/hbE9P7dFeT+EZDk/GEN5P9nOLz/ZPXk/fdArPyzxeD8DCSI/HJl3P73jHD9BvHY/yF4XPzlidT/eVAw/ZY1yP5gvBz+JtXA/LH3oPjgVaT+9NeA+Px1nPxhDyT5PXWE/DRq6PrcLXT9aDak+Ew9YP4xnoD42PFU/8SmQPqRTTz/XF4k+jKFMPwJIbT6DF0U/toRcPh+6QD+Vmj0+sP43P0TAAT6X/yA/6GrrPT4/HD/Jdr491hwQPxeaqz3u6wg/9wafPaJ/Aj8plls9+PzQPmMLQT15O8I+5/spPTBktT4AUhs90lKpPrk2ND/ZPXk/1IInP4JWeD+2uRE/n8hzPxcrAj+mfm4/Ek77PpfFbD+CxfE+FO1qPx8u2T67RGU/P3TRPhxfYz/GFsI+SkFfP9mxsT7dXlo/5gWYPmQGUj8Cn38+S7BIP+FdTj6dnTw/N3EyPhTtMj/HYyY+9gsuP1hWGj7gECo/s80NPiyfJT/Ugtc9ZtoWP3eEkz3mBfg+VvGGPYqr6j5z9Hg9yF7fPqZheD4uc/o9qdmjPq1prj5dbdU+9n8OP1rwCj/MRSw/3LojP2ACRz/vVUM/5gVYPwbYXz/ONmc/3IB/P+LxPUHu6dRBDvj8OhGPMsJX8ydBKuN/P9/JE0FJLc9Bn3HhOeL/OsLSOAxBWP9/P1PL1UD1cclBAACAP74th0DMj8NBAACAP44X3z+O2LZBAACAPz3rA794T6hBAACAP6VTGcClcZtBAACAP5jeicBsUYtBAACAP/upwsDcWXdBAACAP4Ez/MB/RU9BAACAP3BkEMHy7ilBAACAP8o4HMEnCQtBAACAP1pEJMEa3tpAAACAP+73J8HLG5VAAACAP+8wIcH/iAlAAACAP2gtE8EFRRC/AACAP1IXBsFw9DzAAACAP/gBzcAw+LLAAACAP5vSgMDZYQrBAACAPwOrb78fhz3BAACAP2mTF0AweFzBAACAP8XeuUAs/G3BAACAPxiXIkH4K3jBAACAP/98bEGHgoHBMlp/P8D2mkGU9IXBliYlO5JcoMEZ7M/BN+B7P9QUvUGYSInBJuSDPKC+f8FL/cTBMZlyPzwn4UFA1ovBeGJWPZ/VO8GrjLjBa0hkP+4vAEJM4YzBa7fdPQwDAsHDt6zBXdxOP64pD0ISTY3B64tEPkcIlsCr1qDB2Ec3PxFhHEL/tIzBsW2RPnAs2r9OeZXBLzQXP0G4KkJ+gYzBU5bRPn8txz8EjInBkgXsPpBCOELRzY3BNWMJPxu/lkBbSX/B6rIYOzokpcG+gL/BEJKlPgXRRUJbMo/BPlwqP8P4+0AVoGvBjIQ2PPFxkMHM7q3BFjVYPs3bUELUbJTBu/JBP1aQKkG1FGPBB+v/POqPecE5mqLBR6wFPntCWkIoSKLBwi9NP/o3WEHL92zB4h6LPXgvS8HlzZ/BDjKJPShPZUKxH7HB9wZPPxdZhkHx83XBAJH+PS+oFsG0dpvB/kP6PGBxcUKmRb7BXp1DPxXfoUFnEnrByTxSPt2VwsBVZ5TB2A1bPJJOekLSX8jBniQ1P4IutkHc/H3BttuOPheCZsCgm4/BWP9nOx7kgkK57NbB3dIaP+wT0UEq34LB+IjIPqpDiL6ueIrBnFCIObV9iELl3ePBeo39PiPQ6kH6gYXBQiYBP0VqOECQioTBFmq9PkB0A0Irf4nBTUohP2afy0AkPH7BXymLPhdvD0K/O4rBqWo6PyeTE0Fv8m/BF2U2PgGYHEK0UozBE2ZSPw6vRkH6q2LBLufSPXqAKUJnjozBc6JlP1ugd0GsN1LB3xpYPZlfNkKV24zBqn1yP+E8lEGk8EHBjxmoPKEHQ0IEPIvBjL56Pzqgq0F8Ti7BVcGoO64sUELOHozB1q1+PwrCxEGuxh7B98ySOk2RW0JIF47B8rV/Pzvv2kGblhPBAACAP/Ul8UEC+gDBAACAPxaYAUJWOd/AAACAPzTvDEKVdrbAAACAPwT4E0LzkELAAACAP5auFULm/ly/AACAP81BEkLzkZA/AACAP5QCCUKvSGNAAACAPylKAEKrIqNAAACAP6c170HSK8lAAACAPz1o3kHbpuxANIC3OTZTbUIHrTW/aOh/P33bz0EzdgVBjKEcO8tQZ0LFwGU/t2J/PwVLwEEU5RVB/dkPPHCcYUKu5xlA8L99P/6QsUGoNyVBA+yjPJNlW0JlIoJA+N96P7F4oUH0NTZB5fIfPdOxVULg7rJAKgB2P/mzkkG1zUVBenB3PS4VUULZ0NlAUYhwP2XOhkFlI1JBT1gCPuDWRkI2vRhBnWhfP2GNWEE3Jm5BZOkjPr40QkLnoilB/wRXP5iCQUFHDXhB9rSDPqg4NkJAU1BB3SQ+P/qMB0FUdoZBiUGgPomzL0IUBmRBlN4vP9/r0ECbgItB9dbAPltLKELXandB3pMfP2Y8jEBm0Y9BMBICP8wwGUKDso5BAtn7PqkgGj144JdBvTrHOXhrskI8SIE/EeQQP+abEULDbJZBwATePt5yBMCgN5pBNlkjPLvYp0IgHuFA529CP9fl6EEIFbFB8wJsPtzGIMHeUqBBGcqJPOVVpUKG8wRBqG9JPy6P20GdRbZB3gJJPrJhPcH53KBBCf43Pa4bnkLq1TxB4LlXP0e+tUF67cNBfCfmPbfkhsGfZKFBniSdPcjsmEJsvWBBM1BZP0J6m0Er0ctBi1SYPXRLosHpQKBBRwP4PZsCk0K0YoRB9GxWPxBle0EUZNRBtB8pPbM9wcFfnJ5BlN4XPrnHj0JJVo5B5ElSP7irW0ETLthB4Ln3PDp40cE+AJ1BmExVPudIiULxLqBBo0BHPyCmHUHj0t1B9blaPMKe8MHOL5hBdXZyPiRchkL8zadBHy5BP3QPAkGU/N9BBOcMPN5c/sF/t5VByaujPo+jfEIPV7tBwqMtP0ODXUAXpORBwAkFO+mVEcJw5Y1Bd6G5PiTxc0I5O8NBgA4jP35siT/2t+RBgqj7OWOfGsI/uIdBRG7mPnrvYkI6D9FBj8cMPzLVYMB2aONB1cosP4euOELXl+VBtmemPpg4Y8FbitNB7fU2Pxb4L0ISkOlBiBGSPjUig8EDB9BBIQdNP/vTGkJrle1B3+BLPvdaq8E0YsJBNxpYPwDMDkK/Ku1B5pEfPj0jwcG4JrhBlNlgP09OBEKZKetBHy75PaB108FFu61BeLl4PzgGtEH/meJBF7zoPCyQDsKDSYNBPst7P14bnEG96N9BRG6GPBvsGMJpE25BCad9PyhBh0G1ht1B0xMWPFbyIcLnplhB+8t+P/dMaEH2DNpBkq6ZOyfzKcJ8qkJBT1gCPsmDS0KwcARBnWhfP9jdcEFcFmFBZOkjPsnvPEKJnjpB/wRXPzAJKEH7mYBBMBICP7RiIELJA4VBAtn7PkqJCECdb5NBvTrHORh4r0InEiVAEeQQP6qnCUKlC51BwATePu0Eh8CfRJtBNlkjPMUGrUK8xIBA529CP+XUAkIFl6NB8wJsPqIqw8Ce/JxBNlkjPKRsqkK/grFA529CP5gt90EUcqpB8wJsPgFyAcGruZ5BGcqJPJ4Mo0Jj8RVBqG9JP8i8z0FSR7pB3gJJPopYVsHsx6BBCf43PX+ioEJ6sihB4LlXPygWw0ET4b5BfCfmPflDccEb/aBBCf43PbCVm0LWz01B4LlXPx4PqUHyicdBfCfmPZ4PlMGsp6BBRwP4PXfYlULCNXRB9GxWPwVBjEHFp89BtB8pPavvscEs5p5BmExVPp5QjEIMVZdBo0BHP1MDO0EUttpB9blaPFe64cG+DJpByaujPowygkI+ibFBwqMtP/Nrt0A8DOJBwAkFOwSUCMLiY5FBd6G5PscCbEJnbclBgA4jP5e2hr9y4ONBgqj7OV+FIsLSW4FBRG7mPtDYWUI4I9RBj8cMP7jKt8AXxt5BRG7mPjACUUJa6tdBj8cMP9h8/sCZ+9pB1cosPz1qSULSwdxBtmemPorrHsGGLtlB1cosP2soQUIlduFBtmemPsnnQMFKttZB7fU2P+WdJkI8Z+tBiBGSPrrzlMFKDMpBlNlgP+Wh80F/1+hBHy75PUWm5cE8BqNBb9huP8Lk3UEBlOZBTDeJPUSO+MHuDphBeLl4PzaJy0FnoORBF7zoPKJABMLrwo5BAACAP53xgz+QP4E/AACAP/7rxEEykmQ/AAAAP8lQQkKpMJK/AAAAP7V+Wz4wXlA+AACAP6Hhi0FA8mG/AAAAPzv6/kGpdi2/AAAAP7iRxjx+CR2/AACAPyvVYUGP0MC+AACAP8Y31kE0WGG+j8J+Qs1MnMJSuH5CCteVwlK4fkKuR47CCteAQqTwiMIAgIJCw/WDwsN1hULDdYDC1yOJQo/Ce8IzM41CUrh0woVrj0Lhem7CSOGQQj0KY8Jm5pBCexRZwjOzkELhek/Cw/WPQlK4QMLheo5CexQ2wj0Kj0JI4SXCFK6OQq5HFcL2qI5CpHAFwj0Kj0LsUfDBhWuPQsP1zME9Co9CMzOtwVK4i0KamSnBXA+KQo/C5cAfBYhCcT1awMN1hULsUbi9het4Qilcx0C4HnBCexQKQT0KZUKF6zFBmplZQuxRWEEzM05CexR6QWZmP0IfhY9Bw/UxQuF6mkH2KB9CuB6hQT0KEEJcj6JBSOEDQq5Ho0HheuxBZmagQfYozkE9CplBcT2eQY/Ci0HD9YJBmpmDQYXrTUFxPW5B7FEUQTMzT0GamcFAZmYqQYXrUUCamQVBSOF6P2ZmvkCF65G/j8JFQLgejcB7FE7A16OwwMP1yMCF6/nA4XpUwXsUCsEzM4fBcT0Owa5HpcHD9QjB7FHGwQAAAMFI4eLBhevhwFK4+sHXo7jAH4UJwuF6jMBcjxTCH4ULwHsUIcIAAAA/hesswlK4PkDhejbCCtfDQOxRP8KkcBVBUrhGwj0KQ0FSuEvCw/VkQbgeU8IUroVBKVxcwuxRmkEK12TCcT2uQexRbcL2KMJB9ih2wkjh1kEAAH/CFK7tQVyPg8I9CgNCcT2HwlK4DUIzM4rCZmYYQnsUjsIUrh5CMzORwgrXI0JxvZbCH4UnQj2Km8IzMytCrsejwgrXZ0LNzKPC4XqAQs3Mo8KkcC3AH4VrvoXrtUGamZFBexSBQkjhOkDXo4xCuB5dwY/CjUJxPY7BpHDVwB+FH8HXoxlCmpl1waRwQELD9RTCUrhpQuF6eMJSuG5CSOGQwuF6VUKuR6HAcT2CQB+F4cE9CiNBXI8awdejG0I9CndA1hxgP7WJEz0uHGA/wVaJPS4cYD+fyNM9WFZiPwk4BD5J12Q/w7scPp1LaT/j/C0+Bd1uPxiyOj6k/HQ/OPNLPjtTeD+7YVs+ZY16P3OFdz5ljXo/lgSIPvZFej/M0ZM+4Sh5P+z6pT637nY/DhWzPl3Edz98D8c+fjV3P/J72z5+NXc/uAHvPrXDdz+KWf8+7FF4P/uRCj+1w3c/P1IUP4PAcj/vjy8/6j5wP9P2Nz8bL20/D0VBP/5IaT9QcEk/NLpbP94CWT+3C1U/eeleP+6xTD9nCmU/thBEPwLxaj9+bzs/SilwP61MMD+R1XU/jiMmP1Q1eT+V8Rc/T0B7P/2HDD9OtHs/P1cDP6Luez/GFvI++wV7P5ZD2z6twHg/ahO3PrmqdD9jeqI+FytyP35SjT52T24/FTpvPi+LaT/hQEg+QN5jP77ZJj75MV4/qwQLPrZKWD/l0OI9yEFRPxTokz1eukE/VB1yPaUxOj/OcAM9c/QoP2fttjzmBSA/81mePGXHFj89J708t5cMP/2H9Dwk0QM/2EcnPcP1+D4sn2U9mPrpPrk2lD0UXNw+pKrJPZHtzD5XIQU+Dme+PuQxIz7ZmbI+Wg1JPqK0pz6OBnA+uqCePps4iT5ybZg+BwiWPopZjz5vgaQ+/ACEPpMYtD7aIHM+2iDDPh09Xj4gKdI+T3VIPvW+4T7jqjI+ZQHzPhSzHj7JsAI/pIgMPiLDCj/iBvw9JNYSP6Tk1T0/kRc/nge3PVx3Gz+PjYA9vD8eP3CxIj3ECCE/AAAAAOHRTj8AAAAAIchhPwAAAAAO+Lw93xVJP7jkyD5fe3Y/ea9iP/XWUD8HJXQ/Ap8nP1PQdT8e3B0/Ecc6PR4bMT/3xxM/HNMjP/kPMT/D09s+oztQP8rDQj7zAlQ/gjm6PRv1QD9jRT0/r18wPrA4BD8hPHo+I9sxP0BNFT/+K1M/AACAPyYApkHn/ThAAACAP1E9hkEiAWhACtcjPGFmkUJ5EAlA/G99PwgvQkGf+I9A4LkXPirli0LtzIdAOBBaP2hxEEHy0MBAc52mPlHkhkLvuctAn7AsP24lxUAD3vNA6rL4Pvs1hELLXw5BPKUDPxpOi0BBfx1BDwsVP7PugkJaIzpBDM3VPpNrTEA5b0ZBcjNcObBLTsK1sFBCvfsrP5q9gEJq7mxBa5qnPoYuwD9Y2HRBW5RZOn7IUsJBB0RCYYk3P7lPfEJjlIZBoiiQPucQIr54N4hBBK3AOkXDU8JugTpCuY1GP9dmcEIRA5hBICliPn0tYMBdrpRBk1dnOwziT8ImRCxCXYpTP/7dZEJVYqFBqmUrPl7l0cCpYplBdcjNO9TIScJ8aSFCSbpeP5SLWUJsZqlBBHP0PVR9GMGY15xBn6stPPdtQ8J8OBdC5dVpPx28R0LIt7NBCTiEPYFiYsEjCKBBUU60POS3OMK0FQhCjBBuP5YDOkKJw7ZB4C0QPcKzjMERrp1BY7QOPUbwLsK6rvxB7IZtP5K+J0J7dMhBZXAUPDz8s8Fe7KdBFjCBPZQqJsKcEthB7rFkP1onFEIOQNZBs++KOiAa3cG/1K1BVDrYPZMlG8LF3LRB1SFXP+fCAUI36uRBDHYjPtRVEcJRd5JB0uNHPxls5UHsDPNBGm5gPub4CcLZTGlBdAcxPzsdvUGHpAJCyO+dPrXK/8EgiBpBYoQYP9yQl0GTKAlC7fXOPsKN6sGwrq5A4zZ6Pndbq0DKCxZCn3FBP9iZpcFzB7HAkq4ZPvUngD9KkRhCtJNZP16CjcF70gvBA3iLPcA0dsAQ3BpCsI9uP40TZMETWEPBqRPQPG21BMFbGxtCu355PxQNLcHUeHDBAACAP+GhAcCAApnBAACAP/Bb7D9VCKPBAACAP6SazEC0BqvBAACAP6W8L0H/yrHBAACAP+0idkEmFrbBAACAP/alpkEr7bfBAACAPzGiykFmRLPBAACAP1Wc90HVTKPBAACAP3awDELCN5LBAACAPwMiGkLXAITBAACAP1sTKEIrGWDBAACAPytKNkLTsirBGHh+Pyk/TELSb6XA/Z/DOwD12UBrY3TCODKPOynczsHX4xRCEOl3P72PWEJLoPq/gufePAYBIUHQPWjCFeP8PCnc8cEKFw1CPq5lP4fvY0LFwPI/CVCTPW/XUUHVeVnCWp6HPRTuCsLXYwNCA2BMP7LObkJaOsdAiqsKPtqLgEE/yUjCpyLVPa4HG8Kux+9B8KIvP3Mjd0K2ZStBTOBWPu8qk0EUVDfC0h0EPkjhKMKux9hBSikYPyyDfUKavW5B5ZuNPhDCoUHt3ibC32wTPkhhNMKux8BBM6cDPzrMgELZl5dB2/muPpixq0GDAhfCHHwhPuH6PsIULqRBjKHcPm3hgULi7bpBF5/SPu34sUERfQXCOC0YPntUT8L2KEpB9OCOPos1gUJc+QBCQYISP9I3s0EU68PBlrIMPkjhVMLD9QxBrMpePqmyf0JGBRFCCCAlP2yPr0HKkqPBmpmZPXtUYMKPwnU9Q8rPPQ9keEIYHTVC3dJSP9X1pEEKYTXBIAw8PRRuZMJI4Y7AuYhvPSAHc0Jj4UZCY0VlPzI3nEEFeNrAbheaPOG6ZcLXoxLBNIXOPEriakLu31dCy7l0Pw7VjUEqPR7AqTC2OuhCX0LdBWlCQKR/P80JcUHW/fs/AACAPwZFR0HY9bRAliYlOvNpzcDCfnXCD9Z/PxXwG0FWgwdBLLc0PPavEsCcLHXCfCx9P62a00BtgjJB8KfGPBSzxj//6XPCGcp5PxQsYkCAsFdB98ySORQuRMLDtQbCngd3Pb/MxkABfm/C3XtwPxcBLr+yHnxB3V5SO67HNsKPghXCJLTlPXBPLkGokmjCUkmdOegHE8KmUYXCzGJiP9JnqsDNqYxBYqHWO0hhKsLDdSHC28QpPrcmbUH5hGHC9DehOk3+BMLJVIDC845TP0vhFsGxDJdBMC9APBSuGsKPgizC4V1uPgvJlkF7EVfCwypeO7N17sEBR3PCUYhAPxnIYsHP45xBGxJ3PHuUCsKPwjXCtwudPtbzs0E+k0vCvQD7O5tS1sGRKmXC46UrP0d1lsFXJp9BHSCYPPao+MGPAjzCptXAPkksykFIrkDCbCZfPDjExMF+UVjCQ1YXP0uLtcHyrZ1BEr2MPMN148GPQkXCaW/gPqg940GfSjrCA8+9PAeqrsHCnE/CTHEFP/rB0MEh1KRBfnRqPMN1y8Fcz1DCsyQAP3bPAELNdTPCoYQZPfiFk8G59EXCwi/lPi+G8MGX2q5BhLszPPaoscH2aFvCPzoNP0d0D0KLcCvCfnRqPVrVc8FHPTvCeJzCPn2HCMKGYLZBCp3XO4/CmMGPAmbCGosWPyruHUIw1iPC3UGsPQH0QMEL9zDC83akPrBkGMLdTL5B5+NaO1K4f8FcD3HCjBUdP/PSLELEZhzCxf7yPc9NDMEexibC0VyHPhd1KMKZB8dBIXamOoXrS8EpHHzC8UsdP3DnO0KQgBTC2ZQrPs6RrsBnFxzCOuldPij4OMKLUM9Bgqh7OYXrEsFIIYPCDaYZPySiSkKsDwvCBahpPspdE8AD9w/CPX4vPu8+SsLd1NRBIeoOP5LaWEKWVgDCaoefPqe2KT8NrgLCLT4FPu/+W8LlwddBb2T+PiCyZEJJau3Bq7LPPvhLRkC32+3BWp7HPWg+a8LCJdlBArfOPhGsckI/3tvBBDkIPz4qw0ApNdfBWVGDPZaDe8KBqN5B846jPvDVfELVHNPBR1oiP2wNBkEPqsrBA889PacBg8J7p+VBMnJWPr0LhkLzdtHBVitDP9JEQUFhHMPBt+7mPDD5iMLbu/hB0/YPPoV4jEIN39HBGxJXPxXYc0FYgr7BF/GdPFmzjcJgEgVCuB7FPc/ilkIQsNjBR8ljP+IcpEHPFr3BmWRkPMtWlML+ehVCw2QqOnsIpUIvFxjBSaJ/PwpBwEHefqDA09lJOvNMtsLbqudBAACAP+zey0ENvSxAOC0YPnvURsLh+oJB9OCOPjQzgUKhjd9BQYISP5FHsUEvQubBGHh+P30sQUI1P/nA/Z/DO6a/eUB9PH7CqRPQPBzlTMHhjRZCu355P72B0sA3nYfB4zZ6PkPeFEE0LhJCn3FBP9N8ucFyJBTAYoQYP3iJYkFpZg1C7fXOPg3l0cF+pNI/mpmZPUihWsLsUYZAQ8rPPfOYe0Lj5yNC3dJSP+Z1qUGB0HrBAACAP9ej2D+PwiHAAACAP8f+0EGOVwK+AAAAP4Yqb0Jz3IE+AAAAP3CnIb5DwQo+AACAP8bvTEGWFze/AACAPxt6KD/CT7S/AACAP6Bnd78L556/OnWFPntUBsJSuJJA9u6fPuEIM0Jd8PFBMZnaPlh3HkCWH8vBAACAP07zrkG5ygrAuB5xQq5Hk8GPwn5C7FGOwRSuhkIAAHDBrseHQrgeNcEfhYhCKVz3wClcikKkcH3AuB6NQqRwPb97FJBCpHANQMN1kkIpXIdAZmaVQuxRyEA9iphCexQGQaTwnEJmZiZBSGGhQq5HRUEKV6ZChetZQbgeq0KPwmVBSGGxQlK4bkF7FLdCUrhuQZqZvEJSuG5BCle9QsP1iEE9CrxCSOGcQT2KuELXo7BBAIC0Qilcv0Ezs69CKVzNQYXrqkK4HtlBZmalQvYo5EGFa55CFK7tQQpXmkIAAPJBpPCVQlyP9kH2KIhCuB79QY/Cf0JmZvxBpHB2QlyP+kEpXG1CUrj4QdejZUJcj/ZBhetdQrge80GuR1VCPQrvQa5HS0K4HulBzcxAQgAA4EEfhTlCj8LXQWZmM0KPws1BzcwsQjMzv0FSuCVCzcyuQSlcH0IfhZ1BuB4aQo/Ci0HNzBVCw/V0QZqZEkKkcEVBXI8QQqRwHUFcjxBCUrjeQDMzEkLD9XhACtcaQsP1yL+uRyBCKVyPwEjhJkKuR/HA16MuQlyPIsGamTZCexRGwc3MPkL2KGTB16NEQj0Kc8F7FEtCmpmBwQAAVkL2KIrBH4ViQmZmksE9Co5CpHD5QXE9FkJxPao/FC6DQlK4gsGF60FCPQofwa5HUkL2KBy/ZmZhQrgeDUFI4X1CcT1aQY/CkEI9CpdBXA+gQilcn0Gux69CSOGcQeOI1T5crKg8xY/xPkvqBD0Nwwc/aQCvPQwHCj9D4h4+DYkLP5J5ZD4OTw8/4dGWPrb4FD9FDbY+tAIbPyib0j4H6x8/dTzmPgb1JT/C3fk+W18sP5AxBz+tbjU/NgIRP/59Pj/UYBo/+65IP+ifID+if1I/ezEkP/NUXz/83iY/mghrP6TfJj/qW3Y/pN8mP5Tedz9blDE/lzl1P9OfPT9FDW4/S6tJP0i/ZT/hl1I/ou5bPx8RWz/8HVI/RDRiP1PLRj9g5Wg/sHI4P8Sxbj83GjA/Z0RxP7oUJz8gDHQ/wcUKPxMPeD+SkfM+Cp13P8OB4D4HfHY/otHNPpFhdT+l970+0Ap0P482rj5a9XE/S3acPqd5bz8Q6Yc+1uJrP5DaZD46XWY/lPZGPtRlYT/5vS0+qFJbP6SlEj6qfVI/a2DrPTeOSD8bErc9jBA+P4sajD3CTDM/QzlRPcDPKD/y6hw9zXUaP0aU9jzGUA4/6KT3PBBdAD/a/hU9HOviPn4Akj0p7a0+Ztq+PdLGkT4PC/U9nu9nPj1JGj5GJTU+f/s6Pr0YCj5OnFw+UFPLPbCsdD7Chqc9EoiHPihEgD22850+eqUsPZijtz49Sbo8b9gWP+nUdT95QFk9fxPKPguYAD/vIHY9DJNpPqGEOT69UpY+HTi3PlpHtT5gWQk/ZcLvPh+6ID/GbRw/4iM6P8zROz9tOT8/BhJcP32zPT9yFn4/Kv1lwMYCkMEEc/Q7OtNiwZkM/sESTns/dxeYv1PWrMHMKJY87DgiwZROBcKu9XU/odN0QKU9w8GqmiA99aCNwN74AsIHmWw/hR0FQS2pucFNLZs9qVu3v0d36cHhQFg//fBJQXPJrsHb+R4+xbinP/fPzMG2uTE/sziLQZI+qMFBZZw+ADeYQPGAscGcUIg52b2SwLq05MGvXwA/90CuQekbqMH0Mvo+4lQFQQJKncHlYSE8GvUuwOL1xMHYu58+uTTPQeT2qcEO+CQ/AG89QQjmi8HqlTI9qHxEvwbyp8EHmUQ+vnjmQe3arMGpMDY/wNtmQSbqgMEtPsU9nqZMPy8ilMFDys89KfH+QYhGssGxxDM/bpSKQT6fbsHeAkk+fdwtQIVPgMHfwyU9X1EMQnlBuMFCJhk/tQ2jQYTtWsGx+bg+amSYQGk9V8Hi6RU8O/UZQhhqxMFi28I+QV/AQVGIT8EAOhw/A+ryQPhBMMHgLZA6jjknQkYd0cHLoSU+1mPdQVrhRcHPTlY/hA8nQVgWC8F9yxw9DEb5QUTbScGgMnY/fXRZQU3A5cAUXKw7gMEIQn1DVsGgpn4/utmEQc0zy8AAAIA/BVCkQT3KuMAAAIA/WMzAQR9pvMAAAIA/YmLcQb3qv8AAAIA/+sfgQdjcUMAAAIA/RBPbQd3IAb4AAIA/WV7KQdXVQUAAAIA/XMO2QfkLrUAAAIA/vVSfQXoP9kAHQrI5R8YpQt9+kj4Q6X8/8eiHQfzuGUHsL7s8hqAhQp/yY0DZJXo/NYZZQdVFN0H+8d49Sd8VQlGZ40AYIWQ/7IMUQRNHUUFsIUg+EpgOQj1bEEH99k0/ZCjYQDZeXUEyIJs+cbYGQncZMUE/bzI/H+2AQOIoakGKPCk/CgLXQTuZg0Gdha0+Pn6RwI/tfkGWJqU7ox5eQk7WJ0Bo6E8/okKzQQSAmEHsLzs+4I8bwTTCf0FF2HA8FW9YQprIpUAZkF0/5zOeQTu8okHyXvU93UhKwRWkfEGhEAE9Dd5SQkVy9UBubmQ/DKiJQQyorEHG+Zs9zs53wTR8eUHd71A9BctNQi//G0E6XWY/hphvQQ51tEGRJ0k9qkePwVdQdUGi0Z09DvxHQqD/O0GwrGQ/MDRKQQrlukGH+fI88LSiwbDxbUFnROk9HlpBQtmVX0Ef114/DA4gQbHawUEH6388N3W4wQwfZUFGfCc+Df04QrPKg0HKplQ/e2jbQDGiyEFivrw7KK7Rwa/qV0F0DGg+Ho0uQltNl0Eao0U/AHxUQPChzEF88rA6qjrswd7KQkFIUIw+ZDUmQqroo0FgzTk/Sis1P7lhzUFSSR05Q7/+weBbL0HOx6U+zm4dQuL6rEFxGy0/mq/evwy9ykGHFsk+rc0RQgHjtEEVdBs/MQOWwMjdw0EYffU+WeEEQv36vEElQAU/OkL9wJepu0ELmBA/zJ7vQTb8wkGazt4+HlYwwUWUsUFwCCU/2wrWQaIuxkHQ7bU+WOZdweiEpUElrzY/4+29QdCBx0FmoJI+L3WDwT/EmEE/40o/D3+fQQ8Lw0FlcFQ+t9GZwYalg0EiVFk/Y4eGQU3JvUHarBo+6T+rwfAGYkEMyGY//TNYQdhWskFeusk9xVK6wVPyMEEoJ3I/6B4jQe9fokH9gl092uXGwS6s8EBSRH4/8CygQHe0cUH9gt074BHRwWGslT4AAIA/i/kVQPecQUEAAIA/d4ixvrwBC0EAAIA/M9YYwOUmpUAAAIA/O4d8wBpC4z8AAIA/KK2iwDJHwb8AAIA/e5mtwF9jacAAAIA/ABO5wKPYv8AAAIA/0/G0wN6HGsG7m38/wvyowEspXMG9Osc6LvCPwRUC6sHQCvw+4qbtQRuVYEHw+QE/U0tkv3jdc0EoJ3I/21X4QH/ujkH9gl09x7DLwfhFhEBg5Xg/H6C1PzSCuMH/PuM8OFTlwPsZBMIAAIA/652EPvZDhL4AAIA/XOJPQTPaoL4AAAA/X3/NQeRtED0AAAA/3isMv6pCOr4AAIA/PQgjQV1qlj4AAAA//Ny4QchAOz0AAAA/oFujPnj8N74AAIA/PrAeQR7jUD8AAIA/YM6dQarV7j1mZpdCAAA7wh8Fn0JcjzjCFC6nQgAAM8Jcj61CUrgqwlwPskIUriDCPQq2QuF6E8L2KLlCSOECwuxRukIzM+nB4Xq6Qrgex8HsUblCuB6lwR8FtkL2KITBSOGxQlyPVsFIYa1CrkcxwVyPqEJI4RLBAACiQnE9AsFmZppC4XoAwbgekkKPwgHBKVyKQj0KA8F7FIRCKVwPwQAAfkK4HiHBSOFzQmZmGsEpXGhCZmYiwa5HW0J7FDbB16NRQqRwXcHD9UlCUriGwWZmREKuR6PBuB5CQhSuvcH2KDxCmpnNwdejOUIpXOnBpHA8QnE9AsKPwkRCrkcLwpqZTUKamRDCSOFPQoXrHcJmZlZCH4UlwnsUXkI9CinCXI9yQrgeLMIzM4BC9igtwgrXg0KkcDTCPYqNQsP1OcIUrotC9iggwoVrlkIUrgrCAACcQlyP0sFcD5hCexScwSlcjkIpXGfBXI+BQo/CNcH2qJFCMzPZwY/CfUJcj+DBuJ6pQsP13sEXSCA/mSoYPZHyMz9LAlQ9I/NIP+lIrj10e1k/CFUKPnoZZT/pK0g+cF9vP1+YjD6daHc/ZcK/Pqlqej8iq+s+n816P2IQED/I0nc/NEsqPzpYbz94l0M/26JkP0m6Vj8TClk/PBRlP5OMTD+cxHA/yJg7P3Qkdz8tCSg/KdB3P7ahEj/zVHc/5zr9Pr7Zdj9zutw+/B1yP/uRwj6eQWs/g2moPn/ZbT95r4o+wcVqP9/9UT7bM2M/WhIgPq4SVD//5/A9bqNBP9Ljtz2CqCs/UiegPZtVFz9Ol0U96xwLP12nET06kus+bf9KPdmxwT6Yabs9HcmlPlc+Cz5WgpU+g/oWPl/SWD7Azzg+K00qPvCKYD7usRQ+MgOlPnWOAT5Dxcg+F2X2PfyM2z605Zw9ms4GP8WPMT0DCQI/wCZLPru4HT83pqc+nBYsP+FFBz8K9CE/xy4xP6foCD8OSlA/ZcLPPvhTYz/mdBE/ti0CP/D5wT4Z4vg+qz5PP26G+z4wLyA/x3AnQZN5wEECn78+WG4UwPpaw0HpSD4/H9+3QFGAuEHfbIM+GezjwGPcv0HT2Vk/2ew8P5KaqEEUlhg+VkNFwaHEtEG+E2s/Q3tHwKJakkHRXKc9lt2DwSJJokH60HU/jKy4wPdYcEHe5SI9SgWcwS3GikFKXn0/dNQAwYR2LEGBQyg8fB6ywXdoVkEAAIA/2eQbwSQMsEAAAIA/YfQjwbUagT8AAIA/m1ghwf0SisAAAIA/R5ARwVlcGcGQ2nw/LxLZwO8HasEOMkk8Qty/wcypP8H60HU/5DqAwDoOk8He5SI91lKtwX5EgMHDR2w/9fOGv143qcFrt5093nWYwUALmcFslWA/1pcEQNQAu8FhT/s9YLWBwZ2jrcHjU1A/+GPHQGnFw8HWrT4+M2JDwfY+usH76DQ/ErYvQV/+wsFrK5Y+GWvvwI/tvcGZZAw/ZyqBQY0mwMHONuc+2/cTwBXyv8HO/Mo+++CnQZhvvcHxgBo/AyYiQFbJwcHVBJE+QtzGQewxtMHufDc/c3rQQG89vME3jjg+b67fQb/ap8HL21E/dm4cQazkssFHj989bSj5QdzMqsFvDWQ/0FdOQefNuMFIv309hdYKQmhipMFkI3A/sj6EQVTGtcGwA+c8Sd0aQiN8lsE7x3g/rrSlQTC6q8E4FSk83EomQjZzecEDW30/VGy/QcvSlMGfcWE63yMvQpagO8H8xn8/gZ7UQcNlcMEAAIA/RerkQboNK8EAAIA/r9jsQa7208AAAIA/wBD9QQGaiMAAAIA/AdsCQgYCpzsAAIA/NYQAQoRaiUAAAIA/dNHtQQE06UAAAIA/h6zYQXElEkGCHJQ6ASkiQmOUg0FKtX8/hkDVQRBeVUFoy7k7E40ZQm/AlUHBi34/NUjGQSt/fUGhLWc83L4PQtCXnUGiYnw/nbmzQXrViEGyhaA9LPnrQXnBokGi7ms/1CqBQZr/k0GqmkA+gknJQfGko0Gu2E8/A6Y9QRzymEGbVY8+9DW2QWzstEGLVDg/+s4bQWtXrEG9UuY+qhaFQehPwEH61Qw/I6RzQIRovUF5O7I+zY+RQZVZgEGc4SY/9mKNQKDZeEFQ3yo/MSg9QdEgEEEQQKo+Mw0vwOkAFUEAAIA/lasNQbhiy7/TTUI/K787QQqDH8EVxnY+g36hwAhhGMGiC+o+vM6QQYCZf8GH+Qo/g4oSPxDfgcFYynI+lULSQSiam8HCTEM/QqUEQQwnpcEAAAA/5h90QZ5Ab74AAAA/8xTQvukkib4AAIA/OB02QXQypj0AAIA/PWKDPqK/l71nE2cTZxNnE2cTZxNnE2cTZxNnE2cTZxNvE28TZxNnE28TbxNnE2cTdxN3E2cTZxN3E3cTZxNnE3cTdxNnE2cTZxN/E38TZxNnE2cTdxN3E2cTZxN3E3cTZxNnE4cTdxNnE2cThxNnE2cTZxN3E3cTZxNnE2cTjxOPE5cTZxNnE3cTdxNnE3cTdxNnE3cTdxNnE3cTZxNnE2cTZxNnE2cTZxNnE2cTZxNnE2cTZxNnE2cTZxNnE28TbxNnE2cTbxNvE2cTZxN3E3cTZxNnE3cTdxNnE2cTdxN3E2cTZxNnE38TfxNnE2cTZxN3E3cTZxNnE3cTdxNnE2cTZxNnE2cTZxNnE2cTZxNnE3cTdxNnE3cTdxNnE3cTdxNnE3cTdxNnE3cTdxNnE3cTdxNnE3cTdxNnE3cTZxNnE2cTZxNnE2cTZxNnE2cTZxNnE2cTZxNnE2cTdxN3E2cTZxNnE28TbxNnE2cTbxNvE2cTZxNvE2cTZxNvE28TZxNnE28TbxNnE2cTdxN3E2cTZxN3E3cTZxNnE3cTdxNnE2cTdxN3E2cTZxN3E3cTZxNnE3cTdxNnE2cTdxN3E2cTZxNnE38TfxNnE2cTfxN/E2cTZxNnE3cTdxNnE2cTdxN3E2cTZxN3E2cTZxN3E3cTZxNnE3cTdxNnE2cTdxN3E2cTZxN3E2cTZxN3E2cTZxNnE3cTdxNnE2cTZxNnE3cTdxNnE3cTZxN3E3cTZxN3E3cTdxNnE3cTdxNnE3cTdxNnE3cTdxNnE3cTdxNnE3cTdxOfE3cTZxN3E3cTZxN3E3cTZxN3E3cTZxN3E3cTZxN3E3cTZxN3E3cTZxN3E3cTZxN3E3cTZxN3E3cTdxNnE3cTZxNnE2cTZxNnE2cTZxNnE2cTZxNnE2cTZxNnE2cTZxNnE28TbxNnE2cTbxNvE2cTZxN3E3cTZxNnE3cTdxNnE2cTdxN3E2cTZxNnE38TfxNnE2cTZxN3E3cTZxNnE3cTdxNnE2cTZxNnE2cTZxNnE2cTZxNnE3cTdxNnE3cTdxNnE3cTdxNnE3cTdxNnE3cTdxNnE3cTdxNnE3cTdxNnE3cTZxNnE2cTZxNnE2cTdxN3E2cTZxN3E3cTZxNnE3cTdxNnE2cTdxN3E2cTZxN3E3cTZxNnE3cTdxNnE2cTdxN3E2cTZxN3E3cTZxNnE3cTdxNnE2cTdxN3E2cTZxN3E3cTZxN3E6cTpxOvE2cTZxOnE6cTrxN3E3cTZxN3E3cTZxN3E3cTZxN3E3cTZxN3E3cTZxNnE2cTZxNvE28TZxNnE28TbxNnE2cTbxNvE2cTZxN3E3cTZxNnE3cTdxNnE2cTdxN3E2cTZxN3E3cTZxNnE2cTfxN/E2cTZxN/E38TZxNnE2cTdxN3E2cTZxN3E3cTZxNnE3cTdxNnE2cTZxN3E3cTZxNnE2cTdxN3E2cTtxN3E3cTtxNnE3cTdxNnE3cTdxNnE3cTdxNnE3cTdxNnE3cTdxNnE3cTdxNnE2cTdxNnE78TvxOvE3cTZxN3E3cTZxN3E3cTZxN3E3cTZxNnE78TvxOvE3cTZxNnE3cTZxNnE3cTZxNnE3cTZxNnE3cTZxNnE3cTZxNnE2cTbxNvE2cTZxNvE28TZxNnE3cTdxNnE2cTdxN3E2cTZxN3E3cTZxN3E2cTZxN/E38TZxN3E2cTZxN3E3cTZxNnE3cTdxNnE3cTZxN3E2cTvxO/E2cTZxN3E2cTdxNnE3cTdxNnE3cTZxN3E2cTvxPHE2cTtxN3E3cTtxNnE2cTdxNnE3cTZxN3E2cTdxNnE3cTZxN3E2cTZxN3EwAAgD8AAIA/H4U7QB+FO0CkcP0/pHD9PwrXQ0AK10NAexTuP3sU7j8AAIA/AACAP6Rw/T+kcP0/CtdDQArXQ0B7FO4/exTuPwAAgD8AAIA/H4U7QB+FO0CkcP0/pHD9PwrXQ0AK10NAexTuP3sU7j8AAIA/AACAPwAAAAAAAAAAPQpdwuF6fMFSuE1Cw/UowUjhFELD9SjBAAAAAAAAAAAAAAAAAAAAAI9Vzr4AAAAAj1XOvgAAAAAAAAAAAAAAAAAAgD8AAIA/XI9CP9ejcD/D9Yg/9ihcPxSuRz9SuF4/AACAPwAAgD9cj0I/16NwP8P1iD/2KFw/FK5HP1K4Xj+amTlA16NwPylcL0D2KFw/w/WIP1K4Xj/2KLw/AACAPxSuRz9SuF4/AACAPwAAgD8AAAAAAAAAAP5C4j0AAAAAuQJhvgAAAAB5EnW/AAAAACzPEL8AAAAAAAAAAAAAAAAAAAAAAAAAAOxRPcIAAAAAFC5HQwAAAABmJiZDAAAAAAAAAAAAAAAAAAAAAAAAAAAlvIK+AAAAACW8gr4AAAAAAAAAAAAAAAAAAIA/AACAPwAAgD8AAIA/MzOTPzMzkz8zM5M/MzOTPwAAgD8AAIA/mQ1pPQAAAABhwdo8AAAAAEZEEz4AAAAA+wRBvQAAAADqurw9AAAAAGHB2jwAAAAAAAAAAAAAAADl3Qq/AAAAAOXdCr8AAAAA6SckvwAAAABSOAa+AAAAADixDz4AAAAAAAAAAAAAAAAAAAAAAAAAAK5H4UBxPXpAKVyHwPYoXL8pXIfA9ihcvwAAAAAAAAAARJvTvQAAAAD1lj89AAAAADX6jjwAAAAANfqOPAAAAABEm9O9AAAAAAAAAAAAAAAAD4udPgAAAAB1Uy8/AAAAAEdMWD8AAAAA3965PQAAAACWVui9AAAAAAAAAAAAAAAA8lievQAAAACLeuW+AAAAAPUhEz8AAAAA9SETPwAAAADyWJ69AAAAAMK4sj0AAAAAAAAAAAAAAADXo3DBuB7FwNejCsI9CmPBAAAAAAAAAADXo3DBuB7FwNejCsI9CmPBAAAAAAAAAADXo3DBuB7FwNejCsI9CmPBAAAAAAAAAADXo3DBuB7FwAAAAAAAAAAAAACAPwAAgD/sUbg/AACAPzMzsz8AAIA/AACAPwAAgD/sUbg/AACAPzMzsz8AAIA/AACAPwAAgD/sUbg/AACAPzMzsz8AAIA/AACAPwAAgD/sUbg/AACAPwAAgD8AAIA/AAAAAAAAAAAaV3U/AAAAAKcfyD8AAAAAUIDQPwAAAAA4NbI/AAAAAIwdqT8AAAAAAAAAAAAAAAAAAIA/AACAPz0Ktz8AAIA/PQq3Px+Fqz+F61E/cT2qP6RwvT8zM3M/AACAPwAAgD89Crc/AACAPz0Ktz8fhas/hetRP3E9qj+kcL0/MzNzPwAAgD8AAIA/PQq3PwAAgD89Crc/H4WrPwAAgD8AAIA/PQq3PwAAgD89Crc/H4WrP4XrUT9xPao/pHC9PzMzcz8AAIA/AACAPwAAAAAAAAAAAAAAAAAAAABI4Zq/MzMjwQAAAAAAAAAAAAAAAAAAAAD1D5+9AAAAAF6R+r0AAAAAJ+4rvgAAAAAAAAAAAAAAAAAAAAAAAAAAgtq6vgAAAAByJwK/AAAAALU3I78AAAAAHJeAPgAAAADnfJs+AAAAAAAAAAAAAAAAwriyPQAAAADM6/U8AAAAAAAAAAAAAAAA+n2gvgAAAAD6faC+AAAAAEdG3L4AAAAAL/u9vgAAAABuRh2+AAAAAAAAAAAAAAAAjarFvQAAAAAWE1g+AAAAAIt0ab8AAAAAbtM5vwAAAACit8I+AAAAAI2qxb0AAAAAAAAAAAAAAACLhJQ+AAAAAKAeLj8AAAAAJ+R8PwAAAAAo+qM+AAAAADtokL0AAAAAAAAAAAAAAAAAAIA/AACAPx+FO0AfhTtApHD9P6Rw/T8K10NACtdDQHsU7j97FO4/AACAPwAAgD+kcP0/pHD9PwrXQ0AK10NAexTuP3sU7j8AAIA/AACAPx+FO0AfhTtApHD9P6Rw/T8K10NACtdDQHsU7j97FO4/AACAPwAAgD8AAAAAAAAAAFeOFz8AAAAADviEvgAAAAB5JZ6/AAAAAADicr4AAAAANfqOJQAAAAAAAIA/AACAP5qZGT8AAIA/SOGaPwAAgD+amZk/pHA9P/YovD89Cpc/AACAPwAAgD+amRk/AACAP0jhmj8AAIA/mpmZP6RwPT/2KLw/PQqXPwAAgD8AAIA/mpkZPwAAgD9I4Zo/AACAPwAAgD8AAIA/mpkZPwAAgD9I4Zo/AACAP5qZmT+kcD0/9ii8Pz0Klz8AAIA/AACAP7fcL70AAAAA18d4PAAAAACBwAG+AAAAAFeOF70AAAAA18d4PAAAAAAAAIA/AACAP1yPQj/Xo3A/w/WIP/YoXD8Urkc/UrhePwAAgD8AAIA/XI9CP9ejcD/D9Yg/9ihcPxSuRz9SuF4/AACAPwAAgD9cj0I/16NwP8P1iD/2KFw/FK5HP1K4Xj8AAIA/AACAP1yPQj/Xo3A/w/WIP/YoXD8Urkc/UrhePwAAgD8AAIA/XI9CP9ejcD/D9Yg/9ihcPxSuRz9SuF4/AACAPwAAgD8Urkc/UrhePwAAgD8AAIA/AAAAAAAAAADpHfW+AAAAAJqqML8AAAAA4iJXvwAAAABIakS+AAAAAJVIJz4AAAAAAAAAAAAAAADF6JK9AAAAAK+tfr4AAAAAWkdhvwAAAABRGpq/AAAAAFvaeT4AAAAAxeiSvQAAAAAAAAAAAAAAAM+sJT4AAAAAAhJTPgAAAADG9tM+AAAAAO6JrT4AAAAASglVPgAAAAAAAAAAAAAAAAAAgD8AAIA/XI9CP9ejcD/D9Yg/9ihcPxSuRz9SuF4/AACAPwAAgD9cj0I/16NwP8P1iD/2KFw/FK5HP1K4Xj9cj0I/16NwP8P1iD/2KFw/FK5HP1K4Xj8AAIA/AACAPxSuRz9SuF4/AACAPwAAgD8AAAAAAAAAAI/C68E9CtFBcT0bQpqZWT9xPRJCcT2CwAAAAAAAAAAAAAAAAAAAAAAmRey9AAAAAN5XGb4AAAAA3lcZvgAAAAAAAAAAAAAAAAAAAAAAAAAAXI+MwXsUpkFxPUFCj8J1PuF6cUIpXFvBAAAAAAAAAAAAAAAAAAAAADvvMD4AAAAAAAAAAAAAAADKVhS/AAAAAAAAAAAAAAAAnvTJPgAAAAAAAAAAAAAAAM3MtMHsUeJBAAAUQuxRqEBxPUFCUri+PwAAAAAAAAAAAAAAAAAAAAA77zA+AAAAAAAAAAAAAAAAylYUvwAAAAAAAAAAAAAAAL5Ycj0AAAAAAAAAAAAAAABcj4zBexSmQXE9QUKPwnU+4XpxQilcW8EAAAAAAAAAAAAAAAAAAAAAO+8wPgAAAAAAAAAAAAAAAOZy7L4AAAAAAAAAAAAAAAB5IqA9AAAAAMPG870AAAAAZR1oPwAAAAAzzHc/AAAAANSJ174AAAAAeSKgPQAAAAAAAAAAAAAAABlReT4AAAAAURbnPgAAAADcMzE/AAAAAC7jTbwAAAAATL6MvgAAAAAAAAAAAAAAAB+Faz9mZma/V44XvQAAAADCuLI9AAAAAAAAAAAAAAAAm7YovwAAAABRjMi/AAAAAFTN578AAAAAnwm8vwAAAAAdGm6/AAAAADX6jiUAAAAAAAAAAAAAAAAAAAAAAAAAAFyP4kBSuA5BAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAA1rk3vQAAAAAAAAAAAAAAAAAAAAAAAAAA4zRLvgAAAABXjpc8AAAAACMTwz4AAAAAfGBBPwAAAADXTFA/AAAAAAAAAAAAAAAAAAAAAAAAAAA7aJA+AAAAAGuPnD0AAAAA0MQVvwAAAAACEIq/AAAAAKegbL8AAAAAAAAAAAAAAAB5IqA9AAAAAHkiILsAAAAAbkadPwAAAACmj60/AAAAAMvdtL4AAAAAeSKgPQAAAAAAAAAAAAAAAOGVur4AAAAABlqjPQAAAADdNXo/AAAAAMeQnT8AAAAA6KADPwAAAAAAAAAAAAAAAAAAAAAAAAAAzhtWvgAAAADs5CA/AAAAADNC2T8AAAAACBGkPgAAAAA1+o6lAAAAAAAAgD8AAIA/Uri+PwAAgD8fhWs/j8K1P6RwvT8fhWs/CteDP4XrkT8AAIA/AACAP1K4vj8AAIA/H4VrP4/CtT+kcL0/H4VrPwrXgz+F65E/AACAPwAAgD9SuL4/AACAPx+Faz+PwrU/AACAPwAAgD9SuL4/AACAPx+Faz+PwrU/pHC9Px+Faz8K14M/heuRPwAAgD8AAIA/AAAAAAAAAAC43gTDmpmDQQAAgD8AAIA/w/XIP8P1yD+F66FAheuhQAAAAAAAAAAAe9R6w4/CT8IAAIA/AACAP83MrD/NzKw/AAAAAAAAAAAAAAAAAAAAAAAAAABSuO5AAAAAAHsUJkEAAIA/AACAPwAAgD8AAIA/7FGYP+xRmD/2KJw/9iicPwAAAAAAAAAAAAAAAAAAAAAAAAAAAACkQQAAAABxPQJCAAAAAAAAAAAAAAAAcT0CQgAAgD8AAIA/AACAPwAAgD8Urqc/FK6nP/YovD/2KLw/AACAPwAAgD/2KLw/9ii8PwAAAAAAAAAAAAAAAAAAAAAAAAAAuB6FvwAAgD8AAIA/j8KVP4/ClT+ambk/zcyMPwAAAAAAAAAAAAAAAAAAAAAAAAAAPQqxQQAAAAAAAOxBAAAAAAAAAAAAAAAAAADsQQAAgD8AAIA/AACAPwAAgD8AAIA/rkdhPwAAgD+amVk/AACAPwAAgD8AAIA/mplZPwAAAAAAAAAAAAAAAOH6kUIAAAAAAAAAAAAAAAAfhXxCAAAAAOH6kUIAAAAAAAAAAAAAAADh+pFCAAAAAAAAAAAAAIA/AACAP8P1qD8AAIA/AACAPwAAgD+4HqU/AACAP8P1qD8AAIA/AACAPwAAgD/D9ag/AACAPwAAgD8AAIA/AAAAAAAAAADNzIy/zcwMQAAAgD8AAIA/j8LVQI/C1UAAAIA/AACAPwAAgD8AAIA/4XoEQB+Fyz8AAAAAAAAAAAiKgz0AAAAAAAAAAAAAAACZDWk9AAAAAMK4MiUAAAAAcpL/PQAAAACZDWk9AAAAAAAAAAAAAAAAcgtfPQAAAAAAAAAAAAAAAPJYnr0AAAAANfoOJQAAAACzhh6+AAAAAPJYnr0AAAAAH4VrP2ZmZr8AAAAAAAAAAB+F6z8Urue/H4VrP2ZmZr9Xjhe9AAAAAMK4siQAAAAA2OmXvQAAAABXjhe9AAAAAAAAAAAAAAAAVnYnPgAAAAAAAAAAAAAAAESb070AAAAA3TV6pQAAAAAYyI++AAAAAESb070AAAAA18d4PAAAAACIw+Q8AAAAAMK4sqQAAAAA18d4PAAAAAAAAAAAAAAAADJDDr4AAAAAAAAAAAAAAAAAAAAAAAAAAMb2Uz4AAAAAAAAAAAAAAABhwdo8AAAAAMK4sqMAAAAAtTNwPQAAAABhwdo8AAAAALfcL70AAAAAfNkgJQAAAAA4OLC9AAAAALfcL70AAAAAvlhyPQAAAABjgoolAAAAAD+08j0AAAAAvlhyPQAAAACe9Mk+AAAAAJ+FGb4AAAAAagKAPwAAAACe9Mk+AAAAAAAAAAAAAAAA4ZW6vgAAAAAGWqM9AAAAAN01ej8AAAAAx5CdPwAAAADooAM/AAAAAAAAAAAAAAAAAAAAAAAAAAD+QuI9AAAAALkCYb4AAAAAeRJ1vwAAAAAszxC/AAAAAAAAAAAAAAAAwriyPQAAAAAAAAAAAAAAAMK4Mj4AAAAAwriyPQAAAAAAAAAAAAAAAHE9LEK4HiFCAAAAAAAAAAAAAIA/AACAP3E9ij9xPYo/AACAPwAAgD8AAIA/AACAPx+FO0AfhTtApHD9P6Rw/T8K10NACtdDQHsU7j97FO4/AACAPwAAgD8fhTtAH4U7QKRw/T+kcP0/CtdDQArXQ0B7FO4/exTuPwAAgD8AAIA/H4U7QB+FO0CkcP0/pHD9PwrXQ0AK10NAexTuP3sU7j8AAIA/AACAPx+FO0AfhTtApHD9P6Rw/T8K10NACtdDQHsU7j97FO4/AACAPwAAgD8AAAAAAAAAANp++T0AAAAA6kHdvQAAAABw824+AAAAAFKnNr4AAAAA5nCjPgAAAADCMRI+AAAAAAAAAAAAAAAA2n75PQAAAADqQd29AAAAAHDzbj4AAAAAUqc2vgAAAADmcKM+AAAAAMIxEj4AAAAAcPNuPgAAAABSpza+AAAAAOZwoz4AAAAAAAAAAAAAAAAAAAAAAAAAANejcMG4HsXA16MKwj0KY8EAAAAAAAAAANejcMG4HsXA16MKwj0KY8EAAAAAAAAAANejcMG4HsXA16MKwj0KY8EAAAAAAAAAANejcMG4HsXA16MKwj0KY8EAAAAAAAAAANejcMG4HsXA16MKwj0KY8EAAAAAAAAAANejcMG4HsXA16MKwj0KY8Gambm/7FE4v9ejcMG4HsXA16MKwj0KY8EAAAAAAAAAAAAAgD8AAIA/7FG4PwAAgD8zM7M/AACAPwAAgD8AAIA/7FG4PwAAgD8zM7M/AACAPwAAgD8AAIA/7FG4PwAAgD8zM7M/AACAPwAAgD8AAIA/7FG4PwAAgD8zM7M/AACAPwAAgD8AAIA/7FG4PwAAgD8zM7M/AACAPwAAgD8AAIA/7FG4PwAAgD8zM7M/AACAPwAAgD8AAIA/7FG4PwAAgD8zM7M/AACAPwAAgD8AAIA/AACAPwAAgD9cj0I/16NwP8P1iD/2KFw/FK5HP1K4Xj8AAIA/AACAP1yPQj/Xo3A/w/WIP/YoXD8Urkc/UrhePwAAgD8AAIA/XI9CP9ejcD/D9Yg/9ihcPxSuRz9SuF4/AACAPwAAgD9cj0I/16NwP8P1iD/2KFw/FK5HP1K4Xj8AAIA/AACAP1yPQj/Xo3A/w/WIP/YoXD8Urkc/UrhePwAAgD8AAIA/FK5HP1K4Xj8AAIA/AACAPwAAAAAAAAAASOG8wXsU3sAAAAAAAAAAAAAAgD8AAIA/H4U7QB+FO0CkcP0/pHD9PwrXQ0AK10NAexTuP3sU7j8AAIA/AACAPx+FO0AfhTtApHD9P6Rw/T8K10NACtdDQHsU7j97FO4/AACAPwAAgD8fhTtAH4U7QKRw/T+kcP0/CtdDQArXQ0B7FO4/exTuPwAAgD8AAIA/H4U7QB+FO0CkcP0/pHD9PwrXQ0AK10NAexTuP3sU7j8AAIA/AACAPwAAgD8AAIA/XI9CP9ejcD/D9Yg/9ihcPxSuRz9SuF4/AACAPwAAgD9cj0I/16NwP8P1iD/2KFw/FK5HP1K4Xj8AAIA/AACAP1yPQj/Xo3A/w/WIP/YoXD8Urkc/UrhePwAAgD8AAIA/XI9CP9ejcD/D9Yg/9ihcPxSuRz9SuF4/AACAPwAAgD9cj0I/16NwP8P1iD/2KFw/FK5HP1K4Xj8AAIA/AACAPxSuRz9SuF4/AACAPwAAgD8AAIA/AACAP1yPQj/Xo3A/w/WIP/YoXD8Urkc/UrhePwAAgD8AAIA/XI9CP9ejcD/D9Yg/9ihcPxSuRz9SuF4/AACAPwAAgD9cj0I/16NwP8P1iD/2KFw/FK5HP1K4Xj8AAIA/AACAP1yPQj/Xo3A/w/WIP/YoXD8Urkc/UrhePwAAgD8AAIA/XI9CP9ejcD/D9Yg/9ihcPxSuRz9SuF4/AACAPwAAgD8Urkc/UrhePwAAgD8AAIA/AAAAAAAAAACF60FB4XrsQM3MDEDNzKxBzcxMQOF69EAAAAAAAAAAAAAAAAAAAAAANNjvvQAAAACnoGy9AAAAAEyyFL4AAAAAAAAAAAAAAAAAAIA/AACAPz0Ktz8AAIA/PQq3Px+Fqz+F61E/cT2qP6RwvT8zM3M/AACAPwAAgD89Crc/AACAPz0Ktz8fhas/hetRP3E9qj+kcL0/MzNzPwAAgD8AAIA/PQq3PwAAgD89Crc/H4WrP4XrUT9xPao/pHC9PzMzcz8AAIA/AACAPz0Ktz8AAIA/PQq3Px+Fqz+F61E/cT2qP6RwvT8zM3M/AACAPwAAgD89Crc/AACAPz0Ktz8fhas/hetRP3E9qj+kcL0/MzNzPwAAgD8AAIA/PQq3PwAAgD89Crc/H4WrP4XrUT9xPao/pHC9PzMzcz8AAIA/AACAPwAAgD8AAIA/Uri+PwAAgD8fhWs/j8K1P6RwvT8fhWs/CteDP4XrkT8AAIA/AACAP1K4vj8AAIA/H4VrP4/CtT+kcL0/H4VrPwrXgz+F65E/AACAPwAAgD9SuL4/AACAPx+Faz+PwrU/pHC9Px+Faz8K14M/heuRPwAAgD8AAIA/Uri+PwAAgD8fhWs/j8K1P6RwvT8fhWs/CteDP4XrkT8AAIA/AACAP1K4vj8AAIA/H4VrP4/CtT+kcL0/H4VrPwrXgz+F65E/AACAPwAAgD9SuL4/AACAPx+Faz+PwrU/pHC9Px+Faz8K14M/heuRPwAAgD8AAIA/AACAPwAAgD+amRk/AACAP0jhmj8AAIA/mpmZP6RwPT/2KLw/PQqXPwAAgD8AAIA/mpkZPwAAgD9I4Zo/AACAP5qZmT+kcD0/9ii8Pz0Klz8AAIA/AACAP5qZGT8AAIA/SOGaPwAAgD+amZk/pHA9P/YovD89Cpc/AACAPwAAgD+amRk/AACAP0jhmj8AAIA/mpmZP6RwPT/2KLw/PQqXPwAAgD8AAIA/mpkZPwAAgD9I4Zo/AACAP5qZmT+kcD0/9ii8Pz0Klz8AAIA/AACAP5qZGT8AAIA/SOGaPwAAgD+amZk/pHA9P/YovD89Cpc/AACAPwAAgD8AAAAAAAAAAK5HLUEfhQdBj8IVwLgey0HXo5A/hesVQQAAAAAAAAAAAAAAAAAAAAA4ODC+AAAAALU9Hz4AAAAATLIUvgAAAAAAAAAAAAAAAAAAAAAAAAAAhetBQeF67EDNzAxAzcysQc3MTEDhevRAAAAAAAAAAAAAAAAAAAAAADg4ML4AAAAAtT0fPgAAAABMshS+AAAAAAAAAAAAAAAAwriyPQAAAAAAAAAAAAAAAMK4Mj4AAAAAwriyPQAAAADCuLI9AAAAAAAAAAAAAAAAwrgyPgAAAADCuLI9AAAAAAAAAAAAAAAAD4udPgAAAAB1Uy8/AAAAAEdMWD8AAAAA3965PQAAAACWVui9AAAAAAAAAAAAAAAAAAAAAAAAAADPrCU+AAAAAAISUz4AAAAAxvbTPgAAAADuia0+AAAAAEoJVT4AAAAAAAAAAAAAAAAAAAAAAAAAABlReT4AAAAAURbnPgAAAADcMzE/AAAAAC7jTbwAAAAATL6MvgAAAAAAAAAAAAAAAAAAAAAAAAAAi4SUPgAAAACgHi4/AAAAACfkfD8AAAAAKPqjPgAAAAA7aJC9AAAAAAAAAAAAAAAAAAAAAAAAAAAaV3U/AAAAAKcfyD8AAAAAUIDQPwAAAAA4NbI/AAAAAIwdqT8AAAAAAAAAAAAAAAAAAAAAAAAAADtokD4AAAAAa4+cPQAAAADQxBW/AAAAAAIQir8AAAAAp6BsvwAAAAAAAAAAAAAAAAAAAAAAAAAA5d0KvwAAAADl3Qq/AAAAAOknJL8AAAAAUjgGvgAAAAA4sQ8+AAAAAAAAAAAAAAAAAAAAAAAAAAD6faC+AAAAAPp9oL4AAAAAR0bcvgAAAAAv+72+AAAAAG5GHb4AAAAAAAAAAAAAAAAAAAAAAAAAAILaur4AAAAAcicCvwAAAAC1NyO/AAAAAByXgD4AAAAA53ybPgAAAAAAAAAAAAAAAAAAAAAAAAAA6R31vgAAAACaqjC/AAAAAOIiV78AAAAASGpEvgAAAACVSCc+AAAAAAAAAAAAAAAAAAAAAAAAAACbtii/AAAAAFGMyL8AAAAAVM3nvwAAAACfCby/AAAAAB0abr8AAAAANfqOJQAAAAAAAAAAAAAAAOM0S74AAAAAV46XPAAAAAAjE8M+AAAAAHxgQT8AAAAA10xQPwAAAAAAAAAAAAAAAHkioD0AAAAAUHdWJQAAAAA2gS8+AAAAAHkioD0AAAAAeSKgPQAAAABQd1YlAAAAADaBLz4AAAAAeSKgPQAAAACNqsW9AAAAADX6jiMAAAAA2fdYvgAAAACNqsW9AAAAAMXokr0AAAAAkgqGJQAAAAC+YiG+AAAAAMXokr0AAAAAzOv1PAAAAADCuLIjAAAAAICeYj0AAAAAzOv1PAAAAAAAAAAAAAAAAClcv8BSuKhBAAAAAAAAAAAAAAAAAAAAAAbhwzwAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAHE9AkIAAAAAAAAAAAAAAABxPQJCAACAPwAAgD8AAIA/AACAP/YovD/2KLw/AACAPwAAgD/2KLw/9ii8PwAAAAAAAAAAAAAAAAAAAAAAAAAAexQmQQAAgD8AAIA/AACAPwAAgD/2KJw/9iicPwAAAAAAAAAAAAAAAAAAAAAAAAAAAADsQQAAAAAAAAAAAAAAAAAA7EEAAIA/AACAPwAAgD8AAIA/AACAP5qZWT8AAIA/AACAPwAAgD+amVk/AAAAAAAAAAAAAAAA4fqRQgAAAAAAAAAAAAAAAOH6kUIAAAAAAAAAAAAAAADh+pFCAACAPwAAgD/D9ag/AACAPwAAgD8AAIA/w/WoPwAAgD8AAIA/AACAP8P1qD8AAIA/AAAAAAAAAAAAAAAAAAAAAD0KLUKuR59BPQotQq5Hn0EAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAVjDc+AAAAABWMNz4AAAAAAAAAAAAAAAAAAIA/AACAPx+FO0AfhTtApHD9P6Rw/T8K10NACtdDQHsU7j97FO4/AACAPwAAgD8fhTtAH4U7QKRw/T+kcP0/CtdDQArXQ0B7FO4/exTuPwAAgD8AAIA/H4U7QB+FO0CkcP0/pHD9PwrXQ0AK10NAexTuP3sU7j8AAIA/AACAPx+FO0AfhTtAH4U7QB+FO0DsUYhAmplpQJqZqUCPwvU/AACAPwAAgD9SuN4/UrjePwrXQ0AK10NAexTuP3sU7j8AAIA/AACAPx+FO0AfhTtApHD9P6Rw/T8K10NACtdDQHsU7j97FO4/AACAPwAAgD8fhTtAH4U7QKRw/T+kcP0/CtdDQArXQ0B7FO4/exTuPwAAgD8AAIA/AAAAAAAAAABI4bzBexTewAAAAAAAAAAAAAAAAAAAAAApXBjCKVwYwkjhvMF7FN7AAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAsd1evgAAAACx3V6+AAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAACMTw74AAAAAAAAAAAAAAAAAAIA/AACAP1yPQj/Xo3A/w/WIP/YoXD8Urkc/UrhePwAAgD8AAIA/XI9CP9ejcD/D9Yg/9ihcPxSuRz9SuF4/AACAPwAAgD9cj0I/16NwP8P1iD/2KFw/FK5HP1K4Xj8AAIA/AACAP1yPQj/Xo3A/w/WIP/YoXD8Urkc/UrhePwAAgD8AAIA/XI9CP9ejcD/D9Yg/9ihcP8P1iD/2KFw/7FF4P/YoXD8AAIA/AACAPz0KF0Bcj4I/pHAtQLgeRT9cj0I/16NwP8P1iD/2KFw/FK5HP1K4Xj8AAIA/AACAP1yPQj/Xo3A/w/WIP/YoXD8Urkc/UrhePwAAgD8AAIA/XI9CP9ejcD/D9Yg/9ihcPxSuRz9SuF4/AACAPwAAgD8Urkc/UrhePwAAgD8AAIA/AAAAAAAAAAD+QuI9AAAAALkCYb4AAAAAeRJ1vwAAAAAszxC/AAAAAP5C4j0AAAAAuQJhvgAAAAB5EnW/AAAAACzPEL8AAAAA/kLiPQAAAAC5AmG+AAAAAHkSdb8AAAAALM8QvwAAAAC5AmG+AAAAAHkSdb8AAAAALM8QvwAAAAAAAAAAAAAAALkCYb4AAAAAeRJ1vwAAAAAszxC/AAAAAP5C4j0AAAAAuQJhvgAAAAB5EnW/AAAAACzPEL8AAAAAAAAAAAAAAAAAAAAAAAAAAAAAk8LheupBcb2mQgAA4kGF601BSOEsQqRwCcLsUThCH4VvwUjhQUIUrkHCCtdLQlyPHcIfhelBexRiwilcD0EzMxvCrkcdwUjhisJmZtrBKVxJwnsULsIAgJLCcT1qwsP1S8LD9ZDCw/WTwjOzqsJxPajCKVzNwh/llkMK1/7CH4Wsw9fjAMR7lI9CmpnAwuH6E0PD9aDBpPCfQqRwCcIAAAAAAAAAAAAAAAAAAAAAsWK2vgAAAACQYUa+AAAAAH7/0b4AAAAAfv/RvgAAAAB1Vfi+AAAAAHVV+L4AAAAAs4jnvgAAAABEpQK+AAAAAKTnoj4AAAAApOeiPgAAAAAdmck9AAAAAB2ZyT0AAAAAAAAAAAAAAAAAAIA/AACAPwAAgD8AAIA/SOEaQB+FKz8AAIA/AACAP5kNaT0AAAAAYcHaPAAAAAB5IqC6AAAAAGjYmz0AAAAAW1NZPAAAAAADKkM+AAAAAFimB74AAAAA98YfPgAAAAB3eeC9AAAAAFI4Bj4AAAAAYcHaPAAAAAAAAAAAAAAAAAAAAAAAAAAAzcwMwArXozzNzAzACtejPOxRCMAK16M87FEIwArXozwAAAAAAAAAAAAAgD8AAIA/AACAPwAAgD+F6xE/AACAPwAAgD8AAIA/hesRPwAAgD8AAIA/AACAPwAAgD8AAIA/hesRPwAAgD8AAIA/AACAP4XrET8AAIA/AACAPwAAgD8AAIA/AACAP4XrET8AAIA/AACAPwAAgD+F6xE/AACAPwAAgD8AAIA/AAAAAAAAAADl3Qq/AAAAAOXdCr8AAAAA6SckvwAAAABSOAa+AAAAADixDz4AAAAA5d0KvwAAAADl3Qq/AAAAAOknJL8AAAAAUjgGvgAAAAA4sQ8+AAAAAOXdCr8AAAAA5d0KvwAAAADpJyS/AAAAAFI4Br4AAAAAOLEPPgAAAADl3Qq/AAAAAOknJL8AAAAAUjgGvgAAAAA4sQ8+AAAAAAAAAAAAAAAA5d0KvwAAAADpJyS/AAAAAFI4Br4AAAAAOLEPPgAAAADl3Qq/AAAAAOXdCr8AAAAA6SckvwAAAABSOAa+AAAAADixDz4AAAAAAAAAAAAAAAAAAAAAAAAAANejqEAAAMA/H4WzwHsUzkCamUlAw/VIQOF6FMHhetxAmplJQMP1SEDhehTB4XrcQJqZSUDD9UhA4XoUweF63ECamUlAw/VIQOF6FMHhetxAuB6lQHE9wkC4HqVAcT3CQClcv0BmZr5AKVy/QGZmvkA9CkfACtcDQD0KR8AK1wNAKVy/QGZmvkCuR9nA7FE4PxSud0GPwvW+AAAAAAAAAABEm9O9AAAAAESb070AAAAAW1NZPAAAAAB5IiC+AAAAAOVkKz4AAAAAeSIgvgAAAADlZCs+AAAAAHkiIL4AAAAA5WQrPgAAAAB5IiC+AAAAAOVkKz4AAAAANfqOOwAAAAAEseO9AAAAAASx470AAAAATUf2PQAAAABNR/Y9AAAAAASx470AAAAABLHjvQAAAACqV+29AAAAAP9aUr4AAAAARJvTvQAAAAAAAAAAAAAAAA+LnT4AAAAAdVMvPwAAAABHTFg/AAAAAN/euT0AAAAAllbovQAAAAAPi50+AAAAAHVTLz8AAAAAR0xYPwAAAADf3rk9AAAAAJZW6L0AAAAAD4udPgAAAAB1Uy8/AAAAAEdMWD8AAAAA3965PQAAAACWVui9AAAAAHVTLz8AAAAAR0xYPwAAAADf3rk9AAAAAJZW6L0AAAAAAAAAAAAAAAB1Uy8/AAAAAEdMWD8AAAAA3965PQAAAACWVui9AAAAAA+LnT4AAAAAdVMvPwAAAABHTFg/AAAAAN/euT0AAAAAllbovQAAAAAAAAAAAAAAAPJYnr0AAAAAiWCsvgAAAABYnNi+AAAAAFpFmD4AAAAAwJIBvgAAAABca0k+AAAAAMCSAb4AAAAAXGtJPgAAAADAkgG+AAAAAFxrST4AAAAAwJIBvgAAAABca0k+AAAAACxEvb4AAAAAVmz4vQAAAABmL1y+AAAAAOB9Sr4AAAAAwisWPwAAAADCKxY/AAAAAFZs+L0AAAAAZi9cvgAAAAB0wt8+AAAAAGuF7b4AAAAA8lievQAAAADCuLI9AAAAAHVfJz8AAAAADe5VPwAAAACE/iK+AAAAAG5GnbwAAAAATLTdvgAAAAD9tUU/AAAAAMK4sj0AAAAAAAAAAAAAAADXo3DBuB7FwNejCsI9CmPBAAAAAAAAAADXo3DBuB7FwNejCsI9CmPBAAAAAAAAAADXo3DBuB7FwNejCsI9CmPBAAAAAAAAAADXo3DBuB7FwNejCsI9CmPBAAAAAAAAAADXo3DBuB7FwNejCsI9CmPBAAAAAAAAAADXo3DBuB7FwNejcMG4HsXAMzPRwSlcK8EAAAAAAAAAAJqZub/sUTi/16NwwbgexcDXowrCPQpjwQAAAAAAAAAA16NwwbgexcDXowrCPQpjwQAAAAAAAAAA16NwwbgexcDXowrCPQpjwQAAAAAAAAAA16NwwbgexcDXowrCPQpjwQAAAAAAAAAA16NwwbgexcDXowrCPQpjwQAAAAAAAAAA16NwwbgexcDXowrCPQpjwQAAAAAAAAAA16NwwbgexcDXowrCPQpjwZqZub/sUTi/16NwwbgexcDXowrCPQpjwQAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAALkMkL4AAAAAAAAAAAAAAAAAAIA/AACAP+xRuD8AAIA/MzOzPwAAgD8AAIA/AACAP+xRuD8AAIA/MzOzPwAAgD8AAIA/AACAP+xRuD8AAIA/MzOzPwAAgD8AAIA/AACAP+xRuD8AAIA/MzOzPwAAgD8AAIA/AACAP+xRuD8AAIA/MzOzPwAAgD8AAIA/AACAP+xRuD8AAIA/7FG4PwAAgD+PwrU/AACAPwAAgD8AAIA/AACAPwAAgD/sUbg/AACAPzMzsz8AAIA/AACAPwAAgD/sUbg/AACAPzMzsz8AAIA/AACAPwAAgD/sUbg/AACAPzMzsz8AAIA/AACAPwAAgD/sUbg/AACAPzMzsz8AAIA/AACAPwAAgD/sUbg/AACAPzMzsz8AAIA/AACAPwAAgD/sUbg/AACAPzMzsz8AAIA/AACAPwAAgD/sUbg/AACAPzMzsz8AAIA/AACAPwAAgD/sUbg/AACAPzMzsz8AAIA/AACAPwAAgD8AAAAAAAAAABpXdT8AAAAApx/IPwAAAABQgNA/AAAAADg1sj8AAAAAjB2pPwAAAAAaV3U/AAAAAKcfyD8AAAAAUIDQPwAAAAA4NbI/AAAAAIwdqT8AAAAAGld1PwAAAACnH8g/AAAAAFCA0D8AAAAAODWyPwAAAACMHak/AAAAAKcfyD8AAAAAUIDQPwAAAAA4NbI/AAAAAIwdqT8AAAAAAAAAAAAAAACnH8g/AAAAAFCA0D8AAAAAODWyPwAAAACMHak/AAAAABpXdT8AAAAApx/IPwAAAABQgNA/AAAAADg1sj8AAAAAjB2pPwAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAA7XmE+AAAAADteYT4AAAAAAAAAAAAAAAAAAIA/AACAPz0Ktz8AAIA/PQq3Px+Fqz+F61E/cT2qP6RwvT8zM3M/AACAPwAAgD89Crc/AACAPz0Ktz8fhas/hetRP3E9qj+kcL0/MzNzPwAAgD8AAIA/PQq3PwAAgD89Crc/H4WrP4XrUT9xPao/pHC9PzMzcz8AAIA/AACAPz0Ktz8AAIA/PQq3Px+Fqz+F61E/cT2qP6RwvT8zM3M/AACAPwAAgD89Crc/AACAPz0Ktz8fhas/hetRP3E9qj+kcL0/MzNzPwAAgD8AAIA/PQq3PwAAgD89Crc/H4WrP4XrUT9xPao/pHC9PzMzcz8AAIA/AACAPz0Ktz8AAIA/PQq3Px+Fqz+F61E/cT2qP6RwvT8zM3M/AACAPwAAgD89Crc/AACAPz0Ktz8fhas/AACAPwAAgD89Crc/AACAPz0Ktz8fhas/hetRP3E9qj+kcL0/MzNzPwAAgD8AAIA/PQq3PwAAgD89Crc/H4WrP4XrUT9xPao/pHC9PzMzcz8AAIA/AACAPz0Ktz8AAIA/PQq3Px+Fqz+F61E/cT2qP6RwvT8zM3M/AACAPwAAgD89Crc/AACAPz0Ktz8fhas/hetRP3E9qj+kcL0/MzNzPwAAgD8AAIA/PQq3PwAAgD89Crc/H4WrP4XrUT9xPao/pHC9PzMzcz8AAIA/AACAPz0Ktz8AAIA/PQq3Px+Fqz+F61E/cT2qP6RwvT8zM3M/AACAPwAAgD89Crc/AACAPz0Ktz8fhas/hetRP3E9qj+kcL0/MzNzPwAAgD8AAIA/AAAAAAAAAADBD/O9AAAAAFTNZ74AAAAAbs29PQAAAABuzb09AAAAAODs+j0AAAAAfM/xPgAAAAAAAAAAAAAAAAAAAAAAAAAAgtq6vgAAAAByJwK/AAAAALU3I78AAAAAHJeAPgAAAADnfJs+AAAAAILaur4AAAAAcicCvwAAAAC1NyO/AAAAAByXgD4AAAAA53ybPgAAAACC2rq+AAAAAHInAr8AAAAAtTcjvwAAAAAcl4A+AAAAAOd8mz4AAAAAcicCvwAAAAC1NyO/AAAAAByXgD4AAAAA53ybPgAAAAAAAAAAAAAAAHInAr8AAAAAtTcjvwAAAAAcl4A+AAAAAOd8mz4AAAAAgtq6vgAAAAByJwK/AAAAALU3I78AAAAAHJeAPgAAAADnfJs+AAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAACMTw74AAAAA3+qxvgAAAAAAAAAAAAAAAMK4sj0AAAAA7X01PwAAAACjV4g/AAAAAK0YHb4AAAAAUHdWPAAAAAAmRWy+AAAAAPAoPj8AAAAAwriyPQAAAADM6/U8AAAAAAAAAAAAAAAA+n2gvgAAAAD6faC+AAAAAEdG3L4AAAAAL/u9vgAAAABuRh2+AAAAAPp9oL4AAAAA+n2gvgAAAABHRty+AAAAAC/7vb4AAAAAbkYdvgAAAAD6faC+AAAAAPp9oL4AAAAAR0bcvgAAAAAv+72+AAAAAG5GHb4AAAAA+n2gvgAAAABHRty+AAAAAC/7vb4AAAAAbkYdvgAAAAAAAAAAAAAAAPp9oL4AAAAAR0bcvgAAAAAv+72+AAAAAG5GHb4AAAAA+n2gvgAAAAD6faC+AAAAAEdG3L4AAAAAL/u9vgAAAABuRh2+AAAAAAAAAAAAAAAAjarFvQAAAAAqpSw+AAAAAG7NPb4AAAAAtkkXvwAAAACY9Xi/AAAAACBQyr0AAAAAWbRIPgAAAAB25se+AAAAAHXaT78AAAAAeSKgPQAAAADdxIA+AAAAAORMu7wAAAAAmhlhvwAAAADdxIC+AAAAAI2qxb0AAAAAAAAAAAAAAACLhJQ+AAAAAKAeLj8AAAAAJ+R8PwAAAAAo+qM+AAAAADtokL0AAAAAi4SUPgAAAACgHi4/AAAAACfkfD8AAAAAKPqjPgAAAAA7aJC9AAAAAIuElD4AAAAAoB4uPwAAAAAn5Hw/AAAAACj6oz4AAAAAO2iQvQAAAACgHi4/AAAAACfkfD8AAAAAKPqjPgAAAAA7aJC9AAAAAAAAAAAAAAAAoB4uPwAAAAAn5Hw/AAAAACj6oz4AAAAAO2iQvQAAAACLhJQ+AAAAAKAeLj8AAAAAJ+R8PwAAAAAo+qM+AAAAADtokL0AAAAAAAAAAAAAAAAAAIA/AACAPx+FO0AfhTtApHD9P6Rw/T8K10NACtdDQHsU7j97FO4/AACAPwAAgD8fhTtAH4U7QKRw/T+kcP0/CtdDQArXQ0B7FO4/exTuPwAAgD8AAIA/H4U7QB+FO0CkcP0/pHD9PwrXQ0AK10NAexTuP3sU7j8AAIA/AACAPx+FO0AfhTtApHD9P6Rw/T8K10NACtdDQHsU7j97FO4/AACAPwAAgD8fhTtAH4U7QKRw/T+kcP0/CtdDQArXQ0B7FO4/exTuP6Rw/T+kcP0/CtdDQArXQ0B7FO4/exTuPwAAgD8AAIA/H4U7QB+FO0CkcP0/pHD9PwrXQ0AK10NAexTuP3sU7j8AAIA/AACAPx+FO0AfhTtApHD9P6Rw/T8K10NACtdDQHsU7j97FO4/AACAPwAAgD8fhTtAH4U7QKRw/T+kcP0/CtdDQArXQ0B7FO4/exTuPwAAgD8AAIA/H4U7QB+FO0CkcP0/pHD9PwrXQ0AK10NAexTuP3sU7j8AAIA/AACAPwAAAAAAAAAA4ZU6PgAAAACcVbk+AAAAANHcBT4AAAAA4QRrvgAAAABgteK+AAAAAGuFbT4AAAAA4Q6aPQAAAAAXpvC+AAAAAL/1Ob8AAAAA3LgIvgAAAABttU0+AAAAACOO674AAAAAAX+6vgAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAA7XmE+AAAAADteYT4AAAAAAAAAAAAAAAAAAIA/AACAP5qZGT8AAIA/SOGaPwAAgD+amZk/pHA9P/YovD89Cpc/AACAPwAAgD+amRk/AACAP0jhmj8AAIA/mpmZP6RwPT/2KLw/PQqXPwAAgD8AAIA/mpkZPwAAgD9I4Zo/AACAP5qZmT+kcD0/9ii8Pz0Klz8AAIA/AACAP5qZGT8AAIA/SOGaPwAAgD+amZk/pHA9P/YovD89Cpc/AACAPwAAgD+amRk/AACAP0jhmj8AAIA/mpmZP6RwPT/2KLw/PQqXPwAAgD8AAIA/mpkZPwAAgD9I4Zo/AACAP5qZmT+kcD0/9ii8Pz0Klz8AAIA/AACAP5qZGT8AAIA/SOGaPwAAgD+amZk/pHA9P/YovD89Cpc/AACAPwAAgD+amRk/AACAP0jhmj8AAIA/AACAPwAAgD+amRk/AACAP0jhmj8AAIA/mpmZP6RwPT/2KLw/PQqXPwAAgD8AAIA/mpkZPwAAgD9I4Zo/AACAP5qZmT+kcD0/9ii8Pz0Klz8AAIA/AACAP5qZGT8AAIA/SOGaPwAAgD+amZk/pHA9P/YovD89Cpc/AACAPwAAgD+amRk/AACAP0jhmj8AAIA/mpmZP6RwPT/2KLw/PQqXPwAAgD8AAIA/mpkZPwAAgD9I4Zo/AACAP5qZmT+kcD0/9ii8Pz0Klz8AAIA/AACAP5qZGT8AAIA/SOGaPwAAgD+amZk/pHA9P/YovD89Cpc/AACAPwAAgD+amRk/AACAP0jhmj8AAIA/mpmZP6RwPT/2KLw/PQqXPwAAgD8AAIA/t9wvvQAAAADXx3g8AAAAAN5XmT4AAAAASfsTPgAAAADjo3u9AAAAAOOje70AAAAA18d4PAAAAACNL50+AAAAAIUKmz4AAAAA18d4PAAAAAAAAIA/AACAP1yPQj/Xo3A/w/WIP/YoXD8Urkc/UrhePwAAgD8AAIA/XI9CP9ejcD/D9Yg/9ihcPxSuRz9SuF4/AACAPwAAgD9cj0I/16NwP8P1iD/2KFw/FK5HP1K4Xj8AAIA/AACAP1yPQj/Xo3A/w/WIP/YoXD8Urkc/UrhePwAAgD8AAIA/XI9CP9ejcD/D9Yg/9ihcPxSuRz9SuF4/AACAPwAAgD8Urkc/UrhePwAAgD8AAIA/XI9CP9ejcD/D9Yg/9ihcPxSuRz9SuF4/AACAPwAAgD9cj0I/16NwPxSuRz9SuF4/AACAPwAAgD8Urkc/UrhePwAAgD8AAIA/XI9CP9ejcD/D9Yg/9ihcPxSuRz9SuF4/AACAPwAAgD9cj0I/16NwP8P1iD/2KFw/FK5HP1K4Xj8AAIA/AACAP1yPQj/Xo3A/w/WIP/YoXD8Urkc/UrhePwAAgD8AAIA/XI9CP9ejcD/D9Yg/9ihcPxSuRz9SuF4/AACAPwAAgD9cj0I/16NwP8P1iD/2KFw/FK5HP1K4Xj8AAIA/AACAPxSuRz9SuF4/AACAPwAAgD8AAAAAAAAAAOkd9b4AAAAAmqowvwAAAADiIle/AAAAAEhqRL4AAAAAlUgnPgAAAADpHfW+AAAAAJqqML8AAAAA4iJXvwAAAABIakS+AAAAAJVIJz4AAAAA6R31vgAAAACaqjC/AAAAAOIiV78AAAAASGpEvgAAAACVSCc+AAAAAJqqML8AAAAA4iJXvwAAAABIakS+AAAAAJVIJz4AAAAAAAAAAAAAAACaqjC/AAAAAOIiV78AAAAASGpEvgAAAACVSCc+AAAAAOkd9b4AAAAAmqowvwAAAADiIle/AAAAAEhqRL4AAAAAlUgnPgAAAAAAAAAAAAAAAMXokr0AAAAAVmz4PQAAAADAkoG+AAAAAJDgIb8AAAAATtJJvwAAAAAfyam9AAAAAHfyvz0AAAAAFO2mvgAAAAACkS6/AAAAAPA0tj4AAAAAT2kVPwAAAADoily+AAAAAHxaRb8AAAAAxfSKvgAAAADF6JK9AAAAAAAAAAAAAAAAz6wlPgAAAAACElM+AAAAAMb20z4AAAAA7omtPgAAAABKCVU+AAAAAM+sJT4AAAAAAhJTPgAAAADG9tM+AAAAAO6JrT4AAAAASglVPgAAAADPrCU+AAAAAAISUz4AAAAAxvbTPgAAAADuia0+AAAAAEoJVT4AAAAAAhJTPgAAAADG9tM+AAAAAO6JrT4AAAAASglVPgAAAAAAAAAAAAAAAAISUz4AAAAAxvbTPgAAAADuia0+AAAAAEoJVT4AAAAAz6wlPgAAAAACElM+AAAAAMb20z4AAAAA7omtPgAAAABKCVU+AAAAAAAAAAAAAAAAAACAPwAAgD9cj0I/16NwP8P1iD/2KFw/FK5HP1K4Xj8AAIA/AACAP1yPQj/Xo3A/w/WIP/YoXD8Urkc/UrhePwAAgD8AAIA/XI9CP9ejcD/D9Yg/9ihcPxSuRz9SuF4/AACAPwAAgD9cj0I/16NwP8P1iD/2KFw/FK5HP1K4Xj8AAIA/AACAP1yPQj/Xo3A/w/WIP/YoXD8Urkc/UrhePwAAgD8AAIA/FK5HP1K4Xj8AAIA/AACAP1yPQj/Xo3A/w/WIP/YoXD8Urkc/UrhePwAAgD8AAIA/XI9CP9ejcD8Urkc/UrhePwAAgD8AAIA/FK5HP1K4Xj8AAIA/AACAP1yPQj/Xo3A/w/WIP/YoXD8Urkc/UrhePwAAgD8AAIA/XI9CP9ejcD/D9Yg/9ihcPxSuRz9SuF4/AACAPwAAgD9cj0I/16NwP8P1iD/2KFw/FK5HP1K4Xj8AAIA/AACAP1yPQj/Xo3A/w/WIP/YoXD8Urkc/UrhePwAAgD8AAIA/XI9CP9ejcD/D9Yg/9ihcPxSuRz9SuF4/AACAPwAAgD8Urkc/UrhePwAAgD8AAIA/AAAAAAAAAACamY9BFK43wnE9psGuR1vChetzwoXrKUG4HhTC9qiAQmZm5MEzM2PA9ijkwY/CSUGamePBpHBdwM3M4sHD9RBBhevhwfYoLMHNzODB7FGYvx+F38GPwofBexTewcP1nsFcj9zBw/Xewc3M2sFI4ZTBmpnXwZqZIcLXo9bB16O2wR+F1cEfhTLCpHDTwcP1JsKF613BrkehQvYo5MEK1wJDhetdwdfjA0MAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAACvPIW+AAAAAK88hb4AAAAAkgoGvgAAAADk0ZK+AAAAAOTRkr4AAAAAxn10vgAAAACD5rK+AAAAANWhR74AAAAA4Q6avgAAAAAAAAAAAAAAAAAAAAAAAAAAPQq5QcP1P8I9CmdApHAswuxREsLXo7JBexRKwXsUmELNzITAZmYCQQrXg8Bcj8JBmpmBwArXA0HNzHzA9iimQY/CdcDXo3A/zcxswPYoKEFcj2LA7FGowD0KV8BcjwLBSOFKwK5HgcHNzDzAzczcwDMzI8AfheXBH4UbwIXrMcFcjxLAFK4DwoXrAcD2KPDB7FEoQTOzuEIK14PAXI8OQ+xRKEGamQ9DAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAArzyFvgAAAACvPIW+AAAAAJIKBr4AAAAA5NGSvgAAAADk0ZK+AAAAAMZ9dL4AAAAAg+ayvgAAAADVoUe+AAAAAOEOmr4AAAAAAAAAAAAAAACe9Mk+AAAAAI2qRT8AAAAAuOrwvQAAAACbPck+AAAAACH5Cb0AAAAASGRIPwAAAAAnXpE/AAAAABYTWD4AAAAAoBp7PwAAAAC33C8+AAAAALOOYz8AAAAAnvTJPgAAAAAAAAAAAAAAAD0KuUHD9T/CPQpnQKRwLMLsURLC16OyQXsUSsF7FJhCzcyEwGZmAkEK14PAXI/CQZqZgcAK1wNBzcx8wPYopkGPwnXA16NwP83MbMD2KChBXI9iwOxRqMA9ClfAXI8CwUjhSsCuR4HBzcw8wM3M3MAzMyPAH4XlwR+FG8CF6zHBXI8SwBSuA8KF6wHA9ijwwexRKEEzs7hCCteDwFyPDkPsUShBmpkPQwAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAK88hb4AAAAArzyFvgAAAACSCga+AAAAAOTRkr4AAAAA5NGSvgAAAADGfXS+AAAAAIPmsr4AAAAA1aFHvgAAAADhDpq+AAAAAAAAAAAAAAAAAAAAAAAAAAA9Co/BexR+QAAAAAAAAAAAvlhyPQAAAAAAAAAAAAAAAD0KuUHD9T/CPQpnQKRwLMLsURLC16OyQXsUSsF7FJhCzcyEwGZmAkEK14PAXI/CQZqZgcAK1wNBzcx8wPYopkGPwnXA16NwP83MbMD2KChBXI9iwOxRqMA9ClfAXI8CwUjhSsCuR4HBzcw8wM3M3MAzMyPAH4XlwR+FG8CF6zHBXI8SwBSuA8KF6wHA9ijwwexRKEEzs7hCCteDwFyPDkPsUShBmpkPQwAAAAAAAAAAAAAAAAAAAAAdHqG+AAAAAK88hb4AAAAArzyFvgAAAACSCga+AAAAAOTRkr4AAAAA5NGSvgAAAADGfXS+AAAAAIPmsr4AAAAA1aFHvgAAAADhDpq+AAAAAAAAAAAAAAAAexQuvoXrsb95IqA9AAAAAN/qsb4AAAAAz6L2PQAAAAAt5wA/AAAAAFkzJD8AAAAA8k5vvgAAAACEecu+AAAAAHIL3z4AAAAAFx9QPwAAAABvXo2+AAAAAE1H9r4AAAAA328JvgAAAAAi9VY/AAAAAILOwj0AAAAAeSKgPQAAAAAAAAAAAAAAABlReT4AAAAAURbnPgAAAADcMzE/AAAAAC7jTbwAAAAATL6MvgAAAAAZUXk+AAAAAFEW5z4AAAAA3DMxPwAAAAAu4028AAAAAEy+jL4AAAAAGVF5PgAAAABRFuc+AAAAANwzMT8AAAAALuNNvAAAAABMvoy+AAAAAFEW5z4AAAAA3DMxPwAAAAAu4028AAAAAEy+jL4AAAAAAAAAAAAAAABRFuc+AAAAANwzMT8AAAAALuNNvAAAAABMvoy+AAAAABlReT4AAAAAURbnPgAAAADcMzE/AAAAAC7jTbwAAAAATL6MvgAAAAAAAAAAAAAAAB+Faz9mZma/V44XvQAAAADCuLI9AAAAAOVkK74AAAAAzPftvgAAAAC1M/A8AAAAAF38GL4AAAAAtbjHPgAAAAA1dbe+AAAAAMK4sj0AAAAAAAAAAAAAAACbtii/AAAAAFGMyL8AAAAAVM3nvwAAAACfCby/AAAAAB0abr8AAAAAm7YovwAAAABRjMi/AAAAAFTN578AAAAAnwm8vwAAAAAdGm6/AAAAAJu2KL8AAAAAUYzIvwAAAABUzee/AAAAAJ8JvL8AAAAAHRpuvwAAAABRjMi/AAAAAFTN578AAAAAnwm8vwAAAAAdGm6/AAAAADX6jiUAAAAAUYzIvwAAAABUzee/AAAAAJ8JvL8AAAAAHRpuvwAAAACbtii/AAAAAFGMyL8AAAAAVM3nvwAAAACfCby/AAAAAB0abr8AAAAANfqOJQAAAAAAAAAAAAAAAORMu74AAAAAAAAAAAAAAAAAAAAAAAAAAOM0S74AAAAAV46XPAAAAAAjE8M+AAAAAHxgQT8AAAAA10xQPwAAAADjNEu+AAAAAFeOlzwAAAAAIxPDPgAAAAB8YEE/AAAAANdMUD8AAAAA4zRLvgAAAABXjpc8AAAAACMTwz4AAAAAfGBBPwAAAADXTFA/AAAAAFeOlzwAAAAAIxPDPgAAAAB8YEE/AAAAANdMUD8AAAAAAAAAAAAAAABXjpc8AAAAACMTwz4AAAAAfGBBPwAAAADXTFA/AAAAAOM0S74AAAAAV46XPAAAAAAjE8M+AAAAAHxgQT8AAAAA10xQPwAAAAAAAAAAAAAAAAAAAAAAAAAAO2iQPgAAAABrj5w9AAAAANDEFb8AAAAAAhCKvwAAAACnoGy/AAAAADtokD4AAAAAa4+cPQAAAADQxBW/AAAAAAIQir8AAAAAp6BsvwAAAAA7aJA+AAAAAGuPnD0AAAAA0MQVvwAAAAACEIq/AAAAAKegbL8AAAAAa4+cPQAAAADQxBW/AAAAAAIQir8AAAAAp6BsvwAAAAAAAAAAAAAAAGuPnD0AAAAA0MQVvwAAAAACEIq/AAAAAKegbL8AAAAAO2iQPgAAAABrj5w9AAAAANDEFb8AAAAAAhCKvwAAAACnoGy/AAAAAAAAAAAAAAAAeSKgPQAAAAAOdXa+AAAAAFghsD4AAAAAKyxNPwAAAAAG4UM/AAAAALQlL70AAAAAYtlKvgAAAACWz0c/AAAAAHXhgD8AAAAArIfNvgAAAADg/CW/AAAAAPPt/7wAAAAArjOLPwAAAAD/WtI+AAAAAHkioD0AAAAAAAAAAAAAAADhlbq+AAAAAAZaoz0AAAAA3TV6PwAAAADHkJ0/AAAAAOigAz8AAAAA4ZW6vgAAAAAGWqM9AAAAAN01ej8AAAAAx5CdPwAAAADooAM/AAAAAOGVur4AAAAABlqjPQAAAADdNXo/AAAAAMeQnT8AAAAA6KADPwAAAAAGWqM9AAAAAN01ej8AAAAAx5CdPwAAAADooAM/AAAAAAAAAAAAAAAABlqjPQAAAADdNXo/AAAAAMeQnT8AAAAA6KADPwAAAADhlbq+AAAAAAZaoz0AAAAA3TV6PwAAAADHkJ0/AAAAAOigAz8AAAAAAAAAAAAAAAAAAAAAAAAAAITyqr4AAAAA7fjdvgAAAAA3j/C9AAAAAPpz8T4AAAAAxn30PgAAAACiMmu+AAAAAF2Dub0AAAAAVNeWPgAAAAAF04I9AAAAABUFl74AAAAAJ20HvwAAAAAYvBc+AAAAACdnCz4AAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAO15hPgAAAAA7XmE+AAAAAAAAAAAAAAAAAACAPwAAgD9SuL4/AACAPx+Faz+PwrU/pHC9Px+Faz8K14M/heuRPwAAgD8AAIA/Uri+PwAAgD8fhWs/j8K1P6RwvT8fhWs/CteDP4XrkT8AAIA/AACAP1K4vj8AAIA/H4VrP4/CtT+kcL0/H4VrPwrXgz+F65E/AACAPwAAgD9SuL4/AACAPx+Faz+PwrU/pHC9Px+Faz8K14M/heuRPwAAgD8AAIA/Uri+PwAAgD8fhWs/j8K1P6RwvT8fhWs/CteDP4XrkT8AAIA/AACAP1K4vj8AAIA/H4VrP4/CtT+kcL0/H4VrPwrXgz+F65E/AACAPwAAgD9SuL4/AACAPx+Faz+PwrU/pHC9Px+Faz8K14M/heuRPwAAgD8AAIA/Uri+PwAAgD8fhWs/j8K1PwAAgD8AAIA/Uri+PwAAgD8fhWs/j8K1P6RwvT8fhWs/CteDP4XrkT8AAIA/AACAP1K4vj8AAIA/H4VrP4/CtT+kcL0/H4VrPwrXgz+F65E/AACAPwAAgD9SuL4/AACAPx+Faz+PwrU/pHC9Px+Faz8K14M/heuRPwAAgD8AAIA/Uri+PwAAgD8fhWs/j8K1P6RwvT8fhWs/CteDP4XrkT8AAIA/AACAP1K4vj8AAIA/H4VrP4/CtT+kcL0/H4VrPwrXgz+F65E/AACAPwAAgD9SuL4/AACAPx+Faz+PwrU/pHC9Px+Faz8K14M/heuRPwAAgD8AAIA/Uri+PwAAgD8fhWs/j8K1P6RwvT8fhWs/CteDP4XrkT8AAIA/AACAPwAAAAAAAAAAAAAAAAAAAAAAAAAAexQmQQAAAAAAAAAAAAAAAHsUJkEAAAAAAAAAAAAAAAAAAAAAAAAAAHsUJkEAAAAAAAAAAAAAgD8AAIA/AACAPwAAgD/2KJw/9iicPwAAgD8AAIA/9iicP/YonD8AAIA/AACAPwAAgD8AAIA/9iicP/YonD8AAIA/AACAPwAAAAAAAAAAAAAAAAAAAAAAAAAAcT0CQgAAAAAAAAAAAAAAAHE9AkIAAAAAAAAAAAAAAAAAAAAAAAAAAHE9AkIAAAAAAAAAAAAAAAAAAAAAAAAAAHE9AkIAAAAAAAAAAAAAAABxPQJCAAAAAAAAAAAAAIA/AACAPwAAgD8AAIA/9ii8P/YovD8AAIA/AACAP/YovD/2KLw/AACAPwAAgD8AAIA/AACAP/YovD/2KLw/AACAPwAAgD8AAIA/AACAP/YovD/2KLw/AACAPwAAgD/2KLw/9ii8PwAAgD8AAIA/AAAAAAAAAAAAAAAAAAAAAAAAAAAAAOxBAAAAAAAAAAAAAAAAAAAAAAAAAAAAAOxBAAAAAAAAAAAzM4PASOG2QkjhesDsUcRC7FEIwClcjEIAAAAAAADsQQAAgD8AAIA/AACAPwAAgD8AAIA/mplZPwAAgD8AAIA/AACAPwAAgD8AAIA/mplZPwAAgD8AAIA/AACAPwAAgD8AAIA/mplZPwAAAAAAAAAAAAAAAOH6kUIAAAAAAAAAAAAAAADh+pFCAAAAAAAAAAAAAAAA4fqRQgAAAAAAAAAAAAAAAOH6kUIAAAAAAAAAAAAAAAAAAAAAAAAAAOH6kUIAAAAAAAAAAAAAAADh+pFCrkdBwLgef0IK10PAw/XVQsP16L9xvd5CAAAAAAAAAAAAAIA/AACAP8P1qD8AAIA/AACAPwAAgD/D9ag/AACAPwAAgD8AAIA/w/WoPwAAgD8AAIA/AACAP8P1qD8AAIA/AACAPwAAgD8AAIA/AACAP8P1qD8AAIA/AACAPwAAgD/D9ag/AACAPwAAgD8AAIA/AACAPwAAgD/D9ag/AACAPwAAgD8AAIA/AAAAAAAAAAB7tOnDmtkJwwCgxcOkcD3B4drcw4/CycH1FRvAAAAAADYMA8AAAAAAAACAPwAAgD8AAIA/AACAP8P16D/D9eg/mpk5QJqZOUAAAAAAAAAAADOzlUKuRwVBM7OVQq5HBUH26DBDrkcFQQAAAAAAAAAAlUinvAAAAAAAAIA/AACAP6RwHUCuR4E/w/VYQEjhOj9mZnZAPQrXPgAAgD8AAIA/H4U7QB+FO0CkcP0/pHD9PwrXQ0AK10NAexTuP3sU7j8AAIA/AACAPx+FO0AfhTtApHD9P6Rw/T8K10NACtdDQHsU7j97FO4/AACAPwAAgD8fhTtAH4U7QKRw/T+kcP0/CtdDQArXQ0B7FO4/exTuPwAAgD8AAIA/H4U7QB+FO0CkcP0/pHD9PwrXQ0AK10NAexTuP3sU7j8AAIA/AACAPwAAAAAAAAAA2n75PQAAAADqQd29AAAAAHDzbj4AAAAAUqc2vgAAAADmcKM+AAAAAMIxEj4AAAAAAAAAAAAAAADafvk9AAAAAOpB3b0AAAAAcPNuPgAAAABSpza+AAAAAOZwoz4AAAAAwjESPgAAAABw824+AAAAAFKnNr4AAAAA5nCjPgAAAAAAAAAAAAAAAAAAAAAAAAAASOG8wXsU3sAAAAAAAAAAAAAAgD8AAIA/XI9CP9ejcD/D9Yg/9ihcPxSuRz9SuF4/AACAPwAAgD9cj0I/16NwP8P1iD/2KFw/FK5HP1K4Xj8AAIA/AACAP1yPQj/Xo3A/w/WIP/YoXD8Urkc/UrhePwAAgD8AAIA/XI9CP9ejcD/D9Yg/9ihcPxSuRz9SuF4/AACAPwAAgD9cj0I/16NwP8P1iD/2KFw/FK5HP1K4Xj8AAIA/AACAPxSuRz9SuF4/AACAPwAAgD8AAAAAAAAAAP5C4j0AAAAAuQJhvgAAAAB5EnW/AAAAACzPEL8AAAAAAAAAAAAAAAAAAAAAAAAAAHE9LEK4HiFCAAAAAAAAAAAAAIA/AACAP3E9ij9xPYo/AACAPwAAgD+ZDWk9AAAAAMK4MiUAAAAAcpL/PQAAAACZDWk9AAAAAGHB2jwAAAAAwriyowAAAAC1M3A9AAAAAGHB2jwAAAAArkdhPwAAgD8AAAAAAAAAAOXdCr8AAAAA5d0KvwAAAADpJyS/AAAAAFI4Br4AAAAAOLEPPgAAAAAAAAAAAAAAABYTWL4AAAAAu6HxvQAAAAAYyI++AAAAABYTWL4AAAAAAAAAAAAAAAAPi50+AAAAAHVTLz8AAAAAR0xYPwAAAADf3rk9AAAAAJZW6L0AAAAAAAAAAAAAAADyWJ69AAAAADX6DiUAAAAAs4YevgAAAADyWJ69AAAAALUz8LsAAAAAcgtfPQAAAAC1M/C7AAAAAMK4sj0AAAAAAAAAAAAAAADCuDI+AAAAAMK4sj0AAAAAAAAAAAAAAADXo3DBuB7FwNejCsI9CmPBAAAAAAAAAADXo3DBuB7FwNejCsI9CmPBAAAAAAAAAADXo3DBuB7FwNejCsI9CmPBAAAAAAAAAADXo3DBuB7FwNejCsI9CmPBAAAAAAAAAADXo3DBuB7FwNejCsI9CmPBAAAAAAAAAADXo3DBuB7FwNejCsI9CmPBmpm5v+xROL/Xo3DBuB7FwNejCsI9CmPBAAAAAAAAAAAAAIA/AACAP+xRuD8AAIA/MzOzPwAAgD8AAIA/AACAP+xRuD8AAIA/MzOzPwAAgD8AAIA/AACAP+xRuD8AAIA/MzOzPwAAgD8AAIA/AACAP+xRuD8AAIA/MzOzPwAAgD8AAIA/AACAP+xRuD8AAIA/MzOzPwAAgD8AAIA/AACAP+xRuD8AAIA/MzOzPwAAgD8AAIA/AACAP+xRuD8AAIA/MzOzPwAAgD8AAIA/AACAPwAAAAAAAAAAGld1PwAAAACnH8g/AAAAAFCA0D8AAAAAODWyPwAAAACMHak/AAAAAAAAAAAAAAAAAACAPwAAgD89Crc/AACAPz0Ktz8fhas/hetRP3E9qj+kcL0/MzNzPwAAgD8AAIA/PQq3PwAAgD89Crc/H4WrP4XrUT9xPao/pHC9PzMzcz8AAIA/AACAPz0Ktz8AAIA/PQq3Px+Fqz+F61E/cT2qP6RwvT8zM3M/AACAPwAAgD89Crc/AACAPz0Ktz8fhas/hetRP3E9qj+kcL0/MzNzPwAAgD8AAIA/PQq3PwAAgD89Crc/H4WrP4XrUT9xPao/pHC9PzMzcz8AAIA/AACAPz0Ktz8AAIA/PQq3Px+Fqz+F61E/cT2qP6RwvT8zM3M/AACAPwAAgD9FInS+AAAAAFXl170AAAAARSJ0vgAAAAAAAAAAAAAAAILaur4AAAAAcicCvwAAAAC1NyO/AAAAAByXgD4AAAAA53ybPgAAAAAAAAAAAAAAAMK4sj0AAAAAAAAAAAAAAADCuDI+AAAAAMK4sj0AAAAAzOv1PAAAAADCuLIjAAAAAICeYj0AAAAAzOv1PAAAAAAAAAAAAAAAAPp9oL4AAAAA+n2gvgAAAABHRty+AAAAAC/7vb4AAAAAbkYdvgAAAAAAAAAAAAAAAI2qxb0AAAAANfqOIwAAAADZ91i+AAAAAI2qxb0AAAAAAAAAAAAAAACLhJQ+AAAAAKAeLj8AAAAAJ+R8PwAAAAAo+qM+AAAAADtokL0AAAAAAAAAAAAAAAAAAIA/AACAPx+FO0AfhTtApHD9P6Rw/T8K10NACtdDQHsU7j97FO4/AACAPwAAgD8fhTtAH4U7QKRw/T+kcP0/CtdDQArXQ0B7FO4/exTuPwAAgD8AAIA/H4U7QB+FO0CkcP0/pHD9PwrXQ0AK10NAexTuP3sU7j8AAIA/AACAPx+FO0AfhTtApHD9P6Rw/T8K10NACtdDQHsU7j97FO4/AACAPwAAgD8AAAAAAAAAAMb2Uz4AAAAAAAAAAAAAAAAAAIA/AACAP5qZGT8AAIA/SOGaPwAAgD+amZk/pHA9P/YovD89Cpc/AACAPwAAgD+amRk/AACAP0jhmj8AAIA/mpmZP6RwPT/2KLw/PQqXPwAAgD8AAIA/mpkZPwAAgD9I4Zo/AACAP5qZmT+kcD0/9ii8Pz0Klz8AAIA/AACAP5qZGT8AAIA/SOGaPwAAgD+amZk/pHA9P/YovD89Cpc/AACAPwAAgD+amRk/AACAP0jhmj8AAIA/mpmZP6RwPT/2KLw/PQqXPwAAgD8AAIA/mpkZPwAAgD9I4Zo/AACAP5qZmT+kcD0/9ii8Pz0Klz8AAIA/AACAP7fcL70AAAAAfNkgJQAAAAA4OLC9AAAAALfcL70AAAAA18d4PAAAAACIw+Q8AAAAAMK4sqQAAAAA18d4PAAAAAAAAIA/AACAP1yPQj/Xo3A/w/WIP/YoXD8Urkc/UrhePwAAgD8AAIA/XI9CP9ejcD/D9Yg/9ihcPxSuRz9SuF4/AACAPwAAgD9cj0I/16NwP8P1iD/2KFw/FK5HP1K4Xj8AAIA/AACAP1yPQj/Xo3A/w/WIP/YoXD8Urkc/UrhePwAAgD8AAIA/XI9CP9ejcD/D9Yg/9ihcPxSuRz9SuF4/AACAPwAAgD8Urkc/UrhePwAAgD8AAIA/AAAAAAAAAADpHfW+AAAAAJqqML8AAAAA4iJXvwAAAABIakS+AAAAAJVIJz4AAAAAAAAAAAAAAADF6JK9AAAAAJIKhiUAAAAAvmIhvgAAAADF6JK9AAAAAAAAAAAAAAAAz6wlPgAAAAACElM+AAAAAMb20z4AAAAA7omtPgAAAABKCVU+AAAAAAAAAAAAAAAAAAAAAAAAAAApXL/AUrioQQAAAAAAAAAAAAAAAAAAAAAG4cM8AAAAAAAAAAAAAAAAAAAAAAAAAACF60FB4XrsQAAAAADsUZJBzcxMQOF69EAAAAAAAAAAAAAAAAAAAAAAODgwvgAAAAA4ODC+AAAAAEyyFL4AAAAAAAAAAAAAAACe9Mk+AAAAAJ+FGb4AAAAAagKAPwAAAACe9Mk+AAAAAAAAAAAAAAAArkctQR+FB0GuR5HA16OwQdejkD+F6xVBAAAAAAAAAAAAAAAAAAAAADg4ML4AAAAAODgwvgAAAABMshS+AAAAAAAAAAAAAAAAj8IhwQAAAACkcHHBAAAAAI/CIcEAAAAAAACAPwAAgD8AAIA/w/WoPwAAgD8AAIA/vlhyPQAAAABjgoolAAAAAD+08j0AAAAAvlhyPQAAAAAAAAAAAAAAAIXrQUHheuxAAAAAAOxRkkHNzExA4Xr0QAAAAAAAAAAAAAAAAAAAAAA02O+9AAAAAKegbL0AAAAATLIUvgAAAAAAAAAAAAAAAHkioD0AAAAAUHdWJQAAAAA2gS8+AAAAAHkioD0AAAAAAAAAAAAAAAAZUXk+AAAAAFEW5z4AAAAA3DMxPwAAAAAu4028AAAAAEy+jL4AAAAAAAAAAAAAAAAfhWs/ZmZmvwAAAAAAAAAAH4XrPxSu578fhWs/ZmZmv1eOF70AAAAAwriyJAAAAADY6Ze9AAAAAFeOF70AAAAAwriyPQAAAAAAAAAAAAAAAMK4Mj4AAAAAwriyPQAAAAAAAAAAAAAAAJu2KL8AAAAAUYzIvwAAAABUzee/AAAAAJ8JvL8AAAAAHRpuvwAAAAA1+o4lAAAAAAAAAAAAAAAAVnYnPgAAAAAAAAAAAAAAAAAAAAAAAAAA4zRLvgAAAABXjpc8AAAAACMTwz4AAAAAfGBBPwAAAADXTFA/AAAAAAAAAAAAAAAAAAAAAAAAAAA7aJA+AAAAAGuPnD0AAAAA0MQVvwAAAAACEIq/AAAAAKegbL8AAAAAAAAAAAAAAAB5IqA9AAAAAFB3ViUAAAAANoEvPgAAAAB5IqA9AAAAAAAAAAAAAAAA4ZW6vgAAAAAGWqM9AAAAAN01ej8AAAAAx5CdPwAAAADooAM/AAAAAAAAAAAAAAAAAAAAAAAAAAAyQw6+AAAAAAAAAAAAAAAAAACAPwAAgD9SuL4/AACAPx+Faz+PwrU/pHC9Px+Faz8K14M/heuRPwAAgD8AAIA/Uri+PwAAgD8fhWs/j8K1P6RwvT8fhWs/CteDP4XrkT8AAIA/AACAP1K4vj8AAIA/H4VrP4/CtT+kcL0/H4VrPwrXgz+F65E/AACAPwAAgD9SuL4/AACAPx+Faz+PwrU/pHC9Px+Faz8K14M/heuRPwAAgD8AAIA/Uri+PwAAgD8fhWs/j8K1P6RwvT8fhWs/CteDP4XrkT8AAIA/AACAP1K4vj8AAIA/H4VrP4/CtT+kcL0/H4VrPwrXgz+F65E/AACAPwAAgD8AAAAAAAAAAAAAAAAAAAAAAAAAAHsUJkEAAIA/AACAPwAAgD8AAIA/9iicP/YonD8AAAAAAAAAAAAAAAAAAAAAAAAAAHE9AkIAAAAAAAAAAAAAAABxPQJCAACAPwAAgD8AAIA/AACAP/YovD/2KLw/AACAPwAAgD/2KLw/9ii8PwAAAAAAAAAAAAAAAAAAAAAAAAAAAADsQQAAAAAAAAAAAAAAAAAA7EEAAIA/AACAPwAAgD8AAIA/AACAP5qZWT8AAIA/AACAPwAAgD+amVk/AAAAAAAAAAAAAAAA4fqRQgAAAAAAAAAAAAAAAOH6kUIAAAAAAAAAAAAAAADh+pFCAACAPwAAgD/D9ag/AACAPwAAgD8AAIA/w/WoPwAAgD8AAIA/AACAP8P1qD8AAIA/XI+TQuxR3kF7FJ1CMzMGQuzRhUJcjw9C7FGdQqRwA0Kux5RC16PwQR8FmkKF6zFCAICQQj0K4UG4HptCw/XkQUjhgkIK19lBpHCNQmZm/EEAgIZCKVwGQq5HkUJcjxZCexSdQjMzBkLs0YVCXI8PQuxRnUKkcANCrseUQtej8EEfBZpChesxQgCAkEI9CuFBuB6bQsP15EFI4YJCCtfZQaRwjUJmZvxBAICGQilcBkKuR5FCXI8WQnsUnUIzMwZC7NGFQlyPD0LsUZ1CpHADQq7HlELXo/BBHwWaQoXrMUIAgJBCPQrhQbgem0LD9eRBSOGCQgrX2UGkcI1CZmb8QQCAhkIpXAZCrkeRQlyPFkJcj5NC7FHeQc3M80JmZllCZmboQbgeF0IAAAAAAAAAAHsU7j97FO4/exTuP3sU7j/sUbg/7FG4PwAAgD8AAIA/H4WRwQAA8EGuRznBUriYQQAAAAAAAAAANNjvPQAAAADboJg9AAAAAHzZIKUAAAAAKdybQlyPzkEp3JtCXI/OQSlcpULXo/xBuB6OQhSuB0K4Ho5CFK4HQpqZpUK4HvdBexSdQkjh4EHsUaJCAAAqQuxRokIAACpCrseYQq5H0UGux5hCrkfRQYVro0IzM9VBFC6LQgAAykFxvZVC16PsQa7HjkLD9fxBe5SZQhSuDkJ7lJlCFK4OQilcpULXo/xBKVylQtej/EG4Ho5CFK4HQpqZpUK4HvdBexSdQkjh4EF7FJ1CSOHgQexRokIAACpC7FGiQgAAKkKux5hCrkfRQYVro0IzM9VBFC6LQgAAykFxvZVC16PsQa7HjkLD9fxBrseOQsP1/EF7lJlCFK4OQilcpULXo/xBuB6OQhSuB0K4Ho5CFK4HQpqZpUK4HvdBexSdQkjh4EHsUaJCAAAqQuxRokIAACpCrseYQq5H0UGux5hCrkfRQYVro0IzM9VBFC6LQgAAykFxvZVC16PsQXG9lULXo+xBrseOQsP1/EGux45Cw/X8QXuUmUIUrg5CKdybQlyPzkEK1yhDUjiJQrgecUJ7FDZCAAAAAAAAAAAvjA2+AAAAAC+MDb4AAAAA3TV6pQAAAAAUrkc/UrheP1yPQj/Xo3A/w/WIP/YoXD/D9Yg/9ihcPxSuRz9SuF4/FK5HP1K4Xj8AAIA/AACAPwAAgD8AAIA/XI9CP9ejcD9cj0I/16NwP8P1iD/2KFw/w/WIP/YoXD8Urkc/UrhePxSuRz9SuF4/AACAPwAAgD8AAIA/AACAP1yPQj/Xo3A/XI9CP9ejcD/D9Yg/9ihcP8P1iD/2KFw/FK5HP1K4Xj8Urkc/UrheP1yPQj/Xo3A/XI9CP9ejcD/D9Yg/9ihcP8P1iD/2KFw/FK5HP1K4Xj8Urkc/UrhePwAAgD8AAIA/AACAPwAAgD9cj0I/16NwP1yPQj/Xo3A/w/WIP/YoXD/D9Yg/9ihcPxSuRz9SuF4/FK5HP1K4Xj8AAIA/AACAPwAAgD8AAIA/XI9CP9ejcD9cj0I/16NwP8P1iD/2KFw/w/WIP/YoXD8Urkc/UrhePxSuRz9SuF4/w/WIP/YoXD/D9Yg/9ihcP1yPQj/Xo3A/XI9CP9ejcD8Urkc/UrhePxSuRz9SuF4/ZmbmP3sUbj8AAIA/AACAPwAAAAAAAAAA/kLiPQAAAAC5AmG+AAAAAHkSdb8AAAAALM8QvwAAAAAAAAAAAAAAAP2tAD0AAAAA/kLiPQAAAAC5AmG+AAAAAHkSdb8AAAAALM8QvwAAAAAAAAAAAAAAAHtUb0MUrmNCAIB/QwrXfEIAAAAAAAAAAIE9c74AAAAAu6FxvgAAAAA1+o6lAAAAAJkNaT0AAAAAYcHaPAAAAAAAAAAAAAAAAOXdCr8AAAAA5d0KvwAAAADpJyS/AAAAAFI4Br4AAAAAOLEPPgAAAAAAAAAAAAAAAP2tAL0AAAAA5d0KvwAAAADl3Qq/AAAAAOknJL8AAAAAUjgGvgAAAAA4sQ8+AAAAAAAAAAAAAAAA16MUwYXrkT/XoxTBheuRP+xR2MDhepS/7FHYwOF6lL/D9eDACtejPsP14MAK16M+16MMwaRwvb6uR/nA16Owv9ejFMGF65E/rkfJQD0K50AAAAAAAAAAAOvI/T0AAAAAj9qlPQAAAACwVj4+AAAAALZVjz4AAAAA7fjdPgAAAAB85Zg+AAAAAOEOmj4AAAAAkxjHPgAAAAC2VY8+AAAAAELugT4AAAAAeRhxPgAAAADOG1Y+AAAAALBWPj4AAAAAvLlhPgAAAABV444+AAAAAOB9Sj4AAAAAj9qlPQAAAABXjhc+AAAAAA8GRj4AAAAAQMxiPgAAAADryP09AAAAAD8t0j0AAAAA4QRrPgAAAADKxUQ+AAAAAJolWT4AAAAAJB87PgAAAADryP09AAAAAHtSgL0AAAAARJvTvQAAAAAAAAAAAAAAAA+LnT4AAAAAdVMvPwAAAABHTFg/AAAAAN/euT0AAAAAllbovQAAAAAAAAAAAAAAAP2tAD0AAAAAD4udPgAAAAB1Uy8/AAAAAEdMWD8AAAAA3965PQAAAACWVui9AAAAAAAAAAAAAAAAmQsgPwAAAAAEuxI/AAAAADaHKz8AAAAA76EdPwAAAADhlTo/AAAAAJkLID8AAAAABLsSPwAAAAA2hys/AAAAAO+hHT8AAAAA4ZU6PwAAAACZCyA/AAAAAAS7Ej8AAAAANocrPwAAAADvoR0/AAAAAOGVOj8AAAAAmQsgPwAAAAAEuxI/AAAAADaHKz8AAAAA76EdPwAAAADhlTo/AAAAAJkLID8AAAAABLsSPwAAAAA2hys/AAAAAO+hHT8AAAAA4ZU6PwAAAADQPz4/AAAAAJkLID8AAAAA0LrmvgAAAADyWJ69AAAAAMK4sj0AAAAA9h1gvgAAAAC5DBA+AAAAAIlaMD8AAAAA0MbePgAAAADCuLI9AAAAAPYdYL4AAAAAuQwQPgAAAACJWjA/AAAAANDG3j4AAAAAwriyPQAAAAAAAAAAAAAAABpXdT8AAAAApx/IPwAAAABQgNA/AAAAADg1sj8AAAAAjB2pPwAAAAAAAAAAAAAAAP2tAD0AAAAAGld1PwAAAACnH8g/AAAAAFCA0D8AAAAAODWyPwAAAACMHak/AAAAAAAAAAAAAAAA83AOPgAAAADzcA4+AAAAADX6jiMAAAAAAACAPwAAgD89Crc/AACAPz0Ktz8fhas/hetRP3E9qj+kcL0/MzNzPwAAgD8AAIA/PQq3PwAAgD89Crc/H4WrP4XrUT9xPao/pHC9PzMzcz8AAIA/AACAPz0Ktz8AAIA/PQq3Px+Fqz+F61E/cT2qP6RwvT8zM3M/AACAPwAAgD89Crc/AACAPz0Ktz8fhas/hetRP3E9qj+kcL0/MzNzPwAAgD8AAIA/PQq3PwAAgD89Crc/H4WrP4XrUT9xPao/pHC9PzMzcz8AAIA/AACAPz0Ktz8AAIA/PQq3Px+Fqz+F61E/cT2qP6RwvT8zM3M/AACAPwAAgD89Crc/H4WrP4XrUT9xPao/pHC9PzMzcz8AAIA/AACAPz0Ktz8AAIA/PQq3Px+Fqz+F61E/cT2qPz0Ktz8AAIA/PQq3Px+Fqz8AAIA/AACAPwAAAAAAAAAAuhrRPQAAAAAAAAAAAAAAAAAAAAAAAAAAgtq6vgAAAAByJwK/AAAAALU3I78AAAAAHJeAPgAAAADnfJs+AAAAAAAAAAAAAAAA/a0AvQAAAACC2rq+AAAAAHInAr8AAAAAtTcjvwAAAAAcl4A+AAAAAOd8mz4AAAAAAAAAAAAAAADCuLI9AAAAAB44Wr4AAAAAWJxYvQAAAAB2ax8/AAAAALdnAz8AAAAAwriyPQAAAAAeOFq+AAAAAFicWL0AAAAAdmsfPwAAAAC3ZwM/AAAAAMK4sj0AAAAAzOv1PAAAAAAAAAAAAAAAAPp9oL4AAAAA+n2gvgAAAABHRty+AAAAAC/7vb4AAAAAbkYdvgAAAAAAAAAAAAAAAP2tAL0AAAAA+n2gvgAAAAD6faC+AAAAAEdG3L4AAAAAL/u9vgAAAABuRh2+AAAAAAAAAAAAAAAAjarFvQAAAAC7oXE+AAAAANn3WL4AAAAAM1FPvQAAAADafvk9AAAAAI2qxb0AAAAAAAAAAAAAAACLhJQ+AAAAAKAeLj8AAAAAJ+R8PwAAAAAo+qM+AAAAADtokL0AAAAAAAAAAAAAAAD9rQA9AAAAAIuElD4AAAAAoB4uPwAAAAAn5Hw/AAAAACj6oz4AAAAAO2iQvQAAAAAAAAAAAAAAAOF6SEGF60HA4XpIQYXrQcAK15dB7FE4P3E9DkFmZt5ASOGWQY/C9TxI4ZZBj8L1PHE9XkEfhYu/cT1eQR+Fi7/NzKpBCtc3QTMzM0EfhQvAMzMzQR+FC8BI4YJBCtdjwEjhgkEK12PA7FGQQMP1KL8pXC9BZmbGP1yPBkGkcJVAXI8GQaRwlUB7FG5BMzPTQHsUbkEzM9NACteXQexROD8K15dB7FE4P3E9DkFmZt5ASOGWQY/C9TxxPV5BH4WLv83MqkEK1zdBMzMzQR+FC8AzMzNBH4ULwEjhgkEK12PA7FGQQMP1KL8pXC9BZmbGPylcL0FmZsY/XI8GQaRwlUB7FG5BMzPTQArXl0HsUTg/cT0OQWZm3kBI4ZZBj8L1PHE9XkEfhYu/cT1eQR+Fi7/NzKpBCtc3Qc3MqkEK1zdBMzMzQR+FC8AzMzNBH4ULwEjhgkEK12PA7FGQQMP1KL8pXC9BZmbGPylcL0FmZsY/XI8GQaRwlUBcjwZBpHCVQHsUbkEzM9NA4XpIQYXrQcAzs55CZmb+QI/CscEpXGdBAAAAAAAAAADOJQW/AAAAAM4lBb8AAAAAW1PZvgAAAABQd1YlAAAAAAAAgD8AAIA/AACAPwAAgD8fhTtAH4U7QB+FO0AfhTtApHD9P6Rw/T+kcP0/pHD9PwrXQ0AK10NACtdDQArXQ0B7FO4/exTuP3sU7j97FO4/AACAPwAAgD8AAIA/AACAPx+FO0AfhTtAH4U7QB+FO0CkcP0/pHD9P6Rw/T+kcP0/CtdDQArXQ0AK10NACtdDQHsU7j97FO4/exTuP3sU7j8AAIA/AACAPwAAgD8AAIA/H4U7QB+FO0AfhTtAH4U7QKRw/T+kcP0/pHD9P6Rw/T8K10NACtdDQArXQ0AK10NAexTuP3sU7j8AAIA/AACAPx+FO0AfhTtAH4U7QB+FO0CkcP0/pHD9P6Rw/T+kcP0/CtdDQArXQ0AK10NACtdDQHsU7j97FO4/exTuP3sU7j8AAIA/AACAPwAAgD8AAIA/exTuP3sU7j97FO4/exTuPwrXQ0AK10NACtdDQArXQ0AAAIA/AACAPwAAAAAAAAAAxvZTPgAAAAAAAAAAAAAAAMb2Uz4AAAAAAAAAAAAAAADzcA4+AAAAAPNwDj4AAAAANfqOIwAAAAAAAIA/AACAP5qZGT8AAIA/SOGaPwAAgD+amZk/pHA9P/YovD89Cpc/AACAPwAAgD+amRk/AACAP0jhmj8AAIA/mpmZP6RwPT/2KLw/PQqXPwAAgD8AAIA/mpkZPwAAgD9I4Zo/AACAP5qZmT+kcD0/9ii8Pz0Klz8AAIA/AACAP5qZGT8AAIA/SOGaPwAAgD+amZk/pHA9P/YovD89Cpc/AACAPwAAgD+amRk/AACAP0jhmj8AAIA/mpmZP6RwPT/2KLw/PQqXPwAAgD8AAIA/mpkZPwAAgD9I4Zo/AACAP5qZmT+kcD0/9ii8Pz0Klz8AAIA/AACAP0jhmj8AAIA/mpmZP6RwPT/2KLw/PQqXPwAAgD8AAIA/mpkZPwAAgD9I4Zo/AACAP5qZmT+kcD0/mpkZPwAAgD9I4Zo/AACAPwAAgD8AAIA/t9wvvQAAAADXx3g8AAAAAORMu7wAAAAA18d4PAAAAAB7FLRB4XocwXsUtEHhehzBj8LnQcP1wMCPwudBw/XAwD0Kl0Fcj0I+PQqXQVyPQj5SuOZBPQrXwMP1vkFI4frA16P6QRSul0DXo/pBFK6XQB+FqUFI4Q7BUrjSQbgeJcEK12dBpHDtwB+Fp0FmZqbAuB6TQbgeBcBI4cZBmpkZvkjhxkGamRm+j8LnQcP1wMCPwudBw/XAwD0Kl0Fcj0I+UrjmQT0K18DD9b5BSOH6wMP1vkFI4frA16P6QRSul0AfhalBSOEOwVK40kG4HiXBCtdnQaRw7cAfhadBZmamwLgek0G4HgXAuB6TQbgeBcBI4cZBmpkZvo/C50HD9cDAj8LnQcP1wMA9CpdBXI9CPj0Kl0Fcj0I+UrjmQT0K18DD9b5BSOH6wNej+kEUrpdA16P6QRSul0AfhalBSOEOwR+FqUFI4Q7BUrjSQbgeJcEK12dBpHDtwB+Fp0FmZqbAH4WnQWZmpsC4HpNBuB4FwLgek0G4HgXASOHGQZqZGb57FLRB4XocwVyPq0I9CmdArkeJwdejMEEAAAAAAAAAAFtXDL8AAAAAW1cMvwAAAABYkOC+AAAAADX6jqQAAAAAAACAPwAAgD8AAIA/AACAP1yPQj/Xo3A/XI9CP9ejcD/D9Yg/9ihcP8P1iD/2KFw/FK5HP1K4Xj8Urkc/UrhePwAAgD8AAIA/AACAPwAAgD9cj0I/16NwP8P1iD/2KFw/w/WIP/YoXD8Urkc/UrhePxSuRz9SuF4/AACAPwAAgD8AAIA/AACAPxSuRz9SuF4/FK5HP1K4Xj8AAIA/AACAPwAAgD8AAIA/XI9CP9ejcD/D9Yg/9ihcP8P1iD/2KFw/FK5HP1K4Xj8Urkc/UrhePwAAgD8AAIA/AACAPwAAgD9cj0I/16NwP1yPQj/Xo3A/w/WIP/YoXD/D9Yg/9ihcPxSuRz9SuF4/FK5HP1K4Xj8AAIA/AACAPwAAgD8AAIA/FK5HP1K4Xj8Urkc/UrhePwAAgD8AAIA/AACAPwAAgD8Urkc/UrhePxSuRz9SuF4/AACAPwAAgD8AAAAAAAAAAOkd9b4AAAAAmqowvwAAAADiIle/AAAAAEhqRL4AAAAAlUgnPgAAAAAAAAAAAAAAAP2tAL0AAAAA6R31vgAAAACaqjC/AAAAAOIiV78AAAAASGpEvgAAAACVSCc+AAAAAAAAAAAAAAAAxeiSvQAAAADAAbI9AAAAAPR+T74AAAAAxeiSvQAAAAA1+o4lAAAAAIJVY70AAAAAxeiSvQAAAAAAAAAAAAAAAM+sJT4AAAAAAhJTPgAAAADG9tM+AAAAAO6JrT4AAAAASglVPgAAAAAAAAAAAAAAAP2tAD0AAAAAz6wlPgAAAAACElM+AAAAAMb20z4AAAAA7omtPgAAAABKCVU+AAAAAAAAAAAAAAAASOE2wgrXwz/sURzCuB5tQexRacKF67FAAABEwj0KgcHhem3CzczMvTMzMcKuR+E9FK5JwoXrYcEAAAAAAAAAAJZgF74AAAAAlmAXvgAAAAA1+g6kAAAAAPYopMFcj4pAexRewcP1jEEfhQTCj8IFQWZmvsGuR1XBFK4IwvYoLEDNzJjBcT06QI/CycG4HjXBAAAAAAAAAAD0fk++AAAAAPR+T74AAAAANfqOJQAAAACe9Mk+AAAAAK5HlcEUroNB9ihAwQAA7kF7FPrBheujQR+Fr8GamZm/cT0Bwq5HbUGF64nB16NwQUjhusHNzEw/AAAAAAAAAAD0fk++AAAAAPR+T74AAAAANfqOJQAAAAAAAAAAAAAAAM3MQEEK1yO/SOE2wfYoHD9I4TbB9igcPwAAAAAAAAAAPQoLQQAAAAA9CgtBAAAAAAAAAAAAAAAAvlhyPQAAAAD2KKTBXI+KQHsUXsHD9YxBH4UEwo/CBUFmZr7BrkdVwRSuCML2KCxAzcyYwXE9OkCPwsnBuB41wQAAAAAAAAAA9H5PvgAAAACHtSO+AAAAAJvCoL4AAAAAj1MFvgAAAACPUwW+AAAAADz7qL4AAAAA9H5PvgAAAAA1+o4lAAAAAHkioD0AAAAAUHdWJQAAAAA2gS8+AAAAAHkioD0AAAAAUHdWJQAAAAA2gS8+AAAAAHkioD0AAAAAAAAAAAAAAAAZUXk+AAAAAFEW5z4AAAAA3DMxPwAAAAAu4028AAAAAEy+jL4AAAAAAAAAAAAAAAD9rQA9AAAAABlReT4AAAAAURbnPgAAAADcMzE/AAAAAC7jTbwAAAAATL6MvgAAAAAAAAAAAAAAAB+Faz9mZma/V44XvQAAAADCuLI9AAAAAGA6Oj4AAAAAJ+R8PgAAAACp0Ey+AAAAABYdB78AAAAAwriyPQAAAABgOjo+AAAAACfkfD4AAAAAqdBMvgAAAAAWHQe/AAAAAMK4sj0AAAAAAAAAAAAAAACbtii/AAAAAFGMyL8AAAAAVM3nvwAAAACfCby/AAAAAB0abr8AAAAANfqOJQAAAAD9rQC9AAAAAJu2KL8AAAAAUYzIvwAAAABUzee/AAAAAJ8JvL8AAAAAHRpuvwAAAAA1+o4lAAAAAAAAAAAAAAAA16PgQOF6FEAAAAAAAAAAAL5umb4AAAAAE9W2vgAAAAC+bpm+AAAAADX6jiUAAAAAAAAAAAAAAADjNEu+AAAAAFeOlzwAAAAAIxPDPgAAAAB8YEE/AAAAANdMUD8AAAAAAAAAAAAAAAD9rQC9AAAAAOM0S74AAAAAV46XPAAAAAAjE8M+AAAAAHxgQT8AAAAA10xQPwAAAAAAAAAAAAAAAAAAAAAAAAAAO2iQPgAAAABrj5w9AAAAANDEFb8AAAAAAhCKvwAAAACnoGy/AAAAAAAAAAAAAAAA/a0APQAAAAA7aJA+AAAAAGuPnD0AAAAA0MQVvwAAAAACEIq/AAAAAKegbL8AAAAAAAAAAAAAAAB5IqA9AAAAAFB3ViUAAAAANoEvPgAAAAB5IqA9AAAAAFB3ViUAAAAANoEvPgAAAAB5IqA9AAAAAAAAAAAAAAAA4ZW6vgAAAAAGWqM9AAAAAN01ej8AAAAAx5CdPwAAAADooAM/AAAAAAAAAAAAAAAA/a0AvQAAAADhlbq+AAAAAAZaoz0AAAAA3TV6PwAAAADHkJ0/AAAAAOigAz8AAAAAAAAAAAAAAAAAAAAAAAAAAO+hnb4AAAAAhQxkvgAAAAAyQw6+AAAAAAAAAAAAAAAA83AOPgAAAADzcA4+AAAAADX6jiMAAAAAAACAPwAAgD9SuL4/AACAPx+Faz+PwrU/pHC9Px+Faz8K14M/heuRPwAAgD8AAIA/Uri+PwAAgD8fhWs/j8K1P6RwvT8fhWs/CteDP4XrkT8AAIA/AACAP1K4vj8AAIA/H4VrP4/CtT+kcL0/H4VrPwrXgz+F65E/AACAPwAAgD9SuL4/AACAPx+Faz+PwrU/pHC9Px+Faz8K14M/heuRPwAAgD8AAIA/Uri+PwAAgD8fhWs/j8K1P6RwvT8fhWs/CteDP4XrkT8AAIA/AACAP1K4vj8AAIA/H4VrP4/CtT+kcL0/H4VrPwrXgz+F65E/AACAPwAAgD8fhWs/j8K1P6RwvT8fhWs/CteDP4XrkT8AAIA/AACAP1K4vj8AAIA/H4VrP4/CtT+kcL0/H4VrP1K4vj8AAIA/H4VrP4/CtT8AAIA/AACAPwAAAAAAAAAAcT2jQoXrU0JczzFDFK4cQs3MDD/NzAw/H4UXQQAAAAAAAPhAAAAAAAAA+EAK14dBAAAAAAAAAAAAAAAAAAAAANnlZD8AAAAAexTuP3sU7j/2KBw/9igcP65HAUCuRwFAUvgmQylc5UEpXA9AKVwPQI+CZsN7FAPC16OQP9ejkD/NzKw/zcysPzMzkz8zM5M/16OQP9ejkD/Xo5A/16OQP83MrD/NzKw/MzOTPzMzkz/Xo5A/16OQP9ejkD/Xo5A/zcysP83MrD8zM5M/MzOTP9ejkD/Xo5A/16OQP9ejkD/NzKw/zcysPzMzkz8zM5M/16OQP9ejkD/Xo5A/16OQP83MrD/NzKw/MzOTPzMzkz/Xo5A/16OQP9ejkD/Xo5A/zcysP83MrD8zM5M/MzOTP9ejkD/Xo5A/16OQP9ejkD/NzKw/zcysPzMzkz8zM5M/16OQP9ejkD/Xo5A/16OQP83MrD/NzKw/MzOTPzMzkz/Xo5A/16OQP9ejkD/Xo5A/zcysP83MrD8zM5M/MzOTP9ejkD/Xo5A/16OQP9ejkD/NzKw/zcysPzMzkz8zM5M/16OQP9ejkD/Xo5A/16OQP83MrD/NzKw/MzOTPzMzkz/Xo5A/16OQP9ejkD/Xo5A/zcysP83MrD8zM5M/MzOTP9ejkD/Xo5A/16OQP9ejkD/NzKw/zcysPzMzkz8zM5M/16OQP9ejkD8AAIA/AACAPwAAgD8AAIA/heuxP4XrsT8AAIA/AACAP9ejkD/Xo5A/AACAPwAAgD8AAIA/AACAP4XrsT+F67E/AACAPwAAgD8AAAAAAAAAAAAAAAAAAAAAAAAAAHsUJkEAAAAAAAAAAAAAAAB7FCZBAACAPwAAgD8AAIA/AACAP/YonD/2KJw/AACAPwAAgD/2KJw/9iicPwAAAAAAAAAAAAAAAAAAAAAAAAAAcT0CQgAAAAAAAAAAAAAAAHE9AkIAAAAAAAAAAAAAAABxPQJCAACAPwAAgD8AAIA/AACAP/YovD/2KLw/AACAPwAAgD/2KLw/9ii8PwAAgD8AAIA/9ii8P/YovD/Xo5A/16OQv2ZmZj9mZmY/CtfDPwrXwz+PwgVAj8IFQNejkD/Xo5A/AACAPwAAgD8AAIA/AACAP4XrsT+F67E/AACAPwAAgD/Xo5A/16OQPwAAgD8AAIA/AACAPwAAgD+F67E/heuxPwAAgD8AAIA/AACAPwAAgD8AAIA/AACAP6RwnT+kcJ0/AACAPwAAgD8AAIA/AACAP6RwnT+kcJ0/AACAPwAAgD8AAIA/AACAP6RwnT+kcJ0/AACAPwAAgD8AAIA/AACAP6RwnT+kcJ0/AACAPwAAgD8AAIA/AACAP6RwnT+kcJ0/AACAPwAAgD8AAIA/AACAP6RwnT+kcJ0/AACAPwAAgD8AAIA/AACAP6RwnT+kcJ0/AACAPwAAgD8AAIA/AACAP6RwnT+kcJ0/AACAPwAAgD8AAIA/AACAP6RwnT+kcJ0/AACAPwAAgD8AAIA/AACAP6RwnT+kcJ0/AACAPwAAgD8AAIA/AACAP6RwnT+kcJ0/AACAPwAAgD8AAAAAAAAAAAAAAAAAAAAAAAAAAAAA7EEAAAAAAAAAAAAAAAAAAOxBAAAAAAAAAAAAAAAAAADsQQAAgD8AAIA/AACAPwAAgD8AAIA/mplZPwAAgD8AAIA/AACAP5qZWT8AAIA/AACAPwAAgD+amVk/AAAAAAAAAAAAAAAA4fqRQgAAAAAAAAAAAAAAAOH6kUIAAAAAAAAAAAAAAADh+pFCAAAAAAAAAAAAAAAA4fqRQgAAgD8AAIA/w/WoPwAAgD8AAIA/AACAP8P1qD8AAIA/AACAPwAAgD/D9ag/AACAPwAAgD8AAIA/w/WoPwAAgD8AAERBAABEQQAAREEAAERBAACAPwAAgD8K1+O/ZmYkQjMz+8AfhR9CgT1zvwAAAAAU8yK/AAAAADMzU0AzM1NAFK7nPxSu5z/D9RhAw/UYQD0KN0E9CmfAPQo3QT0KZ8AAAAAAAAAAANejUMD2KCxA16NQwPYoLEAAAAAAAAAAAGZmdkApXF/AZmZ2QClcX8AAAAAAAAAAAN01er0AAAAA3TV6vQAAAAAAAAAAAAAAAKRwfT+uR4FApHB9P65HgUAAAAAAAAAAANa5Nz0AAAAA1rk3PQAAAACSCgYlAAAAAFK4XkBSuF5A9mgWw4XrMcEAACXDClfUwvZoFsOF6zHBAAAlwwpX1ML2aBbDhesxwQAAJcMKV9TC9mgWw4XrMcEAACXDClfUwvZoFsOF6zHBAAAlwwpX1ML2aBbDhesxwQAAJcMKV9TC9mgWw4XrMcEAACXDClfUwvZoFsOF6zHBAAAlwwpX1ML2aBbDhesxwQAAJcMKV9TC9mgWw4XrMcEAACXDClfUwvZoFsOF6zHBAAAlwwpX1ML2aBbDhesxwQAAJcMKV9TC9mgWw4XrMcEAACXDClfUwvZoFsOF6zHBAAAlwwpX1ML2aBbDhesxwQAAJcMKV9TC9mgWw4XrMcEAACXDClfUwvZoFsOF6zHBAAAlwwpX1ML2aBbDhesxwTx20T0AAAAAWB4ywAAAAAA8dtE9AAAAAFgeMsAAAAAAPHbRPQAAAABYHjLAAAAAADx20T0AAAAAWB4ywAAAAAA8dtE9AAAAAFgeMsAAAAAAPHbRPQAAAABYHjLAAAAAADx20T0AAAAAWB4ywAAAAAA8dtE9AAAAAFgeMsAAAAAAPHbRPQAAAABYHjLAAAAAADx20T0AAAAAWB4ywAAAAAA8dtE9AAAAAFgeMsAAAAAAPHbRPQAAAABYHjLAAAAAADx20T0AAAAAWB4ywAAAAAA8dtE9AAAAAFgeMsAAAAAAPHbRPQAAAABYHjLAAAAAADx20T0AAAAAWB4ywAAAAAA8dtE9AAAAAFgeMsAAAAAAPHbRPQAAAAAzMxNAMzMTQArXI0AK1yNAMzMTQDMzE0AK1yNACtcjQDMzE0AzMxNACtcjQArXI0AzMxNAMzMTQArXI0AK1yNAMzMTQDMzE0AK1yNACtcjQDMzE0AzMxNACtcjQArXI0AzMxNAMzMTQArXI0AK1yNAMzMTQDMzE0AK1yNACtcjQDMzE0AzMxNACtcjQArXI0AzMxNAMzMTQArXI0AK1yNAMzMTQDMzE0AK1yNACtcjQDMzE0AzMxNACtcjQArXI0AzMxNAMzMTQArXI0AK1yNAMzMTQDMzE0AK1yNACtcjQDMzE0AzMxNACtcjQArXI0AzMxNAMzMTQArXI0AK1yNAMzMTQDMzE0AK1yNACtcjQDMzE0AzMxNAUvgOw49CG0MAAAnDcb0fQwDAE8OPwiRDzQwJwz0KH0MK1w3DmlkdQ/boB8NSuCpD12MQwzPzG0OaGQvDFC4bQ8M1F8MUrhxDXA8Rw9ejH0PD9RPDpHAiQx/FDcMpHCVDAAAJw3G9H0MAwBPDj8IkQ80MCcM9Ch9DCtcNw5pZHUP26AfDUrgqQ9djEMMz8xtDmhkLwxQuG0PDNRfDFK4cQ1wPEcPXox9Dw/UTw6RwIkMfxQ3DKRwlQwAACcNxvR9DAMATw4/CJEPNDAnDPQofQwrXDcOaWR1D9ugHw1K4KkPXYxDDM/MbQ5oZC8MULhtDwzUXwxSuHENcDxHD16MfQ8P1E8OkcCJDH8UNwykcJUNS+A7Dj0IbQ1K4s8JxPSxDexQ5w49CL0MvjA2+AAAAAC+MDb4AAAAAfGDBvQAAAAAAAAAAAAAAAAAAAAAAAAAAXI+TQuxR3kFcj5NC7FHeQQAAjEIUri1CAACMQhSuLUIfhZZCpHCtQR+FlkKkcK1BXI+TQuxR3kEAAIA/AACAPx+FO0AfhTtApHD9P6Rw/T8K10NACtdDQHsU7j97FO4/AACAPwAAgD8fhTtAH4U7QKRw/T+kcP0/CtdDQArXQ0AAAIA/AACAPx+FO0AfhTtApHD9P6Rw/T8K10NACtdDQHsU7j97FO4/AACAPwAAgD8fhTtAH4U7QKRw/T+kcP0/CtdDQArXQ0B7FO4/exTuPwAAAAAAAAAAUriMQYXrBEKFa93CKVz9wWZmk0KkcP0/H4WRwQAA8EEAAAAAAAAAAAAAAAAAAAAAPiuJvgAAAACjYIK+AAAAADTY7z0AAAAAAAAAAAAAAAAAAAAAAAAAACncm0Jcj85BKdybQlyPzkHsUZdCcT00QuxRl0JxPTRCPQqhQoXri0E9CqFCheuLQSncm0Jcj85BAAAAAAAAAAAAAAAAAAAAAC+MDb4AAAAAAACAPwAAgD9cj0I/16NwP8P1iD/2KFw/FK5HP1K4Xj8AAIA/AACAP1yPQj/Xo3A/w/WIP/YoXD8Urkc/UrhePwAAgD8AAIA/XI9CP9ejcD+uRyFA9ihcP1K4TkAAAIA/XI9CP9ejcD/D9Yg/9ihcPxSuRz9SuF4/FK5HP1K4Xj8AAIA/AACAP1yPQj/Xo3A/w/WIP/YoXD8Urkc/UrhePxSuRz9SuF4/AACAPwAAgD9cj0I/16NwP8P1iD/2KFw/FK5HP1K4Xj8AAAAAAAAAAP5C4j0AAAAAuQJhvgAAAAB5EnW/AAAAACzPEL8AAAAAAAAAAAAAAAD+QuI9AAAAALkCYb4AAAAAeRJ1vwAAAAAszxC/AAAAAAAAAAAAAAAAAAAAAAAAAAApXBxCMzMkQh9FDsNSuDLBpLCqQx+FGEJ7VG9DFK5jQgAAAAAAAAAAAAAAAAAAAACBPXO+AAAAAHOe974AAAAAgT1zvgAAAACZDWk9AAAAAGHB2jwAAAAAAAAAAAAAAADl3Qq/AAAAAOXdCr8AAAAA6SckvwAAAABSOAa+AAAAADixDz4AAAAAAAAAAAAAAADl3Qq/AAAAAOXdCr8AAAAA6SckvwAAAABSOAa+AAAAADixDz4AAAAAAAAAAAAAAAAAAAAAAAAAABSul8CuR2E/pHDdwOF6hEBcjxrBSOE6QNejFMGF65E/RJvTvQAAAABEm9O9AAAAABNmBj0AAAAA+dRgPgAAAADryP09AAAAAAAAAAAAAAAAD4udPgAAAAB1Uy8/AAAAAEdMWD8AAAAA3965PQAAAACWVui9AAAAAAAAAAAAAAAAD4udPgAAAAB1Uy8/AAAAAEdMWD8AAAAA3965PQAAAACWVui9AAAAAAAAAAAAAAAA8lievQAAAAAG4cM+AAAAAIpidb4AAAAAbkwZPwAAAACZCyA/AAAAAMK4sj0AAAAAAAAAAAAAAAAaV3U/AAAAAKcfyD8AAAAAUIDQPwAAAAA4NbI/AAAAAIwdqT8AAAAAAAAAAAAAAAAaV3U/AAAAAKcfyD8AAAAAUIDQPwAAAAA4NbI/AAAAAIwdqT8AAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAA83AOPgAAAAAAAIA/AACAPz0Ktz8AAIA/PQq3Px+Fqz+F61E/cT2qP6RwvT8zM3M/AACAPwAAgD89Crc/AACAPz0Ktz8fhas/hetRP3E9qj+kcL0/MzNzPwAAgD8AAIA/PQq3PwAAgD89Crc/H4WrP4XrUT9xPao/pHC9PzMzcz8AAIA/AACAPz0Ktz8AAIA/PQq3Px+Fqz+F61E/cT2qP6RwvT8zM3M/AACAPwAAgD89Crc/AACAPz0Ktz8fhas/hetRP3E9qj+kcL0/MzNzPwAAgD8AAIA/PQq3PwAAgD89Crc/H4WrP4XrUT9xPao/pHC9PzMzcz8AAIA/AACAPwAAAAAAAAAAgtq6vgAAAAByJwK/AAAAALU3I78AAAAAHJeAPgAAAADnfJs+AAAAAAAAAAAAAAAAgtq6vgAAAAByJwK/AAAAALU3I78AAAAAHJeAPgAAAADnfJs+AAAAAAAAAAAAAAAAwriyPQAAAADM6/U8AAAAAAAAAAAAAAAA+n2gvgAAAAD6faC+AAAAAEdG3L4AAAAAL/u9vgAAAABuRh2+AAAAAAAAAAAAAAAA+n2gvgAAAAD6faC+AAAAAEdG3L4AAAAAL/u9vgAAAABuRh2+AAAAAAAAAAAAAAAAjarFvQAAAAAlN6s+AAAAAMABsr0AAAAASXBAvwAAAAA/vqG+AAAAAAXTAj0AAAAAjarFvQAAAAAAAAAAAAAAAIuElD4AAAAAoB4uPwAAAAAn5Hw/AAAAACj6oz4AAAAAO2iQvQAAAAAAAAAAAAAAAIuElD4AAAAAoB4uPwAAAAAn5Hw/AAAAACj6oz4AAAAAO2iQvQAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAADhekhBhetBwOF6SEGF60HAuB5xQdejkkG4HnFB16OSQYXrYUH2KOzAhethQfYo7MDhekhBhetBwAAAAAAAAAAAAAAAAAAAAADOJQW/AAAAAAAAgD8AAIA/H4U7QB+FO0CkcP0/pHD9PwrXQ0AK10NAexTuP3sU7j8AAIA/AACAPx+FO0AfhTtApHD9P6Rw/T8K10NACtdDQHsU7j97FO4/AACAPwAAgD8fhTtAH4U7QB+FO0AfhTtApHD9P6Rw/T8K10NACtdDQHsU7j97FO4/AACAPwAAgD8fhTtAH4U7QB+FO0AfhTtApHD9P6Rw/T8K10NACtdDQHsU7j97FO4/AACAPwAAgD8AAAAAAAAAADPKLj4AAAAAtKqGPgAAAAAQr4W9AAAAAKCpgb4AAAAA53wbPgAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAADzcA4+AAAAAAAAgD8AAIA/mpkZPwAAgD9I4Zo/AACAP5qZmT+kcD0/9ii8Pz0Klz8AAIA/AACAP5qZGT8AAIA/SOGaPwAAgD+amZk/pHA9P/YovD89Cpc/AACAPwAAgD+amRk/AACAP0jhmj8AAIA/mpmZP6RwPT/2KLw/PQqXPwAAgD8AAIA/mpkZPwAAgD9I4Zo/AACAP5qZmT+kcD0/9ii8Pz0Klz8AAIA/AACAP5qZGT8AAIA/SOGaPwAAgD+amZk/pHA9P/YovD89Cpc/AACAPwAAgD+amRk/AACAP0jhmj8AAIA/mpmZP6RwPT/2KLw/PQqXPwAAgD8AAIA/t9wvvQAAAADXx3g8AAAAAAAAAAAAAAAAAAAAAAAAAAB7FLRB4XocwXsUtEHhehzB4XrIQbgeOUHheshBuB45Qc3MwEF7FGLBzczAQXsUYsF7FLRB4XocwQAAAAAAAAAAAAAAAAAAAADTAre5AAAAAOiK3L4AAAAA6IrcvgAAAABbVwy/AAAAAAAAgD8AAIA/XI9CP9ejcD/D9Yg/9ihcPxSuRz9SuF4/AACAPwAAgD9cj0I/16NwP8P1iD/2KFw/FK5HP1K4Xj8AAIA/AACAP1yPQj/Xo3A/w/U4QPYoXD+PwjVAUrhePwAAgD8AAIA/XI9CP9ejcD/D9Yg/9ihcP8P1iD/2KFw/FK5HP1K4Xj8AAIA/AACAP1yPQj/Xo3A/w/WIP/YoXD/D9Yg/9ihcPxSuRz9SuF4/AACAPwAAgD8Urkc/UrhePwAAgD8AAIA/AAAAAAAAAADpHfW+AAAAAJqqML8AAAAA4iJXvwAAAABIakS+AAAAAJVIJz4AAAAAAAAAAAAAAADpHfW+AAAAAJqqML8AAAAA4iJXvwAAAABIakS+AAAAAJVIJz4AAAAAAAAAAAAAAADF6JK9AAAAAKCdiT0AAAAA76GdvgAAAACNnk2/AAAAAPfGn74AAAAAPIAAvgAAAADF6JK9AAAAAAAAAAAAAAAAz6wlPgAAAAACElM+AAAAAMb20z4AAAAA7omtPgAAAABKCVU+AAAAAAAAAAAAAAAAz6wlPgAAAAACElM+AAAAAMb20z4AAAAA7omtPgAAAABKCVU+AAAAAAAAAAAAAAAAAAAAAAAAAAApXAbCCtcNQgrXicJSuCrBexSAwnE9EcJI4TbCCtfDPwAAAAAAAAAAAAAAAAAAAAD0fk++AAAAAPR+T74AAAAAlmAXvgAAAAAAAAAAAAAAAHE9BsE9ChlCSOEuwgrX+8ApXBvCexQGwvYopMFcj4pAAAAAAAAAAAD0fk++AAAAAJ70yT4AAAAAAAAAAAAAAADD9dDAXI9JQqRwJ8IAAIhASOETwj0Kq8GuR5XBFK6DQQAAAAAAAAAA9H5PvgAAAAAAAAAAAAAAAOxRUEEAAAAA9igQQQAAAAD2KGTBAAAAAAAAAAAAAAAAvlhyPQAAAAAAAAAAAAAAAHE9BsE9ChlCSOEuwgrX+8ApXBvCexQGwvYopMFcj4pAAAAAAAAAAAD0fk++AAAAAHkioD0AAAAAq2PlvgAAAACCVWM9AAAAAP9SDT8AAAAAMrI+PgAAAACuMI29AAAAAHkioD0AAAAAAAAAAAAAAAAZUXk+AAAAAFEW5z4AAAAA3DMxPwAAAAAu4028AAAAAEy+jL4AAAAAAAAAAAAAAAAZUXk+AAAAAFEW5z4AAAAA3DMxPwAAAAAu4028AAAAAEy+jL4AAAAAAAAAAAAAAAAfhWs/ZmZmv1eOF70AAAAAwriyPQAAAAAAAAAAAAAAAJu2KL8AAAAAUYzIvwAAAABUzee/AAAAAJ8JvL8AAAAAHRpuvwAAAAA1+o4lAAAAAJu2KL8AAAAAUYzIvwAAAABUzee/AAAAAJ8JvL8AAAAAHRpuvwAAAAA1+o4lAAAAAAAAAAAAAAAAvm6ZvgAAAAAAAAAAAAAAAOM0S74AAAAAV46XPAAAAAAjE8M+AAAAAHxgQT8AAAAA10xQPwAAAAAAAAAAAAAAAOM0S74AAAAAV46XPAAAAAAjE8M+AAAAAHxgQT8AAAAA10xQPwAAAAAAAAAAAAAAAAAAAAAAAAAAO2iQPgAAAABrj5w9AAAAANDEFb8AAAAAAhCKvwAAAACnoGy/AAAAAAAAAAAAAAAAO2iQPgAAAABrj5w9AAAAANDEFb8AAAAAAhCKvwAAAACnoGy/AAAAAAAAAAAAAAAAeSKgPQAAAAA2g/i+AAAAAEHk0j4AAAAAaNRoPwAAAAACi7I+AAAAABYdB74AAAAAeSKgPQAAAAAAAAAAAAAAAOGVur4AAAAABlqjPQAAAADdNXo/AAAAAMeQnT8AAAAA6KADPwAAAAAAAAAAAAAAAOGVur4AAAAABlqjPQAAAADdNXo/AAAAAMeQnT8AAAAA6KADPwAAAAAAAAAAAAAAAAAAAAAAAAAAQu6BvgAAAAA8+6i+AAAAAAvIJD4AAAAASQeMPgAAAAD2Jw++AAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAPNwDj4AAAAAAACAPwAAgD9SuL4/AACAPx+Faz+PwrU/pHC9Px+Faz8K14M/heuRPwAAgD8AAIA/Uri+PwAAgD8fhWs/j8K1P6RwvT8fhWs/CteDP4XrkT8AAIA/AACAP1K4vj8AAIA/H4VrP4/CtT+kcL0/H4VrPwrXgz+F65E/AACAPwAAgD9SuL4/AACAPx+Faz+PwrU/pHC9Px+Faz8K14M/heuRPwAAgD8AAIA/Uri+PwAAgD8fhWs/j8K1P6RwvT8fhWs/CteDP4XrkT8AAIA/AACAP1K4vj8AAIA/H4VrP4/CtT+kcL0/H4VrPwrXgz+F65E/AACAPwAAgD8AAAAAAAAAAFzPMUMUrhxCXM8xQxSuHEJczzFDzcyoQVzPMUPNzKhBXM8xQxSuHEIAAIA/AACAP65HIUCuRyFAzcwMP83MDD+uRyFArkchQK5HIUCuRyFAzcwMP83MDD+uRyFArkchQM3MDD/NzAw/AAAAAAAAAAAfhRdBAAAAAAAAgD8AAIA/j8KVP4/ClT97FO4/exTuPwAAAAAAAAAAAAAAAAAAAABS+CZDKVzlQQAAgD8AAIA/cT3KP3E9yj8AANBAAADQQGZmZj9mZmY/KVwPQClcD0AAAAAAAAAAAI+CZsN7FAPCAACAPwAAgD8AAIA/AACAP+xRuD/sUbg/AACAPwAAgD8AAIA/AACAP3E9yj9xPco/16OQP9ejkD8AAIA/AACAPwAAgD8AAIA/7FG4P+xRuD8AAIA/AACAPwAAgD8AAIA/cT3KP3E9yj/Xo5A/16OQPwAAAAAAAAAAAAAAAAAAAAAAAAAAexQmQQAAgD8AAIA/AACAPwAAgD/2KJw/9iicPwAAAAAAAAAAAAAAAAAAAAAAAAAAcT0CQgAAAAAAAAAAAAAAAHE9AkIAAIA/AACAPwAAgD8AAIA/9ii8P/YovD8AAIA/AACAP/YovD/2KLw/AAAAAAAAAAAAAAAAAAAAANejkD/Xo5C/AACAPwAAgD9xPQpAcT0KQHE9CkBxPQpAZmZmP2ZmZj8AAIA/AACAPwAAgD8AAIA/7FG4P+xRuD8AAIA/AACAPwAAgD8AAIA/cT3KP3E9yj/Xo5A/16OQPwAAgD8AAIA/AACAPwAAgD9xPco/cT3KP9ejkD/Xo5A/AAAAAAAAAAAAAKDBAAAAAAAAoMEAAOxBAACgwQAAAAAAAKDBAADsQQAAgD8AAIA/AACAPwAAgD8AAIA/mplZPwAAgD8AAIA/AACAP5qZWT8AAAAAAAAAAAAAoMEfhUNCAAAAAOH6kUIAAAAAAAAAAAAAoMHNzJBCAACgweH6kUIAAAAAAAAAAAAAAADh+pFCAACgweH6kUIAAIA/AACAPwAAgD8AAIA/w/WoPwAAgD8AAIA/AACAPwAAgD8AAIA/w/WoPwAAgD8AAIA/AACAP8P1qD8AAIA/AACAPwAAgD89Cu9APQrvQAAAREEAAERBAAAAAAAAAAAK1+O/ZmYkQgAAAAAAAAAAgT1zvwAAAAAAAIA/AACAPylcD0ApXA9AMzNTQDMzU0AAAAAAAAAAAFL4DsOPQhtDZqYMw3F9LkP2aA7DXI8SQ1L4DsOPQhtDAAAAAAAAAAAvjA2+AAAAAAAAAAAAAAAA9mgWw4XrMcEAACXDClfUwvZoFsOF6zHBAAAlwwpX1ML2aBbDhesxwQAAJcMKV9TC9mgWw4XrMcEAACXDClfUwvZoFsOF6zHBAAAAAAAAAAA8dtE9AAAAAFgeMsAAAAAAPHbRPQAAAABYHjLAAAAAADx20T0AAAAAWB4ywAAAAAA8dtE9AAAAAFgeMsAAAAAAPHbRPQAAAAAAAIA/AACAPzMzE0AzMxNACtcjQArXI0AzMxNAMzMTQArXI0AK1yNAMzMTQDMzE0AK1yNACtcjQDMzE0AzMxNACtcjQArXI0AzMxNAMzMTQAAAAAAAAAAAAAAAAAAAAABI4XpAmpm5QNejUMD2KCxAAAAAAAAAAAAAAAAAAAAAAFyPGkEfhas/ZmZ2QClcX8AAAAAAAAAAAN01er0AAAAAAAAAAAAAAAAAAAAAAAAAAHE9ikAAAJBApHB9P65HgUAAAAAAAAAAANa5Nz0AAAAAAAAAAAAAAAAAAAAAAAAAAOF6GEEUridAPQo3QT0KZ8AAAIA/AACAPwAAgD8AAIA/XI/iP1yP4j9SuF5AUrheQAAAAAAAABkAAQAAAAAAAAABAAMAAQAGAAEACAABAAwAAQAOAAEAEQABABMAAQAWAAEAGAABABoAAQAdAAEAHwABACEAAQAjAAAAAAACABYANQlcDiMSKBWpF80ZpRtFHbIe9R8UIRMi9iK+I24kCCWNJf4lXSaoJt8mAycVAAIABAAsCCcQ8xeWHxgAAQAeAAIABgDwCq8TmRrpH8MjLyYjAAAAAAACABYANQlcDiMSKBWpF80ZpRtFHbIe9R8UIRMi9iK+I24kCCWNJf4lXSaoJt8mAycVAAIACgC9A3AHGQu3Dk0S1xVaGdQcRSCvIx4AAgAGAPAKrxOZGukfwyMvJiMAAAAAAAEAAwABAAUAAQAIAAEACwABAA4AAQAQAAEAEwACAAQAbBKpHLgi/yUWAAEAGAACAAQAihLVHN0iDyYbAAEAHgABACAAAQAjAAAAAAABABEAAQAUAAEAFgABABsAAQAfAAAAAAACABYAVAnaDuYSGha9GPIa1xx3Ht4fGCEoIhQj4COQJCclpSUOJmMmpSbWJvgmCicVAAIABABtCsIT0htcIhgAAgAHAE0FigquD7YUmBlPHs8iHgACAAYAkAg/EBkXDB34IYwlIwAAAAAAAgAWAFQJ2g7mEhoWvRjyGtccdx7eHxghKCIUI+AjkCQnJaUlDiZjJqUm1ib4JgonFQACAAoA3QSGCfQNJhIYFsMZIR0tIN4iLiUeAAIABgCQCD8QGRcMHfghjCUjAAAAAAACABYAVAnaDuYSGha9GPIa1xx3Ht4fGCEoIhQj4COQJCclpSUOJmMmpSbWJvgmCicVAAIABABtCsIT0htcIhgAAgAHAE0FigquD7YUmBlPHs8iHgACAAYAkAg/EBkXDB34IYwlIwAAAAAAAAAAAAIAFADWAa0DhgVfBzoJFQvxDM4OrBCJEmgURhYmGAQa4hvAHZ8feyFYIzUlEwACAAUAcAbkDF4T4hlyIBcAAgAGAIoFHQu2EFMW7RuDIRwAAgAIAEsEnAj0DE4RrBUIGmQevSIjAAAAAAABABEAAAAUAAEAFgABABkAAQAbAAEAHwAAAAAAAgAUAB8BWgKuAxoFnAYzCN4JmgtoDUgPNBEyEzsVUBdzGaAb2B0YIGIitSQTAAIABQAzDuIXqB5EIw4mFwAAAB4AAgAGAJUIgBCYF7EdjCLUJSMAAAAAAAIAFAAfAVoCrgMaBZwGMwjeCZoLaA1IDzQRMhM7FVAXcxmgG9gdGCBiIrUkEwACAAUAMw7iF6geRCMOJhcAAAAeAAIABgCVCIAQmBexHYwi1CUjAAAAAAABABEAAQAUAAEAFgABABkAAQAbAAEAHwAAAAAAAgAUAOIBxAOmBYcHZwlICykNCA/oEMYSpBSAFl0YNxoRHOodwR+XIWsjPyUTAAIABQAzDuIXqB5EIw4mFwAAAB4AAgAGAPIIEBE0GDYe4SLyJSMAAAAAAAAAAAACAAUAcwFsBXcLQhOHHAQAAgAGAP4JNhIEGZAe4yLcJQkAAAALAAIABAAPAp0H9A+RGg4AAgAEAHcNwheIH9kkEQAAABMAAgAEAA8CnQf0D5EaFgACAAUAeAuhFPEbliF4JRoAAAAcAAIABAAPAp0H9A+RGh8AAgAFAHgLoRTxG5YheCUjAAAAAAACAAUAcwFsBXcLQhOHHAQAAgAGAP4JNhIEGZAe4yLcJQkAAAALAAIABAAPAp0H9A+RGg4AAgAEAHcNwheIH9kkEQAAABMAAgAEAA8CnQf0D5EaFgACAAUAeAuhFPEbliF4JRoAAAAcAAIABAAPAp0H9A+RGh8AAgAFAHgLoRTxG5YheCUjAAAAAAABABEAAQAUAAEAFgABABkAAQAbAAEAHwAAAAAAAQACAAEABAABAAYAAQAIAAEACgABAAwAAQAOAAEAEAABABIAAQAUAAEAFQABABcAAQAZAAEAGwABAB0AAQAfAAEAIQABACMAAAAAAAIAFwAfAHkABgHDAasCugPtBEAGsQc/CecKpwx+DmkQZxJ4FJkWzBgLG1odtx8fIpIkFgACAAcAUAWWCsoP4BTNGYQe9iIcAAIACADfAesFBwumEGoWCRwlITElIwAAAAAAAgAUACkAnABSAUMCaQO+BEAG6Qe2CaMLsQ3aDx0SeBToFm8ZCByyHmwhOCQTAAIABAANENca0iHEJRYAAgAHAFAFlgrKD+AUzRmEHvYiHAACAAgA3wHrBQcLphBqFgkcJSExJSMAAAAAAAEAEQABABQAAQAWAAEAGQABABsAAQAfAAAAAAAAAAAAAAAAAAEAEQAAABQAAQAWAAEAGQABABsAAQAfAAAAAAACABQA3wG+A54FfQddCTwLGw37DtkQtxKUFHEWThgpGgUc3x24H5AhZiM8JRMAAgAEADAIORATGLMfFgACAAQA0wgzEREZYSAZAAIABQAtCL8PqhbjHGAiHQACAAcASgIfBxgNhxP4GfEfxiQjAAAAAAABABEAAQAUAAEAFgABABkAAQAbAAEAHwAAAAAAAQADAAEABgABAAgAAQAMAAEADgABABEAAQATAAEAFgABABgAAQAaAAEAHQABAB8AAQAhAAEAIwAAAAAAAgAUACkAnABSAUMCaQO+BEAG6Qe2CaMLsQ3aDx0SeBToFm8ZCByyHmwhOCQTAAIABADjB8QPmxdiHxYAAgAEAG8IlhBxGPIfGQACAAUAvAcUD/gVUxwPIh0AAgAHAEoCHwcYDYcT+BnxH8YkIwAAAAAAAQACAAEABAABAAYAAQAIAAEACgABAAwAAQAOAAEAEAABABIAAQAUAAEAFQABABcAAQAZAAEAGwABAB0AAQAfAAEAIQABACMAAAAAAAAAAAACABcAowFGA+oEjgYxCNQJeAsbDb4OYRADEqYTSBXpFooYKRrKG2kdBh+jIEAi3CN3JRYAAgAEAFwO7hh2IEAlGQACAAsAtwRQCcENAxIOFtUZTh1mIAsjIiWKJiMAAAAAAAEAAgABAAMAAQAFAAEABgABAAgAAQAJAAEACwABAA0AAQAOAAEAEAABABEAAQATAAEAFQABABYAAQAYAAEAGgABABsAAQAcAAEAHgABACAAAQAhAAEAIwAAAAAAAQARAAEAFAABABYAAQAZAAEAGwABAB8AAAAAAAIAFADfAb4DngV9B10JPAsbDfsO2RC3EpQUcRZOGCkaBRzfHbgfkCFmIzwlEwACAAQAMAg5EBMYsx8WAAIABADTCDMRERlhIBkAAgAFAC0Ivw+qFuMcYCIdAAIABwBKAh8HGA2HE/gZ8R/GJCMAAAAAAAEAEQABABQAAQAWAAEAGQABABsAAQAfAAAAAAABAAMAAQAFAAEACAABAAsAAQAOAAEAEAABABMAAQAWAAEAGAABABsAAQAeAAEAIAABACMAAAAAAAIAFAAlAI4ANQEWAisDcATiBX0HPgkkCysNUA+UEfITahb8GKMbYh4zIRgkEwACAAQAvQz/FggfrSQWAAIABwCoB5sO3RRuGjsfJSPsJRwAAgAIAN8B6wUHC6YQahYJHCUhMSUjAAAAAAACABQAJQCOADUBFgIrA3AE4gV9Bz4JJAsrDVAPlBHyE2oW/BijG2IeMyEYJBMAAgAEAL0M/xYIH60kFgACAAcAqAebDt0Ubho7HyUj7CUcAAIACADfAesFBwumEGoWCRwlITElIwAAAAAAAgAUACcAlQBEASwCSgOXBBEGswd6CWQLbQ2VD9gRNBSqFjUZ1RuJHlEhKCQTAAIABAA0Db8XvR8IJRYAAgAHADsK2RHqF9sc2yD7IygmHAACAAgA3wHrBQcLphBqFgkcJSExJSMAAAAAAAIAFAAnAJUARAEsAkoDlwQRBrMHeglkC20NlQ/YETQUqhY1GdUbiR5RISgkEwACAAQANA2/F70fCCUWAAIABwA7CtkR6hfbHNsg+yMoJhwAAgAIAN8B6wUHC6YQahYJHCUhMSUjAAAAAAAAAAAAAgAUACcAlQBEASwCSgOXBBEGswd6CWQLbQ2VD9gRNBSqFjUZ1RuJHlEhKCQTAAIABACIDRIY6R8SJRYAAgAHADsK2RHqF9sc2yD7IygmHAACAAgA3wHrBQcLphBqFgkcJSExJSMAAAAAAAIAFAAnAJUARAEsAkoDlwQRBrMHeglkC20NlQ/YETQUqhY1GdUbiR5RISgkEwACAAQAiA0SGOkfEiUWAAIABwA7CtkR6hfbHNsg+yMoJhwAAgAIAN8B6wUHC6YQahYJHCUhMSUjAAAAAAAAAAAAAgAUACcAlQBEASwCSgOXBBEGswd6CWQLbQ2VD9gRNBSqFjUZ1RuJHlEhKCQTAAIABAA0D+QZJSGCJRYAAgAHADsK2RHqF9sc2yD7IygmHAACAAgA3wHrBQcLphBqFgkcJSExJSMAAAAAAAIAFAAnAJUARAEsAkoDlwQRBrMHeglkC20NlQ/YETQUqhY1GdUbiR5RISgkEwACAAQANA/kGSUhgiUWAAIABwA7CtkR6hfbHNsg+yMoJhwAAgAIAN8B6wUHC6YQahYJHCUhMSUjAAAAAAACABQA3wG+A54FfQddCTwLGw37DtkQtxKUFHEWThgpGgUc3x24H5AhZiM8JRMAAgAEADAIORATGLMfFgACAAQA0wgzEREZYSAZAAIABQAtCL8PqhbjHGAiHQACAAcASgIfBxgNhxP4GfEfxiQjAAAAAAABABEAAQAUAAEAFgABABkAAQAbAAEAHwAAAAAAAAAAAAAAAAAAAAAAAQARAAEAFAABABYAAQAZAAEAGwABAB8AAAAAAAAADQACAAsAMgNvBrUJAQ1REKIT8hY9GoMdvyDvIxcAAgANAA4EBAjgC5wPNBOfFtkZ2RySH/whBiSfJa0mIwAAAAAAAAANAAIACwAyA28GtQkBDVEQohPyFj0agx2/IO8jFwACAA0ADgQECOALnA80E58W2RnZHJIf/CEGJJ8lrSYjAAAAAAABABEAAQAUAAEAFgABABkAAQAbAAEAHwAAAAAAAQARAAEAFAABABYAAQAZAAEAGwABAB8AAAAAAAIAFADfAb4DngV9B10JPAsbDfsO2RC3EpQUcRZOGCkaBRzfHbgfkCFmIzwlEwACAAQAMAg5EBMYsx8WAAIABADTCDMRERlhIBkAAgAFAC0Ivw+qFuMcYCIdAAIABwBKAh8HGA2HE/gZ8R/GJCMAAAAAAAEAEQABABQAAQAWAAEAGQABABsAAQAfAAAAAAACABQAKQCcAFIBQwJpA74EQAbpB7YJowuxDdoPHRJ4FOgWbxkIHLIebCE4JBMAAgAEAOMHxA+bF2IfFgACAAQAbwiWEHEY8h8ZAAIABQC8BxQP+BVTHA8iHQACAAcASgIfBxgNhxP4GfEfxiQjAAAAAAABAAIAAQAEAAEABgABAAgAAQAKAAEADAABAA4AAQAQAAEAEgABABQAAQAVAAEAFwABABkAAQAbAAEAHQABAB8AAQAhAAEAIwAAAAAAAAAZAAAAAAAAABkAAgAJAE4HsgxPEXMVPxnBHPwf7SJ5JSEAAAAAAAAAGQAAAAAAAAAZAAAAAAAAAAoAAgAMAEIDdQacCbYMxg/MEscVuhilG4oeZyE+JBUAAgAPAAgE1wdvC9YODRIUFewXlhoNHVEfXiEtI7Yk7SXAJiMAAAAAAAAACgACAAwAQgN1BpwJtgzGD8wSxxW6GKUbih5nIT4kFQACAA8ACATXB28L1g4NEhQV7BeWGg0dUR9eIS0jtiTtJcAmIwAAAAAAAAACAAIADQDUA3oH9QpGDnEReBRaFxkarxwgH2YhfiNjJQ4AAgAEAKIMQheLHwklEQAAABMAAgARAHYDxAbrCfEM1Q+YEjkVuxcaGlccbx5dIB8iriMDJRImyiYjAAAAAAAAAAIAAgANANQDegf1CkYOcRF4FFoXGRqvHCAfZiF+I2MlDgACAAQAogxCF4sfCSURAAAAEwACABEAdgPEBusJ8QzVD5gSORW7FxoaVxxvHl0gHyKuIwMlEibKJiMAAAAAAAAAGQACAAgAAQeFDHAR9xUyGiUeyiH/JCAAAAAAAAAAGQACAAgAAQeFDHAR9xUyGiUeyiH/JCAAAAAAAAAAAwACAAwAaAajCxMQ6BNBFzQa0hwjHzAh/yKSJO0lDgACAAQACg26F90fJCURAAAAEgACABIAWwXWCbQNFREVFMMWKhlUG0YdBx+YIP8hOyNPJDkl+CWMJuwmIwAAAAAAAAADAAIADABoBqMLExDoE0EXNBrSHCMfMCH/IpIk7SUOAAIABAAKDboX3R8kJREAAAASAAIAEgBbBdYJtA0VERUUwxYqGVQbRh0HH5gg/yE7I08kOSX4JYwm7CYjAAAAAAACAAgA8AfADqEUshkCHpYhZCROJgcAAAAJAAIABgB+By8ONRSmGZMeCSMOAAIABgA8CWURdBhTHuEi7CUTAAAAFAACAAsAEQZ4C0wQoRR/GPEb+R6WIcQjeCWfJh4AAAAjAAAAAAACAAgA8AfADqEUshkCHpYhZCROJgcAAAAJAAIABgB+By8ONRSmGZMeCSMOAAIABgA8CWURdBhTHuEi7CUTAAAAFAACAAsAEQZ4C0wQoRR/GPEb+R6WIcQjeCWfJh4AAAAjAAAAAAAAABkAAAAAAAAAGQAAAAAAAAAZAAIACgArBg8LXQ9JE+4WWBqKHYUgPyOcJSIAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAABEA//8SAAAAIwD//wAAAQADAAIAAwCMCIcThB4FAAAADQACAAUAtgMHC4cTCRxaIxEAAQASAAIABQAbBSMMhxPtGvUhFgAAAB4AAgAGAN8CwAjSDz4XUB4xJCMAAAAAAAAABwD//wkAAAATAP//FAAAAB4A//8AAAIAAwCMCIcThB4CAAAABQACAAMAHweHE/EfBwABAAkAAgACACMM7RoKAAAADgACAAYA3wLACNIPPhdQHjEkEwABABQAAgADAIwIhxOEHhYAAAAZAAIABgDfAsAI0g8+F1AeMSQeAAAAAAAAACMA//8AAAEAAgACAAkAlAJ0BrEKFA+HE/wXXxycIHwkCgAAABgAAgAMAPoAQQNJBskJlA2HEYkVfBlHHccgzyMWJiMAAAAAAAAAEQD//xMAAAAjAP//AAABAAIAAgAHAJAHZg6VFBoa7h7tItYlCAAAAAsAAgAHAEoCHwcYDYcT+BnxH8YkEQABABMAAgAGAHsH7g3zE6IZ9x7KIxgAAAAbAAIACQCOAQAFbAldDocTsxikHRAigiUjAAAAAAAAACAA//8AAAEAGQABABwAAgAFAP8LbBW9HCgisyUgAAAAAAAAAB0A//8AAAEAGQAAAAAAAAAAAAAAAAAAACIA//8AAAEAGQAAAB0AAgAGAHcJnRGMGEgexyLaJSIAAAAAAAAAAAAAAAAAAAAhAP//AAABABkAAAAbAAIABwBXBzgOjxRFGjcfNyP8JSEAAAAAAAAAAAAAAAAAAAAJAP//CwAAABEA//8TAAAAGgD//xwAAAAAAAEABAACAAYA/gk2EgQZkB7jItwlCQABAAsAAQAOAAIABAB3DcIXiB/ZJBEAAQATAAEAFgACAAUAeAuhFPEbliF4JRoAAQAcAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAIAHwAvAKsAZAFKAlYDggTGBR8HiggFCooLGA2uDkkQ6BGHEygVxxZiGPgZhhsLHYYe8R9KIY4iuiPGJKwlZSbhJh4AAgAfAC8AqwBkAUoCVgOCBMYFHweKCAUKigsYDa4OSRDoEYcTKBXHFmIY+BmGGwsdhh7xH0ohjiK6I8YkrCVlJuEmPAAAAAAAAgAPAEwDkwbSCQMNJBAyEyYW/BitGzMehCCWIlwkxCW1Jg4AAQAsAAIAEQBNABsBTQLPA5EFiQeuCfgLYg7lEIATLhboGLEbgx5aITQkPAAAAAAAAgAfAC8AqwBkAUoCVgOCBMYFHweKCAUKigsYDa4OSRDoEYcTKBXHFmIY+BmGGwsdhh7xH0ohjiK6I8YkrCVlJuEmHgACAB8ALwCrAGQBSgJWA4IExgUfB4oIBQqKCxgNrg5JEOgRhxMoFccWYhj4GYYbCx2GHvEfSiGOIrojxiSsJWUm4SY8AAAAAAACABAAEAMcBiQJIgwVD/gRyBR/FxsalhznHggh8SKSJN0lvCYPAAEALQACABAAVAAzAX4CHwQIBikIegr1DJEPSBIYFfsX7hrsHfQgACQ8AAAAAAACABAAEAMcBiQJIgwVD/gRyBR/FxsalhznHggh8SKSJN0lvCYPAAEALQACABAAVAAzAX4CHwQIBikIegr1DJEPSBIYFfsX7hrsHfQgACQ8AAAAAAACABAAEAMcBiQJIgwVD/gRyBR/FxsalhznHggh8SKSJN0lvCYPAAEALQACABAAVAAzAX4CHwQIBikIegr1DJEPSBIYFfsX7hrsHfQgACQ8AAAAAAACAB8ALwCrAGQBSgJWA4IExgUfB4oIBQqKCxgNrg5JEOgRhxMoFccWYhj4GYYbCx2GHvEfSiGOIrojxiSsJWUm4SYeAAIAHwAvAKsAZAFKAlYDggTGBR8HiggFCooLGA2uDkkQ6BGHEygVxxZiGPgZhhsLHYYe8R9KIY4iuiPGJKwlZSbhJjwAAAAAAAIADQDtA8oHlAtCD9ESOhZ2GX0cQx+8IdojhiWlJgwAAgAfAC8AqwBkAUoCVgOCBMYFHweKCAUKigsYDa4OSRDoEYcTKBXHFmIY+BmGGwsdhh7xH0ohjiK6I8YkrCVlJuEmKgACABMARQD8AAwCYQPvBKsGjwiTCrAM5Q4tEYMT5RVSGMQaPB20HywioSQ8AAAAAAACAA8ATAOTBtIJAw0kEDITJhb8GK0bMx6EIJYiXCTEJbUmDgACAB8ALwCrAGQBSgJWA4IExgUfB4oIBQqKCxgNrg5JEOgRhxMoFccWYhj4GYYbCx2GHvEfSiGOIrojxiSsJWUm4SYsAAEAPAAAAAAAAgAfAC8AqwBkAUoCVgOCBMYFHweKCAUKigsYDa4OSRDoEYcTKBXHFmIY+BmGGwsdhh7xH0ohjiK6I8YkrCVlJuEmHgACAB8ALwCrAGQBSgJWA4IExgUfB4oIBQqKCxgNrg5JEOgRhxMoFccWYhj4GYYbCx2GHvEfSiGOIrojxiSsJWUm4SY8AAAAAAACAB8ALwCrAGQBSgJWA4IExgUfB4oIBQqKCxgNrg5JEOgRhxMoFccWYhj4GYYbCx2GHvEfSiGOIrojxiSsJWUm4SYeAAIAHwAvAKsAZAFKAlYDggTGBR8HiggFCooLGA2uDkkQ6BGHEygVxxZiGPgZhhsLHYYe8R9KIY4iuiPGJKwlZSbhJjwAAAAAAAIADwBMA5MG0gkDDSQQMhMmFvwYrRszHoQgliJcJMQltSYOAAEALAACABEATQAbAU0CzwORBYkHrgn4C2IO5RCAEy4W6BixG4MeWiE0JDwAAAAAAAIAEAAQAxwGJAkiDBUP+BHIFH8XGxqWHOceCCHxIpIk3SW8Jg8AAQAtAAIAEABUADMBfgIfBAgGKQh6CvUMkQ9IEhgV+xfuGuwd9CAAJDwAAAAAAAIAEAAQAxwGJAkiDBUP+BHIFH8XGxqWHOceCCHxIpIk3SW8Jg8AAgAfAC8AqwBkAUoCVgOCBMYFHweKCAUKigsYDa4OSRDoEYcTKBXHFmIY+BmGGwsdhh7xH0ohjiK6I8YkrCVlJuEmLQACABAAVAAzAX4CHwQIBikIegr1DJEPSBIYFfsX7hrsHfQgACQ8AAAAAAACABEA0AKiBXIIPgsEDr8QbBMHFo4Y+xpKHXMfcCE2I7wk8SXCJhAAAQAuAAIADwBZAEgBqwJsBHkGxQhHC/QNxxC5E8gW7BkjHWYgtyM8AAAAAAABAAsAAQAPAAEAEwABABcAAQAbAAEAKAAAAAAAAQALAAEADwABABMAAQAbAAEAKAAAAAAAAgAQABADHAYkCSIMFQ/4EcgUfxcbGpYc5x4IIfEikiTdJbwmDwABAC0AAgAQAFQAMwF+Ah8ECAYpCHoK9QyRD0gSGBX7F+4a7B30IAAkPAAAAAAAAgAfAC8AqwBkAUoCVgOCBMYFHweKCAUKigsYDa4OSRDoEYcTKBXHFmIY+BmGGwsdhh7xH0ohjiK6I8YkrCVlJuEmHgACAB8ALwCrAGQBSgJWA4IExgUfB4oIBQqKCxgNrg5JEOgRhxMoFccWYhj4GYYbCx2GHvEfSiGOIrojxiSsJWUm4SY8AAAAAAACAB8ALwCrAGQBSgJWA4IExgUfB4oIBQqKCxgNrg5JEOgRhxMoFccWYhj4GYYbCx2GHvEfSiGOIrojxiSsJWUm4SYeAAIAHwAvAKsAZAFKAlYDggTGBR8HiggFCooLGA2uDkkQ6BGHEygVxxZiGPgZhhsLHYYe8R9KIY4iuiPGJKwlZSbhJjwAAAAAAAEABQABAAgAAQAKAAEADgABABAAAQAVAAEAGAABABoAAQAeAAEAIAABACUAAQAoAAEAKgABAC4AAQAwAAEAMgABADUAAQA3AAEAOQABADwAAAAAAAEAAwABAAcAAQAMAAEADwABABIAAQAXAAEAGgABAB0AAQAhAAEAJgABACkAAQAsAAEAMAABADMAAQA2AAEAOQABADwAAAAAAAIABQBzAWwFdwtCE4ccBAACAAYA/gk2EgQZkB7jItwlCQAAAAsAAgAEAA8CnQf0D5EaDgACAAQAdw3CF4gf2SQRAAAAEwACAAQADwKdB/QPkRoWAAIABQB4C6EU8RuWIXglGgAAABwAAgAEAA8CnQf0D5EaHwACAAYA/gk2EgQZkB7jItwlJAAAACUAAgAEAA8CnQf0D5EaKAACAAQAdw3CF4gf2SQrAAAALQACAAQADwKdB/QPkRowAAIABQB4C6EU8RuWIXglNAAAADUAAgAEAA8CnQf0D5EaOAACAAQAdw3CF4gf2SQ7AAAAPAAAAAAAAgAFAHMBbAV3C0IThxwEAAIABgD+CTYSBBmQHuMi3CUJAAAACwACAAQADwKdB/QPkRoOAAIABAB3DcIXiB/ZJBEAAAATAAIABAAPAp0H9A+RGhYAAgAFAHgLoRTxG5YheCUaAAAAHAACAAQADwKdB/QPkRofAAIABgD+CTYSBBmQHuMi3CUkAAAAJQACAAQADwKdB/QPkRooAAIABAB3DcIXiB/ZJCsAAAAtAAIABAAPAp0H9A+RGjAAAgAFAHgLoRTxG5YheCU0AAAANQACAAQADwKdB/QPkRo4AAIABAB3DcIXiB/ZJDsAAAA8AAAAAAABAAMAAQAFAAEACAABAAsAAQAOAAEAEAABABMAAQAWAAEAGQABABsAAQAeAAEAIQABACQAAQAmAAEAKQABACwAAQAvAAEAMQABADQAAQA3AAEAOQABADwAAAAAAAIAHwAvAKsAZAFKAlYDggTGBR8HiggFCooLGA2uDkkQ6BGHEygVxxZiGPgZhhsLHYYe8R9KIY4iuiPGJKwlZSbhJh4AAgAfAC8AqwBkAUoCVgOCBMYFHweKCAUKigsYDa4OSRDoEYcTKBXHFmIY+BmGGwsdhh7xH0ohjiK6I8YkrCVlJuEmPAAAAAAAAQAFAAEACAABAAoAAQAOAAEAEAABABUAAQAYAAEAGgABAB4AAQAgAAEAJQABACgAAQAqAAEALgABADAAAQAyAAEANQABADcAAQA5AAEAPAAAAAAAAQADAAEABQABAAgAAQALAAEADgABABAAAQATAAEAFgABABkAAQAbAAEAHgABACEAAQAkAAEAJgABACkAAQAsAAEALwABADEAAQA0AAEANwABADkAAQA8AAAAAAABAAMAAQAFAAEACAABAAsAAQAOAAEAEAABABMAAQAWAAEAGQABABsAAQAeAAEAIQABACQAAQAmAAEAKQABACwAAQAvAAEAMQABADQAAQA3AAEAOQABADwAAAAAAAIACwBwAKYBhQP0BeAIOgz2DwgUZxgMHfEhCgACABUAtAF3A0cFIwcGCfAK3gzQDsIQtBKjFJAWdRhUGigc8h2sH1Yh6yJqJM0lHgACABEAagEBA74EmwaVCKgKzgwID1ERpxMHFm4Y3BpMHcAfMyKjJC4AAgAPAI8DDQd3CskNAREcFBMX4RmDHPEeIyESI7Ak8SXEJjwAAAAAAAIACwBwAKYBhQP0BeAIOgz2DwgUZxgMHfEhCgACABUAtAF3A0cFIwcGCfAK3gzQDsIQtBKjFJAWdRhUGigc8h2sH1Yh6yJqJM0lHgACABEAagEBA74EmwaVCKgKzgwID1ERpxMHFm4Y3BpMHcAfMyKjJC4AAgAPAI8DDQd3CskNAREcFBMX4RmDHPEeIyESI7Ak8SXEJjwAAAAAAAEAAgABAAQAAQAGAAEACAABAAoAAQAMAAEADgABABAAAQASAAEAFAABABYAAQAYAAEAGgABABwAAQAeAAEAIAABACIAAQAkAAEAJgABACgAAQAqAAEALAABAC4AAQAwAAEAMgABADQAAQA2AAEAOAABADoAAQA8AAAAAAABAAIAAQAEAAEABgABAAgAAQAKAAEADAABAA4AAQAQAAEAEgABABQAAQAWAAEAGAABABoAAQAcAAEAHgABACAAAQAiAAEAJAABACYAAQAoAAEAKgABACwAAQAuAAEAMAABADIAAQA0AAEANgABADgAAQA6AAEAPAAAAAAAAQACAAEABAABAAYAAQAIAAEACgABAAwAAQAOAAEAEAABABIAAQAUAAEAFgABABgAAQAaAAEAHAABAB4AAQAgAAEAIgABACQAAQAmAAEAKAABACoAAQAsAAEALgABADAAAQAyAAEANAABADYAAQA4AAEAOgABADwAAAAAAAIACwBwAKYBhQP0BeAIOgz2DwgUZxgMHfEhCgACABUAtAF3A0cFIwcGCfAK3gzQDsIQtBKjFJAWdRhUGigc8h2sH1Yh6yJqJM0lHgACABEAagEBA74EmwaVCKgKzgwID1ERpxMHFm4Y3BpMHcAfMyKjJC4AAgAPAI8DDQd3CskNAREcFBMX4RmDHPEeIyESI7Ak8SXEJjwAAAAAAAIACwBwAKYBhQP0BeAIOgz2DwgUZxgMHfEhCgACABUAtAF3A0cFIwcGCfAK3gzQDsIQtBKjFJAWdRhUGigc8h2sH1Yh6yJqJM0lHgACABEAagEBA74EmwaVCKgKzgwID1ERpxMHFm4Y3BpMHcAfMyKjJC4AAgAPAI8DDQd3CskNAREcFBMX4RmDHPEeIyESI7Ak8SXEJjwAAAAAAAIACwBwAKYBhQP0BeAIOgz2DwgUZxgMHfEhCgACABUAtAF3A0cFIwcGCfAK3gzQDsIQtBKjFJAWdRhUGigc8h2sH1Yh6yJqJM0lHgACABEAagEBA74EmwaVCKgKzgwID1ERpxMHFm4Y3BpMHcAfMyKjJC4AAgAPAI8DDQd3CskNAREcFBMX4RmDHPEeIyESI7Ak8SXEJjwAAAAAAAIACwBwAKYBhQP0BeAIOgz2DwgUZxgMHfEhCgACABUAtAF3A0cFIwcGCfAK3gzQDsIQtBKjFJAWdRhUGigc8h2sH1Yh6yJqJM0lHgACABEAagEBA74EmwaVCKgKzgwID1ERpxMHFm4Y3BpMHcAfMyKjJC4AAgAPAI8DDQd3CskNAREcFBMX4RmDHPEeIyESI7Ak8SXEJjwAAAAAAAIAFAB6AvUEawfbCUYMqQ4DEVATkBXBF90Z4xvSHaMfUiHaIjUkWyVAJtgmEwACAB8ALwCrAGQBSgJWA4IExgUfB4oIBQqKCxgNrg5JEOgRhxMoFccWYhj4GYYbCx2GHvEfSiGOIrojxiSsJWUm4SYxAAIADACLAPQB/QOBBmMJkQz6D5MTUBcoGxYfDyM8AAAAAAACABIAvgJ5BTAI4gqKDScQthI3FaMX+Rk0HE8eRiARIqojBSUWJswmEQACAB8ALwCrAGQBSgJWA4IExgUfB4oIBQqKCxgNrg5JEOgRhxMoFccWYhj4GYYbCx2GHvEfSiGOIrojxiSsJWUm4SYvAAIADgBqAIIBHAMcBW0HAArKDL4P1xINFlkZuBwkIJgjPAAAAAAAAQALAAEADwABABMAAQAXAAEAGwABACgAAAAAAAEACwABAA8AAQATAAEAFwABABsAAQAoAAAAAAABAAsAAQAPAAEAEwABABcAAQAbAAEAKAAAAAAAAQALAAEADwABABMAAQAXAAEAGwABACgAAAAAAAEACwABAA8AAQATAAEAFwABABsAAQAoAAAAAAABAAsAAQAPAAEAEwABABcAAQAbAAEAKAAAAAAAAQALAAAADwABABMAAQAXAAEAGwABACgAAAAAAAEACwAAAA8AAQATAAEAFwABABsAAQAoAAAAAAABAAsAAQAPAAEAEwABABcAAQAbAAEAKAAAAAAAAQALAAEADwABABMAAQAXAAEAGwABACgAAAAAAAEACwABAA8AAQATAAEAFwABABsAAQAoAAAAAAABAAsAAQAPAAEAEwABABcAAQAbAAEAKAAAAAAAAgASAMcCiwVICAALrA1OEOESYRXOFyMaXBx0HmYgLCK/IxQlHibPJhEAAgAfABkAYQDPAF8BDQLWArQDqASvBccG7QchCWEKrQsDDWIOyQ84Ea0SKhSsFTMXvhhMGt4bch0JH6MgPSLYI3QlLwACAA4AwQCOAgAF3wcHC10OzBFEFbMYCRwxHxAigiRPJjwAAAAAAAIADwBMA5MG0gkDDSQQMhMmFvwYrRszHoQgliJcJMQltSYOAAIAHwAvAKsAZAFKAlYDggTGBR8HiggFCooLGA2uDkkQ6BGHEygVxxZiGPgZhhsLHYYe8R9KIY4iuiPGJKwlZSbhJiwAAgARAE0AGwFNAs8DkQWJB64J+AtiDuUQgBMuFugYsRuDHlohNCQ8AAAAAAACABIAxwKLBUgIAAusDU4Q4RJhFc4XIxpcHHQeZiAsIr8jFCUeJs8mEQACAB8ALwCrAGQBSgJWA4IExgUfB4oIBQqKCxgNrg5JEOgRhxMoFccWYhj4GYYbCx2GHvEfSiGOIrojxiSsJWUm4SYvAAIADgBtAIsBLAMyBYkHIArrDOEP+hIuFncZ0Bw2IKIjPAAAAAAAAgAPAEwDkwbSCQMNJBAyEyYW/BitGzMehCCWIlwkxCW1Jg4AAgAfAC8AqwBkAUoCVgOCBMYFHweKCAUKigsYDa4OSRDoEYcTKBXHFmIY+BmGGwsdhh7xH0ohjiK6I8YkrCVlJuEmLAACABEATQAbAU0CzwORBYkHrgn4C2IO5RCAEy4W6BixG4MeWiE0JDwAAAAAAAIAEQDQAqIFcgg+CwQOvxBsEwcWjhj7Gkodcx9wITYjvCTxJcImEAABAC4AAgAPAFkASAGrAmwEeQbFCEcL9A3HELkTyBbsGSMdZiC3IzwAAAAAAAIAHwAvAKsAZAFKAlYDggTGBR8HiggFCooLGA2uDkkQ6BGHEygVxxZiGPgZhhsLHYYe8R9KIY4iuiPGJKwlZSbhJh4AAgAfAC8AqwBkAUoCVgOCBMYFHweKCAUKigsYDa4OSRDoEYcTKBXHFmIY+BmGGwsdhh7xH0ohjiK6I8YkrCVlJuEmPAAAAAAAAgAfAC8AqwBkAUoCVgOCBMYFHweKCAUKigsYDa4OSRDoEYcTKBXHFmIY+BmGGwsdhh7xH0ohjiK6I8YkrCVlJuEmHgACAB8ALwCrAGQBSgJWA4IExgUfB4oIBQqKCxgNrg5JEOgRhxMoFccWYhj4GYYbCx2GHvEfSiGOIrojxiSsJWUm4SY8AAAAAAAAAAMAAgAaAFMClQTEBuII8QrxDOEOxBCYEl0UExa7F1QZ3RpXHMEdGB9dII4hqiKuI5gkZiUSJpcm8CYcAAAAHgACABwAHwIgBAkG4AenCWALDg2yDksQ2xFiE+EUWBbFFysZiBrcGycdZx6dH8cg5SHzIvEj2iSqJVkm2iY5AAAAAAAAAAMAAgAaAFMClQTEBuII8QrxDOEOxBCYEl0UExa7F1QZ3RpXHMEdGB9dII4hqiKuI5gkZiUSJpcm8CYcAAAAHgACABwAHwIgBAkG4AenCWALDg2yDksQ2xFiE+EUWBbFFysZiBrcGycdZx6dH8cg5SHzIvEj2iSqJVkm2iY5AAAAAAAAABAAAgAqAJ8BLwO0BC0GnQcDCV8KsQv8DD8OeQ+tENoR/hIcFDIVQxZMF08YTBlCGjEbGRz6HNUdqR52Hzsg+CCtIVoiACObIy4ktiQ0JaUlCiZiJqom4CYDJzkAAAAAAAAAEAACACoAnwEvA7QELQadBwMJXwqxC/wMPw55D60Q2hH+EhwUMhVDFkwXTxhMGUIaMRsZHPoc1R2pHnYfOyD4IK0hWiIAI5sjLiS2JDQlpSUKJmImqibgJgMnOQAAAAAAAAAFAAIAGQABBIMHoAptDfYPRxJoFF8WLRjaGWgb2RwtHmgfiiCVIYoiaCMxJOQkgCUGJnMmxib8Jh0AAAAeAAIAHwAkA8QFFwgtChsM5Q2SDygRqhIYFHYVxhYHGDwZZRqDG5Ucnx2dHpEfeyBbITEi/CK8I28kFSWsJTEmnybvJjwAAAAAAAAABQACABkAAQSDB6AKbQ32D0cSaBRfFi0Y2hloG9kcLR5oH4oglSGKImgjMSTkJIAlBiZzJsYm/CYdAAAAHgACAB8AJAPEBRcILQobDOUNkg8oEaoSGBR2FcYWBxg8GWUagxuVHJ8dnR6RH3sgWyExIvwivCNvJBUlrCUxJp8m7yY8AAAAAAACAAwAoQWvCjsPWRMQF2caZB0HIE4iNCSwJa8mCwAAAA4AAgARACAE8Ad4C8AOzBGhFEIXshnxGwIe5B+WIRYjZCR4JU4m3CYeAAAAIAACABEA9wN0B6AKjw1NEOISUxWjF9YZ7BvkHb4feiERI34ktyWkJjAAAAAAAAIADAChBa8KOw9ZExAXZxpkHQcgTiI0JLAlryYLAAAADgACABEAIATwB3gLwA7MEaEUQheyGfEbAh7kH5YhFiNkJHglTibcJh4AAAAgAAIAEQD3A3QHoAqPDU0Q4hJTFaMX1hnsG+Qdvh96IREjfiS3JaQmMAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAHQD//x4AAAA8AP//AAABAAUAAgAFABsFIwyHE+0a9SEJAAAAFgACAAgA3wHrBQcLphBqFgkcJSExJR0AAQAeAAIACAD6AmAHIwwNEQMW7RqwHxYkJQAAADIAAgALACABtgMfBwcLNg+HE9oXCRzxH1oj8CU8AAAAAAAAAAsA//8OAAAAHgD//yAAAAAwAP//AAACAAQAdAYUD/wXnCADAAAACAACAAQAAAVdDrMYECILAAEADgACAAQAdAYUD/wXnCARAAAAFwACAAgA3wHrBQcLphBqFgkcJSExJR4AAQAgAAIABAB0BhQP/BecICMAAAApAAIACADfAesFBwumEGoWCRwlITElMAAAAAAAAAA5AP//AAABAAkAAgAIAN8B6wUHC6YQahYJHCUhMSUQAAEAJwACABMAcgCOAR4DAAUfB2wJ2AtdDu4QhxMiFrMYOBukHfEfECLyI4IlniY5AAAAAAAAABwA//8eAAAAOQD//wAAAQADAAIACwAgAbYDHwcHCzYPhxPaFwkc8R9aI/AlDQAAABIAAgALACABtgMfBwcLNg+HE9oXCRzxH1oj8CUcAAEAHgACAAoA9wRMCV0NQhECFaAYHBxvH4siTyUnAAAALAACAA4AwQCOAgAF3wcHC10OzBFEFbMYCRwxHxAigiRPJjkAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAkA//8LAAAAEQD//xMAAAAaAP//HAAAACQA//8lAAAAKwD//y0AAAA0AP//NQAAADsA//88AAAAAAABAAQAAgAGAP4JNhIEGZAe4yLcJQkAAQALAAEADgACAAQAdw3CF4gf2SQRAAEAEwABABYAAgAFAHgLoRTxG5YheCUaAAEAHAABAB8AAgAGAP4JNhIEGZAe4yLcJSQAAQAlAAEAKAACAAQAdw3CF4gf2SQrAAEALQABADAAAgAFAHgLoRTxG5YheCU0AAEANQABADgAAgAEAHcNwheIH9kkOwABADwAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAQA6AAIAAwA2EDQcCSQ8AAIABQC5DIgW2B30IgQmQAAAAGwAAAAAAAEAOgACAAMANhA0HAkkPAACAAUAuQyIFtgd9CIEJkAAAABsAAAAAAABAAUAAQAIAAEACgABAA4AAQAQAAEAFQABABgAAQAaAAEAHgABACAAAQAlAAEAKAABACoAAQAuAAEAMAABADIAAAA6AAIAAwA2EDQcCSQ8AAIABQC5DIgW2B30IgQmQAAAAGwAAgAHALIAugIEBn0KFxC/Fm0ecgACAAIATAxiGXMAAQB3AAEAeQABAH4AAQCBAAEAgwABAIcAAQCJAAEAiwABAI4AAQCQAAEAkgABAJUAAAAAAAIAGgA0ALwAhwGHArAD/QRlBuYHegkeC84MiQ5LEBQS4BOsFXcXPhkCG74cbh4TIKchKiOVJOQlGQACAB4AMgC2AHgBagKEA74EEgZ8B/cIgQoVDLUNWg8EEbESXxQMFrYXWxn7Go8cGR6UH/4gUiKMI6YkmCVaJt4mNgACABEAigDfAbYD6wViCAcLzA2mEIcTahZEGQkcrh4lIVojMSWGJkYAAgAPAFcDpgbrCSMNSBBYE00WIxnSG1QeoCCtImwkzCW4JlQAAgAkACQAgwASAcgBnQKNA5IEqwXTBgoISwmWCukLQw2iDgcQbBHUEjwUpBUJF24YzRknG3ocxR0GHz0gZSF+IoMjcyRIJf4ljSbsJncAAgAfAC8AqwBkAUoCVgOCBMYFHweKCAUKigsYDa4OSRDoEYcTKBXHFmIY+BmGGwsdhh7xH0ohjiK6I8YkrCVlJuEmlQAAAAAAAgA3AA0AMABnALAACQFvAeIBYALnAngDEgSzBFsFCQa9BnYHNAj2CLwJhgpTCyMM9gzKDaIOeg9TEC8RDBLoEscTpRSDFWAWPRcbGPUY0BmqGoIbVxwrHfsdyh6VH1wgICHhIZsiUSMDJK0kUiXvJYQmNgACABEAigDfAbYD6wViCAcLzA2mEIcTahZEGQkcrh4lIVojMSWGJkYAAgAyAA0BGAIlAzAEOQVEBkwHUwhaCV0KYgtkDGQNYw5fD1kQURFHEjsTKxQZFQUW7RbSF7QYkRlrGkIbExzgHKkdbB4qH+MfliBCIechhiIdI6wjMySxJCUljyXuJUImiSbCJuwmByd3AAIAHwAvAKsAZAFKAlYDggTGBR8HiggFCooLGA2uDkkQ6BGHEygVxxZiGPgZhhsLHYYe8R9KIY4iuiPGJKwlZSbhJpUAAAAAAAEAOgACAAMA4gZzEAgbPAAAAGsAAAAAAAEAAwABAAUAAQAIAAEACwABAA4AAQAQAAEAEwABABYAAQAZAAEAGwABAB4AAQAhAAEAJAABACYAAQApAAEALAABAC8AAQAxAAAAOgACAAMA4gZzEAgbPAAAAGsAAQBtAAEAbwABAHIAAQB0AAEAdwABAHoAAQB9AAEAfwABAIIAAQCFAAEAiAABAIoAAQCNAAEAkAABAJIAAQCVAAAAAAABABEAAQAVAAEAGQABACEAAQAuAAEAMAABADMAAQA4AAEAPQABAEAAAQBEAAEATAABAFQAAQBYAAEAXwABAGgAAQBxAAEAdAABAHwAAQCBAAEAhAABAIcAAQCNAAEAlQAAAAAAAgAOAKsJXBBmFVsZhBwTHyMhziIgJCcl7SV6JtQmAycNAAIABgDzBCMKjQ8pFfca7yASAAIABABTB+4OyRbXHhUAAgAFADcGiAz4EocZOSAZAAIABgBqBeAKYxD1FZcbSiEeAAIABQBSBrYMKhO0GVUgIgACAAMA/QoRFWIeJAACAAMA8gm9E24dJgACAAMA8gm9E24dKAACAAMA+wnfE5cdKgACAAMA+gnbE5IdLAACAAMA9QnXE5EdLgACAAMA9QnXE5EdMAACAAMAHgr4E5sdMgACAAkA4AO+B58Lgg9nE04XOBsmHxkjOgACAAMAJAeIEFobPAAAAGsAAgAFAA8RnRkYH9MiYCVvAAIABABPEAcbviGCJXIAAgAFAKQJFRKJGeQfyCR2AAIAIADUAaIDaQUrB+cImQpHDOsNiA8dEakSLBSkFRQXeBjRGR8bYRyVHboe0x/cINUhvCKSI1UkAyWbJRsmgybQJv8mlQAAAAAAAgAOAKsJXBBmFVsZhBwTHyMhziIgJCcl7SV6JtQmAycNAAIABgDzBCMKjQ8pFfca7yASAAIABABTB+4OyRbXHhUAAgAKAGADyAY4CrENMxG/FFMY8hucH1AjHgACAAUAUga2DCoTtBlVICIAAgARAIgCAgVvB9EJJwxxDrEQ5xIRFTMXSxlbG2IdYB9XIUcjLiUyAAIACQDgA74HnwuCD2cTThc4GyYfGSM6AAIAAwAkB4gQWhs8AAAAawACAAUADxGdGRgf0yJgJW8AAgAEAE8QBxu+IYIlcgACAAUApAkVEokZ5B/IJHYAAgAgANQBogNpBSsH5wiZCkcM6w2IDx0RqRIsFKQVFBd4GNEZHxthHJUduh7TH9wg1SG8IpIjVSQDJZslGyaDJtAm/yaVAAAAAAACADsA2QJcBZ8HqwmMC0YN3w5cEL8RCxNCFGYVehZ9F3IYWxk2GgUbyhuEHDYd3B17HhMfoR8pIKogIyGXIQQibCLOIikjgSPTIyAkaCSsJOwkJyVfJZIlwSXtJRYmOiZcJnomlSatJsIm1CbkJvEm+yYDJwknDScPJzoAAgADACQHiBBaGzwAAABrAAAAAAAAAAAAAgAQAEYCjgTXBiIJcAu9DQoQWhKoFPcWRhmUG+MdMCB8IsckDwACAAYAhAULC5cQKRbCG2MhFAACAFoAfAD4AHQB8AFrAucCYgPeA1kE0wROBcgFQwa+BjgHsQcqCKQIHgmXCQ8KhwoAC3kL8AtoDN8MVg3NDUMOug4vD6QPGhCPEAQReBHsEV8S0xJFE7gTKxSbFA4VfhXuFV8WzhY9F6wXGhiIGPYYYhnPGTsaphoQG3sb5BtOHLYcHh2FHe0dUx65Hh4fgh/mH0ggqiANIW0hziEtIowi6SJHI6Mj/yNZJLQkDCVlJbwlEyZoJrwmbQABAG8AAQBxAAEAdAABAHcAAQB8AAEAlQAAAAAAAAAeAAAAHwACAAMAjhEXHUMkIQAAACMAAACNAAAAlQAAAAAAAAAGAAIAAwC3AnUKuBYIAAAACQACAAMAjhEXHUMkCwACAAQAIhBOGh0hYSUOAAAAHAACAAMAtwJ1CrgWHgAAAB8AAgADAI4RFx1DJCEAAAAjAAAAhgACAAMAtwJ1CrgWiAAAAIkAAgADAAcOShj9IIsAAACNAAAAAAABABEAAAAVAAEAGQABAB0AAQAhAAEALgAAADAAAQAzAAEANQABADgAAQA9AAAAQAABAEQAAQBIAAEATAABAFQAAQBYAAEAWwABAF8AAQBoAAEAcQABAHQAAQB4AAEAfAABAIEAAACEAAEAhwABAIoAAQCNAAEAlQAAAAAAAgAOADgA2wDjAUsDDwUpB5YJUgxYD6gSPRYUGiwefyINAAIABACTB0EPDRf7HhAAAgAGAE8FvQpDEN8VjBtIIRUAAgAEAEgPGxpiIaElGAACAAQAyQmPE44cviMbAAIABABIDxsaYiGhJR4AAgAEAMkJjxOOHL4jIQACAAQASA8bGmIhoSUkAAIABADJCY8Tjhy+IycAAgAEAEgPGxpiIaElKgACAAkAwgOOB2ILPQ8jExAXBRsBHwQjMgACAAMAqAltE0AdNAAAADYAAAA5AAIABADfB7cPhxdRHzwAAABXAAIAAwDSDLMYYCJZAAIAFgBMApME2AYZCVMLhg2yD9IR6BPyFewX1hmvG3IdHx+xICUidiOgJJslXybgJm4AAgAFAJYGJw2wEy8apSByAAIAJACrAVAD8QSMBiEIrwk4C7oMNA6pDxURexLZEy4VfBbBF/wYLRpVG3IchR2MHogfeCBbITAi9yKxI1ok9CR8JfIlVSalJuAmBCeVAAAAAAACAA4AOADbAOMBSwMPBSkHlglSDFgPqBI9FhQaLB5/Ig0AAgAEAJMHQQ8NF/seEAACAAYATwW9CkMQ3xWMG0ghFQACAAQASA8bGmIhoSUYAAIABADJCY8Tjhy+IxsAAgAEAEgPGxpiIaElHgACAAQAyQmPE44cviMhAAIABABIDxsaYiGhJSQAAgAEAMkJjxOOHL4jJwACAAQASA8bGmIhoSUqAAIACQDCA44HYgs9DyMTEBcFGwEfBCMyAAIAAwCoCW0TQB00AAAAOQACAAQA3we3D4cXUR88AAAATgACAAoAHgUUCtsOZxOuF6MbMh9EIrskayZXAAIAAwDSDLMYYCJZAAIAFgBMApME2AYZCVMLhg2yD9IR6BPyFewX1hmvG3IdHx+xICUidiOgJJslXybgJm4AAgAFAJYGJw2wEy8apSByAAIAJACrAVAD8QSMBiEIrwk4C7oMNA6pDxURexLZEy4VfBbBF/wYLRpVG3IchR2MHogfeCBbITAi9yKxI1ok9CR8JfIlVSalJuAmBCeVAAAAAAABABEAAQAVAAEAGQABAB0AAQAhAAEALgABADAAAQAzAAEANQABADgAAQA9AAEAQAABAEQAAQBIAAEATAABAFQAAQBYAAEAWwABAF8AAQBoAAEAcQABAHQAAQB4AAEAfAABAIEAAQCEAAEAhwABAIoAAQCNAAEAlQAAAAAAAgAHANgErgmJDmcTSBguHRsiBgACAAgATASaCOkMOhGMFeUZQh6mIg0AAgAEAL4Hfw9JFyIfEAACAAYAhAULC5cQKRbCG2MhFQACAAQASA8bGmIhoSUYAAIABADUCuUUph08JBsAAgAEAEgPGxpiIaElHgACAAQA1ArlFKYdPCQhAAIABABIDxsaYiGhJSQAAgAEANQK5RSmHTwkJwACAAQASA8bGmIhoSUqAAIACQD1A+QHzwu5D54TgxdmG0gfKyMyAAIAAwCfCWITOR00AAIAAwC/CX0TPx02AAIABADRB5sPZhc2HzkAAgAEAPMHzw+YF1cfPAAAAE4AAgAKACcFIwrtDnoTwhezGz4fTiLBJG0mVwACAAMAvwl9Ez8dWQACABYATAKTBNgGGQlTC4YNsg/SEegT8hXsF9YZrxtyHR8fsSAlInYjoCSbJV8m4CZuAAIABQCYBi8NwBNEGrcgcgACACQAvgF4AyoF0wZ4CBMKpgszDbYOMxCmEQ8TcBTIFRUXWhiTGcEa5Rv9HAoeCh/+H+UgvyGKIkgj9SOUJCMloSUOJmkmsCblJgUnlQAAAAAAAgAVAMIBhQNIBQ0H0wiaCmAMJw7vD7gRgBNKFRIX2hijGmscMx76H8EhhiNMJRQAAgAOAKMCRQXkB4EKHg25D1IS6xSDFxoashxIH+AheCQhAAIADgChAkIF5AeGCiYNxg9mEgQVoBc5GtEcZR/3IYYkLgACAEAArABWAQICrQJXAwEEqgRUBfwFpQZMB/MHmghCCecJjAoyC9YLewweDcENZA4GD6YPRxDoEIgRJxLFEmMTABSdFDgV1BVvFggXoRc6GNIYaRn/GZQaKRu9G1Ac4hx0HQUelR4jH7IfPyDLIFYh4SFqIvIieiMAJIUkCiWNJQ8mkCZtAAIABQCYBi8NwBNEGrcgcQACAAYAwgVzCxMRphYqHKIhdgACACAABwIDBPQF3Qe5CYoLUg0ND7wQXxL2E34V+xZqGMkZHRtfHJMduB7MH84gwSGhIm8jKiTSJGYl5SVOJqIm3yYDJ5UAAAAAAAIABQBzAWwFdwtCE4ccBAACAAYA/gk2EgQZkB7jItwlCQAAAAsAAgAEAA8CnQf0D5EaDgACAAQAdw3CF4gf2SQRAAAAEwACAAQADwKdB/QPkRoWAAIABQB4C6EU8RuWIXglGgAAABwAAgAEAA8CnQf0D5EaHwACAAYA/gk2EgQZkB7jItwlJAAAACUAAgAEAA8CnQf0D5EaKAACAAQAdw3CF4gf2SQrAAAALQACAAQADwKdB/QPkRowAAAAOgACAAMAqwvmFfYePAAAAFEAAQBSAAIABAAPAp0H9A+RGlUAAgAEAHcNwheIH9kkWAAAAFkAAgAFAHMBbAV3C0IThxxdAAIABgD+CTYSBBmQHuMi3CViAAAAZAACAAQADwKdB/QPkRpnAAIABAB3DcIXiB/ZJGoAAABsAAIABAAPAp0H9A+RGm8AAgAFAHgLoRTxG5YheCVzAAAAdQACAAQADwKdB/QPkRp4AAIABgD+CTYSBBmQHuMi3CV9AAAAfgACAAQADwKdB/QPkRqBAAIABAB3DcIXiB/ZJIQAAACGAAIABAAPAp0H9A+RGokAAgAFAHgLoRTxG5YheCWNAAAAjgACAAQADwKdB/QPkRqRAAIABAB3DcIXiB/ZJJQAAACVAAAAAAACAD0ABAAPACEAOgBaAIEArgDiABwBXAGjAe4BQAKZAvUCWQPBAy4EoQQZBZUFGAaeBioHugdOCOcIhQknCs0KdwsnDNkMkA1LDgoPzA+SEF0RKhL8EtATqBSDFWQWRRcsGBUZAhrwGuMb2RzRHc0ezB/NINEh2SLiI+4k/iU8AAAAUQABAFIAAAAAAAIABQBzAWwFdwtCE4ccBAACAAYA/gk2EgQZkB7jItwlCQAAAAsAAgAEAA8CnQf0D5EaDgACAAQAdw3CF4gf2SQRAAAAEwACAAQADwKdB/QPkRoWAAIABQB4C6EU8RuWIXglGgAAABwAAgAEAA8CnQf0D5EaHwACAAYA/gk2EgQZkB7jItwlJAAAACUAAgAEAA8CnQf0D5EaKAACAAQAdw3CF4gf2SQrAAAALQACAAQADwKdB/QPkRowAAAAOgACAAMAqwvmFfYePAAAAFEAAQBSAAIABAAPAp0H9A+RGlUAAgAEAHcNwheIH9kkWAAAAFkAAgAFAHMBbAV3C0IThxxdAAIABgD+CTYSBBmQHuMi3CViAAAAZAACAAQADwKdB/QPkRpnAAIABAB3DcIXiB/ZJGoAAABsAAIABAAPAp0H9A+RGm8AAgAFAHgLoRTxG5YheCVzAAAAdQACAAQADwKdB/QPkRp4AAIABgD+CTYSBBmQHuMi3CV9AAAAfgACAAQADwKdB/QPkRqBAAIABAB3DcIXiB/ZJIQAAACGAAIABAAPAp0H9A+RGokAAgAFAHgLoRTxG5YheCWNAAAAjgACAAQADwKdB/QPkRqRAAIABAB3DcIXiB/ZJJQAAACVAAAAAAABABEAAQAVAAEAGQABAB0AAQAhAAEALgABADAAAQAzAAEANQABADgAAQA9AAEAQAABAEQAAQBIAAEATAABAFQAAQBYAAEAWwABAF8AAQBoAAEAcQABAHQAAQB4AAEAfAABAIEAAQCEAAEAhwABAIoAAQCNAAEAlQAAAAAAAgAKAEICtwWECXgNgBGQFZgZjB1ZIc4kCQABAAsAAQCTAAEAlQAAAAAAAgAEAHQGFA/8F5wgAwABAAUAAQAHAAEACQABAAsAAQANAAEADwABABEAAQATAAEAFQABABcAAQAZAAEAGwABAB0AAQAfAAEAIQABACMAAQAlAAEAJwABACkAAQArAAEALQABAC8AAQAxAAEAMwABADUAAQA3AAEAOQABADsAAQA9AAEAPgABAEAAAQBCAAEARAABAEYAAQBIAAEASgABAEsAAQBNAAEATwABAFEAAQBTAAEAVQABAFYAAQBYAAEAWgABAFwAAQBeAAEAYAABAGIAAQBpAAEAawABAG0AAQBvAAEAcQABAHMAAQB1AAEAdwABAHkAAQB7AAEAfQABAH8AAQCBAAEAgwACAAMA3w/FGbQhhQABAIcAAQCJAAEAiwABAI0AAQCPAAEAkQABAJMAAQCVAAAAAAACABEALQCuAH4BlgLxA4oFXgdnCaQLEA6pEG4TWxZuGaUc/B93IxAAAgAVAH4BBAORBCcGxAdpCRQLxwyADkAQBxLTE6YVfhddGUIbLB0bHxAhCyMLJSQAAgAVALMBaAMgBdgGlAhSChEM0w2WD1wRIhPrFLYWgRhPGh4c7R2+H5EhZSM6JTgAAABQAAIAIACOARsDqAQ1BsEHTQnVClwM4A1hD9wQVRLIEzYVnhb/F1kZqhryGzEdYx6KH6QgriGpIpEjZCQiJcclTia2JvgmbwACAAQAvgd/D0kXIh9yAAIAJABtAdkCRASuBRcHfQjiCUULpgwDDl0PtRAHElYToBTkFSQXXhiQGbsa3xv8HA4eGB8WIAoh8CHKIpUjUCT6JJAlEiZ7Jssm/iaVAAAAAAABABEAAQAVAAEAGQABAB0AAQAhAAEALgABADAAAQAzAAEANQABADgAAQA9AAEAQAABAEQAAQBIAAEATAABAFQAAQBYAAEAWwABAF8AAQBoAAEAcQABAHQAAQB4AAEAfAABAIEAAQCEAAEAhwABAIoAAQCNAAEAlQAAAAAAAAA6AAIAAwAqBHoNgRk8AAAAawACAAgA3wHrBQcLphBqFgkcJSExJXIAAAAAAAIAFQDCAYUDSAUNB9MImgpgDCcO7w+4EYATShUSF9oYoxprHDMe+h/BIYYjTCUUAAIADgCjAkUF5AeBCh4NuQ9SEusUgxcaGrIcSB/gIXgkIQACAA4AoQJCBeQHhgomDcYPZhIEFaAXORrRHGUf9yGGJC4AAgBAAKwAVgECAq0CVwMBBKoEVAX8BaUGTAfzB5oIQgnnCYwKMgvWC3sMHg3BDWQOBg+mD0cQ6BCIEScSxRJjEwAUnRQ4FdQVbxYIF6EXOhjSGGkZ/xmUGikbvRtQHOIcdB0FHpUeIx+yHz8gyyBWIeEhaiLyInojACSFJAoljSUPJpAmbQACAAUAmAYvDcATRBq3IHEAAgAGAMIFcwsTEaYWKhyiIXYAAgAgAAcCAwT0Bd0HuQmKC1INDQ+8EF8S9hN+FfsWahjJGR0bXxyTHbgezB/OIMEhoSJvIyok0iRmJeUlTiaiJt8mAyeVAAAAAAAAAAAAAQARAAAAFQABABkAAQAdAAEAIQABAC4AAAAwAAEAMwABADUAAQA4AAEAPQAAAEAAAQBEAAEASAABAEwAAQBUAAEAWAABAFsAAQBfAAEAaAABAHEAAQB0AAEAeAABAHwAAQCBAAAAhAABAIcAAQCKAAEAjQABAJUAAAAAAAIACQDfA8MHqwuVD4ATbRdZG0MfKyMIAAIABwDUBKoJgg5eE0EYKR0YIg4AAgAHANgEuAmcDoQTbRhUHTQiFAACAAcA1wS2CZkOgBNoGE8dMiIaAAIABwDUBLEJlg58E2UYTR0yIiAAAgAHANQEsQmWDnwTZRhNHTIiJgACAEgAcQKeBJYGYAgDCooL9QxKDocPshDPEdoS1xPIFK0VhxZVFxwY2RiOGToa3xp/GxYcpxwzHbgdOR60Hiofmx8HIG8g0yAzIY0h5SE6Iooi1yIhI2cjqiPqIyckYSSZJM0k/yQuJVslhSWtJdIl9SUWJjQmUSZrJoMmmSatJr8mzybdJuom9Cb9JgQnCScNJw8nbQACAAQA5ge7D4cXTR9wAAIABADmB7sPhxdNH3MAAgAEAO8H2A+yF3MfdgACAAQA7gfVD68Xbx95AAIABQC5BlkN4hNXGrogfQACAAYA7AXAC3oRFBePHOMhggACABQAXwOdBrcJrwyGDzYSwBQmF2UZfBtqHS4fyCA2IngjiyRvJSQmpib1JpUAAAAAAAEAEQABABUAAQAZAAEAHQABACEAAQAuAAEAMAABADMAAQA1AAEAOAABAD0AAQBAAAEARAABAEgAAQBMAAEAVAABAFgAAQBbAAEAXwABAGgAAQBxAAEAdAABAHgAAQB8AAEAgQABAIQAAQCHAAEAigABAI0AAQCVAAAAAAABAAUAAQAIAAEACgABAA4AAQAQAAEAFQABABgAAQAaAAEAHgABACAAAQAlAAEAKAABACoAAQAuAAEAMAABADIAAQA1AAEANwABADkAAQA8AAEAQQABAEQAAQBGAAEASgABAE0AAQBPAAEAUQABAFQAAQBZAAEAXAABAF4AAQBiAAEAaQABAG4AAQBxAAEAcwABAHcAAQB5AAEAfgABAIEAAQCDAAEAhwABAIkAAQCLAAEAjgABAJAAAQCSAAEAlQAAAAAAAgAJAIMA+gFMBGYHNAuqD7oUVxp2IAgAAgAHAG4E/AiqDXoSahd/HLYhDgACAAcAigQsCeYNuhKnF68c0iEUAAIABwCoBF4JJA75EuEX3BzsIRoAAgAHAKkEZgk3DhcTBxgBHQQiIAACAAcAwgSMCVwONRMZGAkdBSImAAIASABxAp4ElgZgCAMKigv1DEoOhw+yEM8R2hLXE8gUrRWHFlUXHBjZGI4ZOhrfGn8bFhynHDMduB05HrQeKh+bHwcgbyDTIDMhjSHlIToiiiLXIiEjZyOqI+ojJyRhJJkkzST/JC4lWyWFJa0l0iX1JRYmNCZRJmsmgyaZJq0mvybPJt0m6ib0Jv0mBCcJJw0nDydtAAIABADmB7sPhxdNH3AAAgAEAOQHuQ+DF0gfcwACAAQA4Qe0D4AXSB92AAIABADhB7QPgBdIH3kAAgAFALYGUw3bE1AatiB9AAIABgDfBaILTBHcFlccvSGCAAIAFAAjAy4GIgn6C7YOWBHaEz4WgBihGp0cdR4mIK4hCSM3JDQlACaVJvEmlQAAAAAAAgAKAEICtwWECXgNgBGQFZgZjB1ZIc4kCQABAAsAAQCTAAEAlQAAAAAAAgAEAHQGFA/8F5wgAwABAAUAAQAHAAEACQABAAsAAQANAAEADwABABEAAQATAAEAFQABABcAAQAZAAEAGwABAB0AAQAfAAEAIQABACMAAQAlAAEAJwABACkAAQArAAEALQABAC8AAQAxAAEAMwABADUAAQA3AAEAOQABADsAAQA9AAIAAgCxBAYSPgABAEAAAQBCAAEARAABAEYAAQBIAAEASgABAEsAAQBNAAEATwABAFEAAQBTAAEAVQACAAIAsQQGElYAAQBYAAEAWgABAFwAAQBeAAEAYAABAGIAAQBpAAEAawABAG0AAQBvAAEAcQABAHMAAQB1AAEAdwABAHkAAQB7AAEAfQABAH8AAQCBAAEAgwACAAMA3w/FGbQhhQABAIcAAQCJAAEAiwABAI0AAQCPAAEAkQABAJMAAQCVAAAAAAAAAAAAAgARACYCTQR2BqAIzAr4DCUPUxGAE64V3BcLGjgcZR6SIL0i5yQQAAIAFQDLAZYDYQUsB/gIwwqNDFgOIhDsEbUTfRVEFwsZ0RqVHFgeGiDZIZgjVCUkAAIAFwC2AWsDHgXNBnsIJwrRC3kNHg/CEGQSBBSjFT8X2hh1Gg0cox05H80gXiLwI4ElOgAAAFIAAgAeAHAB3wJKBLIFGQd8CNwJOguVDO0NQQ+TEOIRLRN2FLoV/RY7GHUZrRrgGxEdPR5mH4sgqyHHIuAj9CQEJm8AAgAEAMMHlQ9tF0MfcgACAA0AJQM8BkUJQQwuDwwS3RSgF1Ya/RyXHyIioCR+AAIAGADDAnEFCwiOCvwMUg+REbcTxRW5F5QZVBv5HIAe6x85IWcidiNjJDAl2iVfJsEm/CaVAAAAAAABAAMAAQAFAAEACAABAAsAAQAOAAEAEAABABMAAQAWAAEAGQABABsAAQAeAAEAIQABACQAAQAmAAEAKQABACwAAQAvAAEAMQABADQAAQA3AAEAOQABADwAAQA/AAEAQQABAEQAAQBHAAEASgABAEwAAQBPAAEAUQABAFQAAQBXAAEAWQABAFwAAQBfAAEAYgABAGkAAQBsAAEAbwABAHIAAQB0AAEAdwABAHoAAQB9AAEAfwABAIIAAQCFAAEAiAABAIoAAQCNAAEAkAABAJIAAQCVAAAAAAABABEAAQAVAAEAGQABAB0AAQAhAAEALgABADAAAQAzAAEANQABADgAAQA9AAEAQAABAEQAAQBIAAEATAABAFQAAQBYAAEAWwABAF8AAQBoAAEAcQABAHQAAQB4AAEAfAABAIEAAQCEAAEAhwABAIoAAQCNAAEAlQAAAAAAAgAJAN8DwwerC5UPgBNtF1kbQx8rIwgAAgAHANQEqgmCDl4TQRgpHRgiDgACAAcA2AS4CZwOhBNtGFQdNCIUAAIABwDXBLYJmQ6AE2gYTx0yIhoAAgAHANQEsQmWDnwTZRhNHTIiIAACAAcA1ASxCZYOfBNlGE0dMiImAAIASABxAp4ElgZgCAMKigv1DEoOhw+yEM8R2hLXE8gUrRWHFlUXHBjZGI4ZOhrfGn8bFhynHDMduB05HrQeKh+bHwcgbyDTIDMhjSHlIToiiiLXIiEjZyOqI+ojJyRhJJkkzST/JC4lWyWFJa0l0iX1JRYmNCZRJmsmgyaZJq0mvybPJt0m6ib0Jv0mBCcJJw0nDydtAAIABADmB7sPhxdNH3AAAgAEAOYHuw+HF00fcwACAAQA7wfYD7IXcx92AAIABADuB9UPrxdvH3kAAgAFALkGWQ3iE1cauiB9AAIABgDsBcALehEUF48c4yGCAAIAFABfA50GtwmvDIYPNhLAFCYXZRl8G2odLh/IIDYieCOLJG8lJCamJvUmlQAAAAAAAQARAAEAFQABABkAAQAdAAEAIQABAC4AAQAwAAEAMwABADUAAQA4AAEAPQABAEAAAQBEAAEASAABAEwAAQBUAAEAWAABAFsAAQBfAAEAaAABAHEAAQB0AAEAeAABAHwAAQCBAAEAhAABAIcAAQCKAAEAjQABAJUAAAAAAAEAAwABAAUAAQAIAAEACwABAA4AAQAQAAEAEwABABYAAQAZAAEAGwABAB4AAQAhAAEAJAABACYAAQApAAEALAABAC8AAQAxAAEANAABADcAAQA5AAEAPAABAD8AAQBBAAEARAABAEcAAQBKAAEATAABAE8AAQBRAAEAVAABAFcAAQBZAAEAXAABAF8AAQBiAAEAaQABAGwAAQBvAAEAcgABAHQAAQB3AAEAegABAH0AAQB/AAEAggABAIUAAQCIAAEAigABAI0AAQCQAAEAkgABAJUAAAAAAAIADAD6AEEDSQbJCZQNhxGJFXwZRx3HIM8jFiYLAAEAFQACAAgABweBDGYR6xUlGhoewCH7JBwAAQAkAAIADwDWBu0KQg4uEdITQxaKGK0ashyaHmggGiKtIxwlViYyAAIAAwA/A+8KZRY0AAIAAwC2B+oQahs2AAIAAwCkCAkSLRw4AAIAAwD7CHYSehw6AAIAAwAeCaMSmhw8AAIAAwBBCdESuxw+AAIAAwA5CdgSzhxAAAIAAwBJCdgSvxxCAAIAAwAtCbMSoRxEAAIABAD+BlEOCRY/HkcAAgAcAEkBkwLeAyoFdgbEBxIJYgqyCwUNVw6rD/8QVhKtEwYVYBa8FxgZdhrWGzgdmh4AIGYhzSI3JKMlYgACAAkAuAN4B0ILFA/yEtwW0hrYHusiagACAAcAdgQECawNcxJeF2wcpiFwAAIABACzEdQbHCLAJXMAAQB6AAEAgwACABMA2QW0CtAOWxJwFSEYgBqVHGoeByBvIakiuCOeJF0l+SVyJskm/iaVAAAAAAACAAwA+gBBA0kGyQmUDYcRiRV8GUcdxyDPIxYmCwABABUAAgAIAAcHgQxmEesVJRoaHsAh+yQcAAEAJAACAA8A1gbtCkIOLhHSE0MWihitGrIcmh5oIBoirSMcJVYmMgACADkABQAUAC0ATQB2AKYA3QAbAWABqgH6AVACrAIMA3ID3QNMBMEEOgW5BTsGwgZNB90HcQgLCagJSQrvCpoLSAz7DLMNcA4xD/YPwRCSEWYSPxMfFAMV7RXeFtMXzxjSGdwa7BsDHSMeTB9+ILgh/CJMJKclagACAAcAdgQECawNcxJeF2wcpiFwAAIABACzEdQbHCLAJXMAAQB6AAEAgwACABMA2QW0CtAOWxJwFSEYgBqVHGoeByBvIakiuCOeJF0l+SVyJskm/iaVAAAAAAACAAwA+gBBA0kGyQmUDYcRiRV8GUcdxyDPIxYmCwABABUAAgAIAAcHgQxmEesVJRoaHsAh+yQcAAEAJAACAA8A1gbtCkIOLhHSE0MWihitGrIcmh5oIBoirSMcJVYmMgACAAMAPwPvCmUWNAACAAMAtgfqEGobNgACAAMApAgJEi0cOAACAAMA+wh2EnocOgACAAMAHgmjEpocPAACAAMAQQnRErscPgACAAMAOQnYEs4cQAACAAMASQnYEr8cQgACAAMALQmzEqEcRAACAAQA/gZRDgkWPx5HAAIAHABJAZMC3gMqBXYGxAcSCWIKsgsFDVcOqw//EFYSrRMGFWAWvBcYGXYa1hs4HZoeACBmIc0iNySjJWIAAgAJALgDeAdCCxQP8hLcFtIa2B7rImoAAgAHAHYEBAmsDXMSXhdsHKYhcAACAAQAsxHUGxwiwCVzAAEAegABAIMAAgATANkFtArQDlsScBUhGIAalRxqHgcgbyGpIrgjniRdJfklcibJJv4mlQAAAAAAAgAMAPoAQQNJBskJlA2HEYkVfBlHHccgzyMWJgsAAQAVAAIACAAHB4EMZhHrFSUaGh7AIfskHAABACQAAgAPANYG7QpCDi4R0hNDFooYrRqyHJoeaCAaIq0jHCVWJjIAAgA5AAUAFAAtAE0AdgCmAN0AGwFgAaoB+gFQAqwCDANyA90DTATBBDoFuQU7BsIGTQfdB3EICwmoCUkK7wqaC0gM+wyzDXAOMQ/2D8EQkhFmEj8THxQDFe0V3hbTF88Y0hncGuwbAx0jHkwffiC4IfwiTCSnJWoAAgAHAHYEBAmsDXMSXhdsHKYhcAACAAQAsxHUGxwiwCVzAAEAegABAIMAAgATANkFtArQDlsScBUhGIAalRxqHgcgbyGpIrgjniRdJfklcibJJv4mlQAAAAAAAgAKAIcDDQeUCh0OpREwFbwYSxzeH3UjCQACAAUAdAbrDGcT6hl2IA0AAgAIAEwEmgjpDDoRjBXlGUIepiIUAAIAGwBnAc8CNwSeBQcHbgjWCT0LpgwODnUP3BBDEqoTEBV2FtwXQBmlGgkcbR3PHjIgkyHzIlMksyUuAAIAQACsAFYBAQKsAlYD/wOnBFEF+AWfBkUH7AeRCDgJ3Al/CiMLxwtpDAsNrA1ODu8Ojg8tEM0QaxEJEqUSQRPdE3kUExWuFUcW4BZ4FxAYqBg+GdMZaBr9GpEbJBy2HEgd2h1qHvoeiR8YIKUgMiG+IUoi1SJfI+gjcCT5JIAlBiaLJm0AAgAFAJgGLw3AE0QatyBxAAIABADkB7kPgxdIH3QAAgAEAO4H1Q+vF28fdwACAAYAyAWDCzARyxZRHL4hfAACAAoAAwTxB8sLjg86E80WRhqkHeYgCySFAAIAEQDoA6UHMwuSDr8RuxSEFxYadByYHoQgNSKoI9wkzyWAJuwmlQAAAAAAAgAMAPoAQQNJBskJlA2HEYkVfBlHHccgzyMWJgsAAQAVAAIACAAHB4EMZhHrFSUaGh7AIfskHAABACQAAgAPANYG7QpCDi4R0hNDFooYrRqyHJoeaCAaIq0jHCVWJjIAAgADAD8D7wplFjQAAgADALYH6hBqGzYAAgADAKQICRItHDgAAgADAPsIdhJ6HDoAAgADAB4JoxKaHDwAAgADAEEJ0RK7HD4AAgADADkJ2BLOHEAAAgADAEkJ2BK/HEIAAgADAC0JsxKhHEQAAgAEAP4GUQ4JFj8eRwACABwASQGTAt4DKgV2BsQHEgliCrILBQ1XDqsP/xBWEq0TBhVgFrwXGBl2GtYbOB2aHgAgZiHNIjckoyViAAIACQC4A3gHQgsUD/IS3BbSGtge6yJqAAIABwB2BAQJrA1zEl4XbBymIXAAAgAEALMR1BscIsAlcwABAHoAAQCDAAIAEwDZBbQK0A5bEnAVIRiAGpUcah4HIG8hqSK4I54kXSX5JXImySb+JpUAAAAAAAIADAD6AEEDSQbJCZQNhxGJFXwZRx3HIM8jFiYLAAEAFQACAAgABweBDGYR6xUlGhoewCH7JBwAAQAkAAIADwDWBu0KQg4uEdITQxaKGK0ashyaHmggGiKtIxwlViYyAAIAOQAFABQALQBNAHYApgDdABsBYAGqAfoBUAKsAgwDcgPdA0wEwQQ6BbkFOwbCBk0H3QdxCAsJqAlJCu8KmgtIDPsMsw1wDjEP9g/BEJIRZhI/Ex8UAxXtFd4W0xfPGNIZ3BrsGwMdIx5MH34guCH8IkwkpyVqAAIABwB2BAQJrA1zEl4XbBymIXAAAgAEALMR1BscIsAlcwABAHoAAQCDAAIAEwDZBbQK0A5bEnAVIRiAGpUcah4HIG8hqSK4I54kXSX5JXImySb+JpUAAAAAAAIACQByAMAB4QPLBnUK2Q7uE6wZDyAIAAAAHwAAAAAAAAAAAAIADADHAKgCPgVLCKkLOg/qEqQWVhrtHVIhaiQLAAIACwAhBP8HuQtYD+ASURaqGeYcACDoInklFQACAAgABweBDGYR6xUlGhoewCH7JBwAAQAkAAIADwDWBu0KQg4uEdITQxaKGK0ashyaHmggGiKtIxwlViYyAAIAAwA/A+8KZRY0AAIAAwC2B+oQahs2AAIAAwCkCAkSLRw4AAIAAwD7CHYSehw6AAIAAwAeCaMSmhw8AAIAAwBBCdESuxw+AAIAAwA5CdgSzhxAAAIAAwBJCdgSvxxCAAIAAwAtCbMSoRxEAAIABAD+BlEOCRY/HkcAAgAcAEkBkwLeAyoFdgbEBxIJYgqyCwUNVw6rD/8QVhKtEwYVYBa8FxgZdhrWGzgdmh4AIGYhzSI3JKMlYgACAAkAuAN4B0ILFA/yEtwW0hrYHusiagACAAcAdgQECawNcxJeF2wcpiFwAAIABACzEdQbHCLAJXMAAQB6AAEAgwACABMA2QW0CtAOWxJwFSEYgBqVHGoeByBvIakiuCOeJF0l+SVyJskm/iaVAAAAAAACAAwAxwCoAj4FSwipCzoP6hKkFlYa7R1SIWokCwACAAsAIQT/B7kLWA/gElEWqhnmHAAg6CJ5JRUAAgAIAAcHgQxmEesVJRoaHsAh+yQcAAEAJAACAA8A1gbtCkIOLhHSE0MWihitGrIcmh5oIBoirSMcJVYmMgACADkABQAUAC0ATQB2AKYA3QAbAWABqgH6AVACrAIMA3ID3QNMBMEEOgW5BTsGwgZNB90HcQgLCagJSQrvCpoLSAz7DLMNcA4xD/YPwRCSEWYSPxMfFAMV7RXeFtMXzxjSGdwa7BsDHSMeTB9+ILgh/CJMJKclagACAAcAdgQECawNcxJeF2wcpiFwAAIABACzEdQbHCLAJXMAAQB6AAEAgwACABMA2QW0CtAOWxJwFSEYgBqVHGoeByBvIakiuCOeJF0l+SVyJskm/iaVAAAAAAAAAAAAAgAJAN8DwwerC5UPgBNtF1kbQx8rIwgAAgAHANQEqgmCDl4TQRgpHRgiDgACAAcA2AS4CZwOhBNtGFQdNCIUAAIABwDXBLYJmQ6AE2gYTx0yIhoAAgAHANQEsQmWDnwTZRhNHTIiIAACAAcA1ASxCZYOfBNlGE0dMiImAAIASABxAp4ElgZgCAMKigv1DEoOhw+yEM8R2hLXE8gUrRWHFlUXHBjZGI4ZOhrfGn8bFhynHDMduB05HrQeKh+bHwcgbyDTIDMhjSHlIToiiiLXIiEjZyOqI+ojJyRhJJkkzST/JC4lWyWFJa0l0iX1JRYmNCZRJmsmgyaZJq0mvybPJt0m6ib0Jv0mBCcJJw0nDydtAAIABADmB7sPhxdNH3AAAgAEAOYHuw+HF00fcwACAAQA7wfYD7IXcx92AAIABADuB9UPrxdvH3kAAgAFALkGWQ3iE1cauiB9AAIABgDsBcALehEUF48c4yGCAAIAFABfA50GtwmvDIYPNhLAFCYXZRl8G2odLh/IIDYieCOLJG8lJCamJvUmlQAAAAAAAQARAAEAFQABABkAAQAdAAEAIQABAC4AAQAwAAEAMwABADUAAQA4AAEAPQABAEAAAQBEAAEASAABAEwAAQBUAAEAWAABAFsAAQBfAAEAaAABAHEAAQB0AAEAeAABAHwAAQCBAAEAhAABAIcAAQCKAAEAjQABAJUAAAAAAAAAAAAAAAAAAgAVAMIBhQNIBQ0H0wiaCmAMJw7vD7gRgBNKFRIX2hijGmscMx76H8EhhiNMJRQAAgAOAKMCRQXkB4EKHg25D1IS6xSDFxoashxIH+AheCQhAAIADgChAkIF5AeGCiYNxg9mEgQVoBc5GtEcZR/3IYYkLgACAEAArABWAQICrQJXAwEEqgRUBfwFpQZMB/MHmghCCecJjAoyC9YLewweDcENZA4GD6YPRxDoEIgRJxLFEmMTABSdFDgV1BVvFggXoRc6GNIYaRn/GZQaKRu9G1Ac4hx0HQUelR4jH7IfPyDLIFYh4SFqIvIieiMAJIUkCiWNJQ8mkCZtAAIABQCYBi8NwBNEGrcgcQACAAYAwgVzCxMRphYqHKIhdgACACAABwIDBPQF3Qe5CYoLUg0ND7wQXxL2E34V+xZqGMkZHRtfHJMduB7MH84gwSGhIm8jKiTSJGYl5SVOJqIm3yYDJ5UAAAAAAAEAEQABABUAAQAZAAEAHQABACEAAQAuAAEAMAABADMAAQA1AAEAOAABAD0AAQBAAAEARAABAEgAAQBMAAEAVAABAFgAAQBbAAEAXwABAGgAAQBxAAEAdAABAHgAAQB8AAEAgQABAIQAAQCHAAEAigABAI0AAQCVAAAAAAACAD0ABgAXADIAVwCFALwA+wBCAZEB5gFCAqQCDQN6A+4DZwTmBGkF8AV8BgwHogc6CNYIdQkZCr8KaQsXDMcMeg0wDugOow9hECER5BGoEm8TOBQDFc8VnhZvF0EYFhnsGcMamxt2HFIdLx4MH+wfzCCvIZMidyNcJEIlKCY8AAIAWgCFAAwBkgEYAp8CJwOvAzcEwARJBdMFXAbkBm8H+QeCCAwJlwkfCqoKNAu9C0cM0AxaDeMNbA71Dn0PBhCNEBURmxEiEqgSLhO0EzgUvRQ/FcIVRRbGFkcXxxdGGMMYQRm9GTgasxosG6MbGxyQHAQddx3oHVkexx4zH54fCCBwINYgOiGbIfshWCKzIgwjYiO1IwYkUySeJOYkKiVrJagl4SUWJkcmcyaaJr0m2SbxJgInDCeVAAAAAAABABEAAQAVAAEAGQABAB0AAQAhAAEALgABADAAAQAzAAEANQABADgAAQA9AAEAQAABAEQAAQBIAAEATAABAFQAAQBYAAEAWwABAF8AAQBoAAEAcQABAHQAAQB4AAEAfAABAIEAAQCEAAEAhwABAIoAAQCNAAEAlQAAAAAAAQARAAEAFQABABkAAQAdAAEAIQABAC4AAQAwAAEAMwABADUAAQA4AAEAPQABAEAAAQBEAAEASAABAEwAAQBUAAEAWAABAFsAAQBfAAEAaAABAHEAAQB0AAEAeAABAHwAAQCBAAEAhAABAIcAAQCKAAEAjQABAJUAAAAAAAIACQDfA8MHqwuVD4ATbRdZG0MfKyMIAAIABwDUBKoJgg5eE0EYKR0YIg4AAgAHANgEuAmcDoQTbRhUHTQiFAACAAcA1wS2CZkOgBNoGE8dMiIaAAIABwDUBLEJlg58E2UYTR0yIiAAAgAHANQEsQmWDnwTZRhNHTIiJgACAEgAcQKeBJYGYAgDCooL9QxKDocPshDPEdoS1xPIFK0VhxZVFxwY2RiOGToa3xp/GxYcpxwzHbgdOR60Hiofmx8HIG8g0yAzIY0h5SE6Iooi1yIhI2cjqiPqIyckYSSZJM0k/yQuJVslhSWtJdIl9SUWJjQmUSZrJoMmmSatJr8mzybdJuom9Cb9JgQnCScNJw8nbQACAAQA5ge7D4cXTR9wAAIABADmB7sPhxdNH3MAAgAEAO8H2A+yF3MfdgACAAQA7gfVD68Xbx95AAIABQC5BlkN4hNXGrogfQACAAYA7AXAC3oRFBePHOMhggACABQAXwOdBrcJrwyGDzYSwBQmF2UZfBtqHS4fyCA2IngjiyRvJSQmpib1JpUAAAAAAAEAEQABABUAAQAZAAEAHQABACEAAQAuAAEAMAABADMAAQA1AAEAOAABAD0AAQBAAAEARAABAEgAAQBMAAEAVAABAFgAAQBbAAEAXwABAGgAAQBxAAEAdAABAHgAAQB8AAEAgQABAIQAAQCHAAEAigABAI0AAQCVAAAAAAACAAkAgwD6AUwEZgc0C6oPuhRXGnYgCAACAAcAbgT8CKoNehJqF38ctiEOAAIABwCKBCwJ5g26EqcXrxzSIRQAAgAHAKgEXgkkDvkS4RfcHOwhGgACAAcAqQRmCTcOFxMHGAEdBCIgAAIABwDCBIwJXA41ExkYCR0FIiYAAgBIAHECngSWBmAIAwqKC/UMSg6HD7IQzxHaEtcTyBStFYcWVRccGNkYjhk6Gt8afxsWHKccMx24HTketB4qH5sfByBvINMgMyGNIeUhOiKKItciISNnI6oj6iMnJGEkmSTNJP8kLiVbJYUlrSXSJfUlFiY0JlEmayaDJpkmrSa/Js8m3SbqJvQm/SYEJwknDScPJ20AAgAEAOYHuw+HF00fcAACAAQA5Ae5D4MXSB9zAAIABADhB7QPgBdIH3YAAgAEAOEHtA+AF0gfeQACAAUAtgZTDdsTUBq2IH0AAgAGAN8FogtMEdwWVxy9IYIAAgAUACMDLgYiCfoLtg5YEdoTPhaAGKEanRx1HiYgriEJIzckNCUAJpUm8SaVAAAAAAABAAkAAQALAAEAkwABAJUAAAAAAAEAAwABAAUAAQAHAAEACQABAAsAAQANAAEADwABABEAAQATAAEAFQABABcAAQAZAAEAGwABAB0AAQAfAAEAIQABACMAAQAlAAEAJwABACkAAQArAAEALQABAC8AAQAxAAEAMwABADUAAQA3AAEAOQABADsAAQA9AAEAPgABAEAAAQBCAAEARAABAEYAAQBIAAEASgABAEsAAQBNAAEATwABAFEAAQBTAAEAVQABAFYAAQBYAAEAWgABAFwAAQBeAAEAYAABAGIAAQBpAAEAawABAG0AAQBvAAEAcQABAHMAAQB1AAEAdwABAHkAAQB7AAEAfQABAH8AAQCBAAEAgwACAAMA3w/FGbQhhQABAIcAAQCJAAEAiwABAI0AAQCPAAEAkQABAJMAAQCVAAAAAAAAABAAAgAqAJ8BLwO0BC0GnQcDCV8KsQv8DD8OeQ+tENoR/hIcFDIVQxZMF08YTBlCGjEbGRz6HNUdqR52Hzsg+CCtIVoiACObIy4ktiQ0JaUlCiZiJqom4CYDJzkAAAA8AAEAUQAAAFQAAABpAAIAKgCfAS8DtAQtBp0HAwlfCrEL/Aw/DnkPrRDaEf4SHBQyFUMWTBdPGEwZQhoxGxkc+hzVHakedh87IPggrSFaIgAjmyMuJLYkNCWlJQomYiaqJuAmAyeSAAAAlQAAAAAAAAAQAAIAKgCfAS8DtAQtBp0HAwlfCrEL/Aw/DnkPrRDaEf4SHBQyFUMWTBdPGEwZQhoxGxkc+hzVHakedh87IPggrSFaIgAjmyMuJLYkNCWlJQomYiaqJuAmAyc5AAAAPAABAFEAAABUAAAAaQACACoAnwEvA7QELQadBwMJXwqxC/wMPw55D60Q2hH+EhwUMhVDFkwXTxhMGUIaMRsZHPoc1R2pHnYfOyD4IK0hWiIAI5sjLiS2JDQlpSUKJmImqibgJgMnkgAAAJUAAAAAAAAAAwACABoAUwKVBMQG4gjxCvEM4Q7EEJgSXRQTFrsXVBndGlccwR0YH10gjiGqIq4jmCRmJRImlybwJhwAAAAeAAIAHAArAkYEUQZOCD0KHwzzDbsPdhEmE8cUXRbmF2IZ0RoxHIMdxh76Hx0hLSIrIxIk4iSZJTEmpyb0JjkAAAA8AAAAPwACABMAHwMeBv0IvwtmDvMQZRO8FfoXGhogHAYezh9wIe0iPiRcJT4m1yZRAAAAVAAAAFcAAgAfAPgB4wPABZAHVwkRC8IMZg4BEJIRFxOVFAUWbBfIGBoaYRudHMwd7h4EIAshBCLtIsUjiyQ7JdYlVia4JvkmdQAAAHcAAgAcACsCRgRRBk4IPQofDPMNuw92ESYTxxRdFuYXYhnRGjEcgx3GHvofHSEtIisjEiTiJJklMSanJvQmkgABAJUAAAAAAAAAAwACABoAUwKVBMQG4gjxCvEM4Q7EEJgSXRQTFrsXVBndGlccwR0YH10gjiGqIq4jmCRmJRImlybwJhwAAAAeAAIAHAArAkYEUQZOCD0KHwzzDbsPdhEmE8cUXRbmF2IZ0RoxHIMdxh76Hx0hLSIrIxIk4iSZJTEmpyb0JjkAAAA8AAAAPwACABMAHwMeBv0IvwtmDvMQZRO8FfoXGhogHAYezh9wIe0iPiRcJT4m1yZRAAAAVAAAAFcAAgAfAPgB4wPABZAHVwkRC8IMZg4BEJIRFxOVFAUWbBfIGBoaYRudHMwd7h4EIAshBCLtIsUjiyQ7JdYlVia4JvkmdQAAAHcAAgAcACsCRgRRBk4IPQofDPMNuw92ESYTxxRdFuYXYhnRGjEcgx3GHvofHSEtIisjEiTiJJklMSanJvQmkgABAJUAAAAAAAAABQACABkAAQSDB6AKbQ32D0cSaBRfFi0Y2hloG9kcLR5oH4oglSGKImgjMSTkJIAlBiZzJsYm/CYdAAAAHgAAAFkAAgAeAGcDbgYoCaYL7g0KEP4R0BOAFRYXkRj2GUQbfByhHbMetR+lIIUhVSIUI8YjZyT5JHsl7iVPJp8m2yYCJ3YAAAB3AAIAAwDXDkEZFCF5AAIABwAJBqYL5hDVFX0a5R4UI38AAgALAHoErAiaDEoQwxMGFxoaAR2+H1MiwySJAAIADQDlBH0Jxg3AEW0VyxjaG5Ye/CAHI7Mk9yXGJpUAAAAAAAAABQACABkAAQSDB6AKbQ32D0cSaBRfFi0Y2hloG9kcLR5oH4oglSGKImgjMSTkJIAlBiZzJsYm/CYdAAAAHgAAAFkAAgAeAGcDbgYoCaYL7g0KEP4R0BOAFRYXkRj2GUQbfByhHbMetR+lIIUhVSIUI8YjZyT5JHsl7iVPJp8m2yYCJ3YAAAB3AAIAEwB/A7AGnglTDNcOMRFkE3cVaRdBGf4apBwyHq0fFCFpIqsj3ST/JYkAAgANAOUEfQnGDcARbRXLGNoblh78IAcjsyT3JcYmlQAAAAAAAgAMAKEFrwo7D1kTEBdnGmQdByBOIjQksCWvJgsAAAAOAAIAEQAgBPAHeAvADswRoRRCF7IZ8RsCHuQfliEWI2QkeCVOJtwmHgAAACAAAgARACAE8Ad4C8AOzBGhFEIXshnxGwIe5B+WIRYjZCR4JU4m3CYwAAAAPAACAAwAoQWvCjsPWRMQF2caZB0HIE4iNCSwJa8mRwAAAEoAAABUAAIADAChBa8KOw9ZExAXZxpkHQcgTiI0JLAlryZfAAAAYgACABYAQgNRBjIJ6gt5DuQQLhNWFV0XSBkWG8YcWR7QHykhZSKCI34kVyULJpUm7yZ3AAAAeQACAAcAgAcTDuIT/xh5HVMhiyR/AAIACwCTBb8Khw/rE+0Xhxu3HnchviN+JaQmiQAAAJUAAAAAAAIADAChBa8KOw9ZExAXZxpkHQcgTiI0JLAlryYLAAAADgACABEAIATwB3gLwA7MEaEUQheyGfEbAh7kH5YhFiNkJHglTibcJh4AAAAgAAIAEQAgBPAHeAvADswRoRRCF7IZ8RsCHuQfliEWI2QkeCVOJtwmMAAAADwAAgAMAKEFrwo7D1kTEBdnGmQdByBOIjQksCWvJkcAAABKAAAAVAACAAwAoQWvCjsPWRMQF2caZB0HIE4iNCSwJa8mXwAAAGIAAgAWAEIDUQYyCeoLeQ7kEC4TVhVdF0gZFhvGHFke0B8pIWUigiN+JFclCyaVJu8mdwAAAHkAAgAHAIAHEw7iE/8YeR1TIYskfwACAAsAkwW/CocP6xPtF4cbtx53Ib4jfiWkJokAAACVAAAAAAAAAG4AAQBwAAIADQAkBdYJIQ4QEqgV7RjiG4ge3yDlIpIk4CW9JnwAAAAAAAAAbgAAAAAAAABuAAEAcAACAA0AJAXWCSEOEBKoFe0Y4huIHt8g5SKSJOAlvSZ8AAAAAAAAADwAAQA+AAIAAwBVFWogqSVAAAAAAAAAADwAAAAAAAAAPAABAD4AAgADAFUVaiCpJUAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAQAD//wAAAQA8AAAAPgACAAMAVRVqIKklQAAAAAAAAAAdAP//HgAAADwA//9BAAAAVAD//1kAAAB2AP//dwAAAJUA//8AAAEABQACAAUAGwUjDIcT7Rr1IQkAAAAWAAIACADfAesFBwumEGoWCRwlITElHQABAB4AAgAIAPoCYAcjDA0RAxbtGrAfFiQlAAAAMgACAAsAIAG2Ax8HBws2D4cT2hcJHPEfWiPwJTwAAQBBAAIABQAbBSMMhxPtGvUhRQABAFQAAQBZAAIABQAbBSMMhxPtGvUhXQAAAG8AAgAIAN8B6wUHC6YQahYJHCUhMSV2AAEAdwACAAgA+gJgByMMDREDFu0asB8WJH4AAACLAAIACwAgAbYDHwcHCzYPhxPaFwkc8R9aI/AllQAAAAAAAAALAP//DgAAAB4A//8gAAAAMAD//zwAAABHAP//SgAAAF8A//9iAAAAdwD//3kAAACJAP//AAACAAQAdAYUD/wXnCADAAAACAACAAQAAAVdDrMYECILAAEADgACAAQAdAYUD/wXnCARAAAAFwACAAgA3wHrBQcLphBqFgkcJSExJR4AAQAgAAIABAB0BhQP/BecICMAAAApAAIACADfAesFBwumEGoWCRwlITElMAABADwAAgAEAHQGFA/8F5wgPwAAAEQAAgAEAAAFXQ6zGBAiRwABAFQAAgAEAHQGFA/8F5wgVwAAAFwAAgAEAAAFXQ6zGBAiXwABAGIAAgAJAJQCdAaxChQPhxP8F18cnCB8JGoAAABwAAIACADfAesFBwumEGoWCRwlITEldwABAHkAAgAEAHQGFA/8F5wgfAAAAIIAAgAIAN8B6wUHC6YQahYJHCUhMSWJAAAAAAAAADkA//88AAAAUQD//1QAAACSAP//AAABAAkAAgAIAN8B6wUHC6YQahYJHCUhMSUQAAEAJwACABMAcgCOAR4DAAUfB2wJ2AtdDu4QhxMiFrMYOBukHfEfECLyI4IlniY5AAEAXQACAA0A2gDfApcFwAg0DNIPhxM+F9waUB55ITEkNiZpAAAAgAACABMAcgCOAR4DAAUfB2wJ2AtdDu4QhxMiFrMYOBukHfEfECLyI4IlniaSAAAAAAAAABwA//8eAAAAOQD//zwAAABRAP//VAAAAHUA//93AAAAkgD//wAAAQADAAIACwAgAbYDHwcHCzYPhxPaFwkc8R9aI/AlDQAAABIAAgALACABtgMfBwcLNg+HE9oXCRzxH1oj8CUcAAEAHgACAAoA9wRMCV0NQhECFaAYHBxvH4siTyUnAAAALAACAA4AwQCOAgAF3wcHC10OzBFEFbMYCRwxHxAigiRPJjkAAQA/AAIACwAgAbYDHwcHCzYPhxPaFwkc8R9aI/AlSQABAFEAAQBXAAIACwAgAbYDHwcHCzYPhxPaFwkc8R9aI/AlYQAAAGsAAgALACABtgMfBwcLNg+HE9oXCRzxH1oj8CV1AAEAdwACAAoA9wRMCV0NQhECFaAYHBxvH4siTyWAAAAAhQACAA4AwQCOAgAF3wcHC10OzBFEFbMYCRwxHxAigiRPJpIAAAAAAAAAAAAAAEAA//9sAAAAAAABADwAAQBAAAEAbAACAAcAkAULC20QsxXOGqsfGCRyAAAAAAAAAAAAAAA9AP//AAABAD0AAQBrAAAAAAAAAAAAAAB8AP//AAABAG4AAAByAAIACwAgAbYDHwcHCzYPhxPaFwkc8R9aI/AlfAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAACQACAAsAAwAfAAIAIQAAAHAAAQB+AAMAiQACAIsAAAAAAAAAPQD//2sAAAAAAAEAPQABAGsAAQByAAAAAAAAAAAAAAA9AP//awAAAAAAAQA9AAEAawACAAgA8wTWCaYOYBP9F3YcsyCKJHIAAAAAAAAACQD//wsAAAARAP//EwAAABoA//8cAAAAJAD//yUAAAArAP//LQAAAD0A//9RAAAAWAD//1kAAABiAP//ZAAAAGoA//9sAAAAcwD//3UAAAB9AP//fgAAAIQA//+GAAAAjQD//44AAACUAP//lQAAAAAAAQAEAAIABgD+CTYSBBmQHuMi3CUJAAEACwABAA4AAgAEAHcNwheIH9kkEQABABMAAQAWAAIABQB4C6EU8RuWIXglGgABABwAAQAfAAIABgD+CTYSBBmQHuMi3CUkAAEAJQABACgAAgAEAHcNwheIH9kkKwABAC0AAQA6AAIAAwChCp0UEB48AAAAPQABAEsAAABRAAEAVQACAAQAdw3CF4gf2SRYAAEAWQABAF0AAgAGAP4JNhIEGZAe4yLcJWIAAQBkAAEAZwACAAQAdw3CF4gf2SRqAAEAbAABAG8AAgAFAHgLoRTxG5YheCVzAAEAdQABAHgAAgAGAP4JNhIEGZAe4yLcJX0AAQB+AAEAgQACAAQAdw3CF4gf2SSEAAEAhgABAIkAAgAFAHgLoRTxG5YheCWNAAEAjgABAJEAAgAEAHcNwheIH9kklAABAJUAAAAAAAAAPQD//2sAAAAAAAEAPQABAGsAAgAIAPME1gmmDmAT/Rd2HLMgiiRyAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAEABQABAAgAAQAKAAEADgABABAAAQAVAAEAGAABABoAAQAeAAEAIAABACUAAQAoAAEAKgABAC4AAQAwAAEAMgABADUAAQA3AAEAOQABADwAAAAAAAEAAwABAAcAAQAMAAEADwABABIAAQAXAAEAGgABAB0AAQAhAAEAJgABACkAAQAsAAEAMAABADMAAQA2AAEAOQABADwAAAAAAAIAHwAvAKsAZAFKAlYDggTGBR8HiggFCooLGA2uDkkQ6BGHEygVxxZiGPgZhhsLHYYe8R9KIY4iuiPGJKwlZSbhJh4AAgAfAC8AqwBkAUoCVgOCBMYFHweKCAUKigsYDa4OSRDoEYcTKBXHFmIY+BmGGwsdhh7xH0ohjiK6I8YkrCVlJuEmPAAAAAAAAQADAAEABQABAAgAAQALAAEADgABABAAAQATAAEAFgABABkAAQAbAAEAHgABACEAAQAkAAEAJgABACkAAQAsAAEALwABADEAAQA0AAEANwABADkAAQA8AAAAAAABAAsAAQAPAAEAEwABABsAAQAoAAAAAAACAB8ALwCrAGQBSgJWA4IExgUfB4oIBQqKCxgNrg5JEOgRhxMoFccWYhj4GYYbCx2GHvEfSiGOIrojxiSsJWUm4SYeAAIAHwAvAKsAZAFKAlYDggTGBR8HiggFCooLGA2uDkkQ6BGHEygVxxZiGPgZhhsLHYYe8R9KIY4iuiPGJKwlZSbhJjwAAAAAAAIAHwAvAKsAZAFKAlYDggTGBR8HiggFCooLGA2uDkkQ6BGHEygVxxZiGPgZhhsLHYYe8R9KIY4iuiPGJKwlZSbhJh4AAgAfAC8AqwBkAUoCVgOCBMYFHweKCAUKigsYDa4OSRDoEYcTKBXHFmIY+BmGGwsdhh7xH0ohjiK6I8YkrCVlJuEmPAAAAAAAAgAPAEwDkwbSCQMNJBAyEyYW/BitGzMehCCWIlwkxCW1Jg4AAQAsAAIAEQBNABsBTQLPA5EFiQeuCfgLYg7lEIATLhboGLEbgx5aITQkPAAAAAAAAgAPAEwDkwbSCQMNJBAyEyYW/BitGzMehCCWIlwkxCW1Jg4AAQAsAAIAEQBNABsBTQLPA5EFiQeuCfgLYg7lEIATLhboGLEbgx5aITQkPAAAAAAAAAAAAAEACwAAAA8AAQATAAEAFwABABsAAQAoAAAAAAACAA0A7QPKB5QLQg/REjoWdhl9HEMfvCHaI4YlpSYMAAIAHwAvAKsAZAFKAlYDggTGBR8HiggFCooLGA2uDkkQ6BGHEygVxxZiGPgZhhsLHYYe8R9KIY4iuiPGJKwlZSbhJioAAgATAEUA/AAMAmED7wSrBo8IkwqwDOUOLRGDE+UVUhjEGjwdtB8sIqEkPAAAAAAAAQALAAEADwABABMAAQAXAAEAGwABACgAAAAAAAIAEAAQAxwGJAkiDBUP+BHIFH8XGxqWHOceCCHxIpIk3SW8Jg8AAQAtAAIAEABUADMBfgIfBAgGKQh6CvUMkQ9IEhgV+xfuGuwd9CAAJDwAAAAAAAIAHwAvAKsAZAFKAlYDggTGBR8HiggFCooLGA2uDkkQ6BGHEygVxxZiGPgZhhsLHYYe8R9KIY4iuiPGJKwlZSbhJh4AAgAfAC8AqwBkAUoCVgOCBMYFHweKCAUKigsYDa4OSRDoEYcTKBXHFmIY+BmGGwsdhh7xH0ohjiK6I8YkrCVlJuEmPAAAAAAAAgASAL4CeQUwCOIKig0nELYSNxWjF/kZNBxPHkYgESKqIwUlFibMJhEAAgAfAC8AqwBkAUoCVgOCBMYFHweKCAUKigsYDa4OSRDoEYcTKBXHFmIY+BmGGwsdhh7xH0ohjiK6I8YkrCVlJuEmLwACAA4AagCCARwDHAVtBwAKygy+D9cSDRZZGbgcJCCYIzwAAAAAAAIABQBzAWwFdwtCE4ccBAACAAYA/gk2EgQZkB7jItwlCQAAAAsAAgAEAA8CnQf0D5EaDgACAAQAdw3CF4gf2SQRAAAAEwACAAQADwKdB/QPkRoWAAIABQB4C6EU8RuWIXglGgAAABwAAgAEAA8CnQf0D5EaHwACAAYA/gk2EgQZkB7jItwlJAAAACUAAgAEAA8CnQf0D5EaKAACAAQAdw3CF4gf2SQrAAAALQACAAQADwKdB/QPkRowAAIABQB4C6EU8RuWIXglNAAAADUAAgAEAA8CnQf0D5EaOAACAAQAdw3CF4gf2SQ7AAAAPAAAAAAAAgAFAHMBbAV3C0IThxwEAAIABgD+CTYSBBmQHuMi3CUJAAAACwACAAQADwKdB/QPkRoOAAIABAB3DcIXiB/ZJBEAAAATAAIABAAPAp0H9A+RGhYAAgAFAHgLoRTxG5YheCUaAAAAHAACAAQADwKdB/QPkRofAAIABgD+CTYSBBmQHuMi3CUkAAAAJQACAAQADwKdB/QPkRooAAIABAB3DcIXiB/ZJCsAAAAtAAIABAAPAp0H9A+RGjAAAgAFAHgLoRTxG5YheCU0AAAANQACAAQADwKdB/QPkRo4AAIABAB3DcIXiB/ZJDsAAAA8AAAAAAABAAsAAQAPAAEAEwABABcAAQAbAAEAKAAAAAAAAQACAAEABAABAAYAAQAIAAEACgABAAwAAQAOAAEAEAABABIAAQAUAAEAFgABABgAAQAaAAEAHAABAB4AAQAgAAEAIgABACQAAQAmAAEAKAABACoAAQAsAAEALgABADAAAQAyAAEANAABADYAAQA4AAEAOgABADwAAAAAAAIAHwAvAKsAZAFKAlYDggTGBR8HiggFCooLGA2uDkkQ6BGHEygVxxZiGPgZhhsLHYYe8R9KIY4iuiPGJKwlZSbhJh4AAgAfAC8AqwBkAUoCVgOCBMYFHweKCAUKigsYDa4OSRDoEYcTKBXHFmIY+BmGGwsdhh7xH0ohjiK6I8YkrCVlJuEmPAAAAAAAAQALAAEADwABABMAAQAXAAEAGwABACgAAAAAAAIAFAB6AvUEawfbCUYMqQ4DEVATkBXBF90Z4xvSHaMfUiHaIjUkWyVAJtgmEwACAB8ALwCrAGQBSgJWA4IExgUfB4oIBQqKCxgNrg5JEOgRhxMoFccWYhj4GYYbCx2GHvEfSiGOIrojxiSsJWUm4SYxAAIADACLAPQB/QOBBmMJkQz6D5MTUBcoGxYfDyM8AAAAAAACABEA0AKiBXIIPgsEDr8QbBMHFo4Y+xpKHXMfcCE2I7wk8SXCJhAAAQAuAAIADwBZAEgBqwJsBHkGxQhHC/QNxxC5E8gW7BkjHWYgtyM8AAAAAAABAAsAAAAPAAEAEwABABcAAQAbAAEAKAAAAAAAAgASAMcCiwVICAALrA1OEOESYRXOFyMaXBx0HmYgLCK/IxQlHibPJhEAAgAfAC8AqwBkAUoCVgOCBMYFHweKCAUKigsYDa4OSRDoEYcTKBXHFmIY+BmGGwsdhh7xH0ohjiK6I8YkrCVlJuEmLwACAA4AbQCLASwDMgWJByAK6wzhD/oSLhZ3GdAcNiCiIzwAAAAAAAEACwABAA8AAQATAAEAFwABABsAAQAoAAAAAAABAAUAAQAIAAEACgABAA4AAQAQAAEAFQABABgAAQAaAAEAHgABACAAAQAlAAEAKAABACoAAQAuAAEAMAABADIAAQA1AAEANwABADkAAQA8AAAAAAACAB8ALwCrAGQBSgJWA4IExgUfB4oIBQqKCxgNrg5JEOgRhxMoFccWYhj4GYYbCx2GHvEfSiGOIrojxiSsJWUm4SYeAAIAHwAvAKsAZAFKAlYDggTGBR8HiggFCooLGA2uDkkQ6BGHEygVxxZiGPgZhhsLHYYe8R9KIY4iuiPGJKwlZSbhJjwAAAAAAAEAAgABAAQAAQAGAAEACAABAAoAAQAMAAEADgABABAAAQASAAEAFAABABYAAQAYAAEAGgABABwAAQAeAAEAIAABACIAAQAkAAEAJgABACgAAQAqAAEALAABAC4AAQAwAAEAMgABADQAAQA2AAEAOAABADoAAQA8AAAAAAACABAAEAMcBiQJIgwVD/gRyBR/FxsalhznHggh8SKSJN0lvCYPAAEALQACABAAVAAzAX4CHwQIBikIegr1DJEPSBIYFfsX7hrsHfQgACQ8AAAAAAACAA8ATAOTBtIJAw0kEDITJhb8GK0bMx6EIJYiXCTEJbUmDgACAB8ALwCrAGQBSgJWA4IExgUfB4oIBQqKCxgNrg5JEOgRhxMoFccWYhj4GYYbCx2GHvEfSiGOIrojxiSsJWUm4SYsAAEAPAAAAAAAAQADAAEABQABAAgAAQALAAEADgABABAAAQATAAEAFgABABkAAQAbAAEAHgABACEAAQAkAAEAJgABACkAAQAsAAEALwABADEAAQA0AAEANwABADkAAQA8AAAAAAABAAsAAQAPAAEAEwABABcAAQAbAAEAKAAAAAAAAgAPAEwDkwbSCQMNJBAyEyYW/BitGzMehCCWIlwkxCW1Jg4AAgAfAC8AqwBkAUoCVgOCBMYFHweKCAUKigsYDa4OSRDoEYcTKBXHFmIY+BmGGwsdhh7xH0ohjiK6I8YkrCVlJuEmLAACABEATQAbAU0CzwORBYkHrgn4C2IO5RCAEy4W6BixG4MeWiE0JDwAAAAAAAEACwABAA8AAQATAAEAFwABABsAAQAoAAAAAAACAB8ALwCrAGQBSgJWA4IExgUfB4oIBQqKCxgNrg5JEOgRhxMoFccWYhj4GYYbCx2GHvEfSiGOIrojxiSsJWUm4SYeAAIAHwAvAKsAZAFKAlYDggTGBR8HiggFCooLGA2uDkkQ6BGHEygVxxZiGPgZhhsLHYYe8R9KIY4iuiPGJKwlZSbhJjwAAAAAAAIAHwAvAKsAZAFKAlYDggTGBR8HiggFCooLGA2uDkkQ6BGHEygVxxZiGPgZhhsLHYYe8R9KIY4iuiPGJKwlZSbhJh4AAgAfAC8AqwBkAUoCVgOCBMYFHweKCAUKigsYDa4OSRDoEYcTKBXHFmIY+BmGGwsdhh7xH0ohjiK6I8YkrCVlJuEmPAAAAAAAAgALACABtgMfBwcLNg+HE9oXCRzxH1oj8CUKAAIAFQC0AXcDRwUjBwYJ8AreDNAOwhC0EqMUkBZ1GFQaKBzyHawfViHrImokzSUeAAIAEQCKAN8BtgPrBWIIBwvMDaYQhxNqFkQZCRyuHiUhWiMxJYYmLgACAA8AjwMNB3cKyQ0BERwUExfhGYMc8R4jIRIjsCTxJcQmPAAAAAAAAgALACABtgMfBwcLNg+HE9oXCRzxH1oj8CUKAAIAFQC0AXcDRwUjBwYJ8AreDNAOwhC0EqMUkBZ1GFQaKBzyHawfViHrImokzSUeAAIAEQCKAN8BtgPrBWIIBwvMDaYQhxNqFkQZCRyuHiUhWiMxJYYmLgACAA8AjwMNB3cKyQ0BERwUExfhGYMc8R4jIRIjsCTxJcQmPAAAAAAAAgARANACogVyCD4LBA6/EGwTBxaOGPsaSh1zH3AhNiO8JPElwiYQAAEALgACAA8AWQBIAasCbAR5BsUIRwv0DccQuRPIFuwZIx1mILcjPAAAAAAAAgALACABtgMfBwcLNg+HE9oXCRzxH1oj8CUKAAIAFQC0AXcDRwUjBwYJ8AreDNAOwhC0EqMUkBZ1GFQaKBzyHawfViHrImokzSUeAAIAEQCKAN8BtgPrBWIIBwvMDaYQhxNqFkQZCRyuHiUhWiMxJYYmLgACAA8AjwMNB3cKyQ0BERwUExfhGYMc8R4jIRIjsCTxJcQmPAAAAAAAAgALACABtgMfBwcLNg+HE9oXCRzxH1oj8CUKAAIAFQC0AXcDRwUjBwYJ8AreDNAOwhC0EqMUkBZ1GFQaKBzyHawfViHrImokzSUeAAIAEQCKAN8BtgPrBWIIBwvMDaYQhxNqFkQZCRyuHiUhWiMxJYYmLgACAA8AjwMNB3cKyQ0BERwUExfhGYMc8R4jIRIjsCTxJcQmPAAAAAAAAgAfAC8AqwBkAUoCVgOCBMYFHweKCAUKigsYDa4OSRDoEYcTKBXHFmIY+BmGGwsdhh7xH0ohjiK6I8YkrCVlJuEmHgACAB8ALwCrAGQBSgJWA4IExgUfB4oIBQqKCxgNrg5JEOgRhxMoFccWYhj4GYYbCx2GHvEfSiGOIrojxiSsJWUm4SY8AAAAAAACAB8ALwCrAGQBSgJWA4IExgUfB4oIBQqKCxgNrg5JEOgRhxMoFccWYhj4GYYbCx2GHvEfSiGOIrojxiSsJWUm4SYeAAIAHwAvAKsAZAFKAlYDggTGBR8HiggFCooLGA2uDkkQ6BGHEygVxxZiGPgZhhsLHYYe8R9KIY4iuiPGJKwlZSbhJjwAAAAAAAIAEAAQAxwGJAkiDBUP+BHIFH8XGxqWHOceCCHxIpIk3SW8Jg8AAgAfAC8AqwBkAUoCVgOCBMYFHweKCAUKigsYDa4OSRDoEYcTKBXHFmIY+BmGGwsdhh7xH0ohjiK6I8YkrCVlJuEmLQACABAAVAAzAX4CHwQIBikIegr1DJEPSBIYFfsX7hrsHfQgACQ8AAAAAAACAAsAuwCSAiwFTgjVC58PmBOoF7wbux+NIwoAAgAVALQBdwNHBSMHBgnwCt4M0A7CELQSoxSQFnUYVBooHPIdrB9WIesiaiTNJR4AAgARAH4BSQNPBYIH2QlIDMkOWBHpE3sWBBl9G+IdKCBFIiwkzSUuAAIADwCPAw0HdwrJDQERHBQTF+EZgxzxHiMhEiOwJPElxCY8AAAAAAACAAsAuwCSAiwFTgjVC58PmBOoF7wbux+NIwoAAgAVALQBdwNHBSMHBgnwCt4M0A7CELQSoxSQFnUYVBooHPIdrB9WIesiaiTNJR4AAgARAH4BSQNPBYIH2QlIDMkOWBHpE3sWBBl9G+IdKCBFIiwkzSUuAAIADwCPAw0HdwrJDQERHBQTF+EZgxzxHiMhEiOwJPElxCY8AAAAAAACABIAxwKLBUgIAAusDU4Q4RJhFc4XIxpcHHQeZiAsIr8jFCUeJs8mEQACAB8AGQBhAM8AXwENAtYCtAOoBK8FxwbtByEJYQqtCwMNYg7JDzgRrRIqFKwVMxe+GEwa3htyHQkfoyA9ItgjdCUvAAIADgDBAI4CAAXfBwcLXQ7MEUQVsxgJHDEfECKCJE8mPAAAAAAAAQALAAEADwABABMAAQAXAAEAGwABACgAAAAAAAIAEAAQAxwGJAkiDBUP+BHIFH8XGxqWHOceCCHxIpIk3SW8Jg8AAQAtAAIAEABUADMBfgIfBAgGKQh6CvUMkQ9IEhgV+xfuGuwd9CAAJDwAAAAAAAIAEAAQAxwGJAkiDBUP+BHIFH8XGxqWHOceCCHxIpIk3SW8Jg8AAQAtAAIAEABUADMBfgIfBAgGKQh6CvUMkQ9IEhgV+xfuGuwd9CAAJDwAAAAAAAIAEAAQAxwGJAkiDBUP+BHIFH8XGxqWHOceCCHxIpIk3SW8Jg8AAQAtAAIAEABUADMBfgIfBAgGKQh6CvUMkQ9IEhgV+xfuGuwd9CAAJDwAAAAAAAEACwABAA8AAQATAAEAFwABABsAAQAoAAAAAAACAB8ALwCrAGQBSgJWA4IExgUfB4oIBQqKCxgNrg5JEOgRhxMoFccWYhj4GYYbCx2GHvEfSiGOIrojxiSsJWUm4SYeAAIAHwAvAKsAZAFKAlYDggTGBR8HiggFCooLGA2uDkkQ6BGHEygVxxZiGPgZhhsLHYYe8R9KIY4iuiPGJKwlZSbhJjwAAAAAAAEACwABAA8AAQATAAEAFwABABsAAQAoAAAAAAABAAsAAQAPAAEAEwABABcAAQAbAAEAKAAAAAAAAgAPAEwDkwbSCQMNJBAyEyYW/BitGzMehCCWIlwkxCW1Jg4AAgAfAC8AqwBkAUoCVgOCBMYFHweKCAUKigsYDa4OSRDoEYcTKBXHFmIY+BmGGwsdhh7xH0ohjiK6I8YkrCVlJuEmLAACABEATQAbAU0CzwORBYkHrgn4C2IO5RCAEy4W6BixG4MeWiE0JDwAAAAAAAEACwABAA8AAQATAAEAFwABABsAAQAoAAAAAAACAB8ALwCrAGQBSgJWA4IExgUfB4oIBQqKCxgNrg5JEOgRhxMoFccWYhj4GYYbCx2GHvEfSiGOIrojxiSsJWUm4SYeAAIAHwAvAKsAZAFKAlYDggTGBR8HiggFCooLGA2uDkkQ6BGHEygVxxZiGPgZhhsLHYYe8R9KIY4iuiPGJKwlZSbhJjwAAAAAAAEAAgABAAQAAQAGAAEACAABAAoAAQAMAAEADgABABAAAQASAAEAFAABABYAAQAYAAEAGgABABwAAQAeAAEAIAABACIAAQAkAAEAJgABACgAAQAqAAEALAABAC4AAQAwAAEAMgABADQAAQA2AAEAOAABADoAAQA8AAAAAAAAABAAAgAqAJ8BLwO0BC0GnQcDCV8KsQv8DD8OeQ+tENoR/hIcFDIVQxZMF08YTBlCGjEbGRz6HNUdqR52Hzsg+CCtIVoiACObIy4ktiQ0JaUlCiZiJqom4CYDJzkAAAAAAAAAEAACACoAnwEvA7QELQadBwMJXwqxC/wMPw55D60Q2hH+EhwUMhVDFkwXTxhMGUIaMRsZHPoc1R2pHnYfOyD4IK0hWiIAI5sjLiS2JDQlpSUKJmImqibgJgMnOQAAAAAAAAADAAIAGgBTApUExAbiCPEK8QzhDsQQmBJdFBMWuxdUGd0aVxzBHRgfXSCOIaoiriOYJGYlEiaXJvAmHAAAAB4AAgAcAB8CIAQJBuAHpwlgCw4Nsg5LENsRYhPhFFgWxRcrGYga3BsnHWcenR/HIOUh8yLxI9okqiVZJtomOQAAAAAAAAADAAIAGgBTApUExAbiCPEK8QzhDsQQmBJdFBMWuxdUGd0aVxzBHRgfXSCOIaoiriOYJGYlEiaXJvAmHAAAAB4AAgAcAB8CIAQJBuAHpwlgCw4Nsg5LENsRYhPhFFgWxRcrGYga3BsnHWcenR/HIOUh8yLxI9okqiVZJtomOQAAAAAAAAAFAAIAGQABBIMHoAptDfYPRxJoFF8WLRjaGWgb2RwtHmgfiiCVIYoiaCMxJOQkgCUGJnMmxib8Jh0AAAAeAAIAHwAkA8QFFwgtChsM5Q2SDygRqhIYFHYVxhYHGDwZZRqDG5Ucnx2dHpEfeyBbITEi/CK8I28kFSWsJTEmnybvJjwAAAAAAAAABQACABkAAQSDB6AKbQ32D0cSaBRfFi0Y2hloG9kcLR5oH4oglSGKImgjMSTkJIAlBiZzJsYm/CYdAAAAHgACAB8AJAPEBRcILQobDOUNkg8oEaoSGBR2FcYWBxg8GWUagxuVHJ8dnR6RH3sgWyExIvwivCNvJBUlrCUxJp8m7yY8AAAAAAACAAwAoQWvCjsPWRMQF2caZB0HIE4iNCSwJa8mCwAAAA4AAgARACAE8Ad4C8AOzBGhFEIXshnxGwIe5B+WIRYjZCR4JU4m3CYeAAAAIAACABEA9wN0B6AKjw1NEOISUxWjF9YZ7BvkHb4feiERI34ktyWkJjAAAAAAAAIADAChBa8KOw9ZExAXZxpkHQcgTiI0JLAlryYLAAAADgACABEAIATwB3gLwA7MEaEUQheyGfEbAh7kH5YhFiNkJHglTibcJh4AAAAgAAIAEQD3A3QHoAqPDU0Q4hJTFaMX1hnsG+Qdvh96IREjfiS3JaQmMAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAHQD//x4AAAA8AP//AAABAAUAAgAFABsFIwyHE+0a9SEJAAAAFgACAAgA3wHrBQcLphBqFgkcJSExJR0AAQAeAAIACAD6AmAHIwwNEQMW7RqwHxYkJQAAADIAAgALACABtgMfBwcLNg+HE9oXCRzxH1oj8CU8AAAAAAAAAAsA//8OAAAAHgD//yAAAAAwAP//AAACAAQAdAYUD/wXnCADAAAACAACAAQAAAVdDrMYECILAAEADgACAAQAdAYUD/wXnCARAAAAFwACAAgA3wHrBQcLphBqFgkcJSExJR4AAQAgAAIABAB0BhQP/BecICMAAAApAAIACADfAesFBwumEGoWCRwlITElMAAAAAAAAAA5AP//AAABAAkAAgAIAN8B6wUHC6YQahYJHCUhMSUQAAEAJwACABMAcgCOAR4DAAUfB2wJ2AtdDu4QhxMiFrMYOBukHfEfECLyI4IlniY5AAAAAAAAABwA//8eAAAAOQD//wAAAQADAAIACwAgAbYDHwcHCzYPhxPaFwkc8R9aI/AlDQAAABIAAgALACABtgMfBwcLNg+HE9oXCRzxH1oj8CUcAAEAHgACAAoA9wRMCV0NQhECFaAYHBxvH4siTyUnAAAALAACAA4AwQCOAgAF3wcHC10OzBFEFbMYCRwxHxAigiRPJjkAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAkA//8LAAAAEQD//xMAAAAaAP//HAAAACQA//8lAAAAKwD//y0AAAA0AP//NQAAADsA//88AAAAAAABAAQAAgAGAP4JNhIEGZAe4yLcJQkAAQALAAEADgACAAQAdw3CF4gf2SQRAAEAEwABABYAAgAFAHgLoRTxG5YheCUaAAEAHAABAB8AAgAGAP4JNhIEGZAe4yLcJSQAAQAlAAEAKAACAAQAdw3CF4gf2SQrAAEALQABADAAAgAFAHgLoRTxG5YheCU0AAEANQABADgAAgAEAHcNwheIH9kkOwABADwAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAEAAQABAAAAAAACAAYA5QwSFrccbiGbJHImBQABAAcAAQAJAAEACwABAA0AAQAPAAEAEQABABMAAQAUAAEAFgABABgAAQAaAAEAHAABAB4AAQAgAAEAIgABACQAAQAmAAEAKAABACkAAQArAAEALQABAC4AAQAwAAEAMgABADQAAQA2AAEAOAABADoAAQA8AAEAPQABAD8AAQBBAAEAQwACAAMAdAuiFcgeRQACAAIArg2+GkYAAABHAAAAAAACAEYAfwHsAk4EpAXvBiwIXwmJCqcLvgzJDc0Oyg+9EKgRjhJrE0MUEhXbFZ4WWhcRGMMYbhkUGrYaUhvoG3ocBx2OHRIekx4NH4Qf9x9lINAgNiGZIfghUyKqIv4iTiObI+UjKyRtJKwk6CQhJVcliSW5JeUlDiY0JlcmdyaUJq4mxCbYJukm9yYCJwonDidFAAIAAgCuDb4aRgAAAEcAAAAAAAAARwACAAgAmAlLEX0XcBxTIEYjWyWgJk4AAAAAAAAARwACAAgAmAlLEX0XcBxTIEYjWyWgJk4AAAAAAAIABADuDJwV1hzzIgMAAQAFAAEABwABAAgAAQAJAAEACwABAA0AAQAOAAEADwABABAAAQARAAEAEwABABQAAQAWAAEAGAABABkAAQAaAAEAGwABABwAAQAeAAEAIAABACEAAQAiAAEAIwABACQAAQAmAAEAKAABACkAAQArAAEALAABAC0AAQAuAAEAMAABADEAAQAyAAEANAABADYAAQA3AAEAOAABADkAAQA6AAEAPAABAD0AAQA+AAEAPwABAEAAAQBBAAEAQwACAAMAdAuiFcgeRQACAAIArg2+GkYAAABHAAAAAAACAEcAYQGVAqwDrQSgBYcGYwc2CAEJyAmGCkEL9wuoDFcNAA6oDksP6w+LECYRvxFXEuwSfxMQFJ4ULBW4FUIWyxZSF9cXWhjcGF0Z3hlcGtgaVBvNG0ccvhw0HakdHB6PHv8ebx/dH0ogtSAgIYch7yFUIrciGSN6I9cjMySOJOQkOSWKJdclISZlJqIm1yb+JkYAAABHAAAAAAACAAQA7gycFdYc8yIDAAEABQABAAcAAQAIAAEACQABAAsAAQANAAEADgABAA8AAQAQAAEAEQABABMAAQAUAAEAFgABABgAAQAZAAEAGgABABsAAQAcAAEAHgABACAAAQAhAAEAIgABACMAAQAkAAEAJgABACgAAQApAAEAKwABACwAAQAtAAEALgABADAAAQAxAAEAMgABADQAAQA2AAEANwABADgAAQA5AAEAOgABADwAAQA9AAEAPgABAD8AAQBAAAEAQQABAEMAAgADAHQLohXIHkUAAgACAK4NvhpGAAAARwAAAAAAAQADAAEABgABAAkAAQAPAAEAFgABACUAAQAoAAEAKwABAC4AAQA0AAEAOwAAAAAAAABHAAIACACRCSIRNRcZHPsf/CIsJY4mTgAAAAAAAABHAAIACACRCSIRNRcZHPsf/CIsJY4mTgAAAAAAAAAAAAAAAAABAAMAAAAGAAEACQABAAwAAQAPAAEAFgABACUAAQAoAAAAKwABAC4AAQAxAAEANAABADsAAAAAAAIAFACWAhEFcAe4CeoLCA4TEAwS9BPOFZkXVhkHG6wcRh7UH1kh1CJGJK8lEwACAAUADgfcDXAU0RoFIRcAAgAVAPYDjwfYCtsNmxAhE3EVkReDGUsb7BxoHsIf+yAXIhYj+iPFJHglFSacJisAAgAFAA4H3A1wFNEaBSEvAAIACQAyCAgPuhR2GVsdgiAAI+UkPCY3AAIABQAOB9wNcBTRGgUhOwACAAQA2Q+lGrQhvCU+AAEAQwABAEgAAQBOAAAAAAACAAMAcwy1FnIfAgACAAMAJQoAFJ8dBAACAAMAHwr4E5kdBgACAAUADgfcDXAU0RoFIQoAAgAEAJoRPByhIgYmDQACAAMAMAoOFKkdDwACAAMAJQoAFJ8dEQACAAMAHwr4E5kdEwACAAUADgfcDXAU0RoFIRcAAgADAOUR7ByLIxkAAgADADAKDhSpHRsAAgADACUKABSfHR0AAgADAB8K+BOZHR8AAgAFAA4H3A1wFNEaBSEjAAIAAwDEFN0faiUlAAIAAwAwCg4UqR0nAAIAAwAlCgAUnx0pAAIAAwAfCvgTmR0rAAIABQAOB9wNcBTRGgUhLwACAAMAAhJbHQUkMQACAAMAMAoOFKkdMwACAAMAJQoAFJ8dNQACAAMAHwr4E5kdNwACAAUADgfcDXAU0RoFITsAAgAEANkPpRq0IbwlPgABAEMAAQBIAAEATgAAAAAAAQADAAEABgABAAkAAQAMAAEADwABABYAAQAlAAEAKAABACsAAQAuAAEAMQABADQAAQA7AAAAAAACAAMAMAoOFKkdAgACAAMAJQoAFJ8dBAACAAMAHwr4E5kdBgACAAUADgfcDXAU0RoFIQoAAgAEAJoRPByhIgYmDQACAAMAMAoOFKkdDwACAAMAJQoAFJ8dEQACAAMAHwr4E5kdEwACAAUADgfcDXAU0RoFIRcAAgADAMQU3R9qJRkAAgADADAKDhSpHRsAAgADACUKABSfHR0AAgADAB8K+BOZHR8AAgAFAA4H3A1wFNEaBSEjAAIAAwDEFN0faiUlAAIAAwAwCg4UqR0nAAIAAwAlCgAUnx0pAAIAAwAfCvgTmR0rAAIABQAOB9wNcBTRGgUhLwACAAMAxBTdH2olMQACAAMAMAoOFKkdMwACAAMAJQoAFJ8dNQACAAMAHwr4E5kdNwACAAUADgfcDXAU0RoFITsAAgAEAJoRPByhIgYmPgABAEMAAQBIAAEATgAAAAAAAQAHAAEADwABABYAAQAeAAEAJgABAC0AAQA1AAEAPAABAEQAAQBOAAAAAAABAAMAAQAGAAEACQABAAwAAQAPAAEAFgABACUAAQAoAAEAKwABAC4AAQAxAAEANAABADsAAAAAAAEATAABAE4AAAAAAAEAAgABAAQAAQAGAAEACAABAAoAAQAMAAEADgABABAAAQASAAEAFAABABYAAQAYAAEAGgABABwAAQAeAAEAIAABACIAAQAkAAEAJgABACgAAQAqAAEALAABAC4AAQAwAAEAMgABADQAAQA2AAEAOAABADoAAQA8AAEAPQABAD8AAQBBAAEAQwABAEQAAQBGAAEASAABAEoAAQBMAAEATgAAAAAAAQAKAAEAQwAAAAAAAQADAAEABgABAAkAAQAMAAEADwABABYAAQAlAAEAKAABACsAAQAuAAEAMQABADQAAQA7AAAAAAABAAcAAQAPAAEAFgABAB4AAQAmAAEALQABADUAAQA8AAEARAABAE4AAAAAAAAAAAABAAMAAAAGAAEACQABAAwAAQAPAAEAFgABACUAAQAoAAAAKwABAC4AAQAxAAEANAABADsAAAAAAAIADAAPBBQICAznD6gTQhepGtMdryArIyoliiYLAAIAFQBfAFEBpwJJBCIGJghLCoYM1A4qEYcT5hU8GIoaxRzqHu4gxyJpJL8lsSYfAAIAFAA5ANUAvwHqAkkE1gWJB1wJTAtVDXMPohHhEy4WhBjlGksduh8qIpwkMgACABUAXwBRAacCSQQiBiYISwqGDNQOKhGHE+YVPBiKGsUc6h7uIMciaSS/JbEmRgACAAkA6QAsA1UGIApiDvoS0BfQHOshTgAAAAAAAQADAAEABgABAAkAAQAMAAEADwABABYAAQAlAAEAKAABACsAAQAuAAEAMQABADQAAQA7AAAAAAACAAMADhRJHy8lAgABAAUAAQAHAAEACQABAAoAAQALAAEADAABAA0AAQAPAAEAEAABABEAAQASAAEAEwABABQAAQAWAAEAFwABABgAAQAZAAEAGgABABsAAQAcAAEAHgABACAAAQAiAAEAJAABACUAAQAmAAEAKAABACkAAQAqAAEAKwABAC0AAQAuAAEAMAABADIAAQA0AAEANQABADYAAQA3AAEAOAABADkAAQA6AAEAPAACAAIA4AgGFj0AAQA+AAEAPwABAEAAAQBBAAEAQwACAAMAdAuiFcgeRQACAAIArg2+GkYAAABHAAAAAAACAEYAfwHsAk4EpAXvBiwIXwmJCqcLvgzJDc0Oyg+9EKgRjhJrE0MUEhXbFZ4WWhcRGMMYbhkUGrYaUhvoG3ocBx2OHRIekx4NH4Qf9x9lINAgNiGZIfghUyKqIv4iTiObI+UjKyRtJKwk6CQhJVcliSW5JeUlDiY0JlcmdyaUJq4mxCbYJukm9yYCJwonDidFAAIAAgCuDb4aRgAAAEcAAAAAAAIABgDlDBIWtxxuIZskciYFAAEABwABAAkAAQAKAAEACwABAAwAAQAPAAEAEAABABEAAQASAAEAEwABABQAAQAWAAEAFwABABgAAQAZAAEAGgABABsAAQAcAAEAHgABACQAAQAlAAEAJgABACgAAQApAAEAKgABAC0AAQAuAAEAMAABADIAAQA0AAEANQABADYAAQA3AAEAOAABADkAAQA6AAEAPAACAAIA4AgGFj0AAQA+AAEAPwABAEAAAQBBAAEAQwAAAAAAAgAUAGgAbQHfAp8EmgbACAcLZA3SD0sSxRQ+F6wZCRxQHnYgcSIxJKMlqCYTAAIAFQBfAFEBpwJJBCIGJghLCoYM1A4qEYcT5hU8GIoaxRzqHu4gxyJpJL8lsSYnAAIAFABoAG0B3wKfBJoGwAgHC2QN0g9LEsUUPhesGQkcUB52IHEiMSSjJagmOgACABUAXwBRAacCSQQiBiYISwqGDNQOKhGHE+YVPBiKGsUc6h7uIMciaSS/JbEmTgAAAAAAAQBMAAEATgAAAAAAAQACAAEABAABAAYAAQAIAAEACgABAAwAAQAOAAEAEAABABIAAQAUAAEAFgABABgAAQAaAAEAHAABAB4AAQAgAAEAIgABACQAAQAmAAEAKAABACoAAQAsAAEALgABADAAAQAyAAEANAABADYAAQA4AAEAOgABADwAAgACALEEBhI9AAEAPwABAEEAAQBDAAEARAABAEYAAQBIAAEASgABAEwAAQBOAAAAAAAAAAAAAQAKAAEAQwAAAAAAAgAEAOwQjhsvItwlAwABAAUAAQAGAAEABwABAAgAAQAJAAEACwABAA0AAQAOAAEADwABABEAAQATAAEAFAABABYAAQAYAAEAGQABABoAAQAbAAEAHAABAB4AAQAgAAEAIQABACIAAQAkAAEAJgABACgAAQApAAEAKwABACwAAQAtAAEALgABAC8AAQAwAAEAMQABADIAAQA0AAEANgABADcAAQA4AAEAOQABADoAAQA8AAEAPQABAD4AAQA/AAEAQAAAAEEAAQBDAAIAAwB0C6IVyB5FAAIAAgCuDb4aRgAAAEcAAAAAAAIARgB/AewCTgSkBe8GLAhfCYkKpwu+DMkNzQ7KD70QqBGOEmsTQxQSFdsVnhZaFxEYwxhuGRQathpSG+gbehwHHY4dEh6THg0fhB/3H2Ug0CA2IZkh+CFTIqoi/iJOI5sj5SMrJG0krCToJCElVyWJJbkl5SUOJjQmVyZ3JpQmribEJtgm6Sb3JgInCicOJ0UAAgACAK4NvhpGAAAARwAAAAAAAgAGAOUMEha3HG4hmyRyJgUAAQAGAAEABwABAAgAAQAJAAEACwABAA0AAQAOAAEADwABABEAAQATAAEAFAABABYAAQAYAAEAGQABABoAAQAbAAEAHAABAB4AAQAiAAEAJAABACYAAQAoAAEAKQABACsAAQAsAAEALgABAC8AAQAwAAEAMQABADIAAQA0AAEANgABADcAAQA4AAEAOQABADoAAQA8AAEAPQABAD4AAQA/AAEAQAAAAAAAAQADAAEABgABAAkAAQAMAAEADwABABYAAQAlAAEAKAABACsAAQAuAAEAMQABADQAAQA7AAAAAAACAAoAyQSGCScOpRLvFvUaoh7eIYEkWCYJAAIAFABoAG0B3wKfBJoGwAgHC2QN0g9LEsUUPhesGQkcUB52IHEiMSSjJagmHAACAAwAjwD/ARAEmgaCCbMMHRC0E28XQxspHxojJwACAAoAyQSGCScOpRLvFvUaoh7eIYEkWCYwAAIAFABoAG0B3wKfBJoGwAgHC2QN0g9LEsUUPhesGQkcUB52IHEiMSSjJagmQwACAAwAjwD/ARAEmgaCCbMMHRC0E28XQxspHxojTgAAAAAAAQADAAEABgABAAkAAQAMAAEADwABABYAAQAlAAEAKAABACsAAQAuAAEAMQABADQAAQA7AAAAAAABAAkAAQAVAAEAHgABACcAAQAzAAEAQwACAAwAzgXjCmQPbxMTF1kaSR3kHyoiFSSbJacmTgAAAAAAAQBDAAIADADOBeMKZA9vExMXWRpJHeQfKiIVJJslpyZOAAAAAAABAAkAAQAVAAEAHgABACcAAQAzAAEAQwACAAwAzgXjCmQPbxMTF1kaSR3kHyoiFSSbJacmTgAAAAAAAQBDAAIADADOBeMKZA9vExMXWRpJHeQfKiIVJJslpyZOAAAAAAAAAAAAAQAJAAEAFQABAB4AAQAnAAEAMwABAEMAAgAMAM4F4wpkD28TExdZGkkd5B8qIhUkmyWnJk4AAAAAAAEAQwACAAwAzgXjCmQPbxMTF1kaSR3kHyoiFSSbJacmTgAAAAAAAQAGAAEACQAAACkAAQAyAAEANwAAAEMAAQBOAAAAAAAAAAAAAQAJAAEAFQABAB4AAQAnAAEAMwABAEMAAgAMAM4F4wpkD28TExdZGkkd5B8qIhUkmyWnJk4AAAAAAAEACQABABUAAQAeAAEAJwABADMAAQBDAAIADADOBeMKZA9vExMXWRpJHeQfKiIVJJslpyZOAAAAAAACAAwADwQUCAgM5w+oE0IXqRrTHa8gKyMqJYomCwACABUANQDEAJsBrwL1A2YF+wavCH8KZgxiDm8QjBK2FOoWKRlwG7wdDSBjIrkkHwACAAkAjgEABWwJXQ6HE7MYpB0QIoIlJwACAAwADwQUCAgM5w+oE0IXqRrTHa8gKyMqJYomMgACABUANQDEAJsBrwL1A2YF+wavCH8KZgxiDm8QjBK2FOoWKRlwG7wdDSBjIrkkRgACAAkAjgEABWwJXQ6HE7MYpB0QIoIlTgAAAAAAAQADAAEABgABAAkAAQAMAAEADwABABYAAQAlAAEAKAABACsAAQAuAAEAMQABADQAAQA7AAAAAAAAAAAAAAAAAAEABwABAA8AAQAWAAEAHgABACYAAQAtAAEANQABADwAAQBEAAEATgAAAAAAAQADAAEABgABAAkAAQAMAAEADwABABYAAQAlAAEAKAABACsAAQAuAAEAMQABADQAAQA7AAAAAAABAAoAAQBDAAAAAAABAAoAAQBDAAEATgAAAAAAAQADAAEABgABAAkAAQAMAAEADwABABYAAQAlAAEAKAABACsAAQAuAAEAMQABADQAAQA7AAAAAAABAAMAAQAGAAEACQABAAwAAQAPAAEAFgABACUAAQAoAAEAKwABAC4AAQAxAAEANAABADsAAAAAAAIACgDJBIYJJw6lEu8W9RqiHt4hgSRYJgkAAgAUAGgAbQHfAp8EmgbACAcLZA3SD0sSxRQ+F6wZCRxQHnYgcSIxJKMlqCYcAAIADACPAP8BEASaBoIJswwdELQTbxdDGykfGiMnAAIACgDJBIYJJw6lEu8W9RqiHt4hgSRYJjAAAgAUAGgAbQHfAp8EmgbACAcLZA3SD0sSxRQ+F6wZCRxQHnYgcSIxJKMlqCZDAAIADACPAP8BEASaBoIJswwdELQTbxdDGykfGiNOAAAAAAABAAMAAQAGAAEACQABAAwAAQAPAAEAFgABACUAAQAoAAEAKwABAC4AAQAxAAEANAABADsAAAAAAAIAFABoAG0B3wKfBJoGwAgHC2QN0g9LEsUUPhesGQkcUB52IHEiMSSjJagmEwACABUAXwBRAacCSQQiBiYISwqGDNQOKhGHE+YVPBiKGsUc6h7uIMciaSS/JbEmJwACABQAaABtAd8CnwSaBsAIBwtkDdIPSxLFFD4XrBkJHFAediBxIjEkoyWoJjoAAgAVAF8AUQGnAkkEIgYmCEsKhgzUDioRhxPmFTwYihrFHOoe7iDHImkkvyWxJk4AAAAAAAEATAABAE4AAAAAAAEAAgABAAQAAQAGAAEACAABAAoAAQAMAAEADgABABAAAQASAAEAFAABABYAAQAYAAEAGgABABwAAQAeAAEAIAABACIAAQAkAAEAJgABACgAAQAqAAEALAABAC4AAQAwAAEAMgABADQAAQA2AAEAOAABADoAAQA8AAEAPQABAD8AAQBBAAEAQwABAEQAAQBGAAEASAABAEoAAQBMAAEATgAAAAAAAAABAAAAAAAAAAAAAAAAAAAAQwACAAgAJw5pFgMc/x/YItQkHybXJkoAAAAAAAAAQwACAAgAJw5pFgMc/x/YItQkHybXJkoAAAAAAAAAQwACAAgAJw5pFgMc/x/YItQkHybXJkoAAAAAAAAAAAAAAAAAAAAAAAEAAQABAAMAAQAEAAAABQABAAYAAQAIAAEACQAAAAoAAQALAAEADQABAA4AAAAPAAEAEAABABIAAQATAAAAFAABABUAAQAXAAEAGAAAABkAAQAaAAEAHAABAB0AAAAeAAEAHwABACEAAQAiAAAAIwABACQAAQAmAAEAJwAAACgAAQApAAEAKwABACwAAAAtAAEALgABADAAAQAxAAAAMgABADMAAQA1AAEANgAAADcAAQA4AAEAOgABADsAAAA8AAEAPQABAD8AAQBAAAEAQgAAAEUAAgAEAJ4ODhlzIDQlSAAAAE4AAAAAAAAAQwAAAEUAAgAEAJ4ODhlzIDQlSAAAAE4AAAAAAAAAEAACACoAnwEvA7QELQadBwMJXwqxC/wMPw55D60Q2hH+EhwUMhVDFkwXTxhMGUIaMRsZHPoc1R2pHnYfOyD4IK0hWiIAI5sjLiS2JDQlpSUKJmImqibgJgMnOQAAAD8AAgAQAP8DsgcmC2QOcBFOFP8WhxniGxQeGCDrIYoj6yQFJsYmTgAAAAAAAAAQAAIAKgCfAS8DtAQtBp0HAwlfCrEL/Aw/DnkPrRDaEf4SHBQyFUMWTBdPGEwZQhoxGxkc+hzVHakedh87IPggrSFaIgAjmyMuJLYkNCWlJQomYiaqJuAmAyc5AAAAPwACABAA/wOyByYLZA5wEU4U/xaHGeIbFB4YIOshiiPrJAUmxiZOAAAAAAAAAAMAAgAaAFMClQTEBuII8QrxDOEOxBCYEl0UExa7F1QZ3RpXHMEdGB9dII4hqiKuI5gkZiUSJpcm8CYcAAAAHgACABwAKwJGBFEGTgg9Ch8M8w27D3YRJhPHFF0W5hdiGdEaMRyDHcYe+h8dIS0iKyMSJOIkmSUxJqcm9CY5AAAAOwACABQA5gKWBSEIkArmDCgPVxF1E4MVgRduGUsbFx3PHnQg/yFuI7ok1yWvJk4AAAAAAAAAAwACABoAUwKVBMQG4gjxCvEM4Q7EEJgSXRQTFrsXVBndGlccwR0YH10gjiGqIq4jmCRmJRImlybwJhwAAAAeAAIAHAArAkYEUQZOCD0KHwzzDbsPdhEmE8cUXRbmF2IZ0RoxHIMdxh76Hx0hLSIrIxIk4iSZJTEmpyb0JjkAAAA7AAIAFADmApYFIQiQCuYMKA9XEXUTgxWBF24ZSxsXHc8edCD/IW4juiTXJa8mTgAAAAAAAAAAAAAAQwACAAoA1Qf/DEYREBV9GKQbjh49IasjxCVMAAAAAAAAAEMAAABFAAIABACeDg4ZcyA0JUgAAABOAAAAAAAAAEMAAABFAAIABACeDg4ZcyA0JUgAAABOAAAAAAAAAAEAAQADAAEABQAAAAcAAQAJAAEACwAAAA0AAQAPAAEAEQAAABMAAQAVAAEAFwAAABkAAQAbAAEAHQAAAB8AAQAhAAEAIwAAACUAAQAnAAEAKQAAACsAAQAtAAEALwAAADEAAQAzAAEANQAAADcAAQA5AAEAOwAAAD0AAQA/AAEAQQAAAAAAAAAFAAIAGQABBIMHoAptDfYPRxJoFF8WLRjaGWgb2RwtHmgfiiCVIYoiaCMxJOQkgCUGJnMmxib8Jh0AAAAeAAIAHwBOA0AG6ghaC5cNqA+UEV4TChWaFhEYchm+GvYbGh0tHi8fICACIdUhmCJOI/UjjSQXJZIl/iVaJqUm3iYDJzwAAAA+AAIAEQA3BUYJtwzBD4ASAxVWF38ZgxtlHSYfxyBIIqcj3yTpJbMmTgAAAAAAAAAFAAIAGQABBIMHoAptDfYPRxJoFF8WLRjaGWgb2RwtHmgfiiCVIYoiaCMxJOQkgCUGJnMmxib8Jh0AAAAeAAIAHwBOA0AG6ghaC5cNqA+UEV4TChWaFhEYchm+GvYbGh0tHi8fICACIdUhmCJOI/UjjSQXJZIl/iVaJqUm3iYDJzwAAAA+AAIAEQA3BUYJtwzBD4ASAxVWF38ZgxtlHSYfxyBIIqcj3yTpJbMmTgAAAAAAAgAMAKEFrwo7D1kTEBdnGmQdByBOIjQksCWvJgsAAAAOAAIAEQAgBPAHeAvADswRoRRCF7IZ8RsCHuQfliEWI2QkeCVOJtwmHgAAACAAAgARACAE8Ad4C8AOzBGhFEIXshnxGwIe5B+WIRYjZCR4JU4m3CYwAAAAMgACABkA0AJbBbYH6wkCDP4N4w+1EXUTJBXEFlMY1hlLG7EcCh5TH48guiHUItsjyyShJVQm2CZKAAAAAAACAAwAoQWvCjsPWRMQF2caZB0HIE4iNCSwJa8mCwAAAA4AAgARACAE8Ad4C8AOzBGhFEIXshnxGwIe5B+WIRYjZCR4JU4m3CYeAAAAIAACABEAIATwB3gLwA7MEaEUQheyGfEbAh7kH5YhFiNkJHglTibcJjAAAAAyAAIAGQDQAlsFtgfrCQIM/g3jD7URdRMkFcQWUxjWGUsbsRwKHlMfjyC6IdQi2yPLJKElVCbYJkoAAAAAAAAAQwACAAoAFAocEXgWshoYHtQgBCO2JPYlwyZMAAAAAAAAAEMAAAAAAAAAQwAAAAAAAABDAAIACgCgB7YM+RDBFDQYZRtaHhUhkiO5JUwAAAAAAAAAQwACAAQA1BE9HIYi8iVGAAAAAAAAAEMAAgAEANQRPRyGIvIlRgAAAAAAAABDAAIABADUET0chiLyJUYAAAAAAAAAQwACAAQA1BE9HIYi8iVGAAAAAAAAAEMAAgAEANQRPRyGIvIlRgAAAAAAAABDAAIABADUET0chiLyJUYAAAAAAAAAAAAAAAIAAAAEAAAABgAAAAgAAAAKAAAADAAAAA4AAAAQAAAAEgAAABQAAAAWAAAAGAAAABoAAAAcAAAAHgAAACAAAAAiAAAAJAAAACYAAAAoAAAAKgAAACwAAAAuAAAAMAAAADIAAAA0AAAANgAAADgAAAA6AAAAPAAAAD4AAABAAAAAQgAAAEQAAAAAAAAAAgAAAAQAAAAGAAAACAAAAAoAAAAMAAAADgAAABAAAAASAAAAFAAAABYAAAAYAAAAGgAAABwAAAAeAAAAIAAAACIAAAAkAAAAJgAAACgAAAAqAAAALAAAAC4AAAAwAAAAMgAAADQAAAA2AAAAOAAAADoAAAA8AAAAPgAAAEAAAABCAAAARAAAAAAAAAACAAAABAAAAAYAAAAIAAAACgAAAAwAAAAOAAAAEAAAABIAAAAUAAAAFgAAABgAAAAaAAAAHAAAAB4AAAAgAAAAIgAAACQAAAAmAAAAKAAAACoAAAAsAAAALgAAADAAAAAyAAAANAAAADYAAAA4AAAAOgAAADwAAAA+AAAAQAAAAEIAAABEAAAAAAACAAYA5QwSFrccbiGbJHImBQABAAcAAQAJAAEACwABAA0AAQAPAAEAEQABABMAAQAUAAEAFgABABgAAQAaAAEAHAABAB4AAQAgAAEAIgABACQAAQAmAAEAKAABACkAAQArAAEALQABAC4AAQAwAAEAMgABADQAAQA2AAEAOAABADoAAQA8AAEAPQABAD8AAQBBAAEAQwACAAMAFBJ2HWEkRQACAAIA4xztJEYAAAAAAAIARACIAQEDbgTMBR4HYQidCcsK8gsLDR4OJg8mEB4RDRL2EtcTrxSBFU0WERfPF4gYOxnnGY8aMBvMG2Mc9RyCHQoejR4LH4Yf+x9tINogQyGoIQkiZiK/IhUjZiO0I/4jRSSIJMckBCU9JXIlpCXTJf8lJyZMJm4mjCaoJsAm1SbnJvYmAScJJw4nQwACAAMAFBJ2HWEkRQAAAAAAAAAFAP//BgAAAAsA//8MAAAAEQD//xIAAAAXAP//GAAAAB0A//8eAAAAIwD//yQAAAApAP//KgAAAC8A//8wAAAANQD//zYAAAA7AP//PAAAAEEA//8AAAEAAQAAAAMAAQAFAAEABgABAAcAAAAJAAEACwABAAwAAQANAAAADwABABEAAQASAAEAEwAAABUAAQAXAAEAGAABABkAAAAbAAEAHQABAB4AAQAfAAAAIQABACMAAQAkAAEAJQAAACcAAQApAAEAKgABACsAAAAtAAEALwABADAAAQAxAAAAMwABADUAAQA2AAEANwAAADkAAQA7AAEAPAABAD0AAAA/AAEAQQAAAAAA//9DAAAASgD//wAAAQBDAAEARQACAAYAiQgaENYWwBy3IW0lSgAAAAAA//8AAAAAAAD//0MAAABMAP//AAABAEMAAQBHAAIABgDvDjQYYx6HIiolnSZMAAAAAAAAAAAAAQBFAAIABACeDg4ZcyA0JUgAAAAAAAAAAAABAEUAAgAEAJ4ODhlzIDQlSAAAAAAAAAAAAAEARQACAAQAng4OGXMgNCVIAAAAAAABAEUAAgAEAJ4ODhlzIDQlSAAAAAAAAABHAP//AAABAEcAAQBOAAAAAAAAAAAAAAAdAP//HgAAADwA//8+AAAATgD//wAAAQAFAAIABQAbBSMMhxPtGvUhCQAAABYAAgAIAN8B6wUHC6YQahYJHCUhMSUdAAEAHgACAAgA+gJgByMMDREDFu0asB8WJCUAAAAyAAIACwAgAbYDHwcHCzYPhxPaFwkc8R9aI/AlPAABAD4AAgAFABsFIwyHE+0a9SFCAAAASQACAAYA3wLACNIPPhdQHjEkTgAAAAAAAAALAP//DgAAAB4A//8gAAAAMAD//zIAAABKAP//AAACAAQAdAYUD/wXnCADAAAACAACAAQAAAVdDrMYECILAAEADgACAAQAdAYUD/wXnCARAAAAFwACAAgA3wHrBQcLphBqFgkcJSExJR4AAQAgAAIABAB0BhQP/BecICMAAAApAAIACADfAesFBwumEGoWCRwlITElMAABADIAAgAHAH8DjAj4DYcTGBmEHpEjOAAAAEEAAgAKAFEBSQQmCIYMKhHmFYoa6h7HIr8lSgAAAAAAAAA5AP//PwAAAE4A//8AAAEACQACAAgA3wHrBQcLphBqFgkcJSExJRAAAQAnAAIAEwByAI4BHgMABR8HbAnYC10O7hCHEyIWsxg4G6Qd8R8QIvIjgiWeJjkAAQA8AAIABAAABV0OsxgQIj8AAQBHAAIACADfAesFBwumEGoWCRwlITElTgAAAAAAAAAcAP//HgAAADkA//87AAAATgD//wAAAQADAAIACwAgAbYDHwcHCzYPhxPaFwkc8R9aI/AlDQAAABIAAgALACABtgMfBwcLNg+HE9oXCRzxH1oj8CUcAAEAHgACAAoA9wRMCV0NQhECFaAYHBxvH4siTyUnAAAALAACAA4AwQCOAgAF3wcHC10OzBFEFbMYCRwxHxAigiRPJjkAAQA7AAIABwCiBl4MuxHVFq8bOyBUJEEAAABFAAIACgBRAUkEJgiGDCoR5hWKGuoexyK/JU4AAAAAAAAAAAAAAEwA//8AAAEAQwAAAEYAAgAHAPgMQBUpG4kfxSIRJYQmTAAAAAAAAAAAAAAAAAD//0MAAABMAP//AAABAEYAAgAHAN8JmxHYF+oc+yAZJDcmTAAAAAAAAAABAAEAAwAAAAUAAQAHAAAACQABAAsAAAANAAEADwAAABEAAQATAAAAFQABABcAAAAZAAEAGwAAAB0AAQAfAAAAIQABACMAAAAlAAEAJwAAACkAAQArAAAALQABAC8AAAAxAAEAMwAAADUAAQA3AAAAOQABADsAAAA9AAEAPwAAAEEAAQBDAAAARQD//wAAAAABAP//AgAAAAMA//8EAAAABQD//wYAAAAHAP//CAAAAAkA//8KAAAACwD//wwAAAANAP//DgAAAA8A//8QAAAAEQD//xIAAAATAP//FAAAABUA//8WAAAAFwD//xgAAAAZAP//GgAAABsA//8cAAAAHQD//x4AAAAfAP//IAAAACEA//8iAAAAIwD//yQAAAAlAP//JgAAACcA//8oAAAAKQD//yoAAAArAP//LAAAAC0A//8uAAAALwD//zAAAAAxAP//MgAAADMA//80AAAANQD//zYAAAA3AP//OAAAADkA//86AAAAOwD//zwAAAA9AP//PgAAAD8A//9AAAAAQQD//0IAAABDAP//AAABAAEAAQBCAAEAQwACAAQAng0gFiQdDiNGAAAAAAABAAAAAQBFAAIABACeDg4ZcyA0JUgAAAAAAP//RwAAAAAA//9HAAAAAAAAAEcA//8AAP//TgAAAAAAAQBGAAEARwAAAAAAAQBGAAEARwAAAAAAAQBGAAEARwAAAAAAAQBDAAEARgAAAAAAAQBDAAIABAA1D2UX9R1nI0YAAAAAAAEAGgABAB4AAQAjAAEAJgABAC4AAQAzAAEAOAABADwAAAAAAAEABQABAAgAAQAKAAEADgABABAAAQAVAAEAGAABABoAAQAeAAEAIwABACYAAQAoAAEALAABAC4AAQAzAAEANgABADgAAQA8AAAAAAACAAwAAQT6B+gLwA99ExYXfxqtHY8gEyMcJYUmCwACABAANQE4A4AF6wdvCv8MmQ84EtgUdxcRGqEcJR+QIdgj2yUaAAIABAAHFzUguySsJh0AAAAeAAAAAAACAAwAAQT6B+gLwA99ExYXfxqtHY8gEyMcJYUmCwACABAANQE4A4AF6wdvCv8MmQ84EtgUdxcRGqEcJR+QIdgj2yUaAAIABAAHFzUguySsJh0AAAAeAAAAAAABABsAAQAeAAEAJgABACcAAQAxAAEAMwABADkAAQA8AAAAAAABABsAAQAeAAAAAAABAAMAAQAFAAEACAABAAsAAQAOAAEAEAABABMAAQAWAAEAGQABABsAAQAeAAEAIQABACMAAQAmAAEAJwABACkAAQAsAAEALgABADEAAQAzAAEANAABADcAAQA5AAEAPAAAAAAAAQAFAAEACQABAA0AAQAVAAEAHgABACEAAQAkAAEAJwABAC0AAQA0AAAAAAACAAwA+gBBA0kGyQmUDYcRiRV8GUcdxyDPIxYmCwACABAANQE4A4AF6wdvCv8MmQ84EtgUdxcRGqEcJR+QIdgj2yUaAAIABAAHFzUguySsJh0AAAAeAAAAAAACAAwA+gBBA0kGyQmUDYcRiRV8GUcdxyDPIxYmCwACABAANQE4A4AF6wdvCv8MmQ84EtgUdxcRGqEcJR+QIdgj2yUaAAIABAAHFzUguySsJh0AAAAeAAAAAAAAAAAAAAAAAAEABQAAAAkAAQANAAEAEQABABUAAQAeAAEAIQAAACQAAQAnAAEAKgABAC0AAQA0AAAAAAACAAwA+gBBA0kGyQmUDYcRiRV8GUcdxyDPIxYmCwACAA0AsAMZB14Khw2dEJ8TjhZqGTAc3B5pIcYj1iUXAAIACAA8Dj4WshueH3wiiyTyJccmHgACAB8AHgS1B+IKuA1FEJMSqxSTFlAY5hlaG7Ac6B0FHwkg+CDPIZQiRCPkI3Mk8SRhJcIlFSZcJpYmxCbmJv4mDCc8AAAAAAACAAwA+gBBA0kGyQmUDYcRiRV8GUcdxyDPIxYmCwACAA0AsAMZB14Khw2dEJ8TjhZqGTAc3B5pIcYj1iUXAAIACAA8Dj4WshueH3wiiyTyJccmHgACAB8AHgS1B+IKuA1FEJMSqxSTFlAY5hlaG7Ac6B0FHwkg+CDPIZQiRCPkI3Mk8SRhJcIlFSZcJpYmxCbmJv4mDCc8AAAAAAABAAUAAQAJAAEADQABABEAAQAVAAEAHgABACEAAQAkAAEAJwABACoAAQAtAAEANAAAAAAAAgAMAAEE+gfoC8APfRMWF38arR2PIBMjHCWFJgsAAQAXAAIACAA8Dj4WshueH3wiiyTyJccmHgACAB8AHgS1B+IKuA1FEJMSqxSTFlAY5hlaG7Ac6B0FHwkg+CDPIZQiRCPkI3Mk8SRhJcIlFSZcJpYmxCbmJv4mDCc8AAAAAAAAAAAAAQAFAAEACQABAA0AAQARAAEAFQABAB4AAQAhAAEAJAABACcAAQAqAAEALQABADQAAAAAAAIACQCUAnQGsQoUD4cT/BdfHJwgfCQIAAEACgAAAAAAAgADAIwIhxOEHgIAAQAEAAEABgABAAgAAQAKAAEADAABAA4AAQAQAAEAEgABABQAAQAWAAEAGAABABoAAQAcAAEAHgABACAAAQAiAAEAJAABACYAAQAoAAEAKgABACwAAQAuAAEAMAABADIAAQA0AAEANgABADgAAQA6AAEAPAAAAAAAAQAFAAEACQABAA0AAQARAAEAFQABAB4AAQAhAAEAJAABACcAAQAqAAEALQABADQAAAAAAAAAAAAAAAAAAQAFAAAACQABAA0AAQARAAEAFQABAB4AAQAhAAAAJAABACcAAQAqAAEALQABADQAAAAAAAIABwDUBLAJkg55E2EYSR0uIgYAAgAFAHYG+AyAEwsakiAKAAIABgClBUEL1hBmFvQbgSEPAAIABwDvBN4JzQ65E54Yex1MIhUAAgAKAL0DbwcXC7QOSRLUFVYZzxxBIK0jHgACAB8A7wHYA7kFkgdiCSsL6wygDk0Q8RGJExYVmRYPGHkZ1RokHGUdlh64H8ggyCG1Io8jVCQEJZ0lHiaFJtEmACc8AAAAAAABAAUAAQAJAAEADQABABEAAQAVAAEAHgABACEAAQAkAAEAJwABACoAAQAtAAEANAAAAAAAAQAaAAEAHgABACUAAQAnAAEAMgABADMAAQA5AAEAPAAAAAAAAQAaAAEAHgAAAAAAAQAFAAEACAABAAoAAQAOAAEAEAABABUAAQAYAAEAGgABAB4AAQAgAAEAJQABACcAAQAoAAEAKgABAC4AAQAwAAEAMgABADMAAQA1AAEANwABADkAAQA8AAAAAAACAAcA1AAmA8EGdwsqEbkXCx8GAAIABQDUBfcLZBIRGfYfCgACAAYAHAVoCt4PehU6GxchDwACAAcAkQQ9CQMO4BLRF9Yc7CEVAAIACgB4A/UGeAoADowRGxWwGEUc3R92Ix4AAgAfAKYBTAPwBJMGMwjQCWoLAQ2UDiIQrBEvE60UIhaRF/gYVRqpG/EcLh5fH4AgkiGTIoAjWiQaJcIlTCa1JvgmPAAAAAAAAgAJAJQCdAaxChQPhxP8F18cnCB8JAgAAQAKAAAAAAACAAMAjAiHE4QeAgABAAQAAQAGAAEACAABAAoAAQAMAAEADgABABAAAQASAAEAFAABABYAAQAYAAEAGgABABwAAQAeAAEAIAABACIAAQAkAAEAJgABACgAAQAqAAEALAABAC4AAQAwAAEAMgABADQAAQA2AAEAOAABADoAAQA8AAAAAAAAAAAAAAAAAAEAGwABAB4AAQAmAAEAJwABADEAAQAzAAEAOQABADwAAAAAAAEAGQABABsAAQAeAAEAOQABADwAAAAAAAEAAwABAAUAAQAIAAEACwABAA4AAQAQAAEAEwABABYAAQAZAAEAGwABAB4AAQAhAAEAJAABACYAAQAnAAEAKQABACwAAQAvAAEAMQABADMAAQA0AAEANwABADkAAQA8AAAAAAABAAUAAQAJAAEADQABABEAAQAVAAEAHgABACEAAQAkAAEAJwABACoAAQAtAAEANAAAAAAAAgAHANQEsAmSDnkTYRhJHS4iBgACAAUAdgb4DIATCxqSIAoAAgAGAKUFQQvWEGYW9BuBIQ8AAgAHAO8E3gnNDrkTnhh7HUwiFQACAAoAvQNvBxcLtA5JEtQVVhnPHEEgrSMeAAIAHwDvAdgDuQWSB2IJKwvrDKAOTRDxEYkTFhWZFg8YeRnVGiQcZR2WHrgfyCDIIbUijyNUJAQlnSUeJoUm0SYAJzwAAAAAAAEABQABAAkAAQANAAEAEQABABUAAQAeAAEAIQABACQAAQAnAAEAKgABAC0AAQA0AAAAAAACAAsAIAG2Ax8HBws2D4cT2hcJHPEfWiPwJQoAAgAMAHkAqAFYA24F2geVCpwN7xCOFIQY2hynIRUAAgANAJoBLAQLBxIKLg1YEIcTuBbiGf4cBSDkInYlIQACABwABAUXCYgMgg8dEm4UfxZbGAgajhvvHC8eUh9cIEwhJiLrIpwjOiTIJEQlsSUOJl0mnSbPJvMmCSc8AAAAAAACAAsAIAG2Ax8HBws2D4cT2hcJHPEfWiPwJQoAAgAMAHkAqAFYA24F2geVCpwN7xCOFIQY2hynIRUAAgANAJoBLAQLBxIKLg1YEIcTuBbiGf4cBSDkInYlIQACABwABAUXCYgMgg8dEm4UfxZbGAgajhvvHC8eUh9cIEwhJiLrIpwjOiTIJEQlsSUOJl0mnSbPJvMmCSc8AAAAAAACAAsAIAG2Ax8HBws2D4cT2hcJHPEfWiPwJQoAAgAMAHkAqAFYA24F2geVCpwN7xCOFIQY2hynIRUAAgANANoA3wKXBcAINAzSD4cTPhfcGlAeeSExJDYmIQACABwABAUXCYgMgg8dEm4UfxZbGAgajhvvHC8eUh9cIEwhJiLrIpwjOiTIJEQlsSUOJl0mnSbPJvMmCSc8AAAAAAACAAsAIAG2Ax8HBws2D4cT2hcJHPEfWiPwJQoAAAAAAAAAAAACAAsAIAG2Ax8HBws2D4cT2hcJHPEfWiPwJQoAAgAMAHkAqAFYA24F2geVCpwN7xCOFIQY2hynIRUAAgANANoA3wKXBcAINAzSD4cTPhfcGlAeeSExJDYmIQACABwABAUXCYgMgg8dEm4UfxZbGAgajhvvHC8eUh9cIEwhJiLrIpwjOiTIJEQlsSUOJl0mnSbPJvMmCSc8AAAAAAACAAsAIAG2Ax8HBws2D4cT2hcJHPEfWiPwJQoAAAAAAAIAEwAtAK0AdgF/AsADNQXYBqUImAquDOUOOBGnEzAWzRiCG0seJyEUJBIAAgAMAL8CjQVqCFMLRw5HEU8UYBd3GpYduiDkIx0AAgAEAL4Hfw9JFyIfIAACAB0AwgGEA0UFAwe+CHUKKQzZDYYPLBHKEmQU9BV8F/wYcRraGzYdhR7EH/QgECIYIwgk3ySaJTQmqib1JjwAAAAAAAAAAAACAAsAIAG2Ax8HBws2D4cT2hcJHPEfWiPwJQoAAgAMAHkAqAFYA24F2geVCpwN7xCOFIQY2hynIRUAAgANANoA3wKXBcAINAzSD4cTPhfcGlAeeSExJDYmIQACABwABAUXCYgMgg8dEm4UfxZbGAgajhvvHC8eUh9cIEwhJiLrIpwjOiTIJEQlsSUOJl0mnSbPJvMmCSc8AAAAAAACAAsAIAG2Ax8HBws2D4cT2hcJHPEfWiPwJQoAAAAAAAIABwDUBLAJkg55E2EYSR0uIgYAAgAFAHYG+AyAEwsakiAKAAIABgClBUEL1hBmFvQbgSEPAAIABwDvBN4JzQ65E54Yex1MIhUAAgAKAL0DbwcXC7QOSRLUFVYZzxxBIK0jHgACAB8A7wHYA7kFkgdiCSsL6wygDk0Q8RGJExYVmRYPGHkZ1RokHGUdlh64H8ggyCG1Io8jVCQEJZ0lHiaFJtEmACc8AAAAAAABAAUAAQAJAAEADQABABEAAQAVAAEAHgABACEAAQAkAAEAJwABACoAAQAtAAEANAAAAAAAAAAAAAAAAAAAAAAAAQAFAAEACQABAA0AAQARAAEAFQABAB4AAQAhAAEAJAABACcAAQAqAAEALQABADQAAAAAAAIAHQA1AMEAjgGOArYDAAVlBt8HbAkHC6wMXQ4REMwRhxNEFf8WsxhkGgkcpB0xH6sgECJaI4IkgiVPJtsmHAAAAAAAAQAFAAEACQABAA0AAQARAAEAFQABAB4AAQAhAAEAJAABACcAAQAqAAEALQABADQAAAAAAAEABQABAAkAAQANAAEAEQABABUAAQAeAAEAIQABACQAAQAnAAEAKgABAC0AAQA0AAAAAAACAAcA1ASwCZIOeRNhGEkdLiIGAAIABQB2BvgMgBMLGpIgCgACAAYApQVBC9YQZhb0G4EhDwACAAcA7wTeCc0OuROeGHsdTCIVAAIACgC9A28HFwu0DkkS1BVWGc8cQSCtIx4AAgAfAO8B2AO5BZIHYgkrC+sMoA5NEPERiRMWFZkWDxh5GdUaJBxlHZYeuB/IIMghtSKPI1QkBCWdJR4mhSbRJgAnPAAAAAAAAQAFAAEACQABAA0AAQARAAEAFQABAB4AAQAhAAEAJAABACcAAQAqAAEALQABADQAAAAAAAIABwDUACYDwQZ3CyoRuRcLHwYAAgAFANQF9wtkEhEZ9h8KAAIABgAcBWgK3g96FTobFyEPAAIABwCRBD0JAw7gEtEX1hzsIRUAAgAKAHgD9QZ4CgAOjBEbFbAYRRzdH3YjHgACAB8ApgFMA/AEkwYzCNAJagsBDZQOIhCsES8TrRQiFpEX+BhVGqkb8RwuHl8fgCCSIZMigCNaJBolwiVMJrUm+CY8AAAAAAABAAgAAQAKAAAAAAABAAIAAQAEAAEABgABAAgAAQAKAAEADAABAA4AAQAQAAEAEgABABQAAQAWAAEAGAABABoAAQAcAAEAHgABACAAAQAiAAEAJAABACYAAQAoAAEAKgABACwAAQAuAAEAMAABADIAAQA0AAEANgABADgAAQA6AAEAPAAAAAAAAAAoAAIACACNB0ANNRKxFtMaoR4bIiMlLwACAAQASA8bGmIhoSUyAAEANgACAAcAJApdEvcYJx4TItYkfyY8AAAAAAAAACgAAgAHAFQIjA7wE8sYPR1FIcokLgAAAC8AAgAEAEgPGxpiIaElMgABADUAAAA2AAIABwAkCl0S9xgnHhMi1iR/JjwAAAAAAAAAHgAAAAAAAAAeAAIACwAZCdsPJhVpGd4csB/6IcsjMiU1JtYmKAAAAAAAAAAnAAAALAAAAAAAAAAeAAIACgBlCa8QchYIG6gefiGoIzslSSbhJicAAAAsAAIAEQCZBNQIswxDEIITeBYoGZYbxB2zH2gh4iIjJCsl+yWTJvAmPAAAAAAAAAAeAAAAAAAAACYAAQAoAAEAKwAAADgAAQA5AAEAOwAAAAAAAAAhAAEAIwABACYAAAA1AAEANgABADgAAAAAAAAAEAACACoAnwEvA7QELQadBwMJXwqxC/wMPw55D60Q2hH+EhwUMhVDFkwXTxhMGUIaMRsZHPoc1R2pHnYfOyD4IK0hWiIAI5sjLiS2JDQlpSUKJmImqibgJgMnOQAAAAAAAAAQAAIAKgCfAS8DtAQtBp0HAwlfCrEL/Aw/DnkPrRDaEf4SHBQyFUMWTBdPGEwZQhoxGxkc+hzVHakedh87IPggrSFaIgAjmyMuJLYkNCWlJQomYiaqJuAmAyc5AAAAAAAAAAMAAgAaAFMClQTEBuII8QrxDOEOxBCYEl0UExa7F1QZ3RpXHMEdGB9dII4hqiKuI5gkZiUSJpcm8CYcAAAAHgACABwAKwJGBFEGTgg9Ch8M8w27D3YRJhPHFF0W5hdiGdEaMRyDHcYe+h8dIS0iKyMSJOIkmSUxJqcm9CY5AAAAAAAAAAMAAgAaAFMClQTEBuII8QrxDOEOxBCYEl0UExa7F1QZ3RpXHMEdGB9dII4hqiKuI5gkZiUSJpcm8CYcAAAAHgACABwAKwJGBFEGTgg9Ch8M8w27D3YRJhPHFF0W5hdiGdEaMRyDHcYe+h8dIS0iKyMSJOIkmSUxJqcm9CY5AAAAAAAAAB4AAgADALQNThl8IiAAAAAAAAAAHgACAAMAtA1OGXwiIAAAACIAAAAAAAAAHwABACEAAQAkAAAAMwABADQAAQA2AAAAAAAAADAAAQAxAAEAMwAAAAAAAQAFAAIAGQABBIMHoAptDfYPRxJoFF8WLRjaGWgb2RwtHmgfiiCVIYoiaCMxJOQkgCUGJnMmxib8Jh0AAAAeAAIAHwBOA0AG6ghaC5cNqA+UEV4TChWaFhEYchm+GvYbGh0tHi8fICACIdUhmCJOI/UjjSQXJZIl/iVaJqUm3iYDJzwAAAAAAAEABQACABkAAQSDB6AKbQ32D0cSaBRfFi0Y2hloG9kcLR5oH4oglSGKImgjMSTkJIAlBiZzJsYm/CYdAAAAHgACAB8ATgNABuoIWguXDagPlBFeEwoVmhYRGHIZvhr2GxodLR4vHyAgAiHVIZgiTiP1I40kFyWSJf4lWialJt4mAyc8AAAAAAACAAYAowgLEGwW5RuDIEMkBQACAAcAJgh2D+0VhBspIMQjKiYLAAAADgACABAAQgQwCM4LKg9FEicV0hdKGo4cnx6AIC4ipiPnJOolpyYdAAIAAgAmFXEiHgAAACAAAgARACAE8Ad4C8AOzBGhFEIXshnxGwIe5B+WIRYjZCR4JU4m3CYwAAAAPAAAAAAAAgAGAKMICxBsFuUbgyBDJAUAAgAHACYIdg/tFYQbKSDEIyomCwAAAA4AAgAQAEIEMAjOCyoPRRInFdIXShqOHJ8egCAuIqYj5yTqJacmHQACAAIAJhVxIh4AAAAgAAIAEQAgBPAHeAvADswRoRRCF7IZ8RsCHuQfliEWI2QkeCVOJtwmMAAAAAAAAAAeAAIABgBBCXMRiBhpHvQi8yUjAAAAAAAAAB8AAAAAAAAAHwAAAAAAAAAfAAIACQDyCb0R3BemHFEgDiP8JDom4SYnAAAAAAAAAB4AAQAnAAEAMwABADwAAAAAAAAAHgAAAAAAAAArAAAALQAAAC8AAAAxAAAAMwAAADUAAAA3AAAAOQAAADsAAAAAAAAAKwAAAC0AAAAvAAAAMQAAADMAAAA1AAAANwAAADkAAAA7AAAAAAAAACsAAAAtAAAALwAAADEAAAAzAAAANQAAADcAAAA5AAAAOwAAAAAAAAAlAAEAJwABACoAAAAAAAAAJQABACcAAQApAAAAAAAAACUAAAAAAAAAJQABACcAAQApAAAAAAAAACUAAAAAAAAAJQABACcAAQApAAAAAAAAACUAAgAGAEgL6hOhGswfnSMaJioAAQA8AAAAAAABADwAAAAAAAAAKAD//wAAAQAeAAAAIgACAAcAgwc0DigUZxnyHcgh2yQoAAEAPAAAAAAAAAAuAP//LwAAADUA//82AAAAPAD//wAAAQAoAAEAKwABAC4AAQAvAAEAMgABADUAAQA2AAEAOQABADwAAAAAAAAAIgD//wAAAQAeAAAAIAACAAMAHweHE/EfIgABADwAAAAAAAEANgAAAAAAAQAhAAIABgDrCJ0QVRckHfQhgiUmAAAAAAABADQAAAAAAAEAHwACAAYA6widEFUXJB30IYIlJAAAAAAAAQAxAAAAAAABAB0AAgAGAOsInRBVFyQd9CGCJSIAAAAAAAEAJgACAAYA6widEFUXJB30IYIlKwAAAAAAAQAlAAIABgARCHoPPhZLHHIhVSUqAAAAAAAAAAAAAAAdAP//HgAAADwA//8AAAEABQACAAUAGwUjDIcT7Rr1IQkAAAAWAAIACADfAesFBwumEGoWCRwlITElHQABAB4AAgAIAPoCYAcjDA0RAxbtGrAfFiQlAAAAMgACAAsAIAG2Ax8HBws2D4cT2hcJHPEfWiPwJTwAAAAAAAAACwD//w4AAAAeAP//IAAAADAA//8AAAIABAB0BhQP/BecIAMAAAAIAAIABAAABV0OsxgQIgsAAQAOAAIABAB0BhQP/BecIBEAAAAXAAIACADfAesFBwumEGoWCRwlITElHgABACAAAgAEAHQGFA/8F5wgIwAAACkAAgAIAN8B6wUHC6YQahYJHCUhMSUwAAEAPAAAAAAAAAA5AP//AAABAAkAAgAIAN8B6wUHC6YQahYJHCUhMSUQAAEAJwACABMAcgCOAR4DAAUfB2wJ2AtdDu4QhxMiFrMYOBukHfEfECLyI4IlniY5AAEAPAAAAAAAAAAcAP//HgAAADkA//8AAAEAAwACAAsAIAG2Ax8HBws2D4cT2hcJHPEfWiPwJQ0AAAASAAIACwAgAbYDHwcHCzYPhxPaFwkc8R9aI/AlHAABAB4AAgAKAPcETAldDUIRAhWgGBwcbx+LIk8lJwAAACwAAgAOAMEAjgIABd8HBwtdDswRRBWzGAkcMR8QIoIkTyY5AAEAPAAAAAAAAQA8AAAAAAAAACMA//8AAAEAHgAAAB8AAgAFABoOmBdOHvwi7yUjAAAAAAABADwAAAAAAAEAPAAAAAAAAAAnAP//AAABAB8AAAAjAAIABQCDD0EZtR/fI0ImJwABADwAAAAAAAEALAAAAC0AAQAuAAAALwABADAAAAAxAAEAMgAAADMAAQA0AAAANQABADYAAAA3AAEAOAAAADkAAQA6AAAAOwABADwAAAAAAAEAKwAAAAAAAAAnAP//LAAAADAA//8xAAAAMwD//zQAAAA2AP//NwAAADgA//85AAAAOgD//zsAAAAAAAEAHgABACIAAgAGAOEJYRJ+GTAfbSMbJicAAQAsAAEAMAABADsAAQA8AAAAAAAAADkAAQAAAAEAJgACAAYA6widEFUXJB30IYIlKwAAAAAAAAAeAP//AAAAAB4A//8AAAEAHgAAAAAAAAAeAP//AAABACUAAAAAAAEAJQAAAAAAAQAlAAAAAAABACUAAAAAAAEAJQACAAYALAqEElsZ3R4VI/AlKgAAAAAAZAAAAAIAAAAAAAAAAwBkAAAADwACAAAABwAJAAsADQAPABEAEwAVABcAGQAbAB0AHwAhACMAZAAAAAUAAgAeACUAPgBFAEcAUABkAAAABAACACgAUgBrAHgAgQBkAAAADgACADAAgwCFAIcAiQCLAI0AjwCRAJgAmgChAKMApQCnAGQAAAAGAAIATACpAKsArQCvALEAswBkAAAABQACAFgAtQDOANUA3wDoAGQAAAAEAAIAYgDqAAMBEAEZAWQAAAAFAAIAagAbATQBOwFFAU4BZAAAAAEAAgB0AFABZAAAAAUAAgB2AFIBaQFxAXoBhQFkAAAABwACAIAAhwGJAYsBjQGPAZEBkwFkAAAABQACAI4AlQGsAbQBtgG/AWQAAAAFAAIAmADBAdgB4AHiAesBZAAAAAcAAgCiAO0B7wHxAfMB9QH3AfkBZAAAAAUAAgCwAPsBEgIaAhwCJQJkAAAAAQACALoAJwJkAAAADAACALwAKQIxAjoCPAJDAkoCTAJTAlsCXQJkAmwCZAAAAAwAAgDUAG4CdgJ/AoECiAKPApECmAKgAqICqQKxAmQAAAAHAAIA7ACzArUCtwK5ArsCvQK/AmQAAAATAAIA+gDBAsMCxQLHAskCywLNAs8C0QLTAtUC1wLZAtsC3QLfAuEC4wLlAmQAAAAEAAIAIAHnAgEDCwMWA2QAAAAFAAIAKAEYAy8DNgNAA0sDZAAAAAcAAgAyAU0DTwNRA1MDVQNXA1kDZAAAAAEAAgBAAVsDZAAAAAEAAgBCAV0DZAAAAAcAAgBEAV8DYQNjA2UDZwNpA2sDZAAAAAYAAgBSAW0DhAOLA5IDmgOkA2QAAAAHAAIAXgGmA6gDqgOsA64DsAOyA2QAAAAPAAIAbAG0A7YDuAO6A7wDvgPAA8IDxAPGA8gDygPMA84D0ANkAAAABgACAIoB0gPpA/AD9wP/AwkEZAAAABMAAgCWAQsEDQQPBBEEEwQVBBcEGQQbBB0EHwQhBCMEJQQnBCkEKwQtBC8EZAAAAAEAAgC8ATEEZAAAAAQAAgC+ATMETQRUBGIEZAAAABcAAgDGAWQEZgRoBGoEbARuBHAEcgR0BHYEeAR6BHwEfgSABIIEhASGBIgEigSMBI4EkARkAAAABwACAPQBkgSUBJYEmASaBJwEngRkAAAABgACAAICoAS3BL4ExQTNBNcEZAAAAAcAAgAOAtkE2wTdBN8E4QTjBOUEZAAAAA4AAgAcAucE6QTrBO0E7wTxBPME9QT3BPkE+wT9BP8EAQVkAAAABQACADgCAwUaBSEFKwU2BWQAAAAFAAIAQgI4BU8FVgVgBWsFZAAAAAUAAgBMAm0FhAWLBZUFoAVkAAAABQACAFYCogW5BcAFygXVBWQAAAABAAIAYALXBWQAAAAFAAIAYgLZBfAF9wUBBgwGZAAAAAUAAgBsAg4GJQYsBjYGQQZkAAAAAQACAHYCQwZkAAAABQACAHgCRQZcBmMGbQZ4BmQAAAAFAAIAggJ6BpEGmAaiBq0GZAAAAAYAAgCMAq8GxgbNBtQG3AbmBmQAAAAHAAIAmALoBuoG7AbuBvAG8gb0BmQAAAABAAIApgL2BmQAAAABAAIAqAL4BmQAAAABAAIAqgL6BmQAAAAHAAIArAL8Bv4GAAcCBwQHBgcIB2QAAAAEAAIAugIKBwwHGgcqB2QAAAAEAAIAwgIsBy4HPAdMB2QAAAAHAAIAygJOB1AHUgdUB1YHWAdaB2QAAAAHAAIA2AJcB14HYAdiB2QHZgdoB2QAAAAGAAIA5gJqB4EHiAePB5cHoQdkAAAABwACAPICowelB6cHqQerB60HrwdkAAAABgACAAADsQfIB88H1gfeB+gHZAAAABMAAgAMA+oH7AfuB/AH8gf0B/YH+Af6B/wH/gcACAIIBAgGCAgICggMCA4IZAAAAAIAAgAyAxAIEghkAAAAAwACADYDFAgWCCIIZAAAAAIAAgA8AyQIJghkAAAAAgACAEADKAgqCGQAAAAEAAIARAMsCC4IPQhPCGQAAAAEAAIATANRCFMIYgh0CGQAAAAGAAIAVAN2CHgIiAiPCJEIpQhkAAAABgACAGADpwipCLkIwAjCCNYIZAAAAAMAAgBsA9gI2gjlCGQAAAADAAIAcgPnCOkI9AhkAAAABgACAHgD9gj4CAcJDgkQCSUJZAAAAAYAAgCEAycJKQk4CT8JQQlWCWQAAAAIAAIAkANYCWMJZQluCXcJeQmHCYkJZAAAAAgAAgCgA4sJlgmYCaEJqgmsCboJvAlkAAAAAgACALADvgnACWQAAAACAAIAtAPCCcQJZAAAAAMAAgC4A8YJyAnVCWQAAAABAAEAAADXCWQAAAABAAEAAQDZCWQAAAABAAEAAgDbCWQAAAABAAEAAwDdCWQAAAABAAEABADfCWQAAAABAAEABQDhCWQAAAABAAEABgDjCWQAAAABAAEABwDlCWQAAAABAAEACADnCWQAAAABAAEACQDpCWQAAAAEAAAAAADrCe0J7wnxCWQAAAAJAAEACgDzCfUJ+wn9CQUKBwoPChEKGgpkAAAABgAAAAAAHAoeCiAKIgokCiYKZAAAAAwAAQATACgKLgowCjYKOAo9Cj8KSApKClAKUgpbCmQAAAACAAAAAABdCl8KZAAAAAUAAQAfAGEKYwpvCnEKgApkAAAABAAAAAAAggqECoYKiApkAAAACQABACQAigqMCpYKmAqiCqQKrQqvCrsKZAAAAAIAAAAAAL0KvwpkAAAABAABAC0AwQrDCsUKzQpkAAAAAgAAAAAAzwrRCmQAAAACAAEAMQDTCtUKZAAAAAEAAQAzANcKZAAAAAEAAQA0ANkKZAAAAAIAAAAAANsK3QpkAAAABAABADUA3wrhCuMK7ApkAAAAAQAAAAAA7gpkAAAAAQABADkA8ApkAAAAAgAAAAAA8gr0CmQAAAAEAAEAOgD2CvgK+goEC2QAAAABAAEAPgAGC2QAAAABAAEAPwAIC2QAAAAHAAAAAAAKCwwLDgsQCxILFAsWC2QAAAAKAAEAQAAYCxoLIwslCycLLgswCzILOgs8C2QAAAABAAEASgA+C2QAAAABAAEASwBAC2QAAAABAAEATABCC2QAAAABAAEATQBEC2QAAAABAAEATgBGC2QAAAADAAIAAAAAACIARABkAAAABAACAAYARgBYAFoAbgBkAAAAAwACAA4AcACSALQAZAAAAAQAAgAUALYAyQDLAN4AZAAAAAQAAgAcAOAA8wD1AAgBZAAAAAQAAgAkAAoBHQEfATIBZAAAAAMAAgAsADQBVgF4AWQAAAAEAAIAMgB6AYoBrAHCAWQAAAAEAAIAOgDEAdYB+AH6AWQAAAADAAIAQgD8AR4CQAJkAAAAAwACAEgAQgJkAoYCZAAAAAQAAgBOAIgCmgKcArACZAAAAAQAAgBWALICxQLHAtoCZAAAAAQAAgBeANwC7wIRAyQDZAAAAAQAAgBmACYDOgM8A04DZAAAAAcAAgBuAFADUgNUA1YDWANaA1wDZAAAAAYAAgB8AF4DYANiA2QDZgNoA2QAAAAEAAIAiABqA30DfwOSA2QAAAADAAIAkACUA7YD2ANkAAAAAwACAJYA2gP8Ax4EZAAAABUAAgCcACAEIgQkBCYEKAQqBCwELgQwBDIENAQ2BDgEOgQ8BD4EQARCBEQERgRIBGQAAAASAAIAxgBKBEwETgRQBFIEVARWBFgEWgRcBF4EYARiBGQEZgRoBGoEbARkAAAAFgACAOoAbgR2BH8EgQSIBI8EkQSYBKAEogSpBLIEtAS7BMIExATLBNME1QTcBOME5QRkAAAAFgACABYB5wTvBPgE+gQBBQgFCgURBRkFGwUiBSsFLQU0BTsFPQVEBUwFTgVVBVwFXgVkAAAAFwACAEIBYAViBWQFZgVoBWoFbAVuBXAFcgV0BXYFeAV6BXwFfgWABYIFhAWGBYgFigWMBWQAAAADAAIAcAGOBbAF0gVkAAAAFQACAHYB1AXWBdgF2gXcBd4F4AXiBeQF5gXoBeoF7AXuBfAF8gX0BfYF+AX6BfwFZAAAABcAAgCgAf4FAAYCBgQGBgYIBgoGDAYOBhAGEgYUBhYGGAYaBhwGHgYgBiIGJAYmBigGKgZkAAAAFwACAM4BLAYuBjAGMgY0BjYGOAY6BjwGPgZABkIGRAZGBkgGSgZMBk4GUAZSBlQGVgZYBmQAAAAFAAIA/AFaBmgGgAaUBqYGZAAAAAUAAgAGAqgGtgbOBuIG9AZkAAAAHwACABAC9gb4BvoG/Ab+BgAHAgcEBwYHCAcKBwwHDgcQBxIHFAcWBxgHGgccBx4HIAciByQHJgcoByoHLAcuBzAHMgdkAAAAHwACAE4CNAc2BzgHOgc8Bz4HQAdCB0QHRgdIB0oHTAdOB1AHUgdUB1YHWAdaB1wHXgdgB2IHZAdmB2gHagdsB24HcAdkAAAAHwACAIwCcgd0B3YHeAd6B3wHfgeAB4IHhAeGB4gHigeMB44HkAeSB5QHlgeYB5oHnAeeB6AHogekB6YHqAeqB6wHrgdkAAAABQACAMoCsAe+B9YH6gf8B2QAAAAFAAIA1AL+BwwIJAg4CEoIZAAAAAUAAgDeAkwIWghyCIYImAhkAAAABQACAOgCmgioCMAI1AjmCGQAAAAEAAIA8gLoCP8IIQkwCWQAAAAEAAIA+gIyCUcJaQl6CWQAAAAHAAIAAgN8CX4JgAmCCYQJhgmICWQAAAAHAAIAEAOKCYwJjgmQCZIJlAmWCWQAAAAHAAIAHgOYCZoJnAmeCaAJogmkCWQAAAAHAAIALAOmCagJqgmsCa4JsAmyCWQAAAAHAAIAOgO0CbYJuAm6CbwJvgnACWQAAAAHAAIASAPCCcQJxgnICcoJzAnOCWQAAAAHAAIAVgPQCdIJ1AnWCdgJ2gncCWQAAAAHAAIAZAPeCeAJ4gnkCeYJ6AnqCWQAAAAHAAIAcgPsCe4J8AnyCfQJ9gn4CWQAAAAHAAIAgAP6CfwJ/gkACgIKBAoGCmQAAAAHAAIAjgMICgoKDAoOChAKEgoUCmQAAAAHAAIAnAMWChgKGgocCh4KIAoiCmQAAAAEAAIAqgMkCjkKWwpsCmQAAAAEAAIAsgNuCoAKogq2CmQAAAAEAAIAugO4Cs0K7woAC2QAAAAEAAIAwgMCCxQLNgtKC2QAAAAEAAIAygNMC2ALYgt0C2QAAAADAAIA0gN2C5gLugtkAAAAAwACANgDvAveCwAMZAAAAAUAAgDeAwIMBAwhDCMMQgxkAAAABQACAOgDRAxGDGMMZQyEDGQAAAADAAIA8gOGDIgMtQxkAAAAAwACAPgDtwy5DOYMZAAAAAUAAgD+A+gM6gwGDQgNKg1kAAAABQACAAgELA0uDUoNTA1uDWQAAAAGAAIAEgRwDX8NgQ2VDZcNqw1kAAAABgACAB4ErQ28Db4N0g3UDegNZAAAAAEAAQAAAOoNZAAAAAEAAQABAOwNZAAAAAEAAQACAO4NZAAAAAEAAQADAPANZAAAAAEAAAAAAPINZAAAAAEAAQAEAPQNZAAAAAEAAAAAAPYNZAAAAAEAAQAFAPgNZAAAAAEAAAAAAPoNZAAAAAEAAQAGAPwNZAAAAAEAAQAHAP4NZAAAAAEAAQAIAAAOZAAAAAEAAQAJAAIOZAAAAAQAAAAAAAQOBg4IDgoOZAAAAAkAAQAKAAwODg4WDhgOIw4lDjAOMg5ADmQAAAAGAAAAAABCDkQORg5IDkoOTA5kAAAADAABABMATg5VDlcOXg5gDmcOaQ50DnYOfQ5/DooOZAAAAAIAAAAAAIwOjg5kAAAABQABAB8AkA6SDp0Onw61DmQAAAAEAAAAAAC3DrkOuw69DmQAAAAJAAEAJAC/DsEOzw7RDt8O4Q7uDvAOAQ9kAAAAAQABAC0AAw9kAAAAAQABAC4ABQ9kAAAAAQABAC8ABw9kAAAAAQABADAACQ9kAAAAAQABADEACw9kAAAAAQAAAAAADQ9kAAAAAQABADIADw9kAAAAAQABADMAEQ9kAAAAAQABADQAEw9kAAAAAQABADUAFQ9kAAAADwAAAAAAFw8ZDxsPHQ8fDyEPIw8lDycPKQ8rDy0PLw8xDzMPZAAAABYAAQA2ADUPNw9AD0IPRA9LD00PTw9XD1kPWw9kD2YPaA9vD3EPcw97D30Pfw+GD4gPZAAAAAEAAQBMAIoPZAAAAAEAAQBNAIwPZAAAAAEAAQBOAI4PZAAAAAEAAQBPAJAPZAAAAAEAAQBQAJIPZAAAAAUAAgAAAAAAAgAIABAAEgBkAAAABQACAAoAFAAWABwAJAAmAGQAAAAjAAIAFAAoACoALAAuADAAMgA0ADYAOAA6ADwAPgBAAEIARABGAEgASgBQAFgAWgBkAGkAawBtAG8AcQBzAHUAdwB5AHsAfQB/AIEAZAAAAAcAAgBaAIMAoADBANUA5wAOATABZAAAAAUAAgBoADIBbAGAAbUB1wFkAAAABAACAHIA2QHbAeEB4wFkAAAAJgACAHoA5QHnAekB6wHtAe8B8QHzAfUB9wH5AfsB/QH/AQECAwIFAgcCCQILAhECEwIVAhcCGQIbAh0CHwIhAiMCJQInAikCKwItAi8CMQIzAmQAAAAZAAIAxgA1AjcCOQI7Aj0CPwJBAkMCRQJHAkkCSwJNAk8CUQJTAlUCVwJZAlsCXQJfAmECYwJlAmQAAAAWAAIA+ABnAngCgQKIApACmQKhAqcCrQKzArkCvwLFAssC0QLdAuMC5QLtAvQC/AIfA2QAAAAOAAIAJAEhAzIDOwNCA08DVwNrA3cDfQN/A4cDjgOWA7kDZAAAAAQAAgBAAbsD+QP/AwEEZAAAAAEAAgBIAQMEZAAAAAoAAgBKAQUEGAQhBH4EgASCBIQEhgSIBIoEZAAAAAcAAgBeAYwEjgSQBJYEmASaBJwEZAAAABAAAgBsAZ4EoASmBKgErgS1BLcEvQS/BMUExwTJBM8E0QTXBNkEZAAAAB8AAgCMAdsE3QTfBOEE4wTlBOcE6QTrBO0E7wTxBPME9QT3BPkE+wT9BP8EAQUDBQUFBwUJBQsFDQUPBREFEwUVBRcFZAAAABUAAgDKARkFKgUxBToFQQVIBU8FVgVdBWQFawV3BX0FfwWBBYgFigWQBakFsQXYBWQAAAAVAAIA9AHaBesF8gX7BQIGCQYQBhcGHgYlBiwGOAY+BkAGRwZJBlYGXAZ1Bn0GpAZkAAAAHwACAB4CpgaoBqoGrAauBrAGsga0BrYGuAa6BrwGvgbABsIGxAbGBsgGygbMBs4G0AbSBtQG1gbYBtoG3AbeBuAG4gZkAAAAFwACAFwC5AbuBvkGAAcJBxAHFwceByUHLAczBzoHRgdMB1IHWQdgB2IHbwd1B44Hlge9B2QAAAAIAAIAigK/B9cH6Af5BzwIRAhNCHAIZAAAAC0AAgCaAnIIegiDCIUIjAiTCJUInAikCKYIrQi2CLgIvwjGCMgIzwjRCNcI2QjbCOII6QjrCPMI/Aj+CAUJDAkOCRUJHQkfCSYJLwkxCTgJPwlBCUgJUAlSCVkJYAliCWQAAAAEAAIA9AJkCaQJpgmoCWQAAAAtAAIA/AKqCbIJuwm9CcQJywnNCdQJ3AneCeUJ7gnwCfcJ/gkACgcKCQoPChEKEwoaCiEKIworCjQKNgo9CkQKRgpNClUKVwpeCmcKaQpwCncKeQqACogKigqRCpgKmgpkAAAAHwACAFYDnAqeCqAKogqkCqYKqAqqCqwKrgqwCrIKtAq2CrgKugq8Cr4KwArCCsQKxgrICsoKzArOCtAK0grUCtYK2ApkAAAABQACAJQD2grnCukK6wrtCmQAAABKAAIAngPvCvYK+Ar6CvwK/goACwILBAsGCwgLCgsMCw4LEAsSCxQLFgsYCxoLHAseCyALIgskCyYLKAsqCywLLgswCzILNAs2CzgLOgs8Cz4LQAtCC0QLRgtIC0oLTAtOC1ALUgtUC1YLWAtaC1wLXgtgC2ILZAtmC2gLagtsC24LcAtyC3QLegt8C34LgAuCC4QLhguIC4oLZAAAAAgAAgAyBIwLoAu4C9AL0gv1C/wLIwxkAAAAHwACAEIEJQwnDCkMKwwtDC8MMQwzDDUMNww5DDsMPQw/DEEMQwxFDEcMSQxLDE0MTwxRDFMMVQxXDFkMWwxdDF8MYQxkAAAABQACAIAEYwxlDGsMbQx4DGQAAAAIAAIAigR6DJIMowy0DPcM/wwIDSsNZAAAAAEAAgCaBC0NZAAAAB8AAgCcBC8NMQ0zDTUNNw05DTsNPQ0/DUENQw1FDUcNSQ1LDU0NTw1RDVMNVQ1XDVkNWw1dDV8NYQ1jDWUNZw1pDWsNZAAAAA8AAgDaBG0NeQ2DDY0Nlw2hDasN9g39DQQOCw4SDhoOIw46DmQAAAAfAAIA+AQ8Dj4OQA5CDkQORg5IDkoOTA5ODlAOUg5UDlYOWA5aDlwOXg5gDmIOZA5mDmgOag5sDm4OcA5yDnQOdg54DmQAAAAxAAIANgV6DnwOfg6ADoIOhA6GDogOig6MDo4OkA6SDpQOlg6YDpoOnA6eDqAOog6kDqYOqA6qDqwOrg6wDrIOtA62DrgOug68Dr4OwA7CDsQOxg7IDsoOzA7ODtAO0g7UDtYO2A7aDmQAAAAPAAIAmAXcDugO8g78DgYPEA8aD2UPbA9zD3oPgQ+JD5IPqQ9kAAAABQACALYFqw+4D7oPvA++D2QAAABKAAIAwAXAD8cPyQ/LD80Pzw/RD9MP1Q/XD9kP2w/dD98P4Q/jD+UP5w/pD+sP7Q/vD/EP8w/1D/cP+Q/7D/0P/w8BEAYQCBAKEAwQDhAQEBIQFBAWEBgQGhAcEB4QIxAlECcQKRArEC0QLxAxEDMQNRA3EDkQOxA9ED8QQRBDEEUQRxBJEEsQURBTEFUQVxBZEFsQXRBfEGEQZAAAAAEAAgBUBmMQZAAAAAkAAgBWBmUQeRCREKsQrRDOENUQ5RAAEWQAAAA2AAIAaAYCEQQRBhEIEQoRDBEOERAREhEUERYRGBEaERwRHhEgESIRJBEmESgRKhEsES4RMBEyETQRNhE4EToRPBE+EUARQhFEEUYRSBFKEUwRThFQEVIRVBFWEVgRWhFcEV4RYBFiEWQRZhFoEWoRbBFkAAAAHwACANQGbhFwEXIRdBF2EXgRehF8EX4RgBGCEYQRhhGIEYoRjBGOEZARkhGUEZYRmBGaEZwRnhGgEaIRpBGmEagRqhFkAAAADwACABIHrBG4EcIRzBHWEeAR6hE1EjwSQxJKElESWRJiEnkSZAAAAB8AAgAwB3sSfRJ/EoESgxKFEocSiRKLEo0SjxKREpMSlRKXEpkSmxKdEp8SoRKjEqUSpxKpEqsSrRKvErESsxK1ErcSZAAAADYAAgBuB7kSuxK9Er8SwRLDEsUSxxLJEssSzRLPEtES0xLVEtcS2RLbEt0S3xLhEuMS5RLnEukS6xLtEu8S8RLzEvUS9xL5EvsS/RL/EgETAxMFEwcTCRMLEw0TDxMRExMTFRMXExkTGxMdEx8TIRMjE2QAAAAXAAIA2gclEzQTNhNBE0MTVRNbE2ETZxNtE3MTeRN/E4UTixOSE7ETvRPHE84T0BPSE+gTZAAAAAwAAgAICOoT+RP7EwYUCBQaFFYUYBRnFGkUaxSBFGQAAAAXAAIAIAiDFJIUlBSfFKEUsxS5FL8UxRTLFNEU1xTdFOMU6RTwFA8VGxUlFSwVLhUwFUYVZAAAAAwAAgBOCEgVVxVZFWQVZhV4FbQVvhXFFccVyRXfFWQAAAAMAAIAZgjhFe4V9hUBFh8WYhZqFnEWeBaBFo4WohZkAAAAFwACAH4IpBazFrUWwBbCFtQW2hbgFuYW7BbyFvgW/hYEFwoXERcwFzwXRhdNF08XURdnF2QAAAAMAAIArAhpF3gXeheFF4cXmRfVF98X5hfoF+oXABhkAAAAAwACAMQIAhgOGBAYZAAAAAEAAgDKCBIYZAAAABcAAgDMCBQYIxgxGDwYPhhQGFYYXBhiGGgYbhh0GHoYgBiGGI0YrBi4GMIYyRjLGM0Y4xhkAAAADAACAPoI5Rj0GAIZDRkPGSEZXRlnGW4ZcBlyGYgZZAAAAAEAAgASCYoZZAAAAA8AAgAUCYwZmBmiGawZthnAGcoZFRocGiMaKhoxGjkaQhpZGmQAAAAfAAIAMglbGl0aXxphGmMaZRpnGmkaaxptGm8acRpzGnUadxp5GnsafRp/GoEagxqFGocaiRqLGo0ajxqRGpMalRqXGmQAAAABAAIAcAmZGmQAAAABAAIAcgmbGmQAAAAIAAIAdAmdGrUaxhrXGhobIhsrG04bZAAAAB8AAgCECVAbUhtUG1YbWBtaG1wbXhtgG2IbZBtmG2gbahtsG24bcBtyG3Qbdht4G3obfBt+G4AbghuEG4YbiBuKG4wbZAAAAAMAAgDCCY4bzhsrHGQAAAAfAAIAyAktHC8cMRwzHDUcNxw5HDscPRw/HEEcQxxFHEccSRxLHE0cTxxRHFMcVRxXHFkcWxxdHF8cYRxjHGUcZxxpHGQAAAAfAAIABgprHG0cbxxxHHMcdRx3HHkcexx9HH8cgRyDHIUchxyJHIscjRyPHJEckxyVHJccmRybHJ0cnxyhHKMcpRynHGQAAAAPAAIARAqpHLUcvxzJHNMc3RznHDIdOR1AHUcdTh1WHV8ddh1kAAAAHwACAGIKeB16HXwdfh2AHYIdhB2GHYgdih2MHY4dkB2SHZQdlh2YHZodnB2eHaAdoh2kHaYdqB2qHawdrh2wHbIdtB1kAAAADwACAKAKth3CHcwd1h3gHeod9B0/HkYeTR5UHlseYx5sHoMeZAAAAAUAAgC+CoUehx6JHosejR5kAAAASgACAMgKjx6RHpMelR6XHpkemx6dHp8eoR6jHqUepx6pHqserR6vHrEesx61HrceuR67Hr0evx7BHsMexR7HHskeyx7NHs8e0R7THtUe1x7ZHtse3R7fHuEe4x7lHuce6R7rHu0e7x7xHvMe9R73Hvke+x79Hv8eAR8DHwUfBx8JHwsfDR8PHxUfFx8ZHxsfHR8fHyEfIx8lH2QAAAAJAAIAXAsnHykfVh9YH1ofXB9eH4sfjR9kAAAACQACAG4Ljx+RH74fwB/CH8Qfxh/zH/UfZAAAAA4AAgCAC/cf+R8WIBggNyA5IDsgUSBTIFUgdyB5IJggmiBkAAAADgACAJwLnCCeILsgvSDcIN4g4CD2IPgg+iAcIR4hPSE/IWQAAAALAAIAuAtBIUMhXyFhIWMhhCGGIYwhliGkIbQhZAAAAAkAAgDOC7YhuCHUIdYh2CH5IfshESIhImQAAAARAAIA4AsjIjIiNCJIIkoiXiJgIm8icSJzIoIihCKdIp8iqSK3IrkiZAAAABEAAgACDLsiyiLMIuAi4iL2IvgiByMJIwsjGiMcIzUjNyNBI08jUSNkAAAABAACACQMUyNVI1cjZyNkAAAAAgACACwMaSNrI2QAAAAEAAIAMAxtI28jcSOBI2QAAAAEAAIAOAyDI4UjhyONI2QAAAACAAIAQAyPI5EjZAAAAAQAAgBEDJMjlSOXI50jZAAAAAEAAQAAAJ8jZAAAAAEAAQABAKEjZAAAAAEAAQACAKMjZAAAAAEAAQADAKUjZAAAAAEAAQAEAKcjZAAAAAEAAQAFAKkjZAAAAAEAAQAGAKsjZAAAAAEAAQAHAK0jZAAAAAEAAQAIAK8jZAAAAAIAAAAAALEjsyNkAAAABAABAAkAtSO3I7kjvyNkAAAACgAAAAAAwSPDI8UjxyPJI8sjzSPPI9Ej0yNkAAAAFAABAA0A1SPXI98j4SPsI+4j+SP7IwkkCyQTJBUkFyQfJCEkLCQuJDkkOyRJJGQAAAAOAAAAAABLJE0kTyRRJFMkVSRXJFkkWyRdJF8kYSRjJGUkZAAAABwAAQAhAGckbiRwJHckeSSAJIIkjSSPJJYkmCSjJKUkrCSuJLUktyS+JMAkxyTJJNUk1yTiJOQk6yTtJPgkZAAAAAYAAAAAAPok/CT+JAAlAiUEJWQAAAAJAAEAPQAGJQglEyUVJSslLSU9JT8lVSVkAAAACgAAAAAAVyVZJVslXSVfJWElYyVlJWclaSVkAAAAFAABAEYAayVtJXslfSWLJY0lmiWcJa0lryW9Jb8lwSXPJdEl3yXhJe4l8CUBJmQAAAABAAEAWgADJmQAAAADAAAAAAAFJgcmCSZkAAAABQABAFsACyYNJg8mESYbJmQAAAABAAEAYAAdJmQAAAACAAAAAAAfJiEmZAAAAAMAAQBhACMmJSYnJmQAAAABAAEAZAApJmQAAAACAAAAAAArJi0mZAAAAAQAAQBlAC8mMSYzJkEmZAAAAAEAAAAAAEMmZAAAAAEAAQBpAEUmZAAAAAEAAQBqAEcmZAAAAAEAAQBrAEkmZAAAAAkAAAAAAEsmTSZPJlEmUyZVJlcmWSZbJmQAAAADAAAAAABdJl8mYSZkAAAABAABAGwAYyZlJmcmaSZkAAAAAQABAHAAayZkAAAAAwAAAAAAbSZvJnEmZAAAAAQAAQBxAHMmdSZ3JoImZAAAAB0AAAAAAIQmhiaIJoomjCaOJpAmkiaUJpYmmCaaJpwmniagJqImpCamJqgmqiasJq4msCayJrQmtia4JromvCZkAAAALQABAHUAvibAJskmyybNJtQm1ibYJuAm4ibkJu0m7ybxJvgm+ib8JgInBCcGJwgnCicRJxMnFSceJyAnIicpJysnLSc1JzcnOSdCJ0QnRidNJ08nUSdZJ1snXSdkJ2YnZAAAAAMAAAAAAGgnaidsJ2QAAAAEAAEAogBuJ3Ancid9J2QAAAABAAEApgB/J2QAAAABAAEApwCBJ2QAAAABAAEAqACDJ2QAAAABAAEAqQCFJ2QAAAABAAEAqgCHJ2QAAAAVAAIAAAAAAAIABAAGAAgACgAMAA4AEAASABQAFgAYABoAHAAeACAAIgAkACYAKABkAAAAEgACACoAKgAsAC4AMAAyADQANgA4ADoAPAA+AEAAQgBEAEYASABKAEwAZAAAAAMAAgBOAE4AcACSAGQAAAAXAAIAVACUAJYAmACaAJwAngCgAKIApACmAKgAqgCsAK4AsACyALQAtgC4ALoAvAC+AMAAZAAAAAYAAgCCAMIAxADGAMgAygDMAGQAAAADAAIAjgDOAPAAEgFkAAAAAwACAJQAFAE2AVgBZAAAAAQAAgCaAFoBbAFuAYIBZAAAAAQAAgCiAIQBlgGYAawBZAAAAAEAAgCqAK4BZAAAAAcAAgCsALABsgG0AbYBuAG6AbwBZAAAAAQAAgC6AL4BzgHwAQYCZAAAAAcAAgDCAAgCCgIMAg4CEAISAhQCZAAAAAQAAgDQABYCKQIrAj4CZAAAAAMAAgDYAEACYgKEAmQAAAAEAAIA3gCGApsCvQLOAmQAAAAWAAIA5gDQAtgC4QLjAuoC8QLzAvoCAgMEAwsDFAMWAx0DJAMmAy0DNQM3Az4DRQNHA2QAAAAWAAIAEgFJA1EDWgNcA2MDagNsA3MDewN9A4QDjQOPA5YDnQOfA6YDrgOwA7cDvgPAA2QAAAAHAAIAPgHCA8QDxgPIA8oDzAPOA2QAAAAfAAIATAHQA9ID1APWA9gD2gPcA94D4APiA+QD5gPoA+oD7APuA/AD8gP0A/YD+AP6A/wD/gMABAIEBAQGBAgECgQMBGQAAAADAAIAigEOBDAEUgRkAAAABwACAJABVARWBFgEWgRcBF4EYARkAAAABAACAJ4BYgR5BJsEqgRkAAAABAACAKYBrATABMIE1ARkAAAABwACAK4B1gTYBNoE3ATeBOAE4gRkAAAABAACALwB5AT5BBsFLAVkAAAABwACAMQBLgUwBTIFNAU2BTgFOgVkAAAAFQACANIBPAU+BUAFQgVEBUYFSAVKBUwFTgVQBVIFVAVWBVgFWgVcBV4FYAViBWQFZAAAAAMAAgD8AWYFiAWqBWQAAAAfAAIAAgKsBa4FsAWyBbQFtgW4BboFvAW+BcAFwgXEBcYFyAXKBcwFzgXQBdIF1AXWBdgF2gXcBd4F4AXiBeQF5gXoBWQAAAAEAAIAQALqBf0F/wUSBmQAAAAEAAIASAIUBiYGSAZKBmQAAAAXAAIAUAJMBk4GUAZSBlQGVgZYBloGXAZeBmAGYgZkBmYGaAZqBmwGbgZwBnIGdAZ2BngGZAAAAAcAAgB+AnoGfAZ+BoAGggaEBoYGZAAAAAQAAgCMAogGmga8BtAGZAAAAAcAAgCUAtIG1AbWBtgG2gbcBt4GZAAAAAMAAgCiAuAGAgckB2QAAAADAAIAqAImB0gHagdkAAAABQACAK4CbAd6B5IHpge4B2QAAAAFAAIAuAK6B8gH4Af0BwYIZAAAAAQAAgDCAggIHAgeCDAIZAAAAAUAAgDKAjIIQAhYCGwIfghkAAAABQACANQCgAiOCKYIugjMCGQAAAADAAIA3gLOCPAIEglkAAAAAwACAOQCFAk2CVgJZAAAAAQAAgDqAloJbQmPCaIJZAAAAAUAAgDyAqQJsgnKCd4J8AlkAAAABQACAPwC8gkAChgKLAo+CmQAAAAEAAIABgNAClUKdwqICmQAAAAHAAIADgOKCowKjgqQCpIKlAqWCmQAAAAEAAIAHAOYCqsKrQrACmQAAAAEAAIAJAPCCtUK1wrqCmQAAAAEAAIALAPsCv8KAQsUC2QAAAAHAAIANAMWCxgLGgscCx4LIAsiC2QAAAADAAIAQgMkC0YLaAtkAAAABwACAEgDagtsC24LcAtyC3QLdgtkAAAABwACAFYDeAt6C3wLfguAC4ILhAtkAAAABAACAGQDhguYC7oLzgtkAAAABwACAGwD0AvSC9QL1gvYC9oL3AtkAAAAAwACAHoD3gsADCIMZAAAAB8AAgCAAyQMJgwoDCoMLAwuDDAMMgw0DDYMOAw6DDwMPgxADEIMRAxGDEgMSgxMDE4MUAxSDFQMVgxYDFoMXAxeDGAMZAAAAAMAAgC+A2IMZAyRDGQAAAADAAIAxAOTDJUMwgxkAAAABQACAMoDxAzGDOMM5QwEDWQAAAAFAAIA1AMGDQgNJQ0nDUYNZAAAAAUAAgDeA0gNSg1mDWgNig1kAAAABQACAOgDjA2ODaoNrA3ODWQAAAAGAAIA8gPQDd8N4Q31DfcNCw5kAAAABgACAP4DDQ4cDh4OMg40DkgOZAAAAAEAAQAAAEoOZAAAAAEAAQABAEwOZAAAAAEAAQACAE4OZAAAAAEAAQADAFAOZAAAAAEAAAAAAFIOZAAAAAEAAQAEAFQOZAAAAAEAAAAAAFYOZAAAAAEAAQAFAFgOZAAAAAEAAAAAAFoOZAAAAAEAAQAGAFwOZAAAAAEAAQAHAF4OZAAAAAEAAQAIAGAOZAAAAAEAAQAJAGIOZAAAAAQAAAAAAGQOZg5oDmoOZAAAAAkAAQAKAGwObg52DngOgw6FDpAOkg6gDmQAAAAGAAAAAACiDqQOpg6oDqoOrA5kAAAADAABABMArg61DrcOvg7ADscOyQ7UDtYO3Q7fDuoOZAAAAAIAAAAAAOwO7g5kAAAABQABAB8A8A7yDv0O/w4VD2QAAAAEAAAAAAAXDxkPGw8dD2QAAAAJAAEAJAAfDyEPLw8xDz8PQQ9OD1APYQ9kAAAAAQABAC0AYw9kAAAAAQABAC4AZQ9kAAAAAQABAC8AZw9kAAAAAQABADAAaQ9kAAAAAQABADEAaw9kAAAAAQAAAAAAbQ9kAAAAAQABADIAbw9kAAAAAQABADMAcQ9kAAAAAQABADQAcw9kAAAAAQABADUAdQ9kAAAADwAAAAAAdw95D3sPfQ9/D4EPgw+FD4cPiQ+LD40Pjw+RD5MPZAAAABYAAQA2AJUPlw+gD6IPpA+rD60Prw+3D7kPuw/ED8YPyA/PD9EP0w/bD90P3w/mD+gPZAAAAAEAAQBMAOoPZAAAAAEAAQBNAOwPZAAAAAEAAQBOAO4PZAAAAAEAAQBPAPAPZAAAAAEAAQBQAPIPZAAAAAIAAAAAAAAAAwBkAAAAJgACAAAABwAQABIAFAAWABgAGgAcAB4AIAAiACQAJgAoACoALAAuADAAMgA0ADYAOAA6ADwAPgBAAEIARABGAEgASgBMAE4AUABSAFgAXQBfAGQAAAAEAAIATABhAKoArwCxAGQAAAADAAIAVACzALUAwABkAAAAAwACAFoAwgDEAM8AZAAAADQAAgBgANEA2ADaANwA3gDgAOIA5ADmAOgA6gDsAO4A8ADyAPQA9gD4APoA/AD+AAABAgEEAQYBCAEKAQwBDgEQARIBFAEWARgBGgEcAR4BIAEiASQBJgEoASoBLAEuATABMgE0ATYBPAFBAUMBZAAAAAMAAgDIAEUBjwGRAWQAAAA0AAIAzgCTAZoBnAGeAaABogGkAaYBqAGqAawBrgGwAbIBtAG2AbgBugG8Ab4BwAHCAcQBxgHIAcoBzAHOAdAB0gHUAdYB2AHaAdwB3gHgAeIB5AHmAegB6gHsAe4B8AHyAfQB9gH4Af4BAwIFAmQAAAAMAAIANgEHAgkCCwINAg8CEQITAhUCFwIZAhsCHQJkAAAAAwACAE4BHwIhAiwCZAAAAAMAAgBUAS4CMAI7AmQAAAABAAIAWgE9AmQAAAABAAIAXAE/AmQAAAAOAAIAXgFBAkMCRQJHAkkCSwJNAk8CUQJTAlUCVwJZAlsCZAAAAAsAAgB6AV0CdAJ8ApQCnAKoArACtwK5ArsCvQJkAAAAHQACAJABvwLFAssC0QLZAuAC5gLsAvIC+gIAAwYDDAMSAxoDIAMmAywDMgM6A0ADRgNMA1IDWgNhA2MDZQNnA2QAAAAOAAIAygFpA2sDbQNvA3EDcwN1A3cDeQN7A30DfwOBA4MDZAAAAB0AAgDmAYUDiwORA5cDnwOmA6wDsgO4A8ADxgPMA9ID2APgA+YD7APyA/gDAAQGBAwEEgQYBCAEJwQpBCsELQRkAAAACwACACACLwQxBDMENQQ3BDkEOwQ9BD8EQQRDBGQAAAAOAAIANgJFBEcESQRLBE0ETwRRBFMEVQRXBFkEWwRdBF8EZAAAAAMAAgBSAmEEYwRlBGQAAAApAAIAWAJnBGkEawRtBG8EcQRzBHUEdwR5BHsEfQR/BIEEgwSFBIcEiQSLBI0EjwSRBJMElQSXBJkEmwSdBJ8EoQSjBKUEpwSpBKsErQSvBLEEswS1BLcEZAAAAAMAAgCqArkEuwS9BGQAAAAOAAIAsAK/BMEEwwTFBMcEyQTLBM0EzwTRBNME1QTXBNkEZAAAAAsAAgDMAtsE3QTfBOEE4wTlBOcE6QTrBO0E7wRkAAAAAQACAOIC8QRkAAAADgACAOQC8wT1BPcE+QT7BP0E/wQBBQMFBQUHBQkFCwUNBWQAAAAGAAIAAAMPBR4FNgVNBWUFcQVkAAAADgACAAwDcwV1BXcFeQV7BX0FfwWBBYMFhQWHBYkFiwWNBWQAAAA1AAIAKAOPBZUFlwWZBZsFnQWfBaEFowWlBacFqQWrBa0FrwWxBbMFtQW3BbkFuwW9Bb8FwQXDBcUFxwXJBcsFzQXPBdEF0wXVBdcF2QXbBd0F3wXhBeMF5QXnBekF7gXwBfIF9AX2BfgF/gUDBgUGZAAAAAQAAgCSAwcGUAZVBlcGZAAAAC0AAgCaA1kGYgZkBmYGaAZqBmwGbgZwBnIGdAZ2BngGegZ8Bn4GgAaCBoQGhgaIBooGjAaOBpAGkgaUBpYGmAaaBpwGngagBqIGpAamBqgGqgasBrEGswa1BrcGuQa7BmQAAAAFAAIA9AO9BtQG7AYDBxsHZAAAAAMAAgD+Ax0HHwchB2QAAAApAAIABAQjByUHJwcpBysHLQcvBzEHMwc1BzcHOQc7Bz0HPwdBB0MHRQdHB0kHSwdNB08HUQdTB1UHVwdZB1sHXQdfB2QHZgdoB2oHbAduB3AHcgd0B3YHZAAAAAEAAgBWBHgHZAAAAAMAAgBYBHoHfAd+B2QAAAA0AAIAXgSAB4cHiQeLB40HjweRB5MHlQeXB5kHmwedB58HoQejB6UHpwepB6sHrQevB7EHswe1B7cHuQe7B70HvwfBB8MHxQfHB8kHywfNB88H0QfTB9UH1wfZB9sH3QffB+EH4wflB+sH8AfyB2QAAAAEAAIAxgT0Bz0IQghECGQAAAArAAIAzgRGCE8IUQhTCFUIVwhZCFsIXQhfCGEIYwhlCGcIaQhrCG0IbwhxCHMIdQh3CHkIewh9CH8IgQiDCIUIhwiJCIsIjQiPCJEIkwiVCJcImQibCJ0InwihCGQAAAAOAAIAJAWjCKUIpwipCKsIrQivCLEIswi1CLcIuQi7CL0IZAAAAAcAAgBABb8IzAjjCPII/wgWCSUJZAAAAA4AAgBOBScJKQkrCS0JLwkxCTMJNQk3CTkJOwk9CT8JQQlkAAAACAACAGoFQwlFCUcJSQlLCU0JTwleCWQAAAADAAIAegVgCWIJcQlkAAAACAACAIAFcwl1CXcJeQl7CX0JfwmOCWQAAAADAAIAkAWQCZIJoQlkAAAAAQACAJYFowlkAAAACAACAJgFpQmnCakJqwmtCa8JsQnACWQAAAADAAIAqAXCCcQJ0wlkAAAACAACAK4F1QnXCdkJ2wndCd8J4QnjCWQAAAABAAIAvgXlCWQAAAAIAAIAwAXnCekJ6wntCe8J8QnzCQIKZAAAAAgAAgDQBQQKBgoICgoKDAoOChAKHwpkAAAABwACAOAFIQowCkgKVApjCnsKhwpkAAAADgACAO4FiQqLCo0KjwqRCpMKlQqXCpkKmwqdCp8KoQqjCmQAAAABAAIACgalCmQAAAABAAIADAanCmQAAAALAAIADgapCqsKrQqvCrEKswq1CrcKuQq7Cr0KZAAAAA4AAgAkBr8KwQrDCsUKxwrJCssKzQrPCtEK0wrVCtcK2QpkAAAAAwACAEAG2wrdCt8KZAAAAAQAAgBGBuEK4wrlCucKZAAAAA4AAgBOBukK6wrtCu8K8QrzCvUK9wr5CvsK/Qr/CgELAwtkAAAADgACAGoGBQsHCwkLCwsNCw8LEQsTCxULFwsZCxsLHQsfC2QAAAAHAAIAhgYhCy4LRQtUC2ELeAuHC2QAAAAOAAIAlAaJC4sLjQuPC5ELkwuVC5cLmQubC50LnwuhC6MLZAAAAAUAAgCwBqULvAvUC+sLAwxkAAAAAwACALoGBQwHDAkMZAAAACkAAgDABgsMDQwPDBEMEwwVDBcMGQwbDB0MHwwhDCMMJQwnDCkMKwwtDC8MMQwzDDUMNww5DDsMPQw/DEEMQwxFDEcMSQxLDE0MTwxRDFMMVQxXDFkMWwxkAAAAAgACABIHXQxfDGQAAAABAAIAFgdhDGQAAAABAAIAGAdjDGQAAAADAAIAGgdlDGcMcgxkAAAAAwACACAHdAx2DIEMZAAAAAMAAgAmB4MMhQyQDGQAAAABAAIALAeSDGQAAAABAAIALgeUDGQAAAABAAIAMAeWDGQAAAA4AAIAMgeYDJoMnAyeDKAMogykDKYMqAyqDKwMrgywDLIMtAy2DLgMugy8DL4MwAzCDMQMxgzIDMoMzAzODNAM0gzUDNYM2AzaDNwM3gzgDOIM5AzmDOgM6gzsDO4M8AzyDPQM9gz4DPoM/Az+DAANAg0JDQsNZAAAAAUAAgCiBw0NDw0RDRgNGg1kAAAABQACAKwHHA0eDUsNTQ1gDWQAAAAFAAIAtgdiDWQNkQ2TDaYNZAAAAAcAAgDAB6gNqg3HDckN6A3qDQEOZAAAAAcAAgDOBwMOBQ4iDiQOQw5FDlwOZAAAAAEAAgDcB14OZAAAAAMAAgDeB2AOYg5vDmQAAAAFAAIA5AdxDnMOdQ58Dn4OZAAAAAUAAgDuB4AOgg6EDosOjQ5kAAAAIgACAPgHjw6RDpMOlQ6XDpkOmw6dDp8OoQ6jDqUOpw6pDqsOrQ6vDrEOsw61DrcOuQ67Dr0Ovw7BDsMOxQ7HDskOyw7NDs8O0Q5kAAAABwACADwI0w7VDvEO8w4VDxcPKw9kAAAABwACAEoILQ8vD0sPTQ9vD3EPhQ9kAAAACAACAFgIhw+WD5gPrA+uD8IPxA/gD2QAAAAIAAIAaAjiD/EP8w8HEAkQHRAfEDsQZAAAAAMAAgB4CD0QPxBMEGQAAAACAAIAfghOEFAQZAAAAAIAAgCCCFIQVBBkAAAAAwACAIYIVhBYEGUQZAAAAAMAAgCMCGcQaRBwEGQAAAADAAIAkghyEHQQexBkAAAAAwACAJgIfRB/EIYQZAAAAAMAAgCeCIgQihCREGQAAAADAAIApAiTEJUQnBBkAAAAAwACAKoInhCgEKcQZAAAAAEAAgCwCKkQZAAAACMAAgCyCKsQrRCvELEQsxC1ELcQuRC7EL0QvxDBEMMQxRDHEMkQyxDNEM8Q0RDTENUQ1xDZENsQ3RDfEOEQ4xDlEOcQ6RDrEO0Q7xBkAAAAIwACAPgI8RDzEPUQ9xD5EPsQ/RD/EAERAxEFEQcRCRELEQ0RDxERERMRFREXERkRGxEdER8RIREjESURJxEpESsRLREvETERMxE1EWQAAAAjAAIAPgk3ETkROxE9ET8RQRFDEUURRxFJEUsRTRFPEVERUxFVEVcRWRFbEV0RXxFhEWMRZRFnEWkRaxFtEW8RcRFzEXURdxF5EXsRZAAAACUAAgCECX0RhhGIEYoRjBGOEZARkhGUEZYRmBGaEZwRnhGgEaIRpBGmEagRqhGsEa4RsBGyEbQRthG4EboRvBG+EcARwhHEEcYRyBHOEdMRZAAAAAMAAgDOCdURHBIiEmQAAAAWAAAAAAAkEiYSKBIqEiwSLhIwEjISNBI2EjgSOhI8Ej4SQBJCEkQSRhJIEkoSTBJOEmQAAAAsAAEAAABQElISVBJWElgSWhJcEl4SYBJiEmQSZhJoEmoSbBJuEnASchJ0EnYSeBJ6EnwSfhKAEoIShBKGEogSihKMEo4SkBKSEpQSlhKYEpoSnBKeEqASohKkEqYSZAAAAAMAAAAAAKgSqhKsEmQAAAAEAAEALACuErASshK7EmQAAAABAAAAAAC9EmQAAAABAAEAMAC/EmQAAAADAAAAAADBEsMSxRJkAAAABAABADEAxxLJEssS1BJkAAAAAQAAAAAA1hJkAAAAAwABADUA2BLaEuESZAAAAAEAAAAAAOMSZAAAAAMAAQA4AOUS5xLuEmQAAAABAAAAAADwEmQAAAADAAEAOwDyEvQS+xJkAAAAAwABAD4A/RL/EgYTZAAAAAIAAAAAAAgTChNkAAAAAwABAEEADBMOExATZAAAAAEAAQBEABITZAAAAAYAAAAAABQTFhMYExoTHBMeE2QAAAANAAEARQAgEyITKhMsEzcTORNEE0YTVBNWE14TYBNpE2QAAAAIAAAAAABrE20TbxNxE3MTdRN3E3kTZAAAABAAAQBSAHsTghOEE4sTjROUE5YToROjE6oTrBO3E7kTwxPFE9ITZAAAAAQAAAAAANQT1hPYE9oTZAAAAAkAAQBiANwT3hPpE+sTARQDFAoUDBQXFGQAAAAGAAAAAAAZFBsUHRQfFCEUIxRkAAAADQABAGsAJRQnFDUUNxRFFEcUVBRWFGcUaRRzFHUUghRkAAAAAQABAHgAhBRkAAAAAgAAAAAAhhSIFGQAAAAEAAEAeQCKFIwUjhSYFGQAAAABAAEAfQCaFGQAAAABAAEAfgCcFGQAAAADAAAAAACeFKAUohRkAAAAAwABAH8ApBSmFLAUZAAAACQAAAAAALIUtBS2FLgUuhS8FL4UwBTCFMQUxhTIFMoUzBTOFNAU0hTUFNYU2BTaFNwU3hTgFOIU5BTmFOgU6hTsFO4U8BTyFPQU9hT4FGQAAABEAAAAAAD6FPwU/hQAFQIVBBUGFQgVChUMFQ4VEBUSFRQVFhUYFRoVHBUeFSAVIhUkFSYVKBUqFSwVLhUwFTIVNBU2FTgVOhU8FT4VQBVCFUQVRhVIFUoVTBVOFVAVUhVUFVYVWBVaFVwVXhVgFWIVZBVmFWgVahVsFW4VcBVyFXQVdhV4FXoVfBV+FYAVZAAAAAUAAQCCAIIVhBWGFYgVjxVkAAAAAQAAAAAAkRVkAAAAAwABAIcAkxWVFZwVZAAAAAIAAAAAAJ4VoBVkAAAAAgAAAAAAohWkFWQAAAACAAAAAACmFagVZAAAAAIAAAAAAKoVrBVkAAAAAwABAIoArhWwFbIVZAAAAAMAAQCNALQVthW4FWQAAAADAAEAkAC6FbwVvhVkAAAAAwABAJMAwBXCFcQVZAAAAAMAAQCWAMYVyBXPFWQAAAAJAAIAAAAAAAIABAAGAAgACgAMAA4AEABkAAAAEwACABIAEgAUABYAGAAaABwAHgAgACIAJAAmACgAKgAsAC4AMAAyADQANgBkAAAABQACADgAOABHAFoAYQBjAGQAAAAFAAIAQgBlAHQAhwCOAJAAZAAAAAkAAgBMAJIAlACWAJgAmgCcAJ4AoACiAGQAAAADAAIAXgCkAKYAqABkAAAAGQACAGQAqgCsAK4AsACyALQAtgC4ALoAvAC+AMAAwgDEAMYAyADKAMwAzgDQANIA1ADWANgA2gBkAAAACwACAJYA3ADeAOAA4gDkAOYA6ADqAOwA7gDwAGQAAAAFAAIArADyAAEBFAEbAR0BZAAAAAUAAgC2AB8BLgFBAUgBSgFkAAAAAQACAMAATAFkAAAAAQACAMIATgFkAAAADQACAMQAUAFSAVQBVgFYAVoBXAFeAWABYgFkAWYBaAFkAAAABQACAN4AagF5AYkBlAG2AWQAAAAFAAIA6AC4AccB1wHiAQQCZAAAAA0AAgDyAAYCCAIKAgwCDgIQAhICFAIWAhgCGgIcAh4CZAAAAAUAAgAMASACLwIxAjwCXgJkAAAAAQACABYBYAJkAAAADQACABgBYgJkAmYCaAJqAmwCbgJwAnICdAJ2AngCegJkAAAAAwACADIBfAKIAooCZAAAAB8AAgA4AYwCkgKUApYCmAKaApwCngKgAqICpAKmAqgCqgKsAq4CsAKyArQCtgK4AroCvAK+AsACwgLEAsYCyALKAswCZAAAAA0AAgB2Ac4C0ALSAtQC1gLYAtoC3ALeAuAC4gLkAuYCZAAAAAEAAgCQAegCZAAAAAEAAgCSAeoCZAAAAA0AAgCUAewC7gLwAvIC9AL2AvgC+gL8Av4CAAMCAwQDZAAAAAcAAgCuAQYDEAMYAyEDKwM4A1oDZAAAAA0AAgC8AVwDXgNgA2IDZANmA2gDagNsA24DcANyA3QDZAAAAAkAAgDWAXYDeAN6A3wDfgOAA4IDhAOGA2QAAAADAAIA6AGIA4oDjANkAAAAFwACAO4BjgOQA5IDlAOWA5gDmgOcA54DoAOiA6QDpgOoA6oDrAOuA7ADsgO0A7YDuAO6A2QAAAAHAAIAHAK8A8YDzgPXA+ED7gMQBGQAAAADAAIAKgISBB4EIARkAAAAHwACADACIgQoBCoELAQuBDAEMgQ0BDYEOAQ6BDwEPgRABEIERARGBEgESgRMBE4EUARSBFQEVgRYBFoEXAReBGAEYgRkAAAAAQACAG4CZARkAAAAAQACAHACZgRkAAAACQACAHICaARqBGwEbgRwBHIEdAR2BHgEZAAAAAYAAgCEAnoEfAR+BIAEggSEBGQAAAAZAAIAkAKGBIgEigSMBI4EkASSBJQElgSYBJoEnASeBKAEogSkBKYEqASqBKwErgSwBLIEtAS2BGQAAAANAAIAwgK4BLoEvAS+BMAEwgTEBMYEyATKBMwEzgTQBGQAAAAHAAIA3ALSBNwE5ATtBPcEBAUmBWQAAAANAAIA6gIoBSoFLAUuBTAFMgU0BTYFOAU6BTwFPgVABWQAAAAFAAIABANCBVAFXwVvBY4FZAAAAAUAAgAOA5AFngWtBb0F3AVkAAAABQACABgD3gXsBfsFCwYqBmQAAAACAAIAIgMsBjoGZAAAAAEAAgAmAzwGZAAAAAUAAgAoAz4GTAZbBmsGigZkAAAAAgACADIDjAaaBmQAAAAFAAIANgOcBrIGwQbIBugGZAAAAAEAAgBAA+oGZAAAAAUAAgBCA+wG+gYJBxkHOAdkAAAAAgACAEwDOgdIB2QAAAAHAAIAUANKB1QHXAdlB28HfAeeB2QAAAANAAIAXgOgB6IHpAemB6gHqgesB64HsAeyB7QHtge4B2QAAAABAAIAeAO6B2QAAAABAAIAegO8B2QAAAABAAIAfAO+B2QAAAANAAIAfgPAB8IHxAfGB8gHygfMB84H0AfSB9QH1gfYB2QAAAACAAIAmAPaB/oHZAAAAA0AAgCcA/wH/gcACAIIBAgGCAgICggMCA4IEAgSCBQIZAAAAA0AAgC2AxYIGAgaCBwIHgggCCIIJAgmCCgIKggsCC4IZAAAAAcAAgDQAzAIOghCCEsIVQhiCIQIZAAAAA0AAgDeA4YIiAiKCIwIjgiQCJIIlAiWCJgImgicCJ4IZAAAAAcAAgD4A6AIqgiyCLsIxQjSCPQIZAAAAAMAAgAGBPYI+Aj6CGQAAAAfAAIADAT8CP4IAAkCCQQJBgkICQoJDAkOCRAJEgkUCRYJGAkaCRwJHgkgCSIJJAkmCSgJKgksCS4JMAkyCTQJNgk4CWQAAAAGAAIASgQ6CTwJRwlOCVAJWglkAAAACAACAFYEXAleCWgJaglxCXMJdQl/CWQAAAACAAIAZgSBCYMJZAAAAAMAAgBqBIUJhwmVCWQAAAADAAIAcASXCZkJmwlkAAAABQACAHYEnQmfCawJrgnCCWQAAAACAAIAgATECcYJZAAAAAcAAgCEBMgJygnMCc4J0AnSCdQJZAAAAAcAAgCSBNYJ2AnaCdwJ3gngCeIJZAAAAAMAAgCgBOQJ5gkTCmQAAAADAAIApgQVChcKRApkAAAABQACAKwERgpICmUKZwqGCmQAAAAFAAIAtgSICooKpwqpCsgKZAAAAAMAAgDABMoKzArSCmQAAAAEAAIAxgTUCtYK3AreCmQAAAAHAAIAzgTgCuIK5ArmCugK6grsCmQAAAAEAAIA3ATuCvAK8gr0CmQAAAAFAAIA5AT2CvgKFAsWCzgLZAAAAAUAAgDuBDoLPAtYC1oLfAtkAAAACQACAPgEfguHC5ELkwumC6sLrQvBC8MLZAAAAAgAAgAKBcULzgvYC9oL7QvyC/QLCAxkAAAAAwACABoFCgwMDBUMZAAAAAIAAgAgBRcMGQxkAAAAAgACACQFGwwdDGQAAAADAAIAKAUfDCEMLQxkAAAABQACAC4FLwwxDDMMNQw3DGQAAAACAAIAOAU5DDsMZAAAAAoAAgA8BT0MPwxBDEMMRQxHDEkMSwxNDE8MZAAAAAoAAgBQBVEMUwxVDFcMWQxbDF0MXwxhDGMMZAAAAAoAAgBkBWUMZwxpDGsMbQxvDHEMcwx1DHcMZAAAAAQAAgB4BXkMewx9DH8MZAAAAAQAAgCABYEMgwyFDIcMZAAAAAIAAgCIBYkMiwxkAAAABAACAIwFjQyPDJEMkwxkAAAAAgACAJQFlQyXDGQAAAAEAAIAmAWZDJsMnQyfDGQAAAAEAAIAoAWhDKMMrAyuDGQAAAACAAEAAACwDLIMZAAAAAIAAAAAALQMtgxkAAAABQABAAIAuAy6DLwMxgzIDGQAAAAGAAAAAADKDMwMzgzQDNIM1AxkAAAACgABAAcA1gzYDNoM3AzeDOAM4gzkDOYM6AxkAAAAAgAAAAAA6gzsDGQAAAAFAAEAEQDuDPAM8gz4DPoMZAAAAAIAAAAAAPwM/gxkAAAAAwABABYAAA0CDQsNZAAAAAIAAAAAAA0NDw1kAAAAAwABABkAEQ0TDRwNZAAAAAIAAAAAAB4NIA1kAAAAAwABABwAIg0kDS0NZAAAAAMAAQAfAC8NMQ06DWQAAAADAAEAIgA8DT4NRw1kAAAAAQABACUASQ1kAAAABAAAAAAASw1NDU8NUQ1kAAAACQABACYAUw1VDV0NXw1qDWwNdw15DYcNZAAAAAYAAAAAAIkNiw2NDY8NkQ2TDWQAAAANAAEALwCVDZwNng2lDacNrg2wDbsNvQ3EDcYN0Q3TDWQAAAACAAAAAADVDdcNZAAAAAYAAQA8ANkN2w3mDegN/g0ADmQAAAAEAAAAAAACDgQOBg4IDmQAAAAKAAEAQgAKDgwOGg4cDioOLA45DjsOTA5ODmQAAAACAAEATABQDlIOZAAAAAIAAAAAAFQOVg5kAAAABAABAE4AWA5aDlwOZA5kAAAAAgABAFIAZg5oDmQAAAACAAEAVABqDmwOZAAAAAIAAAAAAG4OcA5kAAAABQABAFYAcg50DnYOfg6ADmQAAAASAAAAAACCDoQOhg6IDooOjA6ODpAOkg6UDpYOmA6aDpwOng6gDqIOpA5kAAAAAgABAFsApg6oDmQAAAANAAAAAACqDqwOrg6wDrIOtA62DrgOug68Dr4OwA7CDmQAAAAIAAEAXQDEDsYOyA7RDtMO1Q7XDtkOZAAAAAIAAAAAANsO3Q5kAAAAAwABAGUA3w7hDuoOZAAAAAIAAAAAAOwO7g5kAAAAAgAAAAAA8A7yDmQAAAACAAEAaAD0DvYOZAAAAAIAAAAAAPgO+g5kAAAAAgABAGoA/A7+DmQAAAACAAEAbAAADwIPZAAAAAIAAQBuAAQPBg9kAAAAAgABAHAACA8KD2QAAAADAAEAcgAMDw4PFw8=","textureAtlases":["iVBORw0KGgoAAAANSUhEUgAABAAAAAQACAYAAAB/HSuDAAWnJElEQVR4Aez9fax17XbWh738g9TTor4c8LFFXB38kZ764ELkCFNio1jgYooTlZNAwWBBDm4+wMd8WGB8qGgFkfMat0GYxC3BVkNIiGkJNLYDqkREU39UitTSAzIVLlVtg6oUIxUVCVQJ+zzdv732b69rjjXuOedae+397L2fe0nzucYY99e4r3vcc84x11z7ee+9+ZkMTAYmA5OBycBkYDIwGZgMTAYmA5OBycBkYDIwGZgMTAYmA5OBycArYuBDd3MZIcWWvaJpz6lMBp6EAffOtfBJnJ6DTAbWGPhZP+tnvZnHu8vBWmw8tOy//pGPfO5HvuBLvvrjX/ql3/xLfsHP/wsf/bzP+2seH/7cz//yh/Y/208GJgOTgcnAZOC1M2DSwTyVK57Lge3PbTfrTwZeKwO5J5TFtTnvqVPbZ5uUa72pTwYejYGZ/L+7yT9r/wiB9aEv/tjHPknC/+v/u//NN7/6Qz/79kDm+B//937eZz2o83mf93kffQQfZpeTgcnAZGAyMBl4ZxgwidjCd4aQOdHJwJUY2LOnturUclzTVt1Me8q13tQnAw9iYD4AmA8AHhRA0Zhv+vmGn6Q/k/1v+bX/rTcc//Pf8EW3x7/1K37ez3DwIID6+TbA7VsDP/cjH9DXTdfz3Bf8TnEyMBmYDEwG3g0G8uKnvBdHDNl+VD7tk4F3kYHcFymvcWE9kbrK4lr7LLO+mGVTngw8GgPzAcB8APDQ4OJbfL/xJ6k3uTfp/1//tv/2SfLvQwCQhwU8CPjITeKP7FsD2L7wox/9xEP9m+0nA5OBycBkYDLw2hggYTBpSNSeNudebeqWT5wMvAsM7Il764xQnmo59mrb0u0r0TbaUk/Z8omTgbMYmA8A5gOAswKmVOY3/iTqJv4m9iT99eANAMuVRdqT/HcHDxduhp3nu8L9VCcDk4HJwGTgdTGQFzrlDjsbTGhfk18XY3M2k4GHMdDtmbRl79pBD8rTnnrK1sFWP1mWcq039cnA1Rh4lx4AfPjDH77/g4edrK3ia+boIYHEt/Mk7L7ij0xCXxN/dZN90YcBiTwIyMMHArwd8BBfZ9vJwGRgMjAZmAy8BAa6BEAbmDLz0VaxK9OWWGX0+ZkMvDYG3DfnzMs2I6SvURl2yxxTvWL2Y91E66dNea3MOhMnAycMvLbktibv5+ryYTv0lC1/LXgSEBsGXvcn8f+lv/yXfRuJugm/DwH+/Df94uEDAB4EUN8HAH7rD/IQQN2kv+L8g4EbizOLJwOTgcnAZODFMlBv5NU7TBtyHhCgrpyIPD+TgdfMgPtjNMdarl6R9tiq/VLd/kA/9lX1aqc8bSnbduJkYDcDryGRNUG/BGmT7fbo+VDAti+Vxz2Bwh/m4y/7/+Kv+m3/0a/+l779DQcJPwk9CX/K6B5+81+RBwAm+3uTfx4GzLcA9qzWrDMZmAxMBiYDL4mB7kZeG+jBnDq75SPs2lUb+vxMBt41BtxP3bwtuybaF+MhV33Nj66s2uxPrOVTnwzcM/ASE1eT7jU0kX8omuznWClbnviSOL0PhEbgr/Nn0m/y/7Vf9ZW3yf9f/jd/xe23+STnyHmM3gTI5N9X/30YUL/x7/T8HwMal6dpMjAZmAxMBiYDL5IBb9orMhlsDznsIxE5P46btilPBl4TA2sxbpnIvJXXcK1s1Idtshw5P1mns2d5yl3dtJ0rZ98pn9vPrP/MGHhJyWom2V0SbrJvPfXHwBxDGayytueKo3DkFf9/6bd+1+23/Sb+4Fd+zbfefuNvss+3/yT76mL91h+dhN+k3uQ/bZat4XwLYLRi0z4ZmAxMBiYDr4UBb7TBKms7F+Gm9pU25PmZDLxrDLgnmLdyh2lDPkcf9W0fXXlny/pZjnztTx0r+8+ylLPOlJ85A881MdWvLtGn7KFJ/S/4p/6pB/eRPqRPyonIz/HowtPknwcA+RAA2W//f/A7v/r2238eAJj0J9YHAJnoZ/K/9u1/V8b/OND5PG2TgcnAZGAyMBl4iQx4A72GlF3rgCPHeol8TZ8nA5WBLp7T1slpy/60d7hlozzrjGTGy7IcX9ly9cRapl7RNto7fa1sT/2ujraJz5iB55iUZuKcDwAy4d6SSfCvfWyNmeU5hyo/J85raPJbfxL9T/7uP3t75Lf/yCTlfuPPN/W80p+Jv3L+BCBf++eBQT4AWPu2f1T28Y9//J+pfk99MjAZmAxMBiYDL50Bb8bB7eP9999/L4/1NnBjn52sDZyfycC7wEDuN+ab+l657qm9/WS9lB0Xmx9tonaws1m+VmadNcz2KdNGXbSf1FO2fOIzYeA5JaM1USah1lblTLavnejv7S992JKdx3PjO8OQP/ZHkk/y/43f8hcX3/77+j8PAPh2n6SeRN6HAST+Katbl2Setpn8d9/wm/RnWcqUf/xLv/Sb0+8pTwYmA5OBycBk4CUy4A1yInKna//QfdJPvXwAoHxof6y/1OEp+3+JvE2fJwOXMDCK+2pPHbk7GH+rnnVqPe0gnyw/WHrbWlntQ31v/9avmO2rrD+ibdUnPmMGnktCaoJvoryVUFO+N1H/oi/6ojcPOfaMs+avc+rwbfOfocmr/7/xX//Tt8l/fQBw+/r/137tbdJPUs83+fn7f5L/rQcAmfwj18Te5H8Lf8kv+Pl/If2e8mRgMjAZmAxMBl4DA95Ag6eHCf4IaWNZ135pg68c7zXwN+cwGagMGOPVjp5lyokpZ33s9ajl6tlHyl05Nj7WO2hHXbtY66bdtg/B7K+TtYmOpS5qBztblk/5iRh42wloTYp9EDBKqNeS8Yck+ee0XfOBspHvObfnwDs+RJh96J/+yn/tr/vtP1hf/+f3/yTuPAAgeecw8e+Qer4BQN36AKBL9POhwEi+/TsA3OPMz2RgMjAZmAxMBl4gA94EJ1YZ/XiY2J+D2X4pQ5njvUD6psuTgTZ+M6ZTli5tInblNaSsHrVtLc/+RvKoD+32mXqV1UE+OdaavlZmH9ZRF7WD+cnyLfuobrab8iMy8DYTURPi7iFATaJHSfeexP0XffwXvbnkoG/abY0x8q3OQd35On/xbayFocVr9fntf/cAgIScV/9J6knmkU38TfZBbNbhLQHaceQDgEzueRBQ9e7hQNrmfwfoyk2cDEwGJgOTgZfOgDfD4OlxTtJvXfpB7vpb2uAux0efn8nAu8CAcc9clU/334GJzr7XZv85hrbElK3b2SxzfOtoR1/77KlnnQ7ThuzBmLUs/bAsbSM5647kUdtp38HA20g6TYBFE+MOu+R6LSG/JNE/t83a+J2/3bxM+kW5eOr1MET49p/X/j1GDwBM/EnYfRiQyX/KJP8m7fUBgPZEHwJUpI4263/hRz/6CX2fOBmYDEwGJgOTgZfGgDe14PgwoW+QP9xDkl8R2+Lo+4cvx31p3E1/JwN7GMg9Rv2qa0t7ylmeduQ8ar0sS7nWqzp1tYmdzbLbyjf/WCft2kY4qkv9UZuRPfuq8h6dOvPzxAw8dcLZJbxdgtwl0l3ivZW8f9mXfdmbhx5bY3R+df5380zbU68F4xlu/Mbf5B/sHgCQfPsAQDkT/ipn0n7Nb/8Ze/4hQFdu4mRgMjAZmAy8ZAbyptqb7wPWRP5Gz2QfOY9F0l/bLhMWx4G3HP8l8zh9nwzAgPE8YiPLlTvE5mG/6mK1q1e0fodrdS2jnXLFLFOudW4b3/yzVp5lXXvLQQ/r1bJqR/dj3aprF2s5epalbN2JZzDwNpLOTHqr3CXOXYI9Ssr3JPv/3Fd8xe1DgYp72lJnNHbnZzefOmfWAFviU62LoZKv/48eAJDQ+wBAuSb9qfsAwLo+BNDut/lg2lK2TrXNBwCu3MTJwGRgMjAZeEkMeOMKVlnb8Y/5lUQ+E/6R3D4ION60H8c4jv+S+Ju+TgbOZcB9Zjv3ALpliVVOvbbJMuTHOByz9q29oj5Vu7rlHTpG1tU2wqyrLNpGHdzzoV1+qm7ZyG75xAEDT5VoZoJbZRPimizXhHqUeK8l7iT51zhGY4x8qr7XuTnnDp/yQYBhsfUA4Cu/5ltvk3STeJGfAXD4YIAHAP40wKQdtL5/E2CU2GuvDwXSjvyRn/uRD/R94mRgMjAZmAxMBl4qA94gH7Ek/ST0o2R/ZL/gIcC8kX6pEfTu+l1j9lLddmA9YLfa3pauLyJ+dLK2ita/bXTzT+rKHWK75Kjjn6NTl4/+HLSjXu2WT9zJwFM8AMiE3+Q2E9+aHNfkuUuyu4R8b6L/K7/6q28fCoxwTz/d+J2fdS51rsmDshw9xdoYJuc+AMik3uS+PgjwbwBkXR8K1IQ+9a5Otc0HAK7cxMnAZGAyMBl4SQx44+oNNb4rt9/8j5L8NfsZDwAc/yVxOH199xhw31wy89pWPTFlxljTKXvOR/U/55J+Wy9t15BH/aYdmU/6lnrKtQ5lfixDT9nyiQMGniLJzAcAJrliTYhrwlyT6pp4byXrJPnXONbGqT5Vn+uc6pzlouJTPAgwLOoDAH4GkP8NYH0DgITdxN9v/1PnTQB06q09ADCxF/NBgG2rDX3+BMCVmzgZmAxMBiYDL5UBbliXx823/Zm8d0n+533e530Ue8VaN/u5l+t4y5vmeQP9UiPp3fY743ZLtnwNswz5pR9ER85J/Snm1Y2VNuUOsdVPnUctR7dOVzZtdww85gMAElqT2JrcomciXJPkmkTXJHuUkK8l+1/7tV97+zAArAftsnytn9HY1cc6hzrHnH/HT/L3WOvkRvh13/DtP5Z/BBCZPwzoQ4D6ACCT/TXZ5N06o0TfeuJWvfkAwJWbOBmYDEwGJgMvhQFvTL3xxm/lk2//a0KvTuLfHZYn3if+7989WMjxlvJL4XD6ORm4FgO5H+kz9ZQtO+7V5d552/Y1/9bKLvObc8nl89cfMX3A5gc7nxF2ZbcN5j/7GHisxDKT15rcZuKLnIlxTZprUt0l36NkvSb5D9FHY3T+VJ/rnHK+lYvKVfL4GGtllJzzAMBX/U3qQb/xTxsyiTw/BdBeE/uq+wAgsavzxR/72Cf1feJkYDIwGZgMTAZeEgN5U3u4ATZBv8NM4pW7pL/arJv4Xun7hqjDmOs31y+Jz+nr62LA/XGNWdnXJZhtkOfhuQQukK/PCWsuz52sDayfXC/LtI107e8cPkZSmUlrTWhrwpvJcCbKNYmuiXaXkI8S/F//L3/izSXHqD/s3fjVxzqHnF/Ou3JSOUs+r71eBvwv/qrf9h+d8wYASblJfYeUd3W6ZH6U7K/V/cgXfMlX6/vEycBkYDIwGZgMPGcGvAlNRD4e3ljfYSbwyDXRX9Nr29sb9ew/xz3Iz5m76du7wYB7Y2u2Xb20pTzqq9ZRBz1oq/x4yL7Mcdyn2JRrnaz/mLLjph8jW1fnct+S+07W1iE2PqxZfrb0rPtOyNdOKGuymslsTXQzCc7kOBPnmlTXxLtL0reS/d/8m7/u9oEA2Mlr7bvxqk/V55xPzjPnX7lJ3pRZK/m91roZ5Hyj/snf/Wff+BAAmb8L4E8AQBL1LtnvbD4AoE0+CKhJfdXzYYCydUTs3N/o+8TJwGRgMjAZmAy8FAa8ET0mFeXmuSbwo2T/F/7CX/ixrqy2v71g5hj9jTn86dtL4XL6+boZeEg8ZltlEdaU15Cyhx0mzGv91L2Z+kimP8o6dCzL1ffgaLy99vRH+RI/lr7eTLNdr7p2WQ+Zj3UOWv/vnjp9yxdsvVYiaT8mqCatYia4mfgiZ1KcyXJNpDPRrol4l7Sb4F8Du/6rD+lf9T3nlfOtXCRPcic+5gMA7iH4zT+Jv0d9APC1X/WVJ8l8l/xjy2Qd2XraRZN8MG0pZx3k+T8AvOATznR9MjAZmAy8wwx4owkej7i5rsl7l+CT+OdBHfSPf/zj/4z1az/vxRiLsY83yPr2Di/PnPpbZmAUgyP7HndrW/U1pCzL1S/DuvdSf0zZc0yOgS115Fqvq1PbnKs7xsORNc+1UdemDtaPdcRajr5W1tV/sTYT92sgiapJqkkrmEltJryZCGeCXJPnTKwz6e6S8i7Z/+2//ZO33/SD5x5df9246Vf6W+eS88z5Jy/JV/KoLMfXWLMMXH4GwEOAevgWwFd94nd89ld/6Ge3bwGQsGeSnw8Balkm9GuJftZLmfub9HvKk4HJwGRgMjAZeO4M5I0l8uGIG+matJvMJ2bir0z513zN1/yar/iKr/hK69a+3otx7sfWh3fopve5B8n0756B3C/3xhCyvJPTRrPUOxmb9kTtlyN7j747zH15qWzfa+331Flrf1PGOeW9O1RGP/uovqCfd9xUb9eq2u037ch8KONT8WB9B/69RhJJYmpSapIqZjKbSW4mv5kUZ8KciTSySXZNwGuSvpXk/87f8W/cPggAPWijfdS+joNefdHH6nvOK+ebPCQ/yZtcJs/XWDf6yBDnd/Uk+6MHAJTxFgDJuAm+yT1YZW3a8wFBJvRVpr62lLHNb/9zxaY8GZgMTAYmAy+BgbzJ9Kb0gHEDnUm7iXyiCX+Hn/70H/iD+QYA7bK/k5v05Q03HOrjS+Bz+vh6GdiKw63yZMa6ImXKYMqWpc06lyP7270We/1kPz5VGb6cMVaeQzqZvrDv7jPHTxmf5Ol8vGl6spZbNsrf6c+1EslMTk1YM4nN5DaT3kyGM0nOBNqkGsyEuybkXeJugv8Q7PqtY6df6W/OI+eX804+kqfkT05FH7g8dP1q8PMWwNpDAP47QBJxk/pE5Dyox/8AYJ3uAQBlo2Rfu3jz3x79tdtzTHV66pOBycBkYDIwGXgBDCyTC2567456c52JP3KX9GOj7BOf+MRv+OCDD75D3ba1T8e6xdObbOnTR/WJk4GnYGAUdyN7+pR1Us46yF2ZtsQqo5933O3r+3bo9KH9Ajwr0b6gf3xzjHru2KvXPtA3D3k5l+MbQm85PbRTFl0vdD7qIB9xr3zb6DX989AEskv8TVIzgTWxzWQ3k+BMjjNpNpnOBDuT75qcjxL93/t7f8+bc45RP9jrmOlP+qnvOZ+cZ84/eZGr5E9OE6/xEKDGMnv8n/7Kf+2v73kLIJN9E3ltJu3oWw8BrFvRPrV/4Uc/+onq79QnA5OBycBkYDLwXBnwJjMR+XDEzXHeYJvAryX+fNvvQ4E/+d3f/T2f+tSnvinbKWe/ixtxfTjeCOvjc+Vy+jUZSAa24tXyivRRbZ2OLe3q+5C9TfvY43tk9iv1Osy9nOXas92esayf7avNsnMxx6dt6rvlA//7+D6te0P/3Xn2gOodYuPjeh+0V/7vQx8AmIRmYoqcyasJbSa5mfxmUmyybPIMZlJtsl2T8JqwryX7n/70t94+DBjhqG0do/qgb+lvzsO55XyTh+RHzpLHyrHcP2QNu/D+8Od+/pf/um/49h9bewhgUg7ydwHAmrBbxwcAlPsWAGh5xa6f+ep/t1LTNhmYDEwGJgMvhQFvLo83tO8fvh3Lm2sTd9EkP5Hk3wcAfPv/fd//fT/k7/+pZ1sw+17ceC9vjvXppXA5/XxdDLg3nFXVta/huW2sn4jswVjK23i3l2/bKO/Auj/V2avK56Jt19CyPX17Hhnhnj6yDmNfdOxfj1y7kcya+km5s3Xl1nux+JDk0YTURFQ9k1YTWdAEN5Nek2GTY9CkORNpk2swE+9MyrvEnST/IQd9+qAg+89x05/0M/13TjlP5558yFHylnzKsSj3l67jKHDZqx//0i/9Zt4G8CcBoIc/BajJe6eT0HvkA4Au0e/a/5Jf8PP/wsjPaZ8MTAYmA5OBycBzZsDkAR+VF98M5s1xJu+Z9COb+IvY+PafI+tmH9n34qY7fTmy9ypvdI/Tm9IrYCBjNGWnpq0i5dWWesrWxbZ+mMxST3kHsi+pn/vzOcl5DlmT02fqpX6uLB/g4pDbrbXYX17XVx18Zz6XJo4koLY1GQUzWc0k1sQ2k10T4EyKTZQzeTapzkQ7E/BMzE3YR0n/H/4jf+TN1kFb6nR91LHSj/RPn3Mezi3nKwfJi1wlf8lr8u06iK7JXtwV6Dd7kX3NmwE8FODvBHDwcMA/Ckji7psAYMqZ1JP0n/MQgN/9c6+zy89ZaTIwGZgMTAYmA8+IAZMKXFomEnc3uXmTnDfamdCPkn++/f8bn/nMj37913/9J7N+9pP9n9xUV5+eEXHTlXeGgdwjjzVpxxAdxz2JrrwP7/bvYk8VG3uP8roHO3vWWZMfmmR3fXu+oEz5UrSPbpxqk7u0y5dlq8iavX/3U4tz1+9Y37XvMG3IfGoMHawv8N+9iWKtZ8JZk1ET1UxeTWgzyTXxzWTYBNmk2SQaNLnOhDuT8S5Z30r0zynv+s/x0y99Tf+dk3PMectF8iNnyaPcVs5di7pGe/QHhOztOZJ9y+v5+QAgE34fBvhAgLJ8G2DtLQAeNrymvfYArmfTycBkYDIwGXihDJhQ4P5B5qb17sib37zpzoTeb/wTKeeb/x/+wR/8EexZH9m+sn/HvEV9eUU3tC80PqbbBwYuTayy3UhOjq2TWGX0/rjbt4u9FDb3G+XKl6J7uGLtj/Jq26PXfh9L3+NLrTPi98TOOt1wPVyv0Toez3u59hknVbZetb9YfU+SmHUy2ayJqAkqaOJqIgua4JrwgibCJsYmyibPJtOgSXYm3jUx75L6b/+j3/7m0qPrr46Z/uhj+u1cnJtzde7Jhxwlb3KZ/FbuWaNcm1yzNflagcvbAbyqb/Jv4p8PBtJmvQ7ph/uXa/k2+5kMTAYmA5OBycBTM+ANYyLy4lVhb3zz5juT+Uz6U/6ar/maX/MTP/7jf8e//p9tLngAcPDrwJD+PjVfc7zJwBoDl8al7RJTZkz09SOTTORyuI8vRZP4xDwnnCOPfNjq2/NGdy7pyrZ8wo+sM/JrzV55XtW31nC9PONAORH5VX3WksNRWU0+0TM5NWHNJNbENpNdE2ATYhNkE+ZMok2sM9nORLwm6l3C/51/4jvfbB20o07Xvo6R46df+pr+Oyfn6JzlIHmRq+RPTpPnug6j9VqzXz2Yb86J/LV+3grg9X0TfGQSe77Vvy3/gi/56o9w3NWjnGP+pf+rr8jscDIwGZgMTAbeIgPLxCISh7zx9UY5b74z4U+ZOiT+P/VTf++f8DMAdMqzrf3lGIub5+XN8FukZw79jjJgEs70U5aOzjYqy7rKYvavLRH59GCfYo/9WuXcW+fK7E/bdHtV2zWQcfb0k+ePPTJ9Wm+t/5ynviRW2foivCNX/od6t55jWxcf2OrHmMGecq33YvS15HBU5jfNmYCamJqogiawJrSZ5Jr4mgibGJsoZ/JsQm2SnYl3Tcpr4r6V8O8tz37rmOmPPupzzsO5OVfnLhfJj5zJYfIq18l/yqN16+wvJlCno5OBycCzYCAvfCP5WTg6nZgMvGUG3B+Ji4TCG9y8efaGGsykP2X+4j+//ef1f2TLsq19OsbJDfTpDTF06etbpm4OPxm4CgNr8UxZf9wknMPk8q7M/ZT7a0tmT1Inscru22uh4436y3PGNWTGoZ/ReCN/trij3DVRFrWf4Gh9T+0Em7EywqyD/OI/XVI4snWJPzYTUtBE1cTVRBY0wTXhNQE2ITZBNmk2iQZNrDPZzkQ8E/Quqf/3vvtPvTnn6PrAluPk+OmXvqb/zsk5Omc5kBM5St7kUm6T7y7xd51G65j2Fx/AcwKTgcnA1RjwwkeHyhUdTHvWtWziZGAycGDAfQIejkggvOn1ZjlvwE3qE032P/WpT33Tm5sPbwFkeba3T8c4uVnWn+Nen2s2GXhqBtwfl45r+xHSb1eWNuTjcbc/T5LJYs99tSXnXlQ+F02quz1+bl/Uz36qzDlFW8raRph+UCf1c2U4pc0at1trdFuea7tPzphB9mPMjHTtLwYzGdwjm1xm4mlCaoIKmrSayJrYmuiCJL8mwibGJsomzybTYCbZJt+ZkNekfS3h/zP/4Z+5fSBQcdSm9p3j6kv6l347F+fmXJ07PCQvciV3cpn8ynmug/KedbTOJYHKfuQ3/5e0nW0mA5OBl8uAF0CxzkS7SHnKtf7UJwOvlQHjHjwekUR4Y5s3xt5YZ1KPbOKv/c997/f+wN//B//wp3n9X5toH/brOODihjn9Ou5T/X6t6zLn9bIY6OKxs3WzqvXQtSkfMfbmYp8Uu/so91XKJq0VrZN29+gITaJF6rm/tVW0zp4+7ctzxxpSl3Lb7MGRD3vtcraF7Xqx1qzd6XnuuOZ9GbGUcZI68qv5mAhuYZf4YzMRBU1QTVhNYE1oQRNdv/k2CSYpNkEG81v/TP5NtkGT8Jqc1yQ+k3zkvUftB72OpQ/plw8C6kOAnB/zde5yITfJlxzKqRwn7yb+uUZb62n5RYF8s6fYjxe1nY0mA5OBZ8WAFzqdUh/hVj3LJ04GJgPLG8nV1//zhrq7EfchAEk/v/2vr//bxn68yc6b58WN8vLmd67VZOCxGfCacu1x7Lci46StyujHg2Rx5bi96b0pz/3Uye67S5H927V1X1teddpoS1lb186yPHekTDm69To9y5QdPxH50qPjOW2sGzrYHrnOY9l4yTjBlp+1sqz3ImQTwb2YyWY+ADAxNVEFTV5NaE1wTXhNgP1G3ATZb8xNoE2oTbJNusFMyGvC3iX6/8mf/49vHwCA9aC+5bVt7TvHTX/0UZ+dg3Nyjs5ZDuREjuRMDpNXufYhQF0T1tKHAVvr+iKCdDo5GZgMPAkDXtxGgx1vlg411K1v+4qUa7PuxMnAa2fA/XHEuxvUvHn1ptibZ2/AE0n+fQDAa//d6//Wtx/7zbHub45Pb4JZi7lHX3tEPo/51ThLPeX0dmTPOlW2Dbh+jBLHZr/mflJmryHnnlPeQvardaqs7p7ukLadfa/N8wZIm9SV7SvraOtQn5xX6tRPPWXLsp2yXO/B+/Nct65bsXAsJ56MG2UwP8ZY2l6MvJUgWl6TzEz+L/n238TXRNjE2ETZxNlE2sTaZDsT8Jqc1+S9Jvro3/8D33//AEBZzPq1rzpW+qFv+qrvzsW5OVfnLhc8BKgPAHgQUB8C1AcA8F/Xx3XbwhcTqNPRycBk4KoM1AtX6spgHjqQ5disY7k2deurT5wMvFYGjPXEw/6Im1FvYr259SaYG2BvukETf5N/kD/+x+v/X//1X//JrKvsDbl9OxZ4f2N83LMH317rasx5vTYG3FfMK+XUO7txvsTYk/d7I2y5d9Zk99qlaOLr3t2DnjPEPW2yTp4vkCnTJq7Zsq/HkDsu19agK+vW9C5ulnGwPB+OYsm4qkj9F/nZShApz2+TM9H0G2gT0vyW2qTVb7JNbP2m26SXJNiE2ATZhNkE2oTaBDuT7kzIM1nPJN6EnwT/nKP2kf3nuOmPPuqzc3BOztE5M3+5kBu5kju5TH7l3DXIdXG9xLU1fpFBO52eDEwGrsaAFzM6rLJ6InIe2W5kp44f+1KfOBl4rQzkfrh//T9vVL3JzRtob75FHwKg+8f/8vV/Hw5Y377sO8e7vyFe7mH3pPha12PO6/UyUGNXHVweJPjYwMHBnsmy3EPsq053v+1F9il13a+paxezLOtfKnOusK3njTWkruW2eyjm3LKvtCN3B/xjz3UYybmOJ3KNjVOdHWP8KIOv4rOWHGZZTTBNPEGTURNUE1YTWBNaE1wTXr8BJxk2MTZRNnE2kTaxzmQ7k3CT85q0ryX8f/U//8u7HgjUPh0rx0+/9FXfnYtzc67MWw7kRI7kTA7lVI7lPNehrlGu30h+FUE8JzEZmAxcjYHuYjeyMahlIJ8tPNSa/04GXi8D7glmqHyfcHijmje23gB7kw2a+IvY+ON/+fp/Tf6pY1/273iLm9/067hnX++KzJm9VAb2XE+swxzdbylrW+L7pw8A2CvsE/dMh+4rE1B16iqvIfvT8tyryonUS/2acp5rqsw4nkuyLMfv7Nkm614iy9E52K0XtsW5j3UnTkDlY9wYIxk/yHwo4zPCQ+kL+neUGKbdb5IzwTTxNBEFTU5NVk1eTWZJbk10TXz9Jpyk2ATZhBkkiTahziTb5NtkHMxEvSb+JvvgnqO2R8/+c1x9Sf/0Gf9zPs6R+Tp3uZAbeJIzOZRTOU7eXYtcn1yzXMsqv6BQna5OBiYDV2Rg7SKWZVVGXztwMduknrJ1sM3PZOA1MFBj+rhPvNm8QW9SvbHNm+O8qUY2+Qf5438/8eM//nf4A4C+/n+FBwDwrp+vYQ3mHJ4nA3Vv4GW1pZ5ynZFlHY5s2I9JX+zH9+72pOj+7NA9ewmyz7Nd7vunlE3SGVO5nndSt17aUu7KtSVWGX3PkZxtyawZdbq1w8Yat8fxHHiIk17PODTO0vbi5JoQVj0TyUwwTTpNRE1MTVRNXE1k/WbbJJek1wTYb8RNjk2Y/QadZDqTaxPuTMJNzmviXpP9H/mRH759AADWg7qWZ7vap2Pl+PqUfuK3c3BOztE5ywF8yI1cyZ1cyq1cy71rkevjutX1rPozCdgPcT75nN/4+7/1do8+E6emG5OBd4mBvPAxb/WUte1F2yYiz89k4DUzcLo/4sbTm1NvZr0JzpvqTPxN8j/96T/wB/n239f/rZPtkO3P/h1vceN73N/4Oj+TgefKgPFZEX/dZ8oVLV9i7MXcE+6TEbqfHorsT/pwn3Z6luWexq5+CWYb5HrU/rO8lqlnnU6m3kMP+drDvetHXWUx1/teJo7ev3sr4BhTGTPGFTblO/E2BqvNsmePNSHs9JpYmnCCJqEmpSapJq0msed++2/i7DfpJtYm2pl8m5Bnop4JvIl9Tfj36NlP9u+Y6Ye+6au+O5fuIUA+AKgPAeROLuVWruU+16Ou1daDgOcUoB/+3M//cvbp0KfjHh1WmQWTgcnANgNeyKjZydrASw/7rn1pT0Sen8nAa2DAeGcux73Dxevm8EYU9GbWm+N682yCL5L419f/fThgW/sC7d8xGf/+SN+O54D0/TWsxZzDy2Cgxl3V6ywsX0PKTo/cAzfy7Q3nHbpPRBNI91Fi7q+0r8m2yT26JbOvraOcWGX0l3Awp/Q9dee7hms8W+Y6Jt6f/0oc3Nq7eDk9NxpzxGTKNUZfhN4l/GkzgczE0oTTBNSEFCRJNWEFSWL9RttvuEff/psgmzCbQJtQm2Bn0k0inok5cibte5L8tTo+PLDPHOuhDwH2vgWQfMJv8u0auCa5TrmOI/lFBOmdk+zjz/lVv+W3sb9fkt/T18nAc2UgL2DK4DUP5p59P1cupl+TgWsxsNw/cbPpzag3qaA3unnjbtIv8so/f/nfv/6vffQAIPt3zPub39P9fa15z34mAw9hwOuEfagnpky9TsfWH7EX3Q/uj4q5h5Tdq+prSF3LlW2/B2uCTJu05fmiytat9dNe2zym7rjiyK+uHFs95BWkTD1lbXVd0V37BY5iZhxjozjV/uxxlBimPZNKZJNNk08TUr+hNmH1G+x8AEDyXx8A+Fp89wCgJv88BPABgAl4JuUm6qOk/v/y1/7az+w5uvb2nePpgz75kALU962fAnRvAciZHMqpHMu5a+Ca1LViHbHleqb8jALU8/i6Szfnbx4CcP5YrzhLJwOTgY6BbqPlzRJtUr+mnH0rJyLPz2TgpTPgHjvsnZuLljea3ox6c+qNbb35zgQf+U9+93d/T/f6/xUfAOjzS+d++v/yGaixONK1g+tH7MHci8juyUT3Z6J7NZFyk86KWaacbbfkek54bL2eS/aMV9tUvfbBnKut07t68iWXiVVG98h1VTYGTnArjg57y7hDS/lQ+oL+zWSwyiaT2JVNNEGTT5NRk1OTVZPX0ev/fgPOA4Au+SdxNok2sTbRNvE2GTc5B2vyPkr4/+bf+ltvKBO7erWvHMex9UXf9FXffZPBNxucK/OWAx4C+HDENyXgTQ7lVI7l3DXIdXGtxLquqT/DUHU/iZ2LH+Jc0BVM22RgMrCPATdYh9hOj5ubpZMLZtq6NkcbXtnnPg9nrcnAy2Ig95Kxfv+Hx7z5BL059aY2b4K5ic7ja77ma37N3/jMZ37U1/+zLNsh25/955j3e/e4D9Pfl8X09PalMWCs6Xfqa7JloAd9dHbLT5HrFG3iepV7o8run0T3lkgZctZRzjrWs65lFd2/3Z6utmvoJuuifVZ9r912ou3WEA4sT7mzVb5GvLoGiXV90TMW7uVjjNUYGsVc2quM/qw/mQyOZBNJ0ETTxBM0GSU5NVEFSV79Jtuk9iHf/ptgm3CbgIMm5pmwdwk9yf7W0bXLfh0rx9cnfeweAnQPAHwIkG8ByJXcwWPyCs9ynuvg2uR6saboo7V9JsHpubxzZ62sqz9tk4HJwE4GcnPVC95S58bJGyjRm6lO376QOra40+VZbTLw7Bkwpg976G6f5E2oN6fe1HrDC3IDncenPvWpb/pH//gf/Yx//T/L6s22/dm/Y97f4LqPl/sTQvX52ZM7HXz1DNRYPOyjw7Qt0zbG0fWp2Y/uE/dNontqCy9pw36n39z/I1utc6lezxn2k/aULRctA7vDemvYzXmr/hb/luc6pOwai4tzorECLs+NXXwRiRmHqSO/mM8oMTRxzGSyewBgIuo30yaqfnNtEktS6zfcJLt+852v/5sg+42536CbTJNcm2hn8m1Cnkl6JvFbCf+oPPtAzv4dE9QXfcNPfXYOzsk58haAc5eL+haA3Mml3Mq13PsQoHsAsJb8s8YGKnvv5/zb3/sX+Uv82h4J3TeP1P3sdjIwGdjDQG5EZfD0yIvjXrnr52jDP8esMvr8TAZeIgPG9HIP3e0ZbzzzptSb1rz5rTfVf+57v/cH9rz+Tx/25xiO+V7u2+M+1N+XyPX0+fUwYByKzCz3UOopZ52lTLzbR8b+jcyeeO8O3R+i+wZ0L+1B21E326Zc+8k9/xA5E/K1fjyvUKfKo3a179Tto8NRf5fY4c12lcM13TURWWNk1zqReFgcxs4RjTvRWBW1gy/mM3oAkIljPgQwyTTpNAk1KTVJNWklifUb7frtP4kvSbCvxJscX/LqfybnNXGvCf7f/okff+Pxk3/3Jz+rLNb62V+O40OA7gHA6CGAc3TOvgEAF6O3AORSbuVa7l0L1ybXywc5o3WOQP0Qf4Wf39eH7SnFbh+l7Sl9mWNNBl41A7mxkNePenHc0unPOuO+Idhxk+z0Le1Tngy8BAaM30Nsuw9u0BtOb0i9efXmVswb6k984hO/4Sd+/Mf/jq//UyfLkW1nf6BjOObGfoRX/X4JHE8fXwcDXcylTRlcP9hn1AE3DvdEoomh+0bMPbUl26Zi1849u4W5v5XFbNvZLK9l6qL1wM6Wdsq3DuuP+oKPHHOvnO06TrXBP3JdB/Rc85RPYmYr3g77r8bnwfqC/h0lhiaOmUyaYIImnSahJqUmqSataw8A/AbcZJjk2G/K/ebcb9K7b/9NwDMpz2Q9E3mTexL+0WEdMdtnvzmePnQPAfTduTg35umc5eCaDwBYn1w317Jb6ycIVffIaKit8lG7aZ8MTAYeyICbLxH5eGzcTJ1cOLv62d9Sxv0c+4HTmc0nA2+VgYzlwx6K/eANpzem3rDmDXDeXGP/4IMPvoPkv3v9P9sh25/9Ox54v09P999bJWwO/k4y4D5x8uoidmWwytqWyF6jbuy5TnY/5P5Adt+I7qdLkX66tnXfpt4lzWlLeatdliPbFky51kvduudi9nFtGU7ps+M2ba5jxbruxsN9rCzPkRljN+G1iMXUkV/cp0sK05aJ5NYDAJN/kAcAvsJeX//3JwAmvyTDfjP+kG//M0nP5N2EfpT4d3bbZD/Zvw8B1h4A7HkLQA7qAwDeloA3OYTP5JcHLj588WFMrk+uG3KuacrPMGA913eurZV19adtMjAZCAbcQB1iWx6DGykvmF5IuXBqu7+I2tYbstr36YUUN/UrXJ7iZODFMXDcR+6Duz3CPvGG1JvVvEGuN9o//IM/+COj1/+9ibe9/dl/7s/7fXm6DyF37rsXF2KvwuEu7o575xiX1Xaqxz67j/U7m9cm98MI3Tci+wnZfSWOks+urm1A92mHdS+rJ6ZMH6krd31rsw6YR/aVctZZk/kjpVle+3D8tKftHLnymPym7Bp2OFr/Gje3+un5MmMvz53YX9wnk8GUawKJboJpwmkCuvbtv28AjH7/7zfhex8A+E27ibeJOGiCnkm7iXwm+TxMHx1Zz7bZn2PkuPqib/wtAJL/PQ8AmD8PAXgA4EMAuaoPAPIhgJy7Bq6Ja5Trl+ta5UcI2HP2QdZNGbeq/giuzi4nA+82A24ycHnc3Tx1F8XRBRR7V//eVsc4bnL9cDWqrn3iZOC5MmDMtvso94w3pd6w5g2wN9LYvv7rv/6Tf/8f/MOfHr3+n+2Q7c/+HfN+/71/9w3pcR/CpX4/V16nX6+HgVGsaReZsTK4fRDbg8N9sIbuGZG9lLJ76xJ0bybm3mXPq6eMzfNBonUtT8yylO03+9GW9ezLelXXDtbE3zLb1H736PRhvZS1ia4DunJF1g+b6ygSB8gZD23s7Im7F743a0JY9UwkTS5NNk0+TUb9hnrP6/8kuyS++QDAV+R9Zd5X6Pe8/m9iDpqwm8Cb1Nekn2srB3bROraxD/vMcXwI0D0A8CGAc3BOzrH+DCAfAPjHAP3bCTxEkVM5lnPXwDVxjXLdlOvaor+F8PW8/haGnkNOBiYDMOAm9MZKm3r7GmVeMLfk9oLKDdr6RVU/wPmZDLxEBpZ76y4pyf3ijag3rN7UgnkT/Se/+7u/h+SfmxP+FoBlYrazr7zhdcz7vXi69+RXn9UnTgYekwHjrSJjYjvvuNtj93EeOnsAu3thDd2XYO6j3FtrCWfWU849OpK7/WxdypATra/N8pE9+7JNxVon+6pyJv7KYtbVL/u+FsJt7Uu+E3M9qzyKg5MYGseisQq+2E+XFGIzaUw0uTTZNPk0GTU5NVn1239/AuAfuTP5X3sAYOLsN+kk1H7DDpJ0m4B33/6buJvIm9ib7Jv8V8x6trWv+hAgx8ef9M8HAPUtgNEDAN8CkCN/AuBbAHIqx3LuGrgmrlGu22iNL3gA4PnaeK+69nMw+0iZPqqe/a6VZb0pTwYmA8FAbhxlcHnETdTeG6juonpyQaXfOtbBOX05aOub3zoTJwPPiQFj+LiX7vZR7g1vRr1ZzZtZb6C5ofaP//EzAO1itkG2L/vO8e734L5995z4vMQX14C2ynvxkvFmm30MuAaj2pRbJ1H7KXotudtj93F+p7MHsOVe6GT3TIfuqxHm3qMOfVi37tHU2cfo7ufEkd06loudfa3M+mDWSznrKGeSP5KtS1/2p/xQhFf7SI6VO+zWNG0ZDzV+bvXTc2bG4SiWX4y9Sw5JHrVnImlyabJp8mkyanJqsnrJAwC/KV97AOA37ibg+a28STpJuwl8JvWZ8PNf6+ZhWda3D/qz7xxPH/TJhwCjBwDMj4cA9Q2Ax3wA4HqKru0FDwAuiWvP5ee0vaTNOf3PupOBd54BN1le0A7yzU1TvRjmhXKvTB/UrX3dMH865tHGwujbO79Ik4AXwUDG6zG2b+Lf2HfP5M2nN6ze1ILelPvH/x7x9f/0+UWQfIaT3dyqrep0r01M2xnDz6obDMhvYpXRx0fsLffYCN17a5j7Utn9+RDMvZ37W9mEuaLloucF62kHlWuZumg9sdpHunbQxD8RWT3rIjsWeK2D9aCv0bqwfrXMNU2s8TCKn0EcEuLGJ/KL/GQymHIm/sqP9QDgob//NyE3Qfcbe5N3E3oT/Ez6q2wd29iHfTqGYz7kAYAPAUj+n+IBQK6v8jMJWs/9a+7sqbPWfpZNBiYDNwy4kRKRj0e5uaoXSnUupsgVLU9sL6455qlfLJY+Is/PZOC5M2C8nuwl90LegHqTWm+MuXH2j/9xQ8LfAqCON9e1vv1k34632HfL/SaX+qz+UlC/K+p/taPnQb1ax7ZZlrYpP5wBObcnddcGu/I6cp2iLrhysBcod090mHsnZffWOWhyWvdp6rmXlfcgfVBPTDlt5/S1VXeU3Ge7Wifneg0Z/unHdRjJloN1HVNXrrFwEkfGVx+TxOqL/pgIjtDkHzznAQDf/m+9AZC//ycZ5pvx7g0Avk3PnwD4bbvJt8m4yXn37b+JfU34O9263UMAx3BMfQDzZwD6XH8CkG8A+AAg/xDg6CcAcMmbFb5l4VsXvoXhWxmuUa6bcrfGVw7eD7Gv2Hs7+/Xcn9XTlnLWmfJkYDLwQAa8uaIb5QOWm6l6kWSTY/MiKtZ6VW8vrnXsw6T0xymiz89k4CUwYOwuEhP3gnsF9Ga13iDnH//7G5/5zI/mjTZ10bON/di3Y4H3e265z+DxNe4p55SYsvFTbejVVuuiW8eyifsZ6LjTllhl9NOjXKPu47zYcy90MnsGu3tHzATS/VWRutWmnvuzk3NPd7L73LKqb9ktfwia1IOjg/6tV8fq5o0NjhJH9apdbvdgXUfaaEvsYqKNpdMYJPIzVvfvhGdUs0sKSRixmziKJpcmmyafJqMmpySq+QDAv2pPcusfu+Mb74c8AMjE22Tc5HzvAwDeruMzegjwNh4AwA88yZl/A+ChDwC6dcb2CKH4IfbaI/Q7u5wMTAYeyEC9YG3eWHUXyLyAItcbKPWu7cnF9fTCqo9OteraJ04GngsDxmjixQ8A/ON/3JwgcyPszfXaTbH70n232Gun++y5cHeOH8kv7VIfydajvB6WidmHNnB+LmNAPrO1tjWkbHyQ5FOeiLxyuCdG6N5JzKRxT9JJHfanmHuV/Zv7uNPd49fCUWK+1r9tuoSfdl1511/OfUvu+Mo2lFsnUXtF1hBbruVIrvEwjKFxPGZsvzh5lBi+xgcANdHn+pqfLOctgNf2AMAHO7nmVwhYz+N7uxrV1y7u7W/WmwxMBi5gwI0GHo9yE1UvkKML6che259cYHPsXr5garPJZOCtMHDcR8Ry7CX3Qe4Tb1zzZpcbbP/4Hzcnj/D6P8S496v8VkjbOWj6bBP5dh7W0T7CrJ91tCci87Hvgzb/vQYDcpqY63Equ6fK/sq9psyeQ3bvVWQvYss9qWwC6R5NnTppT5m9jJ57OmWSZfQuaT7HttaHSXrtb2SnnmXg3iPb5Vj6lvOushxV7qxneeq1buquW0XquF61DL3GBLrxc4KHc0CNSfZBxu819sWT9ZHJoLKJot/8iy/1DQBf6c8EPxN/5CxDfo0PAFzfxCcLtPFA7p1aY2Sn3lpZ7Wfqk4HJQDDg5klEXiQs3Y2TF9PuQjqyeYOVF9odF1bc1b+U04Z9fiYDz4kB4/NkPxn/uU+8gc2bXBJ+b058/Z9ybrCtJ9o+96XjgPf77LCXDj4t99Vz4q7zJfm0vM4j9Utk+s1xUs6yHF954j4G5JTayh2mDbk/3l//tt+4dw8k5v5Qzj2JnPvJstxrlidmufszMRPkp5JrUj8at9bb+wAg22XfOe89MtxZTx7VRetY3uFo7VzDERoHovHT4mlM7tsBz7RWJoNVNvEXn+MDAF//B7d+AlCTfK+zYpa/xgcArGNd42caltOtycBk4AkYWN5glRsrL4giF3wuyN2FlAtyZ8dm+8STi2t/YdW/J6BiDjEZeBADxCofY/b+gVrGfe4Rb2LzJnf0+r91Em2fey/Hut9jR5/0LxH5pXySY3w+cn092X7FOib2+VlnQM5qrbR3Mrbtg+sU9cCNg/1AndwXyrkXlXMvKXeIbXTkHkUmOdaWifJjySbm5/Z/SeI/Gsv5riH8UT7icWRfa8M60i7Rta1IHGAzHhJP4sp4O41PYjxjGf3FfGpCiG6iaOIvPscHAPwtAB8CbD0AIKnPJB+Z5L/afGPgtf0EoFvrJwjUPXvDOuITuDWHmAy8mwy4ycDlUW6m8oKIzIWVbyi9wNaLrHaxu+Bmn+1FdukTK5T+vpsrNmf93BnIGD3uqbv9lDGfe4J9wpE3yXzr7zcSvv6f5cq2rXvNsRZ763RPPWc+k0v8TF1utas/FjoOmB99StuU1xlIzpRdN1oq70f2F+3u9tkI3ROiSV/uxTW57jH1RGSO3J/KYJeMmzyL1Em5tunK0tbJ2kDlrl/LrLcXa1/ozjfn38nyldyNbNVumzVkTSlPrOtMTGAzNjpcxNU4To1h8MV8uqRw9BDg0gcA/CE7/qidf+GeP3T30D8CyF/c9w8BPuQBQE3+0S95AOD/TPD9P/D9bzie2/8CkGuaa/4Igeq5/SFdd310toeMMdtOBt5pBtxQ4OEoN1LdxZAbAxITL6TdBdiyil1/Oy6uLFL6mjry/LxdBkZro/3tevd0oztf8HDc7aeM+9wT7h1ujpHZW/7+/5Ff/9fXp2PnYSPJKb0on2I5fy3OLV3ZWl8Hf+Wp4sNm8261ljtnnbpyInJ/sIZZ1q1p2HLfdTJ7EXvdk6lXmX2Kzb2b6D7ukt2aKJtga0dXBtW3MNuM2mUfyl07ys45HG/UZ8fDmk0uk8dqUwetlzbkXJ+6fp3exQa29yKWWjlj8SAb4y8GMxmsst/8i+c8APB/AiD5Hz0A8CEA/x3e2n8DyH+ld+5/A7j3fwKoDwDWkn/69C0DHzr4EKJ7AIDfe/4bQHjg8H8A8H8BkDv/B4CH/DeAdW3V30Kgeq7PoW9t7M3bfZclU54MTAauyoAb8PQmq1zw8sKYF85PfepT38RFH1u9+Kpblu2Qs8/2Int6UU1/KxGWVfvUr8NA8qtccWukc+tv9fecyp0bPimDh+NuP2XM535wr4g8WOOGhDcA/Ov/3Q2z9cHsz3EWN6v6cvTvOfGnL8kdtiOHR7+r7ah73qKu8hZm3dPxjn0fPESvn85W60z9yEDyJb+UKu9H1tb1Ewfr7Z6omPtmj5x7Lfdfyt1eJUnG3iXcWwm0bUYJtnbR+mK1p64MVlnbCKvftndcUC5S1pYIf+jymLK2Ldxqs2d9qVNjRP29QWzd2k/jl5h+MR8TwYok/dhM/sHHegDAfwd4jQcAW38HgFf6TfDBreSf+j/5d3/ysxxd8s94D3kA4H+D+NgPAFzHusbozyJQb/bX5/zG3/+tP+c/+7/+TfBZ+DSdmAy8cga8ITveeJULnRdAMC+iXNQ/+OCD7+DCi33tAp3tlLNf5NsLaY59elFNX1kW9Ve+RM9mepXv1JW30MlYDz1ly18iOg/wcEQ8Z7y7B7p94+//eQvgE5/4xG9gf9Wj7jX7yzHu95O+LBF+9fe5cp3+HTldzmN/sh9rcc+NNvpErn0fOdKXis+Vu+fil3xVf9KunIi8frhermGDXldyX3Sy+2cPsvfct2Ldj3W/omdijGzCPMKsn0l419a69mWdqo/qpT3H2is7nv2AzrnjQhu8KYOVR/WurLNZv2Ku02iNiQvKany8dxNX2BKRT47TeDXmjWv0lC1/69glhSaMmfw/1QOAb/+j3/7mO//Ed7759777T90efouebwDwin3+BGD0dwC6twDqQ4B8IOBv/sVM/rsHACb/IP74+r8/AdB358K8mB8HDzye6gEAazda57cegNOBycBk4EkZ8EJ0epMVF7d6MawXT94C+PSn/8AfrBfcTvcinH1k/ycXVPzoL6r6/qSEvUODyW9FKMh4ST3lbJeydUA+lh20U137c8T0vcroh2Owl3IP5F7hpvaHf/AHf8Rv/ynDVo9sk321+0lfjvic+JS7RPnDT+VTDG7bc8dd+a6bd/taG+/Imr4eLVPay0DlTv10fdfWgvWiPPFuDV1vynI/dHLunXPk3H9VrntVPZNjE/NEk+2sh2wd7Z2etpRts4W2AR9y1HGYOzY5WEPPdR2mreO72kY6a0zZaK27GNFGPA2PPlb37om3Xm+UGGrPhwDXfAOg+zsAJsckyvUhgL+pN8n2lXuTcF/Jr28BjB4C+CAg0cQf3Er+t779x9/R6//dAwD4eKyfAPhAxzVNfKIA9Fz/RMPNYSYDk4E9DLgxDzdhcaHz4ifWCycXU94C8O8BjC682mt7dPsGTy6w4wtr+swc1ffMd9bpGVjj8BAbR56tewnaRi+qrv054pqvloGHY7CX6j7wppSbb248eADAwzXs9abZvWQb+xruI305Irzq63PiWJ8SDzwefT/owWs9Z3geST5Spr51Fm0Z46bsjpt+3CVv6edz4vE5+iJX6Zs2uaZMeYmsy44j13lNzuuO+2cL3W+JuRfZp1XPvVuT45p0U66t1rXM8orW12597WKWV5tl4DnHaCz7Tw4ulSuvqadc18Ay1xZduSLxgm0tbjZjsI9fY954H+nanxwzGUw5E3/lSx4A8Pt1/waAfwjQZNe/AeBPAB7yM4DuLQB+r88DgHwIQGKfiX4nj5J/+vNBgw8e/PY/3wAw+R89AGCe9Q0AOfH3/3AFb/D3yv4GwLkxXvfOue1n/cnAZCAYcEMtb7S8CY6brbwg5kXTiyk3C3/ue7/3B7jge8Fdw+yju+CeXGT7i6r+x5SmeCUG5HYNT+NmvE7Wxb1Rn1dy/Um76ebiXA+4Yx+xB9xLJP0k/7z+737yprnuqbV9dL+HTtfkSQlqBus4o1ralxzmHILP+zne2fI8tVeufdzrOebSt/S1md407WAg1zr57Nf9bn3v12ZF37vuXnfqHup096Zonbof0d2rFU2GE0cJd9bp5GxnuQm7+qWY/Sh3SP9pH40HD5RVPlKvvKmL1lUHzz1YM9q4diM0fihXrrgnDm+COmO5bgnjv9rfmp5Jfyeb/IM+AAC/6Iu+6Pb4RR//RW84vuzLvuzNP/cVX3F/+EcAuwcAJLkkvP72/ZwHAPlTgD1vAYweApjk+wBAXfTBgX/0L5P/vd/+73kAIAf12//uAUDyC99y71rk+uS6sa7o3fq+tcA7DPzs9sNb5mMOPxl4MgbcfMcLVrnBygtgXji9CGPjZwD8dhkbF+xE6yVmP93F9uQiu7ygVp8hK21PRt4rG0gOK5/GhvaRrj1x1EY76Id2fMSD9jz+TZ86WRt4PGIv5T5Czj3A3kD3AQAP1Nwv7id1Mdtn34u9k74cedXXp2R2bcwjXwePUj/KwWXOMed+iZx93cunvOn/CJ+Sy9c0VvJ5XGv5H6z5/To15cQA5YldXOT+qbL7Me1pU3YvVjRpTeySZJJok+muPG3W1VZ17eJWufVA6mb91JU7rG2zD8py/ntkeKz10pay9bSB3ZFriEydaku9i5W0rcXezcYcvUXEnjXW3b9V1/7k2CWFmTBmIpkJpkmnSSgJaT4E4AGADwH8a/a+AdA9APAhwEN+BpBvAeRPAfIhQH0bwIRfNPEHt5L/0bf/vgGQv/1/yt//s065bqM1xv7kATcHnAxMBt4qA158EpEPF7C4scqLX14o82LLxZgHAL62TBm2xKyPnH0h5zgnF1lvCJcIgfr/Vsl8wYN3/GlLRL7WAV3Zd+rIz/mj3/ionIh8PAb7iFiv8Y/OTTP7iD/+V/dL6rXtcO+kL8+D1Y4ruTzyln4Hh/W8kPN+iFz7vdXTh6Osr8+DzZfjheuux661fKovkbWHe3DjYP2zzige6t5R95pU0fKKuR+R83pncprI3h4dNXEe1cNe66pXXOvDMtrUdtrWUD9sa38dwgH25EJZ3tQTzy2zPphHXbctnbihzih+apxlzC3k4zmjxr4xD/LZKj/UesR/15JDvzXOZNKHANd4AOBbAP4xPF+N5yFA93cA+Ead5HrtLYC1hwAm9Jnkd7L1RF/7z2/+t5L/Pd/+M2/eAMjX//0JgA9NrvX6v2tZ1/sRQ+uSrrv9cEk/s81kYDKwwYCbDTwc5UYrL4R58cyLLDI3A/lTAC/mtV7q2V930V25oOov06uyNnB+thmAPz4dpk2er4HdeGlDftsf544fW7LlR25W9pE3mRn/uS/W5GxT98zKfnEO6edT8VvH7PQjb8f9PEz88pxUZTkZYa2vvuCOtUs/TmX5fCoOX8s4rr3zUU88xkLZQydrdFPO+qW9013junfU2W/I3b6zjrhW12teh11yvCeBznaj+tizLOVsP5KzvjK4ddCf9Ud9wwVliR0/azY478qrvVu/XC/X2LVMJEbQjZUtzJhbyJwr3j85f+T5wlh3D4gju+WPhjUhrHom/8iXPADofgZg0usr8L4B4N8BGD0EqA8A/B8B+DkASblHJu31bQATe7B+059ltQ/77pJ///L/nm///f2/c5cLk//u9X/epvAnAL5t4dsXPoxxbeqa1TVN/dECa3Y8GZgMPFsGvOAcb7i80eUCdnfkhTAvmN3Ftv4UIC/aXf3sr7v46sM96t8SIdi5PFuyX4hj8ngaE0vOr1Fe182xnxtV6Zey83cO6ke82z/Gbu4j5Br73f6ottqm9ulYt3i6Xk/Ja/KU46b9yNWprxcl//JReVKXd+slLrh7/+78d+qX6+2cnI/6xG0G5CyxjwXXYQeylrmGubauf0X2l7a619Qt79A6Itc75LzuZfI7SpK3kujazvoi5SnX+ur4pZxtaOuhfaQ7jpj9VdnxEpOba8lynojs0a3dyEbcUJbxM5Iz3u7l03OGse3OyLjX9lYxk8Eq+61xJpQmmSadoIlo/gSAZNWfAPgAwD8GSKK79jMAHwLsfQvgnIcAaw8DTP5r4o/eJf/1D/+Z/J/z7b9vAMiJyX/9A4Am/yA8y3mug2uT68Wauo51fdHfavDNwScDk4EnZcALkIOqe6Fa3Hznxa9eNL3AilzQeYWZ/xUAG7roxd66Yu0zx0O+v7C+P7wpT/+Zk7rzm9gzIE+JyJ2u/YCuxRaOb4bsD89STk+xv81PHT915UTkw9HwUuO6xj26e6JiV7f2916OqR8HhMP086k5rWPLk36pHzHnEnKdMzrciB1PI1vX14JDxl3yqH/6Dc7PPgbgrn60JcrxAWPtc21cO2zII7TeKAa0s99S3tp/1q/1vMZ1SHKMPZPkPUl01l+T7Utcqzsqsy1YD9pkeeqj/rR3fKSNeuopazsH65q4Vqxvyq53h8bNFmZMLmTOG++35w/3gDGPnnKn2+bRsEsK05bJJLJJJmjyaTLqN9Mmq6O/A+DfAvCbb5Lg7mcAo7cA1n4KUN8EIHHvEnptJP3KHWbin9/8n5v8Mxd/4uBcTf7hoX777wMAOZRTOZZz1yDXpa5ZrmeVHxJY7Kkv/OhHP/HxL/3Sb/7Iz/3IBx7ot/abc97dXnjIMLPtZGAycGUGvPAkIg8fAHBBzAtmd7Hl98s8BKgXcupyIe/aZJ/I9cK7uLj2F9aD38uLqfO6Mm2vtjv5Si6XMtx7lDi5t1OeZYc1WfaztEFojo3+Nj/6og/qOQfKUj/K8lOwxnTdS7kH3CPa0JUv3B/O5TExeZIfxzvyc7CkfpQLZ++F3vG3xmHyVWXb1T5zvFt5tMan8ercne/EngF5WsNhPNT1UmetlDus66/uvnK/dWhd0TroymKXqHodBB96mIDbT+opWw52dm0dpg15dOQYIxk+skx+sFmm7SEo/2uY66dcsYudke3kXHETg63teA7pd8TR6p7QUnXtV8eaEKae3xxnUmmyafJpMmpyarJq8sobAL4FQPLvA4BL3gLgD+vxAKB7CDB6E8AkvkvwRzbbJJL0Z+JfX/vPb/7x0zcYRsm/DwDy23/fAJAzOZRTOZZz18A1yXXK9ct1TfncgPrIF3zJV5Po/ysf/u/89N7jl/yCn/8XeCjw4c/9/C+/Ge/JYvvcuc36k4F3kYHjTRebs1zM8iKYF83RBZefAnBQ3l3Ya7vsEznHQ67+3CzQ0t/jCcUTi8hapvwurm2dc/Kh3CG240FMoJfYWNWzfva1lPHP8ZH5VP1gfdp/0wflROTTo+GnxrMxXuMenb2hPWVtYvZ5sganfsGcvj8li8mPPqTtKDe8Oa+cKzIciPJxCdZ+0R3zHp8Pl0+5bk851jEGKtdnxES3lnvixGsRdZUTjStto3qWd9e7tJkQY1N+CJqw24e6qH0Ls74ymAd9ZNlWn5Q7T1Fb6vajDdx7wHvWdR0SXTPXskPPJx3W2OLcoO3+PFFjtcbyUfc8mPiU++1krEwGO7kmlOgmmyafJqMgCarJKkgCazLrH7arDwD4BvyStwC2HgJ0bwOY0JP4I4vaOzTx30r+8wFAJv+jBwC+AZEPAORIzuAv+YTf5Ns1cE3qerGmaw8CTgJiYCDmSeT3Jv1r9W7fFLh5kDAYaponA5OBR2SAmy4+3nylfLDFBc2LHZgXz7zIeiEWP/jgg+/wr5nXCzR6bYuefeeYyCcX2qPvziHndDu5u/kpT1wyIF9Yk8NTOWLhZB32lG31f/BLf8Slt4+vOa7IiMjqymMccFFjWT3jfa9sW/FkPY4+6+fjM3ccIbnCmrr+nOKAN+bmPBPXuPI8MsLaNvtVXnB6ymfOKed4ZGFKawwkfynL5TE+iAv4B+8O1gjZtdrCut6pd9egtGVd5Vqeel7nlE14E014r4km5nv6tK7JPW20KVumXdzqn3lTR6z1097J2M49cg1Gsuu3B7diynJjcojLc4d7wvhWB90HVe50bFf9dEl/Z8vE0mQTNAE1KfUbapNWv8H2DQAS3HPfAlj7KcCehwAm8F1yv2azncg3/h7+MULG91j7b//8w3/+5f+1b/+f6vV/1nlvMF0r+c8HA74ZwJ7f68esNxmYDFyPAS8+XpgOeHOT5YXNCx6YF9DuYstGxs4NAw8BvBnoLuq1ffaNnOMi6889Li+w+g8zKV+PqdfXEzz5UZa7A0Yc3PN+qe24Lo7B2DmuvrxtrD5Vf9WPOOCkxrB7SHuN+ZFu/Yona3LKcZ3LY3DrGNm33GCzXNsRz+BN7ipHnEew1fNJ1Ws79QdwmvOd8joDxgC1qnyMh4zfJjbqWq3prK/lrnWHNU5Stz425MSsh9xd4zpbTYqfSs8kfq9MvTzwNduu+c7cLR/JloPWkbPOZllF+a9rop5r55pWJFawdWgciZ530ZVPMGN5KbsHch/U3dOVdbba7my9S/bT5rfH+QAA2YcA5zwAqA8B/Obbb8JJikdvAviNOmiibeI9egiQPwkwiQdJ+sV8AJB1lE34E/ck//g5+ubf5N/f/sODr/6b/MOVD098mOLDFR+2yL1rUdeIdXT9ck1T3hMw577yn0n+XpmHAV/8sY998safR4nzPfOcdSYD7xoDbjbweMTNlxc9MS+cXmC9AHthRuePAX7qU5/6Jm2J2S7l7NuLseO2F9v0+Sizhjmv1JHf5Y+8yMFxzY/8HW0RB3mD41rUtUl71r+XuzGez1olN8pHLjrfB/ww3+SmyjXO13Ta1r1wz2eOf+qfa/xUmJwx5kXcVa7URxzl+WOP3PXjGOAJt6fzcG6JyPOzzYAxQk3lxGPMZGzfya4Ta6S8ht1aa1uLFeuItS72tOW1rZNrMpuJ7zXkTMpT3uo7647krT4oZ87WG8mWJ1pXzL6wrR3wT3muw8iGPddSuSKx1Nm6GCMGN4/Tc8cxvvv4395BV66RyeBINonMBNOk0yQUNDE1UTVxNZGtDwDqTwHqAwD/a0AS6XwLYOshAAl6Juw+CBBN7kdovdqHiT+YDx98IJEPKfQ5v/l/jG//4d21yPVxzUZrqn0rnPjt/t4k/iH1/if/tZ/32e/+8Oe8+bd+xc/7Gf6A4JZfs3wyMBm4nAFvuuhB+XhxKhe3vADmBbJefL0Ae+HmbwHwUwD1Dmsf2T9yjo18ctHtL7I5r8tZep0tc72Tp+P6w2mJAfW6HlW3XovnrZV+PvUqOK58yJH6AQf8MO/KSacb2zXeU+/aYTvhtuc15/EYHNq//IxwydsZsbXGUT1vnKuv8bzgd53bx+D1XejT2DmNDfm+2UeLdbjTR3tizZ5rXeUaN5RjE6tc66N31zVsJrRZngnwSM5kfFRnjz37SZm26mLtT/sIa/3Uc+7atal3aJ3EKqPXwzXo1qba6vqPdOKJslFcEZuUdTF6a/M8Zzyf4tY+zz2yVffichPBLazJpUkn6EOAPQ8ARg8B9rwFMHoIQAJuQp5JevcgoCb1e/Tap2OZ+IOj5D8fAPiAw7n6zf81vv1nHXKNWM89DwHWAoc/2veQpH5vW5N/HgB48NbBmm+zbDIwGXg4A3mRWd6M3VzgvLjlRbBeMPMCWy/MXOR5CADWMvRsm3KOkWMPL7inF9ecFyypP5yx19WDvAzX3hgAXYuUtVXMdvdyv07pw9tYqxy/ykte9P+Gi/s5hVw5SN2byUTjnHop28666uDJuPq0xKfkUc5yzJ43fAy+Us45KstJYp4nqjw6x3Tnmuyz8px+3cpjbnPur+vMcN3ZyJNo7+rg8iBOSrwYF3vRdU2s615jqOrUr7ZON/YoU07MhBd76som2+p7sLap+lP1MZrTyK5fliemTD30eshzYrcuaXPtsSmv4SjOPD9Qjixqv8Uaz0u9i/9qU39U3Er8szwTTGQfAtQHADwIWHsLoD4EOOenAHseAuRPAkze9yT6tY5tRRN/8BrJvw8Auj/8l3/8Ty59wALKuWtQ12ZP8s/ajoKLPbI3gb+0Xpf48wYAPweYbwGMVmbaJwPXYSBvvujx9Abs5uLGxSwvhPWCmRdY5Hqh5g0Afg5Q7anXPtDrOOnDGRdc55WMOe+0vUuy808crv3tzUyJgboWI922C6xxttRdB31Tf0p07CUn+HnDQ3eM5l/txDQ2Yzvlaqtt0buxb4ipfsJVzuGpuKtjVr/O4k8+ErvzRJ5HkKlTbeq1ffaNnJwvuD7l2Lk+FbevbZzkT3lXvOQanSO71rRRBjMmqp5la/JW3Bl/YE180WvSri52dewnsauftqy7V7a9uLcd9XK+57SzbfLWybkmlKe+Juf6j+St2FqcH97vrwu3dcbnDuPevV117Y+KmeCPZJPJRGSTT9CE1CTVpNWfAYB7fwrAN+R+W85r8/4UgG/TfbU+v3HPZBw5E/XuYQAJPcl+hyb7Yu2rjpV+6Bt+bn3zb/Jfv/2Xo+RNLuVWrpN/1sNjtI6dfRRcD/mjfyT2mdwj50OCLPMbf/DubwCMXJr2ycBk4BEYOL3x4qIVF7V6McyLZr3QdhdqHgCc+1MA+s1xqg/p38qF1otqxUeg8dl3KQc4qgwuj1h3Oa7cn6PbxwLrmAfq0qeD5Wn+zXGXXKSfF/JCDMNXxnK1Wb7F64JD/En/lvJTMJe8MV7qpzw2/DGfbs6VK/Q955nu3NPZsq8cK33Bt/tjyW3O8yl4fk1jyF2NF/Vl3OQahJzrtEfONU7ZONCmfgl2cabNhHYrCTbJrmi7kd1y0XrqT43M+5wxs75yIrIHa4OcuHe9WGfqJrr2FYkrbHvi6/48ETF6bzs9d6ztgdzrWS/tV5W7pHDNZpIpmoSalJqkgiauJrMmt7wBUN8CqH8PYM9DgLW3AboHASbzJPf1wYC6dSruSfzx5yHJP5zIkZzJYfIq13LvWoisH/LaOlrWBdOlv/uvif1/9vM/7w1HJvmdzLf+/Nyg82XaJgOTgcdhIC8wyuDhKBezvBDmxbK7+HqxFrkZ4CEAqK3D2leO012M7y+y+qrvS4Q95/c4TL6sXuUi8bDm8CSXd5jrfqlc+7xbj+OYx/XRJxmtuvZro+MkIh+PM3gxVrv4TRt8qit3HJ/wpy/p3ymHzuXaXK3155hH3vBLfwt2c5UPsZ4TuvNGtXmeEWs5uv0qO176tPB7yTUc5FzXOJllR67konK3jBe5LvGyWI+bslyrvbLr3KExsYW0HdXJWDP+EpG7w6Q9EdmDNilnH9mms6dtj2x/te7IXutdosMb7RKTy05mDbCP1mLL3sVAZ+tii1jEXmPyXieGb+rcBPwRjesjuh9E94X6o6OJ4BaaUJpkiiahoImpyarJq8ksaILbPQTwpwBgPgDgbYD6JsDobQC+ka/Jek3m9+q1H/T8xh+5fuvfffOP/8wn51e/+e+Sf/iSQzmV4+TdtRC31jLLa4B95Au+5Kvz2/pz5C6532NjD1c/pj4ZmAw8PgNecE5vwLh4xZEXwbxI1otsd6HGxs3D1k8Buot5joWcfrQX4OPF9XROBz5zzo/P8PMaoc79lKNYc9a/8o3uOoww29DHyTFeI9nST/XHRMdKPPLS+J/zS7nGavLTlWlLTrM/5RP+8KnnUJ6ci/q10f4Tj5xV3wqHzitRLhL3nFsyaaiJB+cTy+t5iTeS/F9Kcsz0acF7ndO1GX13+jNmnLF64jGWSuzkmuRarcmsL+W5zso1xqper0m0q3XQa3yp15isOtdFE2tlkbpdWe0j9ayvXZv6OfiQtnvHgausqy6HFeW7W4ctm+uXaCx0uBZXlBGPYsbmQj49dxjf7AHj3v2QuFaW9S6WMxncI5NkUs9kEzQZNTkFTVhNYH0I4AMA8Jy3APIhQPeTgPo2QPcgwISeBwDII7Re4ijx7771xz9/wmDynw8ASP7rA4DkRa7kTi6TXznPdVB2ffas5yJwbmL5nISfur/6Qz/7Dbgn0e/qzNf+FyswlcnAkzBQLyzq4OG4ORnkRSwvhHmhrBfcerFOnZvurZ8CUL/2iZ5jpi/txdc5LBFineeTkPyMBunmfVxreVpZ88p5rgdyLa96xtKt7JhHdH06Xx+bSsfc5ATf69wqF3t1+tni7oS3m/FvyKh+dtw5p6fkLv04+Ii/cVTu5CA5q/s/zyEpZ9KwRyaZ4Y+Sft/3f98PgXmuyfH1Mf1uOJdf8bF5fk39y1ki8viIGMp1ca22MNe3yl5furirtjU9YxN5FJOZVCuDew76tE3K2bba9SPbaRvhOXVHfTzEXrkc6WvrsVVGHFCnxkPqnp9qfBGD2DIWT2Ti+aZeE9fsZWMfmU/qKR9KH+nfPUli1iHJNME04TQZBU1STVpNYkETW5Pd7i2A7qcA+TaAbwLkQ4B8G6B7ELD2MCCT/JRrwq/uN/6Z+Oe3/pn847eH3/53yX/37X/yJpdym3y7Bq5LrtUeOcLqQ+f87t/Ev7723yX5IxvjxfhTnAxMBp6YAW+4GFb5gFy44sgLYF4g60V2dKHWzlsA3Fyoj7D2m2Mipz/thbjOZ6k73yem+60P541F4nHdY71Z+8oxercOabNObUt/i2O5Hvrw1AQlD8aEvpy8ul7n5Fxz/pfI9lP7X/Alfz1v3Twem8tuzCN3+qnfd1jnWPmq+747P5ybWPDQ8U9+93d/z0/8+I//nb/xmc/8aL6J5Hjphz4u+Hc+RzReHpvn19K/8VLnoz3xNI7gvcSSuuu1F3OtkY2BczDb1RglPrGtxWkm7OfK2a+JeuKoP9tZVz2xllU96yJbLtbyc3V5S0x+WSP0xG7drNOVpc1YwKbc4Si2iEHKjMUWj+eMGtf1HOIeyD2iTcyyB8t7ksRaJ5NOZZNSk1TQxNVk1gcA4N6HAP4cYM9DgPogYPQwwGT+HBwl/lvJv4k/uDf5hx85k8PkVa7lPpG1Qq9rNtINoD2v/pP0e/CtP8m/R5fk598AqA8K+N3/zdiPEtPOaeJkYDIwZiA3nzJ4OG4ubHkxywtgXiDzYoqcF+uUuRFAB7kBV9eWdZVr3zkucvrUXoSdy/FEk/OUGW3q7wIe1zk5Wllz+K38j/S6LjvWxjXQL9ZA21Oth2Mf8QI+vJGsOOJK+y7O8CfX6yjD0VPxVceRL3046IW79270OkfnLuZ+9xyQuJVMmISInGf+3Pd+7w/81E/9vX/y5ubDA4DuDSTH1Y/0E79vjyPXzlceROY/P9sMyJdoC/VE5OXhegTmenUy66rdNQbrHjUO1tB2WSdjNOUuXolND8qVQWIz9U6ubRyDulmWsv1os03V7aPas/6WnH1s1c1yeENPTC6rnPxXmbrYxFqO7jomIo8O4ocy40i8PTdELK7qNZaN/AMa92gpL2ud1u3Kd9tGieHInsllJp4mpaDJqskraEJ7rYcAo58EkJB3DwJ8GCCOkn/LM+FXtm8x30ZYe+X/ock//Mlp8pz8j9Zry56BsveP/9Vkvib/Jv5rfwBw/jd/yfyUJwNPw0C9sHhzxejKBywXNS94Xgi9UNaLa71Qe1HHrsxNQn0IUNup1/4dV0y/kE8uwHVex4trx8XTrMLbGcX5Jh7WWo5izSuvdd3lf4Rd+8XaOOYSn5qZnD9jH/XgAr/rfOq81+K03nDWtnJbx1jwhT/p31FOv5XBx/5kHDHWkTtk/I2jzi05qNy598VMFFI2sanIuYXX/E38Sf75fPDBB99hn4mOr0/pa86hzPGx+X3t/Xfxw5yNo5S1HTDiKteHdUPP9UvZ9a2Y66+8B4kh6mUsIWeMKhuj6Mii9kQfBIi1vm2z77RlX9apaJ/ZrsqdvtaPZfYtat+D8lc5RZdrsDusYz376OqmjXhAr3HR6RlPKWccLuQ8Fx5j23g2xkE+2POzpWfdi+StBLEr9yFAJqDImZyasD7lQ4D6swATdRP4S9A+EjPxz1f+u9/7P0Xy7zqwVq5Nt26drQYNv8kf/R0AE/9M8Nfk+mAAnT7mq/+V9alPBp6WAS8sicjH4+ZGygtZXuiQ88KYF1JkL7oVufhj8yaAmxtu1NNmndoWvY6TPlT/9Psec17Hi2zO/WnZf7ujucZ4oXxWwpbcb8m5Nvfr8f7qt6pPvS453i4+6pxrbG7ptT168oR8whWc5XqdyqxnfpxX2q4l23fiLu6YW86/ctXtfc8ZiSYXoAd/1I/E/+//g3/404eU//iv3/7bR46jD/qVa7FYh1POc/7X4va19yNna/M0lqijfETPHyuYa2jMaXOdKxoHI6R+Lcs4Stk4A43PlLU9BLO/lGufWZay9dJWZXXQg3bKiSN71hnJcEdZcjiScw2oU3XbYVeu9bq11FbjAt0YUjaWwMU5YhSTxDFlp/FsjIP5yX2SctZ5sNwlhXtsJpomn6IPAXwAAPoQwLcAQN8E8KcA4OhvAmz9XYD6NoAJeibtncwDAexiV0ebfSZ23/rzUwVf+/eVf/DX/8ufuD2cY85bLpIfOUse5VauxT3rNarTBRD/JV/3EMCEfi3pt8y6Iol/JP+PFs/dfKZtMjAZODCQG08ZXB7lIpYXu7wQesH0ApwXW+XRBR87N+w8CMg6tBvdCDiOmBfq6uPtxTbnUed41I0N+VB/bej8Eo/rHlxVLpPnlFkHYyDtyrWfHWsC5/r3VPw7XssFPtd5OD/nbjxuofWzvXId44SrGz/uuDn6eWBI/9FSPpRe99/sP/1Yyvh6d9R5OV+5SM48Z4h5XlA2aUk08fcb/3/0j//Rz3Ac0/83b/gbAPZRzy/6kL7pt/O4xeM5I3m4LsPvTm9y2GHakPvjLsZyjVy3EeYaK7P+KRsPW2icJmaMKZsYG7PYlSvmt/61DH3UNsfKeqP6Xd9py/462X4TU9YH2+5FuKRucorMWoijdbE8ETn1UVvsGQPKHXaxRQxiz1hcyMTwTZ0mlt3xxji68b8m2+5BOEoM99hJQKlnIgqapIKZvJrQZpJr4pvJsAmyCTNoIm1iDfrH9fJvA5iQZ5KuTCKPbEK/htazbaJjiOlH+qfPOQ/nlvOVg+RFrpK/5DX5zjXYs2a1zih4eAhw83uYv1YfBJDQm+SP0KRfXCT/hz0wGnbaJwOTgUdioLuoeNFZIps0jrzg1QtiXlC92HbY3QBwk8DN++hmoesnx6u+pJ/p/63c30RCdfLySNQ/u253rzecVp7zZsmyzkZZrgnyYl1O1yTX4ynWxTGGfFT/nS+YsXiJnH3VcRY8vd/eOKbvydtTBFs39oFDfI0j55XzTb66fT46X2SS4m/8+cafhJ9v+X/4B3/wR0j284/+8ep/d47JcfVHH/U753JD7DJODkzLxVPw/lrH6DisXJ/qEWeuk+vWIWuL3TUGWXd1Y6Ci9ao940e5i1tsxl/G75q89SBg1Naxzhkv29R2WYY8OtIf2ySO2mmHP2R53MK6FuqXtrO9aEx02MUWNmNwE5fnEfZ0xr+yONrzW+Wjdgt7TQjP1Wsy+tgPAUisM9HOBNykPDGT90vl7E85x01/TPzB5578s9aLYKjKzfm1+58BSOhN7utDAO2iyf9Hfu5HPrjp/ioxW92c+mRgMtAz0G04bWCVz3oV3IulWC++XtzXkBsd/kuuWoe+RjcEjgfWC3RenE8uxMsLr/MXYVA+ejZfrtV51bke9JsTfXKVHFZ+1XMNch1Spm72dXKT1K/HU7MsJ2dxUedv7GtHV+5QHsVVnlifnit8rp/OVutcotd+1cHjEbGUc3KeYPIhb2I9D6BncqHMOeMn/+5PfpaDpJ8knwcCloOcW2oilf07Zq6Vfqbv93sj53mUL+HyXW5j3MhB6srGE3WUTzFijTXKNauy65qYcYhcY7OWVz3jx2tVxpdyxqQyZcrGamKWXSJn/ynb15bN8kTkPOhrVG5Z1h/J8GiZcnKLDPdiXYcsq+2q3rXtbMZCxkvKNb7QMwaRh8dpTBvn7onUc0+kPeteLJ+b8Gd9v33GVh8E5DfWfpPtN9tgfuPtt+Cg3477bTmYibQJdibdyJmQI5uod+iDAMqQReWuDbY6RvVB39LfnIdzy/kmD8mPnCWPlWN5zzU5V94TOKM/DpgPAkj4eRhQE3/eIuB/GNgzzqwzGZgMPA4DeRGp8vHGqly0uotcXgTzwlkvtOpc2JG9wHfIWwDdQ4Bsa39ijp0+IaffJxfh7Ytv8vM4q/H2ez2uOXzEuid3yMktnKMn9ylnXddpdT3Ga/FUa5DjHDgJLuAl+cj55byd6xpmfeXsL8dh3JPjlKv0nYhSz+jqbFl+rmx/iciHI/zO+WQcOXexclbPDyYSJi4g5wq/6fdnRCb6XdKfbbP/HFt/XJP0/34tnOeRa3k4l8dZ/8ihXMiliP0QVx1GrLk+uWZVdl0ruu7nIrFDm4yhjK2UM4axZzx2csYy5epd3ce2OQ/G0ffEUbn2rm6WKSePyNirzTXCnnKtN9Jdr0T7GWGNF/QaW51uTLbYxfOpre4L9Yq5X2rZpn5uwtjV90FATVAzeTWhzSQ3k99Mik2UQRPoTKpNtMGahNckXX2U1K/ZbVuxjpn+pJ/6nvPJeeb8kxe5Sv4qt6yDvHdrste2GSB3FYh7/kAg3+TXnwb4LX8ibw5Q/6b5g+Jzr3+z3mRgMnBgwA23hpQtjx03VPVimBfNetH1Au4Ffg25ueAbPG7mu3r0bX85To6fvtUL8slFuM59qb/WOMp4GK595S55RU7Oq8wa8S2sa8la1f4Wa7HkXZ+eiv/kgzEP48c+qL7LRZ33WnxSRn0x29ofmGMtOMIffTtF/ObjXKp8W/gI/7hWRwze8D/nk/PM+cOJR7fvu+SG+Mqk34Q/kXZd0lTHcOxcG31N/5nP7dHzn9w/AtWvvsuOP+OKyVuu7YCuSWCuWcquaSJxiJ7xOLLVOugZO8o1vtQzee5ies2Wcawsjtoxbi3rbNTZslueiJyH/WzZslwZ7pAT5XOEuR7UcT3EUTvrWg/cc2TcKGd8rcm3542I0Vv99DySMe6G11b3QOrWTcx2aW/lvYniWj0T0ZqkZgJrUgtmsptJcCbHmTSbSIOZYGfi3T0M6N4MqMn8Xn0t6Wfs9Cv9zXnk/HLeyUfylPxVbuV8bV32lLVBscPIPuCbfd4OINn34AEBfz9gRxezymRgMvBEDHhRSEQ+HuUi1V3UvPiB9cJZL7p5UfdiXzFvHLip4f/sBms99TpGXtDxJ/2r/p9ciHPuy5tMliR5eqIletRhnE+d22H9Y+2Tt+RTfnPd4Z/1IuHnr6/7rSzran36yD4X67BvDR6VmJvOj3sAeScX8mBMwoPyGtou+VnlCH+qjwcdXvRdGfTTrblll6J9Jh58uJA3uXKPi8RQHvBL8g/uOWhLvexD2TFAx3ddjPkzYxY+5eRSbt/1dvJ3iKcDG8qnGPH23p2ca4bsvnJNRfderrnyHjRmOszYQibmRmg8jjDjN2XrdzbLRMdWvwTto0Nso4OxsqzqWYYMn2LHLTbWZ1SW5dZLRFavdS1LJF6qbgzVWBvpxuYJHs/dp7F9PJdYxm5A5rOFh1o7/92TJO6pY0JaE9VMYjO5zaQ3k+FMkjN5RjaxzmQbec+DABN4Ev7RgwHt1u2wjlV90cfqe84r55s8JD/JW+XU9ZBz9UtwZ5jMapOBycAzZ2DrwuDF5BTvbqDyIlUvaF74xLwwIncX5XqBV88bgZR5tZeHAGmzjTcGYo6XvugfmHPIud3K/QWYJZbHXO7OluUvQXYOq+ufnCWXyHDOTacJ/9/4zGd+lD+8xl9f9+ENa1HbZZ+LdejXQD8fm1N5YBzlzQcAGWvGIDFJcqq+hdmHXCVHyGfwlHwpi87tIVzaV4fYDsf7x58t5FycX845+cn9rcz+z2PPt/7EpQlRlbMvxxD1Rf/0F3QeK2txDX4fsjavse16nDXx5vq4Xom5nsjdOqdNuaJxsobGVEWvZxmHa7JxTJ2MZfXEtX4swx9lsbNZlmg950RZJ2vrMNvUcvjElrjGcZaxRurKa5hraruKWSflGkd5fkg5Yw/Z2GzRWD5ink9yHyi736uu/Wy8JGncalMT1kxmM8nN5DeT4kyWkTOZNsEGa/LdPQwYvRnQJfdps11N+NG7cdOv9LfOJeeZ809ekq/KJdxfI/F3Dc8OmNlgMjAZeDEMeKFIRD4e7x9v3L1I1YsYer0A5sURuV5I86JeL/rq3hiI2Ekk63/ZZX2wjoOevlQ/61yc4y0mD6cyiyxvL2bBNxx1Psf1Z47vH2Mg+ZJL+CXpN+H3v1gD+ebf5Nf6FbPPHOuO3/QF99PHjelcpfg4fvCAn/qd88lYMxaJXx5eoY9i1Lpg9pF9Ox644Am/TuNTvyEhZXQ+8njQjnraU7beHnS8A+Lf3ZFzyLk55+RBvnJ/w6VHJkLYTIb2oPXtKzHH0x/9S5+di3O7xSPXcgBfl/K4h+t3pU5yqJyIfDzu4i3XxvVKdD1ZX+RE13wvGisdZkylTNyhZ/yNbFmni3HK066e7arcjV3r7NWdF/U72bFGZdpH2PF6ro21tE23rpRpX6tnnURjqWLGWycTo9gzVm/ljOd1mXPAMfYPZwR1yzo81Dy0VV6gieA10MQ00QQ2k9pMdpEzEc4EuSbPmVhnwn3Ow4Auod9j20r68SH9q77nvHK+lYvkSe7Eayf/9GcwcF5hP6hPnAxMBl4eA1wU+HToBeOINxemelHqLmD1gpcXRWQvpBVHF3pvIBKVORGRaJJwjtozDmU5XvqU/tb51PnecXXk5JS75BP5pX22YyHiIPmCR3TWxv9j3f9bnTUy8a/co4/WYMH/8qbGNXgqfnO8g7zCg/Nxrhl7xCzxqs3YFLWL9rGbJ/wac5Xrm7I8alO/BO0DrPKuB0jOWQ7Aur+JMw74VFbHpl15C22bfdUx0x99dK3dC2fErNxcwvFsc2BADo21HmOvuj6ul+g6Jrrncq07WZtInCBnvHRyjS904q9ixmTKGePYUzferW9Z1rPs2qj/9KsMemhX34PwR73EKnccd7bR2mgHPbK95diUrVeROMKW8YRMvInGXkVj9B7783kf68dzLjsk98fWOcO6w3rXSPy7PkxaEzO5Rc7kN5PiTJZrIp1JNnJ9EDB6GGAC7zf4XdLvGwTW7bAbr/pUfc755Dxz/pWb5A35MZL/fADwS3/5L/u2/8/f+7E3v+ubP/Vf8rv+iLM2dvidP7/7/5W/9uu+g1hvK03jZGAy8OgM1JO8eiLy8th5A+XFLS969cKYF1TlvLB3NwPeMNQbFeqSTPFq+eiPAtq3Y4npV/p74cWYhZNDF7Hq2l8aDmMhufKmhjXiv1sj+edBgN92J9/djZHts8/7GyDir8bkgUV9eypOHe/iRBY+fABgrBuT58TqkCf36ilf+g5XyHwSU65lqVcZnY/tD9pRx3489O8GnUPuP+NETkS5AomxTGjyvKDdBOgczH6Uc1x9AfVT350L+F7McTH3AzPJU8ryNvF8BuTxGGeDmMu1yTVDdi09P7nGe3TrGhvGCnZl0D2ecWVMazP2RMvVE0fxTR3LlLPdY8jVT/UOsaVdvUN5o0w5EfmSw7VJdB211X7TnnU72XiqWONupN/HasbytszucR8oryFluz5d8v4Qm8mqCWtNZGuim0lwJseZNCPXpLom3aOHAVsPBLokX1uX7Gvrxq8+1jnk/HLelZPKmVw+ZF1GbQ0SEvr/22f+j28++//7e29+8sd+6M3v/KZv/K/4g371v/Az8f/OP/Gdb3hgwEG7/9X/8t/9Ph4GzD8AKKMTJwNPy4A3TIyq7EXjFPOG9k7uLlr1QodeL4z1gtpd8LVxk4K8hpTxMwC+ZeaGx7YV67jo6Vv6Xud2fyFm7seLa+Wpcon+Ej81HpjDca4RC5Un15v14OcZrIG25Bo5+Vau/e3gPfnV77RdS3b+9HeQBzw4F+db4w5uOLB3MYqttslYtf/kasGTfunnGJ1LxeQxZep1n1pHPRH54ocm8sReZ4+D9ajJjvpeHPXt2HVdXN/N9VjnXz6TK20T1xlIzqp8iDe5d08UzD2E7FqKnqdc63Ox28fdvs8YIw7Ra3yPdPdDF+fGdJZpG/V3Dbv+i/SpDFa5062XfCnLK3WqzbJL0TXO9thSR7beGhpHFY21Gn+pX3hOX8b9If7ZRdqV3Vm5b6pN/R5HieFD7WsPAmrCm8lwJsnINYmuSTZ6l4yvPRAwiT8Xu3E6f6rPdU4538pFTf7lUXzoutT294Fwcx7l23+SfxN7k3vsPAz4qv/+P/+n/pM//x8vyrMuMu2p/4Uf/egnbuP9foApTAYmA4/NQJ78q+wFY3HT7kUpL1TK9SKHXi+O9SKqnhdyL/xi3jys3ZzwV+U5rG/7io5ZL+Lpv3MSnfc9Hi+oR56WF9tcO7lN23OX0+flHN8//hREfkQ5dN2rnnZky0X7Ae+5drwl5/Cnj+JTcHrkQr9uUL+dB+hcM96IRf/3A+w1NtUty7b2l2M4bssX/i05O/p+YCr1lClVV+4Q29bHfg7YcIbvzsk55rzhxH0vP+odZrJzrkx/tKn9Oi6ob/qq7+BwPY58yge8KYP5UR9h1p3ykYGOL2yHI2LvvTs51yvj0DVljZHFlF3/RGIDPWNEuWLGFDIxV7HGYdWN1b1xTvtsU/t7DL3OKXXkTteeKH/YkC3Tri0xy6rsOomUp1zrq2cdZbA7Ml6MKdHYQ1euaJwu0HjeRnZGtyfcMZapb2JNCK+pm7R2SS22TH4zKUauSXNNqrvEu0vQq20r6ffBQW2Xejc2tupjnUOdY86/48i1kEf1a2IGCK/+881+fQhQk/w9+t/+iR9/w8OC3/RbftNfoF/2Uo415cnAZOA6DNSTvjp4etzdKOUFqF6k0L2oJdYLohfQil7IO+SGBHti3qRkGb8x59Vzvl3t+qrjqqef6X+dZ3JwK5/yxQrJZ5XRX9rnNB6Y3/vbDwCSx06G82pf5fuU6+T5KXg95eKOh/Q752RcGWcgscvPVepPAEbxit329pfc5djIuTb3cs9dzgf+5FN7tXUc28Yy9UT7O2ATO2ucdbzk/lfemwBxjtiqa59i9cH1AF0T55Drcc+/c+7XQZ6TJ/m0LPWRrdZ5V/SMNblJLo+y63CHuVbKriOY+yztlrn2iRkT2DNWlGs8VT3jDpnyRMsTjWlsyqC6WG3ZxzXk6qs6fSuDVdZWEc6wiVmefCpnPeUsUx6tzTnlue5rsrFDHeXEjD3lxJPziHHcn0+O8d6f090jeX5wD9WytN/Wv2Yy2fWVyWuX5GYSjFyT5JpE1yR7lIxrz8T9IbL9dVh9qj7XOdU5d7zIm9hxew1bBg1xyav/f+Y//DOr3/LnAwDuz1Pv5P/zD/+nb3iwwMOA+pOCxfhTmQxMBh7EgCf4ROTD4YUmMC9MynkxUx5dEL3Ail7c0fPinnK9eUg9b1poQ/LPX5snwco+quz4YvrrHEDnCHLCOznk6ogsiHxWGf2lfZzLMC6So+QuZW9+xCxTzn5O+D7ye/TjyLM+Pha32f9h/IiF9Nu5GE/Gl8jfqdgTnxmvtgXt13HAHP8kPvVzzF/lM3X4dO7a0ybf1lHPOrYbPjhyLs6NeTr/lLHlfk85E5tMgFLO5D/lrKOcfSPrD/ig9RivQ8/ZgVH5FbPuocb8Vwbk6Bh3cs5eQHZP3GDuHWRjMZG4RE80VkeYMZJyxk/GFHLGWY2/Nd2Y3UL6sI6y/WJXfgg6D/pIufbp3K2nvoaeC0Tryi+6Zdo6PctYP/SKWSflWi915LUjY6qTayxWPeP2Xja2T5H9kHsgdWQ+7pUq3xZ2/1wjidzqwyQ2EdmjJsQ1Ya4JNXpNutG75Lyz8SAA+wi7NtXWjd/5WedS5yoHifKJTfmxsMYE39Z/+tPf+uav/ud/efgQgG/3a6K/50EAbxbwVsAnv+G3/635VkBlfuqTgfMZ8IQv0oMyuDziRokLTr0gqXcXs3ohzItolb2Qj9CbhHoTUXXaY+MVa/743OiPAjK+Nwv6kv7W+ThP8P7CKzeVs6Oe3FYZ/bl+Mh7wcRkT6M79DpMf5MrfHr32Ucdo/NA30I++q18TlzwEB/qe8zSejC+RB1T8ccR8QGV8d/FPO8qJZWT7BR3P8cUT7vS1W8v9NriUA+XKr/wn2mYRN/oKOg/nJldg5aTu+ZrQqIsm+ltofZAxRMdLP9I/fT5rPY48Hrk5tclx5TI5z7K0v2ty5SF15MPhPgjMOEzZmBxhrnuVjQ/syokZS51szFWkbrWpZ/ymTHnqKdu2InWq7Rw9/UzZPrSBVdYGVs7Qa7n1RNuoi9q30LWkXq5fytmH9kTktWMUU54LMw6VH3BO51yQ+0FdG3r3acsfK7Hs+jWhzWQ35Zoc1+S5S7BHDwPOeSBQk/vU7adL+LGNfKq+17nlvFOGN/SOv8ewNYHyof/Rb/6N/ye+sechwCU/B9jzMOBHfuSH3/zhP/JH3vzaf/Ff+P75VkCzCtM0GbiAAU/y4PKImyQvPl6M8kKVFzMueujdxS8vmspenBOR8+CmAT3RG4kOqcvNPicVXrXmZib7U9aHxPQ755XzRpaPe6zcHRYiub1gaZ5Nk5zHIUZKbFR+krs9cm2/k2P9gqiUH5O4w/wZLzjQf+dqHGVsIRN7PJzKBwCjGM445WEBB/3Sj/07HqgPienjQj6N1+O8tssq33IvWr7ss+ELX3MOzit5kwew4wpbJjUjOR8ApDyqj72Ol76kj/qdc8l1QF7wLxfbXC85PER22jLWk/+0v4tycnSU5T2wrpN7Kdeyyqy3Nte+YsZHysQQesYScWZ8J6acdWpcGqvGMuXKHdby2t+luv7SPuWuP8vBcw/5rO3kNbHKtq2Y65dl2NWVK1KOLe3qicRM1Y2jxBqTqZ+cR/afQzgPeI4QO1uWnZw7HiOpXOvT5DaT3pRrooxek2n0UeI9StTTToKvPpIt73A0dudnN5+cr7KcoSs/BZ4ExI3hiz/2sU/+3t/7e9789t/+yTe/83f8G2/+nX/7f/aGnwXwQIDE/ZKHAvWNAfT/4Lv/2Gc56Jc/HMi47JvOp2mbDEwGegY8wYNV1rZIcLjo5EVIOS9aynmBQ/biOcJ6Ee/0ekNBne6mQhvlJEwkWmt/FLD6VH13TqBzBndehGFffquM/tw/+p744PhITiuvQ477mxz407fH5NIxjnNn3Js9wZE+OzfjqMYXN+M8lCIu/TsVxmwX48Y5/7uFbwDYp2M45ohL/dyFPc/OW74rH9rFWn5of8OVPuzlrJ4LkivkLrnBlgk+cj1qndTt0/5zzPTHdQBdC3BtPZz/Ca7zXvmX5w7ThvyufUZcaV+NxYxL5FxL5VzjXHdkYyFjQ5nYQc4YSpk4QzfeUtY2QmKWMmO34qjM/mxvPe17MX3t5LTRp7qoDX10yJ1IPWWwHpanvbNR7topp57tU6511MEqa0s0nkZYY1H9gnMH5wDjX9nzAvazPk+RZI7GMNk1CU7sEucuwR4l42nvkvhzbdlflTu/Ov9zfspwg5w44usx7KNgIRn/6Od93l/jAQk/leCPJ/rfI/7m3/x1tw8G/ugf+Zbb3/bzWj+/8+e/A+wS/c5GfdqT/PNfD1LHnwj4MGDk27RPBiYDh4tAx4MXAS8SB3z/eMPORccLkNhduPICl3JeOJW9GCci5+GNgTcilCnvQb9t9b+jy76V9UdMv+scnTu480IM3/Ir91XX/lxRfw9x4c3ESnzAGxxV/qpuneR1J7dwpV9VfgweHevAQcw9fXd+xpAxRawhf/rTf+AP8vv/0QOAGtO040EBDw0osz/QMUDHBdMf5ZNYDf9veUxd2XVeR7k3Nqq+iy/8dj45R/coWLkxaanJTpf8U6c+BEjd8toXeh03fUpf9X9rPTbXYp3vyrN8J6ZMfT8pa3st2M1Nrk7RGL9B90jF3FMp5zqP5IyLlDN2lIkv5UTtNf5GurFLeSdrM6Yr2m7U/zl25rFVP+vkvPfK8ErdDpPzvTJrSd0trP1Zv7bFvufI2Eq5xmPq7Tlk+7zBXnefiO5/dVH7CT5GUrnVpwkv9UyER9gl0l3Cra0m54+hO1aHnb+juTn/xC3url1+EhDFQAzzij6/2ee/Afznf+uv+KF/8V/5H/4/eAjAAwEfDPi2AEm9bwx8/w98f/vGAAk/iT/1Rm8T8DBh/neCZTGmOhloGPAkD/ZH3CBxscmLj3JerJC7i129WKa+90JPPW4mxLyx6GyWU8a3pvwtABKu/M01ZR7pk3LOJefp3MXFhXjE5fii2yzNszNlrODcMl52xAlcwWGH8lhxwStj1HGfltPk4DD/u3mn38aJsWMsgcaav/8nHnkoZax2SBtu0vkpCw+y7CP7dSzHFtOvKp9wezeXob3nfhkHa3VK/+mP/jqPnJvzBTt+MqFR7pL/TPS3ZPqxD/sEc/z0K/1Fdh7OS8w5Iw+5Tq7WOF2WuS9BPsbrQTv9d6v8tMXLshibeK28xOC5rg1rhs21q8gaY0t03cEaE+rGDbpyojGGTXkPGp+JGbsp01/VteVY9pW2a8nOLzF5GMnyVvmkvjZRm6h9C9fWr7bNuspglbVVNK6wK4s1Jqvenj9GsX48H9R9X/W6y9vyayeU5/RXHwTQdpQsd4k1ti4Jr7ZLHwLQD21rf1Uf+Taai/NMPIe3a9atQbJT/xBxzlsC/GV//qjf7/uW3/f/5WcD/GSAhwE8IPDIhwO+8s8DgK3/bcA3A/73/4f/4v/OWLf7ZKeDs9pk4DUzUE/m6onI9682e5GpF5/u5qhe3NDrBTN1L8yJyPXgpgNbYpW9MbGeumjS9ff/wT/8aR4I1DHU0786Hy/MYOVDnu5ONgcOlxdj4ip5Th35JXy6ee2OFWMmueu4pPyEz/fbBwBwJqfyV3Xt18Dl/PHp5qjzYU7GjvFkfBGPvMpP8s9n6wEA9Y1dHl7Rn33Zt2OBGaPK6d9IZh67jmVML/kYlZW+0wd97DjLuTJn97KYSYyyiftWkr+n3D4THRt0HUDXAlxbj5y78hV4J7aNe9fEeE971quy9V8DOmfnqC43B1yJS9cGzBhN2XU2dkXsxkHGhXLGTcoZU8oZbyOZ+Mwy9YzbkWw726CnbPljIzwwRvJRZfgb2SxLjpXPwW7ttI36GZVj33tkXHVyxqNye94YnYOP9twT7gtt7v20a1vgNZPJS/vyQUDiKHkeJds+DBBrkn4t3f7X/Bj5nvO7lKtrt1sEw8OUDxHv7K0v/OhHP0HC/it/7dd9B28N8EcFeQjgGwO8NYDOGwA8COBNAQ5lMA/eBuDgpwa/9Jf/sm/78Od+/pc/zNXZejLwOhjIE7wyeDw2bo7qRaq70I0umFzEKasX8073piCxyuhrB/1yU2PiBaLneCNfc151zl6IwZOLcXJ5lIke+X4JkaSvHQ5jBS6SmyrDY7WlfsLlTX93vB3HXHIKl/qIfK2PfTou/R5kfLo79D3jw7gxrow1Ek/fRuEBwPd9//f9kLHrjbeInfr+vYD64Mq+QccT0xdl/dyDzm0V5WIN4Yhy8ObIsfUL1O+ck5yBciTCUR57Enr4o94Iax/0jy3HcXwxfUzfnQ+Y88z5pyw/m7jG9aHsGKNHHRsf4/mgHf7Vthez7UuQc17Ix+MmHpPvXI+Uc/2M1UTlXPOMhZQzXkaysZXY7YEsVyZWkTvsbF3dtNnvY6BzGvEwsssn5ciidnFkt7wi64dNHJV39toG/ZKjxlrGYZUzdu/ljO+xzL51X6zJlOXnvs21E8pr9JeJ8loyvZaEZ9mlyf+eZN9x1vyEk5yTHGlTfxuYQfGo8s05mp8S8HCAJJ6//u/PCX7nN33jf8UbBBz8hICD/yGgHt/+R7/99m8O8ADhIz/3Ix88qr+z88nAC2LAE/rxpsiLxs3G86JSLzz1ItVd6OpFUt2LMlhlbSI3Hcqg+iU3I7Tnt9e8AUDiNfqjgPop1rnl3Csv8nWPctkjYZL8v4SwSX+XMRPxwvwrN3t024GL45S/t8Xdcc53Pua8jA1jxhgCjWN//+/fADAOa5LpzTpvCBCvo//JIsdwXFF/Oky/t+TFWtS1QT9dnwNPTd0cS7/0F8z5yJl7332fXKVcE/hRss8DgDyyXtdHjuG66Ev6mL4j57ycq5g8VHnINzyv8X04g+QeHe2TWufQ8ng+2tJtn/3b5rmhviYi3z+USr7rWrheIOuZurZcZ+UaC+rEC3LGTcpe47ApZ6wpd5ixqWzsUl85Ubv92a7aLT8Hs6+tdjnf5KPKcidmuTYwD+qMyqzHulVZm2j5CK0Hbh3GToc1xohJbDU20TN2N84NGf+5b7V3+3ZY9jaSztGYmRArJyKPDhPxp8KRH9XOXLGN5vy27V2wvCXbh9gH7EkeFNSDBwe+WcDbBZS/JT/nsI/EgCepS/GR3HqW3a5xRNnh4CYzjnrhqReoerEbXSDzQpwX7k7mhkF7vXnAXm2pr5WbUJFUITuG2Ple55fzT26Ss3tZTpdIcLgWGSidLcvflqxficjHI+LFuSc3e2XbLjDHWcrJh76l7SGy/R3n6Ngx15yXcWG8GEvGFshr/Hzrz0FS3z0A8MaZuj6woj7tc1/Yr+OAjl1R3zpkDthzLp28WJPgYK89+0w/9DXn4dycc+7vTGCQu6Q9k/pM9s+Vs2/HTV/qeuQcnJeYc97ie5NTY3GMxL6xm7Jx7d6wjvZOt71t9uhZ9znIOa/jg5SI44xP5bpmrCU217TTLctYQM6YTrnGkPHVxb5lHXreqEhdY9cybfaTdm3non2Ie9s7z+RkJFceK8fqtLeutj3o2oG1/h6b7WlrfW17scacsdjhyXniuOeX8b60ux/d891+tk6LbzsB3Rrf5DmxJtkj/doPA0bjVDtzwraGW/N+qvI2KKbxnWPAE8gWQox1HkqS/YjX7s9+Kz50nOfWPueHfDzipogLTF546sWpXtTqRRM9L8ZVrhd6bhq0eQOBrl3bJUg/3ND7SjUPAfb+UcCcZ+Ug+Tm5IMNlcnuUiYcj52gv49PHDfNsjuRmJNOOsq79rW3Jk5zBVsrXZM85OoZ4GO/GX/zK+WRMECu5DzKeiT9vkElG+X0/ej26OM2Yt08wx1LOeE05/VyTc25Vvl2TOw72yrUPx07f9B10fjln5I4nuKpHl+jz9gX7Hc55+MdDFR7A8JMgDs4L3UEZ9WhHH66fvumrmPPI+SE778TKTeqr/B7j331Q0bhNVM662Phg47MXs+5tw2f+T875IEccwzt8J/+5Tsiu50i2PGPAPWp8jJB4osy4ErWJ2sWMR+UOsXV2+xGtg56y5aJlovZsZ5mYdaosL9iVO/T8IFKnysm/ZdVWddZOm+uYaFmibbJeJ9Om2jOGLKvxlnrGpbHanh/WzwvuWfeCeuLmNn6qRPPccUygaafcIbZLDx4QXNq2tuv8PHfOb6P+ZoDMCq+CAW8EmIxyxT0TtY11q97ZrVPRuiBlDz3sB/TjmOqgNjHLnrusz2tI2eEoN0V54ckLUr2A5YVRuV6cuwt6tXljgF35mugfVeMBgH8UEH/1Q98TvUCLyUPyM7wwy+0SiZvRmjyHmBr5doyVnE/ETd6YVH6qnnVP5Oz/KCdvVb6Ut26uaTvMOeaY8zAejI+MHeOqxjA3xT4QQK4HSScxyt8MoF5tb79gjldlfUrU3y3MOVb5ZK2Cmyyr7XJMfUqfc14558pPTfrVTf5J1tnrJPom+HDpzy/g9twP7Xl4UNcjfc65IDtHMeevXDmqevK5kI97ot+Th3L3iHXUxWpXB7NOypYdahzHUX9O6Hyq/wd7xG3l3fUBWb+qu6YVMwaMDWzKIyTeKTPuU9bWIXtjy24dkfrKFbu+tFlXvfaT5coVs61zHHGyZq+cJu+WpY2+Uu9k15KylNXX2lh/C42nrKctY0y5xqX64lxgHI/PCcZ/4kX79G0knQ8dk+SbPjqsiflj650faXvoXB+7/UVBMxu9SAbyQp8yk1HfQiduva5tV6ez0YdH149jXIK139pH9aeWV936zxWd7xG9iNyhFxrQi5GYFy/k7sKIbe0CThk3A6I3BqmnbPk5mO2RuRkhIfDmn2/9sFVf63zqfOUBTJ6QH3BhXovp5xBHxop+qh+wxE/Hw5CfbMseRz/u9eU4ByawPcbHfuuY978bzvXOODBGjB3izSNjlnjbOvy5ij8TyPbK9i06bof6NsKcR8o51yp364vNNa71s9/0I/11Ls5RrHyZ8Isk/nzDD28m/A9J9j0/dMia4I++6bOY80HOuSInDylXvtRHPN8E/2mMHm3sDcuVRe1gZ1srv2ty37d92E+idZ8D5pwO8k2sJrfyLebaILuOKWsT69oTE9qMj0RiCD1xTTbmKhqPHbp3aFPLaz9ZpyvTln3WNjlGyrYVnXfVk59Ohs+0p55yreM6jJA1pCyxrmuW2U+12WYPZizVeEMnFkXjEsy4XcjHPX8a78ey3KPuX3Fzrz52gvlY/XfJP2Ol/ZrJf+3beTme+kvDzQCZFV4kA54ARCehDuZBeS2rttSR+djmoB3+rTb1xJTtB9u1juxzJOsD5XyqfrAe/l0ry3pPIesL6MG4ygdcuSGqF6e8uHkhTMyL70j2wv+UiC8kCpkcmGTpZ84j5Zxz5SMvzsMLdOX7qOdaIHcf1uhtfXJs5UPMHOdwnyDnDYlciJQpi1n/Xs5+jzLzd3y5qLr2LbRdYpXRD8eN3/qG3x7GgbGR8WI8gRnj3jyvITFK8sm32LT1Rjr7yf6VGR85/UhZP9fQOSU63xHCzagMe/aF7Pjpm3MAc56VJ5N+0J9SsIfzf1joEvdr2lwX/Uzfc07KzlesfKDL04hH42+Bxud5yN44xvZ+Odspg3zcOwftef7bz/kmduG08p5r5LptIetNHde9xkXqysRQyhlTnaytQ88T7hnqpM021aZu+V60XSJyPbb6Y/7UkYcRwitl4p561nVNKuZ6UYbeHdkuy7WnrZM974nUqXLGXMoZm+5/bMq3uL2Pu3169r59aQnryN9MxJVF2ih32NnW2mRZ+mM/aXvu8vM8tU+vLmWgOwFo84JZTxxZnmWdvdq6+p2ttkN/W0f1Tz+qPfUqoz/1Rw5zXG3O4Yg3N0FeUPKCg5wXo7y4efFL7C7Q3BBws771W1xu5Hltlxtsju53t1s3E3vKGYeEwN/98s1hvZnIOSHnvL14Jy+Vs5MLtPyO45h1Oq7HYdVcL8sO1rfzr76kj0vZOV6CzJ12Sw6yf2adPqD70a5+DjoGbZSPGHPJNc61NzYyZoynGo/15lidhFaZuCc22TPawNoXuuOI+JBy+lRl/e4w56ec898j0456tgdzrPRHn+scc/7IJv7sWTjKh3km+dg4eCjg7/g5r9CGw/OLqN2/DTDq1/4pxw991Xcx54Wcc1ZOTlJe4/V2f0Q83updzD6NLfeLcofYnsvnuK/hqHAp97kerFeNW9ewYl134gGbcbGGuZczrpTX0HNDYu4b2maZfWlT34u2E+1fHezk2j98YEtc46iWJbcpU6+uRdVZu7SlrjxC2mUZ8iVHxlXGXMrGZGKN23t9e9+zD90D7kn03Z/nnqA+1D+TcpH+lMUt20N9eM7tdwfKrPiiGPAksIaeOEbIhC1T7nCPLf2ofar3WC7qZ5wc+/6Oc7Jc/9GrrH4oOfxrvbQ9pez4icjLI3jLi01ejPKC5QUwL6JeeEFukH0tlxtmfnPf3ax7Uz3Cn/y7P/lZEnaSonoDca7uDQR9cbNvgoXOof85p5TrRb5yk7wp38df8HvC/XEtiItcJ3Q+2qp8W/hI/zimmGNrA5dHzvNcufZ11HPsS6ab/tqXfldd+yJBcD3BXPeMiYwVYy1j1BvjRPaJujJxSXyqWw5mf8qO1SE+bcU1dXIeyjlPZeeffKzJthPtu+MKP50TmPNGhheSds4neb7g3EKiD2eUc95xT9PmkoP29OVDgfxpAePTZ/qa3I84d+6inFQccXzmueQYx8d99Bg2988l+/Ix2zBXPonL+Zfzk3Fc14P1wua6dZjxnHLGhTJxU2PdMu1ixtiW7Pmh7hvaWWYfqadseYddPWxbRzd+7d/5Y1e+BHPv0T71XBdl1xJducMsT7mru2Uzvqin3KHxWJHzALaT88H6Ps+9UGX0XZ/nnJw+xLdM7rOfzl5ta3oty75forwrSGalZ89AXhRx1gtjytouRfuqaH/Y+aTeydp6LBfx2/600bfyHjz60o81Ls950Fb9TrwHy+4NjySMxtEOHo/CTV5w8sJUL2xeREEuttwIcPPNzbL/jVneqD9Upt96493dlNSbi06nXd5goNP31k1D5SD5QU7ulIcxmGtwKhMarpEyyCfXMfXbwkf4x/EcS796LPE0nD/1mIt4nG/t13HXkDI+1deD9fivfVtX/Yj4Uw7XEnTNMxbqXjC2MvaIse4w0ReJQ/aRem2TfVbZcTt0n6avVc45ITvXxOSik90H2QY5+85x09ecj/OGB88rnkN8MEiSTrIOZw85GIP24NrBWK5N+ppzQM75Kef8lStHqXfc1ri81cf75hjTe+sY99v1c/+kzJjqiQfr2/lXn/TnyMvdfCvXuQ6u1R50rcGMgxofVTeWsCuDVc+yTmbPYK9oXfdU1qmyddcw+699Ztmevp1j5eRcXc5pp5zrMZJzXamjnnJn68qt16HnwMQqZ9wRk+g1NttzAHE83rPGvVj3A/Zdn5eYtF7L59eWzF/Cy64gmZWeNQO5+XFU/XhRPLif+kPlOo56jq1NHI/pTco1ER5qf+MT6sg3fV9Dyp7qk/xW+TiHmHe92OQFKS9qXky52HLjzDdlW7/D9dVcHg5Ql2/S1g5u8qmXDxPog5t+bzK8Sam69hHiN2V5k0Ef3Px7A+EcKyYPyMlRd8GW05P4gvf1GCNO6rphe1uf9AUfjjFUZecWsbWYP/WtU9se9Rxja876Zr3UlRORT4/ir2sn5lpnHGSMGFM19oivPIg1Y64mnewpy7KNcu276vqwhulzyjkv5Zy3spx0aB3RfsAcK/2rc2Cunls4B3DwNhD7H7ucIT/koB/7E+1blPfE6m/OBTnnqZw8KMMRslyJ8Iqc/C72UMZqF8t7bNmHMu2Uxe2+3Kvuv+eGp3s95pkcy7vrALpWa+gaJ9aYqLoxhB25ouVrSExarlzjNO3WPQezfcr0kWON5NFYlY81nT66cvhOu3pildFZS3FtXc+p1/Vj/IjUUQZHR41J9ZO9uW+P5v7M6+BZ+/SSpHG2+Vm3/wvBa+DhrGCZlZ8dA258HKsXxM5W65yr1z7VR7jef57olAfIyfK9m7KK2DaPuDFY1D3lrPO3mxu2p/rgU35SVz76XfjwIiPmxSkvblw4uTkm8ffVfpCknaSeb+u5Weegjr+95dszvkVbu7HmJsJybshpw00/fdAffXcPAUY3Gdq5SVD2ZkL0BsKxmd/oSB68mCdPyPJXcRFPcr8vrurascZpS73K6Jd87J+2VVYH1w/mSR1xq/6x/KbZ/bg5XmfHxsd6B+3Y17aPrscd1rXLNc4YyDgxjsSMt+7m2Dg37tTBtHVtsWX/a7L+jDDnoJxzHMW5sZ6YPClnX/YPpj/pP3PjPMFe5yEg55A8byRPJu2JyFsHfWSd7DNl16GuQfqLnHNRzrmmnHxscVvj8HYflVi9te2Ndepl+6pnWZXXx3D/uQdF9+LbQv1IXHJwM095NmYT63qlzrqq5xoTA+jGQsWMGeVEZA/aKo/Q80HGKXX32Guf2cayauvG6Wzpg31VrNykTt3UR7JcJ+Z6bMmu4WMgsUS/GVOdTAxiNxYT36t7UX19TxLzebhH6150b1T7Qn8NSeycw+UPJBbBMJVnz4CbWsRhTwbKovZT9ETT4bG/03bHshxjJNM+y5b9dWOHLU+Ul8jvRV+75OPcln4e7TkX5UTka37kzz5TH/l4TMru5p/c1QuUF0YuyCTjmeyj11dj64W6XvQv1bnJ8GbfPrw5Ud9CfKNO9RHd/pFHNw1yIVau1JNP5WF8HWOnWy/W1TW1PG2u+8iW5efKjpt9a9OXa6Lj5BhbPls322pLRD4eg33vWomuJ+iagzU+Mp4yBvPGGNkEM2VtI6x9pJ5jVRmftKV/Va5zQc+5OvfkYo+cfdQx0gd9ZF6cS3iQuJb4w5PngUvQNsl3Z6M8uUbW18ScizLzRa7zTk6UR/wag4ntOYS4Jp4zvqtsvFtX/RysfS519x/ox/2n/pTo2Mc9n/7GvOU3Y5q1cV1cpxHWNXbtjQWRmEHO2OnkWqfq2caY3ELbWE8d7GyWW5ZY5U7H5mFfFZ0XODpos6decl7Xg/bVhu56pqxtDTMuUq5tLEtErgfxh804rPjeTaxiA9sj43ops99yH3T6rj05k+fLk+fXwN2uIJmV3joDbvbqiBdB7Mo91pMM9dNWdcq2+jyW1/GrvvQpxy2yJ8n3buzK10D6Gx7O/Tifpb8Hu3NKRH7KD37xSVz6WuaZ3NULFBdIbszzNVwvzF5Yuwu4dfICXm8CRnreVFBnS886oz616w969ZtxmCt259Zhd7GvvCWnKa/G177Yquuaa3278GXttV2Kjmd79UTkax2Mk32v6ZZ19Xt/SuyzHrk+yrmeud41HmoMGWegN8EVTS4zCe1k2mmvfVTd8XL8Tq7+qtd55ZyRk48tubbNvh0PTP94u4dzDPsv5+b8OzRxfyh2fct9+qKcfiPnnJRzzlWu/Iz4NBbF4bmDmO72H3bLlB+K3TjL/epeZG8+h4/+HM8HwYHcdmtQ1yn1uqborL1oHHRozBhH1FEWO5tlicQkurEppk3Zdtkmy9JuP4nWHdWzvENsHs5NbrArb5VlvZTlvVuXkc31pFw5sbMTJ9SpmO2yrIuraiMGsRmLFd+LeF3I7DvKxnvSmGcfug+Q+aSe8qF0/jsZmAy8SAbczGCVtR1xdHI5x759AjqOt6fuYOx6Yux0T6QVu7prtvcGPtzbx/MgaJL31JGv8bF/+lIWOxtlx6PMLXnIixMXel7BBbuLaF6AO7le8NU7zJsKy6ut6tTTZps1xEfKO1+1kQyQhFCvm3Ne6FOGN28MksPkVvk+hso63Npzndbl0Tpjf4yP8ZV4jKl1X0f18DP76/S0pWyf2rIfy47YcX1jc00Sc/1cV9c6Y8KYEWvsEZt5dInmHht9UC/72pKrL6nrb2LOS9k5i5WXTreuaF9ijomMX+w3HgDUOaqDo+Pc5H/UT9rX+E4eleuc1JkzsnMX5SbROEtOMyaVb88RNZbZQ9WmvlJGn7Szb1Eb2B79Xncfgnzcjwft6f7NcY/7X5/LnJxz8q7M+rguuVaso7prKrr2FYkVbInGj2j5SNdOfCqD6vWcYJl29a6tZdlX2uyj4qiOdnB0ON/KVdpp25Vrg/eUXQftqVeZNcTmWu5B48EYqTp9ZFmVibe0qWccKoPt/jOGjelTzP1X90PdiVley6Y+GZgMPJABN9hePGe4tT6zDHl5eBJ5KNKvfdQxDjrzybGrnmXHvuzzDvOkWGVOqNjyxLpHrv10+v3cij+39uW8ch7OEawf6j3mx/7Tn6Vc5pLzhjcuYlxU68WxXkDRredFuEMv4qMbgc6+diNCfW9EbFvra9/Czl+SARIS59bNe3Sz0MVd8pvyhbGVa0kc5Xrv0ffEnn12/XU266dva7J9ZB1tFWvflqc9bdnnQS7xDu+5DinX9ct17uIg46fGmjGaSGyhZ8J5qZz9rsnVr6o7hzq/nLty5Sd16yTWPh1LZO4k8fjUzWHEjYn/qHxkt504qucadT5V/tCdT8U6/9STJ+XkEzljE3l4zuA8cBPXNxtheA3NtrVf+672bLOQ+2uf+xB8Dp88RyzOBXWelXd01yTR9cOmDLLuYo0B4wV7ldNm2V4kNq1rnKJr77DarG/7LbS+mP2NZOquHSO+aFPLOl3eO8TWHbmm58oZK7RNfUsm7rKOeo1H9cWee795INfvw4x79qG6e7Lq2idOBiYDOxnITaQ8wp1d3lYb9TGyZ99dHWzLozuRhM2TT4fDExJj0Ecd6xzd9mAcnR/Y8kT6UNn+RmOlPwt5PD/Wpa4Htod87M8+1NeQsuUR3DKXnHPlMS+O3YXUi269MHvxThzdBOSNA3VST9myzjbqu9rxE1v1N3XmRILAQwDqjuad3KRcOUQfxdcilsq63JbVtRvrxESNA+PkmljH6PS0jeTO36y7t5w2/dHxeWPLeFfu1izXtMZAxosxlbFGjOYxSjS1m5CK2juk35E9x6xy+kd7yus86jyTA2W4Qq5ouVj7qmPhDz7oV/UXXT+7+aat8pZ6ytlmJOe41afqs76DdX7qlQd0OapY49D4FDknIIOrB3uiqWM/52DXz3DPPc05iHND91k7fxzOEXec1PlX3uu6qLt23Zqy3thd9w6Nk4ybkUz7UVnaiVF0Y3UkW571rVvRutrV1zDrKoOjw/lVpH61oedReVbv1mVkc03PwRon6vSh3GHGG+XqI9nydu8Rw6Nr3tvdf92enLbJwKtlwAtOTnDNZtkWZn9b8lpflB2Pu4tfd1LxhLMXuz5ubTneuXLj38if7iR7LdtozAfM2TV0rdQvxbV+LEtEPhwbHFcO8+LYXUi5KHvxzQs0cl7IRzcBac8bkyrnjQdtOl17YvavrG/oytV35sTPH/hDh9Tr5p625Em5col+dmzlermGYySe6rpXG/rej31Zv+rVfoixg3WvTG373YP2O8bkrMgd/906uYZgrrNyjRdjS8z4VCbhRB4lniaqYMqj+mt2x6yIf8Q1/etrnYtzFJOLlOEt9SrbXqzjOH5i9Vd9ba6PVcbY9K0PYvqrzNyQ6xxTl4eKlbcajzVm3ysxvUenD+ol1n639Hac03NR7ucqoz/153ieuJl/ziHnWzlXr2tT106ddUbO9U7Z2DBeROoon4vEo22U13Atfi07Bxk7x7OtdvWso78V5UHOKK82yxKTc+UOsdWjru05uvFxDhJv1M+4G9myTsbsvXy674xz9leVn3rPzfEmA6+KATYUn4rVluVuws5mO+ukrrwXs3/b2O8Ry8XPE0meaM6V7eMEjyeg4/hbtsa/kT+jky4ncMq2TuTWGfWjfTT+GfPN9UD245qpb+Fafcs6xLY8Cs91js5djpLLegH1QpsX5Crnhbxe9NHrzYE3DZapd5h1lMG9R/W10/l9Mg8BKHO+HQ/Ykivl5FMZzpEr9+gnsVXW62Q96/oedWLKmKgy+rmfrq81m2XXQPrYPipXoXdcuw6ui+jagXWtuxip8dbF6lqSWpP91JFTpx/1tT4tq77wVot/4yL9znnVOY9iO3mqcu0j949j5fjI1Vf0nIfyY6JjJnZ+Vd/RmZeYc8y5V16MscqfsdidJzhH7DpXRPzbptsHjlGxq0s/i2O8Lzm/uPfPPdc8pH6OqXw8d4T/dX7JeV2Pum5Vd707zJgwbqinLHY2y0ZIbFJWsdqy3Hi2Ti1Lu3VHmHWrjN7ZHI8y55y8jexZp8qsB7bEukZVr2u8pWd8KNMGWdSeaJxpS125InsM22KvReze2sd7L+P+be3Dh+zh2XYy8CwYcCONnDleWA41rL8H1+qMyhjFspS1gadHPXHc6PWEM9I5aY3KVk9QnR9rtuJjHVM/PImKnni3Tt5b5fZXsfoxnPN4bt06Ybvk4zrTdiRbdhoHtNnBc3KQvNULqBdcL7r1opwXcuR65I2ANxjUUd6L2UY5Ebke+KpNufqvTtLE4fyxK3eYnCknp8pdbGmr69Tq45hz7TMWkPkYN+LB+rB/z+3L+mtI2b6jxHTlSk4TXQORdUJ2vcC6tq67cSEaR4k1dklasXXJqwm9yX4i9VMf1bVe1z/j0s7/yQM9fUV2LmKde/KyR67t0e1brD6g41t3MC/sid1cr2nL8dIn/ez8x+b84JyHLepgxwu2yqlxKWbsItcYH+nWre3R6Vt0HFF71+5krNN9ytnEvf2wM8v+1nU89eU55P3jAwzn1vFQ12O0bq5pYq53ysZGxg3lnT3rVJlYxLaGXZm27E8bWA/HqPaqZ72UrVdt6FuHvFFPucO6LtTBVrHWU6/rvKUTK9Rxn6Re7e4h6xpva8jeovxkj0Xc3u2tZVwf9yA7JmO/09OGPD+TgU0GiO9v+Prf9Ps4/tB3/aU3/+4P/D/f/C/+3N98820ffNu//+HP/fwvv43ZzV5eZoVuQ2ljRt1m7OxpS9n22kbomKP62peYJ48beXQC4kRFmSesRO1d29uFL2Pc2npelr5Rp2nbjZP+pLx10j6nPPtV7nzBduL36Xy7dUwb8ugDT6NPV5a80i71g7yDZ+cMVt68aCZ2F2VsXri3LvTeJFwDGYt+ErfGT19Hc8HOAwBu6Jk7enLQyZU79ORWmThC3h1jdQ27dV7aMha6eOpiqatXbV07bQ9B2mZ79SVWHhp9xKncJ9b16ta0i48uvmosryWtxBTl4LWOmgQTuz/x4z/+d77v+7/vh9K36nvOr5t/5ajTu3bYsm/kOjZ67t30E7njUHud7zX07Lv6ot7NwXmS+P/UT/29f8LbQzl/5cpTx2XGZxfL7zUx39m6ttiy/5FsvezjZIzl+cZ9yvki93E9fzyW7ph1/INfd5zlfJTloK5FXatOd90rEiMZ7yl38VPr1zrEHraK17QZ3w/B6k/6q1znJjdySHm1WQa6l5S7dRnZ6hqv6RkXVc52tUwdzBhTTjzZU3dx2tr7/ea+S8w9sLbfcs+s1Ztlk4FbBojdj3zBl3z1r/y1X/cd3/hv/pm/zoOAD/70Z97wcOA1UTTaGNrdbMy52izbg7a3rvpetN0Sm5NInnRSzpPVlpztlNsTFeNvnax2+tj5lCffKnPix9ZdALTXNurdWNicq3gy5/Fcu3VMW5XR88O68hEP2lHXnoi8PDa4rvOWD7Hj0otvXpiV8wKeF3tvALzBoEz5Wuh4jqVeEV+xdeg8LCOxSBt8oHe8aJO7xMpzF1vGmHgSa3Ut61qf6sZPxohx9FC0z64fy0T9qGg5OD7qvBtdzhLluOM+1wbZtUvMdVeusYQ+it+1pPRaiX/XD9/6/6N//I9+BsSH6l/OwXklJgfIlSt1yxKzbfapnGMrV/9S1/89uMb3WhnjZbl6+oHsWut3Ig9c/v4/+Ic//ebmA+/OV0xeqiyfYI3VjGfktXOC5bWNeu17S7edeDL2cs/m3kZ+io/nD8aq8vF8cne+cB5izj/XALmukTrriSwqu86JxAe6cZJyLbPOFhqH1tvSqWedDrXVethHR61b9bV21K1H8qKciFwPea/rot6h61rXOvUaE+rUQa6IjXiqmDbjTTzZR3fxeWJf7q9jPI/tuQ+sX23o8zMZWGWAeOYb/s/5Vb/lt5Hgk/Qjf+FHP/oJ9gCNKf9nf8Mf+y4eAvBA4DZ+V3t9WYVeUOpGqnbLL0VYsa3yFo594GRCf+DN4UknkcW95Mg+lB1ngcf5OK8j3viU/tHOvhI7//JErdyd6LVRR7mi7SvWcdMn5cVcnU8/55upntyYYKsf11N71bGnTTkReXngWzmcg1jnW/movHEhxlYvyOj1wl51bzZGNwjaRzf7licyBnpildOP9FM550Ld1DvZ+VduUq88oleu0VkH0TWpWNfwRK/rvtSNHWNFHbzWx77F7NeYxGa5tnUssXsy75vyylXqHd/duuS6ubZ13Y0h7MpixiNyJpNV7hL2zuYf7RshbSyzPd9A860/SShIueOnj/ot5lwrF+hwJnZy1yb7VHa8xNy76WPKeT5wPh3SprPvtdk+Mf1AxndRmW/8eeAC73zgnjrOG4QjMfmq8VhjNuMZmT0gnrMfar97dMahnj6cjLc8z+Rezv3/1PLpOeaGM313LmLykGuRa6Ts+iUi52FsY0MWtV+KGXP0gZ62lHOMLbv9dJjjdOUjW22Xevq2JSevyrmPsKXuOiW6ptiQRe2JxAJ6YpUzXqpsTK2hcbiJ472V+0zZa2vGvvtOm/rEycCQAb7h5/V+vt3ndf/u+ON/8cduE34eDLCf2Ac8HKDtsOMXUOBGEXEZWT1R+2NgjnvemHGh4wTTnYjqSSv17uSX5ci1z+GJ7MjdkqPiY+dnHRM9T9TKeaK/VLavxDr+5pxP55prWGV0Pq7tQTv8u2azTD7tQ32JGzy7ljnX5AB5xKkX44pc0LF1F/bRzULauVFH38JskzLjqnc+aNPHDtOGvHXAEXVGXFVOk++Ua4x1+nCvudancZgxkfFizFHuJ+U1m2UjtB+Resrg+uFcBggv8NDxk7bkVrmuRRfjrmW37sZPovGWmPFbk0+SdWwm7RVN6jvEVg/aY+NVf7+BJhnlG+k6dvqYc+jmuieeR3W0134ZE1uOjU/o6Zsy/iuDqXey87Wu+rlo+xw7Zf2H+7/xmc/86CHtX/4L/3X+8rKGxKTxCmZMKxP/eWBHtzzRPrJPZceqaLlts78ct+zlus9TR772x3MK/SonHs8zN9x0/OQ84SCPbo1YT+x1XavexbkxM0L6GJWl3ThMmzJlyhWzrJPt17LUO5n+a91qU7d99anqyYFy5RbdNejWaGRjbSnLNa5yxsM5MvvDvSLmnkl5sX/u4vLetnVtXJaP4l67ewGdj/oID7Xmv+8kA3yzz7f4XcK/ZaMdDwPYT6+FvG6TYHvsA/4cI+X0x/JTLCeUPPF4kqonNhYNW3cytKy2qf3en8DK+Ld259OV3dhqX52f1bfRSf4h9jrG2XN2nkt0DTvExse1PWiHf7WtoetvH+r3b3/c8n/H+zV47i7GXqjrxVy93iR4MyB6I792k07drGfbDuu46iPU/8Qqo68dxB3lo/irsTXaV8Sc8d+tl7Zc11ZexuAxLo6xZVwZc1XXvoXZLmXaoXuknrLlB7yL1XZON2XOfw3rvlXv1qCuV7fGo7jBTvyJGYsZqzWuM+E3meebew71c5B2NQlFZ5w6dvqY86rzrrygw1+1dzb3Qe0TPcdMecRj+ls5pcz5paztUsy+cnxl19u3LfjNP3zz2j8PYThI/uGfNs4TGZtrTR0O3h7goB19cFAHrj0f1Hhnf2Cr+0Rb1jf+E7u9oI16yFk/+3OM+7GPezz3Mnv8qT+Mzyf9OLkW5lxyjs5frLGO3sV02ljrjPOUa5lxUbG2yfKMpz32rNPJ2R+yurJIW+WKtcxxsp51Eq03QnkAu8P1SKxrxlpiS3R9xRrv2DMu9sjGFHWVxdyr2O73zfvLh3gncVvjeJ9u/HeIbX4mAycM8Br/VpK/p5y3Bl7i3wPwwgExnaxteWHZtyGfrk05oXgCErsTmSfBLaxt7VNsT2rwU3y65bfY7EOsY1Xf6kk+dS4U6IkpZ1m2U65jVV/0ETyZG/PqY+LGfB9XxlLakPlYVnGt7DS+Cr/4mX4r17nVuctJh/WCzEUc2+hinjcDynlDj80b9pS1VbSOfXWIL9hHPqW/yqLzUU9EHh1wRVnHWeUXva5B6qwTuuvVIWu7evTxmPGlfBuA8c/IHlWGYrZVBsfHyjy6eVebPCV/KXfcd2vk+tX17WLI2Opir8YriR9JPYkdyR5JHkkjr4r/5N/9yc/yzT3f2mMjKdz7AIC6tF9+9/zmDWMwJkf6Un3NedU5d/zAI3axq2P81/7Uc8yUq2+dzlzSru4cKas2y87B7CfHQ4ZTknXWDkTPeSA7V9D61DXZN/kfIXFCPzXO1XPPY0O3rGLdB+jdfqi2bIec/eb4ZV9zUsg9j/7Ynzpe6ot7kJxDnV/lpcY2a4ktMde5rrt6IvIluu0SicXU98ijNtWOPjoYx/rWcWx1y63b2W1TEU7Tpp5cuw7Y6jp1eo3tkd7FxJqNeLI8Y0t5sU9u9ugufe06eSxjT2Wcd3raUrYdtvl5xxm4VvKfDwjYXy+ZVjaImyRR+ynu3dzUO27i035Oy+Ax61X9UGa/4YcnIdETlTg6CY7sthPtV3wvxl7I+D8qu7HbXrR/sPrSndy9COQFYk324tH1ha2Omf7oo3gyr+VajdbNNewQW37sAxsyH21LHHCsr4k5p3N4HvHKBZuyvHAj54W/yg+5Uacv29d+HVdfKFfuMP1WFqmv3CG27hjFWI0t9LoWVWfdsOX6VfkkDjMWRvFyjCVjKvFQ2v9rHFqqLtqPOtgf6WeR6xw7XV4qZ6lXzrt9361hFytpq3GnbqLZJft8W5y/FSfx99tjksNzkn8SyuwrHwLQD4mnhz7VPZPzqRyMYrjjr9pqX+g5Vsruz0S5HKHz6LDONfU1mbEsV67js6asF2tF3ZwHsvPs5l9tlbMap8ZwF/fsd+ygsnrWt4/EOs6anu2yX8e9x9P97bnh2ug5xXOM/Ws/Pc/ccZQ8MZecG3Lloa4PumuYsjbRmEBXFjvbWtlafds9FIlx+1BOTJl66B7qI8x6dQz1NXT+4NrRrZU21hW5rm/qxgI25XPR/UE7ZdF9gq68wNP9cxrHxzrGvnXUK7on0o48P5OB94jTf+G3/qG/8o3f8hff/IE//kO3/7VfJvEPkV/iWwCEhBsm0U3W4/vlqR59YNtC6xw3de1ff6q914sfnnjEejLLk1/KayfK2od9i7fzLn5s2Wwr1jHSN2RP6oleGLApn4vZH3IdN/3SV3Exx/F6um6uayIyH+rwWUP7OcWGe31MzLkg17lWLuRVe+V2dAHPGwdvBERvtB+C9GV7++1w5F+1M6+0pa7cIbbuqLzJH1g5R6/rMtJzLTt5EY8ZE+PYzJjbK9d66H6MTXTlJaZfRe7mlDZ4QR/xg10+K8+5BsqsHXK3hhkPysaYsUeSXb/d59vhmuyboPONvUkkCSVt7WPPN/8k9/RvfxX9/b/JP6ivoP6DzkmsHMjRObjGJ2WOVTH92iPnnFKmbeoPkfUDDn09nzWqvqM7t8ph6iMeM05rXGfsK7vH0VO2XKx95TjK+KRcsba33xz3dvzlPs997znhsZHzC5/Ewznn7vySviPXuaHn/OtasY7ack2Ru/XvYiTrrZXb/576o37OtRPrXRv3QEXq2kZMm3LXrhtnZBvxK0e5JsojzPWtsuvfxUVnyxhSrjGG7v5cReKWOF3uo+U187TMeM+Y1wZ2n1rXOtrVJ75iBvhjfb/uG779x0j+8/g9H/wXb/7wn/wvb//w33f9lf4PAO55MHD7PwK8IP5q8KsnIi8PNqybVvlcrH1eopcx60monrzqiY+TJbZ60qz10Gtfdaz3ii/3OvNqymr77L+OX/3zAvAQpE/a177Rc/z0Czn9PplXv4Zsh4wnt8fIVu3L2KtjFG7Tv5TrPHKOyB0P2jqeuWhj7y7e9cKPvnUzbrIywq59Nw42fBI7/zrfu7lUm3qH2PKAO3Q5TKzco7M+Yl2r1FlT9FzbKp/EJTFS4+aoE4/GGDIfY3BNzrJsr3yKJVbTzzqH1HP+a3LHK7bkXtm1yTVDrvFCPJJ4+wq3r/CTzI++hc/EnHq08Rt++stjz0MAv33Ofju5ewDgfmL/5H7JeVYOkhv5WsOs3/WFLcdTTn/wD1/hg/nKuck3D048eAii3KFtWLN80JK8K9fxfBuDdr7uj23P+aTOfY0zymq81tjOPaDMnkF272hPrP3UcdTTP22J2U/279i3eDx3uN85L/jB9lif2rfjH/GGK31N/5FzbsjOOzlJua5tpxPXo1jXLmbd2lctc788NhrjYo7X2Ubl1q2Y9c+R5azypO46oSuDrGmismst1lgY6V3caKvxhW7sreLp/jnG77KMfWTMW6fa3GtZT1tF61T71F8pAx//0i/95kz6U/7k7/6ztw8E8kHAnoS/1uF/CWD/vCQK3QiJyP0RF5XVjb1Wj74pH42x117GyJNQPYl5skvsTpbVlvWzzxxL+XZOxadq88RoGzD7zfGQ0x9kT/Ke/NeQiwzl4lrdOk76kf6l33VuO9bzpsp9XCmDfDL+1NN2Go+F6/RNOX1Xzrl1HK/xLJfdBTwv+MgeJh9dEu+Nv+iNeerKYHc4TkV8xNb5qs34GOnaO7TtWlxRVmMLva6BOmuE7FqtoWvc4UlsGivH+KvxVGNOHeRjLKZsH9rUl+jYDXa+Y2PeFde4kDN5FDvuje+6bt0ak0x2yfaajUScxJTEkQQzY9b4rki9epCEMv6eBw36w5i17xw/90g338oJetajvf0xjgk0vnKQuHuQQJuMg5msk8TnwYMS3pzwbyI4n4cgvPnWRY6FjH1rTHxhLqNziNx0nGEzzroYND7FGtvdvsg9TTl6V6/2leM7njZ0ZdBy0b5ynPTjVu7PKZwTnuLjuYaxlE++dEj/lZ0b6HyTC+S6jt1asz/Srp7YybaxTD3RMvCpD+N+hPhjWSdbVvHcecAHbZKXKrtW2Osaoru+Hbr+icYGsaKcmHbjqcOTvXKzZxc2YhZbxu62bKwnpsw+yE/Vs2zKr5wBYt5X/jPpH8k8DOBBwNp/B1gT/9T5bwFfIqVukkTk41E37zX07P8cuRk7T0B5sqonve4EObJl2+wTOcdDfq/xqbPVdtlvjld98uReT/7o3UVFu+hFRMx+6ljo6Uv6mP6fzK9fQ/ZDxlXuD+Or1sn61jli4Tp9Uk6flXNOyN28tSU/KXdcY+NCXw+SBWwmDWJNUtZ02lBu28Q6nrr+jHw9106/W22SI2W4RJbTxLoWVWfNsLl2I2S9KXPdE0/ik7jpY9TYMg5r/HX2tNX6h/5KnOpP+ljl0TyrXW4qb+rJtbLrUnG0tuc8ADDxJxHOGK1yjfWa+KOTyJOgnpsA4y/tc4wc3/1hPIOZxHe+VJvJ/hrWNjmG3+4zRw7/SB5Yj3yAoJwPEpQzwcdGP4wDD8jn8kh92snTKD5qHKkTb8jGXaLxmVhju+4JdPaOmPtIu21qX+j4QhyMfBr5l33Zf/WhnE84J/DxfHDQrv9v9n8419Tz2g1f8tRxxDycn2uRPMgVuHUQH9bpYoWyrk6120di7S/b2Gets2avdbdivNbf0u0P9LCNZeojdI6WqycvnZzrp8zapuxaixkDynsx90SVM+YyDk9k4vb93ddl95bxXzF3mmXaqq594itl4Is/9rFP/qu/63s+2yX7X/ct/9vFzwC6OvyNgEzu98jf9sG3/fsvhU43RCLy6cEGvfaxb+Pv8iVPPvXk5YkuT4SeEPdgts++c0zkLX6sk+2yvxyn87U74XcXCG1r2PWFLflIf9LP9P9kzl3sLG3sjVxTdZGylLPuQS5xmP4op7/KOZ+OX+YuByN+4JSyyq0Xdi/4YiYfyNyQV8xkZY9c+1R3zET8RK/+nqvjFwnPqK/kZMRdxlbKdV2qzvphcx3X0PWveBKnxNAyDjPOavylnnK2WcolRh2/+qXOnJDX5kaZPFSOqp78KrMuyHV9iIVcP2ODuCKxJBn0m2SSS2z1m2psxkfGn7FZsYtzk2TGOOdbf/zzw7foJr6OkWOnb87T+ScvcnYJZj9VzjG35PR1S3aOXb1LHgDAP+uBj/SZvhordW7qa5zVODWeM+7dE4nuH5Ey5KyjnH3leMyDBy7G6cjPbJP+2b9j68vgPMJ54jE+nGfyk/rxHHTDzb1/GzzlfCsnuabKIjGBnJhyV1bL7WsPZlvkejjeyD4qz/oZ6ylnnTW5tkk95bU+RmX633HFummva4iea1zlvK7k3tmS2QfWyb3RyRmLJzLX4ZsYvQnqY/weZWI97eqJyHzcC+LBOv995xggLvnWn2/y//X/6V+5T/R91V/skv5qo489ib91XtrfATA43DS52Y6yGxQshxfELazt7vXlBj+O2dkZGzsYR550PCmBebLzRFhPkJw4sYm1nD44KXMCR7b/HFM5fepk64n21fmafnhyT+Smz5uZ0UVjy579dfNP/tJX/QdP5tmt28FGrGWcjfRxDMSaO276gpx+Vl6ZT/Kq7NwrH+prPHphB/PwpjzRpOQSJLHhpjz7Q84xUzZm13w/p4xYIznDD8bp2sIXdnlLhGt0OQeNr5S1jdA1reuceo2JNk6NpXG8juNw1MY+G+x86uI155FzHfGR9uQ2ZXnP9UB2rbq1ZL1JBPnmmXg1tog5dMpJ/EkwuzjUBubRxT5xTXLmAwcT+kuQPtwr9MvhmPpR47fyktztlZNj2tQ+1dc479ah2vTd9ej0LGOdeGBzDpdwCFd1bHXnUnGNq4xT5Rrr6N0+4Vzf7WFt2Sb7dByROIALf97AfDqfrQ/aX46BP/fH6bmA69pTfPJaenquSh9v5PTfOYk5X/lwbc+JZdoYI2DqyvZrubpY7fZn+yxXrnWyrmVPie5JxlSuqD/a1TvM+chTh66Va1gx11mZGFAGjYk9SExRL2Oryvf7pMTjif10H53G9KEOe8vYr3Luu6yjvbNZNvEVMPDhz/38LycJ5xV+jw/+9Gdu/8gf3+j7QKA+BFh7I2DrIQC//ecBAMhYz51GN0EicqefJNtuXDY6ct3wVbd+i4x508ftcRhfP3q0bmAdL09ceWKrJ8Otk6Xl3EBxc8oJN/vuTny38wjfqn6pr3my5wLhzTc3dSRlazdr3QUlbdm3cnKVHDr/nEed410c9eu3jDH2SY05bX37wm36gax/YvqOnPNyfUXnXhGusCVnKXMBr4eJRiI3n+gmI4kmKRWpg401Zq1JbLLPlKsPeWORcvp+rsz4JIUkCOwJ/Kt9JFeVy8p/6q5PXbMt3bXusMYH+km8ZkztOQd1dbKPInc+4GsXr86BOSNvzZ1yOKyYvLIG6HUt1Ov6oRNXxFyeW7r4ol5n72wZq8jGP+cyHjJc+q0/+6J+eBNA/4lVDnXGq3OWi+QqOTxHzj6y3yrjA7bqyyU6fNMuMdeAcwjzZv/ywAa+4QNe6tsccEmZfVV/6jzUjbGOq1EcG+9it1dW9+vNXqtt7Gu0f+DAeHGe1ef0N/vLse79Oj0feA0Dn+JTr6GHa+fgPJTzUc75Vi5cX2M1sZOJF+01dtQp98j62kaYde1rDenn3DajuF8bpyu7Vj/27VxSH/FU1zCvD7nWKbtfjIm9mHtiJN/vlRKTN5vjnPt/9lLG+ppOmR/bqE98nQx86Ff+2q/7Dv6afybkPgRIJEnnYUD9tn9N5yGA/Zrs+60/do+X8ACgLr8b5HDhqBe0umnv9NzsbHD0iqM61FscdcyqWx+78h3mGHnSypNbPSFy4sTWnUCt600wN0zUs78cI8eu81/zk7rZD7L9g/ogMj4nfm7kuHmr3+hwI5fJmBefEXoRESsPjivqW/qcc69zvQmwPpYOkWcZWidrW+LOdddHfRadS2Kdd+rJjXIi3HZHTXQy2THpETPhT5lydJLsTIxYZ+zdGJ0vrn/6fa5c+8gbaBMtbLVecpky/KPnOnSy+8D120L3kOsvZpymfBKzGV/HuFzGYNqzfiPnWFXWt4rMEdvWXGt5x1/ynPwrj+KA2PIcQ6xRz7XtEFva1RPpE924NRllHGLIhOyxkDEYi3HxI+cuH+KIS+zwnrhWl/4ot981xB/K069rya4D/SmDeQ6CF841JMSsAeeZLZ6czxoHclXjtca9et0nq3v0Zs/V+uj2VfeRvuC382SuWw8Bsr8c7963PCcc5MNV7nH/5bzEp8PDOauck9L3nFPyVNfSNe7Q+KRMOVF7YtdPZ6Mf7cqi/aWuTbQMvPSo8b/Wz1Zdy0X6Gslr41DmHMF6sH7Y6joa+3UfVt1YqPEx0t1vGVsps0fQ7/dKicmF/XQf5bXXWK/xfrsJmn+s1xRN02tjgPjklf9M/k3ORRN0ETsPBWhD4r/2BgDl/C0B3h6gPW15y4DD/sSX9ADATZKIfDwGGzY3+ZbMJrfOYsN3fefYytRDburbr5gnKk9u3ckwT5R5EsXOSZaEhpvGmvzTZ47huGLnY9qsB2Y/+grqL37hi4kgNyprN8uUcRPHTTbtuMDUQztYj+Shu4joo37nXHKOt7JrN0bOQTXutB3jz/bvlwdGN3qOr0+iviafyavrX+esDjfIlSN0L9yJybNJjuiNdkXW1UQfOQ/ij5twblDrh0SGdvafmH6knH53c+pszi/basuHAPjnWwHsF+bh2LSV00TXosNcs5Spi77nMA4SM15SPondJtbOqZN9K+MHcvqjzHyQ98yLOvLQcZc2+EZP3pVdl7rurJ3JkYmRdVz7ilmeZcZARcYgtvPBVo3xa+mMYeLPPtEXfQblRL6SQ+XkXZmylK07whznHFkfE9P/S2R4qO2wwREPA+AMGT8dt/rMPLWN5gw/9TDWjX/RvZK4d99lG/tzHMfXR3TmlvHHfJmLdUDbZX85zsI3r1NL5Hr2VJ/Va2b6jZxzcp5gzh/Z9U00HhJTpi56d1iW/Snbh/reutmuk9MP+0zb25S7fbjHH+eRXCm7bnUt0XOtU657RT3jpMoZU5SlnvJin7xf7uPcL9iRRe2nyH4a3TdmGXL3sW1XNm0vkAFe+f913/DtP7aW/PsQoMPv+iuHV/f5hn/tDQB/MuDPAXh48JEv+JKv/kPf9Zfuv/3nIQB+PHcacxMog6dH3bA3upubzap8DtoOfOiR4+YJKk9u9UToibJDEqu8AeZkTF958sxxcnzktbnVuvRDv4zBhQB/0ld0blRItraS/7xh5uba17Ppd3R0F5rkhHJuBknq6ENOR/M/Wcsunk5P3qcx17UrsdJxqV/66bolp8g5x5Q7Pka2jlPWqh416R8l/Cb/8G385ZpWefQQoPqF/9hG89hjz/bKYH0IoI8+DCAOmU9ynHJdlzW9W0ttud5VNiYSa+ykfhLDJe7WyrOfKuf4Va4+d/qIG+p2ZfCMPflWZs2Rc+2JS84Z+YAR3Tquu7qoXcSunIjs4VjEMLFe32Yyjh6KxB8x6p50fH0H5UTsuOzWI220Ga2Da5D9OtYWdv6ttbF+zu9S2bWzz27cnFOVk5+UiX30ugfYL9hy36zttVqW7bLvHLv6WM9f6Fkn29pnjrPwYXnNeor7v7xvY7zUj9fU94/3WOm78xGda86/W/NqMz6MM8qrLctq+2vqjps+pKwfa5hxb73OZhm4Vb6nrn2I2WYk59wqj7mOVXatt9DYWMOMqTV5sVciJhf25R46xvBhN2V8Z7wfSvt/bdOXTuuLZ4C/8k/SzrfufjPfJfl7bfSz520A/3cA/ss/HkD47f9LeQDAwufmUAaPR9mobHA27NpG31u22PiOw9jIFS1vMMfLE5Unt3ry40SJrZ4wOclyA+ANMDel3KjSj33YZ46T4yPf+t/4qT3r20/tX130RI8/JON7/3ss5sJNNvMiweRGmAtMHvXiQhnj0CZvzknktubvHBeY8XQq3yz1fRwe467Wa/jseIRPfcx1k0ewrrvcykPVtcMLcnKXstyabIhwmQfrgG7CL8Iva3VO0sP60M6xxPRLWd+dzx6kbdZTFykjSVzzmTiqnLsOiblGD5Fz/VN2ryVmDHXyIo43YrBrjy3HU8Yv5PSvynCALblQF7MsZfhGr7yn7roSi6whyXJdR2LLernmKVs+QuuCeRir7gV8IJ7zW9nqzzk6fXnOcyzHT1+Tk+RQWa7BelAnbeq27dC1oUw5fXgMmfnSb857rzzyp5ubtuQkZeO/4mjvbO0/ymkr2k/2n+Mj6yMIB8SJccV1lRixXra1T8dw3Hsf6zWLK9vx2nbQHuff/t6NsW/4yUPfnQvIHEXnnRwhj2JAu7FkjCWuyba/NuKPfeqbtg6zjjJxoNyh5WJXZ4+ta5+2lLv+nGeia1bXEb2uMfrWkfGScsaTcofEIPaMxVu5idG7PTO+FzzuM3ZTxn6nY/NjXfWJL5uB+9/78038NZJ/HhL4NoB/KHDtjQC+6efbf2jkbw/4EOAlvAGQSz/ebDcb96bi4kLSbfBzbWz+9oTAeN1RfLBOHTdPTp7UupNgniyRuQmtN5/ckNa29pnjVB/0rcNaFz37sn8wx67+ckOLfz6s8AZmhNxU80CDm3ySTB4i0J7kzAOdMutghxdvnrn4pH/6Xed0Mu/jCXscZ1t13l/GRR1TX9K/5A+5cojuBTVlbYlehMHugCPscgXCXT1GyT/cX/otKGtL7OaDgOojc8GWczpHtq1Y+8P/UexR1nGvzXVC72RtezD3TcaCsnHSYY2ph+hd/9r0ZYTOk/JO1tahHMpth6wdcUm8cB7oEn/WkrgiXs+Jk7W6NSbRu/3CeWfk0yjGqp3z2Cj5zxhOfjo+R2u0x05/uYZd/2u2XEvqpa/nyKzJqL5l4qie9jV/KRvxYux3yD7DXvfbyXWkXANqebbPcapPOQfKiJN86MT5yjrZNvt0rIUPy2sY91dPnXA43vE6WzjT75yLsnN17mCuu3LiVtxQvlUn+3uIXMfJsS1LtHwLPV9UzHaWpe1c2T5E2o9kyuBK7HjLdUyZdUbP9e5kbcQHsnEyQmNrDRf7JWNzuXeO8Xtqz32V8Z525PxYL21TfsEMEL/83p9v6/3Dfj4AEPd+4z+qRz9ryb9ljM9bADd0fojEH/2lPABwYyQiH4/cpHdyt8E5KWAfYddGW3tSwAfGE+/GrnXtQ/Tk5MkLzJMfcp4sOYFyw1kTaW4gKatt7ddxnK/jg9XHqmdd5OzL/rf89uTPDTQ3LHvfCKg3ylWHB/ioF5bkQR/T75xTne+tnjF1ifz++AFA+qFv6W9dc7kTmevo8AIMrh2ZyCjX5B+dm808rpHsuIbcxBK3jNP56hydk/oWZn3livRBMqkvifgk12A9XJ9cM/qjnraUtZ2DxkVixk3KGcvnytlPyoyLnuN3MnPCfs7cqCs/icgerBcJP2tBcp0JT65VyvUBgGu+FS9b5fTj4V4R3TPskfxmNv3akt0D9ik6ZvonP/KWvHfrc67tkvXsfOls6WvKOadryoyx5seIG+M+94PyaH+11xCuASv3A7Uvx3B8/UuulPPcxf4gRqwvZn+OtfDz9Lp24+6jfvK+LQc63r8VvvQ757LFj2u+FUtwRp2KXbs9dbp21WY/aa829cQqo59zjM6F1b6lM2bWGckj35i3ZclBysb4CInvLDPeK9aYSd24GiH7hLLFfrmxLfTT/bOM49NyYr7bA9pyT0z5lTDwhR/96Cc+/cf+N4vE/1pJf30YQDJvoj/C2/9J4OYPAULvP/sb/th34ctLeACQm0QZPB51g97odYNzEtCmPELrVVycBJoxR+W1nzwh5ckrT255YuRms37rz80lN5CcVLOdsv3mWNWPkb/aqY9su+zL/kHHBNNvZU/8IBcOk8k9N/fdTTTfQOcrv44Dpi/po747F+fmXBeYsXWOfMPVop8bPcfTh/Qr/c15ICdvVYbHvYeJRYcmMomZ+MPzpQlOt3Zp4waW/rt51Pnu1emLuiO0jL2TviDjD+3qOqRujLtu9qee5bRb07NNyhkfKRs/a5jxprxWP8tyrCqnf+fIlQPaJp/K8O55gYd7rAVx54GOfXTOyPPBKFYYi7IRdu3wy6PuH/cM+4V4GvlW4wydedGOPrJfxwLTH3mq3Nd1Sp21RRezbEtmHOrU8S7R8d12ymJnd67noP2s4WjOuQc6OfeRsljP93t124M5ZvpY50IZ8ZJxRgxlG+Tsz3EWfi2vadwPel+FfK3PqM/jfdthpKN+c73ET30Wcz4518oP+lrMuPfX6jxFmfvasapfWa68hnmuSNk22kTt10D7rFj7Zq7YnHNirlu3pqx5tWvLeEg5YyZl95uxVXGxT+7icWFjr2Bf7qFjDNeYPupIuSf2yIfWy3baJj5TBohDv/UnyR4dNYl/iM7PAfY8BOBNBP4OAMdLegOApXbD5GY7yGWj1k2tzokAOU8IKdd66omLk0EZd1SW7ZFzTE9a9QSHzgmTm+L6rT83kNi4caQeJ9Pa3n5zrPRj5Gu1Z5vsC9kxwDp+nuCR6wWBC4Y3zue+Us6bBNlfHUtf0r/0PedU53uv7z/BH+Px/eUDgBwnx9cv/RTrPHKOyvBWL7baOiRGsGeSoWwCk8iaePBtU95sEnfX/rD2rKd+Mk/8TXTua2ibrKOton13DzaYe10HdNZIu7LrBn+MkXbr1rapZ337qmisVMx4ulSmT9rWvlPXH2zKI9yaW1fOWnCOI9ZI4uEyY8H1hF/slFOP+vk2EX1Yt0PGxp6InHqWZx+M7eHeEd07xM3e/cLDDOrb1r4cA8zx9RNM7nOdlPfGgvXPxRz/GnKdU+rKYJXTph/WURfX5mj8d7zl+buT768Ved7nuoFerx9Z50bO/nLs6qtzEJljPrzk3FnbZH+Oc+uTPlTfuLs62A7S4/3rPZwjHK+d8nbno36DOZ+cq5x0aHxUdI9jT3mtXi17iF7HTL2TsXnos3rFPG+kTD31illmf9YZ6dVu/YrWE/W/4881pEz5HMy4UM64STljq5MXe8U9k+j+waa8D4l7Yx55fl4ZAx//0i/9Zr/1f4rEPx8a8BDAPww4eguA/xWAb/9vaL/9GQD1n/sSeNFIdBMdMDfnjVw3NZu/XkiqLctr+9TfK2Pt0bN9joMPnqzqyY6bwrVvlbjZzBNptrdP0BNf9WGP39Sp7ewvfWecHD/9QuYCIHoxELlocCPMjcyeBwHcPMON7e3bMdMPZLlIv+ucWi6OJ+plrI3sN1yxqbKvHMfx9WeNs5ybMjztPUwo1tDkI9HEf/TQ6drJf/ZHMu7bAM75EhzdhGjPPuGHeEo/6r4yrkRiShlEp284A2t5rZt6yrYDuyPjpsruRWNsDWlr/dqPejf+yCYHIvWUE6uMbiJPDKJ3R65XleGbmOU8Sfx05wXa0K/YjZE26+VYjJNH7qvcP8hbDwF8e8l22VeO4fjpW10D10t0XRNTpl7qyOr2cU3EX/rrsM6l6sx7j406XV3sa3Nx7iPk3E1ZnsNTzvP8Ql67PnCNuDuyr/Sh+lw5oJx94zmLuK9zzf4cx3Fv8dTHx74H9N7Ncbymom/ew+V8kp/KDXrul+cie07Rn6pjT5t7/1LkPDJqu1Y2alPt2cdIzjZ1fvIwQtexW9/OZkxQpgwSN2LGkHuiw8U+udurC5vxuh+N8URkPrkvUj6Uzn9fEgP3f+iPpPypk/98ELD1XwR+493PAMCX8AAgg8ALxxLLRu02ticAypS3sOtncTIo49Yy2mOr/Thunqw8sXFS5AJfExMv+CJ1aONJ1PZg9utY1Yfq65qebe0PzHGQ04f0DR/zgqDsxUPcmjffRlPH9onyAKYf+ph+53yQh3Pff5JfJP72l+M4vv6kj+l7zkkZfraOTCSQqV9t6iYfFeG2+1bcmHtsJDkigcIv5/4QhAPai1VGh5OcMz4wfq6JcsZ0leEO3+nT+udi7TNjJGVj6NqYY6zJzIvyDkdztj7l8GvSztqM2shlInJ3sI70m2WjfvfYsx9k/MzDvSQytgdxMNorxjd1bQtm3zl2+pprUtfe88u5SD+1Te37mjpzyP5yTteSs/8q17lWPc/ZI9nz+wmuXS/ePyb/tKt9px/pc8cJ8eH9AUiMZJvsy3EWvvZ+5n3WQ+RMZFKmz04/3ssFR/oN5nxynh032OBDzP2DDHfVlnotr3rWPUfu+tGWOJIZi7LRwfnDsk5OG/XURdvuxWynXLHry3kkd7lWymCVta1hxodyxo9yxpey+3KxV4xJYhe53zvHGF6WZ8wb+xWpMz8vlYGbmOBb/1/3Dd/+Y/zGnoSa5L97CJBJ+mPKe34KQCzzvwFQ9zlTn5ulyugniZebOdFNvwdpR73E7AsZ8kTktaO2RdcPT1AgJzVOoGvf+ntTSSLMDeToBGm/juN80pfW54ZP6mW79J9+Hcs55Mk5T/Ke+LuLQl44mNeIA94SsG72U8dJH9K/s/m4mfttjC1P6oe4qzbqxpGc5biVp/Q954TMXOuRScM5sgkHWA+/RX3s1/2N3y3k1W6+UWd+lZMtvYsPuRy1pQ0JvK+UE3/UzbVRzj2nDaQ+yR0PE+gvy86V6xgZz1U2njLO98q1r5GO/5R1WOdmva4u6ylHPsir7Ue66zFaw7SP+jjXnn0ib+1F95X7qcY5yRpldd9mvzlm+ptrU9c3zy8Pkem3a6+9jvtQnTllHznHS+Tsq8rdvNKW5+s1Oc/xJ3K9JlQ9rg+0zXHSl+p7xwXXQuJr7QFA9r/wtfr1+HeA3rs5ktdQdOXhvdy53OS+Gcnss71la3W7Plgv7e7n1JHt0/LUu/LOlm3PlTnnrLXZKret9UTtaygXFZO3Tu72gba6Z9QzdpRzX1R5sU9u9uhCz1jtZeNZPMY2lkObg3T8N/dGyscaU3p+DNzExhd/7GOfJPHnv+HjW3ceAHjUBwGPmfB3fd/+wb9v+YvDPwz4kS/4kq/mePlvAJRNWje0m/4SrH2pL04KMT7lllXZtqC+eJICuSHmYk4SNjq8oXzoAwB9vEdOTO+Xk13o6Xv6383DE7JYT/JeyLoLBBcRDm6Q608CSKxMCLuLTR3H8UF51l+wzulk/nLSn+jzxN5yl/07rn6kb+l3ciIXokmD/KjvwVHyTzJCQvYUif9WTBvbIvVZc/ZFt97JVSfbRuzqVBs8MSZjwwttc32UWb8qY2Mt2MOjhwCMRzuxyvbZoWNm7DymjA85ZufTXhu8wifcsK9z/nv6yPrKiSnbnzb1xJyXHFKuPesi05cHMZFH3X/uNfYW8zWeQeZe62dfjlF910fQcwjoeaVDz9MVu7oj29YYo3bY08+HyDn3Tt7qe81HyjxPp6wt8eT64PXxnOuEde/aZv/pZ51TnTflxBcxRYwRo7bJfrL/hf+n1zRusJ8q+chxlI/XU3m9Qf3POTlPsPKC7j5Wzr1c95Vlnb2zWf8haL97kDrdwfidXRvnFOU13Ftv1IftR5jt9Dmx4zHXLdeXuqmnnLGQ8YGcsYOcMaUsLvZIxOHt3kA/3TfHuO3Lbprc76uM9bQj1491q33qz4ABEmcTf5L/PPJBAH9h37cBuiT9MW2MO/o7ANj59p94/0Pf9Zde9xsA9QRwie4JQoQ4ZHDrsI3Yjc/JzBtkkG8/SXzywGYdXlPmBiBPgsp5AnQsxxaHPnOyGszJtqJ9gzmmfiTmiZ6LgheBvEB0FxHmzFy9ec76KWf/3YUi/Uu/nYs4mvvNOWf9RF84sz/RMfVDbtLvnA9c5FGThjXdBAQcHcQOyUj3xyXh+pIPfXEz6kESzMG36YzFwXp6aCOmqUNd27LmPpTwQQA+GyPJ1TXkjEfGYN/hFz7CtTHVYa4hMm3hj/nYNuvgL7p+Kydm/SoTO9iMoWui/dYxL9GZH2vG2hIb8EE8Zl/OJW17ZXm0ftW1i/KEXuW0dT65VmLuTeTRfiQWPH/BAXxk3dqP/de56C/oOQT0vJKY5xzlDmmDPTH7OVfWH3GtvXXA7nCeYldny7Y2PmUdJ51teE3wnL91bajltrvBHK/6W+dXY4AY4Y2lKzwAuPYttcmLSP8pp95fV+84GvGT3CQv7uPc88p7sO67PW0uqZP7XJl+lEVtIvaUrbcHOdes1dsqr21r/arX+ur6D44O1rSWuc7YlStmXCjXfbW299+725PgyVH38aluXBvTqSsnIvOpe+Ngnf8+Owb4y/n8dX+SfL/1z+Q/Zd8E4CEAr9k/ZrLf9c0fBGTs0UMAHmBAMPN5dkSvOOTmOmLZrF403OhgPVGoe5IAuxOFfdineHJyKD5YTn1k24k5lj54wtM3UbvIiZYbSW6mrZNofzknx9Uf/btFTkA3Pt5wfuRUG/a7I/tAzjkg57jpD7K+J3pBqOiFRCRh5OaZm2nqaq/tsm/k9CF9S7/rnFp+5KDyo255YPbrePqQfulzzoX5eWSykPIosd+yEzfwyU3jJUn+qA1JDsky/XtUX9J/ZOdYkTL6oD8fCtA/B8kkZcnXNWTWgX5cD/VqM5ZF6qVsOx4ewBU8w4P2c32l3Z5DHxKRRwd9Zt1uDMu7spGNtWHurhsPb3ybgrnrT46f8iVj1jWqvtlnon5sYe0r16/GLXqNcXRjgdjN8to++85x00fPIaDnlUTPy55/KEtb1Ws99domx7hU1ucOc14Plbf8yzmO5PfiXL4qew04F6P/9CF973jIWEAmpjjHIFs/+8i+F/Po/V257bpqUSY8yu29R/qP7NycK1g5yfNJ7qNz5K1zylZfa+0tS0yZvtd0yjysO9K1PxQ5V2UfVbdsZLdcf0XsyKODtbVMua63esaEMvGCbNwk1thCX+yR2KO398bo/b7J2GWj1JiuNnQ+1jtop7r2iW+ZARN/k3n/+zwfBGTin3K+DfA2HgLwFgA+dA8BPvm7/+wb4v1zftVv+W1vmd7N4d0oudGOcm7UGzk3NhueG3AulNyUklSgc+IZnRjqSQI9+/REIULi1lHb5xierEBPZiInP2RPgh1aV7S/HCPHb33tTmzNvLIf5BzDcUX9ETvfvTB06MUEJPl33bq6Xd+OK+pX+oxc54TecgQfI56wB1/Zp+M5vv6kz86JuXpksoDM/C89TKh5kDJK4h9iJ8lhjDyqrzkf55goBxWpY2LJzS7HNR4EwD9j5TqM5FwzZXBUH5/x89KHAPomF6NxnoudteX8WmPIB3f6KWeJyqM62s9F+rVv5XOxjul6iBm/yhnn7ltigQdv1km0LzHHTH89f4CeU8Q835wr5zlQWVzry7FF6ipfijnHc+WtMdfmYlmewzfl7lqw17ZxrXAuIw6IC8q4LnIutJ7tROcFLuaz9NMbMO+z1K+Jte/Uj/dyK9dR5uC8nK+Y+wTZPZSytorsu2pD1y52daqt1k09ZfvHlod2MctSfmh59lXlrb6zPuex1PfI9O8YynvR9azrrW48JBozonGUeyPlxT6JfXp774e+3DvL2F2WsX8yztH5VFvVD7Xmv2+dgUz8u1f5fRCQSX+VfQjgw4Pu2/rHtPEb/+4BADbmx/HWiR44UDeGOng8cpPeyLmZOUGRnHChRObE4IlgD2Zfyu+V8dZ02lBuWzHHzpOVJ7JETo7oFbOOcvaVYziu/ix8Ti5TvvF7UW9jHoyX4yPrlzg60Y8uHHmBSTnr0yd617fjgulbcoOc/Cgv5g4vN/O/P6qeZTeyfYCO5fj6pL85F+bI0SURNaHeo5M4c4Poa8g1Qduj+yr+qC6JH/trb/LP3JxnYvKwJjNvkinG9cED/ay1ybKMF+ypuyaJuV7KIHUqZjv4kDtf/04/HirnWI8hyw19r8mshfPMGCHpZa3kSB/VwSqnTv2q28cWZjvk0eE5ShzVq+PVtcs47mQ4Ih5qWe0nx0lfPHeAnk9EzzF5zrm27DmyYo5jWWfT10sx599xsNZv+jOS78/r5Ty+sHvOz2vkpXKMU32qc6lzV6ee58K02T77XcyDsXu/B7dhDzJ7z2YnqSsnLq+zN77mPJyb8wVznyCzh8TcT2uy5zdxre6eslE/2sE86DN15bQri2t1LLsG7rm27qmjL/oP7jnqWtb1RjcOMi6QjZfEjKeUT/YI+8Sj3y/ErQfxnXGs3pVTtvaxn7U6s+wRGeA3/rwaT9LeJf6ZsFNOva23AfhJwNt6CDB6C4B53tD47ONNB91MS3ST3qGbmk3PCWZ0IsiTwkimL8rsE+SkICLvPbIP5BwzT1zdCU4b8+lkbfaTfee4ra/Hk9iSV+xlftmXco6FrA+gfiXWkz4XBmxeIDrcusDUPnM85fSr+uxcRMppV+d/u1mSkw2OcpzkI/11vpkc+AAgk3ySbBMJ7JlwI2sD/WaoS8wySUOmDr8lJaHmYQFJNQdvy3BgG/XTJf/6ou/ORcx5bq1rxoYxIlLGWPrrQz75XEP7yHWosnGDXRns9NpWnfWSbx7C4OOaX3vK6LvW0+a4W0j7bFP7y/JOpi1rR2w4v0TigvIRX/JJP2uy5WtYy+xvhHkeGMldW8bJo3JmLIP16GK/ts++6/j6mecTZM9Xzwn1S6y+aQfXDub8kPI6btVPzu15Xq/y2jVyWcZt6fr9ivVjjOpbnbfrX5GYIY6oX/nKPk/mqg9HX/H7KT/JEeMu7z0G3MhL5aHul9xLyJRX25bueW+r3lq5fbjXa91anvWUR3XW7OeU4dNWfcofeuQ4Va68dLprTJnrqQ2sMVH3g7GT+6LKJ/uEOCQ2xRqnvW48JyL7MfbRU7Z84ltigIT4l/2O/90P5F/wr8l+6so8BKANSf7agwDKqffUPwdgPN5MqG8C3D0AeEtsnz+sm2V4sWCj1k3txj8Xaz/qtycDTghnHrYX05968soT2145+8i+HQ888bk/gZ3FL/3meMjpS+d/PcE/5AJEX7av/dax06/qc/JEO/pqOWPd4W2w/tmPYziu/uhnXlRNGkwWQJN6kly+RSaJzOTcJB0k2eRYS9gzSfNVetqQmHYHZb7Knm31gzbdgwiTfzDn4xzFnH/Ka2sqd4n0h69wg0/o9pd9Yct2nezaJ7puFWmvresLPzJJ5kEKa5X+KYMp46u6c3lsZA5bY+BTFxfEBA+SmB99VD728CmXayjnYtbtbJa7B89B24p1TiOuXMsOuzbZr2OJ+uu5RMzzTMqcl4bnrXLOsl6H2ec1ZPy2n5SxOadroGOMEH42D8/ve66P63W4y9m8b6m+Jg+sP7pxMMJsU/tbzLf3N/1EvubH+dNnyo6xvN+gTlkj5+McKwfuFdBzQN1Tqaec56qUs865cvajnIicOv1X20jPdtbZstm/uFU/+72mnDymD2lP2fVMG3Kud8o1LoyXDo0pscbcQu/3jHGbcW18i8Z41knblJ8BA8TQf+PTf/y7fut/+v/+GZP6xK23AKzrTwLWHgTwgGD0gMF+roXpN2O+xAcAbqRE5OMxuFi4scHuBNDZrJttU16cFMq4e8qyL8fSjzx55Ultj5xt7Q+s4534mDyOZOZJGXh31H5zTOX0qZtDPamj50Vh74Un22WfjImeY6dP+pnovKiHHd0570X7AO3bcfVFP52jiUImyyTWJFP+3/SZgD9Epj8T5UzeuwcAmbw6pkme9bMP5FHyz9ycJ+jcE7u1pFy+OsxyZPxifiSp+JLlXftq6+LGdeuQ9rapfaEz73yIwkMAeMWOb5WTkW5d8KkPfIVPvtlnLjyM4kD2zREfvFQOOs4utcm17dVF7YnuvUsx+0Ku80O/dD1qX3UsffY8IuY5JuV6jqIM2whr/ZE+ap9jXyJ7js222pzrFmbbkTya18I+uv5t27mFzfuTkX68ZynXU/yovnfzNh4q1rq1r415pr/Ij/WRI/pXTmz5qXNxrpWDunfcW6M9a/ljIueF7D/1TvY8QhvLEy0Xrad+bt1sl3LXb5afK8sB7ZTPQdcwsa43eo0JYyWxxhP6Yn/c7MV7fXvvG7OjmE47Mp+M+YPlaFOf+DQMfOhzfuPv/9bf+KP/r/av9GcCfU5SzoMAEu7R2wBP+RAAv5kHPvFgIh8CsGeehubrjJIbx423SEzduN0m5ySAPU8GymlX7vqw/wWyed8/TZIXdSi/OWqfjg/Wk5cntO5El7baLvvM8U782X9y28VxjjuaT/qN3F0EvEjsucjQ3vpdX3U89OSr+oyenCmfcHezltVGXWy2yb4ZU1/0M+dn0keiRdJK4p9Jo8n3Q5DEc/TKPskbybtJPUjCV1/9J/nHbr2a/K89AHCOYM495eRG+RKkT3wk0eZAxrbWl/HoOl2Co/4Zv3LJWsBX8nKJzLzkVJTTLd16HdIW/3iYgq8m+qy/65z9j+aO/Rrcnrseuc87OfdnJ2ebbuxuvh2PI1ttX8fI8dM/zy+Jnos8B6mfi7V91ff2Zztw78Ec99bNemvtdvl7znXweKPu/Qd3NnlfMtKzjm0X19WcE3KuOTLxoG0UGx0XJxz0873OHdp5vSQn8rbKjfOXj+Qh94/nHGzKiXXvXUtnr2df6h2mDTl1+tD2ULQv0f7URe2PgY4BpsxYqVu+hrnOnWxMZKxUOffayf54P+7l+71yjNF9e99dYbyrT3yLDPDX73/Of/BXf3j0rX8m/Jc8CMiku/5hQHQeApCU5zjXlPVZP3wo4U8B+F8A2CtvcQl2D+3GSVxuQjZtHLnBU/ZEUC+wtU7qKecYl8jZF7L+iJ68EjnJoefJTj3rIdsPWMc68Xffye3AM9xSH7w7av975pNzUB6d7PPi0F2U8sJh3doXY2BzLHCNM/mrc3POW5jt7Mvx9EEfnRNJlMnWYyT+PDQg+SSRI3EbHZnUI9cHEHzje43kP5NGOZCTayP9M1+/ce/6z3VR7pB1xC7WOvSNLccwLkHWtj7AkVNj4Bykz6xf9Sy7hkz/3ZHzTVkuKk+PrbvfOnRP7sXaR/U955tyx5O2rKdc+81x09c8vyBvnY+eolw/KnZjZx3kvQccWDdlbRW7sRe2c659x7rcsHjf0cnYus+D7lty/ZGJjWpLfZOL4xz0C59T7uZwqc1+9yB1Dsf7/X1GzlMucq/UfaTuPnso0t+ePtjrWU9dpEwZ7I5RHe1dm2qrdbf02v5SPcdRBqtcdcazXqLrKP+pp5yxMNonm/uD2CMORWPyFNkTxqxyYsrGf9qQ5+eJGeCv3vM7///Bn/vbn+Ubcf4wH9/WXzP5zr5IwEdvAzD+Yz8EyAcAjMV8eQvgX/1d3/PZuxj//7P396HWdet5H/b6X2E3L3JiQSM4thwwVoQpCahQF1pSgdKagk8bYSc5OMgmpKmP3NpJbR9DDY1xj6IQU4c4cSMZ13IT2SRVLCk1SR3c9EhqUmhs2dhFqiFHx6IQy7QqBoeCpfN2//bavzWvea8x5ppr7bW/7wXzue7xPcY1xrrHvMacaz/PPAOPa84v3Br5ssZVv+SE2TCMT3srjjTqFbONo53O4i7v3fBWQvmYj7S7y/bEc5tadWqzcK3H+od9XxzXmset+If+MwavbEO79qP2Nx122unwtd2ACG/Z5h9htqFd+1T7TNjxiI55hOQh3rygddqWbedYeNqPqEagIgarQLxFGPGP+JwJf+IR/CI2/cm2Far1kKDWyXi8eJvBKwWo8yjKx2zuiIe7PTiqo8ZlXc7JOXQOxa38tT3HCQeVVzhmfm71NkDyfI1NX7OcYcdQkbESV8dseIsnuCRdTmdonsRa71Zdfg8fg9m32jZhx3spjuqyrdrf9C36m5Evek1xe/tZx3ZN+Oy4t/a2dRp3KO6L2ntwK09NO9R/t2dkv+u4WQPE1bUwC9fyWfe9vYzL8Yn071Yf6rzkYx8WnPBSx813hTi/M/l94ruYYe1Lv6N78+sHRcppi9aVYWzD2rdE+5F1ZlzamedWdtaPbVi7hmk309J2DkfoGhDrWjF89jvi2pt/V1zfM7xk7ZPXei4t1/kvYeBuXvmdP8Jf8c9TeC4PAnxqngL+FvbWIQCC/BZtZB2Oo4p/DiK4GC//y8El9L1kXr8gidjL5Zc2sH7R3UiNxyHUONNG+EnUvbKzH9jkq1jKZv06pkSdWCJOL8NpZ1nHlW1s9nfpP3O8cFrtHFeMJ9vRrv3JvmJXB55OfmS7KbgpkSftURniaEesbdY+1T47lkR4JAzWK/NhW5/t2D6iGCHob6nrq+EpvK+xqc86wXPiXxHvIQAHEvxBN9t+avE/mju5cu7EWbzpidXOcK3HcKLztoWZH5s2RpdrlblH7MttIjwzVxygIMLJuwczD/atL/pOnY4hcTRWeZaPylHlk3TjZrbpl6LfwRHW72sN1zK17TouwjM+avyobK0/2699q75nFc69p/rwPWF8W9axFSbtkRdjG9Vh/AxHZYZxe8Z8yJP7n3Yi9tbH+xPzZFg7EfvkYUGda8O5Hma2ecUTPk65sK/PgTl22juM/9Cy9llO6tjze1O/V+mLLvl++n29poxl8ZPaYsZpJ2J7UUb7FniuvkxP+9q2rWOExF1yOa+U0U7MNVDXh2G/E4kn349PH3zfsjbX63Ic71o+rORDnoyjjgxX+5Da/z4ZA/ev+/8Hf/mv/8qv/H9/sYp/DwE8CHiqJ/IeAiC+8ycBtPsUbc7EPwcAHDr8Q7/u1333kxH+BBXXL9H6i8kXt1z5Rb/Wpk7K1rqP4XQId3nvxr30i/Dkqv3RSYE4MzEd28zOsti17pM+ZB8vtXeOhz7UftX+pwNPe7YxsBGRVjHjRmWpm/hsA7v2p/Z3xKXcyilhbOMTrY92sm36PxOBKQivsRHuKd7Pvfav+Bc5BKh9Q5T65F80f6JP/sG9T/5n8zWbs+RxZo/mepZ3FO+6IE17C0d11HHlTRT81J9XONcc2JDGIYwcVlTw1/hrwtZ17tCA/tdDAMbouOp4R3MAh3IqbvG6J21Wj9+9ivX7meGZXeuo/RrNf8YlNxmfdtZZ26v90vec4KW+/Cny3/nC+z1whMTd6IKTs3WdH99dV+/36xESl5/R/Qfpxpu3ho1PXO4R7GPhpc45a8K4uj4yzTwn/NAObdjeKdK/PX0n360+tpe4cDPhpI4/vzv5naq2Pim/j9rk1RZHcabNEH84SqvxGR7ZxI0u6h7F74mzrEiZtPfUsSdPrZPwY66chzqnhHP+sev6MJzfjZPvx/Z3Y1mTp9+bXLt8L2r4Vt+VrucKBvhv7vid/9/3S599xsUf+1MAI8RT/GP723wEsk/R88n6Y21FOfXnIQB9uXV7tsXhgk/+c+x8V66g9MWL5Bds/cUcbBif3MXVL/6lYeoYXmNncNon8g3qqP3QUVWsDi7DNS/hrPek3XmfmdjKrXGnY9oxHvpR+5d9xx459D2bhZuXm825MqN2ZpsH/cp+J5977Syf47SfCDxF360Q4Zj/Y4CvladIP2fXp//UkaIfe1THSPwjSFNY5s2DPCQ6R8RpPwZrPTWcddd1eUmYenKOCee4sHPs2PCYBzV1DXAQIPfXCPtLyzBPdb5y7rDrGAjXcT4Vx3vnI793ae/93s7yZV3YtT+5li6xaz21ndqfE3+OH5779LXffk357PdgHxmOcW++fWPMfQ179Mm9cJS+N67Wk+Flfgbjq3NPmPUxiq9pQw5PuWEM9mfveC7Nl/Vri9k+cctV+Mgx1++I36GRH9YX+53UXxlvWJzFm34JVv9oOLHahEcX7Y7iL42b1eO4qC/zpH1JW5az3lE40/bYzqHIvGM7/2BdGxnONYS9+o7k2ttv+13I9Wxcru1zcZne9i0YuPMfvO7/9//CL349xb8CPoWwhwCKf4X5U4hy2leY10MA+mT/HoPUbxuI/9EBwFt8/Z9l4Rdt2Sjyy1o2Db7g9Uu/N2xZ8OSiTeKz7XP2oJ7al3RW2OccWs1PuNY57Pu6r/JaOZ3FH/INxkNbtX3CtZ/psLF16BVHm4Ib1GhDyTTLUqc2WNsgXPtDuPa5jsuxijXd8tZtu/aFviKaebr+2N/++9Q4nypT50is0yYCXqxinjcGUoz684E8BKhlUvxjKz5TQNabB3kQ5ee50fnZg8zpLN+o345NrBxw2MLcJd/Vfu6DAOdudhhQx0DY8YlwgZ2czHgzXm5naL4Z+n2rWL+XNcz3d3bVvIRr/aP+5Lhndi1X6yVc2z/p59qPV//9dsPMCWMD91z7eXBP24PkeerPeo4mY63rwLBrRDQePOFtzhFjpB9P+RnVb9yag+xn8JFjw67fl/w+jb5z1R8ZHiFxeVFfhi+1Rz6SOozfg+R57GWb2d5j69wqb3tbfFVua5iyGYedV847a4JwXRuG6xpafUdy3S0234nR+qzxfndyTRsnmma48YkY8HX/mfhXXCOMEeF5AKD4FzkEMP8tUYGehwC3OnCwbsW/BwC05cHHW3v9P5eKX6TTLyYbBl/Y2Diw6xd/b7jWswqPHcNpn8x314+9fdNhJerYxEzDHo1p1V/btz9rvOva8Sag8mva6dioc3LV/tT+puPGTqee9tbmYZobmuERUifxidlO7c+I5zqmWTjHar22Zd/cOBHJiGbEIE98zwlCBaKiH8FuWdNAhXuK9Sr6a5i89MF6eJtgdIhQ66Qer5GAdKyiHDgfcnMOXScVz5UzPcs5L1uY84hN3oyrZW1HzHFiO36Rud9zCMB8jA4C5PxSZI4ok3OVNv0yj/k8zLHvYh3jbE4rVyMuk9tb2LPv58xnzeJH9dT+jca3N67WVds76dfad5/65SU9fbf2XtzaB6xjK89Wv54zzb4mYr/E5zxfO/fTukYyfLJeqHNZE8l95cD+1fhrwqO6Mk47EXu5Chc5Ruz83oy+a/rhivqoxOrHKLOVXvPvCeMzySemPYvTzz4Gbcc2sq5Mq+k1Lctt2VkOO6/Kaw2Tt8YRHl2jOc81kXZdOxd8R5b1eFibfBeM83tBmI94CJ2GjW98AgaY71/xr/7QDyP8z4n/FPOIYl//r28BEH7OQ4DHvgWw9fSfAwCu3/mHfvCv3NFf1+oTzMhtq8wOa4Prq2waftGrAxiFyUu8ZaZY29wbvqt/VGf2hUVMOJ3XOdv8Wc9JO/M+MktyqF3R9DHuGJd9rGOpTnzk6HMDuYU9aoO42hfCtb/J8czOMtZpm/bfDVSxpeAaiXkFuciTfgQ+eRHo9S/Lk16FO0IO4Z5i0XAK+nyLgMOATJvZWadCUsEIOlbQ8SfKTUW5e07MucMerYHMU/tWx5DjxE4usOGHuXRuz2EeBCjO5d81ZHgvOmeWZ57pE/MPEu981v7X8dXxE64cJadpJ6+X2LWO2ffyxCdO/NYsX6131sfReGvcrGxt46Qvi68e+2I89yGPSD7tvbinTOaZ2efao9xTXrZv/wjzMSweYp//3/HYJ+uyro1R+GS9UNc2x4z6qXmo9Wd4kwPGyJhyrHx3COd3qH6/9DsjfzSKw48RX/1ZDY/yjOJquRque6HhxLQpT/jS65py15TJvmrXMRuWr4qkG6dN2GsUl/Oe6yHtXDvaq+8J6/9ujZ35nuQ6ze9MrmXi+YziDin975MwwFP/X/kXvvbzin+R3/yn2J/ZPCVH6PvkvyLCeVb22vgU67b9mLcArK++AeBTf/Ef+x/8k9/3JJPwDJX6xUrEXl98mScXDoC0Eda4YR21rUvD9Isy4MOlUxphOrKRPSpjvSsc95MpSy4J+6nxa45rfQ9jWbV5FzfqXx1HOnFsHX6im0fiuY0m87p5GEfdxmU7tS+Ea38ZE3GXjM02bJ++K6oUYAo2BBhP9kdvAyDKFP6I/FE+RFsV69YNkjYKE59vAFB3rcdwltd2HDPB6NhHvMvPiP+njqvze2m49s+xiDlu5t0r5/+SQwAOCTwIYC3I/2OQtaTo50DJeu2jaN/BHJe2YxYrN4Qv5Xdv/tH3kbjqk1bh6scyfOe/VnnvwqM2tvrneMVZ3lG9te07xzzzwfjs6q/148+Ftl/bMz4xbfJnuNqE91y1ngxj87HuQ+jl/rUfiesxDtZerodcLxk/tMf8jfiwP0/FTNbveO2H4QPG+HOsadfv0sjXGKc/qlj3ovRjps3iqMu0mjfjq52+s9qGwVtdtG9daRsn1rQaNt8IzQtuXXKWeG5OtvI6v1v+NdeM9sn3ZPs7sl6baz9Cmms48RB7+Nc8Gdf2LRi48xP81v+X/+zP/fxv+NovfqbwB/eK/xTwCP0q/g0/9ul8tqOtaKdu2uFNBA4jTL8ErWv06r9P/8Fv/KZv/vZbUP+cddQvkF9I+qC9YGwe+UXny5/hi2za+fRBvI/a3BtHHYNLx5TIBpfhPfao7iFHh9mTs0PoMAZs4vOT+bTHeMHYcgNPR46dmwIbiuHcXBSjGXfOdjPJOq07sfYn+6qd8+FcmQZmHdZNu26giiqFswLOcSHI8hCAp/Mp/rHrH5Lb+/Tftirm2wSjgwT7BmZZx5Din/E5VjDnRj4Sk6+ntHOO9tjMM/nEUZnsb44JO8ed8y838ARvdb7PvQ3gQQBzvnVYk3OWNuuHchz6sI787x5nc1nn89I5HfE2ikue8zt2jT30h/iovf6afFf6tNHYatxoTKP2NvqLnx7564w3veKePLXMLExdfGr6IXb731rmVuFs1Toz7jXY9gs8vQZrb7Q+WEereNftqM7TObIPT8VH1j+y1+OejLl+V+p3KX2wNv437eqb9c8i/jntUVh/bj7R+BHqK0XzGK5oOkhaTTduC7PsVr5Mu6bMqHz2P224ml3km6XVeOaUOOeWtYCda6KuF8Or7wlrbf4dca26Pvl+jOKI788zM+Bf+Ff8cwDAhfDn+oNf+X9fJaRnhwCPEedbQl7hTru0wWEAcVtlMs3yYIp/bJ/6i2/19X+XVn75iPOLeYqTTYQvv5vlDMkzvLbauySN+slf2tFBjRDHRrw4ylPruw+P+5XcYfOR20NoCRs/wlPeB+OyX7XP6ayxdeZidfpuELmhIEJ5eskmlPHnbOrO+mpbubnYn9rfc2HLZd206YZ57gAAseYTfgQaApGxciHe8nV9xWIVginSt2wFPfV66EB7lEnRaL6sKwVjHgA4zjo3yceIZ3kDz3Gc6eafYeY9Z9e1OgrXOrLfdYy5HpMX18BjDgGcexARj6DnIKdexHOxbsjnPFuOuZ/N5Tnx73cpx518OCeVM8IjbjPOPDPMvNr6nBMc+8OxH8u8n57uCba1hZeOd2d/t/y1/vu50f2htpvx2hVrGcI1z7lwraPmz3TTMu65bNseIXGn12DtnayTUZ5RXae8PtW4Hd+sftMTl7GPxnMXV79ro+8XcdX36JeI107Uf6WfJn0WNm2GWW5k557ofpD5Mp1481yKlhUtn2HtiubdwixTbcJeM56Iv+aq8zvbX3K98J0hDK6u+fdkWY+neVjXuXYzPFvzHX8bBr7hH/2uP/LH/mt/5qc+47V/hf8txL/C2ifyPv0XeUX/2if01l0xBbxP6m9xAKDoF6n7Lb/+X5eOX07itResX/LHhKmf8qN2ro2b9Ccd1iX2ff9qneO+JV/aoB+dmuHEhd9DbIZP7dqfu/BoTHUTT+e+tTm4uSBOEMWIUuMuwdycanvZl9kmQ/8Z12wcWSf9ckNV/Cm6FNUpuBkXQjzFP3H5pF4BiKBDxFne+i5ByiISqXN0ADCqy/6Djgl0nDkXyQV25XfEsXHnsPJ/SXi2LkfxzrWY7eR4cqzJQa4BOZI3OIT3FOfO71Oh6ybnUdt+ifZXzHHleJMH5y15wpZbbdH4a3DoB/VDY39Y/RaercYtYesqeE1fLTPt81Y/Fq9M3/JTw5n2mm37LV7aV8uJl5Z/yfz02X5rn2JZc1eum2yHMRt+jvHblmj7hE+vwXj9zojVpxCuvsdw+qdq48eIS0zfpr0nj3lHiN80XjtR2zxgxmFvXZm/5jPN+mp6DWf+rbTMhz26krfK/aVh57NiXQuuEXH4fRmtu8M3wTWamPa574t5z+Xr9AsY4PX13/w7vvdn/jvf/3/97J/4sR//7Lf9uf/yl7x44n/uqX+K7bSrKP9jf+G/uH96rvBPREhfItBr3aOwffGp/Z76LSPm0/8U/R4qcHjBd+YCul9N1vwyaSdin16DDWToBM7lG9W9joOo8/1Zl1kOFQbt47Toq85rhuQZXrWtdXg0sfY/04wT6zhrmHyn16CPdTzVeadzrxsEG4xxudn4ZByxkvF7bOrLeq0fzL5g176OwlnGuuyHm6miSrGluFbAg4ypXjOBWF//t75E2iJcMfNwiIDY5G2CjB/Z9h10PKBjBB23PIjJ0V5eR1xfE1fXH2HqGcWfi6vtOy7HKcoDmPwkb9hwyRzUn3c81QEAh0nObc5nndPZvDIexyjKwWhez/F5afrQ/6XPGfmkJW7kw0Zxa7+W9Yd9Sd+n/V76tm6TXh3SDtbaNu69IGP3o30Ozf9W0PHQX+1E7NMr1tvJGhrlX+JsxzYIP8dn1p7xp2Okz4Nxjr5f1f8STv+jjW/C1kdV1I8lpk3+UTjjsEdh40X3RdF4scbnfmFajdsbpg3zatuuYdO3MPNm+bTlmDjtETovInm0R0ic12j+R+vkuJ6W78N43Y3T+Z6YXzsRuz+3Z+AbmN9v+dznPs//Xf/bf+8f+eyf/V0/8PXf+Xt/+P51ecQtYjcvhbAiWoF8DkfCnPpT/GP7mv4o/2Pi7N/eNwzMDzpmUC7kxgMA+Lv99Lxcjbl50Au/nGscbCJHR7CVRn2kz+o9H2+fxHW/LL/Vh2vTrPsU7csIidv6yHfN47iI1z7FwVhGTjqduQ7eDWC0cRCXGw6iGUGDaGbzyrQ9tvXVtrIv2tnXapsn+277bqoKP0WXIiwPAOohAMJw9Oo/4pAn95a1LpE2sG2rovlEXx83PMJah+NJoeiYweQ0+cGu/G2FWTekV9wqY/7RmrtFXLadY8sxu7bkxHUgJn9wy1zzXzE+lfCnXn4KwHfF+d0zp/bXcWzNbfLiHIgz3j+58xWkgY+6tvzRIU2flYjNRx+WtnEHvKB/u8eztLtu675L9306WP3vJQzA5Wv9ZN+069zPw6zB+ZqxHGPPurfCpD3VZ9SHjLO/y71X+Y6lz0g/kn4m/e/IHvlkfbOoT6to2fR92lnWuIr4TuNG9lacaaAXdY3sUVzmJd3wDK1DrPlG8eSpl5yNkPkZxRM3ShvNJ3HMv5jrwvWy2kf2f19ybfKdmIWf6vvykeq9F/r8rp//o55X1RGs/Gb9S3/kz97/hX6FbKJid4YpjLUVzCmgt4S7f6E/DwKe6u8BbPUj07LvjkuEiyr+GQPfqbe+oGZfwGXjGH253STLZrJyCplGHYRHda3j4PO6PmU92fbE3nUDmXWu7ewn9mM+dbzWVePHczIYn05a3NrM62bBZkOcmw42IsbfO19zEGB9ta2tzcc+j/JYj31041TwKboUYYr4Kv4Zi6/nj0RhPsm1LpD6RdsaYZahLeqjDxmvXcs7lhT/jNMxywGYHMlbRdfCc+Ind2uT9sCta9anHEOOMccuH6DrQEwOseGYeZgd+IzWwKVxdc1cOq+MI8e3Nb8z3vZyvjUnq7S17xv5IXyW8fov4zJsXPo2y63xzJpZ9W+Ud+nPut5Db4yzb4T7874YyDl2fo27Jb4m1nKc9Ot0nIPvysiPVN9LGB8s6o/1VYS1E/XPxOnbRnGj9JrfciPMvTFt8xqXmDb5Moy956rlbC/j095qw7LmMQwmP9Um7OU8jObHOPNQJuO0c+616xpZ+d/ROjuNy/WonYjdnysZYC55qp9C36friGsEqyJWsavArZjiv6adC1s3mAK72qNDAOLOlav13CKcfcbOMY7EPzx+67d92++5cqpefTE3DTqqfYpsJKTvxa26aGmenmnaFU/7Z9/o3yWX5c73p/Yhw9jXfhiLn5F9OtbB+KrD1pHXDTw3AzeRRDchNiXEDb9v9tV40/YgdbqRZf3Ybjx7MMvarhu1gk/RpbgG8xBAe/bqv6Jv9Mq+dV+K9AHxyZX9wq51OQ7QseVNQXKQnOUca7sOCGOLxt8aL/qulXU76ovjAHOsyYHrAEy+sJNLbLhm/rcOfpz/a5C3DLbmN/uTfc0xYDu+HHNyMZvHx/C/KnveD+qbKuK7jKt+LOO1wflV1siqj6O0rboOvbFdQmkfUvvfEQNvjafsr/YIibv0gp9RXRmP/ZQf26cNbdE4wuuL7wtx8b0Z+Vziqq9JP6SNj8LWV1XUj1XfluEsY7xxhi/B3CcpV8PGVd+bYe1RXtPEzKOdqJ35jRNNA4nbuuCGdDlKHM2Fc2WaYcppJ7rPOv+z9ZFr6N6ua20edn2C+cn1m/FtnzLwDfx23yf7PNX//T/wlXuRj4jmQvTXyzQELCJX4ZuCd2YjhEdpCuZE690S5+ShP/kWADbtkLZV9lZp9jMxx5gHIXDm9db/8n8uJ790I1xvHvMv9C3z0bdRX2r8ZW2y4VEveO7aHmf2A/spP/JAG9qJpxyUsVXnrVMX0/HnRqLtRuOGxAaFgPUv6SOgETSmn0PqtU7bELMvW7b5rYv63EAVVwrqFGKKflAhvvUk2EOOrMN6ExWVFTMPNvWI1lnzGHYcoGPLm4PkQK6cU7HO/VOGz36nyrrcyj/qp2MCHW9ykGsh1wOcJZfOkfPggdY1Qn9Upr7+75yP5nU2t/X74XjB5KHytMXpME1/OMJtH1j9TvqntPVVxNWPaSOs9Z+GWU/X9dH2an86/P4ZcO5zPTHqDG/ZmVcbfMmPY7IP9p+w9hr57jxc+BBtMH1K+pr0QdWuftiwfmyG5hvhrAzx9cp9MdPcN40zLBKvnTiLzzzYo3zZlunGiZat6RlvXhGOsEdcGVfnxTDp2nsx5z7XhLZrJdfOYL25BkE+o7U6ir/P3P+sGPgG5vEf+C3/i9/va/yK0xTLiFdE6uwAwAMB0ushgCI4BfDIJt8o3jjryX7NBDt56iEAfaSuWZlbxmdf7b8ov6DCX25502I1O+8kkF9Q7UTsp7qgMNu6NvxU/cu+2caoj8Tt+VjfnryjPJa3LwvebeQrx3wX1nGD6dyx66bghiK68bgZgYgXn6CCCGriSHMjE7Nc2tZfsfYnwzWv9dEWF33gUnAptME8AMDmEGMk4ojjd+L1Sb11JtreCDNfte1XjSecdTmu5DI5kJs6pznft7ZZW9RZ19gtw6M+5xgdd3LhWhCTu1wb8CvvzANP7BHus7VwSTyHRqwt5xe0LfHc/NJ/x+U4wRx/5ecs97f32/ik9EEZrv7KfDU+w/ov6zH8WLS+xLT39I38/XlbDOS8jmzjwGobl8joDWuDfLJ8hu8Tn/Ef+2Ef7O8a7/x3+ovqSwynv8FOX4SNj0rU1nfpx0aojyZvTbd8ovm30D1SNK/7AGHtiqaJNX0rbBmRvNhehsUabznjR5g8JS/acC//I9s4kXLaFeu8E3ZNJOYaureX74frMFE71+YzfjXeYFN331N+v//Lv/S/+WO/4j/4y389xeqWuCZN0bp1EEAaF3mtW/H7WMz+aSdqI+ax6yGAfbql2Lcu2htdOWba96ri/z39t3+jb4Vf1ETsp7hoP9vJMPbsMyqTcbfuK/2wzlmfniM+x2ifRPt3wDvnUR10Ou/q5Osm4MaSWDcmBE0+QUcwm6dudsYnUjfhbEP70v7QHpfiSrEFKsbyAIC+Zt9T5PGX4utr3Fkftu3swVrWPnnAkOm1PseVfI44yvnMedaua+FZwnxnPr1bh8t3Z71GM958YFz2H8wx5vqQDzDXV3JXeSWcvDMXHmjlWrjUpg7Xm5jtZD+yf6P5ZTyOM8eOnbwkXys7+b2dnf5GG8yPfirjtDNNOzFtyhC+5sqy2H6s33Dj+2Yg53tkG5eYNuwQrnHGg6/hY//oi7b9XjB8a/qK9Cfa1efoi2aYfljb/V00fg/WMobBPZc+NbHahG950a9sw34aZ3iGo3x7uCLPbF4uiWfOyV/n3jWRmOvn3l6+J8t6O/1muDZPUzrmngH450n/L//Zn/v5v/8XfvHr5/4bPoVtRQQtIhYBy1N1/x6ASJyHAORFFCemIN5rp7DO/hBveJSHuDwEwDaf5R6Lsz4QX8en+Jc/DwHuX/3Hh77DT34xR7Zx4GMv6LMO7cS0s92Mx+aT6WmbZjvXoHUkpm17xL3kx36sx8hCLVc6cOx09HWjGG08deNCOCmSEM2Z7sZK3GhjI542xFF7xtE3bXHUVgoshZdCDPQQYPb0n79vwM8asgy2dYHZhjbj055h1oGNWPTtiWzD8vJXuXP8zlfOYZ3fOv+jMGUy/lw4865svouf7hT8y/f/ojWbY3X8dW2M1oVcyq2Yc+JbIY95G+DaA4Dss/MLOsYcd87xin+4fyz/s3k5eLf0M8TMwrfyha6NWVvZftqz/LfqV9fzthlwrTgKw2DapNdwxqVtPuKe85Ptjmzi1pd+4gHTn2inv8HWD81QX5W+Czv39nP2ufSsL/3lzNbnX4rUd2kZ81vWPhGvfQ3KJ2W1Rzibl0vi65xn2HWReL/X5Fqq6+zwLXBNis/53XhLbX0DT/t/xb/6Qz+M6P/7fumzz37LX/t/HUXzteJXcYuQRVT7E4A8EMBG4Fbxb9kUx8aB5y77TD5s86dd0zwEoE/2x3oeg7Ud+wLm+FL4j8Q/36e3tKj29HX2xTQ+EXsUNn4P0ifzVdswyMe2DqHlX+NFUwyPMONmNvWM0mr9hl8Ss5/0I8PYy5VO+s5OJ46djr5uGHWzqZsYG5xiGvHjhlc3xIyvdbi5ibVN+lTjah22p7ADFXcp5j0AmD39ZyyZ3zrErB8729UGaz7D1INNG/aBNw6wvegDebI+xysPOU/OX53Xkw26rIObpud6e6xd+lnH5XhBeZAXUb7A5HE0N84tyLz4NgCHQR5u7cV6AJB1O/euhexX9tcxODbQMVcuTuZwH/fVX+wN61PIf+6jPzqXj3TzVpylZb6ZXdvNfFlvzdfh98dAnXtHaHwNGy/W9FnY+KfG2q9sjzTTtdeIfyVP+NnqV/Q3I9Qvpf81DtR/4dOwReOvQetIxN57pa/dY1PvnnyjPJbd27dZvj3cyXfyf63tfNY5r2uDcK6dlb3ef+q6NOz6NPyR8Rv+gf/eP/3P8Io/op/rN3ztFz+79qn/SCSnyK1vA+SBAGnmrQJ5FJ95RrZCP1Hb/PaXsGkeAiDAjTffpVjL2y6Ywl87DwB86g/+zt/7w5/xRxc/wkIdfTmNS8QehY2vaXBnmvYIMw6bT9Z1iFn+naVl/F6bfJnXVoybhY1/abSfjmPB2Oxx2OnUq8PPDWS0WdcNi02QP6aGSEI8uQG6ORpOrHUQ3rPh2Z8sbzug4gpUfKWgx+ZNhZGgYwwcEGR+66jirQr07EO1s0/atLMlMOmj9eRYHb9z5NzlfE43aNY262D5Hq5uAu/TSN9zjerKeh9rlz7U8TluUC7kRkze5FJ0HsCcY23XCYJ+a57qOqoHANRjnXUN2RfQvtp30HHlWJOHk3na5hzfNPcP87KWs6zhLSTtFp9s0/qMm+Esn/GNH4MB18dstKZXNL/xhNMehS3zEph9qzbh06v4VvxI+hXt9Dva+KT0ufooMf3XXhvfZ960iath85mm36yYPrXa6XdvZdO+7VSsfdsTznGObPg2Xts5uBSd2y10TSTu2H9e23flJb6f0zar8L/VU/+ZSFbkegig+M+fBCi6UyhXm3pqXIYV8vYj09Ie5TPOtxLIbz3XYrapLRdiCn9sxb9vTfC/LUwn8p0k5ObBkAxfglt5Z2mVPvPV+Axv5ck07b2YbWBbrtpb+Wrac4RH/SRufcXGn44cuzr/3ETcaMTRBsamh4Dm9WlEjxvibIMd1UEcbYi2Jxpfy2YbI2GXgh4bkTYSbnvFf7a3x6ZP5LNv2LNDCPvlTxEo43jlAXR+nLeczx0b83pd1HVy2zDr3/W5heM+7VizcgEmR/Im1rlyPsAU6di5ZjjUcm07PzPkLQ7XUa0z26t9sY/Zf8f1iDnew33mGdnOWU0j/BSfbM/6jRONr2i6WNM73AycWxs13XBFmTR+Fjb+qTH7gX166UtJ037A3D+8HxD1P2L6Je3E9GHa+Dfta9E6Rqj/HGH1tc8Rth+2ZXiE8EG8vGiLxo8Q3olP/kd2nTvzEI9t+ghdB64R1g42uLpGa+6w6l2bYv0uzOJrvncRrq/6I/wf81v/KoxTNKdNvhS8HgAkInjJY50KZpG0amecaSOkzhpvOyLp2Ihw+2KcebYw81abMJccJOYBQBX/7/2P/tUv1bkvo+mJ2BmmzlncrD3Lz9JrfA1n+bRrvq2w5cStvK8xzX4nYh+u4rB16GI6fzcIcLTxjDYyNjuEEpcb3wgpa/yoHuNoFztR2zygdYEpslKAKegQZ/U33og2RJ55wCybdWZbaWd/ap/MRz32cXQIMRKV9A0+6ZPz4Nw4X87fBZvysiZcG7dHvh+2o70XLbfrRhUe5KSu13PzknOLnfOOnWuCtcM64ScazMvozQB+zkEey2Z92ZZrAsw+zuaYMU7neeF54Q2mD/EjvE+M9MyjTV1+RrZxonkvwXNlZ+nGVxy1bR7S0h7l7biPyUBdF4bFt8IK/fWiz9oLlnsABFz6lWq7x+hjRfysael7q//Vn90a8ZnUmb5zZFf/ajj97y1t+pD1GU60n7X/ckS69gyT58r/LJzzpb0H65pgzZxco7V2+Na49g6hD/wvc+lv/P2dv6/8b4naW6cpghXZHgD4JgACONtUOF+ClDd/2hln/Kwt+odIz/S9Nu1Yv22CVfQT3hL//JeLH3XJ8sXlU/EQu/xb0w2bYxau8eYHt9Iy3znbevZirc9yGT+Ky/Tntkf9IW58FeddnXtuCLmR1I3ITawiIoc/oodYyo3wnF3ryTBtZzjtWm+KrBRfivr65P3cX/zP+mpb2Y+RXfMbpi+0i+BX4CMquUavnJOHfjgHzotz5Rzu3JTH62K2Xi6LZ+27Hm0n47BHn1mZQx0ba1YOQHkB5Wq0dpwHMecYO9eNdh4EYLO+WUujgxzWv+XE2oZtg7l27LdjcXzOMbia5/H8wLGcbvFtWuZNu9ZT0yxf82X8Le2t9p+rD7ccT9f1cgyM1tIobtTDvflGZZ8iLvujDS4XPpRw8aWE07dUW/8jpl8a2dX36s8ei/hIfXnF9J8zW39LuvYtcVav/al+3nhQbtI2rmLl17BzMUP3R+cxw5TJ+LRZD4Truhito9V6W9beXfTq4/pcRb7nAPzxX/n5V/0R/163+EN/M1GcIlgxbF7FsIcAin+RePNaNoX0tXbWpZ3taGf9xp1DypAny6at+Pdg4Zz4/82/43t/hnX/ntfmpWPzy1txVI95TKth4x+Dt67z1vU9ZmzXlM3+a4Prq9wEpHNP54/thlI3IsK5iWmz0SF2EEfgnk2WsuaznkvQsrat2FJ8JSLO8kk7oltxl/mwrWc0jkv6l+Ojj3DjwcOobp4ge0BAX8kv/86H85Rzt9qU65yvw6ytXB+G1+tkXWaUluW0Resn7Me4iqQbp014fcW6zXHLRa5XeJKz0VrNNVPXDXNS10KGXS8eBLCmvvZzX/u664pDAdKyzJ61lP29wTzDIx95rZhpM9sypOdnFp952m4GXgsDt1ivt6jjqfmwj4nYi/BP+86fph+tdvpVfWtF/JT59Fki/izt9G+m7YmreQyzr2qDhrf2Znx93Y/rXnBt2HpF67E/NWw8mP3PMY1sOCVebi9F5yvnstqZp64Lwqt7Dfflul8fVvth/T31yn+F9fNH4/jv/H7lX/jaz/OH/RT94i3/0N85cTxKRxwjgv2bAIh/DwB4/V5BXcsan+JaOwV42qZbttb5mLB1Zhtp7xX+8OBv/vmjf/xU4xUuq1fZpdxw6KDhUWdrWg2PynTcZQzIaSL2cum0BzcB6fxzc8nNKDcvbTY4bUQswtVNbw9SNuuwrhmO6kyhlQJMm9fpt4Sa+bKebGfUl+QFe5SHOOuBl603JMjrIQDikrBtOB/OkZvzakPOeV5sVlCuh73hLFPtGs460zYfcaNPpmsnYi83sQ9r17GD8gHKEShvo3lxPsScc2zXwggV+B4GMF+sLX4WwMUcW67Wa3tgrpXsq2NwXDnW41wvc3vg58Bs8jbi+pq4WZ3G1zpn8TXfY8Ln2jiX/pi2u+z7Z+AtrJ9ZH40H19eD7zz6kLtw+pZq638q6p/A6nOr363h9HPa1mcY3CqXe6I+lDLaI9Tfpv+9lU171r/Vdk2zzznumV35kLNr0TmlvHbFuh5y3azsus6W8Pv3FDnCu+8Tov9X/Km/+BP//T/zN77uxZN+DwHAxwjeS8qmOJ6VIw/iV/EvEmf5WtZ4sNrGZfysfI2/JGz9lMk2067iP1/3x2aMKfz5OQTi/yP80b9ctthuGnvjt8pkHbN6M0/bj2dgxrPx4HLdOap04Ono6yaQG0zdnOqG5iaIAEIIpdBFCJ3bcN1IrafWb9j0Wl8VW4owELHmK9v8HQBEW6ZrZx1Zv22LlYtR2Lwi9dFOrZeweUTzWa/z4PzknOVcruZ5+V67DupKy3jtEWZc2tRn2Lpr+Fz8LJ161tfOdStXcifKrZjzgJ1zr+26OIesL9Y9P9ngYu1bR2K2aT9A+2jfr5jnS3nP/NozdI6eG+3Pc7fb7TUDb4EBvx9bSNpyhQ/NPaTa+B/i9EOJ+Kga1m8lpk/TniHlSBOrPSuX8elPtXNv1U4fXG3K1bhzYcsk2v4Ms997bHlJxL70Yt6yTM5jtXNNeI9BnPY95tpabL47rjlt8H1+7r5TCP//4Z/89z/7/T/wlc/8XT342/7cf/lLHgA85Sv/jxXPHgJ4AEDf608Bso0qwE0zXjQeHMVl+h7bOsDZlcK/in7DLf7f51fxo4/qJjcCuRHkZlE3qrq5sVEShxDiSTtCCGHkBooQwhaN30LqI71iLWOdKbZStNEP+kO/ePU/07CznHXZRo6zcrAVphzpWX6vXet1HpwbN+cdm7Frgu+Gtuj3pYaNF00XjReNF2u84T1IHdajveDdZuuY5UCUG1C+wOSy8u8ci3UdGK7rZRZmnfHmhj8vsXxdU7RnX7J/9tuxODbQcd/jcoMlN3CbvFWuTavxl4RvUccl7e3N+1r7tbf/ne/lGHhva4fxjK/wnfqS9C8jWz+UWH2U4UR8mmHtxOrzDFsGNO4c6kf3oH6+ImVr3CXhPW1nHsZE+NzYSK+cZDjtuu9l2sg2f85t2rkeXC9DnK23w3f6vX2/Vp4Kvv6b//y//2Mp+tPmQIDX/V/ylX9F85bAJg+vwHMA4CHA1k8BrMu6ReMTt9Iy3znbesDRlcIfW7GfOBL+zBdP/r/lc5/7/GpyO3DCwLv+Mp+M9n1EOGfrm4JyM5DOHjs3gtw8csPKDQ2bDRPk6TpCm49PQ91MUwilbXpi1mndiZkXO8VW2vXpLOEUcJm39inHmGPXTm6wja+Y9Zyza1nbyDlxvlYb8ulG7Ap2DRgWa7zhiuYXz6Wbby9aX81vPLhcsXblQUyO5G00LzkHdR1trSXWR66dme0fCvRNgNpGtp/zbZ8dh+MCN+Ya3uSqcljD5hNrWePFmm5959LN19gMNANPz4DfxxESd7jCd+JP0r9o43uw9UEV8VEZp8+qiF8bxRmffm8WtxWf5fGnhtO3auN/tcXqk80jkk97lNc469tC+kZ6ov1NhC/ComnJo+kZp701L6SZLzHLaLsWElf7j+vIdXUen/4b8Mwt8Dvx3/mHfvCvpOCv9h4RfU74PnW6whrRTP/zEADxPGrfMpmWcWlnnktt6wFnl8Jf0S+m8MceiX/G+lFf+3/mr0s390wMbN8A6Khx4Ng68jtMZ+9GUDcNNyQxNz03S0SRT9s5BOCVe94KUFwruMmfcW6ol2KtzzBIX3giy+v/9Ml+EJ/5sGu7OTbHK+YGOrLNVzHrTLvmM5x1Oyc5Tzl/9/Pp/C54i2VX11St03Ti06759oQtn4i9vibrFm7k6dK1W+efcF0jo/BoLZGPeA6bOBADc42N5t65zv471xfMs7zBddp7uN+T5ynq3NNu52kGmoHzDPj9TMQ+XOE306foZ0aY/kgbX6UN6rtA9q6tsHnM514nmm4dxs/ym45PxU7fWu2Rj8848xNXbePMX9MNi6N+GTdCx1vHn/EjO/l3TshnvGjZmsewOFoDxOV6OdquqzWySnP9nV+1byvHN/D/w1exPwpzAIAgvVT4Pkd+xXW2hVD2EABENGf6yB7VM8p3bdxjhb/in7ngynn6F/7Qn+g/+Pe2vnvd2wsZqI54ejNQHb8bAujmAebm5WYnujn6MwAOAPjwNwH8P+2riKKM4ki0nkuw1kuYJ7AIf65Z+6M2HQ+Y400e9thZdsuu7ZA368+5cJ6Om/CnD4c5603YeXe51LDx1+Jj6rukrHnB9cW4Hy45EZOv5LHOQc4z9my9jdbWuTjXNfk8COB7wYEA65I40L9H4Zzbd8cCOs57XPPA/CVHl86nZbOerCPTM77tZqAZeD0M5PdUGzy9HnymPiX9TLXxRcTpk7Yw/Sy2/qzGj8LmFbO8ceC5y320+vUaxjenvzfdeMNija9h84H0seK5fssJ+dLOsPEV65yQPoo7V44ydf4Js06Md83cr6u7+OH6WtbcXfJxb8J+8x944P+HTxG5ZSM4EaDXit/nLKeQR/T7FgD9N37Ul620Uf69cSPRT1nj9zz194k/WMU/4X/lT/zwZ/xvDW9+UfYAmoE7Btz0IUN7hOsbApx4XDp6MDeR3DzqZpabnxsjmH91/3AM8Nln/JdpPJH3iagiyqeolOMiXnsLzZdonbRR//CfaYm1fsdTx5kcJDfVznzata49YcuCtpHzk/P2MOfO7WgNEHfJx7VzSZlb5s32tR3fAWPdwkVyc+36Ze7reshwrpstmzKkZ1ls1jmin78RwKEU3wcOx7BJc57BHM/GXMvNU3FvvU/RjnU3NgPNwOUMjL6Txo2QuMNVfKf+JX1OtfVJ6aPSzv1qZLPnbcVnerXdLymvXTFFd7Xd00eIXyZeHOXZE0d/zKdd+zgKn+OEMqM8Gcc8GK5zYprxo3ym1TnPsGvkiK6lU2Qlu9a0wTf9QSzmK/+IyC3xb9qep+h7hfFT51NgMzb/FsBLvMHgwUIidgp/bQ5Y8krhPxL/xP3gn/7BfvL/pr+N3flLGKjO2PDqJwA49nT42G4MbiJuHrmRuemJih4EkALcAwDfBkD4kMZhABcCiKejlE3hlLb1VjQP6IWYygMI2jBNrPUQdgxgjtFxg8nJlp1lsLO+LbuWyzZyfo4b8d283S2GZU4PK4PwW//kGLRznDdZv85Fzr32aI3UONYTcWJNN2ydIHGsUQ6pWPccCHAwMJrrjXlOTpjrGp7Nv/kyfW9clmm7GWgGXg8Ds+8w8eOLvSOu3F/c/zMO/2R8+irt3Lvwqxl+rK2fph7tivhW49LfVhv/qx+uaZeEaYv8tnkJjvigvOMTjTN/DRMv/+dwK2/Oc9qsD8K5Tu7t2Zo6fB9ci+Lr+ZZc0RM4VxAr7M+hBwSgQvapBfxj66efCm3Hh7h+jv7btm1lWLGfmKIfuwp/xb/jYB7++J/9Dz/7U9//R77O32+4Yhl0kWbgzTCg403EPr3uHHw693T+dUPJTQin6JWbpoIHROAg9vMAIG2efnIRx4EAokiBrqA6h7STZRBSefDgX/3PPNlH7RyD4wIdc+Vib9jyiVl/tpF5sLONnJecr+GcHpZpzv2bWbgbHc3xrNdxrOHkCTs5xE6O6zzkGtB2fVyL1pM4apc4+5pj2DHX8rJBXSc1A83AB2BAX7CFB9+Jz+R+IHwndvqema2fSky/eks798f0m7SRYfyrYe30udXGnxuXdpalPvNU27ZEyxmeof3e4ijL7snvvlbnYxSmvpp/Ns/G1zVyHx7dSx6+YIf1tdgH6+3++w2XvPav4AQ9BECgPlacP1d5BTh9ZgwIacX4U/TB9kTasD0wRb92iv+R8K/iH+H/oz/2oy3+3+53sHv+SAZGNwQ66tVNgE5frJuIG1duUm6SYoolBDl/CDCF/8zm99CUrWK9HgJk/ZnG01Tb4mChiv8sl7b9rpu4Y00OsOVmhDUvYeu5BGs92dZqQz7diFkqzvcjl82rKJ5j0V7WruO/u3mVl+QKu3KZ85DrWDvXQ7Vz3Zyza9m6vmgv+2I/s/+O6R4d64JOkLwYTtxKy3zX2E9Z9zX96TLNwEdi4Nz3z3Tw9AqfmX4G/0M4/dDI1l+J6ctmNnlnaZfG668T9bH6XtK096D5E63fukdp5kl0PMRhi8ZvYa1nq6z8z5B25H2UZzS3GZdr434d3a2N4Xpar7G7LG//PoQ/+KeQT3G/16YsVwrcpxDSt6ozxXf2/db9t77EbFuxLyL6sS8R//Qf8f9/+pF/6/76h37dr/tuFmV/moH3zICbPmMc2ac3AuTDqT9c6fyxc9Nw08oNCjs31yqMEPZ/+xf+zi/OhL/xvLaf4l+b+lLoj8J50FD/54HaH8PZ59zcc7PNsWNXbkbhWoawvO3BWr624Tzd43rTdW5d3zn/xr1VdCyJjveAD+tXfpK3ymmdh7qe65qua4Uw60jUHuUjblR/9iH7Z78dxxG355p5lZtr5/ix5a9tt8s1A83A7Rio32PD4PoqPlNfgw/C1heJ+Cns9FfY+DIx/Zrxs7TMuycP+Ue+VH9tmj53hFs+2vxZX8ZZ/xbmmK6xrfuSsnB3zeVcOr8VXQ8rrGvoNMxKzjV3u5X9zDX95t/xvT+zV+xv5UO43kqkP3U9inL67OGF4vyxbVu39VVU8FdM4Y89evJPX50D8vDUH/H/v/7eP/hffMvnPvf5Z1463Vwz8CoY0BHTGe31TQDxd5t9XrkR5MaSm5IbFZibqgI7kUMAX/dX8Ffk5wL1DwR6CCBSp7aHAvx0gN/5I/x5/Z/DANOyD2lnf+sGn2PMsScn5+wsl3bWXe3Ml3a2lXP0MJ91LnOesd/yx/Vax2D8euxlDcNVcoedvGLnHOR6TruulUvDfj+yzmwX235lf8/MNZwkD5WjPWHL78lLnkvz76238zUDzcDTMOB3FhxfA7+p7xTTL6Wt30pfumXP0vSB1S9uhdOfjuzc17VnmOXNk3HnbPqZebb6TVrysJWXOrfSsy7qvPTKuZzZq32ItTJbR6fxrGjXH/ab+/yG/+4/87/n/4pXWF6DPklHlD5WQD9H+RTpCG3EuEL9mvazPspbl1jFfob3Cn/FP+hTf37vzxsc9+v3za287nAzcFsGdMSJ6xsCnHtcuSHkxpIbkpsem2ZeKba1eUX/3CEABwUp8NOmHoV9IgcAlOPCtr0RZh+1HUPdbHPMycUldtZxjV3byvm5Wx7r+TusF+f3tqvnddSWY9OuHGweZsFnnYdcz9i5HqrtmtmDtazh2l72J+f7zFw7/qecmedo4yn733U3Ax+VgfzuVpvwcrHnEwbLlf4obXzWyJfqy/Bx2OIovvrBDFs246qtP92L+GzyinvLjfLRF+Nrv24Rpu5z9chRojxXzLk7Z7MGyFPXwjGca+e8/aa/f9/6bd/2e777f/Zv3x8AKDKvOQSgDOUVw9cI6ZcogwC/9gDAsSr0E60zxX61LxX/HFbkU//+Y39v+qvXnX8kA3XTz+pMW24CdOR3zl9HXzeK3FTcnNwEwSqKqgBHtPOkvj75z/DsZwB5EJDifxRf2zVM/7Czn9n/3HRzrJWH2eY4ykdc1nWJXetzXo7onK2Rec75zXl/D7Zjq+Ncr+VYx/BVuRzNi2tarGtjFvaGUpzly/VlG7keso/HOXYc6zmWgxm+h3nuMTQDzcDtGFj7x+pP8DPG6XMC8U2f3IXTR6Wdfmxk4+9G8aM486aP1K645Wv3pu3x21kXfRj58tq3S8LWJ+4pK3fk1a6Yc7THZo6dZ+0VukbGyGp9V3sSfPIzAN8CeOwhACI1hbwiOeOwZ/E131OHU7Rv9cm0mj/DKfqJz3CK/0uFfz7155X/3/V7vvh/Y62zGPvTDDQDCwM6Z2K01zcGDxuATr9uGm4wuUHl5qi4VnRXPHcIwN8K8BX+Ku6r8Kdu42o7NWy/ErPfufE6RrCO/96xFI7kShyVIS7r3bJn5a3/Hs9vwMusv29rvI7l59PlQAveKrd1HnJda9d1ck3YuhJr29m3+zm2747lFPN7/L5nuUfXDDQDlzKgb7Tceq+v/gR/Q5x+J1DfRJq2iB/Drv5sFsYHjtLSN5qnxtXwNb54Txnaqflq21thxreVnmm0k+E9tvWPeDTOOXGeRuh8gl7k0z7BumaWMGss15dhkE9di4fYN/DvN37TN3/7/+i3/bHPPAS49g0Ay3EIoGCuAj7jtSvWMs8dzv5gn7tS3GtTZnQAkOIfnkaXhzAg6f/ev/vv3P/Wn1f++w/9vYEvVHfxWRmojjfD2uD6KhuCm4ebixsQm1VulCmwsVOIK9ZB/kJ/PvlPe89bAFX8W3e2h20far+yz3UDdoyOWTzZDIMj09w8LTNC6684ymuc9R+xzteyweacPutCe+bGHCfNunbTNu7khlZOE+tcEJ7diNW1sxWe1VHby75gH+f504eb8mWMjsuxJmL3pxloBj4uA+kXYcFw9RuGF9TXgJOr+qkarn7t2jB+M31w2ulT3bu3fPClaVm/tu0YnuGsn7P8GW8bYqaNbNsC82JOCNe5MZxzO4q7XzOj+T/dg5a1s15ns3VH/Jv88Dr5LQ8BEK8IYMW7otqwWOMNVzT/NXiurkzH3nMp9BMpNxL9xJ0T/vCl8PfnFL7uz1N/fuvPmn+Ti6s73Qy8AAM4bz6Ji0MvG4AbBZibjRtTbrIptqsgV7jzW32Efgp/bf5OwJ6/BaDoF0dteQiQfaKvhO2zYwBzbDlm7Nw499i1/LnwbNMetnW6Gedc3k/sB/tnvI7lqaxnOB3NR86/dq6PanuzVrHmy7D1irUfJ/PtGBb86HP9wZZ2D7cZuBkD235SHzPwl/pMsfqtDKdv096D+MmtfOlHtd3Hb4FZJ7Z+3fhE+mk4bePAjE/bPKM40xLJVy/rz3jmgHDORdruLcRpn6BrYD+yOJd7x4NtnAvXdWf4zeGtDwEQsghfBbbi3bBIPHaGzSuaJhpvWcOmj5A44zO/8ecwxf5eO4U/9uyJv+If5I/8+dSf1/15Q+PNLabucDPwggxUZ2x47cQ/XT8JyI3ETcdNKjffFNvYM2HOIQB/tV/hn0g86Yj72eVhwqz+kfhP4V83d8c02kBPNsnCzSw9ObvGHtZ7utnm/LGsavgFl9pNm3ZcWWnGaSdiL9dg3kbzkmshbdf7NZj1pF3bP5nz7P/p3OZYk5e2m4FmoBmAgeojMrz4Rv3MwEdWn1R9lmH8mjY4ChuXPnCvveV38x7kEps6671AtjNKs7+ZL+1Mx860ap9Lz/zmtf6KyX216xyehJ3/x+NozWUc9pv8cAjA3wT4Lf/c/+6zf+4P/oVH/e8A/iQARPj6dFzxXcW7YUX6Y/CcmN+Tvlfkmw+Bj11F/17h/6/8iR8+Cn/+a7/+I39v8ivUnX5FDHgjQJdObwSI+3Q5BMgNJTceN6jcdPMQoAp0BT3x/Ld/s0MA/tcA8yZSjvAIbSvb187+adt30DHlOLGTg5Vd+FmlBW/E1zr3hIf1zebpEP+KltaLdmW8luWuzI08j+bENTHDXD8je1aO+FF79uWI9vkUX5TgbrwZaAZeNQO5t9eO6h+J117jho/UN438V8bp48RM097yj6O0kY91LxfJo70HR3UaR3lt0D4Zl2Fs48VRnGmg6dYzwlk+42sZuRWdrxXO5v228a6vuv7edJg1wZPnW/4kwMMAnnBzGIAoThGu+PdwYCb+z6Vbbitftqvt4YRifi+OxH6Nq0/982n///KP/R8/S+Hfv/N/01+d7vwLMjC7Ich47eVmoNwIuKmAufG4qeWGq/AWFeeiIn52CPC1n/va10lL8Z92HgBYZ0XbFrN/9rlupDlG7NXGCR9skmJumMSduWrdGabssL2sM9s72CypnLcMY3+kjzwwZu1E7OVKXh/snI9q53p/rF3rHs579nVtj8ZHXH+agWagGUgG9H/EVdvw4hP1M/hD7OIj009Ve+TTZnH4z1ka8ef8a+7d7unEae9B82ddj7HpM+UrZlyt33GaJ8tW27xb8TNOV/PoHN8OXVuuowxj83GtHUJv/F/mgKfQ/+zv+oGv3+qPA3oIIHoYoPhWjCcq5EHiE00zPtOyjmrb3l6Rbz6EPXYV+OfCeQDAmLlS+Ptb/9/6T//W/wO8v/Gl091vBl4lAzroRB366kYgNxk3JTe23HgV3WIV5yng+cv/P/vVr/7N/BkANm8BmE/xn+FRnbRHvO2C2S9t++wYxBzfauPMm6HZ5kke0jLvrexZm4fl5Ly9ysX1hJ3aGrdpyzoecTiYn1wDI9u1cimO6jLuZM2M+rqea8f3hPR21c1AM/COGNAXMqSRvXvvqn7L8C0Qv5r1VD/r3i26p4PEZVjbeDHzErfnoh+Zr4Yzbcu2XB3XKEw9W/nhifTkK+2d+4pr4TE4W1Pv6OuzDAWOeRPgj/5rf/SzL/2RP3uznwN4ACB6EKDAVnBvIaKedMW9duKs/N52zJeIfcmV4h+bp/0/+Kd/8PiqP0/8Ef79uv+y7tpqBp6agdNNIERSbi65YbnhueGCKcIV5lW0K+xHhwD8PMD0ih4E1Pqq+LcP2S/76ubqOHJs2MPNEy64eRKXG6kDb8TvvIZtZNmtdg7tshZo10/axn00rBwYTsReruS82HVN1LBrZ4aZnzwZ1v6ktHkfzv6d2s6pYzLc2Aw0A80ADKRvSHuUtvhCyuGPxJFveojTf4GUSdyys9zM1leO/Gru32m7x4/iSCNezDyPtemjdWiLxos1nvC114y7nAvs43W6j6zn/Xy6a8f1lJi2+UA+Ne0Q+/b//Qb+Aj1CFeGKiFW4PwWODgNScCPqM4xt3JbgzzI1f63DvOYzfC3yR/2q6Odghf/Sj+/F218iPYJm4PUyoGOmh9qJ2IcrNpLceNy83OBAN2JQAT47AEghzyEAr/77JoD/I4B5OATQBkdXtqed/ckbAPsu5riOm2aM+z5OPs4h5chTy18S3m7jrvrjnFWb8Ef/uI7lwbVMWHuNZ+Ym18clNutrln+4Psb9s985Hu3GZqAZaAbOMZA+Ud9HGe017vCH+i/8mzaovzPOcObLuC3b/VnMew3vN4zL/d1937TEzJfxadsemPGX2LWOrCvT9tpbPCW38n7E2RxfHp/rJW3XjnEgH+Lf9edbPve5z3MIwF+nR9Ai1J/iAIA6qduDAA4cUqBfI8IV8mKtL+OvqX9Uxr/k71/z57/yg7/f8YXf+i/er+F3vVp6cM3A62dAp61TP+Ddxu6GkhuRm5cboxuvqBAXU7hXUc9/AfjzP/+3/p6HALP/EWDrIMB2RPtRN337DeZ4hhspGxnjv3zDXMoFf/J4gvvaYQXlHBHuz5wBuTKH4cO6Hs3pxlzVtXJpmDkfrjHbHPVniWMM9t/xNDYDzUAzMGOg+osM7/aBmz7rwXeZ5xziA7lG+Yjzyj1a2/uMGdZ9fpavxlO/cdqi8ddg1oE9uxjzVlpyoj1CuV3hsn/M53tfHtaY68e6jKvh0Xq07CjtzcaxLnwb4KkPAjwEEH2VfiS2bxU3OwiYxdsu6VyIfoU/gt+rhf+bXfLd8XfEgE5ZZGg68wXvNmw3ldx4ctNyg0zRja0YB/MAQDsPAjgE+Nu/8Hd+0UOAP/NDP/Rj+ROAmfjPNrRrP+wfmP3O8WA7zhMc8fK8cc5NLr86b5n2ke3kJXkzPhH79Io1f7IW7tLqutkTHtVzjBv14RCX/XdO7b/hxmagGWgGZgykv9DXkVf7FO983NE3PaF9zm/mXp17eNoKf/f8TDtnWz/5tCuadq6uUTp1GV/rJcz4E80jL6YZnuHJXG3N7b4014foGkrMdWO+ERL3rj/MC6+v80cCPQhQoCPYb/1mgIcAoO0ovp8SZ8J/JPjzSX8Kfw5M4OtdL4geXDPwxhhIx07X07mvXmnPTcgNy00OdCMGFeSJin9xdgjAYQA/D6j5DCdm/bab/bB/9lfMsdw7pXqzAw/EVT6eN5zzoQ32Z5sB13TN5domXnuMdT1shF0/Fe/Xz6zcfH3ZtxES159moBloBvYyMPKFxo19n75p5rseGZ9+Ejsvha/7NOgePkP2+1lajc/6so2RXcsazjqMG+Gozoyr4yYt42Y2+wpp4Ml1bl87TWcd1XWQcdpirh3jErE/5Ocbv+mbv50/YsdTbv6a/b/9H/2nx9/kP+VhwEscBOQT/pHgR/hzKILo5ycTrO0PuSh60M3AG2IgnfuyKcRGk5uSm5mbXwpvxbgCPUV7tT0I4H8B4O8A8CaAPwWoeTNs3YnZB/sF2tfZJnuykTrm081x4eVp0lguOQ8un1GcaY1jBmac1XjC48t1cAVOb9Koa9beOn40Kvs+Suu4ZqAZaAZGDOg3Rjj3ffijS33fhWXynkLb/bru3bmn77Wpy3pE6z+HtQ3zG2/dhkXjzZ/oGEHiM3ypfTI36/1jPK+H1VHTiB2tDeMzLe1Dbcu/plluSfkgFmuA37cjgBHCf/E//vP3hwF5IIBov+WhwOjNANq49q0ABH6+yk+YQ42Z2GecHHxw8Uf9EP13051r4YPMfg+zGXh7DPhFTcQ+XOUGwE0qNzU3vhTg9RAAoZ4CfmTnIQA/BRjlIc66ZuKftu0TmH21/4knG2mOWR6eBlktcq2dWG3CfJyrQ6j/3ctA5a1yb/gUc01cazNvlF3mPNthDIT5zPCQ2v82A81AM7DNgD6k5jIe3H/p8yij/UjMPTjt3K+rnfv6lk25ml7rIky7iTWPdRCvvQdrPYazvWonBzMb7kkDV9f2XLIGct5reCvNvDUP8Xxm8YfUD/wv6wQxzIHAv/lv/Os/8n//iT/32X/+l/7SL/31n/7pz/6Tv/IzX+dQAJHugUAeCijqH/szAusBfVtApG2EPv+FIH3h4sAirx//j/7U8Tf8vtIvIvg56ODNB8Z5vy4/8Hz30JuBt85AOnPswxWbTW5Mbmq5OT7mEIC3ATgE4C2A/F8BRgcBKf6xa7u5SWc/s//abKT3zivGSdz9JQeXIesguZyFM0/amR+7P49jQG6tJcPaidjzy7VxKW7Vebpe7GtjM9AMNAOPZSD9G3VleO7ryIef03fp84w3Tcx8mcdyA3Qfrpj7tnbu6yPbe5FEy46QNjO+hjON9giP2s24LJN2Hd814U/u+KMceH/J9+XoGsh1kHGzNWGeRGw/1me48YEB7lE5DEA4/z9+6v/y2f/nb/3M/cX/hvU3fvarn/35n/zLRyGOKB/99l7xnsL+nG0Z3wjgiT5i/yd/8ifuL/rC4YQXot9Lse9Tfp7w+2o/47kbWs93r/Bm4I0zkF9ibfBwudk8YG5cbnC5AVYxXsU64ZGoN85DgJ/96lf/5he+8IXvNl4c1ZdtZl/sn5h9177fSMsYV3HycB5ZBgtvh0WRfJo+wkPu9b+WNbaGjW+8joHKJ2HjtLeRdUOZc7heF7VOep/tjsLE9acZaAaagUsZ0LdYzrB+iHjtfVj9XfpA6yLPxqWQdR9OZL8m7L6dyP6e4XP2LH+2p13rqmW9tyCfdqLxtR7HYjsjhCvixZqH+JNLrrfR+Z1hrgfzjNaBaaCfWrbGG26Ugbt5RET7MwGE99d+5sePBwJf///9rc/437E4GPBwgLcG8uLAoF6Zrk0e6jgeNty1Q1uI/pnwV/T7Sj99/VW/5td/x/3acwyNzUAz8O4YSGe+3gBi88mNKTe63AhTkGOnaEfInzsE4CcAvAnwE1/5yk/6dwJmBwC1rexH9g87+17tk801xnw302s+5mEWRfK4Z5HU/IYtW8PGN96Ggcqv4UTsp7gYgfU6Gts1bJ4Mt90MNAPNwLUM6GPS99Q408bI/rj4rkOeGpd76Bm77scZrvt4htnvCVfMPGlnvdqZPrOtn3TvMcybacaJtIFtWzP85IGfc+n3+eCd/JX/dfgu+bi35NxmvLY4mmvTRkhcfmwn49oeM/AN/PHAb/22b/s9vEbP03UOBRDePIFHoHswwKHAuUuRL1LWK8V+Pt2nLS7aPXm6f1hf4553bDPQDLxrBnTky4aAQ3i4cpNyowPdGMEqzPMQQFtRP0IPAXgjwAMDy4keLmRb2Yfsm3b2HZsxiY7viPs22uSKRWHYBWJ4huZrfDkG6tzQE+Iy3vCt0bYSq024P81AM9AMXMtA+jLqGIVv7duWvxlAe3d7rZd7bt2PM8yeTdi9G9wS25lvZGfd1TZ/bc948dL2azuzcPKSeYw/4rIv7ZmrOs+jOTfPVn3mSUzbeonrz2MY+PTTT1ljPHXnvxnkcIDrD3/5D/9JL/6mANeP/OiP/DiCfvT6PvE+zQcR+TzNp07q5p6ZNX2/rh7T3y7bDDQDb5oBnfcI15vCnXNyI8pNys0RxHl5pTBXrCvexa03AnBw/teA5k+s9RO2bTD7hZ19HtmObYj7Nl4WQuXx3OIw/7l8nX4bBvbwnXm0E7GvvRhF1pVhbD6mH0L9bzPQDDQDt2Fg5FtqHOHbXNwzUBcYl/svcdozrPv4peFZvaP4Wd2j+4nMO0unDfIlZrsjTkzPtCOH++flrshxDrX3outBpFz9bKXVvB1+IgZYK9z3+gcHEfl58XcH7l/hf6L2u9pmoBl4fwzo3MHlutusc1NyowLrZqgQryI9BXzas4MADgH8ewCZX7vWb7tbG3L2e2TnGFd2cnFqswrk7f2tiI83opxL7S0kbeuCwUw3DPqxfsONzUAz0AzcmgH9EPWmz9FONO/jceP+YbQPG5f3Fntsy41QMT5KM842CGvvwZrf+ma4ure448Z8Nf4+zDzd5XmYr0vnIuc557bGb6XVvBnGzo/1ZFzbzUAz0Aw0A6+cAZ13IvbhYhN6uNywxNwkU4hXka54r+ghQMYTx98C4Mr0WifhbHPrAIB+2ucZOsYTlIcxMrXJW0618Rk3svfmG5XtuOsZ2Mu7+RLTpgeER3GmJVZ7FCauP81AM9AMPBUD+qtav76sIvlq3Dj8cL9wspc+xM/2YOPzvmJmmxd0fxcz7VJ71t4oPus+1/aRCzh84GGKyTN5M7xt5xxpn0PmMPNs2Yech38tl3FtNwPNQDPQDLwBBkYO3DhwuWLDyk0POzfGFOQjwZ5CP+0U+sR7CMDfBSA8qmt0ALB1CFD7PQrv2pAXXphi+XoD091d3GCgzqNh0aKEjUtMm7yjfMaDfixnGBzFZXrbzUAz0Axcy8DMvxgvUj92vWbx63xxz+C+yp6rLY72YeIU1Hl/MbJn5a+J39um+fa24Vh3IXx/+vDQRft0DtZcz9Odqy0cpRHHh3b8aIvGNzYDzUAz0Ay8YQbSqWuDy+WmdId148uN+dpDgDwQ8BCAnwN8+ctf/r69BwDZj2rTZzdusY6D8HHzjfHexyUXa5tpl7M3vAS66xsMXDu/WW5mbzTbSc1AM9AMPIqB9Du1ItPETDduD5Ln9Kp7aIRzrx3tw8S5T7uXz/I9RbxtiqM27N8ojTjuG0Tse47Ac9eIy8vjmMvZ3JHGx/RD6PCvcRUzT9vNQDPQDDQD74yBdPrY6ys2rrrpuVGC5w4BEPRV8NcweXgTgLcAvvjFL35PHgJQP+FsRzv7cc6uYzA83KArF4eJl693tgx6OA8M1Pk1vBepxrxNajPQDDQDr5kBfVVF+lzjCGec4QXjfmG4p0a6e+85ZE/fykM7mV7De9Jmbczis05t2h1eeR+ReTL+ens2T5fEk7d+nOca3+FmoBloBpqBN8zAzLkbP93Q3ezEFNwKcjDFOzZi3zhtDwBqOocA/NeAn//857/LMmDWr0372NmPczZ9J49jEM9u3uubH6Zfvt7wUuiuPyEDvT6ekNyuuhloBh7FwMw/nYs3HTy9UuQObPZb9tpE9+A9SNl6WZfxhmf1kW+UNrovGOXbirMPRxxx9LRxdVE4XxmfcdoVZ/kzvu1moBloBpqBN8pAdfqE19fdZnnczO7suvml4FaYiyng0/YQgDhtkTgOAfgpAGhdI8y2L7XrOAjnOI925eMQfqPT3d2+IQN+d6gy7XNNXJL3XF2d3gw0A83AXga2fE+mjWzjwNPr7t7gPh48c4323j1x5+olfbSPGyeab6tN84jmnYWJN037iCO+Hh/HnOecEOZzadyh1Om/1nOa0jHNQDPQDDQD74oBHX4i9uF62ODc5NwQwRTfVain8L/ERvx/6Uu/7w9wMFDrJEybYrWzP1t2jkH7uGnHeI8cbG+u72ox9GCGDPjdGCZ2ZDPQDDQDb4yBLZ9mWiL2/Mp9c2Kz17LPuueeQ/JeetkG5ax/q47Mv5XvqrQtvh6fxnJzPlx6OV/GJZpOnLaY+dpuBpqBZqAZeMcMjBw/cevrbiPNzc9NVaxCu4r2S8Q/eSnPIQB/D6DWZdg2CWsnGp+obT77n5jjvLcrF4fFMOLtHS+THloz0Aw0A83AO2Yg97S0GXKGsedXuVc42U8jve67hrfKnKTRl6jzEpv2zJ82cTVsvl1on7Z4uj4t52M0L6TnxzxiprXdDDQDzUAz8MEZcHMYIXEnm6ybtaioFhHb9Tp3EFDzcwjARZ01zbhsbxRHOeO1LQPa/8STTf50s/7gy6WH3ww0A81AM/DKGXA/f0w3sw7twz3B6b64xN+J6LtGT+4bcm9lz83wbnvULu299DXq1/k45mY/r+u8lrU8YT6GxUPsaXymp23+xmagGWgGmoEPyAAbwulVNtkUzimsU3RX8W7YA4EMa4v1ZwBZr+2RVzvTrSMx82nnGLRXNxOnPLAc3DDFD7hEesjNQDPQDDQDb4yB3LPSZhg1XONMT8QeX9wvkFbuGwxvHgLUcoZrW7ZhfLZlmYx7jD2rz7a3US63uMs8I05N30LS8mN7GTezL8k7q6Pjm4FmoBloBt4QAzr+ERJ3uAabp6JZVFiLKcBvYWe9ae+t2zKJ9l38pI7T8S/4hqa2u9oMNAPNQDPQDFzEgPcCFsrwck+w7InzOPZT8tV9dRY27566z+W1jcxnHJjx2pmuTVqmG74c76q5r2svznjN8tj1Q7n8GBYzre1moBloBpqBZuDIgBsFuFxuiA+oaE5Mca29V6DP8lkPSJ4ZzsrX+KwPO/uP/UmOcxk/5CQvkmWc4cZmoBloBpqBZuC1MFD3qBqe9dN8iWlTjvD5yz2VvNojNN06yaM9wppew6Myxtm+4afFu2EMeToXb/olSF4+ztUhtPyb8WkvOdpqBpqBZqAZ+BAMuAkkVpvwyeZdxTPhKrANVyGeYfOMkHzEjzDrqLZ/WLDGj9rIcXzijcH8ZuJDLIoeZDPQDDQDzcC7Z8C9fu9AzX+4JziU0r4c5/vs+bos6549FtnreiyzJ+92HkZu3WkbV9E8e5Hyo7wP0Q3NQDPQDDQDzcDTMJAb0Hozc8N9wBTQW4cAI/E9E/fn4quwN6zwF41PrP2o/f8kx7ds8skHjBt+Gva71magGWgGmoFm4GUZcJ8T6U21DSdiP8/Ffv30bd01cRx3jtP4UZxpl+Ksrq16SPNj+VnY+MZmoBloBpqBZuCeATeOxGoTftTbAFWAXxJWyHtAYDjRPzQoZpp2bTMPATYOAOQil8soLtPbbgaagWagGWgGXpKBPfvUuTyZjm04sdrmezq85ADgkrzL+Jg3xzWzTd+L1MPH/Gln3H2mks+4W+Oo3Vu30fU1A81AM9AMvAEG3BDA04vNNK4U0WlXsX1JGMFu/mor5hMV/b4BYDjzZD3Wnf3NMZVxM2XJCeH+NAPNQDPQDDQDH4UB98Acr3F5n0B6xhs2zjDIZxSf9T2XnX3JPt138uGfUXyNMyxa3rCY7e3JYzmxljHc2Aw0A81AM9AM7GagbioUNA5crhD/iuYU0iNbwX0tViGfYcU+/40gl2EPAzJvPQSofXU8q/GueYCX/jQDzUAz0Aw0A++NAfd8xpV2jtP4S7HWSfmso9qmPzdujXWUluNyDOfiRulZNtu5lf3U9d+qn11PM9AMNAPNwAsxkBuFNri+dh4EIPqr0K7hvQcDVcwTVvB/53d+5z9eDwBMy3K1rezL8QCAsdXxLpORnCyxbTUDzUAz0Aw0A++TAfc9Rpd2jtZ7BOPMJ2bZrTjT9iB59l6j9mdtOAbRfIbFGp9hbXFWZhRvmYrmrWi+Gt/hZqAZaAaagWZgk4G6gRgGq32I23kIoMj2MKAi6VWYZzgFfNoKfPDzn//8d+05AKB81m3fwI0DAIiTg00SO7EZaAaagWagGXgHDJzb8zJ9ZktDphsHZry2mOnGJWLvvazL/IZHSNylH/tluVk447VFy27hJXm36um0ZqAZaAaagWZgxUDdYAyDp9fgEAAhncL6nO2BAPlSnFc7xb+2hwBf/OIXv2d2AEAe84tZt/3bOABw3BAlHyvSOtAMNAPNQDPQDLxDBuqel+FzdqYnNRmvnahNGW3RegzvwZon67W+GmeZTE97lJ5xaWe5kZ150x7l7bhmoBloBpqBZuDJGKibkGFwfd3gEGBL/CvaKyr+Ef5f+tLv+wOPPQCgD8dDgDrGU5rl4zSlY5qBZqAZaAaagffFwGP2PMuKMmO4Iuk1roZrHXvLZD3a1iXO4k2/BLOutK+t45JynbcZaAaagWagGbiKgdywtMH1NTkEOArqu3SftJ/DfDqf9tYBwJe//OXv2zoAqG8BZL3Zn2N/6/hOb0auIrMLNQPNQDPQDDQD74wB7w0Y1szOIZtHzLSso6YbPoejOiyTababacZdgqPyo7haZ+ZJu+brcDPQDDQDzUAz8OwMuDGNkLjDteMQQIHt0/YU32mnQNeeHQAg7nkDgD8E6FsBI6zlrTfbtX/36LiWGxrH/+wT0A02A81AM9AMNANviIHcL7XFOgzjRdL32DVfDWcdNW1PmDx8aj2H2Hm86eKsvOmNzUAz0Aw0A83Aq2FgtGkZB46vCw8CUoBrK84Tq4BPkc8BAH8I0LjZ2wBZR9ZtuxsHADluJsjwq5ms7kgz0Aw0A81AM/CMDJzbB0fpGZd2dntPfObRniF1m1btbLemZZmar8PNQDPQDDQDzcC7Z6BuhIbB0+sJDgFSvCv0RX4CwB8CNDzDrOOKAwDH/O4nuwfYDDQDzUAz0AxMGBjthaO4SfGT6Cw7skdxJ5VMIrJszbKVVvMSPpd/lL43Ltsblcn0tpuBZqAZaAaagWdlIDcmbXB+7TgM8Am8iDjHTpGe4h07Rf6f+aEf+jEOAYjz6b+Y+bKOrNt2weNbAOsxQXKO91lJ78aagWagGWgGmoF3wID7aB3KLN58o3TjRPJqi5bfShvlzXK3sJ+jjVv0s+toBpqBZqAZaAaGDLiRjZC48cVBAGmTA4EU4dop0rFTwKew5wDgJ77ylZ/MuJmddVi/7W0cADjWJGQUl+ltNwPNQDPQDDQDH5mBx+yTs7K3it87L6P2RnF76+t8zUAz0Aw0A83Am2FgtOEZB152DQ4CUohjK9DFFO8KfOJ4+v+1n/va18/9IUDKZB3WC9r28YBiezxvZtK6o81AM9AMNAPNwCtkwPuH2rVZ/LX5arkONwPNQDPQDDQDzcAVDNQN2nAi9vZVDgEU4Ykp0lO8ewAAfuELX/juv/tf/d1f8mcAmVbtrCPrts3jAQB9W/f/Cpq6SDPQDDQDzUAz0Aw8ggHvK7aq2JNnq/xj0166/cf2v8s3A81AM9AMNAO7GHDDEymEbVh7G88cAqRIT/Gewp7f+//sV7/6N//qT/3UXxv99j/zYltP1r3jACDH4VjB/jQDzUAz0Aw0A83A8zDgPcZWa3vybJV/bNpLt//Y/nf5ZqAZaAaagWbgLANudiMkbn7d4AAAUf/Hv//7f+Czuw//JaCCf3QYoPgXPQTwAAA8vgWw7jckOL6zhHSGZqAZaAaagWagGXhWBnqPfla6u7FmoBloBpqBj85A3XgV/fBimnFrvMEhgD8D4E2Ac38LQPEPXnAAYJ9zPB99znv8zUAz0Aw0A81AM9AMNAPNQDPQDDQDH4QBhX0O17gtVEwvGIcA+TQeW5EOpnj3Sb/I/wTAWwD8rwCjp//myzqsO9ucvAHgeEZjzbi2m4FmoBloBpqBZuB6Bkb77fW1dclmoBloBpqBZqAZuDkDuVmnnQ0Rb1qi8av/IjAFeR4CpHhX0Itf/OIXv4c/BsghAD8JML5i1rF5AMChxPpnANnvHFvbzUAz0Aw0A81AM9AMNAPNQDPQDDQDzcCHZWAkljNuEf6K7HgLgKfweQigUM+3AKqwJ8zTfw4AOAjgEGD0JsANDgA+7KT2wJuBZqAZaAaagWagGWgGmoFmoBloBpoBGVDkGxZrvOH1QUAcApw7AEDI10OAz3/+89/F3wHwEOBHfvRHfpy4zPeIAwDGkv12bI3NQDPQDDQDzUAz0Aw0A++TAe/9GJ33rY4004xrbAaagWbgwzKgUxQhotqElysOAGZvAaSAT2GvzU8B/vYv/J1f5BCADwcCvA3AQYBvBFiHbxbkYQPtHq/s22J/2AntgTcDzUAz0Aw0A81AM/ABGPB+NdH7VYaftuFrkDL9aQaagWbgTTGgY7yk05ZJ1JFO/xaAYj1/BjB6C4CDAP47wJ//+b/19w5HAIefBHzt57729b/6Uz/117i+/OUvfx9lrfOCAwDGab8vGXPnbQaagWagGWgGmoFmoBl4egbyPm1kG3cO7elWPtJMr/kJ1/Sa1zKNzUAz0Ay8OwZmDk/HuGA8gU9hjq1g9wn+7ACAQwD+a0DEvocAIH8bgL8TQLp1gdnO8ek//Vgct/0X390E9YCagWagGWgGmoFmoBl4wwxs3aNtpc2GTBnLJV4aT/1ZxjDYn2agGWgG3jwDOshzAzFf4sE5xgEAYjzFeYr2PYcAHgTwxJ+LQwHiKJt1ZRu0ebwWh539dGzGGW5sBpqBZqAZaAaagWagGXheBur9mGExe2PcJUheL+rSFo27BMnbn2agGWgGPiwDOFA+OtLpzwBmbwFsvQmg4M8DgysPAOznobf9bzPQDDQDzUAz0Aw0A83AczPg/Zho+zVc42fp5hPNB1bbuBpP2YwzPIozDexPM9AMNAMfigGdIoPGXl/xJD6f0OeT+yrqDSP6Z8L/EeLf/oofarJ6sM1AM9AMNAPNQDPQDDwTA3mvpS3SBe2KNa2mb4XPpZG+dY3arvnJ059moBloBj48A+lwF0c5OQDItwA4DFD078U8QMDOw4Xjq/+0ferkmSj7it2fZqAZaAaagWagGWgGmoHnY8D7MJGWR7ZxW5hpaVsncbe8sl5tsD/NQDPQDHwYBnS2OeC1o50cAlQRv1f8my/LX3AAkP1NO/vfdjPQDDQDzUAz0Aw0A83A5Qx4b3UJZt60aX1PeG8e8p27bHMrn3nA/jQDzUAz8GEZSOe7dpqTA4D6FgCCXnE/wxT92lPxf/oGAJOT/fywk9UDbwaagWagGWgGmoFm4IYMeH+1VaX3h+TRttwIM8+WPatvXub0HnGed91X89km2J9moBloBj40AzhGPjrI1R8D/OTO4aZgHx0CzA4CFPyJtS7qP17Zh4Ntv+472P80A81AM9AMNAPNQDPQDNyUgbwPpOLlfvDQzFY407bsWq95Z/Gmn9yT3t8zrvu45J3H285hRP1vM9AMNAMflAEcph/txYmmML+zU7inoL/Uznqwj+Kf9saOmz7av2oT7k8z0Aw0A81AM9AMNAPNwGUM5L2VJY0bIXHPe5V70R33jOf65zgbm4FmoBn4sAykg187zeJ0q3AnPBL//BRgFE9crWPlyGnvdGNhYrKPhPvTDDQDzUAz0Aw0A81AM3A5A95TZUnjRkjcy13lXnR435j3j5n/tN855rabgWagGfjwDKTTXxx9OtI7uwr4mdAfxdeyhD8p9d/NwtL2Yn/4yWkCmoFmoBloBpqBZqAZuDED3vtRbd5/1XCmnb6Sb1nu6bTFUZxp57DeI26FqWuWvm6HsfWnGWgGmoFm4IEBN4JNRz8S8iPBb9wo/07xT7eyTz1RzUAz0Aw0A81AM9AMNAOPY8B7K2rRTsQeXzORfUn8rG7jB3XVe8lPBnmmcdZ7wMcx16WbgWagGXjjDKSzZygZXhx/cbLVCddwFf6Eax7CJ4567aBt/41T3N1vBpqBZqAZaAaagWbg1THgPR8d0857L+0DlnvBk3u4J0zfdQ+51f76/vLVTUR3qBloBpqBl2SgbgCL8y+OtTpjRb5Ieto1/2rjwDFT/9pBZ1/gpIaJ608z0Aw0A81AM9AMNAPNwD4GvJcyt/d5hE0zbo3lPpD7Nu7tRO/zCF985X1gKW+9M6xtmW8Vv76/dOyNzUAz0Ax8eAbS8UPGLsevo70EV05ZR1/bW8IffmKagGagGWgGmoFmoBloBm7IwPY933IPNvxd/aX3fJl/eA/ovWDBLKddHy5Zn+mJpt1jjumGRHZVzUAz0Ay8JwbWBwA4zk9PT3XT0e6xR3XckXba1iEOPusm9Z447rE0A81AM9AMNAPNQDPw1Ax4LzVqx7TxvVi59xvd6ynKxVGeGsf9IHHD+8KHtCxD3Xll2pZ9rH+51xxx0HHNQDPQDHw4BtL5M/gMrzeEO6d8dKZhbzlf0kZljnGLU862sh8fbkJ6wM1AM9AMNAPNQDPQDDwRA3mfRxN5/7XYcZ/HPVu910tBXu2adyt8vB98aK/mrXVnuOat4WPdyxifiNKuthloBpqBt82Azp9RaC/44KCPTrWEcb6kidUmfLxG9R/ibDsRuz/NQDPQDDQDzUAz0Aw0A9sMcN+Wnxo2zfjlPo/7sLxXu7OrsE4Rfqld69oKW/ev/tW/+td5GSda3jBo3HEcy72l425sBpqBZqAZeGCgbgRErzeFwcagg8XhaoujONOGdR86Yj8Oof63GWgGmoFmoBloBpqBZuCxDHh/lbi+z/s0HtQ82ApqMIW2onyEmW9mZ73Vtsxj6h7cb8KfY38sl12+GWgGmoE3z0A6RO31ppCHAYMN4uhot9I8QMi6Tm3IzD5k+M0T3QNoBpqBZqAZaAaagWbgCRjw3omqZ7bNmg4uV7mHS2GuKAdTmH/rt37rfyPDW3bW4YHCrI3aTtab9Yxs67y/N13G59hBx59xT2VnWzP7qdruepuBZqAZ2M2ADioRe7nKJnHvZM/FZflTm87Z3u6OdsZmoBloBpqBZqAZaAaagXsG8j4qbRINj5C4zdf/FdopxBH/oyvzjGzr2sIsZxsZh035itbJIUA5AHDc90TFPxmfdmR5tJn1pm3FozjTGpuBZqAZeBIG0vFUm/D2dU74k75dB4Oy3Yqk9acZaAaagWagGWgGmoFm4JQB75tOU07vrcxjGXC54n7Op+igolrBrRBXmI+QPMZrW07MetM23XLWA2bayLaewQEAY3fc1SZ8y4/tiNQ9sjPulu13Xc1AM9AMXMWATikRe34p9MWtvKdpdtL2DDc2A81AM9AMNAPNQDPQDGwz4P1TRUvV+Axjr94A8ABAQS0qulOU/8bf+Bv/214ZP7OtA7ReMdP2lM/82tQ1OQCAC8c942WUx7znMOvWPnB7KKltmvVlOG3TG5uBZqAZeFIGdDwijWEb1r4FWnfilk1af5qBZqAZaAaagWagGWgGlnuzysXoHo08eS9neMn78AaA4h9UmIMK7BTmCv8RfuM3ffO3E09+0bLWBWbdxpsv6zVuhJazvsEBgGN33ODok/lG6Vtxlh1hjaMe46yzho1vbAaagWbg2RjQESVWm/A1F4PIcobB/jQDzUAz0Aw0A81AM9AM7Gcg788oZTht47z/Mu0QLgcAe8X/d37nd/7j9UrhXu0q4FO8Y5tOOQ8RrMO0EVoP/R4cAORYtUdIXH7kjLi0M0+mye0MzZvpxlmn7YjGNzYDzUAz8CQMVGeTYW3wMRcdz7pGAzF9lNZxzUAz0Aw0A81AM9AMNAPL/RRceO+UiF0v89b4+58BjN4AUFyn8FaUK/5/1a/59d+hDRquIp5yWQ92Cn/TrB+kPtC6zFOReiYHAMkJ4+dj3CF0+Nc4MdPSNh289KKeLG+9xhkWZ/GmNzYDzUAzcDMG0uFobyFps4tOZVntGk+4P81AM9AMNAPNQDPQDDQD+xiY3VMZD56/Jm8AKP5TpCvOU/B//vOf/668Mi0PBBTz1FEFvGGFvuLfuvIQwDwiZc8cAFQ+YFdetMHRx7KZZpx1XILUU8tbd8Yb19gMNAPNwLMxoBOqDRoPepGnxhuX8cYlYufH/BnXdjPQDDQDzUAz0Aw0A83Acr8lF/VezPB+PHMAoDgH8wAgRf8XvvCF7+YyTuEOEgf6ZoB1gKO6ic/y2FkmbQ4BrGP1BgBjWu5Tkwt4I8zH+ENoHW+6aYZr2UMdDxx+Mm/XthKzTuut7WW47WagGWgGnoUBHZJIo9pbmGnaow5vpY3yd1wz0Aw0A81AM9AMNAPNwMKA91KJ2PuuEK/+DAAxnU/+q/hX2CPuFf+ihwBi5lXYK+KzXp/om8dyhi1TkTpO3gA4L8Rhr/KVcdj5qXlX/3vCvfAPHo/h83NAG1l3hqtNuD/NQDPQDNyMAZ3PuQq38pkmZl3GVTSP8YYbm4FmoBloBpqBZqAZaAbGDNT7JsLjqwpT8hEnRvq1BwC/4wu/9V/kAEDMwwBsDwPALUFPmm8KjMpkOraHARwCnLwB4BhnvCzxMCx32Hzk1/gFg69P9tpL/Us987hDD5Y+GG5sBpqBZuDZGNAJZoPGzZC8pmW5tpuBZqAZaAaagWagGWgGbsOA91qJ2Mu1V6Te5eMAACFd3wBQaIMKeAS6Qh/hP7pMnx0CpIivdecBALYHA7ZP2H7lAQBjuBfmycE+mxmRN21x9cTfg5KK9+0m39RXw0sbtgXajmic4UTs/jQDzUAz8GwMpEOaNVrzZDjtWfmObwaagWagGWgGmoFmoBnYz4D3V+DhSuG5w04xOzsAUHyDew4APBTgAMC3AxT21pXCHtt0Dw8Mm18kHptDgOnPABi3fMwRluVNW1xxmRxt2Z+M+KaNy/pjH8D+NAPNQDPwqhjAOY4+s/hR3o5rBpqBZqAZaAaagWagGbiMgbzX0gYPVwjRkWC9F6R3eWrauQMARbnCHnH/pS/9vj/wL/zu3/0vc2Er/iumsFfMg9YJmkfMtLR3HQDIgZxcgg9lkx/fkEjM9LTld4jb/WAVOJ9bNmn9aQaagWbgTTGQzu1Ndbw72ww0A81AM9AMNAPNwCthwPupg/BPcTkQsSlSq62w5Q/r+YcAfdU+hbriXIGv+K9oeiJlU8inXeul3Cy/PwOobwAwpqHohovkZsu+y5vcyMs5zDLa9GXYp632lzSWWM4v4f40A81AM9AMNAPNQDPQDDQDzUAz0Ax8YAZSJB4OAhC8D5diVETIaicqcOsBgE/rFesp1PPp/x/+8h/+k1x5EGB6PQSowj7rHOU13T6A9CsPAByX457iIrCHhyZyIh+gnIiZZrvGWT5x2JdxP1jGOZ8feFn30JuBZqAZaAaagWagGWgGmoFmoBloBkYMpGhcHQKkEFWkbqEiF3E9+gN9inGEugJf8Z+YBwHY+fMA60hM4Z925tH2AID+0V/Hk2Mdiu5PHw5GENnaD2hZ60oeRna2a5lE6xNre/fh8SGABxPMc85rhkdroOOagWbglTPgF5puap/DzPvKh9fdawaagWagGUgGftkv+2Wf9dUc9Br4mGsgfcET2txHLlcRtgjRFKjYIxGbYtcDgHzyjghXoG8dAMwOAywrZn3GcWCgXZH8eQAwegtA0S0OxfcDP6SZT07ggHpHl/xUtGxybL3gtA85Z4vNMqm64AmXTlfdDDQDt2bALzD1pr0nbF/OlTNfYzPQDDQDzcArZKCF38cUfj3vPe+sgWd0SdwvHq6JwFWoVgFbw74BkIcAPoFXlPuUX7H/b/4b//qPeBlXcUvce6BgvbaTeM0BwEyAK9CTkxT9jN0r4ytXo/DoIODCQwDv/Ss+43LqppqBZuBWDNQvcg3Tzigu42/Vl66nGWgGmoFm4BkYaCHYQrDXwMddA8/gYrIJ7iEP18MhQArdkdhNAZtCV/HrHwGsT+sV6oh8hT/4Z37oh34sw3sPAbI+7fzpgAcB9IM+0T/6a/9TdGM77hma3/LU5ZgTv/GbvvnbDSc/1bYe0LpH/Tg5CHC+TpF5VROknXHE96cZaAZeCQP55Uw7u2d8YtrkrWHLG2+4sRloBpqBZuCVMtDi7+OKv577nvtnckveF4KHq7wFoChFoFbxOgorercOABT3Cn7E/4/86I/8+NYhgOJ+hNb35S9/+ftM982A2QEAfVd8O8bE0QEA6ZahfI6V8XrAYDy45yDAOrN97OzDyQEA8+ScnSLLx7nF7k8z0Ay8AQbyS6t9LTJcyzr0Gja+sRloBpqBZuCVMNAisEVgr4GPuwZeyA1xf3j8Y3cKUIUpQlXRr8hV4Nb40QGAohyR7hsAin8OADwEqAcBHBQo8hX4ovFiHgKYh0MAfwZgv/MAgHE5xi10/Nah6HesGcYmn2iZRDnzAGDUD+dAPDkIWIt/ls1hDg8LyPt98RDb/zYDzcCrYMAvpkintMFqG5domcxrHMjHtEOo/20GmoFmoBl4tQy0+Pu44q/nvuf+mR2T94eH+8qHtwAUnYpiBTDCNYVstRXC/OG9/AmAglyx7qv/in+RA4C8fFPActSjLeYhAXG2BeYBgIJ8JL4V4o4XNM78jDXHl3/sEPtX/Zpf/x2ki+Y1Tq44OLFO0bayfedAPDkAGL8JwPI5zOV6ITnP69gONQPNwKtgIL+g2n6RR+FRGgPJvA7MOMONzUAz0Aw0A6+QgRaBLQJ7DXzcNfCCLulwTxmHAArS0QFAClxtxa/i2NfwFeUp2vMNgP/w//yf/D+5PAiobwRYLtHDATHTsGcHAAhxhTeo+K5onpnw980Cx1oRLoiTG9BDgK0+yLnoAQB4cgiwiP3UA3m/n/YLLq1uuhloBpIBv5iJ2DVMGeP3YObXBvlY9yHU/zYDzUAz0Ay8KgZa/H1c8ddz33P/DM6o3gcaXu4v7w4BFJ4KUQ8BFLEKW0W/YYVwfQMgBTqi3QMAxb+YhwCjgwAF/wizjTwESCFu/xX4MzQf48oxOS4wL/IQNm9icmS9tV0PIOQ70bk4OQQYawOWkHP6DMupm2gGmoG9DIy+mMYlYl9y0X7mNwz2pxloBpqBZuANMNAisEVgr4GPuwZe0EWt7z/LIYACFeGKiK2CPwUvtuKYtwB4Gq84V7jnAcB/9p/9pz/v5UFAvhFAXsslEu+V8ba19RYAY6gi3LE5PsfEWHybYYSmJ2JbHpQv0EOA7IP8io84AMh5ZDkZfsGl1U03A81AMuCXcoTEXXvRxqhO2zbNcGMz0Aw0A83AK2Ggxd/HFX899z33z+iG8l5QGzxcGz8FUMDm03FErqIXVAznAUCK9DwAQOx7ACBuHQQo+vNtgawbO98AsF+KcPs/QvM4nhT8o/9mMNO1Hb/tehBg3bZb/5AiBxAeAIAeAlzwBgDLx7l8xqXUTTUDzcA1DPhlXRyvDvhxSF+su9rX9LPLNAPNQDPQDDwxAy0CWwT2Gvi4a+CJ3UutfnSPuNyLlkMAxalPyvMAIEUvQpiwgri+AZACPsX/f/6X/tIveQAgehCQYn9mU68HAaMDgPokXkGeqFi3//Q9L/9HA8Z27kBgdgBAex4CgPkmghxfeQDgfFas897hZqAZeGYG6pdycbRbYv/BCX9ScavMIv5t85mH2s01A81AM9AMXMpAi7+PK/567nvuL/UXV+Qf3RMat74njQMAnkLzRBph6gEA4tVDAA8AFP2igtnX8hHoo6f/iP+8PAAAZ4cAxoOjvxdAm/YjxXgKfvtfhT/lEP7+94IeKORhQLXrgYCcWLft+jcBzh0C3PANAOf3iuXSRZqBZuApGPBLmXjqgBHzOOKKxl12EGBbTzGerrMZaAaagWbgEQy0CGwR2Gvg466BR7iOS4vmvaB2Ivbh3vPuXjMPAPIQIAW0YrsiQnnPAcBf/+mf/sxrdBig4Efsa4v5VoBvAija6U8V44py0DT7nf213yM0Xx4E5CGA9YLZngcB4OgQwLcANg8A5vf9rIOcx0vXRedvBpqBJ2Igv5gHBzv7IiPw91zj8nQ/23qi4XS1zUAz0Aw0A7dioMXfxxV/Pfc997fyI5N6vCc02XAi9nI93IP6O/RzbwGkiE5hrIDeegMA8f83fvar91c9CPCNAAU/OIrzIKD+HQD7laIc23jQ/mZfrce4GVo268O2vTwAwK6HAKOfAdQDgJUeyDka3+s7p851YzPQDLwCBvxiJi4Oly/zHuFPHvOeOgPrY7jZDuH+NAPNQDPQDLxCBloEtgjsNfBx18AzuSTvCW3OcCL28V60HgCM3gJIQa0gTsGMmOZSpKeI54k/ov9rP/e1r3txGJAHAQr+GXo4QP0Kd1/hr8I8wzy1J599tZ/n0Pyg4wXzLQDbGR0EeAjgWwAeAszeAFjpgvE9P/N5mDdn9oDO6zq2Q81AM/AsDNQvoF/SU9wr/mu+5Ytf68wB1n5kWtvNQDPQDDQDL8hAi7+PK/567nvun9n1eK9Is9prjPvMeggw+1sAiF4FcYpkBXX+DQDFfB4A/PzP/62/x+VBQB4CkC/LaIN5AEAbtj0T5bWP9I9ys8v+J9pGPQRQ+CfWQ4CtnwBc+PQ/58y5TMTuTzPQDLwgA3xJ+fhlTfsQF872k2LjfGvcfZj6yLvUa/2JtgX2pxloBpqBZuAVMtAisEVgr4GPuwaewCVxH+hHW8x448Dl4t7y4RodAHgIgJjl1fb6FkAKZIVzfQPA3/vzxB/Rj/j/27/wd34xDwJ8G8C8FT0I4BCA+hHxtGf7iv1E08hHfvtVsaZZd9ZvXVl/fRNg6wDg3NP/1f1/zs9iM5c5hzm32o3NQDPwwgzkl3RxtHx5w9mmrePVCYiZ595enEHWy3Bt84WH3s03A81AM9AMzBho8fdxxV/Pfc/9zC88Qbz3hIl533hyP+p9qE+n82cA9X8E8C0AhbHiH/GsoM6fAPCUvx4AzA4BfCMg0QMB3wRAxNumfaio8Lc/lMm3CAyPDgSsG6z1EvYgIA8B8gBg6/V/+QXlfOe9fs7lEyyZrrIZaAauYaB+MdeOdqf41xlMDwA+nb4JQJ9rH64ZR5dpBpqBZqAZeCIGWgS2CLzFGvjGb/zGz25RT9fxvOvxidwK1c7u/7wXNY/h1QFA3nsqUD0AGL0F4JsACGEEsYI5xbQHAIh3DwB8+v93/6u/+0tcHAJ4+ZMADgp8I0CkPPXsOQCowl/Rb1nDFbPv+RaAY8uDAA8AQH8GACf+McB8/R/+/N0/KL8XHgA4f1tIWn+agWbgBRlYHOzBKR/CiPdypdMd2TX/fTjrXNsvOORuuhloBpqBZuAcAy24nldwfQS++zDg7aypc/6hpHPvyOccHnIt/2b+ahM+XHE/6v1nitPRAUD9KUAeAIyetCO68wAAkY/g9wBArG8DeBgA5oEA9XEh1hXp4pbwt9wIPQioBwDUm3WPDgBS/HsAkE//66v/eQAg5+DOe31m2PlcZrutZqAZeFEG/FImHpwsX9hwtNr55Z/Z5l2hzntBBp7tvigR3Xgz8MYZqN+lGmZ4xr3xoXb3n5uBjyBIe4xPJ0gV+xWb86fj/Jbc7vQ3o/3FuBESN7pobhR/ck/qPagHAD6xVsD6E4B6AJA/BVCAI6QR1YptDwAQ8/UNgM8ePvk2AHnMq10PAag/BXvaCnrbB317IOPStkytd3YI4BsAeQAwe/p/8RsAp3OW86idiN2fZqAZeGEGTp3tleJfh7wS/9Y1dxAvPPxuvhl4EwzwPfWjLRrf2AzcnIFbiomu622IvlvNU4v+tz/fE4fi3iOSTXsLSfOyTOY3bUHvIR/Q+0xx6wDAQwCF7uhnAAhmDwAQ04pvXuFX1PsGgOJfzLcB8o0ADgE8CKg/BUjBbnsKe0S/hw+WM2yaeSmbVx4ojN4C2Hr1v77+nwcA8gvKOXhyn7/Mq3Pn/IL145zX+A43A83AMzDgFzDx8MUtDpcven7xz9knjoH6LnMOzzD8bqIZePUM+N3Mjm7FmTZD6zHdcGMzMGXgVmKw63n7YvCSOVT8U0ZbvKSemvcWddQ6Ozxfm1PHsCS4nyRi77/yHhF7ctV7T8WpT/+3fgLAIYAHAPwhPF+P5y2Aaw8A6kFAHgh4CMCbAIj3KtwNg4p8RL9vDoCE89o6BPAAYCb+PQCAg9Gr/xyWcPkGRXIqz/J/Mj+nc83qyPWQYez+NAPNwCtg4NRJF+frl76iJ4Jipu9wENU5vAIqugvNwKtlwO+LHTRc0fSK5qvxHW4GNhlocTQXR83NmBtFOph28zXm6zXzMnEO7id7kDzrq9xjntwvlvS8t8RWkIqKVcWrYtbfttc3ADgAGP0tAJ/IK8jPvQGQBwDYHgD484B8CwAhr9j3QABMwU97eWUa5S2XhwfYvgnAIUA9AFD48+p/in84kR/5+sZv+uZvl0M5leO8z1/NV53bJTxZOh3dDDQDL83AyHGf/M6KL3p1vjrgUbxxKwdxV8d9eHEMte2X5qLbbwZeKwN+V+xfhrUTsb0oY9pWedMam4ETBl6zOOm+vU5BmaLfQwDjes5e55zN5uXEIZxGuMe475yi94Ab6L3jDFOIaitSFa2iglaBWw8A8u8A8CZA/gxAkY7gRoAj4hX2Cv49ODsE8Ik+dafY940BMdPIazkOAepBAAcAvgGQ/wMA4v+SAwD5A+FWnnNO7u/lncflXiPnPFeIayPj2m4GmoFXwkB+cc8eAHgKqGMQ00ForxwFDmPuLNpJvJLF0N14FQyMvg8Z53eWzho/w1GeVzHI7sTbYGAmDDr+bQm555gvRX6K/rTpg3mu6c9jyl7TXpf5ZZ8VLzXbZzIee7kUi4HeI87Q+8qKCv7EFK0Kf3BL/NcDgNHPABDciPDHHADkIQD1pKhX6PO3A+plWpbxbQD6lQcAo6f//rwhxf+eNwDkUn7hP+dodU+fc7zch7BcXAtl6XSwGWgGXgMDfkETDw47nDRf9vzya1enbNh0ceUsqHftMODB9rH70ww0AwsDfjdGOIqj5Ci+xtmC8YYbm4EhAy2CWuhfsgZS8I/sS+rqvC+/9oZOYR3JXnJ6cc83uLw/FL1/TFSAVlSgJqboT+HPAYBP/kF//48QHh0AjN4CeMwbAL4lkIcAVej7ZkFF83kQ4MGBbwLUA4B89V/x/+Uvf/n7tg4APCCRPzmFc+fCOVrN43quWQl9L7H+PnSoGXgTDPjFXZx3cdg6AFHHUBGnYZ7EDceRbb8JsrqTzcALMVC/Kxlevrvzjdn8dD/tUfiFhtjNvlYGWoS9vAh7K3NQBf9//R/8Bz/zMo2xYF87pseUvbbNj1xu4JfcQ9x7yKJ9wHIf6X1g3huO7iFT8CtIKypYKypoR8J/JP4Rx4rl0X8HiMjmaTsiHEGOSFfUX4KWqyJ/VEfNQ7v5FoA/A/BvAPjqf/3dP+PaEv/+/l8O5fhC8Z/rYLBMOqoZaAZeKwP55V2cd3Hc6bCxq9MmjMPFgdS8hHX8R6wbxYEd+/Jauep+NQPPxYDfhS1cvq+n36dMo89Zj3bGP9e4up03ysBHFj899v2HHwp8UeEvGv8YAf+Ysj2X++cyudpwW+4nuecc7I37yLyHPCf4FagjTMFfRb9P/P2jdz7198l/Ff9bBwA8fX/MAcBI6G/F5SGABwAeAnAAkOLfA4D83b+HGowxDwHgQuEPX3A6Ev7Mj/fyF9y351pgyRjesjeWVic1A83AUzHglzPx5Pf/OgExHbc2joS/qJpOw/zg0YG4IawFy1ONr+ttBt4DA/n9ZDyEM87wObQsyMc6DqHTsPGNzcAnKQbavk5EfQTeUuBjK/x/7a/9tfe26XCR9kfg5i2PsbhA947E0/3H+70HzHtC7x1n4r+K/XNCv4r9+rRf8a8gTvGPWFY8158AILQR3M99AMDhgIcAHgBsvfo/ev0/hT/jPyf+r3jyX+ecZeKayCUzisv0tpuBZuAFGVi+yBtOGweu407Eaf7x7//+H0gHn/Ynpc67cS7tLQ6jncQLLoBu+tUw4PdghBmHfenFIC3jgK3TcGMzcMLAWxYv3ffnObBQ0CdyAID49yKc6cwN4Uvm6NL8l9Tdecdr5cQhLBG5n2hvPkjKe0cPAHwKDab4T+GPyM8rn+zPBL//1d9e4e9f0eepuk/Z/QkAT+AR5VtP7m+ZRluKfw4gOACov/v36X99/Z/xMnYPPkbi36f/zoHzsnnvzr38cg+xzPcSx8owXhv0Q1p/moFm4IUZ8Ivol/WAIdbTEWjrJEDicMg/+9Wv/s0vfvGL30PYePODOw8AXpiObr4ZeFUM+L2kU+Pv6rLRmneG1pH1GAf2pxnYZKCF0VgYNS8LLynssfPp/z/8rf/w/SFAPQCwTPO48PgauSjOYbSPnO49cS/JPWDeE3ofqfgcHQAo/lP0Y6fwV+CKKfSxfRW+Yj7x96k/4h9BrfhHbHP5x/de4icAtJni3wMA+5lP/hkT42Tc8gEq/uEOTj1gkXPnwDmp9/An9+/O6777D5ZOXS8ZV5ZWB5uBZuC5GMgv5sGB++UuDltxn04Cx4ED+qs/9VN/DWdinnT02CcO5NRxMF778lxj73beNgOul8ciLFjHSzJiH0ZI3C2vOuba5kvy0G2/QgZeoyjpPj1ONOaTdO29KPfmV+ynwDeOp/8cAMwOAajLeqx3C80rbuXttMetEfnbcEnuS2TRPmDcS3IP6H1hvYfkPlIxCipQPQD4Vb/m13+HhwAj8X9O9Cv2RQR/iv4q/PPJP0/duXz6/xxvAOSr/x4+8BaC4p/++eSfvjsuxX8eAFTxPzoAgHMPAcCcH+dMPLmXZ47rvC9h18QIietPM9AMvCADeeN/4rT90ovVMfDUn1eeeP2/plkGPHEai4PI9p+CBuunbu1zmHmfok9d5/UMOHdbNZinImWMs/y5sPmeG+1XIvbpxQZcr1G+JY6xWI822J9mYMqAQqDxNoLquXlULINe9GFkG3cJKvY9AMjw6ADAfKM29nBDuT35Os9t1mtxDLkvkeR+ssayL+U9Yd4vnjsAQLTmAUA+3cb2ACCf8iuKwZHgT9HvE3+FP0IbwY3wR4Aj/p/76b+v/tOHLfHP2BijY0/xP3r676GKhyz+DMADmCc6CBitF9dNWVodbAaagedkYOq002FjV6fNk38cFc4502u5HQLlOcebbemYjMvwzDZv4/MxkHNBq4bBetV0w6MypPExrdr3ic/8j32p41qH8+aK/mdY+5SbrCPHapvPPNRu7q0w0ELqNkLqOXhUHKe4pt0M39JGzOdv/BX/xvn0/x/5R/6R1VsA9RDAPiaO+MrxjdI77vZrdeKn3E9I1l7QfegB877Qe0kFpwI03wBAnCpY8wCgvgXgAQD/571C2AOA2ZP+kehP4e9T/+d88u/fD+CemstX/zkA8HBi69X/0RsA9RAAHuUUvPQggHnLecT+pMzzfXi0Hg6LyHsNcbK0OroZaAaekgG/gIvDLkKiftF12sTzB0ZwWJykXvza0No5MEb7cqvxZn3aM6ztm8++1LDxjU/LQOXdMJi2vcg48ySSL/MYrnHW95xY+5Bh7PU12nBncbXsOpxjtM2Ma7sZuGegRdXtRdUtOa2ieI/AV6g/Fn3CD1KXwt94DgAQ/16m2+6or3BTx1T5Mr3Gd/j2a7W4QfeKxPUexT4Te1LeS3ofCXoAAHoIkKJUsVoPAPItAA8AFP/g6ABA8ayYBhH9Cv986o/4RoT7Or7i/CnRtmiXgwcOIXwDwD47Bu67ffqfbwDkIUC+DeChyegnAXIs784DmPOT85bziZ1zfbTX9xq5PlhOuXbK8upgM9AMPCcDy5dz4rT5kuMAQBwDT/9xhvwMIB2DedJBHB2CdZ86BsaqQ7jVuLfqM81x237GG2d/aprxjU/LgLzTinYi9mOuWb2jeOKe4zMfj9+hPQgv5BvzwziSR8L9aQaGDLSour2oeiynCuCRgM44hbaoAH8s1if7hhMV/eB/6zf+xs/+se/4jvuDANu2T9lfbfjBliftiqY3Pt0aHTqFQ+TpXlX2prwXzHvFFJeKTkUoqDAF9xwA+AaA4h/MNwAUz4rpmfjPV/6f4zf/eahAex4A+AaA/aTfjgH0EODcQUD+bwC+ETA7CEj+nZM8CMj5y3v9+/uMMu93y+N0bSxrBsv7j0Ns/9sMNAPPwoBfvNMvaPkSV+dN2N/++8f/Zk7BsivncOoUbjlgx5V1GpdjJb3G1zjrMJ/hxqdlQL5FWsM2rC1munHXoPWAL/HJPtN+hg92+W7m94rvWoZP7FF9S9xLjLfbfEMMtLh6OnF1KbcK5BkqqkXFtpgCfWSnaN+yEfReo3ymiYh/LsLkp237ZF9nYxqJ/sx7KYed/7L1XFzV6d607CUne5X3gWDeK24dACj+Ff6gT7Gvefqfv/nfevKP+H+J1/45BKhvAIwOAPIQgDF5nTsEyLcBRocA8CvnlxwC5NxecM/BcmKd9KcZaAZeAQOLQ/90+aNi+eVOG2eDw+JkMR26dubFXjmG9UbB0G371jToYLYw09LOfo3iTb91n7u+NQNyn3wbB97isu5RvaYlYt/6Y9vUezqm+E76XfJ7tfldy3Kn9drWCInrTzNwZKAF02WC6RZ8pehNsVttxbOoqAarwK9CXXF+DhXv4j/xP/78Z16/6Tf9pnthbxpIHOn/1D/1Tx4v44jPQwAPAuw/WMdoGF61E2/Bd9cxX+NHR7A23LfWe1buO3e2e5T3h6IHAPmkWfGpGK0HACn+uf+sr/9f8vSfV/7ztX/F/3O/+s+9tB8OAewHBwD0L98AyAMA3wLwTQDHnj+FkJ9zbwGMDgCcF+Zp9BaA8+q9iPcm93h6v+EaYQXlulmvqA41A83AszCQX0K/nNPfbfllx3lzAPATX/nKT+IUdOai+RLPOIZbD9ZxUa/2CJcxj53VqPyor9Y9Suu4/QzI4wgzDvv8dXfjcWbdzeqgx7a3v/ePz2l/bN/w6jvpmPL7NbLNt8Ixb4/vedfw7hlocTQXR7fkBlFLfYkpdNNOwazoT8GfYl+Br0hHjKcgV8xX0Y6A/+2//bvvRTzI9T/95/8nn/3u3/0/v7+wjTcNtD7Lk/9LX/r9x7zE0xffBPAQgHHkuHK8I7seFtxyLrquZc0XB+feRLT2gp8ue2/dm7xPVPwrLrmXVPyDew4AOAxQ4Cp6FcHco3L5hNxX5xHQ9Q0AfmeP2OZ6afGfr//7BoCHAPbdsTg2xum4QbmQGzAPTnyTwsMVuQadA8V/Cn/myvkD69zuvNdwnbikCPenGWgGXogBv5AHDOfNF7p+yQnrMNIZaI/yn3EMDPsWTqDWYTgR+5rLPlrWMNifp2Vg3/yVdXvXpeX376O07XXAiJzrbN948FYf66e+bPNg177fhUffsRr3yaDcfdyojcNIsh+3GlvX804YaDG0iKGn4gKBS90zoZvCWMGfT/kV/COxr7BXpCvgEeVc/6t/6V8aXt/7L3/vfTzI9Uf/tT96vDIOm3qolzYQ+LVN2rAMecnDIcTobYB6EFCFPhwlH3L2VHPz0esNN+YeRZT2Gsve497kPaLoIYBi8xu/6Zu/XQHKPeav+jW//jtAharCNcXs1lsAlx4A8OT9tR8AKP4vefqffMmhnHovD8o96Jw4R84Z6HyKJ/ca43WR60Ub7E8z0Ay8AAM6bZrWPnna6JdcTEdQbfJUB3HGOdj2LYfPWPxoJy5jzXGPbeoxv7Z1i9ZtuPF6BuRyhM7DKXrDwVxp78Flbk/rPIzBflw/on0lbZ/c2sOx+D3cg0Musv61va+nrzeXc3UOX+8IXnHPProAeqrx31L0+3S/Cm+fvivAEfH/2+//t+6vH/zTP/gZ17/37/47n/3oj/3o8fqL//Gf/yyvn/zJn/hsdFGGstZD3R4meGBgGm1iUwYknb75NsDeg4AU/h6E1AOCp5qvj1pvcU0jH7tr38p7RsUlqOBMEZriVMGqgE1R65Nun3yDPhE/dwhQfwLwUgcAo9//+xMA+ujTf9BDAF/9zzcA5IA/iCgvyRX8ySUox/LOIYxzATpHOW95j39yj7G+p3BNsHzSzuXkWsq4tpuBZuAZGfDLuUt0VGdguIqSE+eAKFscgW0yzKdwAtZpO7dA+2pdhPvzeAacq6xJjk3L8MFmPd3iOl2TtS36lf3Ifj7GrnUu7Q7GVb9fhN2MxZpnyM96vE81tsfwsqds5e7aMtazp/yHzfNRhc9Tjnsm/kcCd/akv/7e3tfzecKuAFd4K/IR9op5/ws0X4H298c+DU1BNBIpiBPqU9DnWwC+CWCfOBxA/Cu66APlKEPefBtg9NOAFPtwZBiUM98EkNunnL+PVPfA8S171Xo/OcSX/Sv3Je8XQQXm1iEAbwKkaN1zCHDpAYDr3TXub/KfC2nX1//pi/8FYP39fz0A8BDA8XoAAM4OAPIQoB4AnHv6n/cZJ/cWo3WwjmMZud+Kg6XVUc1AM/DUDPgFPDjs/KJuOG8deTrxdAqmgzscxK3GmGOhTsekLRr/GLQukI9tH0L972MYkMvE8VyVNXqy1i5NX9ZMbY/xZH8eM75Z2drm6iAuv1Np1+/gI7+HjnHWx5eMt28V7VPGY+dFHtPNP4ob5cn8H9r+SGLnOcaaQlVbEZvC1t/019f7/f0+T88Rzz7lT9GP4FfsIyTyt84KnpHAVwRVVKBQD/Uh4GkDYa+I5+0D+ubbCHlAwUEA/eMQgPapn8MADih4a4D0+rMAxy0PyY22fz8A/uQy8Tnm8723UZyfvjIRe32VPdi9q+5bo0MAnj77VFqR6iGABwCgT7cRu/43gFtvAPgk3YMvvxN+H1zzzyX8bYd28/vF96KKf5/85+v/HgCM3gLwAACUJ7mTS7mV63wDIOcl58x5HN5z1TWw7L2uFZZS2mVpdbAZaAaekwG/jIvznjhuv/gjoTGKO3EQ+5zDLcZ+OqZR22Wcx/6O8q7j6KN82V/bNNy4j4EZb8bL84KzebuLZ40yj65V0Tjw5GIuiV/mdGlrHeeI7Jvha9A6bIs6Dnbpo2NIzA252pkP+2S8p2O17UTs1/CRp9oXeTPdsPkynrhMN814yzROGHjvAuc5xpeiNO1zwj9/04+4Hol+n/IjrhH9Cv4qbBQZxPtHxhBBKTh8O8DDA8LYXL6+T3uIeZ/4K9wR/PY3kXgOBxD5HBhQF+3TD2zi/PsBvjngGwH+NKAeBngo4NsCvgmQ3Go/x/y+5zbCLaTvJFq/eopn9jH3rRSa+fq5olSRqmhVxCpqQUSuT799Gl5f/x+Jf9Y+azC/J4ry58IU/34n+T7a39FT/5HwZ9xykG8A5AEAXMmffMqvfOccODfOFZj3F6t7i621cFhArhGXU11Lxjc2A83AEzPgly/x8AUtjpsveX7ptXUGovHgyjFY39pBMDzbvsVQrSvxMJ51u6unq/d9sH8Va7l12P7bnmOoYeMbtxmQN+eM3NprrPP0EM715xqsccZ/Mqlj0Kb9SMS+1aeOe7U+a/9zI96ya7mTcY+5vdWYHluPnGQ9xrkWSMs4w6aLxouWMQz6yTTjGu8YeM/i5jnGhhClHQUpqPAH82m2Qhfh6xN0RT+C29/yj0S/ohqhn2I/Rb5CPn+7T12IcBF7dKXoV6jnU39Ff46hjgOhTzscLHjwwMEC46JO6uNizPVgwQOGWn89BBi9DSD/zzHf762N4gT1k4nYp9dgn3Vvyv1LoZniU0GqQFWw5pP/Kv59+o/49wCAJ+Ypps89/UeQI/7Fpz4IqAcAfifs8+iJv4ccVfSPDgAe+18AOjfOl/N3ck/BXI/WwGHxuFYOoWXvNtzYDDQDL8TA2nFvOO388o/sT+7KXugYGHJ1DtfSYD2Ox7oNr8QVfd11jZ2adWYb1/a7yx0YcP6SU3k+4GTORmvxXNxw7udzbZ9GeOj95f863mWMMb7afzfgimzQNY5wLX8y3vVYbzmuy5kYl0h+7F/GLbytx7IVX+sxPO5Bx94z8N4EzXOOJ0W/tuJ/j/BHMCv6Fen+Mb180u9TfQSEIiLFfop7hDx1cnGokJc/JwDrhUBP4a8gV/hvoYcZlKc9+uPfJfDNAuIR/R4qgLbpzx7qTwzsQx4C+DbA7CDgOef/PbQ1cYPpZ8mS4YMd+5n7j/tS7lmKzHMHAD699um/r7krfBXGPCHn8rV5xbSv1fP94LCsHphxaIYgn11PcRjgAYD9oY/2N8V/vuZfhX/+0T+f+Ffhn0//4dEDFdBDFtCDF+fCucn5cg5B5/WIo3VwWECsCT7iIdT/NgPNwLMz4JcwEftwbTju/PKP7KMjyDqsd0EGbNu3GLx1JR7GsrR53QGA48h6FruOw/ZvMab3XseIK+dMXg1P5260BvfG7Vyr9uFW8+G4rXdB19od1jHkBoztxlwx89U6VuNd1vDS/q1GeHk9yYlzL9q/GjZ+L1petE3CfGr4ENv/9hsAd0/vrxFyCn7xnPBX5CqSEeo+iUcwI5R5cu5vl32yj6AhnnTFtIKfOnxyj8BW1PM6PpcCG/RNA5++GzZNYa7oRvArvH0lP9E00MMB6vCQwfFxEME4/aOAtAsXXoQpA/q3AuyLWPuydQjgfFwzpx+xTHGB+slE7NOL/Yx48OFyT3Kfyv1L0akIVZgiUveKf5/8nzsA8DvkIYA/AxB9i0bMQ4FbHgTkAQB98gDAwwtf9/dww8MO0AMQRb8HI1XsK/hFxb/8pvCH+0f9LYDROljHuZxcP4Ybm4Fm4JkZOHXaxWFXx60DH6F5T3DtAGyToT7WCdTyhm1jwYcNqPaNcRAn1vT7sJw83TieedpfXXM5b66LZe7k/26ecn5Ga/DSuKzvaI/nufbxFiQuY4yx5Ri8URLzhqna3ECZT8y6juOzrWWccj7CW4zzmjrkxj4ZvgVaZ6J9pP7+BAMfUfRcO2bEJWUVmeBI+COUFcYj4Y+A9yk5T/J92u/TfcLE8xRdsY+Izif7I7GPiPZCPCugFdsVM08V/gp832SYYR2rhw4eBHgYQd8ZC5hCn/5ShngOMUDKWg/p9NtDgNov+c850b52nj9SuXAF1dRXJi7+2X3mAXMvcn9yD9sS/x4ApMBF9KYYRiDnq/95AICY5qk63xm+P14Ibi+fwCdyGFAPBPIgAPsxhwHW5c91aDsPABjD6AAgn/gnJx6SiAp9MQU//7uCYQ9cEP7YzgXo/IDOGZhzubqvWO4plnWwrJpcJ0tsW81AM/CsDPhFpFHt/MKuTm39gueXfmSbb4WnDiHbvNWgx2Ow7U/XwtH+jcZAnOlDtM4xPsXYbsXRa63HuUvu1msRrj9dz+Fs7tycZjgqV+u+68hp+wf27Kt4Daejulfjyz7mppubcbXduDO/dta3Gut8nDmux4w166m29Y4w47BvedGPrD/D2P0pDHwksfPYsSosRcUn4tin4wp/BDUCGyGLoOWJOAK4vuLvk0H/IF+KfkWxT/dHT/W3BD994EJAVzsPA0irApvxpOh3rGKmeQhAPfaHcdNfDxmIJ8yY4IExEebysIB4L/jKwwDHYD/lm37YJ+el4mPn/T2XL+5g5jtPfXTs2bkHuS+5hyk4FaKg4lTxj6hV7Prkux4AeAigcPYpuq/UewiAyPYwQMxDAew8GDh3EHDtIYAHANSP+KdN2vYQwHH4+r/jdfzyAdan+/Amh2Lyq+3TftG5cG5E5wzMucRe3VMw5/P9mqXk+qk24f40A83AMzLgl3HTeecXvH75DWeeoz12BAwv273VcB2D9RteiSv7Zr/PoflXeDou23Qsjs9w4ykDlSPDy7zJ86fnxX9uTLlZpb0112fmN/t0OpLLY9ZjjfFlH7PvbsSJntCDbPiGyZNls84z42Qk2bfLR3Z9CTm2D4ZPMfhajafGu37maFv22rEbbrxj4D2Lm1uMrYpJwgpORbACGHGq4EbwImwVvAh/nuojAhQEiAF/y4/w9Sl/Cn4EMmJaYa2gTqxiXrG/FxXVPl1P8e9YR1jH79jpD/2jzwp304hnTIzVMftzAcL8zGHECWUoS3301z6P+ppzxhogfIu18B7rGDjB9JP6Z7JpHzD8ce5B7k3sUwpOUFGKYPWptU+zFbv8tl0BfO6//kNAjw4B8kBAm+9ZXnkggDDn++hBgLYC/po3ASybT//rAQB9zzcA8gBAPqr4V+yD8gmOnu4n93lfkbZzlZhzebL/1jWwDrtGErH70ww0Ay/EgM587bz54oYDrzZOoMadhNdf/qz/VkPNvlNntnGwB2NIB7bHPhkXdZ62Zftgf/YzkHN4On+DdTibs9yk0ia/Ye1ax8kcb8+vfd4/ykNOy63HGWvUftlfMDfketNEmA3+i1/84vdkviyPbb3gaqzjcV46rmvyVy6oY81LhoOjVf/PxWcdY9t2cwz2LeM+rP0eRc2txpRCckv4I5wVuAp/RW0Kf58GIkB44s/TfoQweVP05+vvCv0U+SN7JPYVyjOkjGmXin8PBDgE8ABkJPazDdqqPHFAAg+IfjhBqPmE1gMSOPRtgDxUoL7ab/tV564PAcZ/62Li+PTVJGuv8cE3597jvuRepQhVrCpgZwcACF4PABTEoL+R3/oZgIcBIuIf20MAMA8BsD0IAF1zHAB4CICAV8z7JsC5AwHzg489APCARL7kTz7lV5T3ETo3I8w51J7uw+P14DqZLKeObgaagedmwBvdteP2Czy4ua4CoobvBnA4OLCOU2SM2e6txpx1LuMpY9B5VawiqaYPnd18bNmXW43vI9STvB3m8Mz8OW+jTWsWV+fW8GqOT+fWNeU82FfDe9FyJ+OzH2D2PTdrN3KRNMQ/NwKZDzvryLqxj2Mdj5OxZD8zvHecW/msO+s17sCL/Srzf+z3nnjqMJ/1rTHbr/ZW/z9U2q3E8nuppwpHBSWo2FXwzgQtot5X/REXPl1EZCA8eMrt02+FfxX9VeSPBP4oTkF/CVYR7ZP9HLu8ZJyckN9DEDlR6IOjvpieByYcBMAPfCmgEGPEeVgCX3DFwYh107ZjqH233x4AiO9lvT52HOHs0kcbnXGL79bv3qF7T+5H7E/uYaCCVQELKmrZ2/KJd74F4CGABwD1ZwC+Rj9CDwLEPAjQZl151cOA2UFACnxsDwZE0xH/XNTj03/aoD3bp2/03fExXg9AfPoPP3Ald3Ipv1v3Bc6Jc7QHj3tqzPF93HpvXdbCaTxrx3XjOmpsBpqBZ2KgfvkMn35p65d8T/j0C2+9DM+2bjlU67SdBaO/M+eGEySt4ij/vaOzzvE4R+Oyf6O0jxonJyMczh/cj+bETewSzPm2ztXcMsen88tc2V/sSz6WW8ZGXbTzcNmPHEdu3m7oFf/493//D7D5e1OVZbIu6wdt8x7X42RM9vWS8e3Jm/XKg+0ZXvCBl1VfI85xVJzlfxjXUv/puPeM4cPleayAeG/lFYwKXQWloh+hqchFpCNGfdXf19oR+NzoK/wRAdz885SbgwHy8UQbMZuv+PuKu+Ifgbt12Y+RwDZOcWx4hDPxLAdwgl258QAAbkb1VoFuXyqHHALAA29CIPR5EwDOFFMgIkr+zr0N4Jxl/+37e1uvjx3PxOHN/OhwT3PvYT9yf8p9TNGqiFX8gz7l9hDg3AGAYtnfzidi52GA4j9R8Q2mGPcgAPQwgDXHOuR77NN87VybIzu/+37/ZwcAHgLUAwAPAeoBgNzK9ew+wHmpON1DY/895lnvo3VdsHyI86MtGt/YDDQDL8CAX0RwfI2+9KM4yhM/q+cwuGzvEPO4f62PWtb9L31MJ4dDJJyOcWRnGe37MWbdtd1D2P48bnQfp/R67uAwOb6z5T9xNGfEsfElzvJlXbW9k/W0nufHzO8y1ocxZj/sq5s36IZekZsjbmpqfJa1PtB2VmNdj8u+5fiIu/XHOhNt+2Tu7a/930LznuD+cdqnW4/5Tdb3WAHxHsorDhMVt4hJxT8iF1GLUFf4I+IRrjzR9wk2N/w+/VP4j576K/5T+M8E/0hgz+JSaI9sy5nG+LgYq6JZTE6wiRfl6JoDgNEhQP6xRMQ+3CGkFFjYCDS45BCF/KO3AUbjqeN4D+v2FmMoTit9o/bit8u+nX7afci9qe5ZHAJ4AMBfqa+HAB4AgD4F9w2Aih4CGG8YrIcAowOBPAQY2aNDAA8CFPaiT/pdo2AeFlDON3+oN9vzYII+epDhIYB85BsAHqTIrVzLfc4H9ske+enyQGKYNt5D1/N/yMOyMb7aZUl1sBloBl6CgXTgtO8X9hTPOQbT53VY/1OM0/7axiFsn+6wOj4d4h6sZU8c5+mY7UfiU4z7rdfJPPFJdC6vmkM2POdUu6LpYJ3bT2LNPPRr3Z/77l71T61nJXLtR/bNzdvNXGST1+bpPxd5jQMtC2adtnNmDTNA+3vVYCeFqJNPou0smHPwYGe/99irecz6lnEt7a37dAj1v0cGbiEi3nIdCEP6nwIxhW0KVYS6T6t96q/496m1woCbfuIQq/WpP2UV/9TnAUAV/wr1PaiYvwYV//UAIDlJ28OB5GnUR8ZjfxTlhkXKka/yisDPAxUFFuLKtwE4dPEtCsrz5gT1Wbfjsr85Bu23vHZv0fejI1gb6T/Xdvjb9NXuQ7k3uWcpXPMQwAOA+gZAHgDkQQA24tj/Jk/xn+hBAGI6Lw8BFNxbmALdgwBE/Ojyu56HACPx7xsFew8AGOPoAIADFO8P5FnewZyPkz1yvDeu5/ayPKwYyvMR0864+0z9TzPQDLwMA37RaV17jeHYT5wHabNyy5ffL3xF2nzMJ+s79Ln0NR0fdjrFPXYtfzL++dgdl300/JGxcnGYswMj2iuBDN91DnLeFLpueiPM/GlnvTvnlZ7WMeydz5PxZfv2y/57gyR6o0SYzf6v/tRP/TX+BoDpidYBWm+2tRrr6frNMTpWce9YM1+WXTio7d7N86pfd+Hs86V2reuuQ6O2R2PNvn9o+xYi4q3Vgfijz4pAUaFYn/ojLBX/PHFGvCM8EakIfJ9UIxKwq/DnkKC+8k89iv/RAcBIUCts9yIC+FxeRXIV/3AhLxWTJ7ka9VcxrvhPtF/kmfHr4QpvAyD6EVceBCC+4HnPHwjMsdWxvLW1e+v+FuenH09c+9Tw4emv3YNA96bcr9zbPASoBwAcBCh6ExH+hvl5ALYHA6KHAB4AVKxvBXgAkAcD2MaDHAR4AMB3mvXn03zsvIjPwwBs86b49wAg28G2H/TbsThu3wDwZwAeAMBt7v3wznzs3BPXc3pYBHXOic24UfhQ8vCveTOu7WagGXhmBvwijpC4+YVzJ73ivAxDsz7sW39yDLazKR5zI9LWUVY0XcwN7cSZLuO0H4zV/jnuGjb+I6JcJGIfLtbYw1V5dz4SmbtzF/mdY8vWum3zHu3LgsyT/d07Z+ZfxkYdZWz2J8cwu0Einpudn/3qV/8mBwGEc+O3nHVZN+h4bX8yTvu8d4yzfLUew2sugg/7ZT9H6DgqjvJa3xGXucw+ZP/tY8Z9WPvWguI114f4o39VBBJOUas45cm0v8dHrPvaP2Ie4ckNPULAm/wU/jydTuGfT/1H4p92fAMAUYydopo+Kajt3xam2NYe5ScNgZwieUv8V64oZ9+yv9qk2X5Fy8kxByEetHDI4lsW/rwCfhFXHgJwIMAc8KYAXJMfbqlD/mw/x1jn3zXxmtfuU/Vt4Pj0j4npS497Gz43fXLuQ+5N7lXuYf4MAPQQAPRNgDwISNtDAHH0twIUz2AeAtQDAAX3CFOcs7a8/I5X9CDAQ4BEfQN15JsF2Ub2gX56COABAOP1EADOPEiBTziWc+fhuA/ezc29Pd8PnV+WQNq5JIwXL03L/G03A83ACzLglxi89cWwsv5bDjPrPfRb53aHOj5Rhyi6EY3QPInWA9470GhrwJvjto+3HPd7quswb6675PSRc1jnNedS+8o5vYT/4fiyXftif+uNkRu7+BNf+cpPcnNgWMxy1gVaf7a5Wr9yv/6eum7FS8aceS2/5sE2z8w3fab/omMRc0zVXo2RdmxzjNnntu8YeCph8drqRfTRpyr+UvgjUBWlCFiFqa+n+9QfIZo394QRob7qPxP+1ONTf+sWFf8KVwW0SL/2XFVkZ1gxbD2mpTiWD4X+jC/yUY467OMIbaOifchxY8OHhwAeuMg7HMM1IisPARBl/l0A8u45BJgdcry2dfvU/QknqA8nauzHjQ9/Xv2xPtu9Kfcr9zDQg4A8BNiyPSDwAACsbwDkAUAeAngAkKjYTlSMK9AV7R4CjNADgTwIYH1ymWY9ovXbHkg/7Ivj8BDg6gMA52tB59ZpzznPtBpv/syTcVvxNV+Hm4Fm4JkY8Is8QuKuveh+rfOWQ6p1r/s52YDcfEQ3oS0kbwoowrmprQTGmK8ct/3OuI9my0HidP7gN/l27sStuZul1TnN+lfzedf23eSs+7asa+bNMWDPPuZZ6qHeu8t261hmN0XeILHh83SL3wKS13gwy2LLgW2AtksfjtfpOBmPfa/2bKyjeOtIXLigjeiHfauY/Z/ZlMnxWUfW/zCmdfuHXmf/RuP4kHFPLTBeS/1VyCpwFb8IVESpIlYhqghF1Pu6Pzf2iAHEKHH1aT8i9JIn/imCbV+0TwrmPVjFdoazvPFwoPAXR3wZZx4PALYOLWyjouNinFk+DwE4CIB/f3LBHMC1PwnwEABEcDEfpMM/ZThsYR6pk/bsQx2v46r4WtbuU/Zj4PSqn1z70vDl+l39cPpt96Xcr3If8wAA5I8CzjAPBeohgAcAI6wHADxZV2Dn2wHaCnBFOSJdwQ76FF+saYp9DwIM1/znxL/9of+My5891EMAeYXn3BOdk3s83fPr3DL9xg2WQkc1A83Ae2JAZ86Y/OIbtxdr2VGYuFt+1n2LTcjNR3GAQ2SjwSm6Ce3B3LzSoVLvDqdq/2455rdeF5zwSTzwNJk/59C5E3P+UvSmnXmwHzGf2ef7Aez4x/kfil37Yh/dvMG8KdLmD/9xU8umb1xF67DOHHN+J45rd3wzYL93DHFXFutbMOaavmTfcr7laA/WOo5jtK3TsdJ5+tSfwsBTiouXrrsKOsNVwCqKFaOIxnzqz5N9xKXCn5t6nkZfI/wRo3kp9Gdo3xIRsgpaUXG7B7OMByByAsrTCM1nOdrb6nv2xwMD40bl5IY5cB7yEICfX8C7hzGzvwvgTwI8BKAu2rt07KxheHjptfxU7Yc7GPlH4xZ/rm998LXVF6f/dm9yrxLdy77xm77527VFDgKw84DAQ4B6AJBvA2gjmjk49ym6gjox09LOQwCFegr9LRufwKXwF/MAwDpBDxpmhxL2i/EwtnoAAEfw6b7vPBz3QudpQaba+dyyY0m02Qw0A2+RAb/oW3jq1BdnMUuDC9O0n4qf7LttrgQWzk7HB7L54BA5NcVBugGBOksx07Rz88p6sY+O9a7N4MB+JRf2+6l4eUv1yoU8HRAOH67kOfl3Lp2bRG8kxEzTtrx1Zju2fY/Les4+7uE4x+b8H9en7dm+/bLPoDc93vCI/PE/f/9vXObNOrCt27ZsGzwzVvuduGfsmb/ytoQf5tg+ZL+w7e8IGdMonrhaz45xjuZq7zjfdb6nEhavoV6FWwrZFLAIUQShQhTx6VNnnuAjIhH6eTPv/0XPHwD0D/v5tJ+nzohVLl/1pz7FrOLW9s6hfQPzUkDfAkdPw7cOAZI/ytrH0VjsXxX+lfdRWbmCO38SUP8uAIcACKz6dwGYL9/MYI5mfxuAvmcfR1zk2mFNu6Zew/q+RR8Gzi195eLL6z4Zvr364/Tb7k2Jdf/KsIcCogcBHAJ4AAAq+Cv6NoACWuFveIbmQ5AjzhXriH7tLSSfhwCJHhpYVuEPjsR/7Z/jGR0C1L3/in1wMP2rQ4JResc1A83AG2YgHTzDyPDc4R8GnHmTAuMz7la2dR/6Ntl43HRwgpwAc7np5AZTbfOI1lOFhiLmiHVDXPNDyH7fioe3Vo/jP8xb8nVmDuHe+UgczV3GZV7sXXOZ/VrmLPt+jvf1+B7G5k2RfbBv9jcFfYp8Dq8+u/twg2C8N0G1jHVZt22Btn9cr/Rre6yO07Eb3otDHmzf/ojZV23nbIbmE60LtJ17PB2nfds7lg+T7xYi4rXVoWijX9og4lUxqnBNoZlP/RH4vmqOoOSmnjBPn0fiX9E/Ev6IWNsZiV37AuZF3gxrK6AVr8RrJzpWMdOwiedS1CdXM9u8lh2Nx36P2jOOPlvWcRkG5QvMQwB4RtAj7P1fGGaHAPWwJg8CqNP2kj/H5TjByoXr6rWt+2v6s8PRuR/oQxdkT4kr/bE+OtF9aoTuZaJ7nXtffQsgDwO0Ecn+ccAqpH0rwHtDhXXmmx0CKN4rKuaJV+iLHgIYJo/5Rd84sN3si7b99KADHuQEjuDL/VL+j3Oy3geZaudyy96xJDpLM9AMvBUG/NKL9Fs7cWab33THbVg0/lZoveBy7dhwcJA8RcVZ4hzdVGZYN6TctHSqJyKDfmS/Tjm9FQ9vsZ6cO/o/nD82quQ3ecd27tzwvAmoSHpuhs5n1pft0O7qyv4t87iH9xzn8ek/dduefXAsrkFvcEDHB3JTwAEANyo1LctYj1jHbPtnxpn93zPezJNlq73iIvmgX3KSaP9nSF7SsoxjFM+Mlb5nP3MsH9a+RjS8hTIp2hRziDsEqOJTYYmo9HfmvmLOK//+114+UfaP/PlU2Sf+Kfrzif8e4a/4TUSYZrjaiuhzqJid5TNdfpKzmW1euVREJyLa6XO2a1vGkV7HmXVgewgAj86VhzR5CDD644D5dwFI57DAvw3gHNlP+2ofQceZmJzwHSD8Fr4LW30sjq/6xwxjr6+7fS59rn5YTF89s/Xp+n33M/c698a652c43whQMCv4DW+hYhtEjPsWAEJd0a9oHwn5zKfgr2g5RT+o8AezD6O+b/0tALmDY7g/zkmdr8NkO6dl6jvYDDQDH4GBdADaiWnDxyw84sq8o7S9cVmHNni4YtNxowHrBsPvqHHMbih7UEfqpmSd2c7RudoP+7Ug48x+7x33e8jnuB2L4cPcwYu8PWByC99wz+bPBs+mxzzyF/F9LR6sF+nk40aAeT43j7UPD/NlH+l79tuxzNByx7E5JteP/XENenMDeoMD0n9e/efm9Ytf/OL3ZJp2lrW+HLNt2gdwNd5lnS79XkbmuJeY85Zlsr4jF7SdfcG2j6L8nEPzi7XeHeO0r+dH9UFybImDt5amIEuhho2IU9wpPBWUPlFGHCISEYs+Ueb35f5xOUWk4p9yXCn+FaqiAhas4pZ+1AtxXOMyrHieIWMkLTHtWo60mcCtHBo2v/U6LvqJnWh75PUyLsdVbesE5VBORz8H8KcaPPHnsGb0dwHyjwPmAYB9tl+gfXWsFeUC5DsivrXvC/3d4eb0mYmLr7/z7yu/O/D31U+P9gB8uv7ffa3uj+6B/NHAcwcAKfh9M8Cn6InmU4AryhX8W5hiPg8BEPt5AJCHCFX4257tI/7tU6IHAPSd+wTGDx9wVPd/+D3Oyel+z5Q7l9XesRw6SzPQDLw1BvzCi/R/ZBtX0fGO4o0zzy3QOsH1FRtObiyKAjYRbJwjYgqHSpybyjl0E7Ie6822js6VvtT+Lbw6hlvw8dbqcOyJh3mM+YNHefUGgPlx42ejY+PjwnbDSxHMRsgccwjAzTobLPmcR+cPtC2Qto/X6Rye4/t0XNTxUKft2HZdf/affubFOHj6z7p1g890bcuDruet8dqvexyP1fGcG7fp5k/EPlwPPNiufIByItrvvWg5Meu2vSPanwXpf/bZ8XxYfIuiZavPKc6wEW+KVcXpOfGvgOQNAA4DFP/+df8U/gpTULFaMQWtgrOK3hSg2KQbpy0aLzq+REVsRcpkHPxUzrbCimHqoD+ODTvD2bdsz3jzg8Rl2DpF+ZRrDwHy8Mb/IYDf/vP2Bn+NnfljT+BiHknjkIe3Bzi4cc5yTuxf9jltx58csR4Jb63L15o2cXzVR2b44OMXn3rc945+99PYW+9sfHSmpc/Wj4PuAe5puc8h+gm7B4rsk9wbcKWw37I5XDedewuFtiIcUc59RIr/KvZTyJtWDwEU/iLplqOt0ZN/+yLaz0TG6v2BHMEZ/MGj/N5znvO07H2Tae/oZqAZeO8M6MwdZw2P4md5zHsrrO0YBlcbjU4OHG0iOEOeCvvH1HJTwU7xZJroRqRDtf5sMze0+76NHW32/1YcvbV6DnMnP3c3BMldcirPYM6BtvMzQzZz5tuff2R92NlW9qHMH/za5y2uc26PazPbyHHYZzfs0c0MhxgcAHCjwA0Om7yXNzxg1mG9oDw5bvuyMdYcg+PeGvMoLes48BZzbB9E+5bc2G/HUNH0xKzHusEzY82+OhbjDH8ofK3C5NJ+pSDTHol/xGQVkIhHXu/3yT9v4HAI4Kv/iEae/PvKv0+QFZAK1BkqZMUUuwrOazHF6aX2SMzK3QjNL6+MI8VzHdeoP47TvIZB46xXvkC5HR0C5B8HzIMA3gjgMIALmwMAL+bbgwDqti37kP2q40ge5In1in3pun3p/Bc4O/3kwccve+QhjM83Lvz/yh9HfPpsfbn+Pfc0/xgge5426H7I/rh1AODBgHkSU1QjuOsBgMLep/QeDCjiFfCm54FBPQwwzbK2lajoB7Nv1XYMeQggZ3Ipv/f8Oy9rZOqdU+z+NAPNwDtlYPRFr3GGRajYYz+Wsmwj2yR+fZ3ZQKqoYJPwqbAOElRAaWeatpsRqFMFdaw7xEaORY7qWI1/b+g4E5e5vHAenQvmBts5Eo0DmXOENBfz/Ii5c04cg+HEkzG5PmyXPtk/+uva8wZG5KkET6w4AODgiviR+De/9cgBaFu2bV9Wa7V+p9bf8Rzbli0niSdccPORfbBfoH1NzLFUO/NhZ13ZxmqsrrP5mO3/1ljfddpLC5BbtK/wUoyBilSFZYpIDwD8Hbn/zR97BeI/fz/Oq+P52j9luRSkKR4zznhRgQkqMsEUmpfYiFLyV3Fq2PFXzHTSkrNqMzc1jjLWWcdSx2VbiY5xNPYsn3xhJ7d5COBc8jaABwH+nIO5Y24TOczhkMBDH9JYB86p7WZf7LPoeEb83WI9P2cdxbnpD7cw07D3XfriQP22vlwfX31/ht33QPdIBTGoWM44bA8KRNPNr/j2ybxiX3E/whTvpiPwFfsjNJ9lbTeRBxn2S+T+wD6LjCXvB+Ap98bVXrjMU5nyY9B5PUa00Qw0Ax+Dgfrlz3DaIzYuSTdvRerNuGoTPj5l/eRuE3HzAN1AUljoDBFTiCqcKnFsHGJuJsaT5uWGlE6VNrJt+nK8Fid76O+BrbQPMR/nX8e+xuAsuZzNZc4Dc0M4sc4XYTZfXqnPtZFtHeeMvqznjdmxv9j1QxqfxOPatA3bta/20TXnxi26ThEfrFU293qZF7SeXLfyZNv2BbxgvI7rMMrz/8rVAXfMrf0U5eYcml90nOB0rKfza3/rHG6Fz7PwRnM8p9h4qra2RCpCTlGHiEQ8IvYQiwh7BKC/HecArv7uH6HoH4/z9/755N+6K46EP3m2hOWWoFd0nsujOFeoi5QfpVXuzoWtj34wHtAxaYNc9jnRtBlalzji1cOAPAhgbrg8CGDOmF/mD6wX6eZhDXAwwJpwbm3Xfoj2Wz7hQ85Y39hPtc6fot4L3FbuC9oj1L+eYuwN7Ef67PTj+vaKuTe497EPukcqikXjZ2g+UJGNCFeYK9TFGm840by+OVAPA4y3TIp+bPZ90P6I2de0HZv3A3IEd3K62vuX+5o6bxcsg87aDDQDb5kBv/yMIe09Y9qTf5anxmcY23Ci8UeBxcaRmwcOTmeXm4bOEOfIa+H+rpp4NxDRuETLZ52248a1cq4P/XoYx9LvNauObR37vkKOcYQHXuRqYy7lOvlP2/kBMx6bsswtohp0jUznbb0x2u9zs3IYC2VjPLZBH+yXfXW9sSbzYiP39X/WKZu8m7uY+bGtC7T+5EL+7E/28W5gS9+X79258Wa6HCUe6hxwIf/2SV7A7PseO8tiWyfoWMHVeOnT6ZjlgHE5jmoT5pPph5h38u9TiIrnrlMBBipQEWiINYVcin9EIuIP0ccTYg8A/L04r4zzu/8U/5TZewCg+Bftg1jFZIrKFMuX2FXcp0BNTrTF5C5t5jDD2pajz4zDvlfc6nvNW8PyA8qZqPhPzIOA0RsBCHsvnvZ7eQgA+paAbwN4EJDt0AfH7PjgQ27k7LnX/2Pa2+HG0velbVHjQC/StNc42B/Sh2Pr1xP1++wR7n3sg+6PI/yWz33u8+Th7wckkpc08NwBgGJ9hFXAk2d0CKDwB00n70jsK/rBFPveE4g5XsbG5b2AXLknrvbC9bw4h43NQDPwgRnASftJ27g9WMsZFqlDOzFt8xC3vmLjwKHlzb4biI4PTDHhH1fjqbCbxxZmWeys17ay/Q0Hux4Do/t4n8rBSjDP5lKek3vtOic1TD7Ks0myMeZcXSAOmSn67mdkH8Z2tx5zHLXvrifXnBu2mK//cxCQm3va5hetz/qTB/vg2HesUcaZY3TcW3gYf35XH7hIPuiD/XEOwex3tRlbjTNsWbghzrpBx3vBPDtmxyIPNSwP5jf8pvEx4uGlyyq8RMUp4gxRWUUjok7xj7hH9PlH4/j9v5d/LA5hiHBU+CMuvRSGtrEHU9hW0augvBQZs2Uc/16UN5H51J6h7dX+1/CoT8aNsJZPrkbcyv8Imec8CPDwpr4lkAcBvCHAYRAHP8x7nXMPBOgLfXUM8JFc+Z0gTvs144bzOufnRunGjZC41d6fvjr3iPTn2vp8/D17g3sgWPdIBX/m0TYty3gI4BP4kdivcYp/BbvhPARQ7IMeAmBb19YBgH0CR6Kf/jMW0LHl/QB8yd1qL8y9erE3lkEnNQPNQDNwGQNuAJY6OP9DyLRE0+cYwuJScYGD5A/D8VMADgN0lDN0k1FwgDjUdKqbYmNxrI6Hked45eW9Yh2rPBxwYy5HNwJyfwkyP+Rnjjfnir6s54s5sf/Y9bMeC3kfxuMNjRsv7ecacr25YYu+/s/6xM6bk2pbBrQ+0HbkyD7Ypx03AVtjTg7Ml7hwUrio82n/Kjf2P8dCXA0Txw0Rh3kcnDhOMce7GvNDv+7naj3fS9+XeMab48uwXJhu+E3iaxYne/qW4ivFaT49RiQi4BB1iD7Efz799w/FiQhBBGEV/9ThhcBUfCIKsVOo1rBpKWwVvYrJinuEPGX25BvlSe722tbDOBTC4lb/7WfNk2H5AJOnnEt5TEyunROQufLAJpF1wKEAawGxX9cD8+/hD3lcB7ZjPx0TnCR/e9bta8lzhdOqfq+Gs0rS1lf44eqrR2H9uvuGewL7gnuhot5w7o35hwMpk+XcWxXbiHlEuQJdVNyD3D8aVvyLo7J5CKCd9VpWoT9C+ymm8M+xOz44ki/4k9f7vQ/+13OS89V2M9AMNAMrBrYcPBkzfWQbl4hdL+uq8UeBpQPToYl1kxiJC053EVi+Yq2z3EIcaV7pVG3TPoD27x5Px+f4GSefGj7Evr9/Hed6XtmI4koe5RaEc1H+92DWgZ31Z7v39ulc5fzY/zozy3gexmEb2V/Xj+ssb1Lc0D2cyt//eyNgHjHLWydoO3Lj+O0TuBr3esw53mrXcdfwCQ+0k+3aF/sG2l/RMeSY0iYfnCD8+a02N2JZn22A2fbJuB/m6m4QS7+37eQjy8gDcXzEQ+iN/PtahMg1/UjRpTBFlCkYUwwiABFyCj6e/vO0l6f9+RfisUkjn0+OFf1g1mm8cSlKq10FrSISTBGcotIx7cFLyyV32PCfWG3z0xfaGvU7x7Gnz9aV5ZIX7Mpb5XUWZk6cn4qsBeY21wOi37dBOAhiDXAwwOVaoB7as4/JufzI2zXr+SXK3NhN6QNHSNzJvZx7hVh9d/p19w33BYW+qNgnPe3cY7Is5dhX2VcU4or7FOnGVbRM4ugQwLry6T9x5KXsaK8nzj1fTLGfNuMg7NgcL3zlfgjHx2u957EMnLMbL4murhloBt4bAyNnkXHaIyRu/4XTKhvHbJNIQaATFHGOCi1es3bTqKgTFS0v2kZuTNmfo4O136djZS3IC/Z7/TjGxGXe4Seu5BA7+dWW+3No/sSsP9u9I3/p0zIv9jnnxrh1/ocxWL9t2kfXjeuJ9ZYXT7H5w2N5OOUNwegmIMu6dqnbdkDbti/27cpxJwfaaw7kcDKf9sN+gdlfbPlJNB4eEP7wxMVhnnVYp22IjllcjT36OZj/8dgc44EB88hHImlv5vMSouNWbaboUkwizhSFCnOEm09882mv4p+DAAUgcXkAgFhUQFpfYk2z7cQqYhWQYIpfx7BXPO/JB0c1X/KWNvNiOG3jQPuY/dau7VwStg4w+cGWPzjVBg2Lxsl9zhM2c+WbAHkAwNsgrAF+ApJ/B4K1QBoHALw1QHnbcu4cY3KEfas1/tT13MhRzXyefnKN6X8ntn4bxKfr790T2CcU+aJxdW/JcO4v7J+Ka/YYhXwKfeLYbzItw7lXZx4EPofUiv8R5gGA/ZhhFfyOI+8BjHO8uTfK53EfXPYz5+ZGS6GraQaagY/EQHX+hhN1MpfhZHPAienQ3CC88dfp6QRBHCOI2OIpK2LLPxA3E1Q6UzHrsw3bBO3P0cHa97WjZV3IS7Xf65pxvKdzL0dlPuucegMgyv8Ic060nRtxNUfr+bGPOTf23/kxfMj7MAbrtk365ppxDYGuNzZ67Hz939//500Fdr0psA7Qum0LlBf7Yt8uHLfjrej4K0erpzu2aR9A+5V9xWYMouMBGbtP/D0g4Tuc5a0TzLZsP3E1/od5W8WN18Jhnk/THL98iJWvVx1+aoHxVPWn4FKEKRYRaYo/RR9Pe3mt31f/EXdeCH4OADwIUPQhEhWM1GOdFUkzXfGpUEzBil3FbQpfx3ErVLDX+pI7xapxzNfINo66ap8J1zYIW6biKG+ttx4EVB7PhXMenC/XQv4EgDXB/PPmx9/42a9+xgGj/w0kcbkWKO+8bh0AyOFTrf1b1vtEzil94dh/jvxvidN369fx8en7z9m5N2RZ9xj3UfZX9poU8B4CGDfCujfP6qCuehhAnAcJWQ9Cn/4k2k8wn/Q7DtBDkMqJ+6Jc7tjvnmhJdLXNQDPwHhiozt0x6egJa1+OuQlQT4YfbJ2Z6AYxExnpKBEUiAmfJJKWDhY782uPHKvOlXbtC7jq85wLeXtv6PoQ5+uhzG1yiJ3zWu26uZuec2Jc1ruaG9o/nR/7C+bH8azX9MMYbIM27ZtrxjWU60xR71sprEl//88NgZf5ErMe6wZtz/Y3xz8ed473nH3KR+Ei59A+gfYTzP5rM/YU/nADT3CQZbWt2/GKzknFkzXw0O+T+FOO1nN/SIcn47XPcfdq0m8pJp67LoWl4hFRhkBD8CnKfd179Oq/T/s9AOAQgAvRhzDkAACxeO4tgGwvhWeK1Cr8FZCK6ZkoJt5xVjStliWfcVnG/Bmnzdxhz9B81DET/KM2LTdDy4jyIY54k1fTDCfmPLgmPAhgPj0EYF0w36wFnv4j/j0AyJ8CcIBEOeqgvpw/+55jfO7vwrXt3dgRuSfoBw3rH7ex+GH9tv5cP6/fr2j6FlrGvYa9lH2FPSdFvuI846pNmdyXaz0eIlQc/R0B68m9Xdun//YZVPCDjqmiPMiffB73uWXfcl5cDs6b4cZmoBloBo4MVAeRDkR7jsXRHx2S8Tgm7UAcGPE6MlEHB+r00hmm48Rp8xviFBU62opZDjvrxLYt27c/9pO+3l9rRwuJ8lfxSPA7Mer41mtCfh4w+dOW20R4zzD2KI546xHv5yPbXc+N/RvNUY1brVHqt0+uC9eL66iuL24yOIhiLfLhxsCbCNZpXt4ggFmPdef6JJ2wnDh28Dj+8+OeLcGcU/k64GAeZ5zAjX12DIyNv5bs9/PAymef+ZMd+awo347XNsUcf9pHLnI9zOwxXzl+10fyY9yMyxePv1Y4vGS5FFrYCDAEI6JMsZcizz/8h9DP3/1jE2c84h/bp76IQ4RffRPAp/0KykSfEtMPBalCNVGBKyoixdEYjSOPdqLxImnaYuZnDgnPMPNqUw99Butlnkux1iMnYvK2Zct3IvOQF3PFHLE+mNc8AOAnAPgeDgL++k//9P2hgIdBrCEODTwAoA36klzkuF/y+3FJ20/kgPSB6f/SV87t8L/6av14+vmZTd7RPpD53XvYd9gr3VvZb0ciP/dh04mre/FWPez19SDAQ4Zal/uh6H5OWOGPXffBDDNewo5bDnfcA+TcPdHy6GqbgWbgrTAwcwjGJ2KPr3Dsn2CTr8btDLsxiDo3nb/OLx2izhTM16550piCqtpZrjpdnStoH+zTytE63lNu3soaeGw/52sk5jy505bXESbvo3TirEf8JNq7t8dzYn8dt+H12n6oy7rtQ66/XD+uLW8cch3yxyl5vT1vNrS9sRCtB8z6KY9Ypl7Wvv1JHo7j3zduxz/CNSfBq3yA9sHvSn4nsek/40L4c+Ot6BcZS44Ru9Zh3aJtivYj+1XtIy8xjmHcKW+5JuBJXkacvbq4S8TCa8ur4FKUIsgQewg8n/Ai3Hz1H8HPa9082fXpv0/9RQQfF38rgHIIRA8CZm8DKDDzIIA4hehItCpuU0AqhHNc2ueQsuQRz+XPdOeVuGobZ377KBJ/TZvWJ1qfmPxUu/Ipz+eQOZkdALA2WBccAvjTEN8Gcf45MPCAZ3QAkDzI42vHGzmkkc8zTv9IU+fsQ/qDD9ZH68dF/bxo/Dk0v/sHe4l7KXsQ+60CH3T/nSFlcg/Gdo+udWW9HARkmLzWZX0K/Yqj/c/xgI4xMXmB09W+tsxJnRvn60ZLpKtpBpqBt8wADoKPqK3jGKM31JTTvgJ1XG4KiengdHzpFLFTROBsEVwpMtwIZpjl0wnbHmg/sm+rMa+dbfKnDb6nj2slcb1OylpI7rTl9VK0vLiaC9pdz4f9gv/sL2E+GXfI+9B366d/rgfXn+sm15U3Cfn6P/bsRsMbBMvVmwXCCGheXeVAizZzPdIv+3jkYD72w2jn/57yQF0PXIC25XzJCSgvIJwg8EfCn7HwRoT8Vcx6sLMN261ov/Zgjmdoj/mr3NR1M2f1hVJeu0AZ9U/RKCK8EIkeAPh0F/HvE94U/wg9wop+0af/eQDAIYAHAdTnzwIQggp+DwDEfEqsUKRvVcgaVvSKjCvFpOO8JcIr9SXKdY3Pdu3juf5lvVlf1lXtrBtbfmaYBwHyPDsEyLnxgMj/BYD5Ze5ZF4p+1wAHQT799wCI+bU9+pb9dkxy+drxCdyOPnBUtWlgtY077iX66erHt8KWScz87hPsGe4p7EPsoe6/Vfznvmueugdv1ZVif2S7v3uPQF11f9sKO6YR5tix5WW1p433stH8dVwz0Aw0A/fOOx04lCwOXPtODKwczQ3CODDq1JGB6eTSCabT1EGLiAsPAHjtj9exdMAjpBzxls+6bTP7Yf9W45eXBeXtvS0p14bjMrxrjchdYnJ7zs5yaa/m4m4N3XWu9of+2ldsPuZJe3qT4lpwfbhe6pqqr/8j3L25qOjNSd6IWB9P/T1I4Ok/7dmH5EkeVhwsY3PMFe8JiH9qutyc8EF7tm9/QHihjwj/PITzuwhyIAA/cldRbhOzDWzaFu1HonzsxRVvrB2vNYfy4VoJ6o6mHB4jXtJ47QJlq3+ILcUXQiwPABT/CDhEnU93ecLLWwA85eUQwIMABKAHAJTx8gBArE+DFfsKTFGRqFCcHQDYf1EB+VyY/NJmhrGNsz/0U/sc1vI1PCsvF4mjQwAPAOQ4ETuvnBcOADjI4fIQgLlnnTC/rh3mHNsDAH9W4tzmnNpXx1R5fK3hJ/Y9+joxm6u+0vAB7/xr9c3pv7Fr+rkwZdwn3IfYW9hL3Vtz7zUO/JbPfe4OPv9deeUf5PNJ/VZ91O3hggcBtke9s/vL3OfSdiwVK0+Gk5/j/sU+tt7DmCPnQhvsTzPQDHxABnAGfBKrrcM4oDfHE8QR4YCqQ8p40ytmmbR1cukM01lWEYGzRXQpPBAjOGOFlQ7ZsFjrsY1s177YP8ZwvBbnKmeV23uy38k/rpM6Rsc+XC/yNkP5HeGszJF/5+J0HuyTfTUMnsY91GN79oV14JoAXS+uH9cVT+xdeyCC2JuBEeaNh3UhkhXRHAIQb9uuR/tlP1c8jDl4GO4K5CAjF37k9A5tB7Rt+yI3dezJg99DedtCxypmO9r2YQ9m32f2ij/HPedRjlw/yd+rsF+rMNnqlyILVHjlAQDCDtGGiEfYIfgR/vyum4MAxH8eAiD8RuKf8gr/RA8B6m/CU3BiIzrBFIoKWfud6HhyfNWGF+PSNm4PWk6OKaOdacZnnfQ3w2ln2Zk9qjPr0E5eqi2HHgCIlX/DVfz7JB9BzwEAc8saUOiTzhpinj0kII6DA8qAo7m1n44xOX2t9o2d0GifyCZMF0nTBg+XfrXsJzOfXOPTR2eae4B7g/uz+6l7LPsvtn+Jv6aTZhz7k/uP9RFHetaXe7qHAMRhm48y7nfWaV/PoWMbIRwQn1xgH3mS9zXm3GD3pxloBj4IAzrlOlzjF2edTiMc99G5RFx1QDqhUbxx1pNhbbE6PZ2lTjQds84ZZ8vT03z92P+GTYecjl6Hn066On/btT/2D3Qc95icHewZzzX+rYZz3TCG9fqJNSJPyZ32aBMzTZzlsd4j1j4s8zDq67rPD/3NNmnX+XfduZnn2sFm41e4I379HynyJiFt1iFh1yV1pPhXNNsuaF/qWjyOnzGsOXCMIySOz3reDD/wQd2Vk+SFPsFJjj3FP4cYjDF5067odzrHnON2/IlysRcdywgZ68klHwvK2T15r/Gf1ypMZv1SXKVQVPwj+Hg6i2hD1PEaN2If4c9/8QYi/L1IS/Hva9+iBwAIQS9EojbtpBhUcCYiFBWoCleFYkXHNEL4MD5t4y5By884znjqNf+eNsybdaSd9Zl3q97KEWF5lFcxedceiX/mTDHPXDLfzqVpoH8AkjQPACw3OgCgX/TPMea4X6v9hD7JfXSrCfOc7ivFv458sHEnfnijbO5H7iHsLeyp7q+i+7Z/hZ+whwI+/c/9h73GOi1rXYl1bzfNMvSn7mXZ7z17mtzMcMXZsl/VeWDunKOteey0ZqAZeKcM6AASq6M4vgK8ciwPjnjmhEbxlCdeHOUZxeVNvQ4ynXMKCB0tyJPXFCGEdciJWQY768t2bNv+ZF8Z0/01drgsHzl+L0spx3O6ZpIHuQlM7rThFXuG5ku85zzqvQ9n22vbebDvp/1+qMs2nGvn3vXgGnHtsJ6w+fkJv3F33SGIZ38A0JuFXIsp/j08sE3Rvtg3+7riYj3uHG9dfzVtzUnhg7Zs136IcOJPFhw/6F/6J93vV0X5FBkrtmNOtL0tpI+k29ctlL/EFZcPHDx8h9f8HHh2XSVWnp89/FqFyVa/UjAqCBGBiDKe0CLSEXW83s+Tfw55OQDA5g0An/4j/qvY99X/RAU/gpC680IcKgYRnYpRUSGqaFUkVmGbY0obHgyPbONE84oZr52Ife6yropZD2mzemqa4VrfLFy5kks5BuU5sYp/1gYHRFwIeeaOeQaJMz9ImPykgb410AcAN3FR7idWZvjgN/WlN0T9tj4ev+9+4Z6juHe/Vvibbrz7kntP7jG1TvK6d+fPCNI2fVSv/d2Due863ooX7FnMTc5Lhp23xmagGXiHDIy++AfnfCoapuK/Op9rwjgsylXMuqpz1CHrjEGctVc6cpxvChIElf8dm445MctanxuB7dm+/bKvK+c74vH9LCTXjyMynLheT3fzvOLnISx3j8GTesfcr/tz6HmNO651++McO+eugVwbuWZYS/nTE8WvQn+Euf7yN/+U5cDKtmwbtD/2z/5eyAUsJAc1fOSDem0DtF37Ado/xD599wMf3vzM0DFWpE7irHuE2Yc9Nn0nn2NIzDFqrzhd8yV38ga+qs9MtL3W+BSJCkMFIKJNUccr/Yh9hD9/44Wn/3kAwOEAeXy1H5GvjSjMg4E8AKB+DgA8DAARhSPxr0A1TeFqvxNzXNUeCW3y1Pi9cdfM7axPtc2tus1b+22Z2gZhODJevuRRfp1/xb9CnvWgkK/in3ljvhH25Les6CGABwCihwHUS57sg4c7OU7H9lrxhZ0R/pGPfnLBu/1k5Vf3hDfq0Vfry3M/ck/Jfdp9yDTRPIbZb3KvsF7TzZ/oQUPu63nYQFnrzbrt+wgd3xbCJ+lDXkfcHeam/20GmoEPwoAOuQ7X+MVB4zDuHMro2nJCOC/SK26V2ZOWThGnqSNWEOiQwXTG2LMnsumg087yWa9t2b59yv4f+Tp1uHCePNc5eC/hHOOj11NymzY8Ez7yfRc+2qfcr/sxS486bMs5ds5dA66LXCvYCPz6Cvy53/9ThvUHpnjOp+a0Z9ug/bF/9veEk9Ox1nW4a76yftsE7Uf2jTcYEP+8BZEHGPDj93ML5Vakbuxs45xtv85hjkU7x6p9XFuskVNOK4eVY8Iv8nmtwmTUL4VVCkJEFyIMMYY48+k/r/cj+BH/9em/4h+hjwhU4HsIkE//sU2nboQgFwLSCxFZRT59sm8KVIWrQpZxpMB1XCIcVNu4EV4SR96ti3ZNtw9itlNty+xB2xjVa5woZ6A8pviWY9aB4t2n9aCHAdjMI3NKnPOWdeUhgMKfOfYtANADgFo+53MPBy+d50WczrpRfSOxp/tw7LkrHzv3s+s6Hsrrp8G6L7mPuFcb9g/7icaL7DHuH+4N1u3+Q17qVeCLxrGv2y5IfstSt/Vm//faJ3w9cLGKh3PiT7nP+dAG+eScHWL632agGXg3DPgFXzvTdBIDZ7LlmHBkOl+dmmj8VvlzadYF6pRBnalOW4ecThcnnMIKcUJY4UV6vbJ81m179sF+2f8T55ucvpvlcxxIriMi5+uJtMGaMg7+sOXxHFpuiNv9GPfzrm3rsm3n1rl27kHXhOvEjT7/9wlFMHGstdnl2ss/noew4W0A2wGzfftkH+0z6DiOuM3HeM6CD+rJ+m3TPoDZN/rKmLP/3vzIl0jetHO8act5tnONnX2utuMSc8xHLuVlzKlfDL8Xhl1zGX4W+6UFyKXtpyBUYCPCEGQIcgQ7r/bz9J9X/7k4CODy1X+e/Cv+EYMKQg8AOBTIQwAPCcyr8Bc5ePBpsOK0ogKTeMWsY6kIJxknR8RpV8w07YpZxrSM27LJb5mKW+VGaZYnTRustnGivHkIIKeKf9ZBin+EuuLfwwDmmHl0vrKOtK3LJ/55AMChAPVRB/m8KN8HALvcVvV/4z2m+lB8a43bE37wyfpr/XfuS7mXpO0eQpwHASJp1GF91K9t3dbl/kZY233NQwHz2mat2/7vwZP9yH2p4jZ/TGadK+L60ww0A++Qgfyy65QZpvYBqxO5C4+cEs4wnaLOcQvNP6rvXFzWi/PUCeNQda46YJ2v4oqnkogqRJkfBFeKMvOK1qFDp26d92hzsP+fyF/ldXG2OQ/vbZk5tsTDumL8cnMG4ZK855A8x8v6x7wvfajpWced7Ty63mZrLdcHNuumHjTt/f0/gjnXp0/Ot9Ze3kDQV/t95CPHVce8Fc5ywQf1ywlYefG7kd9Fv48zlMNReq2nhv3e2+6laP8Tc3zJqevwyO0Wf4dvdK7/+h2vaefClDdPrWszPBJorzFOESimCESIIdQQd4h7hD5P/etv//2jf77erxhEECLmDSv4PQQgbJx5Ff+IQcShgrIK/wwjEPMAIMWi40p0HojTBmv4FmlZR7Vtr2LNd23YeimPbVhbhC/nHR4V7Ip15oCDIMS5T+kzzPwyX+R3LnJ+ap3koy7nOJH1lm8BWGfO6bV8PGe5Tedwu8Qt35Rp2uDtrof9yv1PH65fd59w/0Dgz/YK85BOeeuybvfAWreHBpRP2/oy3rZH9R/3lxiTcSd70EOe+3T4JJy4zTGzn/ORYez+NAPNwDtiwC87Q9I+dcLpVO7sdHzV1jleijrRWt9WuLaRDliHqrNVVCjKFPT5hJVDAF9RzkMAbPODWZf12559sG/2/94Ry+PaCSf372hprdZTjvF0fcGH3BSEP9JE7KuuNefjPpintOEcOqfOsXMOug5ybWDzxJu/MeEBE8jfn6jraxTOv1OBnWvP9rIP9st+gvZ9yp9j3sIJH9ad7dmH7Jd9TYQbwpWvUbz5ErMu7JyDWZp5sm9btmMBc4ybvJ7ymGs/v9/pbzN+lN+8mW8Ul+lT+znFxmPbSiGoWEN4IcQQZwj20R/+y6f/I/Gfot5DAJBL8Z8HAJmfdn0arKhUqCYqNMmT8Y5phPBFfGLl0PQab/hcuvnO4aieUdy5ejI9y2snYuclb8kl88+V4l9xrvhnjphLwh4aWMcIzePa4rCHAwXmnboMUx8XbecBUPY5x/sa7aljeP4EfRh46UVvs7zhQz0Pe5Z7FKgPx5/r990rDIOZnvGmVf9vG8RT1vK5L1HWtuphQLZBWftJvVfd6+R+vZ9X+QP70wx8GAZGToTBn4t/TwQdnObIWaQzubN1dok6rBmmU5vlMZ56sbP+kW0ey4HpfHWqOt0UGinmEWj199k8deXtgCrKspz1Wb/OPjcJ+0j/V478lOdcS667jHtL9qz/rjHGon2KZb2teIs0ORVn+e7botxWm6ZF/daXa8+1VtdZrgHXhWKdp/Yp/rH5A3h1bWWYsvmzAQ4QWKfWDWabrnX7ld+37L9jGqIcJA74oGzWKSez7x99y76mneM5Z1POcYtZ17W2/ZPDiiNO83t9sv6Sv8W+W36rNU+YT35X8rtgmnEZ1gb51DoOsRv/vkZRUvuUggobIYhwQ6ghvBB8CPT8w388/c8//MfTf1/9V9znU/wU9aQT5tK2jPGURQwiDD0AoE+K1BkqOE2vYyPM+MXKxUuHn6Jf1pmInZd8yR9zX8U/64C5UJhjO18p0EfzZL3g6ACAuaYu5h0kTP22R/30x7rt+0vP17n2N1zDcyVVn2V45O+ME+mj+dM2fcGH/cv9yr0Kn179POH09dqZz7j0/7kfZv3kzbJ77Fn9tLH7ghvyHzhauNgXlk/5FY0H+9MMvCkGXMQzvHYw1ndt+ZcqZ79HSNxyFcejI03U6VXEmRE3w5qfMPVWzLZGdtajA01nqzBIgZFCHuFV3wJApPHEFdGVwgzbslmfbdiu/bBv9vvoxJPjxWY9OCcvtTZu3a7jSaw24eVy8ypr78jdNfHWb92GReskrH2HzhvoXDq3zjXo/OeaYJ0Qrq//s7bO/f6fdZZP/1mfWTe2bYLZF/tnf3MM2Dm+S+1aV/JCe7ad/Ul+7LNjIax9CVou0bofi7XvhB0XKK9g8nHCpWtrQb5bde0bl/HGXYKZF3vzc04gvJZ0BRVCUJHmE1rEGE/28+l/in9+EkBaffrvAYBinnqMw65h8yH6uRSciEAEoOJPsTpC+55pjm2E8E/8S8/Dc/XBdioX8iV/HgDAO4I/n/oTZk44tGGeWCfkp+zWHJleDwBcBx4GeRDg/HvgMDoAcDwvPX+z9jedw/Mm6vdoVRtMe5aW8Wlb/riX66f13enPq3/PtJFtHdRZfX7uh5a1/tG+UuMss9XGPTeflgMB+CLuwNsy/u1w5SzD2P1pBt40AzoRBpF2hvd+WTJfLT8KE/cWPjmutV2cjE40UUcl4sCwdWTn0HIjzHZGNmWIz7K2l45VQaDAUMCDivvRWwAINcTbYw4B7Jv9v3fS8ro4Z9YJ3H+Uj+uM8WqPUa4eg7RxRXnn7Nwac32BrjHQ9TV6u2S0plyLlOOAgJ+isAYpT1rWjZ3t5nr3O+Da83uS43ksH9aVbdgumP3Bzr6mXcd0bTi5107MNi+xcxw5vhy3XIArXudr23VfMb8DpmUctvEjPKQe/jVvxh3tmTB4LfEpBFMEIrYQf4iw+vTfv/qfr/7n038FnIJeVPSDKfJT7NNeCj/6wKXAtI8gfc+wtiLWcI5RwSi+lnl4qn44zhESxyVPKdCdf8W+IhxkfhDrHAI4L1vCf1Q/5WyD+fcNEH8K4uGC64F2+wDg6FYuMap/MnwOt9rIstjHfT99tL47/bm2aaLxovEnvv7h/sJ2zGe5Ee7dW3buKYfxzvecc+nwmvyNwsT1pxl4lQzMFi+dzTS/CDX+0rB1Um70OZc+KvPUcdmnyoPhAz44NJ2Pjk3UwVUcObpzcbUOw7SFbZszND9oW+lcveFXXIwOABBYo7cAEGDEK87ErMN6bce27UuOQT7vceysWQM5T0+9Jp6q/hyD9haSNr9Yj6SD116WrzioL9fapeuL9cD6APkZCa/vI+I5TAJH68l1BVKWnwiw9vjwEwLXmOhaE11zYK47+57j0YZHbPDcZZmK1g/aLpj9sY+iY7gFUmfWk+G0M0/a9mmEjIH4HEuO0bEnJyc8bq3p26Tx/a3fK+I2P08l7G5ZbwpBxTNiC4GHeOfJvv/tn6/+878A8OTfp/95AKDgB7UV/KLCjja8EHkKfpF+cCk0FZP2OdE0UDFrXObThkPsW3L5mutyrI4flB/5SmGu6HcuCDN/HPDMDmWsb4TZhu1QpwcKiH7/9wgOAjwoIp01UtvMcbxW3jedw/Mm6rtqq8aLpGvP0DykH67Y2/TT+u3cszJuZOv3TaOuo68vbZFmPstdgpa1v8d2GIttXYfys4Wk9acZeDMM6AxGHdYRkDayjbsGs07LGwe+5g/99WPfFwynifPREYk6qMRLHNwsb9anbZsjJA/x5gWtO2/avbn3xj/FewovxFp9WosAO/dHAa0XTMFgX+yfY4DT+2tZk86H6Ny8R8wxuuYYp/ZlCJeU3YPk2XE5T6Lz53yO1hbznuvAAwDE++ynJLn20s63UWZP/11rru3sk/0E7TvoeCrOOCEfaTW/4aw728TO/mDbz0THkLw9l13ny3azf2nneBxrjl9OTri8dl3vK+f3ZgtJO/m8VmFCv1JAKdgUZogtxB5CzP/2jyf/Pv2fif/69F/BX1FRh7BLoZmCn75wKRztY/Zb27REyho2n+j4X/P83LJvjNsxywEoP3Ccc6/gVvyDHuZg1zmxnlHdplkm2/EAgHXDWuOwCeQggDjfGmG9kNf1QJ22dUuebl3XiUN4nojc+2uLpomZPorL9LTNCx6uuz2s7mPpuy+1V77eNsAL23F/dj8xbH9W7VB3tnWZDT/yoZ2IzSe5y/B9Yv/TDLwUA7OFmfEu8ET6m+GnsG1jC0l7LR844CMXaR+d2MiZ4ZB0TmI6r2pz00zcDDN/1qct2q4OMcPmEa3TG/a8ifcm3wOAKroQXqM/2MYhAE+YRr/bti7rtj3bpz/2zf7L7T0u85Dz4pyAb/3juBjHyDYuEfuyiw3ykZfzk+jcua5A5xZ0vp1/0XXBk3wOlgjnepvZ5POtAdadv/0n3rpB2xWzT9lX+w/muB5jZ53a2Wb2JTmyrzmOLdsxV9wqc6s0+yrWMTlex598nqzDS9fydfnr94swH79Xh9DDv7cWFLeuTxGFoFIEIvAQgAi+0dN/xT9vBfjbf0Qbgs0DAJ/epvBHxHlRfxX/tOvTfoWeolERqWi13yM0L0g9hmveW3P52utj/PRRHuTFeYcr5gChDealEHdeLAtaH2g40bzOJXUwz7bFmmCtIfpZb168EUA8F+uIflGOeqzftl8r9ytn8HKBoW966M5W2qjH5k/EXt3Tpp/WdydmunamYxN/9PHVV8c9yKx8rW8UtuxmW4tvr2OGn8PYD0xV+xC7pGV4ZFv/KK3jmoEXYcBFuYUu/PMYX9zjl5u45Yt0vo4DDfbnRUjZaDT7pb0eU+EgndDISXkTXLHeLI/CtYzhUTvG0R/srX5Zj216Aw8qDhAUXCnCEP9cs7cAEGM8ySU9y1mXddue7duf7PeZ9cUUOj9b9sZUv+qkHFt21LWYYzZuP/qdTSzresX/XVqup7Rdd6Dz6LyCznWuLdaBa4L1dO51/1xL2JRljfn7f2zXVmK2jZ39sq9gjiHHNrLhhXhxlMe4rDf5oc3sS+Up+53jqTY8GDeyiTP+sWg7Ys5n9jd5lmN5kBf5g8Pjddkesn+tL/XW70yG8zt2tF+rMFE4KdoQVAgrBBZCC8F17um/f/n/FuKfdrkQh14KRgVkFX05Bm3zWKbWYT7xtc7PLfvFWKnPMYPJj3wjyJ0HkTgEOCKdfIpvy2ed1TYP6DzYFvWPDgD4KYmX68oDAN9KyH5km7fk7FZ1HR3B6zDweX7S3oozbYSnPjT8sb4a340tGl9RH5/57n374n/X7Q3asp2sa2bX9jf2EcYuX/bBuIw3Tqxpxidi96cZeHYG6uIchWdxxG9f8eU8frEyjvIZHtnjNiBq1C8JNM3wS6H9WPNUxlmdUHVW3gCL9aZ/Fk6BYNmKtEVcbfNcOOux/byB9wZf8ZDiywMARRuCf/SpfxTQuhQhtLFHKBzX2Pm1xDpxzlwzNWz8W0LHINJ37cRqE96+ylo+ch3xdX3XcK4115VrChytq7q+eGOEi7WRa21mu5ZYg/zdAA4BsK03MdvP9WYf7XOOA5txinXM58K1LsO2Bdq+WPtJOMdR7fweactLDVN2lpbxW7Z11H4Qtq+OwTGJjlsekr+TNXduzZIe63No76ljpwe4lZB4inoUTwo0hBWirD795y/+8+o/mE//+WmAr2znk//69L8+9ffJP2153UL8Ox6wik/DmQcbXsWn4Pi11FnH7ZwjzBX7FZkb5pL5Ym3IIVjrI5zxmRd7dgBA3awP2kHwI/5ZVyBri7cA/CkA+ejT6ADgtfBc+7HTTbx0Nvf+vf0wf+LhXiF8a/rpka3vHaURZ/pdpw51j/CC9kb7h20f26K+dTtwkuPcEyaPH8sSTtv0xmbgxRnIhYltWPs8xhdx9WW6Rfz6CznqCwTa55ck0z4kLv0tXOh8QJ2T6E1vojfE12LWpW17ifZHzDRsy4L2xZv3vMFXEKQQywOArbcAOBSo/4e79dmGbdoH+mNf5Xa1FtfrKNeMc+Tacf5qnlHYMq8Js/+1XzUtxz6yjTvFsp5XXN+lOQcjdJ7E0ZpiXp1j0HkHXQsgPydhXWHnWtuyzcsa47CJsPVmO9k+tmtNzH47lsTR2GdxlCMty2tnO9i2n1j7yjgqbzm2HC/jTw4MPyXWvtT+OzbHLhfJX11z9+H193y9bu/W5TGP9gzn9egHqFs78RB7928VBK8hnOItxRkCsD795y/9K/79w388+ffpP69t56vaviruq/8z8Z+vme8R/ykus/9bdorQFLC1zGuYk6fqg2Olfu2cc3gZXcyJ4j+f+lvHFjpX8j8S/9SPmHe90RbrCOHPz0o8BOBQwEOAt/gzgKMjeH9G+r6xj73zq+mrte/9b/G5piUe88398KHdHXVlvdU+tmM96/aYOce6ZxbNK26V2ZNnq3ynNQO7GMiFpj3CjMMehY0//yTFL9Qd1i/dKHzyRYzyD31Z2l6+pBBgP6tN+CU+9mfd3xhPHb83t6A3vKI3wrdA6xSzTuKyHyPbcmCW9eY9b+oVDwqxFP/avLo9egPAuHy12/pswzbtR/Zffldralkz63k5rBDjXC/OoWGwxtVw5n1tdu3rLEy8adqnGGt5xfFdvNyP8Jo1NRKxrgXWEQcAhF1nMzSPZQ2T3zjXlugaA11nifl9GI2NOHiomNxk2qyObKd+9+hP9lO+RMciMlbsxGrLx1Nhtm+/wBzHiGf5Sf7q+rsP1+/63boc5jsXX+tZwny//Z5Mv+tPJeweW68CTjGICESQ5dN/nvZ7AAAq/EFEGmJtdACAUFP4g9TpheCr4j8PABSLKToVlPY5MYVtxmsrQsHRIYDlH8vnay4vF6B8wO9I+LsOEOTMU85D1nPOth3QObW9FP+sC9YLr/nnAYCHAK4v0jyQcL3Yt+zLa5uHqWN4Hwn6v4vuD7b8sH79mGfxt7YBc9oLDvw4dVFP1qlt2rGdLH9av23uQfLkhz72pxl4EQbq4qthO2U8WG3jDphflA07v2jX2MMvJu2dfjlrfx3Tc2P2g7anvFU+vKkFz93oe1PMjbI3/ltoflFRYHnbyz5s2eavIsQb97yZVzykIFP48/Qfm1e3R/8jgAcA+T8DWB9oO46D8dk3+p8cH9dSnZMl7HyJOZc5j6Ynpp3lMh77KT+2e2kblhMprw1W27jp4V/yru18jNaVc1bX0/+fvf+BlbfJ6vvAF9u7Zl/PO3qNdwZpTTQGgSaQASMSQEjYTPAYskOsNZPF/ItmGCOwMevYwRgYr8EQM2KWAGIxg4lt1oZgg3fxhD+x8QoLWcAYR0oIJEELa8cDcSLFJJaVSLCSGd67/em+n+7vc7rq6af79r23+95qqX7n1L9Tp07VU/d8z1PdP/f03L5iH5xy/T8Bf2tPubcqIM295vOU+rfml2XaAzpnE/sgGz7H6Nmp2gtdcx4t3rlTJ38s1Zb5jPf4nuyqm2ue9tYG2iZtuX2++fswl9jPc/W1zvab52C393f5+ryQn3wuDZAkWBKcAcwAVb6N5a0rAIw3/lz7J8EL/AVnef0fcEbqvfkX+J8C/tEz9W7x2LlVTplgVCDakndp63QOfZh7tYtrri2Sug98094C2D0bW66tpcqv4N+3/zUAAOBnf7nXCDKxH0n+FkHvawDO9xy2O5eMyWFwORn/rt9FI2Uk3Z2R9Sw9Nb87ax0HneV341F26hj2m46VYyy106E+1i+VN9oNC2w3O6bIDSR/iM71o2/2N79PfUhmaDpl5+JfaI23/6DmHOp8yd/3x/EZZ9Z21S46tNXRF2BUqlOcTnLlW310yu2vQ12peqReltW2OY46pDOvw+/Ygn8oAQBT/l/sAv+kv/Ir/+zXaas8qOM4Lrqon7pr68keaq3PtMw1TJq862tZrr1l0PzYZinNvg/Jt/SjbJpaz+SqTHtX6nokda2krb3k2rrW0twH7B32E2Xusxa1Pvsmr+ykjp809cw95zxyjkt57NVrq9ykVQfyqSM885DmnOCdd/KW9Sg27T2/PsdJbdtbizpO6phzca7OXzvVPTZ5xtmf7Nmk8DMJeXP1e8/AquC2bMN1/j0XkDinnARrADTAWevtv9/99+0/wEzw73e0AWZ+R7sGAHzrDzUAwDgkAg6+yWV8gaJUAAlV30qxiaDPOsvMQ1MWPGO05J7Txpciq2cH7ZyU9fB79i37pKwe37I1YxhcYO3ZC+wJb4mwbwD37CP2E9f/vW0CT1DAfWZwwj2Terr2l2J79OgcC49R7N/2c42tT4A8+Sntnbd5NsvPtd3Jdyzp/niH5PXGoXw3Tsp1rBbNMvjxGRa4FwuwIfNT81nX47OPfFL4dpp7aFZ11RmreZw2ynTeerT2y/wLVYeerr3ZP0x5256he84p7aCDC9XpleIQt5z8Wl7b4GTjlPsDacqT5pjJV73IZ33VMR32dOR18gUBggKpgAH9APkJ+ivv/9OuTMdx7JyT+mvryd7p75v23t9vz07KdTZv/5q3LeVLP/bpUeRYt1RmbVf7Z14+KfwmxX7Wttq6Utci6dxeqnvYdZa6/u5tvr/v/pqjtKc++8sjG94xoOwrqXsM6j6T1rmQz7mewiujJdtxpeqUOsrnfCrvfLVBi2IvnlWeU75mga15DvmvOnle/QFFbumQyFNOGxLt+QoPzzcykOUatcZLHZ2D84RqD22ae819uJTSl7ZVhuV7ctz7U8ozlc9IfcYu6jcAErQJ1ABnAD+AGeCKq9aALq/+8/1/3v4L/P1uttf/BWYAOICcoC6v/h8C/4I5wai6JbhL3RPoUV7z2Tb5lMtYWZcy4K895dzgc+4tfin4105VfmsMgT/ra+Anwb+3RWoAgL1FAICvoEC5aeJXAWiLDINHjJH75NLWbe9AeJoFeQbu/ATOxtUZu03Ts7Pfzj777av1+uPaF1nyUGUnzfopz3iOAT8+z9QCuQnkj6WYzj493vpKNbvl2d+yQ9Q+rXZZBr9L+aAUPp2nyuOkUaazdiyt8si/UMaf6Lmzbc6FOd/nJ8eq/MaGoXPOKe2hYwtNh1deZ3gpxbnGYeftKI43/ZQldawc+xheOdDUSyc+HXydfoG/oMIAAPTQLQACArRRruM4tvowB22rvRfsm81a5b4/nmefKUdeavlSSr9jPsitn1ZZbUM+26mf5eZ3NPazdtXOSV2DSusec92krqfUdZa6/lDApT/g5x5LShvySeFbSflJ1UGqjpXWOTHn3IfVBnP5KivzdVzz6pc055E8cyffsoFl2Ixn1DOE/5azJkG+AQGDATVwR57gAIEBZBgQMBjgmOqVujof56kttF/uN/fiUpp9K9+VsXu+d8/D9PnZe74uDZAI3ABNAjTAFG9kAVcALUBXvv0HiNUAQIIywD8JQGcAwLf/gn8oIJCxBG8Aw2PBv/pDBaNJk8+28gl+axBAmZe2Zsfq4zycc9Kcv7zrD6Us2x/DK899JfB3D7An3CNQ9pvgP28AsLfYg/7oJEGn/LoJctxDNQCAvsfa6z7b7x0I11/A2cenReu5eFz+5VuwLp2et5tRd+Nm/rhxkNEeoyUn5+qYrTL6js8Ts0AuavK9afbaZHmP78mk3D6VtupaZfQz1XrLp5QHpJOqw2QexwxeB+0cVNnSPZ1281L/Oj/yD/VRhw0N+6l/tY9OLVRHF4rzK9URPkRxonHaccoFyymzx6cOS/gqR73SeU/HXlCWAYAaBFhyCwAgQbAgwYJjq5P6uxe1+2Tf7O+Z6brdTz17kHH4LKFVp7l+a6Fn+Kel106P2M/aU/smbT33rktS10zqWkpzP1XQyp5inwMo2Q/usRa1Pvdk8nUc8uqQFD3Jqy9zgc85yWsD8vI9apukyknquEnVJ/WEdw51bsybsqRpi5b95sp8jnl+DRgQlAHsA/p5ZmtQgDLXjucZGeqQ+jon56sttGPuOXj3ZItaX/v08i0Zt8/t7nmYPsf12Vk/jvcJLo6VnWAOsCZQA5gD3LmCzdtXgBdv/n37DxgDhPn2HzAmIOPGQC8AIPAT/BsAEPifAv6ZsyCv0qxLPuctL1itgPdYm15ie+dYaZ0r9awB6wOgru3JH7IjbbQl+wk5JNeefVXBPvtMwC+ljL3EjRL2FgEnAk/+9oRfOaENMtlL7p86r0takzP8Tb4WEXn+1TPyrnlsoPzKZ/6u49i/ymzlKVv6Sd2X9hntHskCrcWy7BBF5V6buen0+mR58o6ztMyxsz18O718PPjHkdIxa1Gdt0O01bc6aXvO2f48nK/UeZu/K1Ve0qktw4apf84vbaGTK9X5XUJxmnHAdbpxxCmzLzLhld2iqUuPb/VzDGg67zr0CR4yAJBv/+UBDhUs1LxvfHOsnJu6a2dtv7dnWJ/9fTNdw8etZ4+29hfl9WM7ypPPfJbLJ608+V2K/awttW1S7Z7UNUla91Luo7qXWGv3k5Q9zt6AUpb7TN5y+1Sq3NxL8I5fdao6m895VR47UHaI1n6Zd5werXrmHOrcyGMHabWJeWwIn1S7LqEGBgjQcC4B+HvBAOpZRwMB6uy8ct7a0v2Ve8992aPZdgnflJPPxI7nOWt+LgmMCOYqYAOsAdLy+j9f8+AWACBM8J8BAL+XTR/f4vp2F4DGW1pBIGBN8O+bW8EboNG3uOolbQFSy5yL9hWs1rzt5+glA0jns4Rqg6Rz88buAulsx1gtGZZnW2zHWrKuyPLmRwv4J9gX8EvZRyQDAOw1AwDuQYIA1LPfDFowdt0vS2z1UG2ah8LTKUyfgVm18jsfYndeHlvWs1hrPPU4dozaXjm9sUf5E7OAm8lpmZ+jbhr6VN6yS6Hql/PJsg3/chv8zzlMOmMtmo7ssXyVlzrsOWc7+9c5Yf/7/Ozbs9gw9XZOaYt0cOF1fFsU55hyKc44oBjnmjduBAJa/Sir45BHD8vlUzd521SaY+m4QwUSggj0zACAAEHwDwUEtEBCBgGop22OlXNTX+2s7Sf7hb3iGrX2jXXH0Jac85exj3v72314yl63b9LdOA07aFep9k7qWiSt+8d87iP4XF959xR7CUDJvmC/5x5LcJrl9q1U2ZVWfdxjUvWW5hzhsUMt6+V7bZFtH8eRqkdLT8rqfMwzf/hqh5rHjpRpz+Qta1Gea8qT+tzzfLtu+UzD81xTRxv6q6/zc97aw33m/pO+sNqr8NBM1h9LU8aabz9/+dxMnr+HAhqHxqmgLYEbYApQVa//+91/gJeJt7OCf7//T1+SwH8J+M8AgABOmrrKMz/4pL052y7rldOjjN3qlzKuge/Nr5YL/qFZxxy1Q4valn6C/gr8Bf9SbwAA9hPws38E/fAm9hgBAG6e8FsUJG4EsAfZewQSMgCALq6fOl/KWk0Og+eRybNw50Pszk2scKiN/Wxr+zkL2sa+d6GO63jKNj/oE7FAXVjzuXmYapYfyh/T9pCsQ/XqabscO3nrpfab0uI06fz0nCadsBbVUWtRHdtKW22r7NRF/WYcM+bLR1tscnf7V1naTvnmd+ByZc/U17nkPHVspTq8SXWGKwX88KYGBxrnGWCc/eSRDZ/U8U6lypZW3QQUCRIEAtAE/snzNpD5zH3qLQB1YC7aVlun/Sf7ZbU2B/Psm7l2h+rn+ta6zR7d7aH5vHtO6p40v5Q6nu3N72jVc5VPm8Jr66SuQ9LWXnPtkvb2knuKt8ruj14AQMBqn0oZg7I6VupR+Zb+uedyrsljF/LSrDvE98akXP2Sp4w5Sev8ct7VJuZ5ZuGT5nPc4hPwU9/Ls178XoDr16KcAQb5co5pa/da3YvkX7jds/KtNpYhB15qeVLlrWn/ueQZ2vtcChAR2AGQAEuAJkC44A1QBcAC9PM3xev/ADFBP1Re8Aago28rAIBs09I3/wLMHtWeCfSStz5p1stD51L2v3S+zgl95+bG+rMeCf7rHKtM8vTLt/3e8JBm4IeyvA1AMIA94i2ACvwB9ib2GHsR0A/4z5solLPnkM3eMpCUAQB1r3N6jPzegfD0CvQ95mjWzfHU1aTF7Gc+adbJJ638XB65Wd8bJ8vl7Wd+0CuwgIsmRWX5pPCHkn2znWXnoi3ZlCm/8tm+z986TRNnZ1WWjlDyOmCVzjm0c85s1lUZdYzUY6Jvf31uzXMnol0VYn5q07Bj6ukccm45Zx3dSlvOPM453/H3bTngH4e79m3lHZM6+UrRsZZl3r5VvmBDICGIEDCgY6YE/vIJ7lrgwDLeFDqeeqgj+mvvXIPJXmGd2C9J4R8yOX5rzP5enu63TTv2pOXwhz7ZVn6fFr3SlvLaWZr7W951SXpoD7m2UvdUBZC9AIB7DmpfKTLhld2i7qmk6K/eORd553tXijxkKLdF1SP1S741p5y389cmlWq3Fk3b9vgMACRP+yVf9fE2Ezo7V+2Cbdxv7sNKfY5reeaRMZdHBvXK2tLds8Yzw6fSTenq38cAHa0xExAmkAOo8YYWQA/gAmxhewIAXr1O4C9IywAAgGwuANAD/765RZ8K4NSXuQjoKm3Nc66s9u/l52Rcal3OBd6Evlnn2lfwn23sowz60D7f+AO+ybu28lIDPwYH8jYA+4VkEIA95R6TAvQJPhGQYk/mbwHQD3nqkPtInS9lnbYHwdNjPPNaM7Nujs7VIbPWt8bJMtu3+lp3LFW+/cxLe+XWD3qhFugtHOXWJbW8UqZXy8zXOvPHUuVJ7W9+ji5vu3J2tg5O8Okgyet8Je05vS3ndWlZlel46rHnnO2vhfOHnuODrfkk3dm/Yzf1hjqntEE67vA9551ynOl8S55v/nWWqzzzjAmfNPU4xGdfZUKrvgkmEiBU8E9e4J+UOQn0e5S3iPRPPdS/BxBa+3tpmXst917yyLHNUpmL2+3v692em9uP/X7u4ZSz41dzqbrlXOVzX+fedo9DXZNKc93k3b+5n9xLlLHegJPcE60AAH3Yd/ZtUeRRnmPBq0ul6E9ZnQd555u8ZUupfVvys0wdqn7mnQ95+Uqdd8sulGm7pPkct3jWhnLoIZ7gXa5hj2etORecszbCprn33I9LKX1pmzLkLU9Z9Vm4Pf93z8vuOds8jfHvpQARQV2COcE/gEqwhc05W33r6tVrgBlAzWvaGQDgrS5BhHwDLDgTEPKm1re1ALYEbehEEry1qPrflz0Z877HeCjde3OhHLuzDtXezp027hHasX6uZa6ha5bUdXUM157+JG8EECwiGQQwqMQeA/gL/tl7+T9SEJCijPbsN/YvY7ivWnO6L5svlRtHwVNnOQ/zY77SbANf68nXston87a1zHyl1kutJ5+89XPl2WbwV24BFx9aecvuQjFP9jdfaWvsVpuUtZRXTrt9w+HH6UknSF5HKWnPyU3HtcXr2ElbbdLpS8dPfaATB21qa+fr/JPCL/0gx48ypzRsmLq17JTzZO6ZBCHVaScP2EkAJPivbZGnnJRdefSgrEWrjrapMhwndUhgkWBBcCBN0C/PDYAlAQBAA4EQxlInde7tk729EmuWe8h2uY6Vp30tu0s+x+/y7b2d+5A96l6do9lnx6/m1Bq7Na/c1/D1DHAtWtT1qjT3EDxrK4VvvTluBQDYc7SXwmeq45hHH/iql/nWXLIMG5CvtjCfdfJJ4Vt5y6XoA69eLeqcKsUOlKU9Wry28/mljXyPCvytN18pa+btpR74t5xnHH2du7bM/dfan+zjVrll9icvL7VN0slz0X4O89nzb8Wj3gAAzFVABxAT+APcAVOAf8AVV/9ZlyUBAIIGJEBcBgAMAggaBWiCNEFiAscK3NBZQJpU0GW9+VOoMqSnyHjsPupeaU8v7Kz9oXUNrBP4V8DPOHNJecqBKsMgAJS39yT2DYl9xD7sBQD4GoA/SklAgHYEENjHyHNv5T7q2eChy7cHwdNk9DGcnXmp5ZVaL6VevlL7Wm6+RXttLO9RZM3VtcYaZVdoARcZ1Vs8ZZbLn4s6Zsprld3X+Dnujl85Sus5QyOl8yOvg5RUhyypzlqlSxxXHdvaN+U7vnpBU/f1fDbrmLbE1ks+9qFt5c1Ddynshh7qpZ5Q9c95Vce9OuuZr05zD/zbp8rOvDa2zLy6UW5Z5e0jdTxpBROCAajAXyroJ8/88maDAOAQ5asQ6qj+2Dpt73q4T6STPXO7htn2sfiWXpOy3Hvn4m/nPxlnVVZtkHaVd29LXYekrpH7Jql7p1L3EuXsj9ZeoLyCU/P2T4os8nUs86mXvM9C0pwbPHOvtFVmP+t6ecul6AKfVP2SOo856vzTLsnzrJJPms/xHF/Bvs+65fStZ1lrXS0DjNJHO2A3knsPWvfoXD77zfFVRn0uJuc/fyn2/1asCx8acDCeIE1AlnlAGaAJoG4AgLeqgCyCywQAoOQBW7yNBZz5xl/Q7zVuZOT1f4Geb38FgAkK1SsBmzpW6nySPoZNL31M7KaOyWcZ9s51kBdAm1+yLnWdyOe65ljuAfcEwJ39x1t8EnuJ/cU+8+0/QSn2H4EpAwAEAfgqAHX0QQb7DbnoXvV27o9J14fA8/wnfWUsUPNpFeuyLPvU8kN55Umz/dKyQ32yfvBXagE3A7Tylt0HxVwp17w06+6Xbzj+1fkh33KWdMaS6qglPeS0pgObfMqAd5zUJXXdOmlT22o/bQvlQ7mf5Clr5S2DTlPYMPVRT/XO+eQ84eccdq7M5hszHDSc6F4f5SWt4901z9jKr3pUMCFgSDCQPIGAU8C/IAFbpG2xt7bP9YDf7pFYM8usr30yj1zyd6Upc45Xtz1a9+Cp+YYdGKulkzZN6t6W5jokf2i/1T1E3n3E/undCmkFAGhv3xZtjUXZnI7MhfqcU+WxAWXSrM+yHp/tK+/YPR1Tf/nWPLEH5S271DKfW8rl52iCfPmk8qyZz+4hyrlHP+2B7Ui5B1t7tVeW/eb4Vv/JM7j/vLX+bjz4DYAEYi2QZj2gDCAGeAd4eQMAkAXg8qo1gF+QL2DL73NTRt63sQKyJW/+W/oB1ihP+pgA7tLH1lZL9ezZvNVf2S3akkPZoSAA+469wT4xEMAeJHkTgCCA1/8zAODNFAIDtGXvIcO9lgGA1nweo4xD4Rl99JEPTTnbtfgsQ1bNt+T32lguzb5Ly7LP4K/cAi56i1J2KQkz368uOP+MAb1NLcen5SjpiCXVSUt6yHHtObSWpyx4x0ud1Nk5rGnbdtiUj2u/ybX/tU3S/fW4tRtjqgdU/dQ35+HcoD0nXUcdZznBP3z+AF6rf5Y5FmXyd6XKynHgewBC0IAjnwngz1x64K6CA+ZOW4IFXAfn7T9fGUAGY2tjbK79obku8K6VtNbXvDJS5rl5xnScOj55dG2m9j7f36fZridrVd4aW91yzu5rqbavdG6v1f1jvu6juR+GdO3dY/SFrzLIK79F0ZPylr7MifKkdZ41j10ok9b6Jfk6prrRVz6p86JMPqk2aNnGMm2XVNsuoYL8HkXG3HrWZ55gJ320l/st92Jvz2Z5tl/KZ3/4yfOXz9OO3/tL8lCgowW+5kAab0wBYYAo3r4CqgD+vmGlDOBPvdf6BflQeWSYAGKCsfpW2Te0AsSebpZrN/LwUssH/YDtG/9z2qLa2XzSypOvyXWGerMAmrcB3DfsJW8EeBuAIEC9AcDff4IA7FG/BuAtAPebepzTJneRtXcgPJ+C9Jt7s7YN9cm38j0Zp5TXsU6RMfo8AQu4EZLC76cZp3mBY6A8TNbiLXs42plPdXrIV4dJJyypDpoUJ7TnqOq06nCnk2pdpcqFOm7qpd4za1Ftb34p3V+bsKHjp73UM3XPeeW85XXEyQOQ+YOXTjHOs22k9q2UsSzLcU/lldWi6EK5OkkraDAAQGADEJ/BjZwnvIAfoA/Qwx7IUzbj5VwO7Y1cI/cJZfBZJ8/+gs999hC841eqzk26O1f296l1q3k2+67K61jmW/N1X0tzf8OzJtJcn+Rdu7m9RF0+A+yHul98Huo+c4+0aGtM9Ukdk3c+da41j01q2bF5xrWPfNLUq8X35mc5NoFv2caytCdlmV/K1yAA/ShbEvBzretXfNxzdV+6X+do7UMeeUlrm5Q3eXZ8pja09TeEsge5AQDoScCVvIAoqaAMsG4AgGvVvHWFciPAa/0J9gX4LSqwkyboS/CfeiQPyCIv2EreskHvB/QfsqtrkRR+LuUelM894T5xLxEMqIEA9iF7EsDv71NwLvA/VFBOkCpvAbjP1PPQvB6ifn0IPO1/8DeO+RxqX+tr/i5jzcmaqztmzNH2Qi3gArcoZe2k00w9/CGa7Xsyp+WYqz32fZSnfvK3NJ0d+eoQ6YAl1Vmt9BjnlLY6qNBW35Tv+OqnvtAXcl5TG6at4VufZfsjxsix1Uf9UuecU8615YzjKPNHL0ExgBknWicdat8qL/PaNmnq0uLpb3tl1bzl0NRJvgIFwT+gjTd7ObfkqcPxB/wJIlrzVkf00s7a3XXItTmGt/8cZSzqHfNYat/eGC19J3s79uC6fLrXd2dKbVfyrXEoa+lV56jdk7b2k2W5Z1p87mnWnD3PjQ/2DEEgEmXuH3j65F5z/yVtjWWZ+1odK2VulLVozvsufE9+1aWXdy49mnZNu8hrP59Rnj2CdJkoy2Qda8Lzyjrl7RzKWDfaKZeyfNZbPGuLTPqgn7bBvu6/3Ju9/Wt5tpVHziGeemVI18+Zz8/+87b39+S+QQZgR4AFTVDWytsWAAboAkBxndofYPPNf17rB6QJ2OZoAjx5x6u6pJ4Ctkrv23ZD/nxAwfXQTuZblLJWyvV3T0hzL9VAgD8SyH4kKEUQgHOBAIBfBcggAHsZue4zdX5suncgPM8CfepjZn9Kn2PkH2r72OMf0m/Un8kCLjR0mvhDT5l/8A9R20rtX+WeK3+KfPs05qKTI9VBkup8JW05vXNOKnU9J7VVXmXleOqhfur9Qs6tbWu2znStp/l+fcpe8Y4JVQ/1Sl1zHnWeOuFSnHEc6XSOeWumQ2w7KfLgq9zMa/dD1D61neVJHVM9KhVUSAEPALacV/LMUcefudpPqvzUQbtqa23vWuT6JM8eyXzy9m1R5d8HbY1HWeoGj+7nSFWu+ZYedb7au1LXo1LW7NCeqvtJgMn6u/ZQ8uwl9gvJemm2TR4dyOf+ka/69vJ1vqfkkb2kX0+HVrnzkDpvbMKzhL2wp2Cd55AkaNeWUBxtnGxvW+h0U0ZdJoKUyADYI59x8tmtYxMQoK3jJzVggAzmkfPUXu7Dukfduz1a25NXVtJWu5Q5ee7afzP82wG91xsAAK4EWEv4BF8ZAOBtK2CLK9i+VaW+gn/7z9GqRwsYUgY4qzQBm3VZNvh50P4Q9nFdoJW3TFr3Avm6d2oggH3nbQBuohgE4Csqnk3cAiAoQBDAGyv0Q746PYQtDo2xPgTGP0sskDhsSfteG+X06kf5M7aAm2MO/O3q7upoTx2Endy7lPd0QiZ1LdmWJ4WPlE6OfHWG0lGC1ymTpsOWvE7pqTRlwTte6qOu6p5za9pkYycehdwT5ttrFfZCvmNBHR+qXuqZ+qcNdNKT4rDXt2Q42TjF2a7yKXeORxfrk6es5m3XooxPedWDvEAMagJ48Mc7Ab885QADwILJftIcR320q3aGanvXI9cIvq5b1tOnrqVylHuIqkPqVPlDMhwzaeopz1xOSfavNMdLvupb50PetWhR1qu3t9xHrinrLWiEz3WXt5xnAsCaz4Z1toW6Tx2jUnVr6e7cnDNtapl1Laps9DKg4fzM82yQeAYycQ7MpQTPAnlognnODp1mAb3P3SkUGchkbHTG9sztLinXyvVijVyPtKt70f1Z93DmaUPetkmV06LZThnKnTxv+39r+fsx+RwCCKfUHwJXACrfqEopA3gJtigHMPnja4AsbgKQ93vVCf4raGsBu1qmnkmZrwBNmjZolWX94B8/ANBaA9cN2kp1b5DPPeW+zL3L/vS3AQwCAPoB/z//C7+w/o0Abq4YuOLWAP3VpaXnQ5dNDoPnkdGfXjLbY9oukXdMm8cc+xg9R9t7tICbADpNJzrXEwdBGVX2qfmUB4+cpNYntU2WNXgdHGl1gqqjlE4ZfDrGOm46v9XhJq+jV50/860+Kdfx1Sv1dQ4v5DxPtbn9UtaKdwxojq0+6qdtqi2cZ6UAgHTMcbhxtGnXAjeUa0/5nu0sr7rUvO0qVX5S+F5CXwACoCTnJA8wAeAIIgBGLSCR8lMn94O21va5HrlOS/jsK6/cFnXsu9KWbMeX9vSf7POyT7Ou1R/ZlDtG0pZOrXmyDpS7HlLWCj7XTJ51BkSyN1x/9jll5HPNezwy6O/z0WtHueP2qDrPUeeoDWgrn5Ry9rLzEZRD7zP59t7nC8r5cdfEm39k86wStGg9p9iY9ai0Ps9ZD5+pro1roW3dj7lH5Vt72zLbSJUDRTbjMDa6wFNuW6hyoPk8FZ9hld36EPDrz7kBh+CqAirBvW9PfYMKgAIYJag3KEAb37AC/vnRP6/+t8B/HbPm1a1HsUULnLXKzm23Ie9+Age5dvLQXqp7hnwrEGCAyiCA+zR/HNC3//5YJXuX9si8lPX2HBh0WGBY4HEt0AL7aDQF/uRnnOiT61rjLC1Tn0O6WV8p/S1TVtB0cOTTAUqHSadJp0wHSqrTplMl1bnT4dPhMl+p9faDpuwcX/3U2TnsOWzaAVssTWGnF275lO+YUPVI3dQ55+HcnLOOM841zno68AAinWja29a+UuWTlz8XVaZjHaIABEAcuudc5JmjQM+59WiOlfPRrlDtrf1zTXKt5vjsI6+8Sh3vPmgdS12krTm4L3u01ccy5SatOphvzTfXIXnWinyuGTzrCTDO2yD5xpp9Y7tc+x7PPiL16pWVFN6kjqn7HI8NrFcme9c971t9gxrq5XhQ+5+LKpuxGJ8gg8/aqZRnNEF/79xxftJsl3yr3jKoc5Cmbdx37sPcq+7jFqUd5dkeWdiIQCv7xuAM+9E5U8/49kvZk2ds/2/I6s/K9HMuICKgagEo3nom8Be8C/R9i8rVfgMBBgj81XWv/luvDMBZHVNdllDmT7uklT+XjYac+wH5d7HroT2Se2suEAC4B+j7exX8LgDBAN7+u6/Z06RLugUwPQ1GblhgWOASLNAKBuxA4S3Qm/yxX5XhCFDWo7X9Ni/43ncYdmMeqluNuycvy3q8Yzfqcx7p5Oj4SHW8oDpjSdNZk9eRS6qjl46fPA4zwABH2jJpyoB3jNRBHdU557O1mzY4ZOuOzVImvGNBHT91Us+qv/OC6iQzfxzudNjJYw/amLJPypFnLPg65jF5+1eZ5ucoznOdR50T6+x8erSOUfXXtmlv18B1qes1l7ePaylVJjTH6vHoRV1Sda0021V5OW7qBj83D/c6beB7batM8zmufNXNfG+OrBV1dc3m9oZfc6FPXfu5PHuJvq1zw35Vj5qv66IO7E3kojfjmMg7Hm21g3a5K0158lXHuTw6oSugdmnChjy3AGL61gCGtrwPOrceaUv3o3uVvX3oebCN7Vi3PI96PPO3bz5DPl9rOv07gl/j3/Otj3MX8ETfBFAJluABTL4pnQPsBgh4iwrQB0yRyAOo8go1ACplZQAgdTnEq3vSu9pi9L88gN9aE/ZGrnvme/sm97aBAPYte5HEvgTou2fzRyv9zQrb0g95Ld0eumx7EKyY137oR76JMyzLBn+vFtg7j+91tCH8Ii3AJuDTom6QHV05zZM/8qs8DgBl6QhU3npoN+0chN14c2Upi3aZlz+23H63tM5D50qq0yVNhwy+5YhWh448jqM0nUicbBxOrpnijAl6s419lZtjqo/6QdU95/ZCmfex+ZQF7xhQx1aXahf1rvMX/OKU1rd22AOgYZuk1TbaR5rjLeXtmxT+mMQ61hsMOti+9WeuOZfKt8arc3D9096uQa5LXbNePvvIK0+aY1Uefeqaq+MSat8q17Gh6iXtzeVQuf0rzbHkqz7m5+ZU14q8+7u3N9zrtM31r/msk0c2ZwZvdC2Tqgt5+Uqpcw8ahPTNMBS5lNPOddYO56ApM3lkm5fWMsrnUs7NOc5R2j9Ecl3rWpCv89HG7snct0v2Om3sA8+Z6pk0R08IAOhfbLyN23/vAjgESwmOBP4JjgTptk9qX9pwSyDf+AP+/fE/3q7Ovf1PmS2+B/juMv/R9zoA/6F1Yr/U/VH3kPtUWoMA7F2CVoB9bwK4dymjnmeCflLHPaTffdbHYfDiR3zyF/8c6YM++EM+IcoHe38W8EyW3t9IQ/LVWMDNkBS+DbBXwDEdDYAj+UprG+onSflJ4TNPH/P2r3nL70hzDqm7zpJUxwuqM5a0Omwtp06HL51LHFGcMZzsCgz4rmm2lU/ZOa76qKu6Q3NuL7RstsC+KQM+5TumOkBTt9TZeUDTEccG1RnFBtlGPvumPHlt3aKpizz9altlLaU4yzWAkfMB4AGkmAMyK50bRz2ladu0ueuQa1PXrZfPPvDKkuY48uhR1zp1O5VXvlQdoFXP3nx65bW/+RxD3vGT5pwpr3NkjShzraDsjbzun/tCnr1hH/YCvHtCXmp5Up6VuVsAypbSF70IWPHsEUBgjyKDPOcSbZyvc01bPAavPlL1Il8Tc6XMOR+izNc28vdNHS9pziNt7L50z0J7+7yW24dyAkbuuxZlH7Cf0Cn7KXPyN4S/Hbu0Yrd5+PXnWHAxB4wENwAcEmCptm/laWdfQJRvT7lCzVVqf0W9vv0XjLVkWlaBXeadO23lB30aoP7YdXQP1H1jXuqec8+6b70FkEEAbq6QuBVgACD7Oeaxup6zvecAb/8/+dO/6sZE3rpB780CFeM5kOXmB30GFnDRk8LvUgMg5h9++R7FObBu4ig05K7rGbtVZ7m01eYMZeqaVKcHqtMFTWfskOOZDh08jiQJ4IfjjcMPYMTZajlhlCVgtL8OqfJ1FlM3dc555PzgmzZv2LP2I59yHavaR73UM22gHQT0gJBqAwAJdrJNpWmP5B0nadUh67Rnypjj0YP6pKxTDeDkfFhj5jgnt1WXestrV+ixa95ay7qedc/XdXVMx099Kq/Oh2jtp2zHguY+y/0H7xx687O89mvNtTff1KWlL2WtebJP2Mu5HyrPOcD62z95ynJv1LxtfasLeLdMeZWiaz5z7F10dI86v5zzsfwSOx4rs7ZHT8vk1b1FsQPl1R41f8h+tf258lVn5wZt7X/39RzN58P9jzz/Bhn4cf0JDjAfxrO9Mhxn8rcjfYcNv+dGHQMmBEFSwRAgSCAEpdw20hyHMvLWQZUBUOLN/w//yA+v/xs1KAEA36ICtHyD6vgpJ3nHaNEsgx9p2CD3RO6jyrvvoO5b9iR7l1sq9esrNQBgPyiyH3PveSB8+Otf/3bBv3QEAbTOvdGK9epA1lOefG038k/MAjvQn3/EF4JAnYEWxUGwfOIsIJuxksJn3nrL74mi33rclXx1habTA5+OVzpk8tVpw3nC6ceRwsnCMcex5o0Kjj6O1qG3gQkQcOiRQ6pAQMdTHdQJqt45n5xn5bFFLav5lDVnG/VRP2jqjn1MzAub5JwBJNhMOya1nzTlVt7xKVeHVlnt18ozHuVJWduqe84D/hTwr46ValdorvUp651rO7eu7KM6FvnUpfKpN3WZn+OrHPI5tnsaWnUmn3OSt7zVPuXJ53jy6tHSzzLmBV/nx3Nf90Tm2es8A/Rjf9lfXtort559ydt7ZB8KAtCHfcvYnEnsY+Q7F6hrnFR79Cg2pE6avGU92pN5qLyla86jxTtXbXoJtKVnzh27kXIfu8eX0OwHrzzGZT9ALavj0D7H8O/mmqbvsHGQ9Cu27tIS8HEIAAmIaruULdBpUcoERQB8ANOP/72/c8Mzw/+tTgAAUAXAWhIAEMi1xkqdBj9Av3vEPVMp9a3knnffEgCotwD8OsuhAEDq8NB70oOgFQAgEDCCAFrozlQAL0Wg5/EOd915mCHgGi3gpnBDMAf5DV2BwMkf91U+//CfwiOPflXuNt8D/L3ylbxt3zvyrfn0HCWconTI4HXacKBwonG8caxxKvzhKQAgjnY6/afwAAnGMaXTqh7Q1FGHLufUmvOSspQBr+xql9QldVRvgbu0BZAAJQRQMtk+qTKTMiZ5afKtsuxbecaiLCk8erHWh9aRPcC+qHJrPu3U4tOmdY1Zb9ci14g1JX9obbNPXde6trnnq04tvU8tq7Jbexrdqu7OV6oNajvtlTTHSF57V53MO0fy8lKCWIeeffaR7ecoeybrzSfluXFP8lxle3n09KxiHzuPpDn/Q7x7pNoy88kjj3zKNV9ptlnKMw/a5nx6PDahLql2um+a41b96lyxi8m9fOi5btXbV6rMFrWNNOVN/v5WH6LhGR0CHBX8JPCBr/UJoOQFONIc0/4JpAD7vPnn+eT/VOcrAccEAJTp+HM061Kv58BrJ+lzmHNvjtjAOvmk2iipz0K9BcBeJWUAwF//t09Sx3H8h6QeCRkA+IBPfOf2qwAEAcZvAmile6G7W9bT85rBEhfm4JZn2eCfgAVc2A3ozw3RANT5h/9UfuIwOAbjykPNS7OuwaPLC6vySik7lLJPnZMODzQdo3TKcNhwnr3GD9A75OjrmJ9KfauX4DGdVJ3I1DP1z3nB13n38rXfIbuoR+qWOieAB4hUuxEwoRz7mgTd2ReZ5lN+5dEjy2o+65JHNnnHkALq0PHQOhIIqrc2lK8OaaMerz2TLlnj3nq2yl3j3C/wOQ7jk0894NFb2poDc6bcubdoq18dJ3VJPdV9Kc2+8ilbnvFb86169ebPHj5004d95Nv/lg2OLeM8cl/yXKFDlYH92ct1Huads3ZoUfeG9mvls25JfbZhzOxvvqXLoTLntYTmWtL+UH6JzGPbMB/6OK+0Q+7x1nN8qCz7I5d8ypfPdvBV7uTva/oPGx4XSR8D/oUe2Eigcy6esRLsyCsfIMWbVK5R83+o8wwSAOC3AI75CoDjpHzLnK915p8T1d5QgWiWPQdbtNbfsrTFHK/tMgDgLQD2qwEAfhTQAABt6YdcaOYd/yHtvz4EVv981Bve8GVe/W9RzhrbDnpnC3gGb3CeuGh3XjOAbXKwVlnWD/4KLeCiJoWfJjfJLa1/+MnrEFTaaksZzoIU/r7T3FhZJw81MadMOkQ4YzjOgD+v8S8BgTrj56AASkGpIKo69zqbOo9Q5wDNuVW+Z4Nsl7Lgcxx4x0+91FXgIZAG3OcbS21EoEPgn9R+SVN28oxPvtJs0+OVT33yALWWvuqdlHboXsdIu8zx2rHSau9cj1wn13IJzX6uqXLreFUf5kBZay517kvyVU4dL/VRR2jOYY7PPvApL3nGJV/HNz83b+qWgH/2y9K3/9UuvTzjug8JABAQwO61vfNImvPv8dpMO9JO/lQ6JyPr5JPC9xJzs04+57uUx3ZzbQ/V03dJG9qhr1TdtWvu69ZznX9XW/WWpZylvH2hOc6e/7BxjPQxtm5SBRuCkKTw50qMp2zHVjaAyAAAoN+vAPBDgIApAgNLvgKgPMc6lLddUnV7ahRbJHDF3gJYgSltntq8W/Nxnq39Qftabztp2hEb+jUAvqpiAICvr7B3/QHLBPzZX9u39LzPMg+CDAB4A0D6aW951w3/O8DtmWKXQQ9bIM9beSm9Jy9a12f4Dvcp3fZSyzf9Mzf4q7cAi+xCy082iX/k8w9/8jgO5Hs028or864UechQbqXWJYU3zfXXIcLp0nETBALocLAJAuBYQ2uiHKfeIIFfBSBYUN9066gvpbxNbL1RTucenU06kFCdSKnzPIbaV5ry4R039YEX+GlHaevqv1fmE/hX3v5JHeMQTX1abZFJecqGZ12Xrh/rr5wcw7GrfTKvDSuttq5rmutYnwfzPg/mk2Z/1hed0CHHrTql3pXPeZ/Cp7wcN/WZs0HOR959K62yyDvnHDN57UJZ6pg8Z0IrOEgZQTz2PW18lrPvXXh04lnxPGHPprycR49v2QR7aWupNnxsqj4tvSljntZVvmeDxyhXx0rTvu5jaD678PVv29JnHVmM0aKO1xtrPebOkdz5EQ33qAUuWsBHQCT4uSvNcZUFCAJEAZYIALz3vT+1/i0AeH9NPYGUYEogpZxTqTrRX/4pUe2CvQik+La6/raC7Z7S3J2LayulXD7nLX+IYksDKDUAwI9ZsnehBq/qnnXvSnM8db5P6pGQAYB6A4AAAOlj3vi27w18YtdBj7fADuO9vMFL/u1onN1I37XfjGX++JFHj4u0gAuaFH6TVptkvTFuaf3D7+bRMai0tq95ZFOWY5zKKztlKluasi1rUcpMdU7pgMFXB606i+lwCyRxyg0c4PwTHCAduh6sI58UOcpNYJXjpk6pb52Ljl+dc823+qVc+BwzdUkdE1QzjxZImnv7jx1TRgtk53jw6FLLWnllpXzaoSegLddgjmddleU4aY/KYzfK0n7Ja9tq71yTul7u5aU0+6dc5sH80U89Urc6F+fbomnXFt/qk/Jz3LRF6gvPXKTOq7YhnzLkGaM1T8d2nVKv5JkXz3cGiuDZEwB+9i/zzD49njGpO0SzP23RwTHtr/4t6ny1QaUt2x1T5noc02dJW/Ss7Syrc6h57EBZ0pZt5spqf8dImdmm1pufozk/9zK0Ptf+naNcXlrbmk95h3j7SJW9pvoOO4rjo3+xdYIEFwCPu4Kh2l/Zlie4cbysAwQZAOB7//wOAF8FAPwDoki8TeXtKt+xBlQREDABZGsS6HpzAPmZAGTkBXHooJ7qlvO4Zp55MT/mij2wIdfTSfDYDltog2uea+ruejp/beDa537IveCeqJT+maynr0EVfviPfUsAIH/EUvmt/sihPPWFZy7SnNc5eA+CDAD45j8DAQQAyN8GAew26HILePZK6bl+ucs5z98U/4asy3fn9gYD7sbJ/rvSwT0ZC7jgO/ryLgDgH/tK3Tw6DdTLSy2rfclPnIcYb0m5/VtyW2XItE+V32pvmfOQpiPWctiqo5hOefIJcnDUAVeAgwQMc+CSOgAGfUkpL8dJfVr65nyO5VvycrzUI/VTZylAv86VgAA2ASj1kv0rzbGO4ZFje2WSZ3xsXXWcyxMoEOQpU5p2kU+7Vb5lZ8rqerlHpe7hpLn3szx5+1f52IQ9ii2Yi3o6h0qdrzRtKj9H7SdN+Y4NTftUnck7H2itz77Jp3x5xodPmjrBoysAPwNF7GX2+NK3/HWMzKtLi6Ze1KMLejBuq32WMXfyaYPksRv5ar9WXjun3XtltkFOtsl8a4ylZTmHQ3xv/r1y5dX6mredtNbXvO2gdZ7aC5rPLHw+2z2+9iGfMuf42ndvjKkDiXOk4yhdO0wtECHY6NFWH8ps36q3DmrKdpQBfgBBAHrAE1f/SQD/CvoBq4J6AVgLPDlWi1ads00CNMtT32vjnQO2wm4ET7Artyzyf1qgjja0v6Y5Oj9prp+8dZW6D2p55pXhXhPsY69M7EtsS1AF8E8Qi2AW+9c9iwzlQZUpzbrUQV59k566VqKmj/+kT3xnAn54AwHeADAIQLDAfoPOWmBy1q5amodu0ssvv8w5798Z+PVZbv20j4OlHMsGvWIL5ILuNoebYLVJ/ANf//Af4zToULRkIJ9yxzmF2r8lv5bleLWfddlH3ZOmQ+YDJMWRa6UKEgQKAhspYAjwAFgAaLXeiifoFGQKopQDzTFTJ3VNmnNawmdf+RwDPsev81VfKCC/Nc/e23+DASlDPud/Kp+y1I+vbqTdD/EEcZhX6lDtYb7aLfPatkXrOuUehc997F73+cp8bUdeWTkGOpDHJqwXNmGv1r1W15p6bXoq7dlRW1X7pN5zfO2HPMqUWylzo8y1q9QgnvuDfeA+rm17eeUnrXoszTMGawTt9dEG1MsnnbNf1rlnoJS3aKvMtnP9s67KSB3meOZEfc6tx2sLqe3MSy2/D9qaS7VDPrs+24eoz372zWe+jmHeNtlvbyx9hx1tukcJHAAY5nt8q96ypTSBjH0oEwwBlHjTD3AiAVR9258gKoGUMnuUcahrUXXo0ZbMXttLLFd/7AtwxYa88SfI8vO/8As33HgErAJaqaONfS5pPuoETZAMn3XwPb1bdZYlhe8l96lBAO0JyMeG7F1sC/gnuEIQixsBfn2Ffrl3Bf6VHppjSz/mnfPo2cFyD4VWAMCAQAYADAJ82Ote95n2HXSRBcR4NJZ/0bOcv2Mk/tZQtj7Pd2d3xYQpY9Hgo9FlWsCN4IKa3y34yzvwz6bIP/puHh2DQ9T2SVPeetOV8Q6V0Z82KSf10NFzY9t+idyUCZ9y4atj1nL+fLAqbTn9CW4qQBJQzN0KEGjSN2XB53hVl5beluUcKSNvXY9W+Tl26lXnCEASMEmZL8BFsM8bTPlKqzzGatkidWjx9pEyZks3dZyjBG9aY6RN4KvNzPdsnOsiX/cn+bqHj933ynSMuv7ehmCdmKt7kDm15l3XiHyuI7ZGBsm1rn1SrnbUXtK0W+re47O9vLKkrpNjtih6Y4d8Tn3z3mpfyxiLsqSOfxeKTOzYk8GcqXPulfbsluXuFSjlmT+G7/W1vEcdg/pjUp3rufPo0pJpeYvO6e88pcc+43kG1L7IbP2tcyzra7+UuXImdv7DlNfP2HpDAoGkAogsOyefwEW5lgGCeKMKkOLqNIkAgFfUqasAqgUAlYf8yjumlHr5pVSZ0qX9sp3j9mi2PQfPONgK+wFaAarYFrAKD0ClTnueY8xTZGjTBMCWaatT5GYf5SR1DNrJ96i6YS/2JLZjjxq4AvwTXCE4z9dYKCeIZYAlAwDIIo+sTHcNCDhf52g+qQeBXwEA4P+mj/+OyX8DSCCA8re89d1rahBg/PeAWm+Wiulo5Lm85T3H8+8TZ/z2PN/1UY5UGVA+Wb4pGf9ejQVcPOg0vXy+AMASJ4INud18Zey5cvu5oecocrL9oXzKyjnAV0ctHyT56nSngy8ASFAjX4EPQAkwnFeKE3wCPLKPcqCOI606qeuptMoz73jQ1Cf1hAc4JWhyXoIn5i4gTMAIX2VlPsdcwtPXdvDH/MifOif1rasy0x7y2ippbx3qfjNf92XuWfm558dnwLbSlOtYqRs2yv1oIIB5py2ZP/lMuY6U08cbIMjBeWFPE2RgHahnD6RcbQids5+6V5pzkU85yTtGjinPXCrwZy7ozdxtN0cZi/oc8z555wtlnMwnX21mPveGZ2Ete8g8etXx1LVFmWMtz3kv5auM+8rXufmMJj30jLfqs3/yS8aj/Z7M6kPMuEEJBh6SF1g5pvkaAACcAlLzCjUgqQIo+/co41DXoupwF6rslF/lZZta9xB5bSNo9c014JVEHrva7r51chyoQQfL7nvslM+Y5JNWXr2kBgAE6QYB2Ke+/efvD7crCAZQRoAAO7eCWMrJAID73LpK1UGqbpXmXCvv0cAbfYG+AP+3fPq3rQMB5A0AZBBg/M8AWu8gTXxH4x3Ge3n3FQB9E/7ubc/1bDvlHVTZ5ge9Ugu4kLvNwYKvNoipOgfkq5NwTD7lbTdcjOe4PWqfpFWmeWTYrievlts3aWt+6fD1nMaWI+8Dl1SgKE3AJA8IAmwk0JQHcNhOGdIcB77qhO5zQOCYuSGnjqceUHWECp6cQ1KvTQv+pQke5VMmvOPkuD3e9vYhIJHAFp1aAYrUtfLonnKrPVpr0LN/7rHkW/sx96t83du9vO2lKd9xcx+gL/Zv2Yoy9qOgva6P6wZt2bva0zxyae9aald0yZR6wqt/0tqGfMqQd60cKymBibo30JF5Z7sWj3zKkzpmj6pjS/cso79tU1arTZYln7ZKnn1BPmnulcfm1S31SP0rz5xr2SXkU//kfT6T9p7pJeUpB56xlpTRZk/+1FHUn8At0sfYukgVEDxUPkGKY1IGyAEg+SNqvp1uXaGm7Rz4QW4dh7zjPUeqvaAATN9ICzYpP4eNlJH2r/xj218d3SeVVn0zrx0F5doSkE/ACtDv1/P4nQW+ysKtlnoLwP5JkdVK2SZ5dUn9nFul1eYeBLzNzwCAQQDBfwYAMgjwmte/6QeVMeisBTx7PY839OVNAAD/AD8Enwqe8397rrfPc+UxaPKzSozKy7OAi5cUfpNWG8SN0HIIcJLSYZRP5ykdF/mWk8E4TYcidFCXHrV/1TXL6Wu+yrE8KXwm5yDNubbs0XPEfegSGAhqklbgRB5wUUEXAAkgIjhK8Im8HEceHVqJdUy9a77VxzJlJ52bDwBKcJeUuVAHQDwG+GuvHHMpzzit4EoFeKmnPG1IFaA6dtoDXntJfXYqrfvLfVdp7tHk6x4/lM++OYZ6pH7qjs17dvNNvm/wE/hjb8pbe1m7tih2JsBCf+yrbdUHmnrKt55P67Jv8squtDdnAz+1PXnkJpXP8Vq8OkKpN9/iW2W2r/2zXN51btHcD8fw7Cnan4seMzbzqO1bcztXWR3r3Pl8PuW7z7R/x6Ev7/6WV145laI7ZdJaX+Vs/YYcd+Pz6F9MPKAKCB4yL2BxTPICU9+kAqYATgQA/BqA4AgQ1AM/yk4AlDxj1rx6PHWqbbS1NoRqk6dug9b8nLv2aeWt02YC8RoA+PG/93du/tEvvW/9I4v1xyzzFgD9lJHUPd6j2VZdXD91lLbmapmHAedLgn15gwKA/laiHb8foJxBJxbwzE26wXXx9wDb87cfXwSfBkqes359vk/PcvszUPLmJwpcSMb5p46WSS9E1cdVwwXd0XAa6h9/HE3e8OH4+6aPzdNyuNhkmaqs7WaL8faci06dfZMmv1ROrx2yTMwBPucCX51HnelKsVlN2KwmQaNUUJsU4NQCpoApQJZ9k9ZxyFd9ap451LJWXll1jBwfPucAgOuBP/YV9aZTAgGOV3WoeYImLQDbAp+1DIDLNfXUs8qvNqn2q/uEfN1Tdc+Zd29W2tvPqyNmMRhwjNzjqWvOg3UF/Fb7mGevYivWG1uT4E/5by+RSV/Wzb3u/lOn1FN7WoZt5aH0kdofqsy6fozb0ptzsLY1X+XlOC1efdSTNvL3RbVL3Xvk3QO5J1q852Pdj6fkkZ/yzKcsy1q61DLn0SpvzflQWZVzX/mcb+Wbz/nOOdv9Lbfs5XYgoMqdyzMm9XtjO8aOtpyurZcjEHgMWgEKeUAMoAew7/V/AwAEBbyqnsDpEAByHClzhX+MOV/SmNpbuzxHmzjnFk27JJ/7DSDOXuTWCrcp2KP8bgUBAN788+OKBLFIlPNbALmP/TpAD+hb3mvH+KlP6rlkr20PgtV5Iuhv0Qr+P/uP/LUbEuUECV77oR/5pq2swbQsINCd/j24PcfxLdJXJr8933dn+bTvbhRl70oeh0s9kl+ijXNb0vZJtdFQSTXGBCikQ4BjBADF4cXxxyFd6vwgh7Ypb7vZVhtyz6m4Y5mypUvl2x5aU51ry1HsOektZ1+QAK3g0QczgTM8wKcHWlmblhzKciz5lk5Ly5TRolWHOoc5wMgcBP2Aa/hWqjLJM6606pD5uwB/ACg6oltvrJZNql3rPmntpbrfWs+Pe3R2f7cO88bzpSyoY6de6pxzYa7YwR8GFPjfF8X+jDdnY/VcQnMu8C257J3W/AhusBeyjzKS1jF6efSlLumSOZzSJte1x7sH5qh7xr15V6q8SqvcWk8+28C3EnNtlWeZbaRZdwzf0vGuZd3nvPWMZxnPO/kDz/0h/Vr913JzrA3fdZiWgIT7bCNgYQx4AwBclQY0EQTIAID/G4CAqAIgwZBy56hjOj/ayj8Xqn2ey3x783TttcccdY9BMwBAcMofAeSH/0jsYQA/AS1usVBP8kaL+5nggclggnkp5e77YwJgvTlTngcD3+lP8A+4Nw/Yf/uf+OvrJPj/3K/4f96QaLP+PYDNuZYiB787f7v4jnMevwFfSv8a34O/b9Stz/n9M32HETdWVr42r3nLoVknX2m2P8Tbt9XOukrn2rbqnnwZBtpP4SSkQ4BDxKY5xgmybcqRbzoTMfaSejdrpUv6HmqjnkmdjxSb1FQdcp16yqvzn+ABPoGqPA9pJkBHC2ABjniY7VdpHavmq26tfPZBfubh65jkq+6tGwzMB/0F/b5ZN+8hVWnKdqykqQ+yesGTlj0tQ1/6GZxgzJRb+WqTase6P+r+cW8lzT2Y/Owebj3bWfbyNPCWch07dVPvOh/XncBgb2215anUHzfyqj02TztXndR1jtY+yKMs5bLWrYAV+hBIyrbyylC+cs0nRT/yc3pmHetBPtel8tk++Wx3SIbr36N1r2T+IXn0Y7xK1aGn/znLHatF1cu6Q3nbVdp9zvN5PsSX5z1l1vFa+Wy/5dtj4jh1na85cPAQdRVoGQAATBkAgAKYBFL5PeoeEEJOlZ155kY+6UPMd4zxARcVZMk9UPncL/IV/BsAAKSzP9mrfN+fN/9Q3/azn9m3BAIoYz/nnqacRBsTfUgZAOjtd/WTLt1niao+5o1v+14BPzTf+gP6AfsEAZL+ka/5sfVNANqP3wNIa074PH+nGG/1d4DzHR8A30RfG5+KMurW5/vys92xVMB8i1pm26RzdbRr1VvWo9mPNpmyDv7ZfFrG2hlmtUG2f+BvN0s6BMc4T/arjs92k5Wxcty78OeQr+6V1vmnYy2fjrd8Ov7ygoakFVAmyIXngQWAtMAUIIz+LZDKGBU4UYYuOf5S3mCD7ave6qH+6M118JbelPGWFZkeSBXsZ16ZlTpm6kK/Fojr6WH5McAfGzCmtpC6zlL3gtT9Iq17q+4987PPxvSQ2z3XtZxnjzLoKikbmnqomzpDnU/uHeZPkKR1TV6bHkvZ56wdctkXrKVrq42hqU/q2eJpW+eQ80CecyEoVXVugX/7px5L+JZ+tUz7H6L0O9Rmrj7XvMXX/ZH5S+PRv+rUmtOxZVXmfeZ9Lru0Ps9L8qvnPJ/5lD03l2w34ffHXIlvOmqUrz9LgcJ9tqtgHVAF6OFNaX4NAOBEAigJjBIQnXobgLkBnJLe53yH7McPArjeueaC5x5N8A8v+OetPKCdmyrsV4A/iWAA5exl3+pLKRPgtwA/7Uy5x6sO5qvOS/eY5wDUAEACf3jf/vvGPykBAJK3BfjvBFPm4Lfnb+K8iR/IWY8vgK+T/jY+C38T12f8/tmuDEycspea/Jj+ys+xHMc6abbJMbJc3nr7SpX9rKiTT6NsAYF/6FuOwTGOU6u/si+dtnRvzb3lWFdHPvMVHPAgZhLkJBXsAoJawASgAsBOkJT95XOcHo9+vTrKlQWteevUF4pOc2/fBVW080CSUtZKKR+ecaXw9CGo0AuWVGBnXuDvd81TpnNr0Wqvusa5/hWstfZUa+/NPi/9A3v6fGe7l/vBPnVyb6f+ObecN3bBbr39qY2XUNbBWxespeut7XPc1Ac+dW3xtT155LHnCDjwHLVuM1C29M1/awx0Sf2Sb+mZtpc/N811lk+a+5DyzM/x7FXr5U+lyjmFHtI55yrfG+eQrNqP+Z495fN7Cn8unfpj62wl3TpWS4HCfbYDvAhkBFYAJN6QAqgMAuRbU0ATAAqQlADp2CBAAsD7nOOQ/figv7UG7D33QAXRdV/WPWoAwL1qwIrv+pMIVgn+2aNLE3JNOWaLT51b8ztUtj0IVgw/5td68+/b/wT+8gYAyBME4PcAOJdT7uDXAL3r9/F3Cpvp8+DT4PuQ92/cyobd/rf2pd6PfIsulWNfZVaa9fLKpm2Lt2yDa2nD379dW+XQ/9l8nHTSqaHCSahOjZtHyobJZHmrn2XrRYgxJvlcJNrUfK/f0vIj5KEvuqm3NOcr33LMceopT+e+BQwSzMALcqSCH+ncG23q7Fdpyq5jLs0jM+XUMcgLmtW39R3qBIEEBwT8UACfdAn4dxwohxnyjgX+tMd29GfM1rxqWc9mdY1z/d0T7hf3j9Q9lpQ92E3Tw2z3HC8tD9k5pvpA1TXn4RzTBtqHtbtrEIC1yLV3jR0jx1UXaOrY4m1jH+Ryc2aJvi3wr5w5qh6Obb5FtfUhmuuTa3SoH/WtvrWMPPtBmnujx7NHqevu1dhrd23jOEl7etVy5ySt9eTn6mr7JXOhz5J2zTZLn+Wl7V7eP0/Ur9I9ffpj4EDpU8A3P4cAwkPVC/ylAHsAlAEAqN+d5k0rdfl2tQYBjg0EJBBkzuYfav5jnIcPECR4bvHsRcor8Bacs+fYpwSi2JO88Rf8w/cCVL29meOoT5Ylb7301P2Th8KHv/71b88AANf9Bf9f+hXvWb/pr9QAAJS29F//HkAKfr58nr/y+z7h6vzn7xv+CL4afg0J3wr/YP03oH/OKw8rVz7L2uPzt2fXL9vYd4726tRjSm//zvk3bf23jLGnOqRM+Gf1yQXYGe/WcBgK42VKxwi+pmzb45F7cnIB7yLjiL69OdR5m2854C1HvwKGBDTygh0pYAWeN6MJoJP3LSXtbG//OcqY1PfoXN9aJ1iDomvrbWrqbABA4C/4lyYQlM8xOLwIMgDiDo2V48Lztpe+jHWsvVynpHVd69rn/nDPSOtem31Gpofo7tndL+dA69eXZ0Ed1AmqzjmXnGfO372APedufdR1yLx72LWGut7KzzFTF3Qkn7omTx26uV+WBorYxzkmPLKkqYPjV5p6VF4b92iuhzxt5Y+hh/q5Bw5R9idtWvvUcqltzp1XrlT50PtMjgd1zCy7Mz/3zE7rfL57tP3sr/Q+SkfGtM90/JTf0oGy7edU4HDufgCZfEMKsOKqv9+pBlgZBCAQAOCivr5hFZxJEzTJC5patM6LNrVs5B8erJ/T5q5pa/0pc5+0qPtK8M/+IxhV3/5zW4W6DExVeb3xLa/tyVsnvatdtgfBiuGX/DMAwBv9+qY/AX+LNwgwvgqQll37exTk2bzjV+c4f7PwQfCtDADgY1G2/nvW6zstzzF6/O7vxu24678jUznqpgyoH+r42GYZvf1bxVz0jbZ/p3eyNpKf0b9pzL5Rb423XqgVj+Fqwqi1jLzl0tpGmU3KwqzGWyk2T2lzbDok0/qG3DoH824sqY51z4mvTn8FDRVgCHYq5aGdA1cAYdrUfjXPeJRJra95yw9RQZqUg2Xue/+CPkCY170BZyT0byVlnwLiAJYkxsN+jonMQ3Ojvq5P5utaCv5yzXNfuGeOfk7Yp/PJ51o6/8yX/e7ehqqjeudccr5ph7Qj6zd3W8X1r5T9W/eA6678HDN1SR17PDKO+a0CbgjkePCMKc3x5RkbvqeD5dq2R12DUylyl/Z17Wkv36K9s5e2vbrHLFevpK159crurLt/W5LOP8OHnvF8pm3r8y6t5eZ39OUj/472dXZM6OznrgDiXP0BNAAcQJOgnjf8BAD4QTWTNwIoB3j5ltWvAhhEEKhJl4ApQZX0XHMbci4nYMDash6ucaWtfUKZ+wjqHjNIVd/+s0cJTlFvP+XW8Vp52yat7c61p/Jw4G9TBgD8wT/f+rcAfy3zqwDjfwVIy655znk+u/NefnXu87cO++ML4afrC+Oz+Hey2VcZO9oew/rbsfgb6t9X+HWyDRLavLpbL7V8SpW7ooyFH6P/sx17N459kfmsPxiCjwaZRGzWC3VrUI0o1VGs1PqkyCGvvAll7FX9RIfUJ3nbQZckZdsvZSV/QFbOBT7nDF8TG6+VdPylAgZpBRrkBT1QwSoP7dzbSwCubaUp51y8spPCA+CWXKsW/NGWt7LMqwX8KUMmYIy5zQE4QD71BB+QS3uAKH056BhDfefsoO1dE9rKV+r6SV1fae6F3Ct1X80+I7lf93mf4UN095wrI/Z+6pN6qr/zgTrXtEXaExuzbqyr67yEsl51DyAr1yzHVA9p6tjj2QeHdGEf0S7HSt7xkvbGq+Xas0fT9nO8Z9Fcm1ad/ep6Zz75F2KPwFNXy55qfvFceZ5Wtln0d8xn73g693z36vafecdF3yXJ9n3aGpuyyedcQOIccgA5gCa/3w+I4s0q4P+Hf+SH18lfVwdk8ZaVAIABg3MFAQSILXqOeQ4ZjxMQYH+5phVQJ9iWF7wnTfDPvmMP1rf/BKfYwwYAkFfH6+UdW5rt7mPfTA6D1bnzu7/ku97Pm3+SAYAK8g/lvQXAbwpM5D/9TGI3Zpv5/pm/asffNPwC/Bn8anxiKHnK138TDp/1s2MgQx8Cmfg65g/Iz3k4r/5Yq3HW8m5p+lT4XYy9HXc3p9wdjpdlT5p3wm2jFoNiXA0oTaNadogip5tcGNrA96h1WQ/fSrZVds0rw3rzLVmrst78sEUv5WaUr2AgAQR8ggz4BFXJA2jnQAzAK0FT8ilnCW9faCb6Zl4eEDenW6+OfoAuEvoD3CkDyAPqAWW1r4CfNrSnL4cZIBJ95uanfVu0rkPN13UzX9fXdYfmPqn76YXWvnNvtimHVD7L5Huf2m737Jdx1St1dQ45N+db96z2di9A2auttatrSb4GAFKOsnMtUo/Ur/K0sww57JfW+JSx1/ijmOPAO9ccM+Um71hSbdijae8W77osodm/1Z56yqWtNpQ192TZL9027E3aztH2vt7tTevn5FB3YqpzrPmDctXvfijPcuu5pbx+bGe5+aTw7YT9qOvRXr/NaI6xye3+3Su/D1BxqkzADmAL8MTbfcCVXwH48b/3d27+i5/5md9473t/av3/q/Mr67x5NViwNAiAfMGVNEFW5QWMzon6WmbdoI8D7JfYPdct19g9kDQBv7zAHwqwZ78ZoHKP+uv/BAQITNHW/ZZj5v7J8tQhy5fM79Q2u6Nhw/3BL3zXL9YAAG/1K+j/k9/w929Itdw8MvhBwA/64A/5hDrGE8zvnatljtZD22l1zvO3Dn8FPzkDAPgn278Dvf4LypGPf4E8fCCo/sY55G/nxt+sVUJ2jqcv1hhTc2kn88+OaoD9TXJrVAxLYjFPSfaFNtOCjbRd6NoWmZQdorXfXB5ZM2nOBm7AFmXzZxIUSNmsmSrwIC/4kfLgHgLaGQQQDC+hCbqyveXoIF8pALwHrLIcQOhbesAYifmYLKNN67YDZbQBXAL41VP7JNV+LZpl8EtSrlXyrqc01zz3Rd1He3uuv0c5pPK5JV8/td687Waf99RNnXMezg3q3NNmaXf3BnuVfTF3c8O9cWoAQH1SvxaPzpT39il7Cn1zTvD0kzrvpK2xKEvbtXht3KN1PTJfeWTUMvKWS1ttLGMvwu/tyVV5t4w9SX1/3+7vuftsqy7Qc6TzzY9nUFu0eMukPrtSyvmYl25Kd+W1je2g50hVfitP2eRzKnC4r36AIABWgv/v+Y+/5wbgz1lFgqfMrwEcCgIIxARzCbTkE3BVnrlSdl9zHnLvL3DgutU1Je/aS90f0AT8yQv+AfjuUX6fwq+oGJgiQEA/ZOfYuZeyXB0se6g9MTkMVpmXvvn73rM0APCV3/qT3SAAQYMn+oOAntuYLvnMW+65bp35fbr6m8jfePwR/LWzBgBu/94iH3+DMfS54Le+xV3/DnXG0U/T99LnubVf2go7PctPNUJzg7xwa2ApC3dqUsYeZRO8fAfH0b6V3mVzpSz4kuZswGbrper8V8CQYMJNnCAkgZU8wBfAInhq0RoEEJQhQ77SubraNvMcJC2QB9gH2KFLXsVH/0wAr5qoRy6Ajf7KoJyxtUWl2I6ypGnPY3nXpK4T+bqWHj6uee6Jun/q/lqdSPvP4+aYsrweWvV5rvXms7/8jsY+Tx3V3bnkXNMWaU/XIvcG68o6Htqv1LO27oOUodwcK3VI3Q7xyK2BJfYo5ch0DPkcR35uDO3Vo9q1R+saZP6++L29GHtiUnfXc7u9x3d78b7rmVfOoebPMz7PHXPikzT5Wpd5+Pqx76Fy2yWFv49UdenmHwpoLB0HAAQAA2Dxhh9AxfV/3v7zd8wgNTcCqONtq/8jQP06AGAtwVsCPAFXpQKwSgVulMs7J8vMD3p/gP4Y27oudS3J57rnvsj9Is8+MgHs2We+/Rf8E5AiCECeukMBgJZO6nvMHO/ath4Mr3rHt77bAAB07msA3/DXfvaGIIBv/SvlqwDcAviw173uM+s4V573DGca8i26/Gy//buO74Gfg8+DvwXFX8G/uB1ruUx0u5ULRTay9J8YB57ytXzaHvv3KOQzBnKQ5xj6h/pn27nsj7UaemvLypN/Nh8XmAnLTxYSQ5uOcTzps13okKGsyXg59iXwLX2j7JAd2JS9lICgBSDcvG5qgYjUTS7lweXqewUzGQwA2AC+eMDvK/XAHWMnoBPYHUN7OmuDSrEVZdrsVOoa5JpUvrWGuca5D+q+2T4L7q323s9nUz4p/KEPz7Yf+d3zzrjqsKKpp/rnnHLO2iNtnOuRa8easxfYr7k/k2cfs5fcH/ZPmY7l2NDUaY63LZS96djoxBiUp3x4ynqpNVbaqvLas0fT9g/B57p3efdHe39O99HzacPz5Nzll9BsA9/65DNKvflW2yxrtbOsRSk7JTFmS17qssffFUCcs7+gCHAG+MogAID/H/3S+24IAJB+/hd+YR0YIAjATQDexgK86FMDAQI5aII9+ASC8OrQo8xXoCY9pw2GrLsHD1wX19A1Mw913XM/5D4R8EsB9An+2W/8DkX+PoW3UriRYgDAPdYaO8sea93rgfCaz/7TX+XvAAj+W18BAOwTAPim7//5bgCg3ALwbKpDXlo+9ZSvFJ0py/LKWz9P8fGQA10l/Av8F/we/C0o/sq6fjfmvMyQt+53Kxc5+Ez6bfpRlDOubRePtZKbfZDhGMhOP5FxJ+NM57IywfP+5ObBEu0FLgbX+EucUtt2aW/Mu5Sj7136t/oqE1rSEjv0nHw2Z6YKIhJsCEaS+lAlBTQBaHBYBDVJAVbU+wYdOhcU4EDgoTpEaSP45+2tb/iRz1t7+/uAmof2Uo5rv6Q57+S1EWXyx1DsTnvtn7xl0rpm5HNN69rnfql7aZ3f338+m9BTPz7r9jefdPP8x/5OXXMezi/nrj2gaetcl1w713zudwGoq3sg5TlOjp06HeLpRxu/BsBzgXzlza27bVpjaJ9K04YtPu0NT5ta1twzsWb3Vr+/Lzf7ZXk5e88+8uemdT8r33HPRZUrzXEpW/KxD23lpUv6Z79e+5Y8y6CnpBxXWb3xm+WPBTx64wrOAGOAL8AUNwEAWtwC4G8mf0+5DUD+B/5ff2N9E4AgAO24DXAoEJCgTyBYaYKzHi+wbNHe/Eb53QF+z4ask3Xyde1ynXMftMC/oF/gz15kbwH+88cp+UqKX0uh3P1n8EDZjocO6qe+j0XrofCa3/f5b/u4r/nx9Y8AegOAQEB9u0+et/9f8xP/fNEtgCv8QcDeeXrKOb3fBz+BM7/4C/gY+Cr4O/pX+DWUr9sv+TtRZDIG/gtykMkLH5L+FeOt5Tf60Xdv3NJOvwj5+GLI1afEZ2Qu1KHDWl5L5mqQ23GSrguf2z9uvPamCePnosn3KIa3Dn6b3IRLNtaltEn9OzxzPZSq419BAps2k0ADyqauyQc2KQ8A4AkgznfnW8EAyiynXQYBeJASeGXeh0xqO0AUACrBvm3sb1to5Ws++9i+RXPeyVc7zeW1rbamrXyP5holn+tZ1zr3xvZZcC/N73PPo3xOLbsrnX3mU+ecj/PMuWurtHWuSV0/9wd7pvWVEb8GkP2Ul2M4rjR1Qk/y0qyT5w8T46OPMpZQ+yfVLknTbi0+bdzj3S/Uy/dobXMo35OzLp/fl/t7Z9OePVn36mPkl4yZbXp8bz62r8+g5ZWmnNon8/bLsrvyKVN+CT3UBr1qm1ldHwt4tMYVrAGQAEsAJ97mA+p528pXAbwFwBnBLQBuBvDm1ZsABAG8DQBg820sIA5AJhiDJiBLYKgeLYregjfrW3MZZfcH9Odsm2siLxV4u79cf/eEgB0q+PdGSQX/XPVnP7IH2ZMEo9iH7FOCADUYxRiOP6f/Q9fVw4Ef7fuUv/wPJgEA3uS3bgHwI4AEAL79R/5JM0BAkMBbAHwVgL+3dbxHzHtOooJ8pdZRbpqWvRxYSn7XdtPH8oUUO+Hz6Ffh02z9hio78x359MUHwl/DrwJfkPSxGG8rvyPjhU45/eiPjuiLf2iAAfmMyVwYfztG6rzhtSn0WX7qxsu8G++kzcTCbQ3fWcSVxadjXEOeuaBnb0635cz9UGIDZ0rAkIACPsGID2hSQVGlPBg8EAYD8iZA5X1rz4NEn6WJh7r3lj+B2zE8Y8+1r/M0nzbp8R5yadOlvOtCe3lprh98rm3dC3v7p733OZR8JitP/pSP8lp09zzG/k7dc07O1/lD045pf9cHmuvqOkMJArAH677kSn72UVbKz3FTn8qjcy0jj3zGTzlzfEsGZdpEmvaqfNp1jt/bK7E291bX3o+7/TGtZx/29lPWnbJfz9GnpVvq5bxqWSvf0qfKb7V5zDL1U4fMyyeFN9Gn8sqxLvOL+IcGHIfGE6wZAACI8UbVN67eAsgAALcA/P41NwFoS9CgdxtAwDcXBDAgoD49ynyyzvyheY768wcIWAftn2si75pmAMC9IPifA/6AevZX/V0KbqVkMCr/i0rkXiLwd//VQ4K/jUsDAAD8d//YP7l5zz/+/3V/DJA2/hbAx7zxbd9bx7vAfOv8RU3P3g0tf/vTbzjKF0AusqQrHln4Lfo9+DOU7elwQCfkqpe+FRgB/+roAEDoh1xls1+QjQ+I74ZcEtiFPHNgLmv96Vd13uRXxeuPtjf/bKmGmG66xiK4GC5Ii2abPb69IPvjXmq7lzebcW9epdwHoUcrKBA4QNngmXwwpQmAkhcgVcrDAZjyrX8FWuYBYbQjaMBD64PrQwaljHrbCeQSqN0XX+dlHhvApy3ksRl8Uu24lLIWtM01kc91g891rWu/t2fae5xDyOfxvg+k9nMXeznnkHNz3tpBG2lT7Q91naC5N9w7UPYWt0jci1L2Gn1SRsp2vNRDXh2llidVFmXK6lHbZH945UvTTsmnLVv83v6IdejWsVdoJ13Sxzb22ey39l7Yr2NPuj97lDb56bWznLbn4JUhTR3k5+psU6l9Ks121mXZQ/JLx2+1oyzL5StlPpY5t0N5262pQOASqEANCmgCnAGgeAvLW33euvLG3/+FBtDF1WvexHoLAPDl1wHoYxCAN7j52wACP98CQxMgCtqkqVvlBZ1JL8Gez0UH1iNtX9eHfK6ta+4ecJ/55t+3/gSe2D9e+Wdv+Z1/AlEEofDhoN4AYO/Rj0ACcnP/XOJ6TA6D28xL3/3jP+UPAXL9398CAMzXxG8AEADg9wBqnfm8BXBh/y2gZ2VS+Fbe8g1d/c3GZ3jhlsLjW1Q/gnrbyM/S1djK0K/Bj1mPtdFrqkeW3Y6lfOWgF34VuAP/za8a4+fhW6Xe9j1EkU0/dFS2eASKbMq3uqNb6rrj2XXaG55PzW9Kn/i/Tjpp5ckffOt9aPHW9crZGHsj9+F4ljLnVvPqY7n5PmWDHZF8OCplU5sEEFAfRmkFJQIXKQAJPoFS8oAoHsRDQQCBF9Q/NvzBIfl9SICaDx0PHgn50gR5d+HRn/45j8o7Z+2QFJuRr7aby2Nv6rV7j+ZaybuO0LrOe3tlf++795LC38en9Szs9nrs6zoP5+ic617VtrkO8LludU+4b/iDUfcoe5CgU/ZXtmO11kv9WD91lNY1rXLM064lO/s7DlTbJK32a+X39kbYf1K3v2d2a3a/dezBumfm9qVt59o8RF3qkTxjmz9EH0LP+x7DOeY4lkmtq3nLodZJs24Rf2mgRPAGcAKoCcoAVYAr3vYD/Pn7x9XrGgAgSEA7bgEA3AwCZABAcAZAEwy2AgCCN6m6SQWd5OW1Z6vMukPUvofaPff6tJM8tCbWz+R698A/e4MAAPslwT/7KsE/ew//iwRPEKq++XdPpT6XtmatQ4L/ChDQ7m8AwJsE9dKv+87/bB0A4CaAZS2KLL4GcAG3APKshD8uFV9A/6H6Hfof1rfoxJdoyMVvSTmzupb+yHZMZODj4bfhz5HgKcN3sp2UvnOJduhGX3w//ETkkcQhlCt7K2vf1mw/10NK2bP69CZuOXQ/HVikrdHn2rXkTstYiNTjUH5fz6m8JfV1jBx/Sf+jAiRu+qQJGHwIfcATbAhMpAKhFk3AJO9DyR+RBPpLefoR0RP0S5EriIOvifEpS5p8rat52vZSa+7Yh3LtdIhqY9rJ96jrkrSuX64t/N6z0d+j7MX8uBez7C58lWd+f5/Hc5zzybmmDbRX2jrXpq5f3SPm2UfsMRxu92UGAVJmjuX40tSt8rZp0dYeaJXRN+WmXeTTbpXf2xNh7726/n7ZX7fztWWf5f6o+65VZ1lte0n5a9DxMeyVdpGv9M56XRogESwB2ABQADVAGYCMK9iAMEA/twA4k3jzCvjKrwF4C6AXACCokABQUChgEywmRS/y6neIYlfaaN/kLVvaJtsPfvrVAe06tx65jq61689eMMjkm3/2GgGn1pt/9h4BKG+hsAcpY18SdMq3/+4ndbvEtWsdIPxXgPWHAAkAtIA9vwPADQB+CwC+1YYyvwZAEOC1H/qRb2qN+4BlnKMmhpVv04YvkP5D+h36QPoyd/E9HAMZ8LN6Fh2zL7r49p+bwiTAOj4guts2qT7PetyQTR59kInvh3+4CPwjo23nVfHWr4F/th82H58W3d+YGjQW54WlfHshcgz1yLIlfK+f5UupY9m+l7e8TxfaJDe/vA8vNB9yH26pDz00AZE8Dxp8BV3meYASYAm0ehQAxtcD6McDWJPgrUUZk3LHbuV7Zdmn8nWu5qVpo8prRyn18j2a6yGf6yXvWkKbz8f+s+Ceg/Jhb933J8eQn+7pso9zXs4192naLe3tekDrGrb2i2VEdvN3AQwCpDzHybHhXZ85WvvkHki+tmvJT3vAp60q39wTxdbrNvv7ZLo+91PPvsv9kPuwV55tBn/5FnAdH0XTSwQlAiYAFEANgAY4442sP77GW1cDAHwtIL8G4C0AAwCAMkAdgQTSXABAgJigUV69KsWGlLVolmnr2tY2yjVv+0GnoF97pB0rry1dO6hr2wL/+eZf8J/f+SfABNAn4GQAgP3n23/2HPuNfeb+qgEAdVT/S6CtQ4f/CtDfAfD6f+8GAOAe8E8QgP8VoBcAoP+nveVd61sAH/HJX/xzrXEfqMzzFrpLvb/5pbz6D/oa+CH6P/pE5vF7TvVDHO+gD9LRk3HRB/8N4M9tYSh5ytHNMaCMI12PGXJtRx/6ngH8a3+W3nWpPPln9amGMK+xdjQWpy7WXh4D0z43/T6PoXfyyW3yS6l9a3vLk9Y2p+ZT5jIeO3SSm1zqAw5NAFOBiA97Uh6SmiroMs8DuTQIwBUeInoV+JsHtMEL3qSMBZ/U8XvU9r165mddnSu2oCxtUnntSLl8j6b9k881knf9pM31nu519k5rD94W3zvJ8Su/2ddlzzo3qPPOfZp2TLvnOrl2Sd0vlbLn+OMB+Dc4RRCqtcY5dq7VHJ99lvJVXtoBPm0k39wLxbar1V5yXm7WZX8fLSl3r9W1trxFswx+fJ6WBdwLp87q6P6XAEJSB4EbVNDmG1qAWf4YIG9hAWAAMwCavwNgAAAAByjLAACyBGgCQYGhgE2a4FE+9evxzCfrzPdotoVPewx+Cv61T4tWO7pm7iPW1TV3HxgU8to/e4VAk+CfveTVfwMABp/YfwQE2Ht87YR+yHF/uY/U6xLXsnXQ8F8Bvvr7f3bR/wQA4Of7/wQBWr8DkDcH/BrABdwC8Jzc/Y1f/f3XP0iqr5Blyetv4K/gB+lH4X/D6xtRb9uT/JKpj8GyMYddKv6LOuIfoQd+GuCfBH5AP3zCY3RBJvKYE/3BLMiFkqeceTq2tlvT1HXHOw/o+IQFdht0U7hb6J3xdmUsPuWHaKvvfhkj5vjJ17pefqcbLabyzB+SaztpypTPuuStP0yxWUluYGk+uAk4KkhJkAXPA9FKHhJSQTYPEn9UBFctygN8V/DvuOeirTlaVm1CvtptLp/2rnyui7xrlrSu72qjtPaF+wd6CR905DPVNfZqzhFeG6Sd0ra5Fq4P9Jh9wF7NrwTwNRT2o7JzPPjUZQlvnyqn5luynD+02sb83l4Ie67rqr2Py7teS2mucatPllWe/PgMC9zJApcISgRMAre8BQCg51fYeesPEDMAkF8DyP8SEFAGqAOYCfYEaIJBKGCtlRJEyqtfpdjSMvlKra8U2ZZlH/iR9m2ArbSTdkvqWkldW9ecPeB+aIF/Ak35o3+Cf39/wrf/lHv931smyBb8X/q6tg4Pruj/jh/75V8BvAPaoV/6Fe9p/leABAB4808AgN8D6N0AoDxvAbzm9W/6wdbYD1DW9Kf0D/Sj8C/m/Ajb0Ya2+Cf4QPhS+Ej4RCby+Fn6NvopOab8xD/B99A/WeKH2HZFlYdu+mwGAADtlKGP7aSMBw/NRBl6M0f6zoH/7Lfl5/Vn2asv9ABb4fKG0AipmWXTjTtv0FPaMqb95M9Fcw4tmZTVj31qOXnrqr5ZbjvbzNOy4dm4PhRSH1wfeh/8BCcCoaQJtuQr6OKhooxDI69a1yAAdbQh4tZLyGqlOuZd8gLHpM6NucOnDZL3sEy7JY9d51KuQ/KuU9LtAeT67vZ47gf3SotS9lCfw/vXedzSnGvaIu2Xts11cL2kx+wH9iB/UNifRJSRm+PApw7yqSO85ZVWWeZrO/MpN20iv7cP0o7tPZH7Y45nb+S6zbXNdq1+uc9sm2WDHxY4qwUuEVwK5ABPAKkMAADmedsK4Oftq29hyefXAABvgDgCAAAzAwCAs1YAoBUEEDxWqn6n0ApalV1lXeK6nEMn5nmKHPslrTbLvHaFtsC/AQD2Bck3/wSYBP8Ekni7T7CpXv0nAEAwgD1HO6//E1RwLzF26nTKvO+7T+sw4W/tq37pn24DAHx/H/BO6gH8t/7g//gbBABavwOQ/Qgo+FWAB/4fAfLvqTx0+6v76Y/ob0Crb5F5+9AOHwhfCt8IkG0ijz9OHe3wWZShfyKd+Cn4FfgpU/+EJZvov61Pn2bFI5PxwAm8tPHtP+AdXdDBcZOux+zIEqP45p95MW/mhIxW33XZdA5ruzOR1afym9Jn/m9dYA0l1WjnoCmzxVuWFN5P6krZobz9pL32S+tp15LRKrNt1sHvUmPj58PhgwsVfEB50DIl0PJgEGhJK+AStHNg9IIAXL/2yk0rAIAMypUFrePUPPpQdgp1LpXW+ZNP+7T4tGeLT9snn+sj3zyIcp13vHsCekmf3KPotWiPpl3ShmnvXJu6bnVv1Hy2p44/BPxxoTzHgM/x4atu5mu7Y/LKkLr+SZt7gec8bXoc73pIXRvzUD6uYeXXlZ1/ss8x/TriRvGwQN8C9w0wTpUvcBLAAaoAV4D5/DHA3i0Arm4D5ARmcwEAgwwCxUoTTMqrX48yb+qkrXbKgma9fU613aX1a80tbXNovq22WZby4dOuriX7h2QAqPX2n72SV//5SgkAn7f8gH2v/gP+DTwtvf6vjpe2Nq2Tgb+lBAD8IUB+B4AbAHO3AHqBgVpOMIEAAOkRbwEwbf9mr0E2c8ZnwG9Jfz391pYPo6+i74MfhM+Nj86LEZM+u35SykpfBX7rr6SOm4Xa6Tyt25Tj00RiTugPHkAPf/wP/dDXOef42V+eevRFd2SBTwxqIF85tm/Slr67MtdjM8tNeZZVn8h2T4rWSWZ+s8A7g91H/hiDq5u0txC13nyltf+hetvbznylWS+fFL6dXt49TPmAwLPhTR4AUA8BKQ9HTTxEmSrAErjzoPmGtd4CAHBR30vKqLSOhR6UnUKzT84Hvs6ZPDaRah9p2rDy2rlF67qQP+LwYa+49u4b94b5x6AtHdRzR2N/Mue0RdpKe2praa5RXb9j8ilH2VDHlaZOPd62S2mVkzbo7gXstlv3nT3ny9gHtpWfo1nX45GXdeZviwcZFrh/C1waIEkwKJgToAPeAPK81ecNf34NgDe0+WOA/g4Ab3bzKwACQAFhpQLGShNUVsAuuFtKlcUYPVmXuC7H6rTUHsqlveufvGXSrKtjaFtorqHr7Jt/AgDsJQJKvv0X/Hv1P9/+A/4B/YB/r/+z37z+jwxkIp+x6to6x0ujrROGv518BaD1Q4AV0B+b5zZA3gLgb31Lh3ss8++sf8/XAQDmjD+B76L/o7+MH61fq49TfRTL8YdoD0DGT/eH9wDgvCzBZ0eWPhJjdv2Wnc+x03VjmP052Db8QuQyDmP6oga9GB/9u+MWGejovMQc2IYy9X8h+nR5dZyn97j01yPaBUZj+aTwd0092ZTzyfFa+XWj2396bQ/1U4b9zbdotkm+NUavXrnWJ4WfptjU9WFh45vyMPAgkCZAgvdwSepBA03QzsPWCgJQ5oNYafaXT/nJowP51CX5rOvx2R7eOea8sQV5bZI0bSevXVu0rkPmmwdPXdPpvnb9cw+5Rx6bqlvS7v5k7mmLtJ12Tbu7Jq5TXcdDeftJU7bjSVOXOd72c7TXP+cOf8RemNp0s+pp89wbc23dL/bNfq06yyrN/rVu5IcFzmqBSwMk6iOwE9ABqgRvgDa+BsAbWr8GAEAzAABw83cA/AqAb3wNAAjUBIaVJngUzKlLUvVcShOYwrf6YQPKtcU109b8DpXl/LWDfawznzTXJe3s2rr2LfCfV/8JHvn2v3X1P9/+09ZbJshlLPdL6gZ/ievYOUxefOk//S9/vgYAAPt5nf9Y8G97bwHwY4Af/vrXv72jw7mL8++qPHQvAIAvg/8jkNfHJq8frL+DryIPxR+iL30A3fjq3OYl5Rt42tFXfyb9l63vMvVdsYd6J7+Zg21XfqD9kc04zoNbCPDoSZ1j2r5FaUN750R/+JSR/bq+18u3eqlnmzov5yml/Fl+qgHMJ4U/NmFM+8hD+Si78uvK8s9c26wr3bZjtNq0ymr/pfkqq+ZTjnXQXXLj3lIfGqgPLzRBCw9HJkFSUh4iE4dKTTxoPrg1COAPr3kwSWkPb18ocqU5BmOTTx2O4W1bac4x+bSHfNosD8O0q3zavfJ5AG35XMMpz5q7vrn+l86fZX9qe2mukXxd05q3nVRZ0CVrWp8d1/hUenA/7Nbbda/UPSG1PvPyUD6uxyY3zc/V2X7QYYFHt8AlghJ1EkAJ5gBXgjdAFyC/dwuAN7O8yRWc+RUA+gsEe0EAAJxAzkBABZfk1W8JtX/K6/Vz/tdM69ycfy2veeZcy5bmHQOqnVvg3z1EIIkAkeCfoBKAnr1DEMmr/775x+/yu/++/adP3jBx36BD6n2pa9k7gAgA8D8BcP3f/wqQrwAI4u9C8xbAx7zxbd/b0+Geyv3bvKPh2+O/4Nfg8+A3A5oB8iR4r/LjO7f8H3wgyqmnLaAf8M++MQhAOfX6S/g96cNsfVj02vddMAu691PMB12YB2/+wQbkmSPjTca57ZNl+mnOB5tk/yqjO4eG7Fn9meHOn9qt06b8Sf/rZNMAyVvv4tc6y6W13nzKoYyPZZvcNJ91yds2adb3+Gz/GHxPL8r3U2zg3OQ+IAKXBD8JijwUeHhMFVRxIJh4YDNxYHCA5FcBuFJEG8G/NPvJK1fK2PBVh3PknZ+02sFDL20Frw0rrfbOfB5WE761hptd5trmnsu9kOWPyadO8knhdyn2J3ZIG6U90+a5Lq5Vi7InWuWWpZyU31vT1A0+9Uve/tKsk6+yyE/2AXZJO+3zrLF2lO/RtD9t+MyVbVrs2piX2tf8oMMCD26BSwUmCQQFdIArQDtgHtAF+AKoeQuA72kD2gBnvMH17WwCtBoAMBggUEwqiJQmwJQH5FWwl8DPdtAqJ9sl79wveW2W6ua8nH/aA976SrUB5cnXduZTrnaGup6uc4J/9gXg36v/7Jf6w39+7x/wT/LtP78NQHv6EkhwXzEe4+bc1H+pzR6yXe/Aeem7f/yn/J8ADAAA+s9xAwA53gL4iE/+4p/r6fAA5f7t394CwIfAp8G/wUcGOHt9HjCP383V/rlAAH3xm/C/vQWA/05i/yCH/rRhrJY/s/Vjdv6JulazWD6lt34g8tUFij/V9JPwlUqiHe21h7q2+luWFN58lb3N788v51Hn+mzzGMWPBiIvL7VMarnU8qRzPHW9DzL9JG/ZtdGcgzx0k+LhcGNLfYChPDAmHpiaBE4eEjyUJgG6VAAP5dDJAMDcLYDspywpY8E75jlpzk2+zl/bSNN28tq1R7eHR6zJusy1alP2o+taefLX8FH/3b50rsUWaTvtemh/umZL6dza5pjwqQ98Lavt5/JVlvm9faFt9ilrnbbMfG8f2N76Y/P2G3RY4GIs8JBg45ixKvADUAnoAFuALsBXvQVgEMBfZ6cNQI/2vVsAgkPBYtIEkwK7BJsCPSl613r1zv62E8BKsRH8Mba6xLbOR4pN0pbVRmk/+yyhLTmO4zq6vuwbAwDsCd7+sz/81X/f/hNAIpBUwT8Ajv2Vb/+R4b4S/LvOqf8lrhE69Q6iXgDgLm/+sy+BBP83AHzBnh73VK7/hHj5bRAA3wOd8IPwpev3+bmRC4g3EEAb/OjqN1HGizna0Yf9g9/OTQACCflGvvpDW18m9dsYQ7+jRXdzWfXDL3Ie6Ia/RtlWdvEZW7agP/2g6Njqq/+1hLb6T8adzjfns5n9pl7+yVMX2YlmXj4pvIk+1lWePJ+s35T0/z2mbV/K5dc4T+g0lQcmN3wCFh6WTBUo5UGRAFyQLk0gz2HBoZNBAPK0Oebt/zWD/+bh4ZrUtdrl2XGuqbuv5i1vtc26x+Crruah06QtbumS/Vn3Jvncn5Vvtc+97h+KfB5SjyV89pU/1G9vb1Tb7PZA2q+uZ62redpbZt9Dedu1+mbd4IcFHtwClwpM1EsQJYAEZAHoAF2AL675ewsABxvQ5g8C+gNttKsBAN/YCg6lgkapYFLaApxzZfQTGNZ2zq1Fnf8105yXc692tTxp9lvCZ1/XyXGgrG2Cf/ZCBf8Ekrg10rv679t/AgO08e0/gQT3Uq5z6n3Ja9g7cF765u97T94A4BbAOW8A5NcAHul3AJg6f7t3aeU36Wfgd+gLtYIAgHhAff1xv+ov4W8TQKCdXwXgnKIvtwOoZxzGc2zo1p9J/Xa+hz5H0t08bvsgB7n4ZDnGVvZqvpP5x1jqov816UO/26Sutl9K7d+k6IH80OeWX5Hn+3GxsUDyWiTLkq/trZMu6W+bc9E69rnknlOOOkJ3iY0ZKTe8D4s0gVEFTnlQZBAA3gCA1EAABwmHiEEA/0tAgwC2S6oMqLKT1rFPyTMX+uWc6nzJpz20kTTtWPm09x6fa7PPsx9cx8qTv6ZPzgO9ze/2JmWxN+HTltpamuvRWq8lZSlDuUlz/EM8/XptenV1vuv8/D7QbtWGuRdabbL9HJ9yBj8scNEWuGRwgm4CKUCeYFpAB5Dj7S1An7eyXK8leQsAoObvAADUCBr4tlZAKPBPmuBRUCewhCbg7PHqav/aznlV6npQLn9t1Dm5fjl37KKtD9lUOS2aMuVTnmvoWKw3a8+eYS+0vvff+i//AP6kQ2//GYcx1SV1vuT16x1ONQBwrqv/eQvArwE88u8A7Pynlb+E/6APgs+Bf4Nfi//MtX2APOAdP9zEizjAPC/iaJd+sH0zCMAZRV9kUU4bxkkfZ+3HoM/Ul2ktl75K0s2cYi7MaS1zKm839yxn3Nu+6z7krYePpK3ORVP2mnfcDW3N/8mVuZBObC5vnZQ+Pb7W9eRb/hyptmtRyjYpHgA2aW5+HuJMCZASUNVDIoF3gnb4BPQcNAB/gwAcRhw82Ua+yiGf48zx6DdXT51t6lzI51zh0w5pnzz00o7w6wOg2Hpb5lrsU/at6+cernnLr5E6lxalbDYIgF3T/rku8HXdevnaL2XOrWld41Pz232Q+2N/L1Qb5XpbZ1nNU55l8lL7teiSNq1+o2xY4EEtcMngRN0EU4ArgTWAy1sAvI0FvAH8fVPLLYBDXwPoBQEEj9IElskL9ipVR/rD13rzzqtFBc/a4Bppzss5az/WD/ubT2rbpMqiDD7r5JXhus2Bf67+8xsSvf/yz+vagn9ulvD2n1sCBpUIJjAHwT/jq5/6Xvo69g6bXgDgnIGAvAWw9vd6ytxvOX+rNyl8Cf0SfBl8IHxa/GcAu1f6AfGCefxwyqnXz06/mLIaQDBwQB1jpN+09W/UbUqxSPoY8ru52D7mtJ2ndXO01y/LV7x2WkKdH9SEHwkvtc16PzDWVMdVdv1xvuYHXVkgjZI8xqn5YbDlFtB20F2aeRDc3NIESwmo8oCoYJtDoSaBPZFDAwBQggLWJa39GYOyOlYF89aj3xxvfc4DPucIn/PXJtLWwfFCse0kn2sw5VnRXKvMwz/lz25fapNiw2pn7S/NNZKv61jX0nbKkNaxzE/W8YB+9qm0K8N5tylrX/dGltW9YdteG+ulvXZV7sgPC1yUBS4dWAqkBH2ALACeADJvAQDQAG4kHHOCANwOAOhx5Zs3v7SvtwAEcQJGAZ1AUiAvwATkCfaSWm8/6wSoSXNezi3LLn1dDumXc3F+2g27YCMDMGkvbZi2OsTbR7nIcy0Zo77593v/fuefmyLcIGG/EERi72QAgLxX//mqALdO2E/uI/VXz5z7ITs9dn3vMHrVO7713fw3gIB0r//n2/s5/k9+w99f/L8FeAvgEb4GwN9u/37Lb1+epN+BX4Ovg/+D/8wLN3xuALy3AKA1CFD9YvoaQKCvAQDkIZtxGHfi40z9GZdLvcknn/ndnKYy7la+0G9zLvqE2lA76lumjfQvtf3aDjvdnfugYYG6+FE12DtaIG3bfmgOPAytzT/3AAi2pQngE9hzYHDYGATg8MlbAPSjffaHV26lPISWyUsp7/HWUZ/Jh1sqUISmTXzQk04Ov2Lf1Xq212FXfsyS5/oe0+8S2qp7i05tFDZMO8vneuQ6LeWzP7xyk86u6Uo/2tY2rbLaZpvfrX/OnXXSPkvXbK79XN2c/FP7zckcdcMCZ7HAYwOQpeMLqgSRgjxvAfBWljf+vKn1rS1gjjKAnqDNAIDgTRB6KAiQILPHCwShthEUVpqgOOucpxT7wC+106W1cx7OUbtoK9ahBlxsA7XfHLW9MqG5rqw5wZ/83j97wl/8Z48A8Nkv7J8MAMBTnj/8538t6Z5xvdHR+bpm0ktbF/XpHSIZACAIYJoD/q26Q8EAbwE8wtcAnDp/n3dp5Y/gV6T/oo+DT4RPi9+Lf80bfW8D4I+TBPX1JgD99KMNINDXWwPI1H9a4Neou1QfQ0q5/G5uOc9Nz2yzpM82QFJt1LIX89GPFAtoA+ZLEpdQThvaK2tth6nO6rvRfvw7LHDPFnDDJYXfpdVhsX1gV7ybV+rhkQ+DB0k+FAJoHwxpBfECew4fotQGAThIaGugoPYzr9wW9eGU0uYQTz2ybeucpB4A0LSF9kmadtzj0+b7PNsg1yjzlSf/FD85/93+xC6rfZkpbQ6f6yKf61Z521Ra5ZLPcc/O7+8D5836ao/ksyz3QC3PfItvleU4KXvwwwIXawGBwCXTBFWALAAfoAvgCAhr3QLga3L8feStLte2uQUAcAMELg0CJKAU5Ak2K1WfbKeuFbwyn1qW+Zzvfa/LfQHUnIO8c3T9tBnrMRcEoL19odX2ysu3/u4LgL/gnyBQXvtnXwD+8+0/AQD2jUnwX3/4zwASY6Z+zvW+7Hru/dA7mP71z/qW7Q0AQPqXfsV7Fr/VF/RLCQzISw0WIPctb333zSP8d4D+DYfuUvhK6c/o6+AL4dvq9wrmuZXrW314/HODALTVH7Yvfjr1JGTgQyN74jOlXlN/prdslDuv5C1LmrxtKcty8zvasY+20k7QtBX4gDkyV+edWEUbHbABevJRx03uGf37bCd+AWus7XcPw2YjHgWw2OCmeijwEJAqOBe8V8o1JAMARKo9cGo78lWmecdbSulnW8bjIfYrCDkfeOcJzYPBwyLpLDjUzm3K1nBtLmCbPLgKOXf5o/coa5FrdAyf6yg/u57xR+Skdu194JxzP2iPuii98tpu5IcFnrQFzg0o7lOe4EoQKID0FgDgzlsABABI/F0E4HkLgCDAXb4KwJg1CTwpr+A0gWvlbVvLyTtXKXa9FlCZe0D9oc5TwO76CdbTjtpYG1VqvX2gysk3/gR8WHOu/XNLxDf/Cf55++/1/wwAwFPOnsqr/8hnLMZ0zXPNrmmteofbp775c7/x477mx7dv/gkCCNp7tIJ78qYMAlSerxgQBMBP7OlzT+XpB+g/bP15fZnqG+nXCubxrw0E4Av7Zp8gAOX6zNU/phz/mf741MhlrK1P1PZzMEXVu5pnrr5Vl2XKsgy6S+G7pX3SRsyj2gasgD1I2Ig8tmH+2ke7bm2Q4260Uid1HHRY4N4tkJtOfvdAuEnjweAB7j0cRsZ8SPJQ4BAw8VBk4pCoiYcnfw8AvrYhjxxpypQX0CdNPVrlPMhEPD3skJVzgfeBhiagrLbBXnsJu1KuffcpC5/r0cpT9hw+2oG5ujeT35Q17FzXgnyu1Rzf6kvZ3lo6LrrB73RU151+2ca20l6/TXnOF/7UD7rkJ/PJ06bms9/ghwUu3gIJ1i6Zr0BSQJjAD5AHUAPw8waXAABfBwDE+T8C0AZQuDQIINDsUQGoQFC9oIBCaYLfbFPrbZfzvU9AyTjnXndl5hzgnZvzx2bajyAOa2IeOmdzALhJwO+b/gT9ft8f8M/eIPG7EOwH3/4TAMivALB3Evz7OxJ59Z+xXXPnlfM9t03vS17vgCIA8Hu/6W+84tv/3g0AQb9UcF+Bv/W1nPZ+DeABfwcgp83f8GnC37hN6ePoC6VfK9DVx8433IJcfG98aP3j2j/LJ/7TVK/U+RQ+fZVDvPZgHPkNbdgFnbEN89IezJn5Z0AErJC3IwwAaB/6a2/tH+OfMufRZ1jgJAvkA6IAy5JuHgofktuHw83rZpZ6gPiweBB4APjwJPgWpHvA8LBkIgjg7wHg8ADMs14+5ci3gH2W0U5dkiKTMf3hEx70nAO8c4PmvLWFVFs1qXadp3V9zD9nmnsUO+z2admj2N216NG59at9muvImKnD+XnnCOXj/Cu/rlz4T8pY2GU0Gxa4LgvcF7C4L7mCLEAXQFIQCSADAHILgLe7XN32FgCADoCXQG7uqwAJQuUdxzyUMaECVYFtUsGh+mYdfNa3eOcLxaaV3sXOyrqLjF5fZUNNzk8baDdtCZDPt+tpW9tCsbttWUcBv2/6Bf1e9/etP+tPyrf/BIsyAMCNEcC/V/9pT39ksr/y6j+6uIbOMefds80llfdOKwIAAHMTQH1JEuAvpcgkuMCPAT7w7wC0/r7v+Unp36QflP6tvq8+Mv4xfrmJPHXpF4sBqkzGW/tQ+z4SS5U6H8v3lrqWV7k7mzA+vtwqVbtgD+bHXAH2AH/APi8J/X0E8iTqwCkGANI2yl2PM7VBzj91rPqP/LDAvVvADTh9OOIBWW/g8qCwuesD74PjIQL1IIEK1qU8YDXxIAHG+ToADxsHT7axb4s6RtIcv5Yjg0geY+FY8TDTJvWH94DM+cL7gEO10YRqw+nDX+3MAucauOCWmX+OtNqg2m6TX+3Nid1X+VybY/kqa5KfX8u2fof7sLbOtdJj193+c/1qm8wnr4xWmXWDDgtchAUuCYwc0iVBVgJqQSHgDBAIYOPtLmDOIACgLq9y0w5AB5Ckn8BOUA/47CXa2E5gKqhNmjpSXtsKiA/RnLcAE1slf8h2vfpzyEjZyoO2knPVTtjEAAA2dU20b10Dylkr2gn8AeeCfr/nL/jPa/+Cf97+5w0AgwCAfhNBAdosufrPnHKuaY9L53uH0Md/0ie+M8F/3gDIt/kA+KVgv9cOGXwN4A9+4bt+safPPZb7dxq6Syt/SB8mfSH9Wf3bQ/57+s/6yPRRTsqGd8yJLvt+zinmcJ72XZrf2QQ9bu2i3syD+YALwCEAe0C+oN+XhOT9gUQwA23BKPQTLyjTMYoN1HvQYYEHtUA+KC1++oDEQ+JGdmNLffh9eA4dIjwkmXxwEuTz4OHsAMwB6LS3XfaVz4MJPhNtMi9POQ9vHceDTcp8TDlX5w/VNk2aB/Eyng2Ra/OgG+RCB9MeSQ/uVdYj12kJ31zDlZzbNdkfc9ma9vphbuvkk1ae/KkfxqmfVlltM/LDAldhgUsHKC39BFsAL4G1IBJADwgE7AHiWl8FIEDg/wog4MwAACCzBUAtlzKmoF4qsK20VS8YXkKdc1JsQ75loyVld+l7SL6yU19456p9tIvrxzoA7F2PVgCANWbd6ht/1rQVAKhBAAMB3AQwEMBe8XcA4AkW0Y5AAuMwpuuOzurPfJzjXdfjkE3vo753SH3UG97wZQQAem/954IAX/mtP3lUUIAxGOuRfgcAE/g3Xb9iQ/FhVil9oPRn9XFb/ru+MBT/GZrtlZOyGWuddv5N6tVbqruWO0bKsWxjB/VRvxVFb+bAvMAZ3AL2ij9gH+BvIk9QgHpwCm3FJtoFWcg8MH/1Sl0HPyzwoBbITSg/fVA6D0w+7B4AUA8GHgaToFsqcJf6AEHl8808ETbbtihyKW9Rx0zKGMgX/BPNo0x9pc4FmnPMuW8f9DhQtg8+ZdpvnrLoaX/yfiw3/5TpkrnaBrqf6jrc5uua1fx6zTp9m+NMx2ZNUq+75Ol77Mexl/Q7pu0SeaPNsMBFWOA+QMV9yhRsSQFggDFAGWBRAAlwA9zVrwLwtldgx1tjwOZcEEDQB0V2AlPBq1RQmNQ6qXUC4aQJkLM8eectxdbwp9r8Ln3rmMpKCp8p56ItsI0BAO0M6NbWlNV63/4L+qGHbgH4VQB/B4B9wB7xBgABAMC/e4TAgXtEXdADfdGdueTcnHe1yyXne4eQAQCAOW//v+jr/9Y2GNAD/wn84U29N/9ZjnxuATzS7wBohqlv1PGD9GvT14XXB660trM/NH2qrT819ZP0PaTomry63wd1HOjk7T+6M08whOAfTCDozzf/gn/acTtZ3EH/tMER87+PuQ6ZwwInWWD6kNSHtwCkfODzIPCQyMMjAbhAvQXmLQOQ8xByC0CAbl1SZVX5vTwPrXJTduoq7zygOb+c9/ZBL7aZlFc7TvMs1OZQ2i2Z67Areb5c2kI+Kfw0za3FMXVV7n6eVZmOfThvH2jr49xadaNsWGBYoGOBSwYnc7oJvABhCSQBi7ytBbgB+ABzva8C+HY3AwAJ8uWTCkYFggL7Fq1t1FOaYPhY3vkLOqVzNmvVndqvyko58HPJuWoHbSfIx96sYQ0CYHsS9axZAv4MBHgLwDK/DgBlTxgI8CYAeyQTNwNoQ/98++96ordzyHlWm1xDvnMsvGAAAPBfr/8ncE9ewN+jtqUe3nbwBgAe8XcA0ofY+if6rfqy+rX6ufq9lVJPme2kyoEqG7rA9+0t1TnLqw2QvbUFPLqiO3MDU/CikVvB4AOSV//h8/v+Ffhjj7TBdv5lvBgfXcZnWODRLdB6SFDK8skDsy4vACof/DwQPCTqYVKBeYL5yvOgEX0DqPNg1nryGQAwX8fIvDcLePvPQ02fqmM97HJeOd+9wy5tgw3JJ+0fCNXeq27rj+XmB923gDY6uFfX65Fr1OOXr1mOrWaWke/xWWcbqXKyTZYdw7dkHtN/tB0WuBoLXANIqToKNgVfgDFAGUBSEAlABMDxthdwl18F4FZAfr8bkNcKAgBCTQYBMgAgIBTAJqXOZLmANwFkAskWb1mLOv+0R7XVXN7+tlGO+WNpypNPWueQ9nDtsJm2Zk0MAlBmAADKurjGLcCf4N96AgAGAwD4BgD83wCg/k4E7QgwMIZjo6M6M5ec27G2upT2vYOKAACg3Df/gvS57/wL6JfQDAAYEOC2wSP9DkCagb//m7TyddJ3xT/Hz03fOP3rLE//WL9e0KtvnLK3fpZj72jVLfP3ze9sgT639tAOzJ0r/eAMEjiBBO9V/x7wb4L/lfzVhKZjTmdI3fgMC1ycBdyYSacbmc0dKR9+DwSoh0UeIK1Dh8MmD5/kuWrDf3/Em4/6VQD75WE1x/MA+50eAwpVN/LqDc355IPunLEDfNqjy+8fCFO7brZC2v3iNscFKFTtow1RTX5KV2vUXZNWXU/Ortyxkp7C0+cSPtpUXWre8kGHBS7WApcCRE7RQwAmsAScCSQBbVwT5xo3b3S53s3fRILYBAPIU049ANEgAICvJsCmILAGACrId/xaLnCEqu8cZW5z9dZpAyg2lC6xp31r22Nk2Nc+ypyj6g7VLthN22Fj7O0a+hbeMinr5C0Awb10LgBAGwMA/gaAlKCAe4L9w9q75ujn+tX5HWt77fbYtHcwEQAA7BsAgALaewkQ/1V/5SfWb/WhNS0JChhwwGfs6XXP5f4N3/hCt36Ofiu+rb44/jY3bvGP8bfxs02UUUcbfGv95eobK3fiC+/8pY0Omwmr1z1PfyI+x9xe/xejiBmYp/PWDhX0iw/EBTnvA3NXB+lEwZEZFnhsC/Q2puXQXSrAKR8EHw4fMA8bDw8PHh88aIL+ygPWva5f6+ybNOUm7wEHpTz1SR59TTmXnKP8YmCJ7bBZ2rDNsw+0Ofz4LLOANtvt0bZ9N/WuRaVzfXbrkmOhnfmlvDPKfpYNOiwwLHCCBR4bgJw6fgWcCSYB34A2ASKADoDHm3+DAATHuRmQgA8wCdgE+JmQkQEAgf0cFTDSRmAr0JUmCJZnTvCCS8sPUdtrk6U2rf2O7c849klZPb41D+0BNQCA3QD52J3kmrgOBgCgrrHAn7WWhxoISEqbDAD4Y4Be/affc3j7z/r1jgwCAID91ht/39hnMECAL/D/uu/8z24yGRywXVLrDAC89kM/8k09vR6ofOfvrHwd/Fb9cnxe/GmBL6AXX5vkG3DfgguIaavvbBBAX1j6Aj4Vad+XeqApb4dJ/2pjB3S61U9b6Ptji8QLdZ5iAedZqXLXtD331Ger5GCGBS7NAm7UFt17kNz4+UD4sHjYLAkC8MD5EFagz0FEEIDrONmuPrBL8zz0tPXhlwr8PdxyHjk/eeYOrw0W0/0DYmfXzW7Q9pe2Ny5FH+0jRS956LmT8nMMyvJjXZZVfkmb2ucc+TpuzZ9jjCFjWODRLLAULF5quwSbAMwEkgJEwJ9fBfD3AAgE8F8DZhBA4Eh7QWcNACS4r0EA6kzWtQIALSCcZcyJfM7NsmzHXFvtaJvgvLd2KT/bL+2vXOUowzxU/ZLWORgE0FbYDju6foJ838hnIACeetaLdQPcC/DlDQS4vtYD+P0aADx7hDrAv2O53uroPHKO2uEaae/gIQDQAvqCfuuS9sC/gQDq4W1H3+S/+t1/+4b0mt/3+W/r6XWP5fVvO/km8DUAwEsxfGuBv99/l/I9+AwGGAhIP3nPD576YExXvaT3aIKmaMdd20IfHpo4Jeek/59tW/zE75/Oe2P73dxVTF3MDzoscNEWcMPmht4eKj4A+XD48OTDJdCWHgLsBgQ4cDiMcHp8g09f6+fkMFatd/ykCf7rIZDzSt55H0U5DF5uRki1LRsh7X3RG+NClKv2yrx2PZUeWg/HOocpzinrHPoMGcMCV2GBawQtVWfBmMDSIIAgEjAH+APs1f8akFsB/pdvvBUGANLW2wCAS984C+4FhUmzznKALKBW8JhUXZMmYM45WZ5tK297aLVPzdsm+2RZr73l2bbyVSb5qmvm0yYZADAIIMDvBQEMBtQgAGuZ6yn4h1Ke/xMA+yJvghBMcN1zDdXbOWqPa6a9Q8oAgAAf4C8PbSUB/jf8tZ+9aaUE/wJ/KfLk//XP+pZ39/R6gHJ9iY3fg8+5Svqv+Lj60PjXvOXPAAC/v4W/zdeMSP4aPr+dRbDAr+TiQ+PjIxf52zQFwg8w3e4Q2oEGG1vog4c9tMuxdDtf5p7ydzzj8kk9NiXj32GBC7WAm1WKmvLQaWLz36Z8gFpBAA6eBN7wFaB7MGU5Bw4HEtHIJcA/+8LXMWs+AwCpt4ebNOfHnMk796SWS7Nuy1c77vIXui0uUi33pcqZd49SLr+U2keqTPNJ4f1kO8pq3naDDgsMC5zRAtcMXlJ3QRkgTVApiBQ8Au5505u/B8BNAPIGAfItMEBQgNkKAiTor/UCR0GtOlUqqEwqaK4028gjT14bSLEPfNKWzbJN8r1+PRmOC0UnqfpVWm2hraCuHTZm/QjiQHnL79t51sb1kTfYw1qzlibyJgIAgn4p7bz5wTjIY2x0UU/n5DyX2CdtdYl87yjxKwAtoN8qE7wL/L/2+3/y5pu+/+dvoJZB8zYAfRL4K+NL//z3/FxPrwcq1/+AbtLL+18FwD/mxRpBAG8C+HtZgH/OFlIGAggW4JMTPMCX1j9e+7aOtaNMV10eaOp7wzj+zhbotLJHpvTv5/jss+V3852OsafKKBgWuC4L5MOD5nWDTx6kfHASTCfIrgC8AvZWngOKQ8ivArTa1DLGoSxpHTv1Sn3lcz7wPPBZZl6adfLUNVPLlpsy7XxdO+VxtXWfqoX7NG1pm1rXK2/1VX7WZdnghwWGBR7QApcISo7VCUBGH4EZQA3QJpAEnAMMAXiAP34PgOv//CBg/iigQQCAokBTMFgBfgv808byGgBIIJmAEr4C48znnLLcOaYsymwvrbakvNoq21be/tkv+9s+qXpUfTPvvNUfio1M2M8gAHZlHUiuYy8IQBsCNwYAvNoPwO+9+ScI4K2PXG/XUF1zjtrl2mnvqPEGgCC9gn7LkwLuAfkA/14yCCDYb9HbAIB+RU/Fc5Y7lhTZ8Lt064fql+Lj+lIOMG8gwN8CyP8SL78SwE0AggD44gYBlDkZ7zJ8We2xs0PDJumfO5dKs82ET3k7HvvzcfzKryvHP8MC12QBN/P+w3R7uPBg5IMjkPawEXBXIC5IryA+8xxMXEci+pjlLT7ltcaiTF2kqSt8zqPydZ61vuZp30y7A0Obsh/Szte0Px5KV+3TGi/r5JMewyvfPr285YMOCwwLPLAFrh3ApP4CNIGmoBJQzhtdwSNgkO/++3sABAHg+XoAYBCg6Ntg+ggKfdtsMABayzIAIIAU1LaCAAJgdZYyF/k5WvtrAyi2maOOsbRPT172V2ZPZ/XtUW2VAQBs2goCeEODNTBlkIB1JABAYl1Zd6h5+LreymFMdEBP51LnmXvvWvnecfPxn/SJ78y38xkASNAvgE/w/63v+cV1AAAqnwEBbgXMfR0AmfiYPd3OXN7yTyibpvBB9U/TL9dn9vcB8LO9GeCPBEIB/pR7CwD/W3957ePWcc882YXiqk3oZlnXLk0fPey2V78/1zpGjrtQ9dFsWODyLODGRjP57oPkAQNNYC3YhvaAeQvQU8bBRFTymK8COAb95ZOqT+roYSbNuSTPYZD5Q/ze4bHqvy7rHyKXtwsuUyP3Y2o3V2ZdjyrHevLJWz/osMCwwCNb4FqBS0vvBGiANsAbgBIgZxAA0MjbXoBf/h4AQQBuBdRbALSvQQBBYlKDAjUA0AoC9AIBAs2ltIJo+qUNksde5KXWLemT/Wp/5UB7elc9e3nBv/RQECB/p8EgjQEA6rztwZoaCIByA0TwT1CA/cA6K4O1ZB1dp2qj1t671rLe8fOpb/7cbxTcz1GBv9f8AfoC/x6lLTJrEIDAAOXQe/qfAPRDWpSyftLfXNGWr6oPrE+sn6w/jv9dv4JLG9ojb+3LMsZOh1wa9c2yh+Jz7EX22c6F+cyl3VxbcplfHfuh5jzGGRa4Fwu4od3wDCJ/9NcBODw8aJIK2D18pFw54joSkUjLkiKDfIumfA85qYeftHVAHlPWCx40D5O03+7A0M73sojPSKh2lB6auu2kh9qP+mGBYYFHtMC1Apc5vQWlALcMAvgWGXDIFXHAYAYB6u8B+FUAgaaBAICiqQYBWgGAGgRQpx4Q7gHpWl77W+/8k2Iv8lLr6CMvrW0O5enn2EnVjzL5HhX0JzUAANWu2Fvbsx6sDSnLAPOuMWCf2x4keIIBUG8BsMa0RRayBf+uGfr2bIRdrj31jh4CAL6pB6gnL3jvgf9v/7H/z42JIIA8lDwBAOSRanDBMvzNnm5HluuLJIVv5S2f0gJi53xZfeAlVDlrv/by/di0F0swtZH5Yqumz04b27dpypdPWnny4zMscHEW8KGpilk+fYjKw+MBAc0DReAtTXAun0BekE8dV4/4KgDXkMhbV6l10JocF5p6watz8pbNUdunvFb75oHSPkS0cbX9yB+2QM92lvdolWw7ypOv7UZ+WGBY4BEscO0ApuoviJUKPgGWgMgMAvDmFyDojwL6g10EBQCKfm+cdnwlAKDojYAaDEjwyDgJXuUT3MpXQKy+0LlU+5mnj3M/RJU/1w77Wp+8ZVDlSNWlR517UtpmXgCu7aCuXysI4Fc2BP/kvQHAembyRgC3AHz7j8xcQ3RBJ+fkfOt+u/Z878j5oA/+kE8AnPtmX8AutRzKW3+oYF+awF+euvw6AP2Q6W0A+Dv+CKB+hpQpwpuXP0yLP67viV8K3/JPl5Ypa013+qVOvaV5yHJt5pjmU8/D/MpWM/Oc68+41lcdennLBx0WuCgLsJHrxzI3+eQWAA9NHigJjhOEw1eQngC+gnu+h8RNAH+ExPrs05JHWR03dRLEp85L+Cqj5quM9WGyss2E7g4KbYqtk6+2H/nlFlhqx6XtGPmYtss1HS2HBYYFFlvg2gFMT38BmwBOgCmI5I0xYJE3wLwRJgjAD+WS/D0Ayv2OeOs2QAYBEjwyRisIkABXvgeSLUf/BKLmra9ynK/zT4qtMj/XNtvN8cqQqlel6imlXr5HE/wbAMj1Yw1ZAxLBGQM1gH94f+uB/+rRZHCHwI+/9UD/XD/GQid0ZF45f23Y23fXVj53UPDf8SXQF+wngE9e4P9/+7v/cP3W37zUIIA3AexrUMHr/9w+mNNrpi59CvhlqfqSB/LVH615/WBp1uOzkoduU1tPpul8pDNTf7Cq1EUeup+YYy23TFrr23kmp3x4Po69ye3nLR90WODiLJCb1429ozwckfIAqeA4AXkLtAPuE9gL9vklUn6RNOuty/ZVZo5XdUk9l/AekFVOK9+SlzZarfDOfjv+4hZ+KDQsMCwwLHApFrg2wLJU3wRtgDgBp0CSmwCAPoMA3gQwAABgBCwSBPAmQA0C0Ner5wkgewEAgWUFvBUs17z6S7M+ZVlOO1LaoMUrb0nbXn/HUpY6JE0dD/HaCFp58trWmxyAd9aBBPBnjUj+ACBrSECHdeU3HvwvH/3uP/1ZQ+SRDNygJ3Ootlm6/66l3dw59Jrf9/lvE6QnBdAL6qHUbct+5J9MwH+C/srb11sABgLwOef0KnX60lKq9QWTt2zvJdvEjwy/u5brg1IOL7V8Ka1yQ9+djmh+OZ+0LVqZV1/LzO/Tlc1u+03reuW7Ncz2jgMdn2GBq7cAm5tP0t2G5+G4TXm4JEBOQA5fAbt5wb2Anx8kIQDAbQDaWG/7Fq1jpR7oRz71nOOzb/KMQV6adS152mdNp4fGxrLj33NbwL2q3Jq3fNBhgWGBC7fAtQCVU/UUuApQAXYCyQwC8MbYIACAkdQKAviWOb8OAIA0ACCIFKgKKAW0gtoeEE7gvISvcuxTgat2SKpNlrTNfvD0yeS4UMFz1c28Npijaa/ktatrZwAA8G8AAHDPWvK9f9bQ/4/dmx3c6iBIsOS7/9U27EPmf+p+vLR+c8cTXwMAlAv+BfnQFpin3Lf/tb6Xtw/9SGe4/r/zn6f+4EHg3/Ivaxl+Zi1bkrff2k9dyZjQqucUD8wt0WPWpd+nzdFHvk2ZO22kh9rP1zse1E/qZdmgwwIXb4H9B4aHJFIeNAmMKzBvgfcsMwjA/13K/wrA7wK06rMMPsfJ8eFTt0O87auMlC9f21TZaZ/VClcbsujjQHj4rT9s/vA2HyMOCxxtgUsDJOfUpwVaBaiASsCkQJI3yDUIwBtjgwB8b9yvAxgEoI9vkDMIIEiVJoBNXkBcqTomqG7xtR952wnOqw0yTxvaV5CbbVq8su3vmFB1aOmWcz+F156uG2uH3fPtP2/+WSfAv7/twP/wQBDA/+XBq//0q+uGXs7BeVYbnHOPPrasQwcGXwNoAX/LKrCnnDJprZ/LE2zAzzyk06o+/Qv5FqWsC/yrL9nL42NSd4j2+mf5xF9dyV3n5/1W57XALPfepKWLZRtb78+lXe7cky7ryyRzzMzfuwHGAMMC57CAGxhZ8knhNykfkBWfh0mCYwGztIJ38gL/rAP8EwTw9wCyLnnlSnPs1OkQn/2SVy5UXS3LdvB1jBfSRtptZ9dzrNeQMSwwLDAs8OQs8NgA5CHGF8AJ6ASqgD3BJG/wAfOAewAkV8cBjDUI4HfHDQL4Flkg2bsJMAd4W2C5lgmyBadZr2zLaOtcoc4/qfW2pc62LWr7pOoEdewWVb+70hoAwNYZABD8E6xh/bj2D/gn+faf9ePt/xz4Zw7aRVuk7eDZt9KH2MP3NcahAw1/i7fyPeAu0JceC/6/872brwzQ7wv/3c/58kP6lHp9Zop3PnPy6RsW/7n6kXfJ44PO9bceupdS332+TPmis65Hey2YW2v+rbJ9O6TMXG8N4tjmBx0WuDoLuIlzs08emnrIJDgWMEsTwFc+gwF8DYDfBMiybK88aY7ZAuRVR/O2rf2VK/X/TDUPrX2UCZ0cKvsHB5tAu17dhhgKDwsMCwwL3JcF7gtYXJLcBG8CWEEroLQGAbhK7ltkgwC8TQZU8mYZEMk1c4AkgYAMAhgI4O00KUEr/BwIboHnubKWLNsngHXO2EEeShtTli/l7euYSVu6ZZm2aNFqs5rXtgZtAPOsgwEA1oh1E/wTCGD9BP+ul8EadVD/arvcP/Lub/It3rJLp0vOFb4KsORqfwYBegEDywH+Jspur/4f46dl26m/rA9YgGX6jHfl8Tn1PVOW5VlWedrsJXXeUZcm52nZY9PUST4p/H5qzftQWUvOrgw7OK42qXnLBx0WuEgLuGFblLJNigelHigJjhM0wyeQ7/EA/+/8y3/5r/h7ALVdysyx4Ksuh/K1P/mUD89XEwgC1PLaN8faHqjaa0cvctGHUsMCwwLDAo9tgUsHKOfUT/AmwAXoAfoApoBAgKWgkiAAgJK3yXwNAECZQYD8HwIMAgBE/UqA4LIVBBBwJiBu8QLSFm21t4z2gnPn2qO2tR4byfeosrVf6qcOLeq8oaekBP4EWvLtP8EYgjKsF+sE6Pe/dSTPerGegP8M0qiTc3Bude7unUrZn5S5T5O37JLp0vPnw173us88JgjQCwYk6JcH/OPLLdRFP9nm5ne+Mr5f+Mvw6SvK67+2/ErrbHuI9sbIftkGfpJ2/up0Hs5yU7/LXQa3b/vbeTFv5pfzP8RP7HErZ13Wt422whrqomVq3vJBhwUu3gJu7CmNh6I+THmIVeBMvoL6mgdwcwuArwRk+yorx6k6LMlnf/gqnzyBCAMA6Jltsn+ONzk8pgcGiz0Og4vf8kPBYYFhgYe2wCWDk3PqJjATwAnwBLEAVsBgBgEAiwBL3hz7lYBWECBvA9QgwKFAgAC0BZizTIAqzboE05TTpgdknTfUuUOzvMenTPuqDzR1Sj71W8IbNBHwJ8WeAPj88T/WiBsbgHzWiYANAQDf/Ffwr3xt7xxyfmkD90xS9mbuqbpXravll5Y/5rzhfwUgCPDuH9td2+ftfQ/s+7YfKthPnrL/8Lvec4Mfd4wet2316aY+Mr5e+Mnw6SfKpx+Z/uUxfMpQ7jG06rma1/5cNpN1rieY6axdWnpsdL61uTbRjt4qhtYkBrGtfaHVjhNbTe3EBNVLetZJD2HDAg9lgdzA8tBNun3IfBjqQ5IPkA9VUh+4HuV3AAgCCL6zL3zKP/SQVt3I1/7kcwz14jYCOpiHZruUk+Nol629dgfDQ63fGGdYYFhgWOBqLHBpgOS+9UkQJ8gTzAJaAYUARG8CAOj9SoC3AQwCkPcmAACUN8yAUdqfEggQkEoTRM/xtDfZLoMAzM+5JnXetM3yFi84TipwdsxK1anSBPQ93sAJ1FSBf177N0jjbY3ed/4F/+iq/jmnOvfcL5VnrybQT/6+9/G55B97UPF1AN7YEwSogYAE/MkD9M0bCIC+8xve+Vfx5RbqoD9Mc/mkGx+Zuls/OX1D/c/0I/UvE5jid5rwh7mNCjVRZ3v9Uv3ROt6hvHpuqX7+juZcF5rpQZql3dXxReeLjbERttJuvFg0veMdX/ln5LGvNtbu9NW2yMK+yj5gK3V5ECOMQYYFzmUBHyjlmd8dah4Kt4ebD4IPhtTDCJqHXfIefJXShgeWBzQfQB/ClO140tQneeulKaOlE4cA/z2hh4A6ZtvUR7lQx10Zcd9uG8tqV+086LDAsMCwwLO1wLmAxDXJSSAn4BMMAwwBrAYBBJ1+JQCgSQCAxHfNCQAYBOAmAEEAgCntuUEwFwgQ/FaAnPkKqs3TRl2zveU9cJtg1zlDtYPUstrevPLVR1p1Me9cKxXcJ8XmmXzbbzAG+3rln8ALa+Kv/hsAIE8dbemHfHVBV/V3Ps5bmnuk8ux1wX6l1/QcoOuJB9+L3Ab46nf/7XUQIAMB8tIW8Af8n/CDf6qaPtzOz3t5d6Ven1BfU98RX1Lwjp8L8BSI4vNy85TEC6hMlgtc7atv6jhQx15Ktz6r+l+O71rtjP17Zet1cM7YWztjY+w2Z1+/foydtXEGBcQC+v2Os7bd1F7ukaprlg9+WOCiLTD7kK0030Y4PTx8IKB5GMF7+EkF9kk9yCzLB86HrsrNMdWj0mxzSDfH5nDlfyVQh6qb80h9HGc7fv9QuOiFH8oNCwwLDAs8pAWuDbCcU98EdgA/wCDAUGBdgwAAegAlwNLvmnPlHB4QSrlfBwCg9gIBgFsBbwXEgtS7UkGuAFfqPJ1rDwjbvlLba6djgb/zlibQhwfsmwDu2JxgiqCfAAs2JrkOrIFX/6Fe+acfsrAx9tQm6O68BPzS3BOHePaiAYBz7suHlHWns+bll1/+1Dd/7jfy3/dVwA/wz7f98H/15993851/8+/e4OPdadxN5zXoXLEbutIF/09fUD8R/xFfkhdLgEoBqUCfG6+8cMLnJP1XP/uz/43JMuppB1AFoApOkat/7LinUnRfJ+ezo8y2hQk2Vrjbv8rt0Tp25jd234wvv8Um+OfV9gRbsF8GV7CryfIMBNAHe3s7QJyAfG3dsZ2WcW7mBx0WuHgL5KaV3z1kHAgeGLfUhwGa4Bjew/BUmvJyHPmqS+ZtU/VKXRLk88BzALcCAD789lUvx8hxVyuc9mLBtePFL/5QcFhgWGBY4CEs8JBg49LGErwJ9Co4zkCA4NS30ABRr50LOgGkBgHqTYC8DSDATfArIK4BAcHrXEDANtIe2BX0ShPMW9aj2TbBf0uvOgfnBs05a1PtIeCvoJ9gisAf+2J3gi685cf23sigjHraIwv52kTw7/wE/FL3wBxl/7pnKn9pe3upPmc5Y1Y+KD8SyJV+ggH8TkBNfG2AWwOr8U71w+yXFH7tC+sD4hvqT+JDEmzwLX8F/QL9X3rf+/67VqKeIEAF/4BRfVF9UKg6yGedfM8Ptu/ah536rps5bhbKuR9atmxXefMtSlmWV77m0cM+O7raD8zDubomGYgxGMCa9FLeBjgUBGCsju0O2WrUDwtcrAXqA7d7yG4PvvWmv33YPER88Dx0pALnpB5kWZa8faU5xvahW42vHpVme2VAcwwPbMo4DE4NAEz0mR5MF7vAQ7FhgWGBYYHHssBSoPCU2yXoExACFAW6gFyApAAWwArA5K00b6IBngBRAahvqKE1EEA/k8A3KaBVwOyYFVAfyhsAEPQyD4GvVEBvG8tb1LZS+pAq+G/p5VwE/jlX7Qjgr6BfwO+bfkA/b/YF/dhb8E8Z9QB/3/ozrvrVObrGue6HePa/4F+az0SrLOsvlX+sc+cO4058YP1LfUpBZgJ/3zoD5Ovb/gT+BgQA/fWtP/IA/r6YwlfVn1UHqGUtqs+Lv4ucTNTN+K/OWbMlLqhl5qG26/HKtV3m784HLtA2zFN/P9cK+5IA+jVZB9X+4hbt3LBdnTP58RkWuFoLtB/S8pDxIJh8OJJ6CB2i2UdeudIK9lt520KVA3V8DwMp14A4lH3Qpdb74NM/5TnOVof9AEDa72o3wVB8WGBYYFjgXBa4VGDyUHoJ3KAmASJgGNAr2BWQZyAA4OrXAgCiglHeRANiMwlQ8/cB6G9AQCpIzmCAQBraAtq1rIJfwXulgnnKK/jvtdUejJHjqlvqWoE/c0zA37rej+1809972893/QkAEBQgSMAaYDfGQyd0a82NtXWde5S9R13uwZrPumvmz3WOPJCcHShd+b36lFD8QXxFktf9ecvMCyWvlkO9bi7IB+gn2KcNfepV/+p36m+qQ/qilUc3+qMbINa334xB3hsFylz7sFP/dTfvKajH7Pq1yffKlGNb8+elq7XZ+uHBOz9pCwfo77uW0ur/ux7Kgjbsxjz5pD02JePfYYELtkBuWPn2QxoPGA9APhDw9TAyLwCv1PpKq9z1w1bGbpVlv5TpuPlgw3NAGwBoPfw++PZXpuNsddg/QC94uYdqwwLDAsMCD2+BawYv96F7gkLAoqAYMCzwBWAKcgGcAE9ALQAf4NoKBFBHMiAAD2gFALeSgYEMBgimpepQqaC8guA5QH9MAMDgQgYAqg7qqP4V+DP3tEl90++tCt/y++N+/+iX3rcH/LEV46BDgn/nyxoa1Mn1TZ69lCBfXpp7rVWW9dfEH3vicNX/q77ow36aH/HjfwQ4tv8d2k/8X/09KL4gfqH+IqCat8gCbSmAmwTAN5GnnkQfATmy9E2RX/1Mx7e8RVMv5DKGAQn8XAMN1NFWmTM+bAsLYFLLe7y2s978+ekCTMD8nGul2JEyafKWSbPv2mb7Pr92kTL/8RkWuFoLuJGnD2556PLBkOehOTUpI+n6gctxffiybMVnnxyfA88D0oMWSmSWAIDXrTzU80Cmnf2V6ThbvdRndzhqu6td/KH4sMCwwLDAOS1wTWDlvnUV2EFNAkdvAxgIEGQn8K2BAK+s+9UAwL+gtwYDDAhkvQGCGgxgHAF20tRFIJxBgHwjLi9NsCyf1HYV/DOmOiSPjt5oQH/f9B8C/gRP+E4/gD9Bv2/8tSV2agF/56vuBnBab/57+8l90Kt/SuXHniVv/P2f8pf+8X/+0s0v/rf/xg30h7//d7xCQOC1H/qRbzpW1hHt9d12fm/4lviA+IPpI8IL5qHy+JXJ61+mD1p9S+TrX0LN63tWSn/leRuBmwXcNPBrBlDKCArQhj6OsfVhV3Nc2Wg3530eE9b6Vllts59nrHMldOrIYo69uqPL9+fuvLDB+AwLXL0F2NB8pMm72Te0PHAeJknrQbUkn/27D299EEOX7O94HrB5UHJgchhzMLYCAB6oUmUoM8dZHyRVp7UZxz/DAsMCwwLDAlrgKYGZc87FAIB07jZADQYYCADsAvq5xu6tAIIC3BLw9wGo9+03tCbqkZPBgCUBAcD4XBAgAT28gLlFbQutb/0F/1LmLvhP4G9gw/k6Z6/41zf9v/xPf/kVEsAf22k35BBMYAzGbM3TOST4rwEA9spzAvq9Z8NzYAnFP/uPfvRzfuNf/A8v3ZgIAsB/+9d+7Ps/6g1v+LIlck5s0/R39fv0A5PiK+onVl8zy+HpJ1WGsqWUwye1rdRxDEDwlp+3/fi1v/Ir/+zXSfi3vOiijlsH6KlMx5qA4X1fdmqLU+rDR5+MdUnlx80rtxX2GZ9hgSdnATd2+wAoD6+HSVIPqkM0+8g3D4reQxq62N8xPXwF89K5AAB1JNsqIw9tx9nqudONjZC2e3IbY0xoWGBYYFjgWAv0gMFzLU9QKPiX5m0AbwTMgWKBsG+/Ab3eChDUAoBJ+b132lhuHX0F0a1ggG/bBeAtcOzb8aTw5gXOSSv4py2BBd/2O57jA/or8K9BDebKHHmbn2/8ud4P6IdyC0Ab0V7gzziMyfiHwL/r5frl2j7X/V3nveS8wO/iF/5/7Ve/4YYE4P/pH331DcGAP/vn3nJD+t1f8l3vf/Wf+oc3DxAEQOWp/xu+Jr6ffqBUcK3/2aO2T2rfLINvyRD880afN/u84fdG6//0L/7X9//qr/3qb0AJBhAUoA22pV+VT37rxzq/Ou9T87fyWmPOlVVb7Omnnh3anFOr7fJ55fbVv8+ywQ8LPFkLuOGPOgzzAW8dYlmffPNhn3tQbx/slOF4gnfBvJSDk+goUVKuaQn6pbaTKke5jrXVdarfk90IY2LDAsMCwwKnWKACgpH/gMmPv2GPBJDwAkuDAADmDAQITgXhUIMBgHfALKBWAMzbbxKAl2R55inzLTiAeu5mgCDZ8b2hINhvUfTvAX/n1gL/jFVBv3NET+aZwQzmQfKNv9f9Af1e858D/jkn55G6syauT66b6zj293R/z5wZL/J9f0C+wB/63p/5rFc+7zu+9ea3ff1P3fz2v/Df37z0Te+7Afi/+uv+6236mDe+7XvxxWZk36VKvxcZs76vfqB+4VJagW7tZ71+p34ofmmCf9/6A/wF//i3gn+v/iunjqP+LUrbdXm1QS//8vSKP/3VG1rHrnl0zPbaoLYzj27wSeG7Cb2p7+m/X57rD88n90Yrv240/hkWuFYLuMGTHjwEfSilhx5e20mbD+3+A9nVQzkedB4kAnmpAQAOS65GCfyT2haqHOU6zlbfqY6suXa71vUfeg8LDAsMC5zNAgMQTQFR2iPfGCeYzCAAYNOr5hkIAJwaCIACXDMQAGgGKHslHnAvKAYIC4zhTZTRpgYDCCggi8RtA2T7Rj4Bs4GAShNIA6Zrsp5+zsGAhrcbvJ3gfAD9vuUX8Ds/KfPKt/20ox+BA+fSCmagTw/0sx51rXJNBz/d7x4kgP0Pf/3r3w7lB/74bj9v+vmufwJ/AP8Hffe/vHn5L/7azau+439eJwIBGQCA50YA8lby78vnUu7U79TnA0yWpH94LqrfiS+Kj4r/yo8KeuWf2yy++eelVn3zrw+rnJ5eh+axrXfu0DL3zDMOvjPjozO6w/f0oNz2tMtE3Zze1Dl28pZtaeo+z7NlXXO3r3vB/KDDAk/eAm76pD4YewdA7yE9VL59QF+OA3X3AO7Gq2XR3jE8YATuHiQeQAYAblYfr0cl+Led/ZSjXMfZ6jzVKTeENsuywQ8LDAsMCzwrCwxANAVEh+xRwaVvm2sgIIMBAu5eIAAQDYAGPOfNAACy3xsGSMgDLDIYIGimv8GADAQA1jMQYGBCvaQCa8C1oB9Kvbq3gL9v+tEd0O/NBYB+Bi8E/IL+GsxAf4C/AQz1Znz1EfgbdNH+dV3IH1rLUf8BNx52gH6+z2/yO/4EAL78O9+xfuMP6H/pB/75NhkAgNYggLcDPuKTv/jnzvS/BaTP1uLbvmj4oVu/cFWmr9ijtKVO2mqXwJgbq4B/rv0D9L3JyjPrd/6p88UWPiz+q76rtDVOLXNc+qsjei5JyqIvOuNnozf8nE6MSb3+OL66wQPnoewe7eo39dPb67jZqK67lNLk3c6tMusGHRa4Wgv0Njbl+6lxKPQezlZ584FtjdMqi7GV7SHHgUESyEs5hHBuCADwAykcNh4yHjwZBFCOch1nq3dLr6td+qH4sMCwwLDAeS0wQNCyAICAMmkFnYJRwSnUQICgOsG0b9N5y+2bdACwgYC8FZBvE/NKMeUA67w271cECAa0AgGMa0CgBgME2gJ/9LU9gFw9kS3wJwDhW34CE+hkAgDBe8Wf+qprS0/0EvhjuwH8l+3TY59nT5NWAADw/2lf882/zht9QH6Cf3mDAAJ+bgiQyHNTYF3/p3/0hq8F3P5PAT0fVlWOocra933T9wtfdOsbHlmmbykVhOO74qP6nX/f/gP6CQTwGwAAf0G2/qugWd9VqvwepV0CceTQtjevnhz6ZdBiSXCCPs6XQIaJ+VNOPfq1xuzpty7PtWrz7AnX2P3h2vfylg86LPDkLODmz4dCfkdnDjkPjaMe1t1DuBtjY1ryfHblMbZjeMhxUHiYcHCYMgDAQZqgX962UmXlwbM9bFKfjX7j32GBYYFhgWGBWwscCxhG+92vx9cAgHkDAXkrwGCAAQGBdgYEANgk3oADtBNkC7C9FeDVYoMBAG1ANm/V5wB2vl13PKgg34CAb/wp93v+BCdSJ9/2+6YfHdTHGwuAf0G/V/y5KZBv+9XJoMQS4I9ttXfSsT+PCxR4EH78J33iO3377y/78+N+v+nzfnIL6OeCANuvBKzA/gd8zJfffOC/9tabF//oD0wCAX41gGDAaz77T38VXxHAb1OHhVRfsza3fOeDTv2/vVuxWz8xfNVDZenL4oPil+K38sIKEM1/9QfoJ+HD+kv/gmT6pM8Kr1+c1HGSUk9/Aw6MSz7bLOUZF929tWCgwpu36pk60Ydy+nlzgPkhg2CAc6RPT489+9Y1muZZY9fT9XadrbN80GGBZ2sBHwoflik94oDbe0Dtu3sQp7I35Rh+v/y2r4eBh4kHIIdJpgwAcCBxoAj8k2YfZSmbsbZzaOm02SLoOj7DAsMCwwLP2gIDMB0HmFr2SgCa/KFAQCsYYEAAUN4C3rxtB+ADqgH8CboF35QRKPCKvYAb8O53670ZAPg2+X17AwOt8fOav2/7e8EIgT86q4PjC/oNPhx6408ARXumjeVb6zLKDu9tDz9+vf893/LSK/y6P9f/+fG/f/ULvu43/IE/3+y3ggC86QfcA/p/80sfvV6nr/1jr36F9NG/9+3vf9W/9TXrYAAyvDEgJUjwmte/6QcZHx9OfRZS/bgW3fdH2/5gv52+b1B9WcEwPip+KyAYMAzo940/IJk6fFd8Vn1VqP5qjzIOdY4HTz9kGWwAdCM329n+EFUWentrgRsL6I7eVWfH1/dmbPWgj/0MSjjHqsfWN9em7TVh+V0Xt4JrbL5Fl7Rp9RtlwwJXaYHc8PLQ/eQDdwptyduUYbQc1/xm/NuxPAQ4RDxIOCA8TKQZAODNgYdngn8PJvsgx8MmD8IXGHuqN7qNz7DAsMCwwLDArQUGSDoMkno2AnzWOgFppYJXqV8TIAhgICC/JmAggLfiBgO8fu9XBJbcCjAQwNt6QLhfD0AGAQETwLwm6mhHn7zm37uFQCDAWwjoJug38NAD/XNv/A8B/9Ya1DUZ+f4ej4PwRUD4t3/tx77/M778zb8GMF+D//iF/14QgLYf+Dt/zxb4e4PA/y6QQMBXvPlfWd8yeeNnfskr/EDgWv4qaEDwgK8LECQgWIBfFzrdhU2/dN8fnvqGh+vDl9WHRVffxvtGHECN30o5qfqp+qqV6hv3KO2RBfAGsPvGnjHoo49dqXVJ4UkpD/CPz20QgHH0tRk7U84b4I8+GfjIvo6rXmu//NaWa76/Dq6960i+x9t20GGBZ2eB1kPRPtDywVvKtx9QjOy4Ust2Y9+O4cPvweNh4uEo5eDku1P8BgAfDlMOIQ65XhBAWcp2rPXhwvhT/dUROj7DAsMCwwLP2gIDHPXB0TG2qUDUfA0EkDcIADUQAM1gQO8rAryVr4EAr+Lzxp23//lG3qv4AHPfyOdVfIMCUFP9bj83DlrX/L1xAHCogYa84u/Ngrzi3wL9zD/tkXaqdjxmbUbb/h6vhx/+E18H+C2f/m03L33Bd+0FAXjT73f8eYvPfwfIW39AvrcH/AFBaX61AJ52fL2AGwYEArY3A1ZfH7j9nwOqWjWfPid15o+hOz916iP2y1f+pP4l/qa+qWBf2gPO+qj4rPBS+erL2h4q6OatO+C/BgBoo27S7F95xkImPjcyAf6cHSR4yqijjXolVR9vEPjVBwIB9DUIQJ/UbeuX45uT9m3PevJxLTe5/r9L2/UljJphgSdgAR+EpPD7yQfPh7BFW/3aZZpuf9xbufVA8iDhEDF5mGYAgMOkAn8PV/spywPOsV5wTlOd1XXQYYFhgWGBZ2+BAY764OgctpkLBGQwQOCbQYClNwKWvKHPQABgnWCAvxcAwDdRRqKedoD7GlQA+Pu236ACNwTQg7f9fr2gXu+voL/+sB82mAP9aUvWxvw51um5yugdgPxyP7/gTxDgVStgDvCvCeBOGTcGfOvPDwcK/KHmMwhAAIA8QQBuGXADwB8RfM3v+/y39XRqlOtzNqq2RbVNzW8bFsZ20E0Kfxa/Ex+0+qOUVZ9U35Ry+BalLPvaxvbU+fYfgI6fjH9M0CHbOpb9qJurR39uLwDgedZ5rpFNgAFwj/yqF/IoIxEkoB03AQxMIIsgQH6VYM8vb/vn2pql0P5lWUZ2WGBY4JAFfHh8oOYpDyMPnNQDr08ZP8cgz2c6zu1D7sPv4eSh5CEC5SDisOFw27z/v7nhIKKMuprsqyxlO9Z6LvvzUce1suOfYYFhgWGB52yB5wp87nveCU7lk8KbBL1zQQB/ld8f5+t9LcDbAL6xTwCPc5/JN34CfKlv9ls03/Z7kyCBP2/7W2/60R/AL+g/5m2/drvvNXuO8mfPvpX/RBDgVX/om5o3AbwN8Ef//B9/RYAv+Bf494IAP/z9v+MV/ocBAwzeAuDHAWd1mq/UJ6VV8r1e2UZemjIo2/6IID5mBdWU6YNWWttmvf6r/izUMtuRx/8FaAOyeU55DucCAPRRZpWHXMtoA4gHwNdbAMgHxPeCAI5BvTcBWkEA6mm755vv++faXppr0FvDUT4s8Kwt4MMyR6k7R8LQyqlGz/E3bXjAV8kHPw80Dw8PKQE+B4gBgPwagPVQ+0CRQ1K2YzHuOu30Vb+q98gPCwwLDAs8Sws8R9DzmHMWzAr+occEAOpvA/C9er677/f1ucbv9/W9uu/bfL4GYEBAsE9AoAX0fcsv2PCKPzLrj/qhQ33b71cYEvDPgX5skDZJnvUin/Qx1/ApjX3w0Fv5UfxI3+TrAPG7AAQBAPK+1TcA0KMEBr7wh757+9af/twwMBDA/xBwUKfTGyz1AWu7iT+rb4mvCa/PmVR/tEf1WaH4sdW/1a+1HhDtVX2eWZ7LDAAoz/Hsl/5yypRnbAE8b+556YZsbwH4VQDl2C8pMlo3AdAvvw5AO/TTbms7Tv3zjZ0361vX4PRVHz2HBZ6pBXyIkvqQnUIxY8rKfJp4I3t1OOYBmYcTBwgHgskDkEMoAwAEBDigrJfaz4NI2R7C68OF8fsHTOo7+GGBYYFhgWdngacEZq5lLglu4WsAgJsAra8CHLoFkIGA/B4/twJ4W28yMJDX/QkSmCynHX3oX0E/1/z9bn/+gr9v+tXfWw1S5yqttjDPWsJfy5peq55LDjx8LH/JH8DOtX2+++//EMCP+v3E9/zW9Xf7e18FICDA/yyw/trAu/6X7f8GgDx+B8D/OpAbB2vfbYliD9Nm6ifjUzaSfmel+qUtqu+KT4uPC4iGx7e1Dkret/QAc4JzBPJ4a0+/bCtPH+pMVWa2U74BBsYgcSNg7haAc1JHxuLGAHrhx5NqEIC2BwIAD7OqY5RhgSdqgR5Anx5kbWDcaoOZUqZ8NZ/lOxlxUHow1kODw4fkwcchlAEAeIIAHo53DABUnUd+WGBYYFjg2VrgWoHLtest0IUKhgXJGQAASPMW3TfqeQMg/4cA3sKTAOb+SKABAW4HeEOAwEBN/vif1Pr8nwKQ5Xf76zX/OdDv3KQ57xbPulJ+7et7LfovPfi4BUAQYPs/A3AL4DbxBp//QjCDAAQCAPxf/p3vuHnvz3zWK9BXB/DnO/8J/PkvBF/9b/6J9X8JuFSnB2y379vqPzd83PR14fV5kwrA8Wd9e967bo9/7Pf/DQBA5wIAyBWQ9+Sqg/43YyATfxvwTwLE5y0A+uQ8kk859AH8m/iKgD48fbZBAO04pSxt2vwBl3oMNSzw9CxQH6bMwx+TtE7KaJVtvzNFxDQPRQ6APHw8ODzouOJUgwAceBwiHGoGC2ivHA8ix2HMddqfG7qqu3oPOiwwLDAs8OwscC1A5SnpKcBNACxANgjgG3QDAK0ggL8HYCCAa/j+NgAg3WRwoFKDBUmzjf2hS674q7tzgeYcezxrmzZ5Smt96XNZeuB92Ote95mA9O0PAhoAuL0RwH8fSADARN63/dBMBA4IJiBP4M/V/9d+6Ee+CX9uqU733K76iOah06SvuaL6n5Xqn0qZJ/6r4B/A3ALq+sbUAabxg/GPAef0wRfWB05qYIE2JH+VP33mbE85vnV+lx/wTzBA3fS76ec8KqXOsZFFX4IK8Dk/+mGjGR/9npd3iB8WeHoW8JBiZvJz1IPM9tk2eeuhfKzb5Kb/KnNDbw9HD0QPDA8fDh4POQ4OEodODQCQ5+DjAKSew0QZeSA5zvpgYezpYT3VdOSGBYYFhgWesQUuHaA8Vf1aYFjgLJDOmwAEADIIwFt3bgOYCAaYCAicKymTcbyFoC4EJ9RV3ZeAftZUwP9U1/da5rXk6MNnW/3H8T/zgb/z92z+a8Bb0O9XAKA1AMB/8fe//ez/dP2/BPDfBWbyzf9H/963v5//chD/b4keF9JG33fWz9UPFejq90LxV5mz4B9gD0gGpAPCqdO31TfOAADf0ccHBlTjL9s2aYJ5AXiVTXvHchx1oo96AeIZK/vnfJwjc8750Z45GQiAJ6Ez49mvEQRgqbXzhSz7UGNY4OlYwIcraY9n1tbN8VlH+01aGADwAIJyYLQCAJYRBOBwyQPPA8mDtxMAUC90HZ9hgWGBYYFnbYFrASpPVc8aCEggDS/Abt0IEIgLzHvUIMFSWuU4DlQ91Et96zwyz9r1AH+v/Kmu96XNa8nhx38J+Jtf+ugb0vprAAsCAPww4Ad+6d+/+c1/4P9xsw4ErIIE3AL4oL/76zcv/cA/v1n/2N/mBc0SFR6zTcv31Y/c0Vs/F79THzSp/ikUHxf/FWANyOZNO4AbkE9d+rW2zQCAV/Nb7QX1yMePVj5jJfjOMeQZC3BuEIA+gn/GQiZtSM4n55g89chVnuAfqhzq6YPNVgu8s+VmtdPuj7n+Y+xhgau1gA9RpUyolh3KZ5/KZz7lbL8G4OHgwZGHjocKhwWJA6J3C4AgAIeSfZSjXMdZHyrtgwVdx2dYYFhgWODZW+DSAMlz00cAnIAZXmCdVNANFYgnTaB+Dj5l59ipU9XbPOsI/9zW89rmu+QAxKfiBgABgPWVfQIAkdbX+7/gu27+7J97y/q3AKBrsP/d/3L9OwG/6eO/44b0Wz7929bf++fGAD8cuBpbX3GJGpfWRt2hm4S/uUr6oEn1TwXFAGpAP2AeXxefFuCNX6tPCyWPT0x7wDxtDRj02tMHHxqZtM+AAbJaYzim49GfMQkikBirBhByfj0+54DMTNRhF/pit60d9/eFtr60PTD0GRa4Sgv0HijLpU6u5i3vUdpvEg/2KuUBkYehBwQHj4cPhxSHDQeXb/2lHH4cIrb34FKm4zDmOqnHlPb0HuXDAsMCwwLPxgLXBlieqr6CZQF0pQm65ROUVx7wbqBAmoBe3rraP/OOJ626mX+qa/OU57X0oOM3AAgCvPC/f/Pmjf4qAJDf6+dH/fh9AK7+U/7yX/y1dZ6AAb/wD/h/1R/6pjXlRsAF/tr/IVOkDyy/83PxL/U5V1Q/VKp/it8KmAb8A879SitgvQfOBeP0wf8lAcr1g/WB9Ymh1BkAyDFafewvpT+6oCdBACj9sq/A3fm1KPagnLbIVj9lOR5taLtaAO3JWmhj+PEZFhgWuKMF6gNlvlKHaZVbVtvUPO02iQf7NnlIeBh6AHgwePBw+BgEIOpJIIDEAeghRFv7Q5XpGI651WMcKK7RoMMCwwLDAmsLPGVwc61zA1Cju8C6RwHk1AnM75P2dKBcO8tLLR/0A7Y2ujRbHHkMvvhRb3jDlwHeP+D/+J+s3+4D9gH/Jr/rz9V/ggX8bsBrf/trvwEfbTXWi/hnt/yRQ19s81lfV39UEIz/CngX/OPX4uP6dj19Wnh9Yurphw8MsAeY4yO32tOHcWiHfH4zQP8ZME+/6j/35OiL63fbznkl3frct/5+5mmnj64MdKBMGeyPSBe74EOxYYFrtgAP2dznUP1c36zbPMxxGPig14OAA4HDIFMePEYgPbhs50GiPOVDt4fP7lBBNw+Y1HPwwwLDAsMCz9IClwZIhj5tsCiohh6TMkhAv0P5JbLHGrXX6Brtcuqh9+Gvf/3bt9/vX90GMAAAfWn1dYAE/6eOcaH99I/1JXe04evqk+Kj4rcC5H2pNfdmXt8Wit9LP0A/oJ5AAHnKsx28vnENADBWBhpoV/uS15eGpjzl2sZ5TXztmP/W/y5l9nMc82s5O/9cm7oFtLn5QYcFhgUWWODQg5P1S3iGzHapguXQKX97COTD7gHgIeQBA61AP+vk7eeBhDzlTw6f6aGS+g5+WGBYYFjgWVvgGkHL0HkKQAHt2GQJeD+2jXLT5jlelg9+ui7XYI+7HH58LYCr/d4G8L/3E/xTfxf5V9R34/MG2NUXhQqmBeW+/QeUc52/vs2vvjH+MC/BDAJA6xv59IfxkR2LN//871m//E9/+ZUcizbZxzGl6m2+5WfTZuJrx/zX5VPfe/IVCfttZdCW/lPscEVbYKg6LDAskBYwEDB58Hng83DJQ0hwDzUIIM26PLw8oKDK9nCJA0Vd0M/gROo6+GGBYYFhgWdngWsAKUPHfWApCD/VNtk/+Tl5S9vNyRh1+2v5mDa564GH38Uv+hMEeOH3/PX1jwS+9JGf/go3BO4q+8L761PuKAD2NumL6uviswLcucIPKAf8Q3mjn2A+/Vl4/GP60oYk+McvTt85edpTz00BAwD5XwfmePbLcVN3eevNS1drtJv/qTw22+974cs/1BsWeJoWuCtAtv/uYGgcjB4oHnIedBxec8kDS6ocDySoh/BqeXY6bPinuWJjVsMCwwLDAidY4DHBxxj7YcHgEgCfbZIfa/Wwa/VQ9j7hyGh2ee2HfuSb+G2A17z+TT+I/9Zs9DQLdz5mB/zjqwK6Afv59p8r+fn2X1+2UvoD6DNhY8rTfyZvygAA4N/fAagBB2U4ZvrR8vjTyW/9a+a772Pv7HF6Xe4U5I3PsMCwwBVZwId2dxhwWKySBwnUQycPsTnw76HnIZf9Uy7jrNP+AYQJ1e2KzDlUHRYYFhgWOL8FHgpojHGeJoAc63rd63r+E+VZSNSH3Pm3+JW3fmf6ovio+K359p+38gQCKhhv+bP6xtUvrsDddvrGBAAILjBODQDwdQJ96daY6u98mnTft57aYlrPpkibZV7e/uTHZ1hgWOCBLOCD2RvuUH32y7Y+0Bt6ezhymHjA5OHjwSVtHXjWSbO/MieH1f4hlLoOflhgWGBY4FlbYAC46wZwY/3G+t1lDzzrw+/uk5/1cQXlvo3nO/gAcgIAfBVgCRDXx235vNYltZ1BB8bk6wb8BsAx4+JPb33pqR89nfOuDmtSx6dF7Zf1lTefbSkbn2GBYYErskAeAJuHeQX8PVAE69DW4eUhNkezX8pzjDXdHU4eKKnXFZlzqDosMCwwLHB+C9wFPIy+A3yOPXDde+DoE2Xlx+F76Zt90Ad/yCdw/Z8E6KQufK+jxV9Rh/Qlmz4utsAmAH0AvwEA+NbV//Rjk09fV36unrVxXL5mYACA4EMv8JDy4Ld+dNuHTn867ZDLZ3mWwWd58rXdyA8LDAtcuQV4wHdp9cfDgyUPHA81qH9Y5mi2h09Zyl/THPvKDTnUHxYYFhgWOLcFBoC7bgA31m+s3132wKHzhF/y//hP+sR38kN/fMef9Mmf/lU3n/aWdzUTdSTbrn8T4A1v+DICBauxnhrg2/m2zO3lqX+LbwoQB+xz3R8wTsqr/9V/TV/2GL76xAYAAPy8+fdHB1sBgDrOdh77/nNv/bK8xVsmbW27ubpW+1E2LDAscMEW8IGGblI5ID146uF1T+BfPS7YZEO1YYFhgWGBh7PAXcDD6DvA59gD170H5k4agH8P6Gd5KyBgICApQQECCfwPAQDUubEvvG7ft40AgH4tfqzfxQf0A76hefXftpVuQfitz1zrW/n0oxk7f3iQIAA3EA6NPxlXv31DXZKcu2WnUOXUvr3y2m7khwWGBS7QAvkAy0MnEVIOmjzE8vCSz0CAZUmzP/zM4aUeF2iuodKwwLDAsMDjWGAAuOsGcGP9xvrdZQ/0Tp2PWr21T5APX4F+L5+gf44nGLD223pKXEf5xrcVLK/8WvxQ/FSCHIBwbgDwX/KR+DFAggL4trSpPuyeH3srD5mtVPvrHxt8YExuHRgAyBsArfG3YzifKT20IulnJ39Mv0NtR/2wwLDAhVsgH/7mAclB0zu8PMQO0ey/PbhWcle2mY65MZY6SS/chEO9YYFhgWGB+7XAXcDD6DvA59gD170HWqcL3+ev4H8u/xlv/cpX5urn6v7gF77rFwk2tPS48DJ9TNSU377kwnf1Gj6gHyBev/ef/iv8xIdNPxY+84xn2YpWOeQd3/99gLf/h75+kDInc+ovxBJfOtskr9360kfNsMCwwFVbwAceuklxcHHg1MPrEOinvvYhP3N4OfZVG3IoPywwLDAscG4LDAB33QBurN9Yv7vsgXqe4EsByt/y1nc3v+M/B+ZbdciZS5/9R/7azRf9e3/llU998+d+Y9XlQvP4k/nRv9zQW59WAM51f4A/lNsABAWqDzvxXVf9V8KnMnt52t6m6hMzhl8DIPjAm38SfEsP5axpezznXOdv+aDDAsMCwwJrC+QhsX+Y3R5aHjqtw4sDrJVoe+QBikLqIx3LNCwwLDAs8OwtcBfwMPoO8Dn2wHXvgXoAci2/B9gB+AYGWrTXD5Cf6e1/4q/fkAD+JPgv/Yr33FzZTQB9yal/u/Jt8VG9gs91f8C/3/vXd9X33aNt8D0dI9usxlNG+tGMow4GAPj+vwEA6tSFfspY05RfN8jIDwsMCwwLLLRA95DMAycPrsrnIVXrzKeslV6tw3KhuqPZsMCwwLDA87HAAHDXDeDG+o31u8seyJOOq/8C8wTsPWBfy7OP4F6ALxX8C/oB/iba3P5vAanWpfLp26Ljxu98eRcA4G0/AQBovvmf+Kur9uu8/adUuZVOfVxlrKg+MRTfmXEJPgj+vYlAAMC26/GVMR2/zhE9xmdYYFhgWGCxBfIQ2R1cHji31MNIWoF/zdtucnghq3+ApR6LlR8NhwWGBYYFnqoF7gIeRt8BPsceuO49sD3XVr4TV/8B4wnS5RPQ93jbVirAX0LRYavTZTL6kWgnP/Fr8U3xVwH/9Qf/Jv7qvq+6k7Orq1bYH5O2+L6R9I8B+oB+fgvAryKok222/XZjph51/JEfFhgWGBZYZIE8rOiQB0v30PJgOkS3B5cHX5W/yy9SdjQaFhgWGBZ4ThYYAO66AdxYv7F+d9kDnnVcv58D6BXU1/xc32PqCC6o05XQ9HHXPi1+KwEAUl61X/urO5906gvvypm2MjVBK7/fXz/4lqoHgN8gALR5G2E3fspt6aJOgw4LDAsMCzQtUA8sGuXBsuPLocUheTTwV8b+GI6bFH58hgWGBYYFnr0F7gIeRt8BPsceuO494AHo2/9jwPp9tL2yAED6uWuftue74teu076PuvOFN4uhTKlLBM0yeeg0OdaKEoQA8PPDf/74H3m/AjCjUx2P/PgMCwwLDAscZYE8qOjYPazWh1EcXhymlElr/SRf5e7yRyk7Gg8LDAsMCzwXCwwAd90AbqzfWL+77AHPuREA0BJH0/Rvt76tgYC1j7rzRbf1q1GSZ9CUk0pYnmXyKWOfv/WdAfsGAeAn4H/VZiWs9kX+3LjUj8+wwLDAsMBRFqgHzSbPIbQgdQMB+weYh1ePHqX0aDwsMCwwLPAULXAX8DD6DvA59sB17wHPtBEA0BKLqH6ljTd+rH6ovqz5fUo/ZUizTLktavsWpWyaVrr4VQTf/JPf+tK1/WbEKrulxygbFhgWGBaYtUA9SDI/Pag4iDw4j6H7B1jKnVVuVA4LDAsMCzxnCwwAd90AbqzfWL+77AHPvn/7rV/9Y/dxpf9YmVfwI4CaLOm8X7vxUWmf7Vr5lsws6/H6vMo0P/lNAt78A/7xszsBgOzfG2uUDwsMCwwLnGyBPAR3B5VA/u7gH8VyjMyfrPToOCwwLDAs8NQscBfwMPoO8Dn2wHXvAc+zT33z537jsWD9Ptp/+Otf/3Z1ugKqn6mq+/6sNTufdFdyd643PpJ3utwCfkD/5O0/vna2o9f+p46x32KUDAsMCwwLzFjAQ6RFdwdVHkYeTj2abfd5VKljzag3qoYFhgWGBZ6fBQaAu24AN9ZvrN9d9oAn3oe97nWfeR+A/hiZBCHU54pp9TvNMyV5aZY55ayzbAnNfvLQ7c1aAgCmdfnUb3aM7GvZoMMCwwLDAme1wOZw2oiUvwtFUh5e8mdVeggbFhgWGBZ4Kha4C3gYfQf4HHvguveA5xjXw48B6+due3v1/xp9ttRZXqp575PmWPL7lBdppnngf5+6DtnDAsMCz9QC+4fSxhCUnysh0XGSzzLKx2dYYFhgWODZW2AAuOsGcGP9xvrdZQ/kAfhYvwMA+CcAkbpcMd/zNVvlrbKlUz/UN+vhW4mxsl0rT9n4DAsMCwwLnM0CeejIJ4VfmlAq+2YefnyGBYYFhgWGBRoWuAt4GH0H+Bx74Lr3QB4JfP/+3G/2D8kj6LD+YbpU5Onw+qU5o1ZZ1p/Cz8nMOngT42RdHXeurrYd+WGBYYFhgUUWyINFPmnlybcSg1kuD/WjHPODDgsMCwwLDAuEBQaAu24AN9ZvrN9d9kAcBS9wRfyL/r2/8soh0H6Oet76X9kP/k1MdeGZ6vseyjud2s7yQYcFhgWGBe7dAh5A0OQZ+FBe5WzXy1s+6LDAsMCwwLO2wF3Aw+g7wOfYA9e9B+rhd+z/BmDAQLokOLD+vj/fRx+fc1vgkO9L/aE259ZpyBsWGBYYFthaIA8geamNzB+ivfaWDzosMCwwLDAs0LHAAHDXDeDG+o31u8seqMcC1/EPgfm3/4m/fkObHp0LAgD+1/8HfR145IcFhgWGBYYFnq0FKthfYgj7tNrO1bXaj7JhgWGBYYFnZYG7gIfRd4DPsQeuew+0DruPesMbvqwH4gH+n/1H/toN6S1vffc2WZaBgSqDuo/6qI/62NaYo+zeLNDyg1tl96bAEDwsMCwwLHCsBTykDlHk2ubYMUb7YYFhgWGBZ2uBAeCuG8CN9Rvrd5c90Dv48qsAvukX/Cfwr3wNBBgE4M3/az/0I9/UG2+UDwsMCwwLDAs8TwskgE/+eVpjzHpYYFhgWOABLHAX8DD6DvA59sB174G5IwbATiDgY974tu8FwJM+461f+Uovfdpb3rW9EUBggIABfbhRMK79z1l61A0LDAsMCzwvCwyg/7zWe8x2WGBY4MIsMADcdQO4sX5j/e6yBy7sOBrqDAvcxQJgimPSXcYafYcFhgUe0AI1YFDzqNIqe0AVx1DDAsMCwwLDAsMCwwLDAsMCwwLDAvdogR3Y53+VWCVummTiRy1JWba+jXLbfqXbTsY9KjpEDwsMCxxvgQHoj7fZ6DEsMCwwLDAsMCwwLDAsMCwwLPDULLAB7QH6Bfq/63f9rteT+LHJVrLe9p1gwFOz15jPsMCwwLDAsMCwwLDAsMCwwLDAsMACC+QLCHkp3ZNfIG40GRYYFriDBXjeXvRNPyBeQA/Y/6AP/pBPMPH7FTVZJ6WP/b0lgOz1GOPZvsMyja7DAsMCwwLDAsMCwwLDAsMCwwKXb4EE88m3NK/1Nd/qM8qGBYYFTrMAz9ce8E/QD9j/sNe97jNJX/jvfs6Xm975De/8q/JS29GnBgNGIOC0BRq9DlvgRa6beC2FjcdG/PDXv/7t/EpqJjcqlHLaHBY/WgwLDAsMCwwLDAsMCwwLDAucyQKCe+mc2CVt5vqPumGBYYGpBbbg3zf+An9BPzjpHe/4yj/zF7/j23/oh374h37yp37iJ977X/3sz/43v/S+9/13v/Ir/+zXoeRJ1NGGtuIscJjBAG8FMNa4DTBdiJE7wgKAfTbWx3/SJ77zq77ow37627/2Y9//w9//O1756R999Q3pH//nL3WT9f/if3jphkT+jb//U/7SEcOPpsMCwwLDAsMCwwLDAsMCwwJtC1TAbr7S7D1X12qXZXflHfuuckb/YYFLtwB7ffLWvwX8AfIA+1/+p7/8CmBfwF9BfwYFaEuyjcGAGgho3Aa4dJsN/R7RAi+yQXlbD+DvgX0AfYJ/AwI/8T2/9eY93/LSK9/31f+bGxJ5AwC0J08w4RHnN4YeFhgWGBYYFhgWGBYYFngqFhBUS1vzsk5qG/OVWn8KrbLMV1m98tpu5IcFrs0C7O0t+Od7+oJ/QDpv7r//+77vRwDwv/prv/obgH6CAJS1rvz7pl9KG0A/QQFkGDSgP20YgxvajMnY2x8K3PwuwHjurm033Zu+qx+M4OqIb/kF/QnwkwfsV6Av4G9R2tcgAF8JuLf5DMHDAsMCwwLDAsMCwwLDAk/bAi1HfgM8No4+s7eN5VrEcvPnoKfKzH7J31UnZVWKXMvuOsboPyxQLcDemoB/wDg4C3DuG/8K2gXutKvJ/lluIIF+GUwgIOCNANrTdwQB6hI99/wK+Av6AekJ8uWPBfutAABlyKtBADbvc1+CMf9hgadgAZ7lj/jkL/45vuKzjjQ/hUld7xzWt7hYEwKtn/rmz/3GVvJ3WXAQeEuwmu5wiK93zYfmz8sC+azKb0DH9Dm2Lq2T7ayX0i55+2VZ8r329qv19q30ULuU1+KVZ13NWw7NuhafZdlv8G0LDHvt22UN/v2+v+AdoM539wX+gnT+VgvsaWvi73Iv2cZ+yDAQ4NcDGIuyDAKU3wXY13yUXIkFNv/Vw12UfZGr/nyv/9yAvxUIqEEAvirAJr7LBEbfYYFhgce1AEDyc/7YO29Mb/njX/I/8sfocbV6ZqOv/hZwln/O53/O3/qDX/iuX/xTf/67bo5N9CNQgLPwzKw3pjsscI0WSOCVPHPp5bM8eeefZckvrbddpcqSZn2rLOsP8dm/xVsGlUdmj3e8rLes1y/bJp/9rpXP+fR455b1lj0nyvz33vwLzrniz3V/ru1zhZ+/2YJzsBBgnzf1JIC6iZcqJPNQ29EngwHIRDZj+LUCggDoQDv6la8DPKf1eRpzZZG5qk/iu/ou7gtHBgXYEMjI7+23wPs5yhijBgEIPrAhn8aqjFkMCzwvC3CD6I999btvSAYApB/zxrd9L3+onpdFHn62nP2ngv5ekODffutX/xiOxcPPZow4LDAsMGMBAVbSHo+YDSDZF2gf2yTN1rbryWm1bZUpxzrlZbl8pfaBWtfjqW+1qWXZzjrLpIzBp9ZvSnflrXz2SRm2fWyqflWPLE++thv5tgWa4B9ADvgHkPtWnr/bgn+BP/7SFpyD5TZ4jnXYJctX1KAAGMpAADKR7W0AbxuggzhxBAHai3c1pTjegumkAGqCA0snQttzgPulMmoQgK8YjCDA0tUa7YYFLsYCLwLw//BXfMv2TXMrCPAZb/3KV/ijczFaPyFFcBZ4498D8eco50bAymTDEXxC+2ZM5SotIABQeZ/JFq1l9JkrU6bUtjVPuXU9Sh/rkrevtFVHWeuT8lr1ltmuRR23VUd/y5O3Ty0zb59sZx209bFPq+4+ynK85B3LMqnllWa9fI/S17oq5ynnmfP6v0kHYPNyVSDuj/R55b8C/wno39huif3W462DBLfBgBoIyCAAAYj6dYD1uMvHe8prdz1zY9GI5videihAWjD94h/9gRucczbjoVmxQZeC93O1awUBuMVwSNdRPywwLHAZFqjgX7A5ggAPsz6c29hau98n5XYBzszDzGyMMiwwLNCwgL7cxunfNJDPOmpaecuyPnnre3RJW9rkJ2XBzyX6Zb15aH5SJuVz+Z68LJdXlnlolslLe/WHytdC7/kfdZgb5lAb66XOe05mq02vf5Yfknkt9dvv/fM2HpAP4PbNv7/OL/gHrK9vSPpGf7eXT5nvemyCAcg0AMFYvOQl8JBfB6AcHbfj323sU/QdfY62wGpx2VDv/ZnPeuXXfvUb1j+qx/X9L//Od9z83m/6G6/8q1/wdb/xqj/9ozcvfdP7bl79df/1DT/Kdchxo/5cwH6pHAIArSAAPyDGxj3aLqPDsMCwwINZgNtHXPPvAdBeEIA/Og+m5BMeiDP7PgF/SzZfCXjCJh1TGxZoWSBBSo+336F62x1DkancFs0y2yZlrFabLIfPT7anfE6e9VLbmpdavoTaB8qHPnykm9z0X+uSJm9/ys6VlCnN8Xq8baF+bGv+PqhjSB3DfKXWt2htW/P2sbyXt/yp0An45280WM0f/GuB/+1b/92evKstsPneVxDwu9Tlf/oX/+v7/QoCOo4gwF1N/kD9eeMj8Af8w3/ed3zrGui//Bd/7eZV3/E/rxPAP9Nv+/qfWt8GoH9LVTbh1/6xV7+S4P1bv/Z/9wplf/bPvWV9PZ981p+DbwUBCGb8hW/+czdszJauo2xYYFjgcS1ANBnwn1f/AYw1GECeNv4eAJSvAxzz9aTHnelljs4f82rrFmC/j7Le35DLtNTQaljgQSyQQKfHH6OIMqT0hb9rUk7S5FN+La95dZujKW8JX8fIPLyfc465RK9j26DnnI51HuazX5bdhVePlGFZj6Yec22WtlOGOpjvUdtdG927+s9bd36Nnx/jA4Dztxtsw0vOAv7PPdduEMAfBkQ3/p5P9Nnt23PrM+SdagEWCGD8i//tv3ED8Cf9Rz/6Ob8BsP+g7/6X6yT4h/72v/Dfb28AEAjgNgBl3ghoOeCrn5r8GQH/O97xVTdf963ftk46kTjylJ87IEAQ4Ce+57du/3tAvsrAXHlYTrXX6DcsMCxwPxbgD1gL/HtOQCs4rUEA+nOD4H40fNpS+VuQtn5onrVdWVjH7Wkbe8zuOVqg7m3zUmwi36PZJm1o+yyTt06qDPJ3TVVW5uHz4/hJ7zr+Mf3RJcdWt0Nlx4zxWG1bc3NezlPaK7e+RbNPiz9Uhsxs4xhZBm/+EE15ta2yW9S2rbpLLZu8/feNO9/7JwDwSD++txcEAPCjC3rl7wGMWwAXtK1YDL4PDwiG+gN/gGOCAL71B/y/9AP/fJsMAgD2BfyAfnjqaA999Z/6h+uvBuCEs1GJRvFVgTXI/5a/efMfftd79tJXv/tv37xjVWf6uv/gP9gGBO5yO8BbABkEYL7Mex0hu6B1GaoMCzxnC/BdMf57PwB8gnx5aQuUUke/TCMIcORuWn3969y/9N9aq0Nl/JePR2o+mg8LXJoFKsg4lFf/bNfiKeuVKwPaa2O5co6jqzPiVnbt55hZbpnUupq3/DRadar5jS1StuMnladd8q18ynpMPvWUb9FDZdTPfbSBbTIvnzR5+pA31XyrrW0OUfvSjo/5Q3TT+rr+3Xv7z5V//rs/KC9dwVqPALT3AhPogk78HgB03AK4sI3GJgEEZxL8f9rXfPOv80YfIJ/gX94ggJQAwKv+ra+5+YCP+fIbfhiQvnxdgGCAXxtYt/lD37QG9y3wP1dmYICAwP/53/nMm1O+GtALAnzFm/+Vm+FsXtjmHOo8Vwu8+Ic+77P/AQCeQOEcSDQQ0KL1NgA/JDgCfYu21It8B3/O7g9VRxBirNmiNXuoRjrUDzXeUx1HO7YoZVne47FNtq22sl9tZ3mLKq9NAdSC6uR3erT7bTSzTn2klp9G1aNH+7rl+BsNN/+ihx91Ii9/mKaNlvY7pc9h2eotdW5Sy6F8LJdm2brB7T+13nyLUlbLU26ta7VvtUkZ8kv60pZPlbkpvex/90A2L295y06qV/9fcE893JzW+uWPArb0e4TgxMNZ4JpG4k1bgn94AgB/9M//8Vd+6//l/7t+o+9bfYF/UgH+q1ag/gN/5++5+c0vffQN1/tJH/173/7+D/zX3roOCrz0Bd+1DgpwI+B3f8l3vX8O6M/Vfeff/Ls3f/3//dM3X/T1f2s9zl2CAPwvBsyVxLw/7uM+bgQBrmnzDl2fngVWf7AA6oJ/gb2A07zU8h6tQQBuH/HH5+kZ7nwz4r/i69nzMcr5rwfPN7sh6UgL6CTXblne4+2T9ZY9F1rnnvnksYf5Fs0y+Ez2zbJWe9tJa/u1815kb9oAJGpCB8rUJXnLGGnH7493al3qgozMt/j+OOqXVH6ZvozXlz+VkW3Vs9fX+qS2TTmWLaPOLWmPR3c/8jkf6rLcfLapfLZJvraredv2qO2p50OezyG6abXfzvJLoxOAzRt1f3E/37Dj49zz9/57dlnrx9jowNcI0RHdvKGQtwBe2O3jnrxRfp8WYKH4HrxBAMAwwJhf+Aes+53+XhBg/fZ/9dYf4A+ARpagGjm8cefaPunbv/Zj38/3+j/vz/9ff2MO5M/VGQCgzR/+w2+/uetXAgx4oDO68/sE92nvIXtYYFigbwHBPwGACvJrHjBqmTTLBKvUZSCAHwfkD1Nfi+dbw9XBQ7cutOtDUvR6vqtytTPX+XYCNW/5c6A598qTtyxpLTcvxW7yUD5Js26eb4HMqezDIHuJjCrz1HyOdYhnjGwzP+YyG1Z5mYefH2OzFrVdlWG+6m+5tD+Wc1myJ1ptKeOT/Q/l5/dZX9dj+i3RwTZVd8tblDI/9jN/KXRy/Z+363y//kLe/mujSZCCv93omf8tIP7X9scJd/vL/oM+oAVe5DvwAHUAOz/4xxt6/ns/AgBc2ScRCPDrAP4eAOCfN/z/h9/5O9dAXOAP5fcDoAYWkv7E//1Ne9/7nwP9tc4gAI7qp77pTeuvA3jr4NiAQP4eAPp+xpe/+ddaP1z4gOsxhhoWeI4WeDHBf4LQBPeCziVl2cYggIEAggBEop+joefmzI2wP/AF/6d/zO+vaOtLoOO/BZxbtZPr0smVlyI0+ZrPOvlKVczyVr7W2eYp0Dq3Xt5y6MMngeS5KHNA1pK52K41tnJqmyxv9TtU1teLPZf2n+ar3Dk9pnJS5oavssjbp1VXy1pj2/88dDp3cueRu2+L88g9RT/7tChll/dZ7QP+RvN2XWAN+M9f/qeONi+wZx7r09CTQAU/UviOd3zln0H3i9DzsexzYeO+iDNMIIDv8PP9/RoAaAUCCBDUt/4ZBJAX/BNggIdWUH9s/u+8979cy+CmAok3hjj1n/d5n3tj4ncCeoGBDBSgDwELbicg4zM+4zNuXvP6N/3g+iG6sIUa6gwLPDULEAnmeeMZ7l39B4QK6KVZliA167Pc9hkEGD8OuL+b+OOcAZhqw8fIs6bj1sb+Wj1QCU57fjKffKtN1iefbZ8yz5xNzFMbWDZHbT/X5vQ6AMId0vaK8UpG8luZu3lPdZwbkz5ZX/NZdy6+p2eWLx1LfWvfzNtmqcxj2im7jnd6/lx78FLkqMcSSptL+qyfDXCJV+v9r/8u8L/Zm9xUAF/6VYXUNQIVnBHj89gWYKH4nizf6ScQkLcADALkjQB+KFCA71t/gH/y5G0D5ZbBsYC/tud3AEg69f6PAVLLcWRJ//6//yfX/5MA/70g6cu/8x3b/2YQ4M/vFdCHwAJyyWOHEQR47B05xn/KFuC2zRs/80teIfDms1oBfOZpQ940B0btJ822lCGLcbl58JRtfMrcCIykvS6BH78FcMpKdvukw5W8HZaW0d62lbZk9drY9qlQ58l85KGmXrn1hynAcCfvcHvaHgMmG20F+lLkwWeesrVeSeHvITmulDHUxzJpd/ylNlyif0sW/XrlS2TepU1r3Esr0z7O8/H0Wy3T9llNnmerlc+yTYv7/Xf9/PoDe2C1H/rhH/pJ/+s/AvderX9Bm96vPnPSJ7qiG/8lIF8DQGd0V9f18zm1+5zcUfcAFniRX8TnNgA/3tcLAhAI4OsCvtkH3Ffg7y0AgwJ/4K/+J+sfFqyA/tg8XwPwFgDOqcD/FEp/AMF/8TM/8xs8TP/ol9538973/tQ6CMBvAlxbEABQxRvV1/72135DTZSP/+3gAZ6gMcSsBfgj9sbf/yl/CQD+yZ/+VWswzjPYAusJPjNIsKS9z7YyqvxJEGDzR3NW72dU+SL/DSPnqbZ7bMrajVsAJ+1AHdhDnVvtLDtElW078vKV2jbbZNm5ecev42V5rTtGh5TT4i1LWnnyu5RgqMXr4FeKDNu3aKe+gmZlZPkS3n5L6dr5Dz1rfqkc283pSBvrbb+lafvKr/pt2y3lU8ahPrZttNMec9S6ro7Ib8ie7Dd1WEKRtaTdMW2UWfU8Rsb5266meVGfyVt1vlfP1f/8/v9FXatfraW3FQgA+L8B+HWFEQC4qL21rwwLxFvwbRCA3wRYpd/29T+1/W0A8v5+AAEAgX4Cf/j3/sxnvfIpf/kf3Lz6Xf/Luu+xgL/V3lsAp4D+Vh+CCj//C79wQwCAQAA8bycJAqwP2X0TXVQJDxsAn/+N4aWP/PRX5hIA7KKUH8o8jAVWhzLR18cKaiXw92s70B6YT8AOX78mkPUCVGUtvS2g3HHjZ7oFCRRq00uh4xbAdI1OzAk+6Z684iyTWi6t5eaTJk+/Xr4n0/K7UMdExiH+UP1SPZQjzbEtSwq/SYKgzFdAdOY8fs250wsNHQWpORbtMt/jU162yfKlsrI//FYGNn+5A2wpv2tS/pycRpuqb+psXVe3lCdfKfpQ1kpzutqvtlF+Lbd9b5zsZxv7SC0/lmb/5PtyVuZYf1p2oYJyPtLKryvv4Z+9AADfqycBrgHZlxgAQCcDAKkv+JK69Z6e2vIeTDdEnmQBFujV/+af2NwE4AcBb4MAW7oq4wo9P6aXNwG86v813/f16yv/66DBCvzzw4HcHACAt0D9MWV5CwB5X/et33anmwDIQCYBgAwC8HWA9f8OsDk8TrLjfXfiAUPHJeCfwAA3A+5bpyH/sizAswzI9est7AFAHgEB9g/JQ/mFM+51QD+3Urhqzxt/QTw8SaCeILMCe0G6ffMmQPaTz/bKT5nJ08f22Ac7XdbKPZo2L9YfBDRwqp3PSZF9SN4f/MJ3/eKjWeN6Bk7HVK1bZf9/9v4F2NqtrO9E99aOxq/cuAOY06Un1VXp6uqc2F5Cuo/douIxRhSkOhANsLVQoe0AXjoaGuEYtlxENgbIxgCiaBDsAKYFBWwlB4sYNihUbC+nQzpoGqXTnlaStJ1U6Tkl7G+d9zfW/M31n88a72XONdft++aqGut5xjOe8YzLO953jv8zxnhf06BT6aRlSH3zLaWZt/K9ODL+tH8c2/1/2pGXptUqq3F0Uya/hKKTesdxwQn0goKAUjDZo9SlJ18iO0te7Gf+5C0bWU9uOhRnt/HkkZm/0c0xfnJNVmVs6O5LZpkde9Z5jFof042fmVKnu1eOgR5FVoN5qty47exRdaZo2u/ZqLIpW6bVPKfj9R7vxZFd1F9zADA/YZ4G6AdQ54o6aW1cH7flouo1Vs4N7jfqlA6AumPhCtV3rB23t9zjAO3FgNUJMMT5rB8OAAOOAJwC7ROBA+D3CwJS3i3wLd/31r05AADtTBydnOoIkCJPvuoZl7KzwKMAUI4GAJpYXb9qI4GbByC3FPjnrgBuyqvWnkN9zq8HGL+MY7bcQ+cC+gTOg1dHgQ4DKQA/A/ps8Sc/u2gA7oJ2KHGdAYBvAbm0AkHz6ADQ3pg++bOMJfqZB6fI+V2J62OZfqDvfTZCn/fq/6HF6zW6iDjXm8nP9enBS62pIDMrkbLk0TG+DUU39Y1Lq93UJY2/pbLUbRk7/6qtGteGck0Yl1a5+ZJWvubB1rIgKNmVUs7CvG3CPehCCRUUKx+j6kt3sUEe6jtWhunoGKZ0e2nWD2qoeto+RRf2Z6+ep2zdHWAafotQ6zsX38b2qO7Cto/mr+3THtRQdbaNa5N8YzZTZ8q++ft0MB/1Jnb8d9KWkzgc8vP6WzsABNT5BQAXb9qYPN96LG3fur46LHpHFq5QfZe262roMQiYdLuCx0PuDgf6fqt4g9VlXgzI6n1bzXcnwBDnPQCCf+irnv8FnwDk/8lv/cX1pwNxBtz1U/+mBRwJT372PzizA4DdAoB13wWQk9QxvucIQLfKsVmdAAAnAA193vp6v328tTWu+zar/gn+4ck7FHqeD6yt23TIcD49wAOY8Sv4l5fqGKjpc04C8/doXeEHvBESzCur4BG5stSHJy0BfeqaB4quddDZYH71enl1HODEOJ+rcb2sfv5nPfyt9JfPVBwABmT25UXRwycB9z5+er8BynoU2ZicymWaulLTU0eZ1DTi/NV4lZmeNHn1x2TK1etRZPyl7rHk+D9yAxL5cepcbYa2CfKMzh07pCeYZD5DXJppPR49Qy99Fxlt6OUbk/d0kdkG69ej5sX2NoF8Pf20l3xPd1uZ9pZQbaMrf2Wo98Td0efIMr4tX/PX+BJ71mucej9Luacv428NqA8OgMvo/itUJhN6zt6z1T4Dq+/veMvDbvJJP4DqvqrcgObnPGV9/n/tBOg4AKgXn+a786t/+uiTH/f3Nr4m8Kf+7v92xMsFv/IJ9204AJhIbrP9X12PAdRdAE5WpTmBddIKrcBffeznSwFxBvzib3z45kPe8uvtE4m8F6FtFx5AwkWfp+fhzqR8l1X/6gQ4gJx93SFX2w67RBKksypfwb6yKs98PT7zkQ7YlgK4KzBcCuDJpy6g/AUvfOHRD7/uR47e+BNv3NoBwPNGZ0B1AlhO1lPnweozgZf1g38lBhVb+Pg0Ks9GgX9Sn6fZf+fNf/ljnvwDV6JzrlYlcpz2+JRR87F4yuWhBvMa3xfVbqXaT/kY39Mdk6UNdDKevPnVGUtLvdN8ghH6MuMdfgzECQTn8k+la2NbKrgmXwLrbe1so287luSxTlk/5mfKpWlL+9tSbJAnbVV+W5vqz9lWD2qZ8pm2L976zNkb1Vsw3udsn2v6ybMt71vvc+9703pyZdDz+ls7AFxRv+Jn6tf11WFBfQ9HAPYwPABugH1esKcDIF+8hxMAEL76xJUDeOeSBZzt04AD6M93ALCiz5Z/gL87AHAQsOrPLoA7v/DFLfzJwYGwfp/A8F6BBNsC+qSkZ3yM99N9pDPx1O4YuF8qx146AXgvwBP/6e+udzHgBGBXBAFnAH3Nqjw/Mjt39ExGbiScMRXI7xrH1nnWd6Y5h+QL6gF2rgjec7Vf8K7MOLrypPV4Zehm/gTaPSAIqBeE1xV441ACwJ/Pdt730vuO3vC6V9wk4AAwTTu9cgTx1kenBM6AqXzaMv/hM4F33NGOdAxOI56tCf6TJ82+uwjKEZMLun2uejHb/r5X/YzLQ6d408+b2vdZF2TG5Y0nhZ+LZ/6qa1qlqWeaZW3Suye2KJO2Y0jQt4sN809R5gVz6T1APZVnm7Rs11w+69GjUw6ALEOesuTHaOrM1Q0b6kvH7FZ5z3bqzNkzPe2QX3na2oXXjjRtp2xtm/vx7vFxbx5p1d2Qz9gy70aeibKHG3nz3u3Hvd+l9VmgHLrvvwaoGc89BwDYAGc990Br+75L39be0NfUpb4DACcA7y+gDaS163Pc19uWcPvq04H5yT2cAID++5//aTfb+fsBlLNd30/1rXYDOFi37jjyf/Jdn9tW7znLr23P9eMQABA89lmP+SPA/0Pf8MfHOgPQB/gbOC7QdgEMoJkJNpPGd7zzHUfv+YWfa8E3+1fKCn+GdAbkLgDBf9IxwJ86Yzzl8DUAdgB4JODe9/6b1g//4X/4H7a37ePUYFeDzgD4dAjsa4cAq7i7Av2a7xGPeMTRV335p7SAc2frAXHIcK16gPGoA0DgnqDdtATz8OpmevLaqLqAbsG8YDDj8AbTk5Lmqv8rf/CVa/CvEwCHAOlTQB4bFfxTT2W9vOTJemw4AZg83MZ/ODf5NGCC/h7PszT78Dz5gxPg1ICsv/EZT56MU3HToFchZH1r3Uw7Sz2X2pjXmwIZqzRBifSOyNOTmU7aVLp6PZr5tDNGmbjPpQm2x/TG5NqWjulVOW2qMuvQowJ/aeqknbR7qt8Y+0O5NWT+ys+1q9rKOLaISzNtildfOqZLek8nZfJjFNumyRNP2Vj5Y3LzamcsPpa/ymv+mn4q7nVe/qzzOdCjyPjzOXUcO/v/Uw6A3pl6xl9r39nLO5uFuw+fATxbB3ZyM7Bf/JIXv/6P/vAlRzoA2Anw9Bd9+02ANyv0rMgnSBesA753Pb+OpwYHQAPyw6o+NgX/AHp55MTbOwAG4A/wJM+/9+gfPPqUJ/5se/nfc370vUePe/1PHz3i3ve0wOcBCcgJz3/LAw3s4wTQOfD+97/vyMCqPIG4q/9SJp91Yj8G7pXPOQjSCUCZ1O+r3/Jb7TN7OAEMtLPtChj6v10DdwiEQ2CX/ueG3teqv6A/KfVfOYg6I+4guhV6IIF8gnbBvLIxPeRVR11pOgEA5wn8Elgnr44yKIF7OFf9Bf5J1TOPtqTIqYeA37YS1xFQnxXmTaodnCjtx/VWGBA7toHfH45F8OzsgX9lpGcfnhfPtTkcYzp1MZ14SlGY40nPYJ6Ubc8Pk8BmF5qBsjIuv1mHsfKybsmP6V+s3LasKPfMknBHydeLYwe5tKczJ1tSF3QEspWaX7nx86S2uZZBHQwA/QT7Na6etNqq8daPnXFa9YxXu8RN69G8TqSPxU2T2hepP8WbD2oYs2G6VD3iyZs+R80DrWGJzZrfPNVWxquOcWnqdvn+M8jnjDSfKcqg/JF2Hn/tmcm4ZvUch/zb3/H2B1iYBBOyAwA56a1d51ePJW3bqCt1o47UlTpTd+varsvl1nVJey5fh1X/9//q190E/OsAEPj7xn3BuKA/qSAdcM5kdlswykVjKzEr3YD5dgxgAPyC/dzez/l0z6jf+XnPau8CIA+gX8Cf1LplfeF1EkBxYPDyQCaXgHJ3BKSTAJ40dJgcMsEfC6Q7MUV/KmCTgLPgpe/6wLEDYNgJgdOlHXcYQD+01p8+whnQHDOr4wLuEGBFnz7lh2JsdO1ry38C/h6PE2CqHmP1O8ivRw8kSE+gnvLkU0fgnzL4DDWvDoC8x7zXkpqeFL636p/gH/7vvvx71/e2+avtdAAI/Km3PLTnBKj2iGPr4AQ4Hu/8ePMyPgH/GM1nal6bffJcl4MDs12X3sSzyowvoeicPdx9evLfnXin3j7KPW8b1JcykkYbmNhuE5qdIX8CFfk5at4pal3Qke9RgSu0BvRN7+U9L9lYna2fYF+KHN70Hh2rq2VBW/Aar+KZD7vEt7Gf+eHX5Qz2M66e6aZJp+TqJIU3ZN4p2Vh+81SK3cxjOZXWfFPxtFntZNxyldW48lHqdd7tucED2Gdq5Ynv4689axhrOgB+6DWvejugGnrFQPXGbgXqRh0/9rHf/3jWlba067HZd/voq1vHBqvvb/vH9zbQL/gnDii++4f+qIV0AIw5AQDZ6jWenQKrl9lxzpWVFCZShM984n/7HGSAVOJ6l7ipqA8TYbf1C/TbCviw4s+qf9sWvwK8rP4TeB+A5e9Ca7sE1rQB5wCBCadfBuBYgcA9qZNSJqFM/plAGhIMqEdeAQDHAXgZIDsAPvcn/uDmw977f36iF/jiAS8MJOggwAlgoM5tt8Cqj+hP+pu+5ubmxtjHlv8e2O/JcAAcjgLcOs+M2pIE6Ano5U2v8R7oV7fS1OV+SpCXgFoeavBe5EV/FehPxcmf96xlapd6CPJJE/jrvCBuOnnM36OkY497tXnZayfffvEb/GZ864ve+Bs4AL77/ge6uwJ4jtKf0l7fnkXGdVm9rPF2uwJjE07lY9R+GktHPh3uLuC3p4/ORNhqgt6zX2W1TsbRS77m2zaOrZlg26BLAvbMM2VbnbS5NK96mZd5BnFpTUNeQ+rIW2fjF0Wzbgn+U97jqR/yqXrapkozz5Rt09TvlZfXJMsxT6Yjy3jqV76nq82kaS/lPX4bXfObZ65+6ldqfuVL7ag3ls/0Sbrdc4Fnqs9Mn6/KMn42/u7T5+rzU4DgNPAZY6217Wyl7Z67U88rfVxh95aea84brPoL+qX3vOb+ttLMOXuAZoJpQLIBkO+KNDxyHQbkhSevwNp8UG2SH6DNqrWAv23rjxV+5VD0WPXWhjYtX7n2z0JtizawTTkEdxfgJPnSl73pJjsHnGQyEQXUu4NAigyd6hRggomM4OcB23sAVp82/Ix/8vGjuaCToOcUSEdAdQy0/ly9R6Ge45+Kf86f/5z1Gf8e4O/JcAIcttOe6/18acYrWO8B/QTwla9x7QmkMw6grg4A7z0o91PeU/Lbgn8cA+TRAYCdtE9cBwA8DsGf+u/f1MqmjrXO2DG/9dVmxg9OgM1hzCSLt/LTR2OOgPMC/14vHKebtbqtY2PAnk5xkpp0TJ46x/wwsWsTy0qxm7IaH9IYJ+g4Ke9R0jdCtVPrj37VqTZqXP1qq8Z3sT3k6bULmYBwCRBE/46o91jcslK3x2d+80CzTrVeNc145k+ecolLM63yS3Rqnl7cOknnVv3Vg/bspYw69kLqwE/ZnCpH29XeXJx86Jg/4ymfs7NLumVtm9e6bpuvp3/WOliXUbr0+VCfFzxFj2VJm3CP/zZW1sGH9c36bq1v7Tupzx6rMGuq/RZwL1IXnBLUE0dFvgCQdK7vYI3flsNf9gCdxkv9OOdPAPyz/Z9VbgAvwD+DIBgq6BZsA4jZtn/Hwx9zxHZ8VqHdvq9Oszno6TAgnXyAbJwFpLeV7MFOA/yDA6A5AgbQrwOgAdlBz7oIyI1fJqUugG+PFOgUYIKfDgGOEBh0CKADOFCPHQA6AGgT12HOATCWjmMgdwmccgCwQwCnSrxoEL4dt1jttqiOgB6430bGj1aOxQN//XuAVWvBulQA3HMGmFbplCPgnnue3D7v+dSnfnMD3oJmQZr3EfcSASDd7qvylv+64s9b/wHuhJrGewK0h/0MlEuaK/y+aBTK5wRxHlAH26he1lseu8nrBOAH7vqPjv20gJUHdjHR5/VIAM9Og/24L8q1YYvhflpxraw4carURlT5VDzT4DfD3SswhFy+R83XSetN5sdkk2VU23N1qvrGrWtS0oyr16Ft4hpy47bnjlWacUEi8TFQaB6o9lImr82kps3RzGOdkma6vOnGx2gte0xvn3LrtpRSNrq1Dj1ZbQ/xXr4sO+33bNb8xnu2TUvaq5My9JbY2aZeWfZ58Pusy5wt+yapfTdJfR5MU565PjPh+ctn6rHk7P83wHVurX/Lm9/8To8B8FvseIh6nL30eQutDyibOjA/ok7UrW7/xwHQ+v2kn+at34oaXigoHfacb/mzv5yf9IP/4Z9/0oNtJX4FOBP8J58gG+AOaAeg8wI/Vnif/Zg/c/RFj3xkA+8CRwAAgYkwk2A+H8iW/U9+3N87dhasXuyHLVersYkzYR2GT/251Z98BpwNbP3vORyyrhfJZ3897N0f/Zir8u4a4AWFvIwwdwngFMgvE7z2/R854giA9QbIj4H8beTYoX46Beg/+3z9lYHBKbAhWzkIcApsA/THdA9HAW69p4yfARTsT1EBsY4CacrHeD6xxzNEMC04BzAT+KQfAfANeOccfwX1GQf0A9gf+IdvaOH/9fYf2dDnXQGWkeA/eepC2dzDPVvUBR3aCa1gvwdU0UEXxwoTj1tvxOzeIn7Y2ZL/Ld/xozfTEaADQNrr111kXAsmG7vX+NrldGKZFVfWJmBDghQd+bPRu/sroutJ3EQ6c5tdQrM9YTfTcx6VfOqsefrk7nBq1LhpA+3Vm7y1jJ7eNrK0CW/QhnGosqTKU6/Hm4fnVg2ZJg9dAq5q+Zn/PPnahiVx6zPWrl6/KTNv0iyzJ0/ZWfnsZ2xN1cuysp3W1bSlNMuxDpa/1EbqWY9KU2cpX20Y7+Wv7TB+itZnwrLnaD5v4fOP5+9Z/9pzi/bxm5er66yws9KODBx5SQB7w0Fh/eouBepOG1qfH/frWfvl+ubnovEmfwKf8yP4hn/APy/6y231CWDhPQqg3K39AEaA/0Mf+tCj5z/zITexiz0oZbHDwGD50lc9/ws+8ZX3vvzjbbfA4ABgN8DGDgAdAAPwv5OQzoAxfuUkWDsWVrsMANF1O7/A+jyp/fXQd338yC36UtLSMYBTgMksTgECzgB2AugEQF+grzOg0of85oNHGdSfo9jJ+rTrsHp/A9fYXQM6BXDsfPlXfMURYQzkz8kPRwGu7/OkV3PeJ5Gr92MAPsE+OgbllZKeoP+Zz3j60Xd+599Yg3yBvmB/DvAL/gH6BIB/rtzDqwPFHgAQsAntBcA/YF1ngralyHEkoEf7oNhJMFrjpukEYKLR6/fbWUaf8Bz5K0+778Pf+uy3tS/AfMv3vXXdrzgC7MezUF5GOPTzPiZX1+1y2eZKaUfK4HcLd58A0VMTZNOwLT9CexNxZE7Uk47pppzyiFeqDvJMM74L1eZSarlL9cf0tNOrcy+PeqTJayNlmdd+RwafabvwlmveLH9KZtpZqW2wXVLtGldPeaXW2/ZUWvWrXe2PyWv+ubj1ST3rlLIxPutR+bE8PXmWWfme/pSs1qPGyYss6Zi9mtf4mL5y27CI+pzb7lmaz2L4ffxtHANwhf0P/+gPH2Sl3Xe2XQLIPuWcoC6u/ucOhcP2/xgGOAAS+AvUAet/63uf0FbPAeBtK/9qiz2AsAJ/ZYBmVoMB/5wFB+Rjy2BZPaoDAKrjgXI9KkAZAFDse6RgEfifcQrksYTLcAjQrtZ/gzOgOgSQN8fAarcAOwU4SvA3XvKL7V0D9E9LH4B6jwrwcSiwi6P138CjS9ouTgHykX/DGTDsBOC4QHUKsKODXR9zoL+m85CMYXpgr3EP4IkF2NYAWGcFvcprHB10Da7iV4APkF4K8hPIywvKAfq/8r6fWQedAMjQoQwDdcABMOYEoO4AdepGfmxhA+BveVDqQLvHnACA1J4jQCcAk45rPETOr+p33303kxSOB+gMwCFAoE/P6gi4jZ2VgnyunbxAX5nxZXS4Vs0WdA+h/YYMdpxwQ3NS70S9RzNPj6d+PfmYTH3oOjipT1nh5+yNpZ+HfF3voY49+5kuj5481HzZ58rGqNcs09OW8izHdGXopMw8SS1HmmlTvPrQXiBvyqutrJf13aBlnNT82q7lKK+05j/POGUvqddYHeb6hnz21ZiNJeXXPrLe2qzxlGdewKVxdZLOtce2bFCv//Fzdsmz1OcvlD/y8Cc9ju32/xTQ9ow9uwD43J5HAdZA++7Vc3238pbkanWinynTrf/UhTrl7oRLcEwsqf/l6bDlP8G4q//IANqex/dMfYJxwLLgFUoawPyzPvuzN1b9tSntOQME/5TLkQPeN9BWlQfQil1DczDwcsABbLLafCYHQMcx4PGDdnRgdfwgnQLrHQ4rZwhpZw3Zh/A6AaSA7b/wwT++SYBXH1APj8wgOCfeAP6gw3VkJwbXxeDXEwDoOAawtc6zcLcAzgPyrF/WONhpR0UG6s4AnCsEymHrdwX6Y3FWjS/vrjiUvOceuPHMb//W/x2wLHCu9KUvfPZ6Wz4r9oaqtzQuqE9KXuKA8ZQDwF3t7wH/dAigl3WgnkscAIBNHQkcB0jwL8/7BnAYTDkBqiMAp4BOgDZp2POFu8XM3cAZxUsDuWb05VmcAPQ9k41brI96zcmJY+WNJ4UfD0wIdwhM8MgnXWIjJ9/yTtCX0JrH+FJqHdU3PkfRRyepNuao+eb0tknv1Xcsv7pj6Sn3Gig7a90zv/VImeWMUepDWqVj+sptxxjVpnbNl3W0nlXW7qW7N+8Z86fdWvZcWto4D9621nrVuPWcq0PtH/WVG+/RrAvptQ5T8dRP22mzlz91k7e+0AzoZHyUH3+28uzuPXeR55/P6pRtw5/aBeBn9njbfj0KsG7XfhwQtZ6nwH9u/e+d/W/1OZ+61Lpd/bgOAMC5jgBX/wFxnp93F4AU0NvA6uprAAB0zuYDMO9//qdtrPoL+HvUMqX3vvn71mCfsgCXUB0AUMqGUr/2PoBtjgJ0QP+kE6FzdMA6Cfw9QnAW54CgvvVp7ATACZCOAIG+YB2Qn6DfdGSs0HM9HvGIRzRABQBh5REgxkvTkOMYuPPOOxvFoYKzgFX89U6BYedBA/kD2Lcsy+MatPExHKeoFEeATgDstbDaIbDUGYC37urfQYcaLukBQFcC533wgPhqR1kC/MoLuKWC/wT68oJ2KQ4Cy6DsdADkLoDkAegAe21ILb/uBuD+1AkgSK3Av8opg3ctDNfirD/uSy7ntddhwlYdAdmnS/jV9v9r3xc7NsCJJtnlx2mZ7I5Objt6OXmuPHbWE8zglaV+b5K+qyztzvHUcdswZ3Pf6fQDNqXVfq1/Td82nv1e81JWlS2N13rW+BI7WTf7QzqWv+aZi/fs1Lq2uPfW3ZtjqObvladOLw2Z6fui2pRqd6z8lKtbKX2ArPVF6QPTMr3mty5ZVvKsGBtSvi++1ifrav3H2raWMwbuHq5/UsfFOPW53KPIzvK3sQsAJzig/+3vePsDAG7ojBNgH3OU49+aoV/oU1f+Bf9u/bcu1PGw+t+55DgA2KbPCjwgHEfAPS/6ngfX2+IBdwMIN+gAkArI206BAUC+7RV3tfP+AnpAvyv/lVYdzroLqgX5lEsZNajX6rnaqeCWdFedAaCc+fcFgYvfF7DESRCOAXcLWFfrtotjIB0B8IBvnQBJBfpTlFV9wPZL3/WB9s6A3/qd3z766L/86E1uUsKH/vk/by8nA3BwZp8jGxzdMLBLgIBToDmDVrsEqFcbDx3gn46AlgeHQudogM6Bxz7rMX902AXQuTFvMREP3wrW9xUXkCcdW+UH7BMA3/IA8rGVf9Ok/+zX/3HLl3UH3NddAMahbO3vOQCwmc4H60XdcCzoOKhgtHcUwJ0AByfAdjcOEwOOBtQ+novfJqv/TtSSHk+8jrs55UhM26RMXncIvcnzWWR1Us+kEVkCgJRV/YxbD2TyU3RJ+8mPXs/OmHxp+T2byrRh+6rceG2D8rNQy97VRs1vHbEnX+lYWdqyH6Tq17hyqelS5dCeLNNrHTfi3ld3b95HmV+ecuSTZvmpIy/NPNvw5u9RZGOBMmqeWq59obzGkfdk2rWMsTp4/3vvj+ltK7e+Y9Q6Q7MNKZ/kHRenqc/iHk0Z/K5/G04AgTcv3ANb5PsA+I21b9ftOa7zmcrGFtcE25RhHSgbnONn/5AfwP9IV3OGkZfuAdyhAEYAdNsWngAvnAA6A6Q6A9i2ryMBcJ/gv7f6r4xPDGLjIff92wb0AdDN5gDgAe8C6+oE0PnQtp3zQrqyU6CnjwxHgc4CgChl7M05EI4B+lHnAHVLxwDvUOi9R6E6ANIJkGDfXQFS03gxoPwpOqzmP+Vnfu9BPiPIlwR4kSBOAR0C/+Ov/uqDvpSMCS4vWWNXAE4AnAIbzoAcGyM8bRfoS9kJwBgD+PNySAI7RuTTGcCXI7jBR4buQXzNeuBJX/+ktyZwPm8+V/7ZXi/gT9ANCBfc95wAyFLnd//ZO5uzIOs+5wAgHSeAXwLQXo+mEwAnhs4DAGkF/jVOOdyzKyfANRsdl1ddJhDbOgHYPXB5Nb7UkhP0bwL9OhEdJmjrCV/hxybF5ynvTeC59tuEasP6Ipcfo/YF6fLSsTzK0ZOvdEnZNU+NL7FR6zBX96pfyyRuf5q2JI/5zJPUOvUoenP2rc8UzfLkl+qrZz7rZL026s39dPfqHkpe2UDTTo+nPORJsw7Ke3mVWQfjYzRtZRnqp0w+86SePJTyk5pmvUxXXmmWJc89Lw+tcdOwJZ96Y/qpm3ytUy9e25PxNe84qM/a8Tg/FvnM3tePR3v20w76AgDO2X/fBwAA51hA7gQAhKNLno32nNRvqm7HvzV3H98PlovNCv7BM4D/5z73u/+fp95HcNJPU2XdZmlDp9JRX/aXH/UjrPYCiAFqbXU9wd2MEwAgzm4CV/Z1Akw5AjjvLzhOQM+2fLb3Ux/A+hS4BySjQ32xgW4N6QxoDoYhTwXbOgdoB7bYPbBvxwBA2H61TbUeNQ7IR7btDoBTDoB4VwBp2Pzqt/zWza995wNHz3/LA0c/9/5fO2JXADcvAefA+9//vqPX/uS72suyWJF0VwDjI1f7p3jaXEG/gL/S6gw4fBbw1nkW8YxJ4DzF806AqfSptAT+8q7490B3D/ijJ/g3HfD/f/z+h9s9keWzgyZX/Hs8QB7nWq/8KqtOAIB9Bfu5Qp1pOgH4FN6tM3LOvyVM1tjSn/06xuMsQP/8a3VlSqgTyIwfT8xOJlYbE7X1RC8mbr3J71JZTqrhx/JlWs1DnIloDWNy9DKt2hurQ5XbF8grX3WXxrMu5CG+NG/qm2+MVpvUv8p2iVveWN6pcmpe+7RHtW+a8aTYWxpqvozLayvj8LXepttW67imeW/dfdqpZv5t6db1WJVtOdRPHlrt2X7lxjOPfOoo61HKtFxpTy/tWW6Pem+blvG0a3rS1E158tVGxuVtB7TyyiZpjo9Nnh8Qn8/+mOSzW9mutDmoaAd9oROAl++5E8At+Mz9WIlHR0cA/UTejbad1PfU7wi65KGsBP7YxtHgyj8v/euC/7uH/j22v2t7b4N8Qyfx+QS+Md1etDeAt43dAOkEwDkQcfTYRZC7ANz272o/cWXPeu1zG1AHkAv+AccAfwKrz4DHBi6HcgTMCebl2+r6UD66yKoDoBc3LzSdAgJtgTjp7hg4D6fA+tOEQxtb3Ttg35X+Meq5/DnQX9PNZ1tJf+I//d0jdgm8/kO/vXYKwPMFAurqroDmBOD6p5OowzMu6kp/Bf41no6A2/hN27fcA+c7vuvbPpjgOYF+8qkDP5VWdY0L/qFz4Lu3KyCBOVv/P/rhB5oDAB6bljPmAACM6wzAAcAuhLTZ43E2eMzAdwT88Ot+pLsTIIG/YBWZTgCe47fcADrHBjG5sE/9SoD9KuV6MpE5x2qch+mxSZ/ysTJ76ccTszpRyzgTrQhOdMeoE0FohqqfaZXfRpe8TCJ3DVl2Ldc4OvBS5VD7RhlxeWgvT6anTtZlSb5qp8anbFjvSrFR26BOtT8X1475k07lTb3GMx7v3hyHxKdskGb7a7/WeOqmzcxfdUxLffleXU/JRtp0Sm9BOy03ac/OlCzzwtu+HkWmXN2MV1u9OHXpyatMu5aZlHve+BhvfuzKm2cJTbtj+bPOY32MzljaWu6YyOfvaZ7nu8/tsWf9rvKuEwBAjhOAzwPyYkCcAn4iECdAOgKyv7Jf7H/6EB2CwJ/8/A5jMx0Ooyv/w9hZ9cGu7bzN8g0dxiqS57ddtd4AewP4AxgL0KF8OvC9b/zUFtIRwG4AVvv5hB3hS1/2pps4DwDmUsC+4J+V/+YMGLaRu41evQTulW/OipXdHujvyaoN4ukQyNV3gTI65+kUoO3Yp5wsX+eEFMCuU6CC+23i+YI/+NbO1bXh+9lcM68z12ntBBjO9zcnUAf451jheEgF+XPxZz/mzxwR/qv//GE38fLdZnfgLdlcHtoC5/OkCf7HHAA90J+r/gD0uvrPDgAcAdUBAMAHHAIcn/fq/2EN/NMBAJDvgX5lloUDoDoBOA4AsCcIRqWC1oxTH766cQ3B6qWOe5yN3/zf/P319bNPpdfIqdID71N9m/rJk8c4tPLKjikTrQhO6JDJS5dMps9LxwnlLjTrZFt6FL2efE62bT7rM2d3afpc+V5L6FhYWlbV03bKe7JMh1dnrD5VXvMbty+nKLr2kdT8lfbSlUnJs239a3t68bRb61Xjvfyre33UkWKeaot2ZSA949lu+UqrzV3itUzieb+bjsw0Zb3yTDsrtT96ZVQZfYzMvh6lJwB/83m8+bzmWc5fPsOPJWf738aIfSg4xwngiwFZlfdIgLsBmJvoDNAhAMDvBfXIQ8hVf2yz7T93G6DvdW19dtLms7X0dstNZzcnAC9yW62wJ7Db4Afg/fQXfftNHQBSHAEcDQB855vyBd5t9X7YBQDgBVwCfhvIxCEwOAA+5Yk/e+wEAGSuwL15k2KHdOrZA/pTsrRT+eoM0AkgMF/Hh/bZhvZegSUvE1yiM7xXwF0Czf5QjmUK/l3J3wb0p64OAGTYrqDe65FOAI8D4KzZGAcjzoClTgAAfy8wFm+3++9WbO/cuwBytT95HAY1PuVESCfA3A4AQHh1CAjI2frv6r8OAFbzrQs7AADcgETAP8dpCIJ/6BOe8uojQLxgf4xSJuCf8gjbHAdIRwA8R3ZwAvDDfCuOo/NoE33F9cIJQMChQ5z+vIV2Ii2ZAFadjMP3wzBhdZJaJ7PE6V8p/HkGJ4BSyoI/a7DOvfalDL2My9M/8pVqeyyvcmnNf95x6+41TkrZNZ71MW/KlvDaHNM1fVs6Zi+vwRyPjd61qLIaHyv7VBu4z+4+uad24SmLfEnlJ+15jw951/c7fCf02jPWd6nb65eeLPOM8eYbKxf51L1f89Vy5uynbW0hk0+Kbe3VcuhfZfLQyeA48Zqdpvxc+syG98/nuvFd6LHdoY60iTYDwJmv4wQA+HskALDOVn3khHQGoC/QlyIzCPrJh420qXNBG9SBPmx91m/3Lu28PfPQ8YA8z30DQhPwreMD+OYLAgJ/KS8Y/Mp7X/7xBO+Cfqir2QJPgXoDoYNNysIR8En3PHDKEYAugB07UOLuAjCuvW1odQIYF3iP0WwLeXQI7O1dAjoMwilAe9s1WL2lHxAvoN/GMWD/57VNHscMY8D+xSnAywH5lGBzAqyuVebp8YyFuvrvSr/A35cB8hlDAnHSeDDcnnfhrdNqHs6C521B/RTgzzRX6HUCJOCuQD/jAHB0pRX84wDg3Rhsz8824AB47it+cg3+cQDkTgAcAC+4/wdHHQCWByWkwyGdANhgF0CCfVenk5KuE+DwZYCt7p0bnPHXASD4vyYr/2OTOeXS2iHKpb100sZDmaA6gU2aE+Aez3NhLDixlKo3ZafqmqdSVpyQSWu68V5ZyLKN8lVunAmpOpVW+5lu/pRN8W3iu7om6lm2VPm2NG3P8dvaRr/Wz3jSyhNvgTEqP0F75WRd67XIeNXLOPy216rmX1L/bXUoY1GeqXvcNPu19HVth/2QfZd81SduunzqaC9lY3raqdR7udKql2VkufJVn3jarHHSenmynCk+rx16Gd/gvUZ9ynPdZ7y0Put3jR//Ngxjg/rRXp6nzNcF7oB2HAAcC2DFnqMBAHe28OsQGKPooEseV/zTmUAZlOUzfN1HJ/2wa7sO+eiBfCeAq8Nr4O+K74gDgGMBrGCzKk5wNRtQ30DlasUesAjI11FQAbvlokdegk4CdAHcxHfZAVDL0p7AHwpAlo45AKoch0AD1gM41xmw190B4RDArjsodAhQ9hKHQOs7r+MEbddr2A0CbX09OAQA6DgB2CmS16gH/pF96rf95hG7ASroB+AD9Hn7P/buvPPOdSBO2uqlgPt+eB1u8gvuAVZTE7DP8Qm20a3xXn6dAEtW/9NBoAMAIO6L/wD+GdDJMt0B4Oo/9Dk/+t7mFHAHAAC9lpPOh6ly55wAOgSklJVOgD/9p/70Sy74El/b4ngZoA4A+GvodPT5KK3XQrl0Kh0d9eRP6DDh25iAriaAdTLbm/z2Jsk5iT4P3glijyIzjJU91g7bS7r8Wegudup1ME495JNuUz/yjdlJm5XfpoyqW20tjjNe7w6HQMaVF1rLznhec+W7XJ8ledb1zvpl/eWh8ql7Fl572p6inXLsG2n2mzxpla+yGldfmukp68lNh47d08hTDzsZMm2Mn7LdS0s7WVaPv2Poa+SVKkO+EfrXjWd8PseJ86fsOHb2/+3eo260kecpv5+szOsIcEcALxr3C2SAeVb0CYB8gnEBP7rqueKPTVf9KYsy1/2y/7advXeuqwU6mvP5gLwGLmO1d+0IGHEAsAMAwCc4xAHwSf/Za9aB1fEmG8D/lAOggnTtASqtk7TqLok3cM/2+k4gbVvwv9gZMLSfrx7sNQw2cQiwYq+T5SGxQ0CnQKvj0N4xsN6T42BhHKydAAMPQN/GCcC1Y0xU0C/w154UZwCOBvQPYOa6PkU26n2jvhAwAfUSgJ/6U/yYAyDBt7wr8IL/XInXAcAOANKzzN4OAHcBAMZxAvQcAOkQwKZOABwP6XygHr4UkPZw7KD3PgCBP5TgbgE+D8gzfOMKHCLdHsA59Xlf9o3/3TXqr7lJnOlQedtuvFLSUwa/GerEc4gz+aohJ7vwvQlxygThlaqT8pTJS1NPnjT5JVRb0myLk1wnnVLl9kPKlW1DM7+8NO2cAgEj12dDb+Sapd3ka965OHnRSRtLefMlhR8NOT6n9DppY3Wq/VzjY/l2kdsu8xo/RbOd8HcPfZLUdORzQd1tqOVZ5qoM6y2lrwzI5KVVr8bVG6M9m2O63r9jtOazLnNl9Ozlc4V04lWvlkfcsrLs5LmWGZdHfir0r+cwTNbPcHnovv+OfyeGetEu+6A6AnhTP0Ces/sCfgB+Bh0C6Aj68+hArvpTVuuHzTbuu223pz0uYjvzzaf5WCFeOQAS/CPj++4A/rr93y3/6AB0cQDc8SV//+jOr/7pdeCsP+mC7SlA3gPp+5RZdtYl+Qrul8QB3Rnou1yxJ04AYAOu206BfTkHsDMEyrOctoNiYrW/B/5T1o6EDEdDOGcMwPicP/85WzsBsFFX+nUCKCcO+GdngEcDrtHk/PZ8YCxoNZ7bOaA/l54gfIxnJ4BAW6BvfIzm1n8Av+Bfyjl97Fo/HAC8LDN3ALgLACC+xAEg+NcJkXWg3HwnAO8gYIV/zgngLgD0uE95ji+4NAeV69kDCdhpgfEeb5o0W4xMufwJ7U04VzInpdI60c2JsBPjpDl5lncCaXyOWgZ62+bt2daetLbJtkpJl5f2ZExWTT8Lxc5G4NpV2Ux8Sfnb2lQf2/C1jEyvOqbNUtt6PF6Px+hQ1mr8nozZ1CN9ItR6Loljr6eX5dQ2zuln3sZnG7K9yoc6rNsN3ws139J42s7yogzb41j3PkEuf5GU+5XyvG971HTrlXVN3vQxm/ncQGfs2WMdtAfNcuC3Cd1r7LWSHl/jYWhcCPinHP7W96Lts18A7ekMYC4/tvVfOToEV/sr8KeM1heWe1yHw/899sCNwZ33q20XwABQAeoASQBho0McAA5wBQxyxvvNz/sT7Z0AAGde/ocu+e94+GOaE4BVZFb+MwBQ12fMVyvxCbzhzwPoz9m0DkuAftVJ0E8aK/GC8KTICehkHvXbSj6A+axOgSF/OmCa42VHRwCggpeNcd4ZsOH2fa4jYyQdBl0encGJINiHuurv2X/P/0O/6JGPbGOIPDw89zi+D6YuoQd4qCdwF1CnTH4qTZ0eHdsB0AP/OAgE4L3Vf4A4DoHqABCIVwcAcVfie+8AqA6JLL/uAtD5QP3YDYADgnIt21V/KfcjvE4AnBSH9wFcwiC/mCKZcPX+Up586iqXkgZvXH4UWI5NWp3oOvFN6qTZiaFx6SMf+cgvlu/RufReHmTmgyY/pq886267cgLvRHesL85DPgoAmPwvDNRLXXlplRufo738yAzkl+/pmj5azsn4PBmbPdlQztqG6Snr8Fmvpfy6jGLPtknRS5vGoZVXtkFtA/TuVdtS1uPVk5q3p7tEhh31VjazTWN83jNLeO+3MV3Sx9JSrp0xmrrJ046My6cdnw1JTa8y4qZJtZnUcsf6sSe/w2sr9fqcpsOl23iuEz/Pv+P7c6iX7bLt9IfOACkAP4NyafYhfYbN1vaTdp5nW25v280B8Nlf0kA+gLkBPADcCvwjAygTB6z+uW96wYPI2pv/B6eB4J+dBO0zcoMzgFXusYBjwBXyBh5X5QjGpRW8I1eWvDKoeWt6jWeezFdBfi8uiK+gP0G+L+tDt+o1x8rKIYDeQ37zwSNf6pdOAfppW6cAuy8yrJ0AXM8tnQFcZ7dA6wTg+i62M5TJ2AD4u8rPVn8DoB9HAw6jFgYnCDsHeC/F7X1H3hqt53OjPeB+VhkOg9e+4ruPWC2vYD+Bd/LqIXv/+993auVfEI5zAMeCTglAOKv8PQcALwckvecAsLxKAfk6AHqOCI8D8GlB7r0E+9UBQL3SCXA4QnNr3DerVgjSs1HKpKTJS1OWPOnqyJ9QJ5iF9ialTmqd8CXNyXGPF5iTJp+08sZ7tpShY9Cucaly8yS1/rbLCajUPqhx5fukbdJbrsHqum1eKyfGVXckTh2r7Z6s6uwSr3ZrvGvT9pyF3h0AFjvEO4H6jIWe/pystk/bc/k20s/Sbtt6Vhvmv/u432xHj3ovQHuBewr5FPW+qzo9e2OytNHjM5/tUJbl1rz5fEgePeJj+im3nDFqfZbQ9VjxGm3SfM7D++fz3vh50OPnUowZ25t9kX1Y+099+qHTzvOo88Fm9gAvYOOt74CwHvgXLAOifSs/4L+9sG+18g8w9BvygL4x8D8mB+y2lfDBoQBATlAuqM96JF/TzSs1fY4C1H3bv1QHQIJ+6sduhgTypCfoVz/lpmOTvLS3OQdWDgAcAQZ1yZ9OAfpv9J0CsQMgnQAcx1gM2ouTQCcA26A520+dt7FFPz32sY898sWArvb79QkAfy8AHnOMHvjr2QP1fQACa5wAye/iFMgjABVo1zjAG5m0B75xAnzon//zpmd9nvvc5+zNAUDZBp0AOh6k1EsnwH0vvW/DCZAOAI8e4ADQEcAOLX5cr+dIOdR6pAecxFWKurLklUlrGvLNsJq8rSdfQ7w3KXWiBs3JHXyd4NU4QByZgHxbWu1lfBtbmU8+25Jt7PUBfdSTp0wdaaZN8ehvBK5TyhZctw39zDvCZ322zdvTx15PPiurbdtn/O7Sr+cYr+2v8VP94DXO9lK/jF8Ub7mr/nFsWGfjleY947NBmvfWEr7ayjjlZjz5ajvTpviaj7jPhTna0+3ZQzZWB9tU+zTj9v8GPT0m6nOe+EX+nfymlPGTbenx63Zttuki6357l6UDgNVmVox9C78gWyqAruB/vfI/7ADwfQJjQH+pPB0C7kSw/H1TAC3lAVZpK+AfAA7VASDo10kBKE+QP8YL5KEJ5rHX4ivwn3ryOgPqDoHmOOBTfXWHwHD9Evgnv3YClJ0Aj7j3PbOAPo9vJPhfkrfpD2XStzgQsNXsjQD/dAawPej2vjOvf+vrUQCB9T5oOgB6q/06AXppY7sAAOCAdOuHAwCQvc0OgCwveR0Q2B9zAOAIIL06AQT/UncGpCOA3QiHowDX/55ZtSAB/FSjpvROJmXHFjJ+zK8ma+tJ2MjkrU5gc6I7N1HeBqDP6VLWmM6jH/3orzKM6SCv9c22ZDt7k9XzlNVrMFyyYwfA5sR40ykQ14+6nbIR6TUt9ZOvenuN2ybrVdt2EXHKrvWwPnM06zenu0162r1ofqaejg1oDXm/yOf9JE8avFS5VLk2LGcsrnzOpnpJLbNH67NhSRw76vVsKss6JG9bp+gd9RqdHiM84X2+yyeFv8g/67KUXmTdDmVlDwC0cAKwcs8Zcl/gl46ABN2Audz230C/2/9xAuywA2DOMZAOAcCzq/u+hDDrl7zpAvlMg8e50FbVB/DcttsPlDhtbEccXvOvmw5xt/gL5sdAP3JBfAX9aUOdShP41/y0XRs4KGhDW5XnvP3wEsYE/ZVfOwFc5S/OgAT3e+EH+1wnrgF9aX/a7/TpnDPgmnynO2+nA196ACfAs579rH8rqN4Xfcc737HVEYAKxnu7ANgBwHsArOMSB8Arf/CVp+qh86FS6pAOABwBrv4nRQ8nAMcRAPscBxD8Q135h9cJAEXvcBSgDMDrG2XyxN8cVSf1ks905JuhTC7rRDQnq/BOaHPi6wR4Cnifd5rgX0p5yVs+dYW3zlDaku2sfXDe8VMTfK/JzLUazWf+BZS27cPO2oZ1tuwaR46sUvUui1rfrFfyvXplnm357IPK98q6CFm2d9WeubGf9418PiOW8OZLSrnGrYPxpFP20ZtKN81nQD4TzsJjV5uWIc26V942J7Xtd+T4Gh8LPuuhh79DD8z3AA4At+9zFABADxgGQAIa8xw5YDPB/8bW/5UTgLwA9jlQf5b0dAjkDgGPKCTQ1wmQMh0CazoAVcCoTgCo4JX8AG+DALwCfYH8GGhPfXWTCvwzPyC5OTxWLxAE9BOowz2vuf/oWa997tEP//yTHvzln3/I0aue/wWfmHMCcE33Au51IlQaoN9+l9r/xqVzDoHDcYD5e/iqa/BD9+WPefIP7MsRkKv/FWQvjfccAMh8ESBOgCVHADivv7RM9HAApBMggb889XAXgO8D8KWArv4L/okb0OHlnUw2ruSYGCYxvAH4xS958esZDxn+4te94tUE0uR7lDyf+Ze+/ht5qVCbFF3Jhu5cKYF7NZDy5NET0Pd4ZVJ1T60kO9FMmhNUxhRxJ7LQnCQLsMcoYNw0gbkUefLqKc948uaZoqkPn3WWt022N/tgG5786stLlVe6MbFnks/1hBq8vsbPiVKvdZm1jFqnXrr1nKLkS1tTuvNpg6k29is9GeOkzNtJ/d342h9L4hdRr5MytuuHUv86ZjPuPQP1PlpCK0BOO8lbVsqSX1LWmI73/xTNZ0byvTyU05OnLOuS7ZC3vZXeUa5JZ1x7jaWM5cPfoQfGe4BJlODft7S7pR8wCdDWEQAFtOMA6AF/dwL4FYCzAPxt8lJHwDvOiQaWVy8DTIAp+IQC+gHZBHjANEDbgEOhrU6vjgOkHvbVg6YzQOCOHD3SkCXI7/Fu8acu5DMvcfUB/Q9790c/9rS3v2EN+P/Fr9x1VMP9z/+0m82JMThuuF5jYcwJsHhbfwX+xOm3wVkyF9o1wOGyuk7EyeMOAdpfdwbw/e5hFB8eaOO38nVJucEPIDs76vsBXHVfQusXAOrqfgLysbTeMQB3APCCQerxghe+cPYdANUBkOUlb52WOABwBFA/nQDsMqgvBdQRkDsAkMVRgKs0Jm4A2r/1RW/8jVe98yNHhle/+yNHhPvf9uEjvziCA+PLv+Irjh7xiEe0r4NADbw41OCXSr7mKc97N5Onq9TYPdTFZ52ARJPKiWea8qSmn6YxmawTzYw7KZXm5DUntRVkEweUSwXoGU8+dZVLzbsLxUaGrHPytMs2SrMf5njyoCNVv8arzqlJfVyXdRrXGbm06FgWOvDQjeA4qfJt4yPlt7Is42Jojv3TY/t0HdSXLsmzmw59aj9ZD2XGd6fWX0odk691Nk06p3+Sf2JsON6k3i/SfEZsw5u/0rFy0NvGPvc7+knzGZA8zwziUvmMp/4Ub5mpk/Wu7c24bZe2ey2vzfhYagNj9c/rnrKL5q9CHS66zVe7vD//n/wn3yVoZ+Xf1X8dAjoCeGEbgJzdAIBtHADmS8qEjDdi88I49LYB8fvSpVxC2xa/AqUCTYEpgBNwLthOwA1gb2B75SAgngFAblznQdqBJ13g3qOu9GtLO9Vh4Er/HOivTgA+1ejnAMccAMg94jHmDFgsH4C/IN4+Xkp1BuQujoe+4Y+PX464ukY6A/g6AA/Oq31XHWq3TQ/ggNzWETC1+p+AO3nBd8oA4q64S90BgINBBwCAeuodAL2vEVhe0lq27wHo7USwPuTXCcCztR4FEPynM0AnAEcvtrkW56Vbgb+g/2Vv+VDbucDLCwH4fCmET4QaiM8FdMmPE+C86n8Jdp0sSakCvHH5jKfOlHxzdXmYTDq5TJqTUPmctOZkNgG2fAL6XYB7zYPdKlsat05JrX+2yXZWmv0yxpOHNPPKq2+68R49NbnPiX6HrzZG8zNuOvl7Mmz25E12MgZz/J0nX8d0Lcv0SlOvphH3Dz3/5DPvVeKpZ9ZxLL6fOk+MlzruHPPSvKfkud96PDLymaaNSimzyjKf+XvUe32K8mwgXVp1leczJPmq34trI9NqfXttrP29cX/O35OO74umdayOjdeUX3Qdb9/yOCcqeE/wr6xLB+CPM6Cm4TBg0vk//uqvPvjRf/nRm6yi/dz7f+3otT/5rqO/8ZJfXL/8bV8gf6mddAasV+UHsNqcAwO4BHgL5relFdibv8qNC/rRA+gbqIP1QLc5Hxas9FfQX+O8ed/3OUw5AfJ4x2LA7+r/GYB/dRDgANAhQVr2i32Gc4UXCTZgww/UyQ/i7Xsj3yItZ0fA999370eWrP4vBdwJvns8DoDf+p3f3nACEAeQ836BpQ6AuhuhV1aV5RGAsfcA4ATgOAJ10QkguPc9AB4DqBSnxWV/TpOJTq74C/xZ6WeVH9C/DdivzoDP+fOf0xwE2Pnu+x84akcCbpH7YdUMJ/NE64RqKm6+Pl1N7uvE0nhvEpoT1ZzA5iRYfikwR+/xj3/8122jv4uu9epNwGmLbbPdgg37Y1uqHah55Xtp6kg3Jvira9WTqZ+0p7dEhg30pKN55gFHf8xlvqGc1Xie1818y/m8X+D5oyz/5njTz6t+S+xSV/Xks/5ZR9PVPxvl+owExxrp8tAc1/DeU0nzXks5fM1vPMvYpZx8Vll+lRmvz4d8bsijK6++VDuVql/lxmtf9Poj+2Hj2pyMkXrNHROOmfOgvTGY5WZ61m9M5zzqeLBZeyDBP9v+68q/OwAqrcCfnQBMNP/2j73t6O//w19uAeCPI4CJtAGHwC/+xodvosNK2pOf/Q/ap9+WAvl96eEQYHs8b5oXsO9KBfZTVNCPTu44gK+gX+Dvef4K6LeNt6MAMy8F1DGwdgII7OfoANbz/QgVzG8Tx46Oh7RZHQB5nUjDoYMzAJBzVVY66312iG/XA/zIcb576vOAY6v/uboO2K7xMVlv9R0Z+jgAqMvUDgAA+bYvI8T20mMAOAHQ1QGA84P6UG51AiBjR4BOAvTY5bXdVdiPNvfkS3781ze2+j/nR9/bVutd6a+Aftc4TgR2RuBsaJOj/TThMq04caIO8klzMiWvrvHTdJi05+QxJ5VMuHsTbCfiOUl14gp1cpsUkE68gnXBfqVV76xx7Wsn65Z1zzb1Jt3ZJ9k32W/Jq9/TtR+TZt7K53Wq/Jgu8qq7TVy73TyMw7u3AO7b6I6DmBzDjm8pafKV1rRjzZN7KfXH+Goj63KefNZnrA62R2p9al7lyyjXLK+b8aCOMceKNMc1fL23jHP/yVdabUzFyVvL0bYUnbzfl/I8L9DN50ble+k9+2nLPFWv9oPxbL/9LG3Xyesyfv/U8eB42Zb2xmG1MaazbOwdW9NGtX2I76sHWGkTyC9e+efN/hFwDLCCA/Bnlb8XAPs4A3QI4ARgdwCOgCf+9R9vQBxADvhjRT5BPiA94/vkea8B7yjwfQEJxhNk9vgpsN9L64F+9QD8BHTc4r8tyK/6vAiQ8N43fuoRxwCWvAtAJwDHO1yBF5D3aIL0bYB+T5dV/1bGQHvpOkl61yJl7Rq+4T3v+/Tn3v9qthvzkNzX/XKwc/E9wA/gk77+SW/t7Qaoq+09oA/AztDTAVSjUx0AOC1ZdSd9zgEgAM+ypvisBzxlLDkGQJ2wqxPAlwIC9BP0uwsgnQAAYyYSF3kVuf/Y3s85f1b9odRjDvi7GwDacwaMydHlvQDsNsOBdJFtPaeynAj1aMrglwcnjAN1Ipk0J5zyTkaT5gS2ToyJC7yTCsqlpMlDa8i8yZtHWY0rl9b6Wfdsj7xtHqP2FenyU1S9MXumj9nYmOSvrh26yDOPcWiPV7emqa9cPcvI9DW/ZLzdveloannJh3xJ/rPp5C3pvYEs75vUkTfdeFLTksIb0JXvUdOl6MhXOpWmbi0j5WN8zXM6ntcHfibkeIHPce49tZRm3h6/jX3u8SzXe34JFbCj67MjeWVJMz35tIV8LC3rmrz9UPvZ+Knr0x+DjgfoWf4cl9o4PX765R/r5Vga18O2duUt70D30QN8J1owrwNAygRLXh0poJ/AOX8mmoB+HQCA/Z4TwHTT2PoJ6Pd8elt5Xq0mt5XgFSDUIdAA7OAM2KdDYP0+g5Vdbbdz5vHyvinwKYivFFBKPoE/bSKunqB/ycv8Krgfiwv43/aKu24S3vy8P9HAPw4AHCcC/KV0bDcAbdn1nH8F9+1as8tguN5TNum7qetAfzenxWCrOgRwBOzjfjnYuLwe4Osk+X6AsdX/CroTaNe0jAPAcUx63l6KU4AX8FHe1A4AnoOEtJllJ5868ukAmDoGUI8CYJdy3QmQjgDAv+8FIB3gfdFf0QCEC/6f+4qfPOKFfj3wroyt/Ojcc8+Tj/7W9z6hhXT+cA2QP/Wp39z0es4BZLSV988wcbq8UXvmknOiVSdDxucpE66TydSx/moS5gRS6kRTyiQUPiejyTuZrRPanBQLwJNWkC94r3LymFbzZ1pPJ/Xls15Z92xT8vZDj9pnPYo+8qQ9G2OyajMn+KQRrzoZVz9lY/xSXfU2aB1XNX73CHisehknT8aP+UG0BgTzY35T17xQ/sjvX49XZjnopsz4VHrqyFfas1l1evExmfK0ax2X07FrNiGvY6s3rrmvkOf9Jc+9KN/L25Olvrx2kuZ9vivvc4P88mN0iU7Nm/WyLdLa9trXxO8YuzbT9wHjZclfjif061jqyTZ1Sv3OUGfrsqTeB52pHvgP/v1//1cB9QJ9JmFTIR0AvGwJUG9gIst2f4Mr/joE1IMyEQT8JxBl1dnPDArk8mVwrhDvyyHg6n9vR0F1NlDXqV0Cgnoo4BPQbxC0kgboF8g+7vU/PfkG/zGQn/IK+AX9AP9nP+bPrFfZ4Gkn/Zt9voQnjyvzOmb24QAA7LurAHvVMVDj9hv9+xc++Mc3E+TLpw48NprtwZnDbpepe+GQdi164Abb2Hk/wNTq/xjYBmQn4JaX1h0Agu0lDgCBtra2pds4AKgX9n0fAH3h6r+gH4qTlWctDgLSdQK0H98LutxsxWcHALvEAOYC/QTunNsH8AP03/aP723hPb/2yqO5gC4OAVb80x48sm999tuOboEXAjqR4or1eGWb1AnXSZ6TdNMGWieTOdl0Alopk1VlTlzrhJa4oLvSCvITvPfSMl1byio1vdJe/ay7lDYlbxul2TeVz36sab04NpFLezppU/6OzjUjbUxuvn1RyjkVcoz10pfKsKOuNonLb0e9X3q0J+P+8E9eitz7R36KZhp8/dNuzya6mV7zZrpp2llO7ec90hxjvfGcMu+pMeq90bs/Mk/qpTx57mni3tuVTqXx3EC/9/yYk22bL+uV9c9+g89+rvwdeT1PxmyOixwz8tvQOjbT9jGfdejw1Nl2UF/i0I0wXfdt6nvQHemBGzoApkB/TcNZwOo/k0oml7yNmgkyq2djAacADgGdAZz7XwJG0SGwEu2WdAAdAYcAoBxw3sDtFrsDGsAftv/3wH+VpTPAHQI6BDh73uqyOscP6Gxb0MtKP0CUl9Y96nW/dOYt/gn6AfoZWOn/qi//lDYZ9jOOXD8dAEsAf0+nXoPmjGGHxhBo/9TKfQXyxHXmQHvpYzL6V7A/RRP842Rg7LCr4/B+gJEnwTUT8+PI9+GXguwxh4D5Ad88w1z1T4pTgGMAuQOA8+v1SwAAbj7Pp80pmvWRpw6Us+QYgPWjDI8C8D6ABP/U71Xv/p9bPdMJcNG7ANh9w0tIK/AnDvBnNR8gPwf2p9LJj63qBMDpwFEAdo9csyFudZ1s1bjyzckXkygnTjmh6slW6TmBzIlmTkCdIPdkOWkdmxBXMC7IRy4/RdXr2UmZNsb0kWcds+7Jj7UXefYRfE9WdTJe+7DGUxc+r89F8ZZrXWq53Ym6Yy/HXeUZh1W2JO743Y5yz+R9Qpy/nmxM3tOtMuLKtGM803oy9PlbmqZu6jcDYUMdqXU46XvKW9LvPZ2JvHWcOH68R3o0xz/3YMbHeOyOpaW82st7fBueZwb6+ezo8fX50tNRpq4062Mbsp32ZVL6m3j2+8Z1PR5XJ9f/eKQYP44t+1/HW8a11x1TWTf52gbl0I36M/4220BtLRv+8LdzDwydC5B3BwATMkDjFCVNB4BbTgH1rvqPOQCqPF8C+NfvfXd7gdsSh4DgFIfAJ93zwHplWkDZAPkA9CqIr3FW/wXzNW0qXp0B2kHOywQBmazyExqIXb2cjknuO97ysJu5er8NPwb6eblfD/TX64gDgOMO1NM+3Ka/zSMl76n+X+AMWK/6D7rbOg0A9dUBUHcCCPxbOUMZAP8MXJ/LehHazvfpIeNoDzztG570rDGgLbCu6WNywLfAOinPrqUOAM7jZ3lZVvKpI0967gLo7UbIet38//1+e2cB+XUC4JR15R/w/9J3faAFnAHuBuC5DTBuP7ajPbvfhM//rIe/NcG5K/685NQV/54T4N43f9/RPS/6ngef8O3P+D34KScAOwGyDHjKiV0A13XicDLBOr4sGd/kmTD1wuYkamOi5uQrJ2VOQHs0J6qVd3ILdWILrUGgvoSSVz35pMmjR7yGrE/WUb62g7htTx5ZjauX/SdPGrw621BtQL1GZ6XaqjTtZrnymd4dX4w5xlhv7O1DVsfv8jh3jPd9paZ5DxmXpr46Y7KpdO1B+UtdeeXSLEcZlD/TktfOON3XddAO9ZAPmmMF3jFUab0X8r5KvuoZx578HMWeNuXnKM+G1PFZMUZ55syl+VxCr6dvebU9trX2Ye1r4xvX5fR4a4No9S/HUsqn+P4YmxgDvXFAG6faM9EG6rZLvafadPul0fk6AAD2NQgiq1wHACtJrCx5ph9HQL7kr4L+qbg7BJiojjkEpgArablLoDkEBgDI6m/uEgDc89I/gPsU0F+alg6BBrB5qeAK9DPJftXzv+AT2wD91B0D/Z7rZ6Wfa+NKvzRlTIIB/+0lgEPd+FIDgXr77gVB/a7Uvq/HBLgGgnwBOTrsGBhb4R+TC/6rAyB3AQj+246M1ap/gn94ysdRczgOcOs87/jcW74PYA5oC7ilgG74MQdA7gBgizoAuu4AIA7wrg4Ay1hKlzgAAP7pCKDe9SgAYD8dADgCkBE4CnDRuwBYgRecc8Y/t/rrAEhwjwzg/+e+6QUtcNyM983MOQFwtFoOlGchedkFcE3fA1InOsb7k7CRSfnGZComasidNDoZq5NP40xO4Z2kVlonvznBdeKbVFC/hJJvDNxn/im93qSbNtR6G6/tsx92pdiz/7ax4XXxOm1Lye8EXKosbVmOaTWeuvBTY2pvaY7n0yBmfPyf1uXHrt43VWa86s2VM5ZPeaVpr5eWMvj8s27KjGsTeZUdpw33+bbXZJtrnLp1nOQ4YtwTHxv/3nOZ7n2Tsim+p6/dXWg+D+ST8szJ+BSfz7+eXtYv22ifZV8mX/t8fa0374U6PhxHc7SOKe10x1bWJetoG2xXvU6pmzYWtGWu/of0Xg9wAVz9B9QL9HvAv8qYjAFwWXHKs/3wPYcAAH/KAWCajgDfH4AzYBdgWkEpwA8AiDMABwBhKcif09MJoAOAvuEsPm/fB8QnqF/CC/xza7+g/7/6zx/WztEK9sco1xIHAcCfXQJMgm0H9cTx05w/xRkw5WRZch3I34D2AP4B4h4P0CEzBvDH5IJ60qfAv/kT/HvNu06A4fofjgP0ngrXU8aPxw+95lVv7wHtMYeAwJ888HyVJIG1PM8mQDZb7MccAABrHADo1DrU8jOevPXY5giAzgCOL7gLgGdwzwHgLgDScADw/KbfLuqKc9wMUM4L/gT9YxSgzzPrK+99+cepK4Hn6tNf9O0301HQ43EC8PzTEYDDoR2NGF4IyMTiotq7x3KOJ1qbk7m+bMuJfk604HuTNCdqOTlNvjeRTVlOegXoCdrnePPM0XQQJE8+6lNp1rHHZxuTZwJL3InsUpo2Mr+8tNrLiTF8vWa9uHpSr221ZXxJepaznpSPjLeluuhpK3llG3R6/HO7VaDSv0em7ZxXHh8H1jHjyqS2xTi08hlPfXVPaLlGXpuNvg2d2esQutWGtpM6xiqt49z43H2iXtLevaOs2jOe9zwy4tLke/qZN3mfMT2ZadLUkbcsaLYv+ezH7Ofk19fl9Fh33DlmMr6EPxlX2I6xkOXDW8+suzztY1HAdkpNNy8UW+tyNttjfb0XjB/okh7gAvhSPyZMFeQbrxRdJmc6AAD81QlQ4z2ngKB/jDKpxcGQoDT5JYBUHfJ5bCABIQ4BtoX7HgFB8i5UB8DX/tXHrz+/hxNAR8CUM0DQny/xA/QD3lnBZzI7BvZTjh5OAoA/gRdrsYrmdv0GkFdb41kJp87sCFg7A1ZHI7Lf5LeluSMDgH73D/1RC4L1KVqBfwX/bv1Xzx0GeW2neJwDtP2wE2DJk+La6NyYOhIgwK4AnfjY6j9OAHcA8KK9OQdAfTFhr6wpGY4I6qITQCdEpQL/lGMXJwC7AXhu+g6APAaAjN0KpPP8/tN/6k+/5KKuLmXxfOJ9AGPAXzl147mFA8DAbw5v/u+B/irjuZdOAJwOOJOv2f2eExv5pPCbgQlZmZitJ08xWVO2dNLGBG0sOHmtNCe68BkS9H/DN3zDNxtPXhnUvMkrk06lqSOdqmum2WYmpvKVOmmV1vS5eOaTT5qTYSfE9brlhLvqbxvXtmVJlVfKWEImNd041GBapabP0jreT8d5nE3fI6fzbN5D55tu/bJMZdKsPzL+lCU/Z+M4vfQ/fez1yv7uyUzPNK9d2jE9qXq98ZfjG557ZEzWS1M305I3HYq8hrzHz8rzTMGGNHll+dxRVsutdRxrD23KPrWf83q069Yfxzl+4Jf8OfZOxtvdJ/e05VKPrFdeg3odwJ7s3IQabH/mq8+eTruW1P+g0+sBVkCX7gBgMpWByRiBieQSB0B1CBAnXx4byF0CyHm54BOe8upTXwsAiC51BKDX01UOMAYoulpcjwsscQSwAwA9HQCPfdZj/khAL9URkM4A0yroB/gD+se2+Cfg1znjan+C/gTgbsUHdCevQ8CdEToDcAj4foNtgX9Pn/5uTojVzgDBvwC+UtKRGXKrv/zaBi+EHNnyP+UEaNd9cAIcdgL0ng7XVzbnBAAou/LuLoCp8/a/9Tu/3UD5EgcA4DsBvuVkmaZnmulLHQAJ/OVpAw4A7HIUgaMKgP88CoADwJ0Arqq3SdsFXG5+6HEAzO0AeNkv/J3mtBT4S3EI8Jsj2NdZAFUmRYYjVicAFKfCNf0iwOkJWG9yVyZlbbI0I3PyKO1N4JyYJa2T17G4k10nwNIE9/KCf6nyzCMvFfRLlfdoTsyzvuiaJp/p2e4pvk5yp3Sn0nICLJ/XxWsldZKcOrvy2NSe9i+aTo7b3rg/AccnAGVc76rr8CS2jnN8pptnk5b7P69l9jNy4pmesl5aT7enV8eiY7pH874gnXhPr8rG9NIePPe1NO/xXXifMZnX50ePqm9a5pO3blnv2lbi2adj1yHGkWOC8eIfMv+SV9aj2lmv/GfZWaess20R6EtxAFQnAGnqQ22r5TC+Wji5R6y7tFfvg6zXA6yG6AAQ3Asox6h6+3AAVKcADgG3/uNYYAKLA0BAOQbkTe9RQB5n8gmAdFb6e3bIi3wNmlkhHsIShwAOAOzqAGALKuBegF8pToAe6Ae8L13t5zoA+j3fT16uCfUAaH/qt/1m96w94B/QXx0Bgmm26tNm2uIxgfXugD29QJC+pp/pX+si0E9KnQTwyAX+8NaX/OpUmk4BeWnqsrWYB0/vHjnIrmcPVCdABduCcGjv7f95HGCbHQDVAZDlLOWX7AAQ9NedADgQdAJw1t+jADoBdABAeX8Lz4yLfCkmxwCmHAAAeLb/19V/nAD+5gj40wGgLB0AyHInQDsKMBwDYKJyjUa1E5seRXYSmBwRd5K0gDqxkvYmcTkhg3eyupQ64c0JsOB+jFYnQAX4GZeXZjk9nnr36pS6vbZlP5CecXnlvfxVZp4ezQm0k+C8Nr3rlenw2pA3XXtS5ZVmGfJjlDE3lpZyyiAuzbTktQfdGNM53i+bt27nU4+h2etV/5N7fElZWS/4ErKf98lTTs9eHVfEHZtLaN4fS/TVyXzy9R4knve9z4U5PfOpZz5tmd6Lmycp9SNuPSu1TVL7tPb3xrXuj5U6rohP/eXvzsk4XI0pyrcuUutoGwT8UEE/lHfyZLznDNAWFPuUt27jZvum2nBI6/VAOgAE/AJ8qLJKSWM1hQnZWXYAVAeAcSamrE7hAPjKJ9y3dgD0AH5PBpAH4AEOAbx8fg9Qy1Z/HAGeR0cHIIp+zymwdgYMoDjzYAtngmf/faGgDgBe/FdBv3F3AqQDQNBvn9PfNZDG6pkr/R4PYEssk2XqOgb6BctjNHcEpI7OAN6XkDsD2ksEh6MCvkSw13e96zImy37WAfDQ4SsK8NSBdCgOgAT/yBLI78LjEOB6AkwOToDeU+L6ytjZMQXIXf2f2v4P0F6yA8DP7I2B/HRAJI9+xnfdAaAjgONU2MMJwPsIluwC+I+++L/+jeEq+0N/rhec3xwcAAJ16G/87o9vhK995wNHX/qyN9183Ot/ek2REYdyPTKPtqpDwLg7AXiG8pv15Y958g+cayNnjDOJ4VnD+GTSM6NustfnZBKWEyAmZMRXE7MltE4ejY9N5Jyk5sR1indSjI4TYSlg3SDYr9R0gb1UG1L1jG9Da92MT7XLNCe4SU3bhmb+5Ovk1+tSr5NyJ8nmQ64sdUxParrUMnoUnZ5cWS89ZfJS8/XoehznWN+G937IPMiMJ68MqhxqqOkph8/07fkhe3sG9+/vpWnWqVD69o5B1uvj85RxjXshx548Yz/5vBfkSU899StVXzp2P849K8iHjjT1tWl6xtVT1qNZN/kxmu2r/VmvH9e5hdNjxjEG3eZv87dH+wOlbOqT9YOnHWPAX/CPA8BQHQE6A+wP7VMWZbb2UY/NNtIm6wp/+JvqAVZ+3AHgSwAF+0yWpkI6AATu+6JMppm4Ej7/GT/2CQFmpRVQkg6gE0QC/AH9ALzGDw4BnAI6BlwNVwZFT8cAq+mUAQWEeo4e4GlAl3QcAgBjgg4AQL+hbv3HAUAA0Fewb1zAj4OAdwEA+gnYB/jTLkD/p3/Pv16viCeA3wfPuX3s0Detb4f+7DkDcIZ4PbxOxreh5KVP6V+uj6v+UNtjXSrg763uN1vDmEjay8c4OTgBpp4W1zONH5IxUI4cwO1qOjRX/lPOLoGpIwA4Qgm1rAT3NW0sfpYdANQ5dwFYL3YATO0CuLBjMMOP9uO+6b/8Fwn82WGRoP6J//R3jx727o9+7FGv+6Xm3MQZ8Om/8y8/9nkf/cQR4V/9wb/7BNdJJ4DXiTh2Bf5Jee+ATlR2RjChuIwRzaToW1/0xt/g04S8mJDf0TaZGa9MBQRoVtlxnAnRDqFOIJ1gOulyEgZlIivtTWp7MifITooF8gL3pDoBkCVvHmzIS1NmGZVSrypbEu+1p7a/xnt5xmSZFz6D/S/1uvSoOmeh1W4dFzWOPjJpTe/F1ZX2dBjDyDfG8tiYn5NzP6AD7YWptKo/p5vp8FMB21PpS9OqnVrniGdf2//STJvj7xhszumQrm1oDY5Txnvyjv8qI55pmU9ddaTqQ+v9t+Te7+lgB/kUzbLUTZl81m+Kt321DzPu9eDarMPpMTQMufbn2CQCP/ZnmvrHdFWGZVKP2ueC/wT2gv01feJ/+5w1P+IM0A79QxmUZbmddo614yDv9QAvZdIBUMG+joBKnUSdtwOAHQDf+Z1/ozkAlgBIQF0F/qz2AxZ7QB+5oQHc1XlzV56xhTMAGwBtQgJb+DzTjq1WhwFI9hwA7gCQugOgOgAE/WzpB+zrKIDnaAEOkeZ8uO/fboD+z/2JP7gpQD4LfcrP/N6DhJ4NX+JHW+kXXiKYzoDeewOyz5Zcx6qD46Xt2hhAfLtOq36uIL4XH3MIjOnSHpwAPGB698tBdj17ACBRwfaS1X9AaXMKDAAVUJ4OgNxKDw+ge+UPvvKUA6CWmw6B5NEj7g4Aypt6L4GgN6m7AKg3ttgFQJ1xpFJHnQBZd78IcNG7AADnAvhKdQAA/HmmQFn51wnALgf6xnxHqz/aryzBv7xOAHYgXMa7AJjA/JWn3fdhftuoA896fk8XOF/6E7HTE7xxoJMTw8I7oYLmpLJO6pxIO1l1IjtFnQD3JtMA+KWhl19ZOgKmZKaNUdphWvLIptrYSxuzk/JePmT2r5NeroMhr4+8aUtpz655tSmtYyPjyaOf8Sm+Zzv1mdgTh65Db6yPyTLfGE/esbSzysfqdR5y6tppS/Zn5e3/MVr1jdNf8mPUcSBFr5bjWHMcOt6Ry0+lqZdUm8rSDnzea97P3ovQ3jMk0yuPPWXaJi5vesaTr/Ubi2e74OlLae1XrwnXaT0mTsbcIJoE+6T3/jZ/e7A9BMuyDtRJsC4dBf8A/14IJwCOgcyPTfrItls+dRkqvemg6LXiIDvdA+kAEOgzIUk+HQMpvwgHgDsAAIUCSalAEYAIWGeF2BX/pcAfINucAyvwj52HvOXXN4K23X6OPgAcEEnZ1IcA7xZ87LJd9Vmvfe7RD//8kx58x1sedtOdAFJ2BADqAfo4AXhzv6v8CfpxJjzh25/xe4+49z3NYeGKfAXoX/2W32oOABwBY84AVtSof81LnPyvff9H2kocAOIXf+PDN1/97o80eU9fZwD21v3eOyow7AzYx1EBd2HQ73PAvpfek1VHADoc4zg4AU4/K667pL4TAMBdV/8TTFe+7gBIEA3Pai4v3hPwJ7hP3vQpCvjfxgEg8M86k993AVAvdgLkCwGz/pfxLoC/ds8Tf0mwXimr/wSAP+f2oTy7eDazA6Dq6yip8t5uAIA3v2n8fjGpuKhxzcQF8P+IRzyiAX/Av2HiSww5+aKqGa+TnuM4E6Itg5MpaU7qxiamyuukljhpKZd3wlzplBMA3W0n59X+WePUHxu2Y4r2yjJ/pk3ZsG+ljB2DAMB4UvSJS+W1o1yaeeW99kkZF8ZzjMiPUcZhTcNOyjKuPvRUOD3J39v4P1VWr/yzyJbWfYme9VDX+Ipm31Y++9rrOUerDeLmSV7ZGHV8VZpjUx6dOkZN61H1e2nKvN/yHky+9wwiferZ432t7V4805K3XmPUNmV/jfWt18FrdQdjwfGxSetvCPElfyf3Whln1Mk60hZ+UxO4b6zwB+j/i1/3ildn2HAIdBwBOhUsi3In2kubqPPhb6oH0gHQA/4CfqnOACYuOgBYzWACSdjXEQDe/r9kBwDA0nP9nFOHX4P6AYTDzwXArcAfIMskM0E/wJ9dAdAa0BtzCOSL+Ji83vOa+5tDAGcAwRcBCvalOAFY6b/nRd/zoKD/IcNq/xjwr+AcII8DgFV86ibgxyHBy7WMmw9dgD+An/D6D/32EXFW2XAE6Ay4973/ZtYZgE2cI73dAewU4F0J2zoDcK7k8Yq242C4zgno5aUC+4xzPZTP0YMTYOqpcX3T6k4AQLKgObf+J8/4RwdnwdgOAD6rhwOA9ClgT1p1BmQcfh87AGwT5eEE4D0I+UJAHAHpAGAXAM7Wi9wFwA96BezGdQDw4j9+a3h28Qzl+dtzAJivR8ecANi9qF0ATIh0PPBb6u+pDgAcjhN3lROZpCcTMid4TvpWE7Q7tqROppxMOrFzguqE1DiUCa3UyW2NK4fmhDsn1zn5HtNJ+dikXPkYTRu78NkW+V3skMf8Se07qMEJ7xJqnqV0zOYY0FCeY2VXPifwyWOPsSvdGMeO9R7dcrxv2F2Y17aS1/pJZ+316pwy6mBcHmogLfmMr+TWr0ftY6/hRVLGGeXleBsbo1WnxsmHrObvydDJ+8v7zns2nxPwGdAxXf2aP+XJZ5nWQUparbtx25AUnjB2vXrXuo0Tx9IJnfiJmUw6+a0p48w6WV9BOr93G8AfQL8C/4L+L3zGT7/ToEyqrjZ0KGA/+4rybX+nzZONOiQOPaADAGDvOwB6jgCBf05ceJkSID0Dk0gCq01ncQiQV7tsec8dAK78NxnfrB+C4BIHQNsevzqjrzMA0JuOAIExFNAv8K8Av8bHHAGf8U+OHQQ4BJozYbVDIHcHADoB9Exk3R3A6j5g/+kv+vabAH7a2ra7U/+yxV/ADk0Qn6v98joBKAvQX/NoCycBoB+wDwXkm4Yt4sjTEWD6FHV3AH0OCK9HBdr1incG5DVNnv5j5b+B/mErsF8lII48AX4F9aZVWvXG4nwZYGZifniGXMMecCdA783/Auekri6jD5D+uy//3vWWekE0ABoHwNQLBxPozzkJ9rEDgDbUXQA4AXq7AKg/z1ye6Rf5RYAnff2T3toD7Wz1xwnAy02rA4DjAb08U7KeE+CxX/bFx+0dJonnOIxv8Bvrb6rgP39Had/qOSPA71XHtJPJ2MnE7li2mpy1iVCPV7+T5iRK6sQO6gRU6gQsqZPaHkXmxFk+J8tn4Z2gS9NWT5bp2/LU3fpXfltbqa+tSu1f+32Oqr8L7dnOMVB5xgkyx8tSah5p2kkZ8tFxzPhlLEvliZ9jWNJGyp+su3X1Xky6Y90tb6p+9K0BPfl9UMYOdqTa7I0pZTlGkWVcXrlU+RLqvYSuPDTvO58PSeFryDzy2pIql2aZ8NYjaW1HthOe0OtX+zdpXnvGYAs5tk54flvyt4T42F/qbfzGWJ71s+4AdMF6A+8jK/4C/y96wQd+RV6qEwDaHAGr3QDa1Qlg/1iXiXaPte8g1wEg+HdiUgF/laMPQHfFn8kjAeCPA0DwLkVGuvpzFDvknXoHQHsDf4D/9Rv5B2AJz44AQCJn9wHVDeQPwFpnQAJ/QDvgPgH+GI9TwDRpOgpwBhiaQ2AAwYDMPC6QdWogeaiXOwbmgH86L8ZAuI4AdjPgbEDPVTR40nOVH5DvEYK0mQ4AdLSLnJ0CUGWZL/l0BozuDFg5AwD86QAQ/AP4qxMAZwA7AwT4CeSVSTNtKd+u0TCGPu/LvvG/42EzPC18IB4eHNe8B/7md37nSwX2AGVX+RP4y7sbgJV5HQAAacE/lGcbsgrse6A/ZcmTlzKQuQsg62h9pmgeBZCnzu4C8DlcXwbIDoaNXQBMIi7gjx/v77/v3o8A3gHpgvgxB8BDfvPBo10cANr3XQDSZ377t/7vTCjOo6lMWAD2CfrZ/s8XCXT6crwBBwCUydREPXz2JD2elJ1M7o7jx9fuZLWQ+ILgRAqak8uc5PEcdLJXJ7DGnfA62c3JsBPkpDkBR248dZby5h2j2jHdOJR6Js005dmWOf3Mb3lS06o9+8y+lNrvPapOpdhGJq3pvXi1X8cB8TpOMr6UT7vm6clmxy1jf8HYPquOddyWTpa757r36pZ96rWrMuPkl19K63hZEu+Nu6Uy7U/p13vKey1p3ofyUAO6yjNfj7c804wnHasvOmNptnXqWtRrvjHe6u/C8Y+Lvx8TPzXdpPVvi2VaL+pJG/gd1QHgyj0APgG9IB/gT/iSH/rI/ypfnQHVAYDNdAJk/1in1v7NdtOYXdvc7YhbSpgOAJ0ArlboBEiajoB0APQAvc4AVlJ50SDbqgHlfNaPvFO7BJhMo8OEtfcZQLaRs/K/DivQX50AOgma3sop0I4MDC97Axw2Z8AK/CeIl68Av8bVG6M6AjZ2CHQcArlTgHrhFEgQLZ/gH175EspuAPIA9F3VZ+UfEF/zpw7giHcBpI7OA3cOEGc3wb6dAVy/BP93PPwxpxwBjCn6TLA/R5c6ANTzetz1hve879Ofe/+reRDxwDs8WK73o/AlL3nJD4yB6XQICMJZTQdM3/fS+xrYTwcAzzJCdQDsEgf86wDIIwpjdf3Yx37/45lW43UXAM9V6l6dADgAaAO7APhU30VdXcoCkOMAMOgA4LfDHQC8BBAHwE/86pvWjgIdBkupwF+6uo/33dS26i/w5/cT0M/OEdsn5UsupNNGJjczFTmehJ1MaDJ+siJ6dwH86KesxldpTqKgTO6kTLSIO+GSjk1cU56T4Mo7YZ6iU5PwsTTlUuzDZ3yqzKk02kC6dEqXtFpmjWvLvsm+S94+T5rplddej1bdXjzLgXeyn+Mix4u86cZ7NG31+MyzMW5zDF8Qn3XZlc82YCPjjR+5H6ueeaWmG4cavA69/t1W1hsLVbY03htryBinScf0lsjrmO/do/k8kB+jvfyUkfKMy9d6ZLy2lbRsW/bn2PXyWid1TKzH1fFvhb8T+fOyBBSb75jeffy7YnnUy3pSd8E/v2PVASDwhwr4Af8ZlOsI0HEwtwuAOlindfs3272krdk3tw+vAwCALtBPkC8vVafuAOg5AJQx4cS+YF1ARxzwxrb3Jz/7H2zsEMABAPgnPOEpr16/AJDV4QT/2BLcd8F/xzGAI8I8rCCzyszKdDsisHIGCNwF9hX4G69U/Uq113Yh4AgZHBDrHQhxXCBXv9kx0L4y0HEINMfF4CTQCSBNkN7jAeis3OeW/rqKD5D3/D+OAuLashzskI/0DDgC1J2juTOgrbbjlBn6hsB1ZWxUBwByVv51BECJtzydlwOmM8C+BNgrT5Avn5TjJOzi4PoBPjLc9bO/9iEdAjyAbp+nxq3T0h96zavenuC5x7sDwCMAL3jhC9t2/3QAsP0/vwDAuwCw/eKXvPj1HDkg6L0eo+iwM4F8OA4A7nMOAFf5qXePV8auAncB6HzlKEC+C8BjAKR/5n/8FT9zgVf5xqOe8iUPCIqh1QEA+Gfl/6wOABwFgv/zcHJwbV31B9Tz1YEe8LetL33hs9cOgIn6OBHjksifpkzQBBPSlK0mcGsd4yvqJCppb/LppK/SnMDmBDcnvvCC3pxAn4UXVNcJPDZTZryWlfWraRlfqpf1yTKVV5vE0zZ89l/2K32e8cpXOxlPm5ZR89e417g3DhgnyB0v8lLlSXt2KCPlqQ9/Rxmnc/Gap8aX5DcPNIP1RNZrpzJp5rVcZPI9mnnmePOnnnXs0drXNV7zeP23oWNjCDl2anqNOzalNT3j6iSFN+S9ls+Cyvfu0979mvZ6vOVOUeuPjnxS+7peixrnmiPLa+94mPidGJIW/wmcj39r7j5xAFgXr2eu/o85ABLgA/zBFWAIKEFngA4AnAXrXQAcJSg7ACgz+4p+mGj/4kbfVoo6AAD0uQMAoC/or5S0bRwAgPi1AwBAPgB/gDegT7AF2G0v8BvO8OMQ4OVP5MMR4DsABMeu6u8C/tuWcRwAHccAMtLbDoHBIZAvAxTAQwX9FeQTr2noIxf4Zx/TJ4BXnAE4IOgPAg4JX5S3bvPqKwP0F6AUIF7DHOAmHeDu6r9OACiAH8dAOge4ORPwk0ZeQL4r/dDcDYCOaZRn/iV1QwcnTMsz9Edb2V85A7jWgn8pfWegL+ecAI61JRQHAfXoAf90AshzXvmul7/5bXgreQC2B9Ft9SS5po0dftTe/o63P5DAP1f/kecOAID5mAPgjT/xxrYDACDPD+RZeoT82Kl1y3puw+cuABwV7gJIJ4DHAHjmtncBHO9yOUszFuflnmFbvMAYsE9gBwC/N097+xvWDoClq/1Terx7YHHllimuV/0B/qzs804Xfsf4EoztguZuB3i/CsBv8UxROSFD9bQTYAr4M4EzD3wn5GQyJ5dO+KROvHo0J7PydULcmzyfReZkvU7sa5wy1K3lUccqWxLXntQ8tWzjplda+ygBghNt+7NHe/mXyLClXrWb19drLxWAGJ+idVyhi+1entTtjdElMmygJ12SJ3WyDpXv1XlMVvNmPMurfOrN8eTt6WSdsq/rNa1x86WccZHxyptex89UPMc3eo7BHtXO0jz13sp7T75S8iBLKp9y+VrGXLzXLmW2D5p9y7Ug7jWR9q63svVY8ll/Qv3NSAo/9XfyGzOMM8ea9aBu1Hls9d8jAK78C/IB/G/7F//fIwNYg2C6ToCluwCoz0z7p9p4+6bpAABACU4F/K729yi6fAXAVf4x+tqffNfRc5/7nGOgO6zoAnDHAGw7Cz8AL5wBgOC2Mj+AY+gaCK8cCALCMSA/Jm+ryhwdGHEArOWr4wXoA9BxCjQQv/pCQDoEBPlSAL88eagrfcjE8Ise+ch1cOJ35513tnScAM2pMIBJnA/kRea5+HQKIPOt9m2VeuTIQA94s72fwE0IYHe1X4cAIJ/0zFuPBKAL8OemRV8HQoL/zL+Uf+gb/rg5AQDpXHOuh4Af6op/8ukEQN7GWBwJSMC/ZOWf/uQ6CO53oekQ4OHYHsq372PmSrecH493/aNf/M0eoHb1nzRAtA4AQLI7ADw7z6o/oH3Pjb3BlwvG6lfr7Io/8uSJb7sLYAEg3WtTKY9PpgLcAf+87R9HhA4A4tt+AaDnBACEM1nYV+WZBLHqzzl+gD+gHvDPCwxxAEBf9gt/Z73zIB0A1IVdArTx8z/r4XNOiXQAnEzMTiZ4m1v9mbDVNOLITZMP6kSqUid9SXOy6mQwJ7NOcJM6UUYmX2mmJV/1jOdkHlnGK28eqLalmdbjq55gwDLII1/TMt6zjQz7NWR/yqMDn7TmMz5lVx2p9qV5ffO6OzZSJj+VZ06HdG1D2ziNsbk0rg30e3aUqTdFrfOudMx2ry1jutvKa13zmizhya9ebyykTH4bynjr6TsOk6ae+TI9+d59lffjGE8+78+0oayXL/WW8llX25Ltg7ff6zXMOOOBeB0X6zGVz/1jnp87fz/gl/xt/sYM9xL2LdsxQp3HHAAAeLf/A+pd+Qf4/6s/+HefOFr9wSNzJ4C7BTZ2ARxeBrjkmm2nwxufAf+ECvyNV8pkBX1WkcaAf8qZBLnlnVXVJaE5A1Zb43EIAAZPbf2fA/ElndV9t5WvgX7RGZUPDgHApQE7AE1AOlvEG3AP4N+OFAwr1PQVE8ME/vB8EkoHAH0D4B8Dmtj2ZYI4ImiHDhEpDgH6CYBL3wG4l342ENDOGX+cAbm6z81ISFCfTgNAvwF5gvy2ij/UwRcaGk+d5Kkr9fZacx0A9vQf4w+evpfqCCCePOMSGf1UwX46Anp867vhWo5dh7PITzkEtn8Yb3djH7S36gF+dMe227sjQAcADs1v+b63rh0AvACQ3Ups99+q0G2Uhx9e7FfAb7yCfeVJcxeAn1mt7wJwFwDtuchPAq664gYgGID8tz74hrUDgPufF5hy/+EYENQDnuHHqHqpA49DZZuun9MF/APiBfbsVhD8f+nL3nSTZzvPVutBfQ3NWXDPk5sDYKHDZXNSlhO91QSNSdpGSB35qjPEmdiRr04qa9yJKPdM8sTrZJZ4nfROTZbRJT2p/FS+qYl6L61na0k5vXw9cDAl69moMuqSofYracpSD15b8qYjl5+j2oZyXfNae82Tmq5u0qo3lqae45CxuEuo4/Wsceu1D7pLXSiXfNI5G+pBs6/PwjsesCG/K2XskVcqv3RMTuk59qV57yMbuy/VV6fGe/mqrjqZt8fX+mc/1mvENeyFsTGwvl98zm9Sf8rmHAH+xqC/dhg7Bh1X1BvgL/jPc/915T/BP4uGCf51AuAAIA0sgaPAXQDbOAGoG/Uc6Qfbf6D2AOcOdQC4A0DQBR0LOgDG3uzPChmTIIDY1Kr/lDNAgJirwRwfAAh6hn8UsHeAfQPaE9v/F9sKZ4CAFIcAbSXAC1YB+QQdAAB/eHYDkLftKlidLa+7CogLOnECMLFkhewdb3nYTT4fyKcD6WOdAM1Bsmo3uyboN1az7celDgH0Af2u7EO5Md0VwA2aacotZxtqnbzGtIG+cwzSTwSvuf3aQH4B/8qkXO/WB4NTBJqhOgf2servtVpCeX+AxwXaA8sb8kAvrQf4AU/ALF+PAACOee65A4AX533Hd33bB9uPzjnXnh0G1sf6VepLAHUKEIcnH+8BIHBcYepdADy/Sf+z/8F/8PhzbtKGeX7A+TwfK+buAEgHwKs+9MNr8CyIrlSgLc3089ihwZcEKIPycFzwrNYBwLsLPuPBozbh4Rqgk/XCAcBvwmr1f2piZlpSJ2rH9O4BMMWErTsJQqej54SSNPke7U1Gc0KYk9nexJ4JMRPg3sRYmRPkOV3uV3SSOgmfoplnrgzSDVkvZVPl1DTzTFHLqDT7lbRe3yLHtrSWoxw6FbIs+AQl9fpnWo93bJgvdZQldcy1Mco4raE3vgedzCd/Vpr1ks/6wyOXqqOsJ9+mTthRP/merKYTN9Q6j8XrtU69OiZqnPGUsow71khPPuPKz0LreDde78MaT73kq17G0SOe+srUMy1pbZ99ln0N77Ubo4wB0hwL0I175TTwz9+Njd/cicjp35fVvWa9qCtt6DkB3L6f2//BDgD9P/yjPxx+FTf/cAr0HADaYb6sk4Ejg5RJ2fad/THTDxPNvQ2T6EgdAK70J+jvyXAUpANAJwATYSaNTH4AX66QT4H8TGMFOOOAMmwAZln1bgBdB0AH4E8B+PXq/5B/Sm/nNOwOgdVoQCp1b6v6w+oPuwHoE4A/uwEAqMgE+BX4CyBb+pD/ntfcfwTo/+Wff8jRv/iVu04FHQJP+PZn/B7lrPtq1Uc6J+ruAMF3D7DjAOBmZeUqwb5HBlj552bt5U0Z1zPjlaef2nGG1VcdGFeMOShn+nUgNccKOyWQDf3nmBXsJ00nQXPG4AhZOQGk6Qxg3Hkt7PuLpG13wOoLA+39Abfhc+iqNJmX8FVATZyjAABovgKAA4Bt/zoA/srT7vswP0IX1QYmER/4wC9/rFdPZAL/mo4jgK8L6ASgHTyvaUt+EYBdADzLSecTmBfVLsvhh51nJS8CZPcYzwNW0nEIJJjflj8H8E+Vb/gZQ4A9deR+5t0Frv4jY/eF4F9HAPXnvQfsIGgTODtgnOYkbnNyNgKMqF8Lw8RtTSu/mtTlJDInlsk7yXICCHUC5mS20pz05mS4x6OL3DzqKDee1Am3lB0e8mM08y/ha33Mg334sXKqXN2k2kpqeUnp14xXnvzItJO8MnVq3hrPa+j1hfaue6aTL+Py5jOe1DSoY21jEp/jtTPOzbOEZhnJ17xZp6zrFG+e1FFWaS0v4z3dlPV0kaEjVT/rIu+1zbh8j6qflPGScfg6hnaJLx2faTvHNvy296T3qHm3yW8eqbaSkpYh6559WPveazhHHQ8b94zP/RM6PP63OgJw+reG+3AIlke9qDNt0AHA/FWQ3tsFoANgagcAC4q5AwAHQAX/1QFAXazXuh9O2u5vJX1w+Mse4AIKpgD2An5pOgNIF/yTh8kj4J/VIt4HADjbBfgn6AeMNaC6Wk3nBYBMUP/+P/zlVhbgDlBXQe4ccF87ALZ0HMzZrenUz90JlNmA6wD2GxAeKH3EBFGAmeA/ZTgPeHkU4L4H+qdk5GFiyflZ6sCqeu4OQNZ2ZSw8LsANydEAHAEEnAB5LKCC+jnQn9v9rRfjiTHHaj/Xl/Zz7AHKLgnfhyClXzecAUO/J/BPHr3eToA2zrbc8q+jQOo1OwvdsDW0l4dd3qMH/mJ74C1vfvM7Bc9u/yc+5gCYeHv7uVWc5/bcewGqI4B47gL44df9SHtu8/zOlwHi2OCZ63OdH9Zza8iI4TaRGL5EwDEEADLOTcKznv2sfwvg5s36brlf4gg4J/Dfas/RDMA9z0WeAzhhcQC0zxYO93MeW0CPsQSl/jg6Fjj9nIxRXk5m5E/oapK2ngQRJ4/yk/zHeZSvqJOoKVonpE5cczKbfE54nQgjk6/UtF6+qpsTbfg58F/zE7e8qbQxnVr+knivHGW1zRmf4rMdWVf5qby9tLx+8F7jMVr1l+RJW44px916vDo+cwwrC2q+Map9aeohI25a0qzjNjw21E978pZnPZAnr94YNf9YunLrkNRrhSyvk3xSdXuUcYO8N352lXkfOJ7n7KiX+ebuQXTRqdR82jLeo+pIezrK1JHapuzTvD7yXsMp6piBbtwzm895fjfyj2f/kr+T35W4/yyTejmG5hwAuQuAhcO6C2DXdwBkX1mvdT9s9sHSNi/pl1tIZ3iIuqIKuE/ArxNAeYJ/8gAwmegAthoYA5QNK7oJ6JfyCfxxIgj8AZy+nI5VZ1alSAfEVvA9FSePwHxK76xp6QDo2aIegFq2iVbQCBBk1QjgP7baPybXIUD6e9/4qUdve8VdNwnPfsyfaVtM6a/eUYGx3QEV1BMH9E8B/16engzgTV1yuz/jjjHU3p0wgPKHvuv4awvQ9v6DQcYY0QEAXcfp0yFv7gJoY3oYl8q4Ljo9XP1vDobyab96TYxvgPQ4smH63ugwNuiDywCVt9BT7UxN4YckV9h1AgCeedFf7gDAAdp+fM9U4m6Z+QHOrwS49V/nhbQ6AtwFYFvcBVA/CYgDgLZekbF4MhkZfrNoO5MOjihQv//sv/jCF3/5Y578A7zdn+MYOAkA2NDzPsaAcwFAD9DHuQuoZ+cCDgCe8z/xq29ar/6jZ/jav/r4I97Bs8XVdxJz0hd1kjP0zcQE6HS+1F/xTqQqpc+RQQ1OwJLmxLYHEJwI9yiTY+XJI6txJtjInWgn+E/edGm174RceZaVabX81Nd2peikrBdPO8lb9hhFN9OMa6NXX2WZb4yv17Fe4xqv+sZTr8c7lhxfjrv1OO6M0ZpmnkrT9rZ8r64po30Zn+Nr+dZVeY0r34ZaB/LIJ/Wa9OhSPfKOjZk5eY7N1FVex7Dyqlvj6knznpvjyYNOpWP5Uq9XXn32qAPNeuc1yL6HH7vmOUbkpet7YvM3gZ+X/N3Y4udmI9/aiWx5OcZoi06A3g6AdACwC0AnAI4AA7Le6v+edgBs0+7bSvcGKyyswAr0Bf7pDEjw744BwBXAqwGrMwD/BvpWK/5PfvY/OOLLAf/jr/7qgwn8fdkcFKcAOwJ40SAv48JZ0AD+yOo+4BegexEOgAb6V8cU1s4Ajx2sjgmg0+rEjgCdAQPlfP8cwBfoJ03Q/+bn/YkjwvOf+ZCbX/Xln9IcOv/Vf/6wm5yrBXDrBEjqKjx1cscCjhzA+9QxgR64T1nuBDi16k8fDWPOdyG0Ff2hDzYAP6A/wkbayhmgI8CdArkzoOcEYJxY1q6gPZ0B8pXuYru1ZbgPqCOBB+pt9SS6Qo3lx1oALcUBwNn5dACw/f9Sqz1Mjn/oNa96u3VcQnMXgJ8EZMt/7gLgGADODdp6GccAok+dvIRoGctEZdDcOf+yUu64gwkboJ6t/jhweecL4J8jDMgE/El5f8uCt/5bhWyDPHQzCJSQw9f0jKtbqJO7Hq2T0jppNZ4T2x5YcCKcE+Pkc5I8p1sn6Uy+6wRcnSxDu5QlL83ye3y1Y9xypMgrr8w8YzTrVetAHtMrv40981b79fp5XaGkSateL64u1CBwqOOJuOOujd8yNlOmXo/27O4is77SXvtSpl6P7lK+ebAHL1Veqem98q0nafJnpXXc5HiSTwqfwfypk+M6dZOf0vF+m6PYS52MJ586lbdOKe89e9ST2m77v3e96vV2nCOXT5r3RuOPn/X8fvh7Ab/0L/N0f2Ms23rSFh0A62MAw05Wz+/rAMiXAeoIgBrc+u8LANfgf3X+H9sEyqJM+i77ZKMf8vdut35Y2l/XW08HAIAsQb+8gF8KsAJQN+A+ADFA39KVfvUAmDgOAGMAeIA8oB6Az3lbwH+C/srrHFAPhwH5sfOEp7y62QTQCrYvDPyHEwIHgIHym0Mg0nOHAICdlXvCEidABf33P//TbmIDoM97BnDi8HlBPzHITgCcNX5SMB0AyTdnwFBXdwZwjXUG8Im+KYdAAn7GRO4WYNWdclo/rIA/9WnvixjKAOhvAPwA/ukE6PGUSx3ZEQAQZ9WNcUV/95wAjAt2Ieh8EbzvAtr3kYf60s8Cfyl9w4P2ej9drm/tX/KSl/xAAmqAM9vmPfrEVvlLBsd27o10ArDiX3cD1F0AfhJwaheAx7toLz+yFnagp3uA/v8LH/zjmzxvWP1nNwDPht7q/xte94pj8H93A+mnjfUlTsqckKElf0KPbZ7Ep3TQjeCkbowyBjL0Jq7InNhWWifuNZ4TZHmoE2b5TIOvE3CdAL3JOLo1v3YtZ4r28iqzHsTlkyqXWhepdqS1HsiVqbMNzbzw5pU3XVqvnxPunpw8Pbl5emMlx5J8+72LMcn4HBuPKSc/ce1Ix8pFnjrySXt5x9pY5b28WWaWU/nUk0976CvPvKlT+Vq/Xpw8PXlP5hiROpa2oeTdRn+pbt5zYzy2emnKpalTnyfWJ3Xgx/TQt79qn3q9kMtD8/rmeJfn/liH3rO+/1uyVMrvCH+bvydxTzoWqTegXCdA3QUAkNcJAMifCoJ/9Hd2AGzW+bgVh//9HvjM4ayl4F7Kin9v1b+BqgFcCfYE9EupwB+Q4zb/n3v/rx2/ZGsA/hXoL4kD/rFBgDcPcSbp7CqgrATcF8EL/hvwX+AAcPUeyvb9dAjoFICSpi7AH3DPZ6h4m7RfGWAVCgeOjgB2A6AH+E3A3+PtG3cGANq5Xs1hs3L4zDkDcAC46o/TAZtMjgkAfx0MgPBdgb/OAMYeq+dQwTzOAJwOrZyhTK9B3QWRn0+kLtjUxj7A/ZwNwD/9Kuh3BwNOHGTcm/279iA97x7gxw3QrxMAPlfMOSe/5Rbu86zyjXx3gXXuUZwDfhKQFwL6ScC6C8D3ALAL4Aq18zz7cGfbHEPI1X9W/nknQK76w3MsgUnSzgUdT2zIvjkp68WZHFZ5ThgLz6TyjkHm5DJpTkTlc6Ja+ZzgOumVOnGWCgSSqiutusahOQF38g2Vz/TMB6/9bWi1UeuQ5cHX9F7+MZn1Ir3yY3nG5OaHak+aaVw74nkNx3j1zD+mV8eHcccSNMfb2DhMncxbee1DrVPKerw2emna6FH7oJemLG1aTo+iV+WZVx6d5DOuHGr5+6JeZ+nYWOvJvRd6aSlTL6l86sEjP0vQRqWWt43tpc+bei28Tnndcgww5onn2IfnHlmH+pznF+JYdsyd/f/J782qXOvj2BP8u0pfnQA6AAD4hlzxV4ae4H/tAPhLX/+N2Kur//SZfTPRFzoyzt4Lt6IFvj8M8GcnADzhlFOA1dQB+LsavBTwq5fbmwHjAHPA+pLVfgF9pWPAHz13CLS3d68cC9Uh4A4BAe95UIHn3A4AwLmgfoq60s9qP2dIBf1TlDOpOANwAvDOhh7orzKAcg32D/0GaBV0A5pzZ4A8q+zYaI6QYXwJ/psDYAC37iBhjAjmoUsdAuSjDm1srfIBqJG3Ff6h/Pbyv8Hh0K7D4ISo7axxHQLYdIfAHIjfOR2Hw3BPAfTXdHBW+OlDHSasMvOguxWfPVe9TZzvFkTjAODYESvifvGEH58r1IaNnQDWW5q7AGiLXwPwk4D1XQD5NYC/ds8Tf+kKtfNKVgUnyeNe/9PtXQD1xX+Af15WeAbwn5MY+ZNJ2ekJYD+NyRu6q0lcpU7qpE6uiMNnyAlr5eskV8AgzYk8MuKm9eKZZro26iTdibg0080jrXaNW3/jlZq/0iwrefSI92i1YZwyK58y0yq1nCo3XtuizZ6cfkCe/aGsp69M/aR1jBB3PDnellLzQdNOlpFly2f6trw2pPaLVHmPLi3LdqFv23p5p9J65aesV9+ezDymJYU3OK6mqGNSWnWRLwnk6+mNydH1OSDt5Uc2ZmMu35S9bKf9Zb9CubZSr7NjQNq7Jzae2+PPfn4n/a2A3+XP/Enb74f1cizy22YAqKcDIL8IIMCvgF+54L+9+T8+/ddzAFA29Zjoj13afPvloSNbJw5Np0N5cRIABODUAMqOW/0byFuBHFbix7b5u5W/gvxeHOD//ve/79SKf0+35wzQ6YBDgPcN+B4BAe7eaF31H+JjtgHzU8DfNIA/gH4K8JPGjoB77nny0VOf+s1Hz3zG0xtPHDlOABwSdTW8guGxuI4B2qIzoAHt1XsDcBIBpNFjDOF8wMEk8Helff0SP7a/r0Lbyj+A+TlHgMAfsI/DQKcB+alLqw/b/IeAs4KyCUt2QGS7aYdto0772h3QnBbDfQHwb461oW4Af4/dSOk/2viIe9/Ttpu3F5rd3Sbxt99D6pJa7Pb6dADwgrwv+8uP+pFLqtJUsZNOAJ0BUI8BTO0C8BhA2wUwTFimCj6kHb8PgBcSss0/V/95GeEewT+Tsd0Dz48ITqCc0EmdXGUcGcHJap3A5uRW3omvtDcpNm2Oklcd7eQEPCfryecE33zYSXvahY7VXR1tSLMO8qTJ98o3b6W1XqQrq7pL4ubNuvd4ZVDbD1WuzPgSap6kOXYcT44xaY49dXo0bSWf5SWvDjJ5aI3XtLSRfPZByqf4tE2bMi6f8spnXP2kY2VT17E05LUtxs1jPGkdf4535I755E2vaSnfhtf2XB6eBYYp3aX25mxgJ0P2mf0pzWvHta3BeyKf2Wu+/zvAT7GAfZ8/yye/OcPvh/XK8Uib+J0b2wXAir6hAn7l0t6n/+oOAMqmHiP9YT+cR1/ss1+vji22MgL6AR4A/21X/Dn3DWDpAX9AvuDbFfptgT/g3zAG+JVnGT2eurAdlkC6DgEcFbR9DKwvlp+TA4Bz/lMOAJwJAP+pgE5zBCxYFU9A3ON1CJD2Sfc8cPQpT/zZNfj3SEmjOJOGd0e01e4B8Lv9P8E746ZtiSedc/3FGbAN8HcXQDoBGNvbOgGyzbTtLLsDcCA0Z0dZ9RfwSzkCoEOA/vILDAdnwMU/K/mxFziz8s8nT1ktPwOgO+9G3MivA1h3aO4C8GsAOAB8uSFAn91ZfhEgjwFcka8BnHff7cU+E5VHPeVLHgD4s3uC+BkN5yRGPin88jBM4NaTppjMOamTOsGqk9Kc9DGBZeLnRNaJrTQnv/BMjKts23hOrqcm4zUt8/XqQZ2tyxifbUh7lEW8lply0zNfj7cM0pLv6U7Jal7iyuSnaPYBejU+lxf9DI4RaY6rHHMpH+O1Ac0yduG1UW0aT5u1HzJtKa/ds9Cxe3CqDll39DI+dS17aWPjrjf+L1Mm8Jf26kJblCevjLzySVN3rD+QZ/+NXR/GQo517wdpPq8bf/p5z0+Mvwln/LnZyK7NE1p+MxyLtC0dAPzutZ0ArORHEOQndZfAWi+2/WOHgG3KsK82+mazP86rLzY65taIDBeTlUW2MLYV/9UL/gAbS0MF/oCW3ov9KhAXrE9RAT9v/5/SM62WMRc3n5TyXvXu//noUa/7pQbWPvlxf6+BRoAj4TIdABwB4K3+vV0Aueo/Bf5NQx9Hz647ARIYywOQGTP0GaAf+1IdBa3/2A0xBBwCHifYWPUfdpwAtAHLgn4ouwZciW/OgSEOwM8V/wT+uRuAMcn4rjsBqKv1X0JtB/ms+5LjAr7sj3oQ2s6aoX/yqxuAft7fgIOHa4wjgMCxGZ0ASdkZwHEd7l0eirfGA+lqtYIfN1b/AdA6APg+/VBLfxCvVoWH2vDDOOYE0CGQxwDcBYADgFV/HQB5DOCKvPDwyvX1BVfIMZcUfrsw/OYziXQCNUZzQpo8z5pe6E1uc/K7D94JdU64c1Le49FFnnmSz3rZBmTwpiVPXuRpA75XtjLTk9b8adNyq86SeM+O9pZS+8F2S5fkz7yVz3GTYwqecVhlvXjagM8yqJ91TZo6ydf8NZ668tkHyGqZ6k2l1TYsjdMfU7pZtnzWN3nrl7LKV52x8ec4T4ruVJy0qpP68lVnCsybBypwX6JvuzL/HG+eKZr96fWolOtZx3k+k3lWr0P/Wc/PkL8JlSe+r7+T35lVnayn4xKQblg7AFZgvh4LWIN9t/pLC/jXHv3m2Kc8yh7pl32199a2w3ZFQJHAH/AEgFv6Zn/ACCu1ACFATT3ff5YVfwC/4F9wLgXUV34O6PfStUE5HE/gcxR8i3LM8QEApb2uKusc6DoFyg4A+rirN6zCA8bd5j9HeV8A4DADgNEt/wL8KYqu7xDAzr6cAABu+g6QLfBvToCh7QLnpOkM8GWDgH5sPHS1tR9w3cD/agv+EuCvE0AHgA4CQPeYE4Brua0zQIcB+RqoXzksqD/3Bm1g1Z86e480vcHxAdiv4L/u7NABwDXiqwDalVIGTgB2c/AOj/YwvLUfWZfSOiYC7/pHv/ibOAAA//wgXUpFtiiUH8c5J4DvAYDyRQCONhDYBWDwGED75CE/+oe/y+iB3uTOyRj1kV9GY/LGM8NJXKV1UmrcSVjSnJwhz0luToIrj17KzJeyHp+T7rmJOunoq2de7ML37Csbq4/5tAXVftIqT/1987U92K8y21Wp12GMVv2xeC+/fQjNMQPvmBqjqVPzEk/b1inrYDpp8mehtYwpu1NpvbYskdFPY3pj7bIevbrXNHXGaI4px2+O9/PmK6g3PlVu1anxqbxjabZ9jNJ/9lX2Zb1GXkvHfz6DeTafCqef9T7/L+J3yd+h49+ZVf2oc45L2sgcSQeAK/jG146A6hgI4O+Zf/JgC5vZV/ZT65/NPrmIfrjeZdCh7UV/AzADkLi6CrBYEgAe6Alq2DbPeXoANaB/W+CfgB4wznZ8qADddKlyaQ/cz8nISzkve8uHjqZA/1x/NKfAahU6HQI6Vtagn1XvAez3wjYOAD/3lw4A+bldAAJ/9DLsywmAc6SNpVj5xwEAuAcsJ/jv8ekQYHcAzgDAMy/aa+fvV84XAb1Af4ymA0AeuzoBqBPn/GtIZ8C2TgHzcm9QL8ZPO87gyv9Qvlv9pTgDpsC/OwJwAnDvGTbsDs4NXuB5vZ9MV7r2N/iRu9I1LJWjvjguXPWH5icC8xgATgA+c+guAB0AeQyAH+NSxLWJMnn48sc8+Qeg16bSxxV10pXVVpb0eFK2ORk6LetMKp1MJXVCKqXf4J2EjdGcqDnZnZoAq9Ojma9OqHsTbybryJM6gU95zVvLmYuTX520ZVk9OlW+9rSVbVUm1TZxeOVJM7/1rJT+Rma/Z/pUWtUzvzRtKkvaGzc5ruQdd9JevrSb9co6yFeaeZfy1QZxZWkjZcmnTq89VWZfKK9x5dWu8Swbfl/BseZYTNoD147V1Bvje/l7uuipK+3pVZm60po+F7ft0l6fkpZyr4eU6wbv9XOM5/MXfgP895/r+ZtwUfzJb0pxANgO2qUDACqvI4Ad5zoBlFVqHqh9pX37aQL8+7t4UX1yPcqhIwEJrBgC/AEQcwA30wX+DZitVvxZOQds7wL6E9C72t8D/gL9pHMAP9N1SpCfnQVs8T8L6M8+ST53CNC/eWxgXzsAcAB4DEDgX2ndETAG/HUCoM+YcEV7V0r7Ab7tzP/qCEBzAAyOjx7gH5OlIwDnQVs1H5wBY0B/Si7wT+pLAZNyrQDv6QwwLqinX+CX9I95miNguM+4Z5rzYegXgT+0gn+upe8AgK+OAZ0AjLvWLwPwtx3scLjOIO16PEWvVy155n/gA7/8sXQCyNdjAGO7ANj5gGOAHWM7tv5K/CB/64ve+Bs4NNrkaseGXGI2+7BHUwY/HooDwMlUUidaUieq0p7cSZo6UuQGJsXwUuVjMuU5mU7eSXilc5N40s2DvTpht35ZVuXNL11SpjrmsdypeKZZ77SjLG3VNplW25D9b1+nDP0a10ZPX13zSZVX6hgZo4yzsbRqy3olRafGldX8lFNlNW57qk3lqd+TZfpYu5Tb9t69pk61l/HKW5+klSc+F3I8wjsWxwB16qi7Cx2z0yt3TLdXbi+/er00bBtqXyGvsnodiHv9oF5faD6D1+B//FnOT5HP/Yv6WbK849+XcABYd8dtbXfPEVBBv3F1tWF/ZR91+sc+sI7Gb2/KhfHTfmwTBpCwSpvAdY5P4M82/94b/RNwJ1CvvHrKE/ArQ0deqsz8c1TQjx6g/7Xv/0jb4m9b5tq8j/R0CADOAIW99wgAvue2/pvOewA8BuDKcHUAGCddkD9H0QVIToFbwa80dQHO9Bkg95Pv+tx2/h/wTxgD+kvk6x0TgyPAVfUpwF/TEvjDk97sDG2lvYJxgDh11VFDG9MZAK8Mah9Isy/g0eedCJRFufQN9w7l5dZ/4p77h1IPQg/86wzACYBdxhRjxzbQ9+zsub2feIfW1x7gB3TMCZBfA2AXwCt/8JWndgF4DGDXzwHyAsGrsDuFVYcXvPaDRzgCmGTUfrpG8eMJ2HGFnfAom6bFAcBEysmbNCelTujqZFUdJ2dT1IncrrROqo07EU/K5J24k/hKU1cee/Da7VF1x2gtpxc3L2nyUutAXF6qjvnStmk92muHMq4FfL0mPZk6mVfZGF2q2xs32ByT98rLsmr9My4v7dnqydA3j3zGe3mWymyn91OPqpNU+8jkoTWeafLZhh7vGMy03vjKcTjFmzd1kGV8Gx5g3gPn29jYVtc2JM3+6fH2d16XvIbwXm+fvdAOuM1nuj9TPveNXyQ9qc/q9yTrX9uYY1JwD9iXT0pfEbfPtEU/WcZE/1xkH1ztsuhEJl2CMMBOW7nnRWpDWAJwBcs4DAAvTAT5BB+gesmKfw+kC+gT+KOnPGnKe7Z6MoE/dgT957Hav6T/qs7aITCsCAMK3SWwjQMAR8DUMQDBf9I58G86ABPAXcHskrgvAARApwOAuEAf58ccb7rUsokDcCvAXxLvOQHa6vlgj/oJoBOcc9+w+6A5bOKYgE4AHQLGaT9BpwG85eq44H4CvOMAqIGyAf6s/k+B/3QCpAOD/ORdvaDuaj+cDrW78B7gB/Wf/fo/bi8zdAcAtB4DyF0AvASQowAeA+DrB/wQb135YZLA2Fw5AS5t4kIf4AD47vuP33FwzXbL2G9SLoM8NPlemjrtO85OopxUVerEdCl1ogYlT8bh6ftdA5Nr8vYm2chyUr4UWNQ8vXiWZ3qvPNOWgAp1d6HVPjaQpS3rl3Wv/K7XYUk+ysprVfklNhwv0l6ebFOWkfLkU0e+Z7fKbI9ybRqHVh3TevIq8z6Zus/QqfeUZdhH2lE+R23HLjTHm2Owjk3jpmce0xy7Ga+8+at8Lr5rvmpXO1l/+NpvVVb7v16nvN757PW5vHqenzyzeaKf7AY4jl3s/97vy3H9ht93601bsm1j41bQbz85fpOmHfvIcqIv7KOL7Y2rWhqTGlYBE/gDOgA8hrZ6uHphWTtH3HEKCP55yRhbQOeA/xKwDih3qz985jkL8Bf0Y49z/fe+9990t/gvcXykzhhfgf1Z4pSBg+XpL/r2m3/re59wxAq/q/1jtB4DABQKGpPu6gQAbAu8e5T0uvINEKcdp7b/DyBaML8LzfI9DrAE9KeOQDxl8M0JMKyi008AFAIgXHAOqKY9AG2B/RjwtwzurbzPkCNrToDVkRvsWUZSyvP6CfTHKE4b6kueDNSfh+hVfT4d6nV5PcAkxS8a6ASoxwDYBfCC+3/w1C4AjwFwfm+XFgD+GZv8NvFjvouNfeRh9R8HAI4AHByXWZczticnPuOTs5NJo/obDgAmVE6upDnxGuOX6OZkTt4JH7QHhjI9eXXrxJt4Ts7rBH4snnkqX8uo6b045SAfK095Ly8y21Fp1a/l1HTjaae2p9f32dfw9XoRrzo1TjnIanm9eM27TXysnJ6NLLuXvkRmeUt1q36Npx36deweU+61kJJfXqpN4vJjNOsDvzTUsWVc6hjv0dSB7+kskS1Z/dd+0uSXlKMO+TLQV8TH+qzX514jqddV6rN0Atz67D7jT8besufvzXHdht+Rud8S259jNGXy9gvUvoFO9A8Ns057a+R1MnSDbZas/gEuCIAQQA6gjADQh7ILIEEKesQB+gR0oKz4P+Eprz5i1YcX/PVW25fKKvBPsJ+OgHQIzNkW9EPd4r/LSn+C/KVAfpc8U7b96gLXiOvzlfe+/OM6BF71/C84dTwgjwEkyBc8Js10V/rnKDsS5pwACczh6RPGUa7+t1X01fl/dhYscQDkLoGqTznYAVRXML9rnF0FbL0HTNtvbsUHWAvQuaco15V+qcBfqlOB7fkE+oQ0KMH3bqQTIMuhHmOgv8qpb4J/+fZFgNv8gXidHt4XWVcmLtUJAOjP8MafeGP7GgCg35cBsvuL9wDs/DnAYYLAuGSMQvl0ZftBv8jGD2U97Rue9Cx3Abzkx3+9HQcYxNdh8pB17PHKehTZcRiuw3oiteJzkiXv5CsnY8rUSVr1jDupc9InrRPlqlfTM14n3zlBh3fynrS3Zbjm68Utq5fWk1lmTUNeZWNxyhxLQ24ZYzbNb92l9CF89qXXI6k8evLQ5NNGtWl5UuosL611Qa5MvleG+Ss1b+apvHalNT3j6kgzrfI9HWTKK5/56VPvlSlq/49dA2yaVvksL3nrtYR6Deu4JG+VGR8bnzl+1amys8QpX7vWpdK59KpPfKyfsk8rn9dNPq9zPkPXz2Wf1Se/Sz7TL/jXcl1cLf/k98S6lt+VbJd8tpu+yLi8upWO9E2t17rCtwVDJzGREvgDZgAZgDFB5RjwRIcAICEPgJ/A+X62fP7tH3tb+yY0Ez8cAIBsgfscOE8g74p/bvlP0K9N6ZTtBP3ou8V/rI09OW3uyXeVncWe/a9jRkcNcq8f/Je+7E0373nR9zzIDgEcAjgA6jEAwGGC/coDapHNgX/SsQV4d/t7Bfs1zqo4/cf4qw6ABPHpBEign3zqV55ykbH7YFfAn/mak2zlMHM13W34OgF0AEBpn0Cfe0Y+6doBMOjSh+ZB38A9x3UlPe3Lb+MEsN6Cf+lVOHN9WzyEr2EjmcikE6AeA8hdAPwW5DGAxz7lu2/yu7NLs3FSc395jz3mcV/zDiYCu9jaNQ8TDYC/uwDgr9lRAJvu5EeqHKosKfyp1X8nVnXClXH6rBdX7uStR53oOfmtE2TjpkORSU1nzML3JuF1sl7Bw9iqYc1X45TlxN+0LF/ZHF0KNiyvltmzP2fTetpntR+J08f2s/wczXzqaltq2VMUXdKlqatMe8bVybh81a1yy0q9qlPTjI/lzfzqWEepOsbVQ27/1fuGe63KiKs/Rq0v6fKVZvlZpym+jsfUrWm9sTomy/sUnYz3eJ140p5OLQudKts2nu2tfO1f43mNvJbI5PN56jO4UQH1Cc3n+mXz/p5YD+OTvy20K9ub47vKa3yjbwY7Q8HHZZ1Q6mI94G+Dv6EjAP6AC1YZG+gYVo4bCHvNv94a4D7lZ36vfXqP7fO81R8K4CfA14A8AX0F7YDzqfSefpVlXOCPjLKp7y6r/XMgH1A2p7OPdFf6AYSs+AsIx2zjDDCgi6MGoM5Emi3qgEABvsBfh4AUOTrEp5wAAt+2k2QFVAHNnm8X/APE5QHA1B1AS32knv9P4F9B/Vi8OgUsSycAZSaY34an32lfu39W9427Xtj9QP3pU/pXUA4FXHOvCfgF9FBlbeUfR8HwbgHypAMAHXXpL8rEZpZhOds4AainwD/p53/Ww9/Kj85t8EQ8NHHLHmAS5DEA3g2QOwDg2QXAin/uAoBnR9iuxwCoImOS8WrAeX3RAPwvft0rXp27AHg54Jbdd5nqOdmRTypPHeWhJ4GJ1EioE7Bt4k5uk+ZEWN5JMlRZpalT+ToJJ56T+h4w6MnIMwcQemVVWZY9xc+VRV5ty6e9Xv6ezLzYou8qtT9rn+8a155l2YakWaeUy0/lRaeXnjJ5aPLmVb4t3Sa/utDkrU/KkdHfea/Ac79VWcbnrtE27bM+S2iOwyl99dQxPkYZvwZ05HelY+Ugp06mV976StU3Xmnt5951yetW+Xyurp/F+Yze5C/z92au7JPflc06H8vL70y2O/l1HxT9Ju/ZPZbN1e0WSx86xxX/BjQG8LItaFWfM/6clQesC7ArTRDuCr0r+tUpIOCH6kQgT9rYhqcuTFChgP6xc/1joHmJ3L4Y08305Mf0p+TkZ4Vf0Ai/q02cAdrDgcBYANAKXAGP1RFgHIBfHQA4BZCTrwHjFSiu7aFMHBCA7U+654F2Lh5ATpx61PP/OgAS5FdgvyQtwb8OgF12AdD3DfTjOBvqyz0wFh71ul9qAL29P2NwCOgMgNLfAnmBv3SjjKGc1IM30GeUTX10AKQzAH6pEwA96pXgXx552259Wz4wb7Hn/56bw3b49oz98AOnHAA4AZ75vFe34C4AdoPhAPiyv/yoH9m1KkyEHK+OWZ4/qzG6q9mt8lEHdwFAmcxtZeB6KDsxo7byJ7Q30RpkOSkb4+m/muYEF7k8tDcxTplAyAk1afJjtE7GiTuxly4FEOr3qHZ75fVkPRtVZr2qfJc4tmq+rJf9hwxeqhya1+IsvDazfPip+lXdXeO9tmEr69Tjlc3RtFV1TUsqX3VrPPvbe8b7R6pcSp6x+0r76MiPUesInQtcQ3SkU/pzOnU8OIa9L85Cq+2si2nWPdOULaW9Ps1r6TXymtVnJfEGbOsz+PRz+ir/0vBb4t/J78rpNhynlbaO9oF6Y3Y25ZRf62Gdbh3KQOIbzKyWACAAYYAzt4lXoNaLCzZZPX/9h367AXMB9rbAHFBuHlf7AekEwD8TRSaNHB3YxhmQDgjsvvrdH1m/zI/624Ze+6Zku+absknaErtcK0Gfq/1zdpemuyvAcaCDAVCJM0CHAOA+HQDwbvUnDT3ykF+btQ69tjZnwGqXAG2jnW6BZ9U/QwL9yi/ZIdBzArArYcnKP+CcehFYdR8D/VNy+oO8OATYJbDeQbDagUPbdQJU2ktDhk3qpAOgUkA8IAmANBa4lqbBC6p0AEg5d32Wldtb52l6aEn2wItf8uLXcxygfg4QB0D9JCDPdHYF8DuUNrbl8yiA4xWnAO8XYPK0rb1d9N0FQJvaZGwXI5eXpzfpUSaldvDG5TepE64V7U1Wt5E56U3q5NiJs3EoshpXr1Im6MrqZN0JflLBhbKMJ2+6FNvwSWt5U/Fqh3iWJy9VX2q5xJM3vUfVm6oXfUc6tNf3eR2S51pmvMePXRfrY1uMS62T8Urn0qt+xs2bdZPfN6XcOZtVh37M+yR57rmMV95rgFweOlcH0nt9lLKL4HMMex8khc+AfqYbr7K0SzuIz7Un+wzdXh8pS1347Pt6jcaem+33xucuz+fkT57Xl/frsn3J+RtD7oxv/t4cp222+XT7+3mO66XtLOc45Vb7zwDiLG8DdANQEPhXcDYVF7gB/AHou4B+wf4SCnBndwATq2/5vrce8U4BXmrnuwVwCLhbIO2Rj/q96t3/815A/1Sf9NLsJ9KST90xeerIc60AxYL+bfJqYxcqgKe8tsuAcbM65844EsAy4W7An90D1HV1zGCsTOz1Qk8fPR0CgHRW6wX9S8C+ukmrA8A4YBsngDQdAgJx6kI9pwD+tmnsEAC807fsdMg+Rj4G+qkTaToAyJfAH8Be41wrQf4SiiOAPIJ/QJZAiy3Y/FDdas/KQ3t27IHhx/dd/+gXf7PnAOCTgAB+dgL4SUCOAXzZ459xk8nPjiW2bDgBGKOOTccn4xtn91ntz9UN+y97y4d8CeCc+nVNd7LUn1A58Sq0TlzvGNKrbC6ek2EnyfR5hgpY5uLm7U3SnewnAEheoIAs+dRJXnvQGtCrshpXJ23CU7blJ1/1do3XehCn36T2IdTrsg+q3Vo+7aiysbj1HEtfKtdOj1rPHq3jL3UoO+Nn5e3zvE924bUjnauXfYhe8hlXvi/as53jO+8H5SmrvHF1e5S6K59qx1x/jaXb39K8dlPPRp6lG0FAvEn9vfH5bfyq0an6mZYUfttAm9OGfaDM+K1DGVS9Ff8e2OrJAGACHrf5nzfwF8y7ik9cZwA7AdIZwNcFiOMkcIcAE0xWWBuAW60q99q2D5n9sw9b1Qa2c2W8pp8lju1t6l5BPXnbKv9q1Vrg36uTZUnR6fFV1uwPgBvb2kWH61qdAQnw5fOIgCB/iuYuAJ0AAn/qsC2w31afNupowcGSDgHiHhfoOQTIi0MmAX+PB8gDkJaA/9TpOQKwtX4L+8mD9dZ5eB5asnUPMEF6zy/8XPcYwAte+MKNYwA8s3kRIAB+64JKBs7+95wAjHV22Xz5Y578A0ymSra9Rdn9wDGIvRm8fENOiqTUCN64/Catk9Ih3vo9qJPWlE9NdHNC7CQZyoTaePLKpGMT7yrvTe6d+J+V9mzvIrMeABcDsgpkatx8Syl1Q3eqjtl/9vUulOub+dJuLX+uTlVfW1Xei8/Z1tYYpQ2kSSs/li/l1CvjydtHyoxD8x7ZhddG2oS3LKn1q/2X6aYhS311lKvXo+r0qLKab2ps1/uhxnt5sa+8lmWcumRAnnH4Xj+qU/vbazf2PPTZuUFPnsubz+Lj3xCf18ex6/O/1tt4jyLrBVqb+snbE8rG4sqvF2WAsQ2SFURXjgVRSyhACz1ekMcb8gHh2wD/3NovoD8L1RmgXRwCrP4ziaR9rY0DMARAuYrr6mimnwVQ2yf0S/L2Z09m2lieTJfHTgblV4laP+pUnQNz9TRvpeZrzoThmjYwvBqHqaselGsNOL7z85613hmgA6BHpxwApAn4Bdk6kbYF87vqP/RdHz/6jH/y8aOHvff//MRdP/VvWh9QF9/N4A4B2uzuANLpn3QAuPovTWdAdQLk1v8E/T1+7GjA4VjA9fp9OM/aAoTriwCJ//DrfqTtAuCZ7ScBeQ/AZ/7HX/Ez+6hPzwngbgCOJ/2Vp9334dXRlfqjv4/isXkedvdRt56NWtcazzym9Siy4zCA/MZDdwhTDgEnxnXC3Jtcp44T7aXUiT1UQCgI2IWmnbS9LW9dtGddEsgkb/qu1HLG6pn9mf29K8/1Na+2x8qucvSrzPhUGjr2q9R8lVqnMWrdx+hYvqXyMbvIvTeg3EMZ34WvZdU60jfItu0j80hr/oxXHePSXh12Hetj+bI+yVOHsUDfjaUpr/1r3GuV4H/2Oeqzd5P67PZ5bfwq0X3WTVtj9Cq1+3zrwmBK4A8wSMA0x6sP8Od8P4B7DvgLyucAPqB9Tmcq3bpQH/RwTAC0xtokaGygfwCKOgSkOg1It91jti5CTh10UOyjvLO2KfvP1Xj7TvCpc0XaHDCr/lxavnpQ7dAP9IF1SGrftOu32jbvuwdY9Tf0HADKdATw2UH4pOTnqAHl7Arkz5IP8I8T4CG/+eA6EK8OgbYrIBwB9EEC/eR7jgDAke906IH9KRn5BFfYNhyOBZzv8/26WGfFHdDP1v90BnAMgPe66ADgSAAr9G2is4fG4QTAGcXY7AXK+pqnPO/dD/2//F//73so7lY04SSKtiVvW5UlhT8JgH/i0C1DTn6Td3IMdcJc6dQEmzT0k6ov7YEKZAkOe2BBnbG0BA/74HvljMl0CkjH9JDbjqSVJ05/Se27vBZT1yivQeZJXpuU0QvWtaZZL+VzdtSr1D6qcu1Jl7Qldcy3hGa+7Bv5vB/Og7ecsbrSN6TVPlJuvhpXXql62luarr60Nza8nnMUG+poLyl1Ip601jOvG2m9flRWqdfR597os9Nnaz5z+zzPbJ/T8LfS37bt2lb/evUVExqAPwAtV04FS0sp5/sB1oLtpeB+CribtoutrAcOBOpGHWmPoHBp29AXYNddAq78Ikdvqc1t9KpdVs7NT70aoF2Vb9tqHvX3QbFtfwjwqUOCfIC+YB856egaiGcedFI/81DWWHssH6oONINtxiYr4YBOQC+Tel5EeM89T25bitlWzPZ5AXIeBdABAEWuI6BSHALtGMBQ57OA+V3yPnS1C6A6AapDAEfBQ97y60cE+8+dAj3APybTETAF+Htp9ViAToDDsYDr9dtxLrUdgN/333fvRxL8w9/30vvaMQAdADgDvvjRzznaJyBnIjXmBGCMclSAdw/we3nRnw08l74+f6NOnqSUKJ8U/nTYgxPAyTG0TpwzXifdmVZ5deskPif9CSjG+NRPPvVTPsVTl6l0bUL3ESwrbSGrcfVqX9Gn9mPt3xpXT2q6cajB8iqlXsqSV0Z+eKnys1DrlNS670qrLeLYks7ZzftBwFhlxHtpqdfja9lZ1+RrP5OWstTt8er28mWaeZEZah7llfbGSI7tTE++2rE85Nan0m2uX+1jr4PXC9p1APSer6dl/iL4bDZ+K9Nsa/K9Ns+l9/JcTRkTGCYyCZwESkuoYMsX+wm4Be2XQa0DlJf5AfrZkUB7BIRL2tbTye3qvCeAlwoCGJkQGthKDYgF2AqQ7aeezTFZzUPZrOKiT5q2cTpw/hxAqiOiR9t29EG30QGYrvMHb//UsomvQWKAfAG6QB4d7WprrH1Vrr75LY8yCDoGKMtyyGPZ5hd4V/vtegzAXqDJRF7gD/gncA1xCBDgkXE9WdGnf3EK6AQA9MNX8F/j6QygTruA+m3y6ABIwD/FN0fB4ARo/cP4WI0H+hxHSAX+Ne5OAeQ4A7Y5EoBjYMoRsI/z3VfzyXuo1VwPAOqrA+ANr3vFTbb95zEAnr97/3TfADrZjdLbBYDMsc4zgh0B7WgAQPXwt00POJGC7h46DgInwE6InSBL6wT6LPE6ka+T//OMJ7DYppwKYoxjQ36Opm6P79Wn9tVYv3udpGN6yqtd47061Halzlh/ksc2jun38iqzPlLrDbWN0kyb47E3p2O69pN6f4xRdEnLPFM8ZZFumVLrafvpw8ork5p+Vpr2ktdulRHfV7CMJbT2lfGk9m29Br3rt3YAbPds5fntczmf5T1Zph/469QDTKw508hkvwKlJXHAFqCEF/sBsgHbhF0B/1nyUib5PWrASj/1OivoF+y70k6bv/Rlb7r59Bd9+81XPf8LPvGOtzzs5i///EOODMSRGx77rMf8EQEA+fnP+LFPNIA10d/Yz74H7BuQC8wE8oJ84vCAU50AOAR2DdptTozVS/rgBeAJvrO+58nTN7S/OgWaA2KoI31LmnqOa65d67cAskzgAZ6A+6c+9ZtHgb8OASb5AGEogVXyXP3fxiGAM8CXBdJf2wD7Jbq7gP90ANCPjFfa2ZwuQ7/Tp/DsmhDsz1EAEtv86Wc/89jbBZAyHQECLEEWQOw6PVsPdd1fD/TeB+DXANwFEJ8D3PskhS/fjDkBHKeMc5wQOAI4urDajbD3uuyvVy/E0lj7q9w49GxhxBHg5LhOmp1M5wR7CV/z9Sb32wAI8i/Vtyz05c1v3LS0qU7KKhBOkGsa+pVPWeaptjMubx2lY/299FqlHXkpZcJbtu1IatoUndOv5Vmm8kpts+NoaVvNt4T2bKbMe2KMokta0sqnPXjqpaxXx9oPc/1EunbMS1y5sqRe85TtwmvHceE4N54U+8Z3KYs8tjOpfZoyefvZ60dcXrqlA4AfBZ/FyacM+eHvGvfADVYqmKhUsLkNeCMvYOQiPuU35VAQ9AP83d6/C+hPoC/YBzS6wl8B/7/4lbuOMvzB79511Avo4BzAMfC3vvcJbZLYQPUAslyFz+tg2V4L0hp4ddW+Q9tq90oOsMQJwGo18l0dAOTDBqCXAI8sy2r1GvoISj2zHdb/POm6b1Z1ALjSt9SHculLdADrf/Kzv6QBVwAlIFPgD/gH6NYVf9IF/6Zlnq98wn3NLk4AA320ZDdA7g5IZwB1XQLwx3TYzm9w6790bPWfdPK0/hr6T/AvKH/sl31xA/D0EQ4s+5w+nXpfQDoH6HN2WmhzKfWN7DoB9r7Ce40f4rdb1b/ju77tg7kTgGMA7ALQAcAxAO5TJlLn0Tf8Zo4dCdA54LMFR8C3fMePrp0B5MUhwKTsPOp2zW3m5FIeun3ogH8mwE6GoU6ap6gT7B6t+VJnbOIPMMi0jCefOsmrI800edOgBtJ6vLIxOgV0luQZy29dpdl38LVvp+I1LzaV2W7L6dU5Ab186mlD2VibSFfX8qaodZROtZG0np4yaOr05D37eT/swvdsVpl1G6vfWB/Zn5me7ap86k3x5JtKN21Kz7EgNc9ZaW1T9mWm2ZeZ3rt+a9Dv83C7Zyk/Jz6Hr/lPyx03LuITvjt2Uu/3bUdTS7INg4EVfyfxFWguBWrkA4Cwuu6q+xRAP480QT/U7f0cP6BeABTCXHtoh32APkCflX3CPS/6ngcB67nCL9jvgfxtZNjRGcDRgbaqOgB1gbUAyxX+Map+pegLSEkjzDkBqEPV6YF/wCryGsxreTo2dAzMXYuzpHMN6TOAKyHBf1u9Xr3Ujsk5q3SA+Gc+4+lt1X8p8EcPR4H5mOATkBM4f8yKOaCYvsljAWdxCNiWBPwPHc72G5eH9oB+T1YdAb4UkGtHf9GOMYCuM6CB/6HP7/6hPzrejTE4nHSwJPDv8YClpccD0CNw3bh+hMNxgCUP+1tPh4kOW/91AvA1ABwA+TJA7sNzdRINv6HYX+IIwHmFQ0JnAA4BAjvucL5z5K5N1PZ4qeijRe9BGNrR9Aba6gA9/786qRyLK08Kvzxku4LvTZZzMp08E+/ehFt56qpHmmAgeWVnpT1w1LOpXlJ59YlfVLBMKX3TC7VPl8TTjvZ7tLZVQN8D/1V3LN4rpyfLOibfax/pjqep9CmdXr7e2EfG/Z90TC/lPfspsw3Kss3J9/qqylK/8lV3Lt7LPyebszmWjl3StF/1lPeo/daj6CvPayLP9VyHbZ6ZfdDvM/j8fx3Op4Qb/FYT2vG88yljymqv/45/x1bXievWuV5TNrdLY7DgBRH4LwVbgmgp+R71ul86+ts/9rajB/7hG45+95+98+hX3vczLfyzX//HRwQ+qccqPCGBP0A9wy6Og8wP6H/1u7d/kV8P8CfYf9sr7rr53jd+aluxB6hvA+y30XVXAGVRJs4GgBdAWsAvmIamDF6Z1HQpdnIXAHqC9CUUEMtWb2yoX0H/0rj5qcO6vqsdA0vH4pSeq/5s/Udv7RAY6i5oZDIOUAcwEHACuKoPJQ0ZQVCvHOAv+E/Qj56OACnXMEPPIZCr//I4VuQrdYeAfcf9iAMA0F9X+yu478V1CkDpL8cM4J82jYF/5YBxQTz6zfEyOGFwBjQHTByz6DkAlHFtxnYFCPp1FHB8AF3yUjZbsttDc7tH4UH7mvcAP+I6AN74E29s9zJfAHAXAPf2vj4HONNVbRfd1PsBGKc+f+AZv9w7ju2Vo6I3QZgpejyZowcve8uHjr71RW/8DXh3HjD5BPATOE5Beg3ojFs+15ReHyiTUgH4GpRLT9JXE6z15GoVd6Kc1Ak1FHnGl/BOyutkvk76t4ljaxt9dAGqvTwC2Jqm/DxoLcu4fbSkX9XxWmVcHqrNpJYnnWrjmBOAvOSTakObYzTrUfms9648Ns07xpOe/SYv5b6Ar/eH8ZpmvqTWIWnWJ+XytT+M175ULiW/fI9mftORye9CzZ+2K592TUsZvHZSnjL7plL6Gpl9nunKknrt1vT08/Lk+cgT8wT0I+ev0mPpidz4daE3HvWUL3nguc99Ttt92uaN59+WG3nd2rU4LvOk7+8+vvdyPHidV9fA67B7P1MJJhkCf8HvFJjqpQH6n/b2Nxz98M8/6cEP/y//6dFYeP+vft3NGt7za688MuzqLBD44zTIt/f36qqMttYAcHI7v6v7rPADwNmif56AX+dAAn/Av84GjwjgjBCQCZiTkiYQVG+M1l0A5BOMT9Ee+Ed/KeBfqmcd1u1ZbePnOqXTyWtaKYAf0Epgpdzx3d4PEOCfSThgnt0WAARAq+AfXuAv+DeNuOAfim4GQD9gX/CfVEcD9AlPefV6dwDXBIBPHwHsDT3QX2XE1afvWr+tjjqwio8zQHBfgb9yKMFVf8cOxyYE+FMU8AKQEZinLn2hM6BdQ94XMey+oP8F/T1KOsBIW/ACJWWCJsoWSB12Auz+23Cdcz7p65/0Vp0AnPsn6AD4my/6sXavr350L6SZgGomFqwyMDYB+2MBHZwG/PDvuXI3eJEvoB7H+KveeRJwCBjuf9uHWxpxXqD4gtd+sKVBcRjsuU7bmhub9Dhxwp46PZqy4zzDRKuNhUJz0jzF54R7KZ+TujHeyX+lY/rI0VW/6pkmFbQan6LqVjqXRzAsndLP+s71o5NnJ8Rj16dnJ8vJPsu6Wd8pmvpzfC2zxnv1rG0b0zmr3L60D7kX5KG9e2NMlvmSn6sj/aFO7Zsap6+rzLxJq04vX5XVeLWR9uFruvG0k7zpu9Isn/4lnv0sX+Vj16vJK/A8ic89S7d9dl9V/Rt/7Z4n/tK/+oN/94l3vPMd7T1U5/T7a/tvcH2YE3zmX/r6b+Q3Gb5eM+KMnTZ3WOkQRx7XTZvbUQaKwN8txBU8LYk/7vU/vQb9Atiz0uo8SIcBjgJ2FhB0FkDf//73Hb30XR9ouw8SGFaAT5tIp825nd8t/YJ9X9p3EYDf/qKsHvjXCaAjACcL7xpoK6krsA/QMwjYKiVdkC7wv/PzntXO7rOKbzCtbeEeAJpgHQBIII4uegL0pOqfN7VMwH0DukNfcF0B91DktIF+4roL/rn+zQEwyNu7AIbVaHYyAERZRQbc8z4DaIJ/eIE//BjwT5Avr1OAOIAfR0MNOgRwxnmtbGNSAf4U+Ecn83zSPQ9s9JH3CA4BHQGAfuIAf/rP8UP/AdwF2pXmi/sA4YB1wE3PAZB5dQasr8fqfQFTzgDSBPfaEvgLqIgbAFPDk9FJ/3YPyYP2te0BfiQ9CvCC+39w4xjAc370vXv/HOA2HcXkj1V3fn8z4Kzix34bW1vqtq2O3Dc4RF7y479+BNg36ABALg/oJ+A04D4/5/pt0xzvaSl55SvVbsrhT8LdZ3MCOPFeQhmbNZwVEJAfm3N2mEBuGwDB2+ZJfUF0yuR79a19Mxbfpa97/WRdpuhYG+b6prZvqi2mTbVLHWnqKktKesYrb3rakZ8Fjdwz3EOde0cblGcZteyxeF4jdWo/1rh6lVa9pfFqZ0kc2+iNlTGXVtN7ZdqvS2nv2qyvWT7/Tvghef0crTzx3p/P1V7adZC1HQA4AI6GP3aoc4yXueM5LCA18A/o//Tn3v/qu17+5rcR4HUG6BAQ+CM3kMZzirHRru3mtZrvawaOW/2Z5C8B+T0dVvsB5oLXi6bVSQAoJjzrtc89ynDPa+4/Wodh5RzgTDq6gPwE+hcJ9u2vBP2s8CfYH+OpM/VnhwLgrAf8BZCAcID6nV/44iPAPgGwK+AF9Bo4n00ASAniWGXlRmD1ikkrDzcGIcFJLOdU2VL7H33xf/0bbmdP8CkvcCW+D+eAjooxipOCctI50BvLyASha6fBkBeACnD/2r/6+PWOAIG/5/wF9lDBflLTBbuAe4G+NPWRcU11UFCfVqdBxv1KPQmAc0A9fWm/Vmq/Qx0jlWLHPtGu/UW5S4A/Y8QxU1fvcxxNOQQoh/Jsd3M+TewMSFs4BLJc6uLuAOgVAi3zD+iDxt56gB9vdgG88gdf2RwArPy7C4D7DPC9t8KuiSGe2d6r3BvteTY4A77l+97aQm75510E9BNOT/Jc8f6qk1DjJyD/+BopJ5ZpJ/wEoFk68UaPSVrSzNub3M/JBBhL9BKEoJ9x+DGwa1rqj+nOycfAcdqG77XHvjLNuBS5/BzVRqW1HnPtGUvHjmnVZq991jfbkLzpS+lUXtOgBuwq75XRBY3eE/WeQY7M9BWtdi17jtb+sj/JJy+ds1Xz1Lh2Ku3ZHeuznq4y7Mrvi9Z+HYvX69Hi9dqdjvtMhPLnM1G+R5Fd+z+OAHzsY7//cRwA/OEM4AXCzDP3eiRguD+Yj37mE//b59z1hve872Hv/ujHCHf97K99iPjaGTCkN9APzbDaMcDYimu6qP9vMCECgOwC/F09vWzgL3Dehgqyk26Tf5+61gGwPwb4fceAtDoCPAqAA4BVZEGdwFqwL9AX7DOYeUEb21sITP6Y3KmnIwDAD6BnssiDa9HoUmkY4OTBQYANVtLrzgLBfwLU5AGy6iylY06AKl87BFZgWvALzd0ixLlP2tGYYddD20kwrFADVAHs9h1tEyiTVgP9i467J6DagGq3Ad4hTRBM2Qn4rad1tH5cexwBc8ExMkVbmYNDYG7FnxVExhLAe2q1PkG5vODc1fukgnr6rPXN4PRY79BYfZ0BO5SpbgP4g0z7plM3dAhXHLh45xzo/nvgxvffd+9H2AkAkOU9AGxpxwkAf0HvAdh/q85okQkIz3gdAemk434icP9kOs5dJptnLHqX7AnYa37TelQZeeSnKGnHYfgNa5OrhXRsEr5UnuBgLE/qJK9+yub4CniITwFY06Cpm/IlfK9cZLW+tklKeo9XVqnXrsqNZ3ljdbKdU+lL0rKsbAd1qXHr16t/T6Z+Um1KM22Ot4xTlPvi7hXQ9x5JSloJWRZ12TbQt0vzWNaUvva8Zj1ddTJN23M082zLY5s8lmH+jMvP0Y3rkNdonq/PSZ+VyKf+lupN2dhH2snze76tp3SrA+DYDXB0lEcCeMadsaLt3D/AHqAP8Pe4LTtvP/13/uXHDDgD2BVQQ3MGDPmpC2NhqM9s/zfg337AVy9AE0wsoQ+579+2FcJ73/x97Vz/PsHw7WBrCeCvAL8Xr84A4r4UUIANdes6wIdJHkCfHR9ttZ4BzIN69YeMSTABLxegnYeP6fugDFIAGONPR0OlayfB6u34gv50CiRv+hyt4L/GyQ/gBhQLtr0nBNo6vlgdJ80VeFeqoeSVyhM3NGC9AvTJa0s6VfY63wqgU2/bn+1yLJBuSNDvtn7pRtrK4cHkPwG0IF1gsC3oT3AuL+iwHMuodO0MiOMB5EGPMa49KXa1TX0BMdwHq4flPob0wcY16gGeabwI0PcA+DUAKM+koSmzP6DXqLnbVPUGvw3cH3OB3wcmx9sYP2fdpdcs9eAzWEV1Mu2EL8BmY4K9Q1p7Dq3ywWfQdsp25XsgQhlUIJSUSaXx5JUlzXT4uZB5sx49njYj36bt9l3Sml+bvTKRUUfTsr7yNS3j8j1a6zEVz/rLpz6yjC/hqVNPL21Z1ppu3isn98OYfKhXu7+gQ8jyLL/XN/uUUea29vKa17zZhuRpnyHl8toxDkWW8eSn0lKvx1uPU3TsOvXlPAt9DsLnX8rlpal3qbyLmrtS3uWVOwB0AEB5WT07fplvnuFIAH12g/HWHACs/q/ex4UTgGO4n/Hg0TrgCHBHgMcE1rsDBgcATnzGAzb7HT8MUoAXK2kAEcHFUirwYcWf7fa3A1g/axsr2B9b4R+TJ/AH4M+F5z/zITcBfFxjJrNsxeeaM+lloI0Pjv6QOVfpMB65eZhMAvg9jpBHEqpjgPjaOTC0E6Ar6E2HAPySXQMJlHu8thM4c+8I/r130jngfWJa0tRLubzAHyrApzxW4KkDq986degHQq+PlKnDbgLzNxtD3B0GxEkT+KcjoPGDE6ACfFcCBdnnQRO0VyeAcXddMN4J1KvWpecAaO0537PV53rrHIyfrQd4cd0LXvjCU8cAGE+r5+TZCrjGuXkmuxug5wi4Rs6znAj1eGVJk+cqEh8Pw2/YqYn2Bct6IGAbmeAkKffAWcIY+MdmOgqIZ7mV36YdVdfrglweWvUyXssfi5NnLE35mE6Wl3zWcQmfeffBj5Y5Nf7n0ob+1u5YHef6i3TySnv8WFrVtQ6WuZSar1LbBiVNWvUynnVNeY+fs0f6ojB3nY5/r3zO+dzr0WPNY3vyV5K6IARI3yVMOQBwAnAkgKOE2G5HArgW2/21XTQb2//j/VsP/4NP3EwHAPHmBPBoQB4PWDkAGFtDFfI6HteIld2zbPVn1Z+X+x2A//Qn/irgTwC/Cz8H+E1/zrf82V9mVV+gz8NkNRC2G5KXpE19GaPcSDgu0hkwxgtykybgBbwDbtMxIKBP2gP+S2Q6BaACZUC74P0UmI+V+gTjCchz+78r91LaBt+Ocwzvb6h1zDbBe/6f9rcdDUP51FOgn3XYKJeVdRwNg9MBXZwTrLrfeeedp8B1BdvnGQeMsIIv+M8XDcLzIB4rXycA+QnXCMRc0h15axfL84ajABwDyK8BcJSH59Ct3foFrRsmMzyL2VmTTgDuGwDcAguXqcIEKP8ynjw6xqXmI65Mfhmtk/KTCdnJueiUwdc8Y3Hzmb5F3jYnWOWDr6EHhnZ1AgjydQT07PTKU5Z1Q5bxytf0O+ybBbTaMq5NqfIldNs829S3jckF7Vpqk/ZM6jredqWdutY+pL9qnylLuTLyp7zam4pnPnntjtEpe1N9N5VvLA17pKXdqptps/z8dcvnHXw+44yrc60o7+n64df9yE4BYP9T//2bjv7wj/5wWIOf/uNIAGWx02CL38bWz1xbMFt7+d8A7Fn5r8A/nQA4ANZOgJUjoL0scHgnAHYYw6truHmtWgGrLcuuNi6hrFjyOT9eMHfW1fBbMb+AH8oqfl3Jr/ElTgBBfY/yRQLAvqv6/sB2L/rmELhWMQYyA5p2skNgL06BATwn0K2AOeMVXBtPncpXR4Mr6wBtdXvlo2dAN+3IA+blx6iAv1L00wHgCj/0U7/tN9dv9keH8rOOzUkwPDdwHo6B64uWuzPAbf86BIj36iL4h+IkwAHAw/pa3RCHyu69BwD6nPvHCeB7AOB55uy9sGtqkN8XHAEA/2sC/sd6mgmXf/LSlCtLKo+ePHS/YZj8dyf0S8oZyzsjr+CC+BgQqvIeqE8ZYyfjPT5t9uqyi6zbh51+wDa6u5Rx1jyzdeSaD3U7FRwLqzTboJ5xqfKtqeVM02X3w6qu1mGs7xgLc2lTOrZ5zMaY3DE4lt6T25YeRV+5fM9GlZnnTNTrdXdbjV7yfKrXMOPw/vncI558L26eS6Vs0b+ovx2OBLT7m7GXDoC67T/BP7y7AOpLAnkPwKQD4Ite8IFfWQL41XEb88t+4e8ctvr/7smq/xzgXwLwq04P6CsD7H/ZX37Uj7Atc+Vdqjffpd5kF1h4OyvjLoHesYGxnQLK3Sngiw2TuroO+BWsC7QB1Mp6VL2krrIvpYJy9H2Tf9qTT0dABfo1bh5orUcD9ivHQwP8g3PE3RNS5OSjbuxmAED3APZlytIJMLf9n3QdAAeQd4F37hUu6ju+69s+yKq/XwNgNwDPlitc5UPVlvfA0t9K9NSdoplmnt3o8gn69va1DV0YKhgRFC2hPWDfk03ZquXvGu+2N0HRwv7o2jlDXtozaZM6Yt+6VlrTiCuT3xetZW/GufvyPhiLn4zbTr2WXF/HyxLdMZ07diibcrex1yujyrCHTFrTM75EJ/VHx8zmdavXjOvmn9fKuNQ8xq8VvUgHAI4GjwSwILXgSEB7+R/PSc7/s0APqJ9a/dcZgA7vClg7AYaXB+IA4CgBY3e4SJvXDeAosK80zyTLo3Md3+x/XjsMBP29Ff4K5pfEBfeVuroP2Meb0x4E1+qWu+DKDg9UHAJM2AX529J0CvjJQ0AlzgHS2hv7ByAMYBZEJ7Du8ertSqccAL3yBP46J9itwDEBgDxtSEfHEp485GVXgm3gmYDsrMcA7Nes21kcC4B6dwCM2UFOSAcA99cFj9ZDcVewB/jRzGMAOAIODoAreKH2UyUnRpVW6zV9STx14M8rUNcsy3i/vOE3soEF62N8hDLn6AXB2BKa4L+n37OvrNV1qJvxpdR8G9Q2T9GhrI08U3Hs9NLH5D1dZVN12jZNm/ugm2U7tpKO8TkmT4/FibotvcY9vTuKXXWqvBdXdwndyG8fWXaNK983pZxq07KnKdeMv7xGvXhTCr2xuPIrTS/aAeBuA48EsGOO+UXppPU1YNyBzfMLAOfiAKASf/HrXvHqDF/zlOe9+wuf8dPvJPyVp933Ybb4Er70ZW9qb5IHnAJm+b68QQAMFRRLzwt8X4Zd22R7l4D6MZ0K8omzqu+ZfcF+89xwcx/+duoB+s/jAts6AdQH+LJCTODmxYvnOViBM8C1ncnv7BQQLJ+V9hwAgPwewE8g3cD18Gk8AW+PAoJtyxRtuwKGdwD4HgDebfCIe9/TdgBg11V/7Bm3PGQZlJsHRwtlt74c+rGVBR12IeiwQEe75utRyhlzAFiuFMeO17b9kO400g6ZbrUe4EWpHgPAAbD6EsDyZg7PbRxKPMsJbZfSEEdGABAtN3bQ3HMPOOGaMquOFF35SntpKUu+5iW+baj2qk3S829b+6dBxQpkTAGjHrCfk03ZI609k1dlJz+Xz/TM0/ht+5qyt80zpY89w5TePtIsp0e1X9OU9yljqjfWUiaPLn/Gk8JvhlqPVdzrOEbv6ORDtydfIjPvNuWdakttm3HqCg+dCqk/pWea+tN0KHp9LSpPfOzP6zaWfq3kl+UAwBHAkYDv/M6/0eab3d2mw/XkeQk234sDYNFXAOYvX9uWQMWYtFA5JjNMamgEL5ljO7oAFnr/8z9t/Wb6BMGCZ8F0pZcB7MfKtG7WGZptWcJXoP/m5/2JI/uJvqMf6U/6dv4yHDTO0gOMXZ0BgEwB/hRlpV8guXHDDjcq1w2ZZ2EFvQBLeIG0K+cAWsG6K/bVKeCWf2mmk4f8rOQDiivItzypOxcE1sqTqqOMuvYC6YL/rBP1/Nyf+IObOAnzbfuC6wT8U7z69h267rjgGmw4BUrbzZuOAGSAeq4dfKbVeqDH+f+2PessA+yQ95bqAe5vjgHwGcD4FODiNpL//e9/3xEvDmLS8dSnfvMRbxAm8HIgxiYORX4DFhs9KJ5XDzjJlfbK2SYtdXu8MmjylNuL92S9Oiqr+sqhpC0LAowOHQNIVd5zAFSdGr+jU54ydJOveU2Xqru4zUv7hp7c1D2WHMuSX9bXm7Z6eSxP2tPpy+jPefvHwHRej/L9ozz/xvhM79cvy6SuMyGvrbx0Lu8u6dgetZ9135av7ZzKjy7p5lFXufHTlP7Pa0PcP+VjVL2k6qbs2vCX6QDACcALBO976X29dwq1a9tzAMy9A8D3AKyPAAxfAmgvAdyTA2Dbi7s+x8AkSGfBnKPA3QUC6wTegnEpoB1+DLzvItd2lrsN6E+wPwb020Nk29486O+9B9IZAMA0pGNA8M/W3yUOGnRwiqEPYHa1WoAqTUC+dg4MoLbtIFiB2wZ4A+gmKBestzICsFdHBnnUrWnEKcN6CrgF3eaTogvw7zkmOAbALgD6q4LrpXH7Zk6f+hmsm5S82oHqAECuAwB5lgHwP6z+7/32umUMuguAlwJuvQNgmHQ97Rue9Kx/9uv/+OhX3vczR2/8iTce8cP/3Oc+p60CsBKAU4Dxx8snD46ASxk2c5NZ06VUUr7STJtrjHlrHuVzNPON6VoH0tVJWfLqzFMByEAFRkn5HSQuzbQ5/o6wPcVP2TmV77jtY+2iD+ybMR3lPV37sEe128unzaW02qjxpXZ20cu2kZ8/6XFs/L96PYqsHxaOg1PXupfPMkyrceW7UG1dPcoVsc/z6iiTZtptwV+2A+B9733v+1fvbTvd38MY5LkJbs4dAGdxALSyGNv98XC6DhcoaR4PdxWwLVJnASurPYcB5+EF2ksdBVPOgAr6tTlFLT9BPjsgqDP15+JxEa9ih1/gtb02RXnDcf0A7zoDWKFDtktDsMlYYFUZ4ABIdbU9QSq88kpbngD4OgF6YL4na/qrbfUtfTj/76cCK20Af+UwECADtOF1CuCg8KsEHAEg6BCgzyq41k6l2kVfYC7Nvqn55uI6BqAAe3duEE/72kHu6v+u13mXsXHIc316gB9PdgHwEsAdHACtoYAVHAEf+MAvf+z/+P0PN2fAG173ipsvfeGzmzMAh0A6AvgdvD49dMvWdOkEealedlTmka8UfWTKx/KnfAmf9nr2U6auspPVxwKWpgD5XNodxdZGnPaPpGOXNOmY3qoPT9pw0qfZPvquF+/J7GfTjPdsjKWR19DLZ1rSJXrqZL5d+bQlD80/bPs3xpsuXVafkevevc72pXmML6Xmm6Pz9mij7ZOXKj9vanlQ/ihvH3/7srOPuuxs4zIdAK993et+tI3ffu3PZQcA+HqizH5NrrD0lNOAVVecBW6thwLOBepJe8De9JqmXLuUQVlM0JgYth+eK9xRh6rt1gNcW67xPq8vN2EbO4NDwBXrDcC/Avo9IL+rbBsHwIZDYNgdkLsHBNYAZ3gobQD0u2tBUL2EYqMH/hOkpyNgih8rLx0AgHz0sKN+gn+2Ye/zWu826g65rmoPuAtgDy8BvPHoRz/6q178khe//qMffuCInQHsAsABYNARcDgacGmjoTfJTdkYv0uF01bmr3LjUnWNS5HLS6uu8UrRN88UVa8LzHmO9kKbgA7gqj1nB2p8kgqk0IeHbhu0cUJtt22sceVJk6/6xE03Lalp0tRXti3t2agybJ4lpD34Xf9sG/nle3S8rlzzs7Vl3HbPrmPMtPnye22rsmxz8lXPeNZZ2RTNNHj/LMt40l5aT5Z5rj1/GQ6A3/nt3/5fv+EbvuGbZztvGGsuiPMG/7uGN/nzVv9tdgDc9bO/9iHybXwC8HgMzxZ/qyi0IwgeP2B1r76j4PnPfMhN3lMAFeC7ig9QW6/i32Ydd6sMgCvdjmFMNSfSascBYPqOhz9mffZ+V8BvPncK6ABgFwIBAMNK/xrsD0C/8dKxHQLhEABYC6KXUoG3wJ/tztxj7JDg3qRuyAA96OoIOAvFDsCfXQBQV/rd8m+cMrnXr/R4OVTuUnuAH+Q2Tve4Ms8OIX5vGI9MSHQASHlPAGP0cDTgUi/9RRSeE+7kKbvGd6lPtWFcOleOetB+YI501oBtbIyVoXxJOeqOU9qcf7axJ5tKS/198ZbXo8gyWKYy4j1e2Rw1vxR9+RXbjc/paKdnY65Ol5O+ZCwe93W23XZa50yz7aljek9fvdSR15Y0dcd01L3t6UU7ACa3/G9ejfYMdEfyTg6AwVmQDoA1jj0Zq5sl3qYxbzjpbdoNh2ZfiR4Yfmw8LgAgdeu/gH4b2vIO2/7ZXQDgr+AWMMNOFrYzbzgDAP9zjoDVJwQroAbYj4V0EixZ1WSFiL7AQaBzIB0E2MAmAL8X0mmgE8D69ihlXYkxcKjE7dgDNxjPOKkE/pWmI6Dey7djh93Cba6T+GzqVFrq7cKn7eSxZbxHkZ2EJcBcncy3C5/gbIw/bTfbA8+f7TqOncSrPHV7aZmuraSZp8crk5rXeFL4GtBX1uNTVvVqmnHovv8oO/+MJ6088W0C9uf01ZHO6ZuuflJ4/tDJv4zLS9WrceVJx3SUSzNPj1+q18t7S8nYdXdRfzNb/mu/NgfArjsA2CXAboG7hhcAth0Al/QCwNqoQ/zQA4ce2KIHeAB4XAAQD1ifcwK42o8DgDxLzhH7ngK2OHcdAiM7AvJ4gO9LgFI2AWcAwIbVSwMgfuiCff0Irb9K4nEN2ksA0BNwHhjSgQDYom7I6OctLstB9dADe+8BQD0OLb4KwMTEcHAE7L2rz2Kw99zqyc5ShnnPy672oUvKUKdS8yPfDAL8Hq26+4qnAwCbNU5tj8vq0ZTB51+v3Zk+xZt3SmcqzfxSdOWhhio3PqVb08yTFD7/zIMs+RqfStOeOtKenDTT5aVZ5pis2jTey1ttGIdWfeNjaaa3jBP/zJ8qyipNm6ZlvkxXPqZn+m1NH/O4r3nHW9785nfuGj72sd//+JwDYfGW/80r0XUAsKL/Gf/k40e86X8qpAPALwAwP45n4mZph9ihBw49cC164AZAAdBanQGAcY4P7APU6hCgnFPHBcIZoLOBctMxoWMA4D306lX7EbpB+1ag/6rV7VoMwkMlz6cHcFzxhQC+FFC/EpDvCIBnRwBOrIMD63yuxcHqZA/w3PTZKX+angbhp3WO7VyUfLJRkUh9xv6m0sbyLJVrW5r5lEGTR2ebeOomn3bg/VPH+DZ0m7zqzlHKH9PZNU17ts34GO2VY95Kq43MW3V7cfNvm9bTP8g2e4C+3TmwpX/KAUD6jotL6yMAzAnyCMCuDoBWj+Pn8WYPHGKHHjj0wLXsgRsAbAA6q+0A/3MD3MODo62sp+NhcARUB4DAH1Cy8jZey449VPrQA5fVA3jqX/KSl/zAu/7RL/4mXwp4//vfd+SXAuquAOLsGOBIy8ERcFlX7JYvVwAitcHGk8LvGrDbyzsm7+n2ZObvUWT8ka/+Kau06p01rv1qR3ml6iHPtOTRybi6VZa25M+TWj5lJG+ZVWa8UvWXUvNP6aOjnrSnX9MyH/qmS3s2xmSZJ/nUH5OnzoG/gB54+zve/kDPAfCHf/SHD/IbPlRh12u13gGQDgB3ADz8Dz5xc2wHAGkPe+//+Yk8/48NFr3OUJ8L6M1DEYceOPTATj1w0avZgBSdD37BACcEIKRtNdqpFYdMhx449ED2APfSc5/73f9PvhKQnw3kWEA6A9wRoCNg9WOfpg78oQfOswec6ELnAvVIfeM9mWljdKos81S7yPPP9JRdJj9VH9OWUHTG9Gyf6cYvg9Y6GJfWOilfSjP/WJ7U6fHmM824VPkYVU86pjcmn8o3lTZm7yA/ew/c+Gv3PPGX/tUf/LtPpBOALf+Pf/zjv+6M5rsOAM71A+51AFSKU+DgADhjzx+yH3rg0APLewDnQ3sp2WF70fJOO2geemCLHuCFmHw6iLOKfDaQ8I53vuPo7778e085AnJHQPvU2hblHFQPPbBFDwg8kiaPqV68J0tdq9DTS1nlM96zp93rRGubtqm7eXt9kWnb2DxP3V6dlFW6bT3M38tnmhSd5M3Tk5l2UfQq1OGi2nrVy7nxqKd8yQP5HgB2BOy45b+2tesAYFUfB0B+CjCdAPA9BwDz89Vc4DB+ak8f4oceOPTAoQcOPXDogevQA/yQsyuAyQaOAHYH5BGBxz72se1YgO8I4CWi16Fdhzpeqx7oTSSVQQ00qvLKoPVPXSh/lfZkVSfjyWde+Kk/86GT/FSeJWlnsWXepbTWveZbUt/L0LGec2X39FKWfM/WXHovj7K5vHPp2jnQ69sDawfAHrb8116YdQD0gP/GDoDhCwCHFwDWbj3EDz1w6IFDDxx64NADt0AP4AxguyHOAI4IvOcXfu7opS98dtsV4DGBpz71m4/4AsfhM5e3wAW/3CZMgZqaZhyafLagyo2nDnzK5Ss1z5jc9OtCbQf1TX6s/lUn42P8mK2rJM+6T9VrSi/Tkp+yt23aedndth4H/YvrgRuP+6b/8l/8v3/91//pHrb811ovcgC44p+09wWAeAHgYZzWnj7EN3qAAdIGX3uJG9u6IzDhrIHzpgTlTX/D5CFy6IFDD5xDDxwe5ufQqdfV5KMf/eiv8uWB7AzAGfDKH3zlEY6AZz7j6W1XAI6AdlznujbyUO+r1gP1GVTjvfoezzF6KSdgt9qp8Zp7LF25tOa7TnHbUGm2wbSUyU+lqXMZdEm91JFO1XOJzlT+Q9qhB5b0wI3/7L/4whfvact/LW8vDgC+HsALAMMBUMs5xG+zHmifQGNQsDWUAUz4sr/8qB8hPOdb/uwv7ytgjxfFrQfgyY/7bdblh+YeeuBceuAw0TmXbr3+Rh/5yEd+8Ytf8uLXf+ADv/wxjgj81H//pvZZQXYD8OnAc/tayPXvukMLduuB3rNIWaW1hKl008yT8eRNh47JUyf5bfUz71Xgrb+UOslLr0I9z6sOY22s8hrPfjqvuh3sHnpglx7YygHweR/9RHv5XzsW8E8+fsTLAu96+ZvfpgPg8AWAXS7BLZKHlXlAOJO+xzzua96xL4C/ix2cDTgeVqtQvQfyLdLrh2YceuDce+Bw/5x7F1/7Am7gDGBnAM4APymII4DPhh6OBVz763vZDajPoBrfpX49Gz3ZLravY559tH0fNq5j3x3qfOiB69gDkw6AzxhAvqA/KXz9BODhBYDX8fKfsc6CfgD3LkD9ovJQPyahq200hx+pM173Q/bbqgcO98ttdbnP2NjhKBfHBNgZ8K5/9Iu/ya4APh/IsYBz2sZ4xgofst9mPTD3PJtL73XXLnl6dq6qrLavxq9qvc9ar9rObeJV96x1OeS/pj3Ayvi+nOB7Plp3ygHwhc/46XfyFYDP/Yk/uPkXPvjHNwH7vbDhAPhLX/+NBwfANR2cW1b7Bt+MZnV931v5L8oZQDl5bGC1bWXLbjioH3rgtumBw0TmtrnUe27o4AzgxUU/9JpXvZ3PCeIIOHwtYM99fOua6z13qqzGszdqWo2n7u3GH/ri5Iof+uKkLw7cOfQAeINd0fsw/aSvf9Jb92FnZeOUA4A3+t81vNmf7f1jDgDkOAjQ63wBYI/VO5i6Cj1wA+8OW/vPCvp5myWBT0hxRvSLHvnIFu76vz365i6B/NjBHp+j+lvf+4SjVz3/Cz6RYaljoewSuAr9fqjDoQeuQg8wQTpMkq7ClbjGdWC3GM4AHMjXuBmHqt+aPXB4vt2a1/XQqkMPXHoPAP7BJ/wGnqUyLFayo+4sNkreUQfAl/zQR/7XsV0AOABITwfA4QWApWeve9RtKz3QnwC7x//ci76kAXEA+df+1cefAvl/8rO/5AjAf8fDH9PoLuDfPD0bfqO65xCwvlOOAdrctuzwZYLD36EHbu8eODgAbu/rf2j9oQdu1R44AP9b9coe2nXogSvSAyyg8j6cb37aU/8570nbpVrk++HX/cjRd3zXt31wl/wjeZoDAKyHfV7m5w6A6gBwNwD0y//hHz/YHACHFwCOdOs1FzMgBP4C5iVU4I+3i9V5QT4g/TIC5btLAEfElEPA9uEYgNdBwM4H+uOaX9JD9Q89sFsP4AQ7OMJ267tDrkMPHHrg0AOHHrgVe+DgPLoVr+o5tQknwPffd+9HOAoHZccxoLthi+P5lQstG6vyX/6YJ/8A+nxul+3/Z91FcKp5Q9ms3jcHwHCWHwfAF73gA7+SDgBAfwZ2BpDO+wJwGtC2FUY63BOnOvhsgo1B0SbiDBbD8dbcE53xsm4wcLhIXGwuGIGLTmC120Ccc5psWxEUL6GAawJb8i8D7C8p010DOAWW7BKw3TgDuGH3fvONX69DyqEHrkYPnDxrrkZ9DrU49MChBw49cOiBi+iBw4T+Inr5UMZt0wPgLID829/x9gfYzg+4Z1W/BuSv/MFXtnScAOC1c+iktbMB++sdAMPKPgCfwGp/gn/4r37Lb93ESeD5f/KusNHhebHwIrWOB2h/5n/8FT+T4T/64v/6NzL8uW96wYOf/4wf+4ThS1/2ppuEr7z35R//K0+778OEJ3z7M36P7SWEv3bPE3+JoE0+wyTwhbL9/pPv+tzJgM4jHvGIo+c/8yE3BcFSgT6r/J7l1/4SEH7VdKi7DoG5HQI4AtrRgIUX+aB26IFr3wODA+Dg3b32V/HQgEMPHHrg0AOHHjj0wKEHDj1w0gOr+Z07AP7i173i1azsuwtAB0BSHAOko/uZw66BOP9/WzoAbtB5fOaI7eL2LJNm5Mj+9J/60y8RkAvuP/2r7j365Mf9vaMbT/+po4f8zQ8c3fWy3z76U3/3fztie0UGvC2Pet0vHT352f/g6KnPfsXRk5754qPHPuW7b3Km5JnPeHp7szIy0jIgWxoe8v/4b47+5Oc85ejOz3vWRvjcL/3mTwj0Bfk4B64aiN9XfXQGcFxAh0eP4gjg2nqtD/TQA7doD6zPiA3tuy0f7rfodT0069ADhx449MChBw49cOiB27cH1vO7tgNgdQSgOgAA/wbwaG7/BweFA+D26knAPSvsrKjfeeedLRAnPPShD21xgPWf/NZfbCD/IS/4n44ect+/XYe7f+iPjh76hj9uoJ8OBvgD9h9x73uOWOEH6Avyn/vc5xy94IUvPHrB/T949Ld/7G0tvPYn33U0FtRZQnEu3PVNP9YcEjgleuHfe/QPHt35hS9uDoLWpqFd+wLeV9EOzgCOM0ztCsARcHir9e11z99mrV3/QAztxgFwcALcZgPgsprrucTLKv9Q7qEHDj1w+/QAW5gPuzu719vf/R7tZjgIr1EPrHYA6ACoOwAA/IJ/qNv/2+r/6vz/bbP9H7DHQ4Kt+6z4A4QBy5/yxJ9tFCCrIwCnAKD607/nX68Bf4J/gT+gH8DPFn8AP6GB/QVAP8H98179PxwRnvuKn2zhW77vrUcZlEMzHzw7B9iRAMjvgf8xGfprxwDOgRqGHQU9Z8F12kWAI4CjDr2dAMhwAvDCxNU26Wt05x+qeuiByR5oP/g83JuH9+AAmOysQ+J+e4Bzj0wy9mv1YO3QA4ceOPTAZg8Afr7poX/uE9/zaQ+7edjZ2fpmE+z7HqCkJ/MBdA9/17MH2nUGu+gA4D0AuQOgOgBc/Xf7P5j42jsA9P7RCfU6MvllpZ+t+4BZAD5AH+DLyr7hk+55oK2OA/zZUl9X+wX/An9W+gH9nPFP0D+2oi+4B9SzYu87AaQ4G6ZW8T/9r73siLIM5oMC/qmzxxLGAP+u8g1Hwcop4Ko/zgADMp0DlWaaeS+Kevxh7GjA/c//tJuH9wPUO+cQv+Y9sP5xKA6Aww/+Nb+wV736TEi++b/5+0e83+aq1/VQv0MPHHrg2vbADeb2AP/XPfQzj6BfeeNTjjiyu/rNu7YNO0PF2+/+HQPYBxcReB7X0ECfDoETZ8AZij1kvaQeaC+IB8jj/MIBUHcBuAPA1X/f/l+2/1+7eeENVvM5mw84BsAD8Fndp2Gf92Xf+N8Bjjmf/6nf9pst3TPyTXcF/uEBuIBRVsDRZWu/gF8q8Ge1P0E/K/A90I88wT51pBxAei8I4Htpp2SDLew1efKr9xLsCvS3yTfnFLgocL+0HMYGurwwcMwRwI4AdgPcxj8el/QMOxR7Dj2wdgA0xyg/9ocf+nPo5oPJ2gNf85Tnvfuv3/vuo7/xkl88Ohyxqr1ziB964NAD++gB5voA/wT/OAAMOAIAvvso65rYaEf+BP1t8XMAhjyDmQMQ4Amk0TdrR8Dx3OCaNPNQzeiB5gDgejYHwPAegOoAeMrP/N6DhPryv2vnAGCwAvq5sVnRZ+s+gB2QD3hvIJ4V6gHcIzcAVgGAjQ5pOgAAvMgJyAT7SXEGuM1f4O85/h7wZ4s+K/zongLusVLfdhmw0+CMgTJo1zbg/Tx0lzoE3BmwFLifhx7Xm10BvfcDHHYDxKPlwF7nHthwAKwmQserA9e5VYe6X+keYJLJ758OAI4CXOkKHyp3S/cAE2PG4Dl+iutS+4/2MSdmJZxFL19SzWePm+P3Umt3voVzjPdnH/7vjzoAdATgKDjfmlwJ6+23PcE/1x+Q1wukbTgBznFxAIdDjk3HKBQ5Y5e6XIlevH6VWL/niWvKW/1zFwCgXwcAb/5n9d/t/+hf+XkhFWSA+BZ+AK/AH4APD6ADKAJsBf1QHAGs+pOOnsAfmg6D3jn/MeDfA/2s9v/NF/3YGvQL6qmrfKU950DKANTEpaZVO8TR2Seo34c9bLR3Cgz9fx4g/qw2dQJM7QZg3F2/58GhxoceWL/w7wbPz86DnsnC4e/QA3vvASZ0gn92AHzrs992tJpk7L2sg8FDD4z1AKCHsfgt3/GjNzmOYuBYCs4AQMlY3qsu53kOwAdAcfz0K59w3xHhix/9nFOBeTMOgqFNt9Qznzax5R8HwAce/lnNCSDg71GcBfTbVb+2Z6jfGggytmkr90ADhCtQCDA0Tho6OgE4MnAOY6Qd0XB8zlHu1zZWj+tyhq64rbKurzvXszoA/Bygq/9u/0cP/bYD5Co+G9oAHlb6+ZSdgPTOr/7pBuIF+cgBgoA5QD1yt/zrGMABIPDHIQBQFjxiL1f75dnuzyf9WMX/ssc/4+Yzn/fq7jZ/zvXztn9X+wHjPaCuTEBve3YF7eT3SAH8We1RjzEbKU9+m7qTT2eAzpp23a7AJwmpD18L6L0kkN0AHAk4hwfjbfWEOjT2wnugrQYwbgFf/NivPOxr+YXX6FDgrd8Dw8QNwJUOAJwAHAm49Rt/aOFV6AFWexlvAv4pih5O/uvioAIcAZJ6QArwjzMgaToEcBbcSivhAHpe/Mf2fxwAU04AvuhFwDFwizoC1lv/+Z1PIAjo//Tn3v/qu3721z706b/zLz921xve8z4dAekE2DcQxDZjrjdW52Tkw8F1nZ10F/wsnD0GsPHyv2FMcH3o331f9zO3m4rhtQSYATIB8lLBvVv+2U4OsNQhIAVwmn/jJX+rYwKkYaN31t/t/gB/3q6fZ/zl2eb/hKe8uoF9V+QB9/LpCKAuuwLnbUD2Revu2iby9ZwBOmUui+Jo6jkB/FLA6kY58/g+GDj0wAX0wBro6wBgUhBeftIPf4ce2GsPAFBY8Qf013ArgY+9dtrB2F56gHkjgP6Jf/3H16v9U+A/03BataMqV3TlkfuKtjHnJACgXPkX9CfYl++l3Sq7GvlUN4AeB4C7AP4/n/zw7k4AP+mtI+CzPvuz24sCV7+Hexl/l2xkYxW4YSiB/wD4Af6f8eDRkQFnQDoBAILNCXY8/s82NxhsjDmp5oB/pjuGWYA7zL1nR1e7/tX5k+8CqNv/GSPohwPgbNd9toozClQkgT9gHvAPWHR1H1lbzcc5MLytHzAp6Nc5ABB21d+Vf3cDNIfBsCNgass/Lw4E/HPOv273xwHA+UbBviv7FfjvCo73BeK3Kb+n25PN1S3zJD+VDz2uLw6Zq7AjYM4JsFpFnRnJh+RDD1x6Dxw7AIYfY8YsD3vCasJznHYVt31dercdKnCWHmDiV1f/dQTwQtzD8/MsvXvI2+sBgAvjDkA/B/7rcYB0AsBzPKA9J3sFXYIMpy3An3oL/p/0zBc3B4BgCaAk0K90DaKG+eyaP97ReAmt2V+R9Ivb/P0CQDoB4E2X+nnvpDgRbhHH5KkV4Lbq//I3v62Cf5wAyEjXCUB/hgNg5wuFjblVf8Zhjl35HnXMYrMdDdi5Zrd8xg0HUO8YwJgDIOaEl9dJPHS5GQGEAvm2Sgw4jBf6AeQBioB/gGWCf/KRnwDwF/yj56oyNnvg3zf8s5WfB6wr/ekAYNXfrf4V+Bun7CnAW9O21a/5l8RrGTU+Z6Pq1/hc/qXp2PV9DV6vy6A4I3ovB3QnAD8Y7WF5ebfLoeRDD8z1wLgDYHAKDJl1AszZOaQfemBxDwCgxhwAOAK+9UVv/I3VhGOxzYPioQfGegBQwJirQD6dAT3Q35OljbYbYKzQC5Izz6CeBhwAzE133QGgc4Ct1RfUhHMrxu3/gHuPAdSdAEudANhou+POrbYXYHj4TWdOyko+WMpt/z3wv94FEEcBaH9zzp7MDbauNAu4c+C/B/KnZDoApFfJObd1B51vhjafYwxwLXkuMgZyB8D65X+D3PP/Z73m+2jSDd7oD+gC3APo24v7BqAOINQZgBwg6Rvk1TWdPOgTEvwTF0SS3zP+Sd3yD7jnRX4J+uVd9RfoQ93mTxlLQe6c3pitlCePvYwnP1dWL32X/EvyLNHJ+jTnzyW/PJDPBT7/mQ+5WY8F4Bz4ju/6tg+yle6worWPR8DBxjn0wCkHQPOg8wN/8iOPzuHv0AN76wHAmCv+lb7gtR88etlbPtScAIctnXvr8tvSEOOHVf9c8U8eMD8H8qtO1cf+6ll54X3M3ELgD3X1X5q7AABHgvtKBU5JV+80uvA27atAHCOAfgMAHvBvcCeA7wUgzi6BBvSH9wDkDgB4Fh6v+fOou/p718jq/9oBwDsB2AUwvAwOYH1GMHjjPMA/zoEcu/DX3lmzrxth006b7zGO106g4brqAAD89xwAbSHzZD64afG8Y1SULf+AQ4E84J1VYMAgoF95A5DDqj9g3h0BppGHdJwCCf4BkYJ/0up5f9/yz5Z/Hpy9VX8cAKQn8D8v8J8AGH5b0DyXv9qr8W3zV/1a5zH7Y/Ixe5e5K4BPBY45Ae598/cdff99937ksDXpvJ8UB/s79ECbFDCB1SO83rly8sA/OAB26NhDlvEeAKBU4E/8u+9/oIH/+9/24SPCYSfAeB8eUqZ7wFX/CvhdwR+TV4Cv/hRl+/0Fg8MbOB4S/FcHgLsAmLO6elpBkvGeQ6A5Nqa7+MqlAk5ZKASsC/ylAHuPAegEgOoI4L0AhHxJYDoBsHvlGrxdhdbnv9vq/wD82vb/YYVfsN+j7aWAe3IAsKvEsbhPyjiuTgAcDYeFt+4AacdAqgNAJwCUoMMHvdWz7XixqGvyHIR4HRgwrPoD+tzGD0hPmQC/AcYB/LP6X1f+iQP0oYL/5kQo4D9X/OHd8g+4H9vyj0NA8O9qfzoClgDZqpPxMb4HhHuyzN9L30a2i61d8tQ6LbWB3mU5AnAC1F0Axn/455/0IGH1Yp0DoDqH58XB5E49sHYAMClg0owDYO3lP3EC7GT8kOnQA70eAHxVBwDgn9V/gP+r3vmRdcAJcFjN6fXiQZY90MAf25oHYNN7yR8AWdDfA/lnkeEcoMyhPhfy294D/9TfkDsA4HUCVKBvXEdAUgBU9u+V5offKbb7A/INAv+k1QFAXNmUI4CXAt4CXwXoOwCGFf4e8FfWcwAEIFw8LMizT9Dfs5XjF341hi/knlzcEZeveOo9EB4DWIP/sv0/rvfF9CWTUC4eYE4wjwMA0J7HAAT/DTCuVv7VN408AMNT4H+1dRx77Bao4N+Vf7b8j33eD/BPegX+xpcC1wp4l8R7tnuytDWXnrpz/C62pvJMpc3VpaZj6zIcAWNOAB0A0Kv8FuHLfzYdanCBPcDDvE0KcLbiAOC5S4Av274u5sF/gY0/FHV5PQBgqg4AwP9LfvzX18AfJ8C97/03LTzxn/7uEatVrEZcXq0PJV+lHmBSynOqrWIOIObzPvqJI8KjXvdLsy/5y9X8HvDPdPglOnzV4gJWzbsr/wn8XfmX4gAQLFWAZFxHAC+1Rma8/QZcpYs+UhdW513hn3IA4AzI1X8dAFLSPBLgjgB3BahzjR0Bp4Cf945gv0f5HCB6rgivFwe2dHad1+q/Y1vqmJbeCu+yGBn2u4rXcz4c6zxDubbtRY8A/xX4R87vbZkH7lrmsnwUiieVt6yzYu82fsF/OgQE+A38DeC/bdcZQL1y6J1f/dMN/Oeqf1v5X4F/7LUjBMNqfzoAAP/8kEyd92fb/1fe+/KP52p/5fcJaivInYtPlZ1p2/JT5Y7ZGsuT+lVn17S0g4084uFRj/OkS5wAl7BlcNkNeNC6nXrg4AC4na72FWprdQC4+l8dAOwGwAmAA4AAwGNFinOrTFSuC0C5Ql1/vasyrPQyWfXcsqBfypytgneAOTKofNXpxXugvyfLvNg/z6N+cyv/6QiAB/zrCADUA5IS4Av0BUuVMh+/6gMGkOIqPnTOAaCujgCBfVLSejsCkJGGLo4AnOV3HO+Su+rdRP223gHw8D/4xE2ftdx3AMZdACFOAwH6eVLGr2M86XUYxxc4gNo4wIHKvUPf8MxqTgAcAUNAxrXmul3U6v8NVkZZaWdFHtAmkAegs3rP1n4AXQPsA7hXzpv+Af9s0wHYAfpxHJgHGTxyAgCxlTEC/nEE8MI/Ho69T/wB/Fn550WAOAhwVuA5/dq/+vije+55cgvwpBHu+qYfO9PL/yoQnosnAD4PvpZPGT1Zlj2Xnro9fir/VJq20MHZc57AP23zYkC3/yfNnQBty+D1+fG4wOfToagL6oGuA4BjKkxs1j/0x2P0sAPggi7K7VAMoCl3AOAAAPzz8r/c/v/qd2/uAtAJIODj7dVtgjpMWtaTlcN4vfWG0HBNcfg87N0f/ZjXHvoXPvjHNxkTX/2W37oJ+Bfkz9EE7fKCe48JKO9RdTPNMldHAfZ+DeoL/wT7PSroT5rAK4G+ToBK0bkOR28A4gnmpxwA7hJQv9J0AsCTDujvBfOixw4EQNQVd0iuHQBc1wb4hnuKFf7eyj+y/AwgoLCsCC8e4ziucvwlnztUUn4W3vGNDfjDUYCNS9XmfQB7xivXlPHA9TUI/tdzwC13e2yUNhehMB6aT332K45YPW1bt8sn/QD/7gho2/UHB0AD9QOoA8wD8NrxgMiHg2Aq9D7zJ/h/xL3vOeJzfr7d/4df9yNHf/fl39tCAjr4Nz/vTxy97RV33cyg7B1vedhNAsCPt8I//UXffvOeF33Pg+wcwDFwVueAAFc6BYan0sx/UXSqLrumLak7ttv4GsZMAvbz4Bc7AeZukEP6oQfOpwfahOCOYXLNg56HP8A/HQAX8gNwPm07WL3CPQBw6jkA6vl/nAHuAsidALkjIAEhALHtEHDb6mo7I3OMNpbPcyJzhfv7ulaNa8b2Y4CI11mwz2ckCQLvpJn2Ld/31q6O4L0H5pfKtJGUejDe9tnn2OsB/TEZoIo0aAYcAoIiAb9gqUfPczfDvvonHQCAch0A0nwHgDLBvSB+n/T7v+RhD1InnAL8lvK7OrT1KjjQ2+899xTjSQcA9xcr/dUJoHO1bv+PFeFFlxDHLGMRxxoYz/GYAB9Zxqd4daVVtzeOkR2OAmxcrvUuAMYDTgAdAVCuWfu9PHGmn8/4ZcIJ0ObBJMhvK/ecyR9AfgP1A/hnlR85IUF9D8T3ZLm9f4rnpX+Af3YivOF1r7gJ6AfkJ7gf4wX9mf7LP/+Qoxo+/L/8p0eE9//q1zXHwLNe+9x2lODG03/qTDsFKgAeA9LKpeRbwm9rv+qPxbPsqrNt2pR+td0cSufsCHjsl33x7E6Aq/At4Y1HwyFyu/TAekLAw57JHhMWfiihnR+B26VfDu085x6oDgDP//ccADgBcidAvhdAR8AS+rXvfODoi17wgV9pE9rBMcDEvE1yrsbk/Jx7/HqZB2Qk8E/Qr+OIXSMGZPBQwD8U4G98zgmQAD55gEvG4XsyQL968Ht9F8AwCeezmZS7TcjVf8CScYC/oAlglI6A5Enj61tXfeQA8N2aL5B3JV/A36M6AdTdlVKmtixfmTapIw6BfTuGtr42K2c/II/nn06AugtgA/yvnpXUvYDCRcUzv2UndQ1gLJwCY0DeMboLHXMCXHr/L+qxC1FquwDuGMaDOwG4tobm5BnShpoc653HbyQTzg3wP6zmu4oPJbBCzhZ7Vswf8oL/6QhwvzQA9LdxBnju3xV+gLygflfK6v+YA0BHgBSHwMt+4e8c3fOa+4+2cQZsA3orCN42vktZu+TZtl5n0T/PHQE4tZY4AdpZsgu57w+FHHpg3QNrBwBgPx0AOAEuwQFwPl7mdXMPzFXpAcAS4MygAyC3/4/xOAMMOgO2pdrmyAFfGSDwBmQmqwQmxtwPTJLXE+U4H8m9MbJSclW6+NrWg/5mFwcr/gB/x4hgf4yql5T5ZcYB59UZIHCX9gC+aUspNphc7+MiMB63Af7q/v/Z+xtg/bK6vhNtYmLMP91tAjqVipW6VVqZJGNpcplU5VYAMYZLKz1UbhtfsKUIL5cMgpoQSQtJbFFEwAECivgCRsGKMKOCDY5otLiGBtGKQcjVjBgjksSbwCRxMlUxU4Huc/dnn+fz/L/nd9baz37eznnO+T+nap3fel9rr732Wuv7Xb+1HoAV9gT/kgCAKomASgLg9jJA5K6eYxdt0cjjhgSAavqAb+1KgbmAvEUIkI/h2NONv27DejLj1vxIo3bAAozuds4b+hz5sp5c7NTXJlteBEi85djGUYDhXpWW9hRjIXEZ8wowrHmfcxP/W771W8+B/yQDOEoNETAX6K8iDFrg37yvAqF1rhH357EkAcZvnPEqzU3wv/sa0PEYiDGo/QOUUOUHyPGTel913/9y8k3f/b+evPitD45GMD8H/LvDPxf8A/wxX/DKHzmjxp87+UkG6C8pUN36K5MEAORDCAj6e5J4/H48xMc64LYFtlt+5jkVZpxVchd5UMaqfHrhLf+W36rn2JdGAH37vif9iUlNAN71kQTY/ThzzHGiBRaDPawvkzv9Tw0ACAAn/ZH13+dkYN7U5/h3S7QAC74EZoC6egGgIH2VPKM18LP/2/LIwOi/cBtHmXnilwZSoGeoI0bCAolhrSKRkGQCJALfUWcxfku869kPOXz/7Ppzrl/g3wP7LX/6E+8hZfYx7ZAA1UwBe0B0K7z6kyfxzHsX8zl9R0C/iRTwzyEBBE5VC2AXzzG7D6wZke8KUO3N/cjUBpAAyHDjGFbJAUF7jyToAf9N/SUEPC4Q822vNW4QBwzlnE0eGI4f+DyMPY0MzpD+9K8lCQDByZEpTJCdxIHsHOt1OkfPJi2oX4L9nn0OCZDAP+2C+5T2ZfywZ1inXRpNdUt4nZIArsHacrcNwQuAmQXccyYEgMQuP4MV/py7f8VP/+IoX/jG92y0498D/wB9CAJBf8pU9Re8K3/06z5/ec5fP4H/HFm1ANIN2O8RAfhzfwD3BuzivoApYFzD0p32KbCe8dK+CnxneKZLey9O+k/Ze3llGuLsgwiA5Hrxc+98WO0SZV4KyDtmsN3t13bM7dgCnRZoEAAAf8wX/j8f//0sDC5AC2A5AR1BUuc9XUNvFnACMuQ2BADaAAnoW/Y5cSQBWuDfCwpbYdXPuJIFSAkC7jpSw4BF9W2nC+pr+IbXeyTmPdSQAf4tcL+JH/1KQqDaBenKFsBv+VXQ34ojCbCLywDJgzpuAv5Jw3eGlAhQ4o9dYARIqsBfEHXIu6bMT1MEgGBYsF+JAH/iT5nhpjEPpORASomCTQkA05GnZWEHzLdMxiO+9VSaB/N34ytc7voC6Gk/SQDiV0NYYw0wmwD4+r/1tb/UA/0tf/CgfRK5CuhnXO32W4E/MvMZLwQ8jrutd7hcizX6zW686HQMyv/wZ95/8lPv+5XxJn3OggD4Ne76E28dtX93/gX1nOdvGW74x2RY3f1PMgCAL2BDeplfXujHTr2GvLAD6IhD/NQCqOBfjQBljwyAKFiHCJgDeBP87tN+EXVZp4xVcQnf9a8GPPrRj57UAoAMWJwdbH2cu/kAj7kcW2DRAjL6LgRg6wX/EAAQtY3Jf5ftd3PCGSbksT6nDPQuyzjmdYAtwJnmFgHQ2qFvAfpd+lnmFAFQQf4m7iQEsKs5AMjj2+NbO8BXtfcqATq4n4HNHoC+WhVTknisD1cRA9nH0l6PAQCyW2B+LuA3beZD2m1ITQgi1sbks42RBEBiJAEATJIACf5V/0+/Q92YoF4AaMAvIF4gj1sgnFKQnEDfNCnNax2ZeWK3DkkWYKe+LVnjVbfP4TNMSeJy50Dn4x21ACAfmXOd/+lvtCcS49w/9uFTwOx83cn2rDd5tED+Kj/6vGC+JQXzylacSgLY94270zs6zj720TXRAjdQjwP8pxH4s/O/DvivgP+Pfte/ObnjlR8ZSQMuELz9b79rPEvPeXpv3EfixhBOPEgGLuJzJx/ALsgHyAPouRiQeOQ/ljFoEVh+lRIQSMKQ1I2fqWGie9YDbxp39QF8EgO/+ct3rDwWIDEAEUB996URsAoct4iCTdK08pnya5XR8pvKY90w8udoyq5+JWDVLwNwFGBi4J74tI5BxxZYrwVGwL1YBDDxVwIAN/7GG3LfNTG1XIhQzmKxvNYiY70nPsY+lBZgAeZlbQIzQLFgfJcAf928JAKQAP0qq18Nr+4eWZCEAGAXMKuGAIvnQ3lX+6wHYwzvn+enPbKtaEfN6+Ioh3EkCFaRAXO1ABK8C+irrIRAujM9dsw26sZoinB+ehvwn2kF/ikBRJIA2HPXNEHUoQIm2rcSAIB2wbeguSWJU0F7urclBFrkQeYvSVCBfK+urfpOpR2Q/QcA+Z3v93SeHcKZdzGSAUr9F3k4L89eA/BtrwL7vfAkAQT6Svpp2gX1yuy39me/g0x3q4yxnfd/8d4MaO78SwAA/rEjJQAYsAHcrfP+CbYF+wB5wDBg7fYvvn9U4UbingKIhiO5d4DddcA+QD/B/irAL8hP4K89tQxG+09/4uSRC/Oo9/wfn0TlTUJg1VEACQDlOkRAtkPaVwHijNuz1zwyXg27CPe65c+JX48FbEMKtC4FzKMAkE7bLBwu/ss+lngFW+CGDD9SAoCdfw1nEvEnPBYBu3rUEfy7yBjVFVmsYHZPNOyqzsd8dtQC9C0Akju4gkAA37qAfV/xrYsgdFuZxIEgVtkjA1hE843sqNkPKZsbXLrI+wfI2zZjmw9gH8DfM74H2470q7QBJJlSCtKVFexv4s68sG8KnHnnr/jW+05e/oqX74QAAPgAgpAYSQDBlMBI8OTuvxL/cR44pB401IXvAwIA0JyAXXDdAtPpVwE5bvMxDPeH7nnaUsOgBezX8TPfCt5bbuMqJQFSmi6fCzvtsmIdeRPUO/emPH8efK23/5SvfsqP9wD+HH9IAPul4D7lVJj9WAKAo+XcM+A3QD6bfptrNcL1iCzpc7O/rPtcLPAA+AJ/pef9JQEYyFHPquAfkM0uOsDcG/IBboI3fjFg3M3/htMd/bwDQDDekre//t+P+XIkYMx/sbMP6M88knhIeyvP6neOBBiOJnDRDUSAEjtkAL8CsAkRAHHxiC95+1Y/I2hb7hKk7yPPVv0uohzKqL8YsAkRMOc+gPGc0hEIrTvMHOPPb4FzBACgTPCP5DgA47ZEwZC1E8H8Utoxx4mERa67DTMJgJyAtLdL2K/vrtphv7U84NwhlgBYEgDKEQAOP/u3L1C/br5Zn5Z99FvsTo95ay+SeNUIYFO2iAC0Jtk8OUQAtmkXQ9MBMM7z9oD+Kv/abvahKZkEAHYBu1LQD1DAT/ccmfHNj6Mum7QRY/H3vvobT/gZ6l0cA3AHVAl4wrj7LyEA4AccCZwSSB3iXQASAKjLA5ITvAOMKyhOt8BZMC3IVmZeCfDnkAG1LuaJzHKzPtoz3PiZXrvxTJfSIwZraJM6n1a5Sfcd02xLAEgSJNBPe5IBac8+i5004MoWCXDUAlj5ek/7Q58YWpkBEZaq/5z7F/wL+nWj/s9LAuSfAd8F9AMAP+15P3/yB7/2N87GC7X8CsJbboA5/sgv+pn/+hAEgMRDgvxqb+VV/Vqg/4zfQgtAAkAJEcAxgdf92vetTQSgPi450gLJLb8ecO751zzmxiPdOnFrOZu41y0v46e9lq02AOBfs+4RgVVHAdBGYREw6+s6Rjq2wPotMBIAgAoMAFwC4ElP/h/egYEEOEMArLc73wPJywkF8G/57FTgvu1mGZn+NM35HQn913/68yl6eemP5K+6T32P/9dtgRveA5CADVCXQHtdwL6r+NahJ0dwmkQFO9a4lZ2wSgLoTjCLXSIg1dwBlRABV1kjgG9c8A8A5/m/932LdqPt1jSkt+1oq+xLLbsEAGGVAEiQn2A+/Xt2AX9LbkLccHkaBABm1wSAwD9l2gFTEgGpAQCYGonadb/0PcYH4LLTjREYK6cAsmDZOEjTVZlEAGGSATXeKnerDMvP+vTyMX1NY9qUEAAcAYBo3WPzT2a9KwIgjwMk0KfPpjvtSQJAekEAtEiAW1wL4HQtI7i/ubbxvS61NN2oQY7zz811mnH7EpYOkF/Bv8BfIoAXpOr/CLoH4K9qP7vbgP4zxMAA+KtbsA4gx16BOe4E/rgB/xjT9vI0P2Ur71b+An/DdCMF/lVCBHzlr/7O2kQA2gOokE9pA0yB2wp2W+5e+vRPeyuPq+zHs935l/7GaCQAlOsQAauOAhxvK+2PKceQrVvghur9SBZ2eQFgEgCEF3C+qvDTs/2nE0qNu5x0WBiTNwYCAPcC3CTIXsYfyQEnq5sTkHFrOXPdpt9Ezi3jGK/RAiy+AEwJ1AC+gLpdAfld5GN9RrkA+NqVy3IkAASyEgEt/8GP9NUIaCsRIGiFOIEIGL+HRrseqhffNtoMgnAkoH0bAkDCwLZaRQJQpu2IfeoywBYJgB+bVP/TD7xtPLKKBus73vmOMwY/wjHEXaGGfe51MR4K/pHeA0DZ7uDvQrrrn+Afe4J/QZWA6tAAEz991yMAANKA5QTGaRdIp2yB7wxPe41LmGW2ZM8v/dNufvhp8MtnAOinGzt+/DLBijsAzvW7XXswRrmLv61MEmAK+NNf7avKJACSBLCvX7VxdEfv6QbjMRoQrP0Yc5brr1hjse7LdZrx5q8Hh8y8+G+KAGD3n8F4BOEB/D/1K39y3OlPcL5ql74HzAXgVSYB0AP/U3maXwL7deyCf+pRjwUQhvl7v/Sm5SWBv/efX3bCbj/nxr0PoErC170ksAXaW36HCt6tK1L7PurK/RIYSQCkBAByHRJg6qcBuehxDRWuHY0Lx2xukRa44cDPoJ4EgBoASBavhDEJLCZKgPLU3wj+Y4Iw7k2APcwJhFtulhHpzsSnbMLSRH1W1el8HW6y3TfLWd/PfI9ygxagX33l//hD406sJIAEwAisBc8XLM+UncCdeqzh5qcHx58fHNKk1J4aA1MkgOCWthHgcoEiRMC64HKD17SzJOz8J/gWjAvilRICPWm8lLaR7WN/aknKBQggMQBrTe7wV7AP0H/3z/3Uyfve997R/PMP/uOTljEcSfyRrFmjFYmfBADHAHYB+DMPwA+mRQLoB5iSDBBMIRck7RpPtL+o9H8JAMCvQFkpYK8gWbfhPdmLR/6kyXK0V2m8KmseLbd5qYVgfQT+KQX+/iwh5MhUy/MeaT+I/xc++7Pfb/0sk7LwRzOQuXoqr1bYLgkACIT6E4GSU1VmX8XO2X+BP1I73wPfAM/fqv819hvBP/PvZ37l337h7S96zXdjPvMvf/Vfw493DTGgwW+MuwjHviQLbq6Z2s1Vd/8hASQC0s5LYfefs/yAtyng3wPpq3bmBepKQXoSABINKYk/lTf5mKfSvFvyXJxht18SIAmA6sc5f3b4P/Q7PzRedHj33XcvSYFKAOAmLpcb7gMEz80zgXjPPpUXadIIvlsyATn2jEMeuFOab42nv3EzXHstC7f3A6xDAnAfQP7EJPa8EBAtgBEUtT+vo++xBTZpgRH0OrALxD3/nwQA4zeGAX/RD6fA9pgv8QphcBNkL4A84ZbPAsNJZSxjiDOC+4XEzzxJZ13GhShx2pPQzTJvhp/1K+VEPqfxDDf9Wfcm7X5Mc7YFbrB4A2gJ1ABwgLkzIPyCCYARoC/AvvYWaE8AarhScK8b2TPkYzzSJRlAW6RJEkDwyq7s+N2cbduDcgEG2OSh/gJvJX4V7Nu2LX/9jKOk3VYRAKwzLVeZ4F/Qzy6+YL8F8tPvox9+8CRNhmF/6cte+oNrvIwb3/7y+38rCQDsuz4GUMkA3RIDSME/32iCqgM7mnhDAgAALHhNCbAFzCrTjl8awtJkGHbyVfbshvdkL13WWXsCf56vZQD8+gv+kczbzX43zGOAXutHWR5rSGkdDCc+83Qzz4Yn5W+781/T0y8r4NdNH619FT+0cAT+gn8kxID5HRKp1WjK3XoN7x9wD/i/403vfu8dP/krvzaaV73lbUsyYAiDEFga3JrBnzXjcq12uj5q15Hdf4F+yp//0IcfToO6FDvWAn93+atMYF7tU0A9QXq1TxEA5FlNTd8C+XP8zhABHRJAQgAyAIAJAAXUAzKnNACSELj39a9ZSxsA4DsFyvcRJuieAtgt0H2ZftS1Vb7aAHM1Ab7oCU846ZEAaHIc4uU77a/96HtFWmDcpXfnXSDeIwDcAZgx4I/5AtCXE4TgGTlMPAJ5wi2fxQh1MA1xmJCRxjdP4mAkAchzaPOzwH7hXhIExGmYWkYrzui3qPsy/DT/K/KqD7uagNeqBXBZBEAPoAvOlYJ7pH6mTTCfYT1/0ymX8QoRALiVCAAwJxFw6NoAfK8suPmlJ54PkC74RkL+4J/AXntPEr9laBfJpJ6kTNpMIwHAGhTQXwF8y10BP27iVYnf97z+dQ/M/QoZByv4x+0xAIH6NhLQQ/qeVANAWUHVoV1QPHUPAOAV4IpJ4K89wxL4G640ntJ8U6bdeNtI8qN8wb0yQX6C/xrOHFn7HfMpdSJvTAL+KXvGn0sAMb9XAL8Lt6Bd4G//VCZZRdwkAKqd74B0XbKkNuDVdy93/+8YAP+jfvajH//0f/KJE36RDrsmCYHUEhg1BQYigHEKEmFBnLD+Ov/nwL/q/D/hqP+z+18Bf89dwf82O/Q9AqAC/zOAPXb954D9WXGCBHD3H/n5H/3kqB0hsERCBqAinkB/yg5ZMHUkYAr0T4VtQwaQ71UC/IL9HvA3HKk2wFwS4L4n/YkuCcCFgAym57+wo8+xBdZugeXuNn2KiY/BHDsEQO7+YwecYxjLWTwsAfH5Ysd8iUNc8hwXIH9kAdCRg8HPcMq0XOLjTzh5aDI+cTRn6mMZEgGLsohDmeaFPd34m7/lShogtZtm6T4SAOff/oY+vCMWYKheCwYBce6Cj2Cb3fg9GwH4uhIQapq041fdgFnjKo2jzHT48dy2RZIAkAFJAtB2ANlD1AZA9Z/68jy0Ac9BfdNAChDWA/w9/7GNggzINllFAFA+oJ/1J+r6LaCvXwJ7wb+AX3eVpl2HAKjq/5IB+zgG0CIRkhTQ3gJWzAkbfvI7T8YcohYAgFmwmlIgTrim5WdYSuPV/HALpo3Tk5mfQL3Kf/DX/tsTjM9CuHakwF8/03/74x71EAY3kvBhAv0Ac2VtbMgSgD71rICf59Ev7S2/mm/LTfm7APw1D3bu6ZPZL9OeBAB9PEG/mgD6IennC1Kr9RjXze8G6x529tn9B/hDAGDu/I2HTj7jdz/58Kc/dDLK23/7X3981BAYiALIAowEAOmZu8c1keuu2lKqfTHAThleipf/9QA//i3Qr18LrAvYlT0QLgFAvKn8eum38bduSnf8kdohAG7/ileeOWcuCcCFf3N/NtAjAbc97h9e+A5/EgUC/wTMh2pPsJ/2rG/Pnzi8pzkkwJyjAIuPrX5mR/f1boE2u7oZCB134QG09CXAvwQAMgmAr7j3K38hCQAWWYBk0g7NfUoi3Gz3JalAnATpY3zSDEbATTj5USa7CZSLG3/Sp2GSMb+U+BOPPLMMngs/w80LvzT6E89ny3Dt1jvdi+e/+fRH21YtAGhlEQaABZRd5DGAEXAPIFtAPiUBoYZrT4l9E1Pz1I1cAtwOEQDgFfTSdrQhdwPwrWz1UnaUmG8c1f/lcyxIgKoFQN15DttPsqAlM69qty3IH9MjAVDxT9BfAb7gXlnB/TrudQiAvP1f8K/c5zGAFhmgXw9cMSbuqJtslQ1jeYLiBOraE5gDxnG3pEA9wzMt+eGuMuNoz7wA9gnYIXRe8a33nQjYqf/zn/83T9gI8lkA/Gl3t1+iwPzSTXzAP6a1U8+9AAB620Vwr8Rfe0/yM4hzXhg7xBW878rtpYAJ9ms/xQ1ZAMjXSAAo8ZdQYC0w57mucJxx/bdU/x9U/1vgHwJAEmDUBOCYgEYS4DwBcK5Zxp/+Q+1fVf88ApD2F77xPWd2/gHhPSLAMIE6UuCOrAZwLrhWVsA+hwDIfGr6nbtDEwDwr/o/u8oagSXAmnB+NnBKAyDD2FFOQN6y72vXfwosJ6i+Cva5z+K7WkUETB0FeM5Lvu7hQ2Ldz33tV9NDIFvlPp+Gstb569VN/7XyGhdtCzAuAAcsVAJATQDAOf2O8DOA+yYJcFqPRZ7mRXwm1CyP9IQL/olD3hgJANJoiGt8wjX6n6nPonzKw5+4mQ92/DW4zRupv5J8NOk3NPYm7b7OO7rl4rIgYbHmUQCAG0Duoo4CJOBu2QWlhGlvyV64ILaVJv2M16rDCHQ7JEDVBoAEQKOiBQAutHMN3yRHQCtI55nxA/RjAOna0Q6wTWyPOdIyaAvBvzJJAIG/gF+AX2UL4K+KY3hNuw4B0Dr/LwGwy2MAgvsq3fUf/QetXPpRgizsfKsYiLsL7U/9wpb3AACABeiCXMF6AnPsEgD6r5LmU6XpAMbmS94AdMA5/u7QC9qpJ2Bcw848BjeSb7ca5ss0GZ7zLXMb7nHuPdtmNyAGqGOCe9tJP9zaq/RZzmbbcQ3fP/15V6C/5sMRleyb9Ml005cT+GNP4J924l7z9fW4bmGDhP4xnv9fEAC58y/4V45aAN4RgByIALUAyGexKUneZ/+Y1FGvqgQAZECCf+yPf8MvnAH8HAXgt9a5D6ASAQn8016Bv2BfOQXSP++Hf/dhSACkhEIrvzu/4RdP7hx+oWAqr03DztVzQQKo/i/wT9VyVPrVEoAE4GcD52oDcHygBfz36XcVQH2rjhXoV7dpev6E895WEQCE118FqBcCLj64sx/b0bVuCwjiRkZ0bNNhshoyuem/bo7z42cZOXDO9TfN6W7+aZ3nlD7mz6AtsGWRIPjGLuhHogFQtQBMe9v5thrVyggHTJMXBrtlAaJrOHEkGCQASJPGvFIalzzNH0n+lsHiyHyMn+GGGc8wZAL+dJfnntPmxzgzW4B+KAkAYIMAwAAI96n+L9imDO1KgCj2lNUuWN2HtB5V9o4FuPstoIYIQP2eb2Pma9hpNL4t6iQ4p420IwHrAn8ldSfM9tTekvi1jH2nEgBooSZIT3sF7RmW9ql4NUz3OgTAlAbARR0DAPzTd2hHgJGgSoAlSYCbsXWnnWbDzADO7pYDvgW1KQXqPUlcwpRT8QDCGOPqRgrylYJ9gD3zGHPKYi7Z8Gk3T0Y7qUlA3SvAn3L7bJAIc2tAf67Afa77td/52pNeXMLcubd/Vkk/FvQnEZDAXzt5HdrdFnPbeGa8cb3I2oa1DyCe8/6Af8F+S3IkABKAuGoDzCIAGBhgW939rzJJgDMEwN9+11LVfVQVH1T/55AALcAuqK6ygnQJAEiAVj63v36ow2DueOVHRoO95rELt/Vc5jWQAKn+LwnAjvKN5/zYEvwnCbCONsCqewF2SQbwLgXKV0VOAfp8hrnx5mgC/MXHPKZ7FwBaAEwiMz/4Y7R+C5yCbYDsYASPSyIA/5tkQD+XTUPO5l+B/3k38TU363VKAJzmNacmY3wGf0EtC3SAF4sS7FMEAECdtILusT7UZVEvJxbGffIiT+IL0CkTN+GWR7ynfPVTftw6EG4c4hmX+GnwJ57PQdnY9Td/01COeSszb/3IQ2Oe6V4+83zSZc57OcY5bYEbLMAAFew6SgLsSwsAUJ3EQgXZAFD8WlJwelGy1m0EvQNhsYoIAFRf4pGAUQO0BdDTbxUJYFzautr1UxruXQkSAd7oL5BXCtCrW/+WXCeu6dchABgP3fFvyYvQAhD8036C/pRcnkgciACOoB7CpgRzV6rTC+QBuYJ0/QT2+iszvPoJ8Imj3Tju9gP4AfsAZIA28w7zxzC8MacfxB/1oX6SJdTZ9uC5eKbW8xmf51qHUFz3pwCnQH+LDOCnASvwx01/TfV/gL5kgKA/JWFooLEWOIgXtftKjJf/jer/g/q+BIBn/lvgXz8JgJEE4CjAcAwADQL60uLbP9+/efEwrhX4p1sSQAKA3XfuAgAoYdACSPCfO/5pb4H2c2B6OAqwBNYNex4DEPAjW/n80e/6NyMhMJXftmGWCwHAzr53AEAC3D6QJIJ+JcA/zd/7pTfN0gZAY4BBfJdgv+ZF3RMw79s+F5CvU4+aZ3WbV/qn3XDkKk2AKS0A8mShzOSy+zHi2ud4E1wPwFVwKnhF6lfA3vkB7mZTmac+uvtpFqC5UcZpWsIL0G/Wy3xWLzCW+SbYpQ8B7AXMLQIALQAAuvEY9McFgGUPEjf+gmriC7ppU9s3w4mDMX/qYLjAXUleGN1InoMyMT6Tcawr8SgDSd4a8yEefqZPmfliXz7zzffi+z7KHbUA74WFG8ACgOFRgH1pAVRgnW5ApQQA9m3ND/7aR5Z5aK+yV4b1yPphHwHvQATQPhoANQbwRvtJArC4pX139KpWZsM3Qz0E5UieL936UXe1FpTU3XBlpteurPniJl/WoHnWfxWAz/C0C+Y3kesQAL1LACUDXv6Kl483+FfV/VVuvifjpF0/JWG8A/oXdsGUEr/sV3yrAILbmA8u8Y+xHHV7gSrAVoCO1CTIn7InKE5AbJ6CfgDxmZ391XPxJbbSadGAQOqdRIDt1pPEZ65ct/KMOS3gvks/5gwJKskA3Lnrr72SAOmGMDigYy3rNvWq+CMBwLg8XgA4fLMA+jkEAHH8lQAvBVxJAMBkriIAIAPyCMAqAkAyIMG/9koCAMD10z4FyiUA3OkXgPfS9MiBXvxN/VXthxjh5/8q+JcAUCYJsM6RAH4qsAL3Xbmv4u5/Ava090B9xmnZa7opbYCpCwG5v4GjMRxHgQgAtKz68m+RcIH31OMugTALFkBdAlTakgFSImBc1JwubMxbaRm6p2QzLmU086c8jWBzcFNXzTJ84T+6pxce40496ZnEmZR5VgAzCyckQDlV/z0CgCQOhjjZPrC/1on8yBdDPPK0PUljuGVmefiZNiX+GOKap+Hkp/GZiEM4z2Ea7KZJaT3w65EA5k/9l23uO/GtnpW1H5wNPbpWtcCoBQCowLDTCJAFSALmcsd+l/YKrAGV+FWpH/7rmAr0q9u8ev6GI2tdR+Db0QZokQB8F6tewi7CAbLjO+uo6bcAO/WFsACAYlokAOloh0yv23aiHTGsLf/pBz7wEEB+GzC/TVoIg5e+7KU/OLdNGYsE+y3JMYBdXgYoGYDEsCvKe+NdJLDCTjjfIu9FogY/yKWRBJj7kHuIBwgHlAtg3dmeA/wF+0rS9EA/+VMW7+kQNB/20JQ7zRKyYVuwD+nVywONgdaFgMwfFfQn2E+7mgD4cYHqYj2103a45MzGdQlrNdYy2xIAs44AcPZsawKA3e44AiDYr1KgX6WgexWYJ54EAMcB5sQnDZoAc+Nal3UlZQDEkYD7BPrYqzsJAO1v+8f3z7og8JU/9/f3QgJcBAFQAXYLhK/jl/mlvZVHhqeduNWd6adIgC/7q/ecOQqQdwFw/INv4A9+7W+M92TAWo6A8pJHmUsuPsFXqyqn4QNoZoAXuNJuCVAT9J0jAkh7EwCeyY88l2HY013TDO4Ez2Nc0wySuo2Li4UfduqiMRy5rOPNMoZqnPlb1pO4LFwAv0jAQCUAWiQAcfBH0j5ZD+qQ7ZeAnTIMww7YJg+NJIPAnbTEQWY+gnnDE7Sbr89C3klaUG/zy7zxt1zzIy8Mz6j0eXnO8T3dbGfaNf9O27kfnnGP9k4L0F8AGyzgvBQQMLJrAgAgDYlQAXWCfO1KAeYc2QLz1a+6a76GV3/rg9RIBNBOmp4mwGKXq/bfzhvZzLt1+V+C9pad56TuAkxAJu++Fxd/0iix02ZsLP2L3/7ICWZqxz6Bfc8+lZ6wTNeL+w3Pf/4r5rYiY2sL+KffNgQAgJ3dfqV21aXH9h6+C47h8B2688/PdHvkhDi+IzVMRi3e4Vzx3OfcdTwJANXwkRACgvopKeB3d1/wTxryYfebOYJ3s+t63wL53djmHoAE/lNEQL0QkH7dIgD0E/QjkwzgO2C9cM3ey3IDiPl1JwTAcIwAcmdBgp2fSyAAYGBT5b9l72kAAJRGdfcgACQDKgGAu4J/gblyDvCWBJgT1zjcC4A2gO5dSsgIdvzP5R/AXwKgJyUBOBKQvwTQs7/7V157wuWCu9r9N58KhKs7gfGtZO+RAKu0AAD/9G36/qc97+dPIFmu4cC17jh8eib9LAg7C8wWAFvwLEAF6AkwBX+EYYirGUHgAphj15/FAXbD0z48xGkdSIcdOZjMW8CPNM+U5G99LItw7JhlvqdlDc7l31g2cUnPQgbgy7MKmpUV/D/jWc/8dcG0BADpycdysQuYyce8kMQ1zHIF/0jzJ671qfbMzzDyEqxjJy35WX/rSt2x1zwkCXzf5JF5mrf9gLbznQ2terY/pXvxXiPO8iUcLfNbAICqFoD3AexLC0AArQREYkduYipo151yyp5hU+VbR+utVDPiUkmA4TvYhAAQyCPdaZYAoC0yHLvGdmJ9+dF//dGHP/7xj33i4f/rYyf/8WMfniQAeoB9jv8q4G848llPfcoL5vf+226buggQImDTYwCq+SsBOxABGICQ4B9w7+4/3yFu+pcEQBJLqQmAmvBlHQeAAACwq5oPcMdMAX/CBPtI07PLv1R5Z0y/Jn+uF3bwOOOlv3PzQRs8gfwce94FkMA/7eZD3LwLgL6bQL/aE/xXO3FHLYC5D3dV4g392DXg+AsAWxwBGDUAFgTAbaffB2uis3804rYEAOAIoCPwR+4L/APcJQDW0QIgHb8McA6kD/5bkQEDyCfflQRGkAFVQ6C655IAH/qdHxqPGwjedyFvdcA/9fw9EqCnBcAvOAD6JQDGb2LoK7yn8X6AgZk7+zXeEq6bIJtB6ebAdBOwDX5OggBYwWsFqYJB/DEJeElnHkjtxMHgpmwBsm78MAJ9/E2Tcc2v5Wd9ap2y3OFN33xe7UO55Es6ni0BcQJyAbQ780r8BdWktXzKtU7mm3njZ5nYBenm99yve96/pQzSZDrd+pFOvwraJQ6sK3lm/j6f9ccN8YCbPGt+1FMDAcAz8i54d6OxTVMalvI0/Jb48Hb6kEMbMoZJAKAFwFEAQMguSQABTdUCEEwiiZMyw1r2BO9TdsI05FPt+qVsladf1jOfayYJsNPXR2bsDLEzLECfK3ke42rnGfRLaThS4A/oT7MOASBgn7urnyRBps30+GPuuuuuL16nkVfdA7DtMQBBP9LdT8A/bc03BunG9we49/uQWFIaNzUBeOecF+a28MXO4DqPvVVcxnHBvOAfCSFQNQGMB+B315+4gH7mq6Ei5wHNVrU7jMSPf9rjHmRu20FtbgDq5+bDuxGsryMr2K/umhdaAIB/d//d3beP96TxJAMgxpj35z7fFYh3VgNguMAPom7OrwBwEWC9A0ACYLkuajXAXAKAwZuBQ3CPKhGAiF1gZOunAI1byQAAkQbwLXhWrgLk9dcAVsXP8J2SAAvwj9p/ljFpX0EEqAnwZe98cJYmwCGSAC0Q3fI7ZA2CXn1bJMCUFgD3QdD/7e9KiAHKYNBtfZfX2O8MAbAE3gK1BTgTYCd4ZdIH7AlSBYBId4GJQxoBIYOf9swLe5ZBPNwtQ5gg07zwM2/80p86pDHculHGbTynz4xcPDd5Eo9+IShGJjDGLpAGJLtDj3/Gyzax3cg3ATt5235IwswfSd6CdeIannWr9hZgt0zr+4L7XvCfeIbMH7f1t2zLpN6YfOfafTe0q8RNq33ru13Eucaf2v4ejXfBIi4JAICK6uAjIFyceReMbCoFy0gNgHJbk+CfvAT4ypafYSmNlxJ7z/gMPhdtpcldW9W2IVf4fnb9NhlnKMPd+wTu69h5zho//bCj5p+gP+0QAJIAAPHf+efvPKMRIHCv/oJ7w3VX2QpPP+y//N6fOBnH5TUamfZLlf+WfdNfA+BbAiCp8s9PdfOeJNcE9LjtR73vSxKA9HyfEHVf8tZ/8bAkAETQGo+9VVTGDYF9JQBSC8A4agqo3n/RhMVWD7th4nvv/aoT5r0Nky+T8V6/7w3ff7L0WGFhnVLB+jpugL/gX9lKT5+2XwP2E/C37AL+Kom7j3FxRTPtM3hJADC2pAbAqp8BTAJg/BnAgTggPfksxrU2WTb3CAAEwIvf+uBylx8QLoADFKHavIkGwFzQX0H1ploA5MNxgLVAe0dLgDwgFGrdZrkHIkCwX48F6A8JwO3/vWMA+P/ef37Zya5JgLwLoAeEffdTcpu0U/ledliLBOj9IgCXAfJdCPxT0nfQBvjMP/WEn7jFwMiSBBCUjc//R27uvuMvwGYQwwD0BLICSkGg0rhVMrnpZz6Cdv11C+6V+JMm4+GH0Q+ZfpaR6Yx75pkD/ONvWT6f4BpAnEbwrGyRACy2LN/2qfmSv2HEx21e5A34B6wLzAnH33q1JGWQl8YyyYO8NJSDHUmYUrvlkE/N0zojbfsz7broS/QrFo2G8U61DzP5aT/c55R+HfMe2jR3/yEBAKnsSO5SC0Bgk4AZew9YT/kD2AlvAff0W8ee+WmfqoN1T4kd4CYBkGANkAdAp11pX/r6LrsTYwP5YwCSFcS33Dxfyx8/w5T4oV2qqn+C/mqXAKjgvboTuPcIAdJkPPPQLyV2zAPveODBtdt2+A6+/eX3/1YL+Ou3iRaA4N+d/wr+7Ss9wD/lT5/iG00SgJ8P47zx2s+/QQLGcnf7kwAQ8PMLAfoD+onPmL1BUVc2CXPqM5/5DMFtG7iteDrWET/2oz9ywjGVFVFvBg/9GcKqBdqn/CrY162saSEl3vzDbz6hX7urX4kAwb6EgPH0V16zywBHAoD+zvtblwCAJBh/AnDQ7EFzYDYBMOcSQAgABnRB/njuffjZOMAQPwP4iC95+zLMOMi6+193QwHLgiLtcwC0BAByExJhWxJgJEA2Bf9JKAQRUI8C4J7zCwH7IAH2Ad73kedlkQGVBPiiJzyhexkgvwRgH29JtAHQFOCjvzkaX1uboGvJdgLIxkl+mIAEZ/rRJgA8AbXAj4UBADHBoWFI42daAbjxiJP5CyTxS5PptK+SlmFdjE+ZDvBInvO2eG7ikSZBMwsCQLGG58YAmNPoTzzSkIf1sJ3MN4E7cQzHH9BPvuTHgiAJAPLG3zIyH+2Ugck8TTcuMIY8KQOD23rj1p5lZn7kmYa602a8L9vTNrVd8a9mjHMkADYaZOjDufMPQNUAWtxVBqhMgZE5YQJkpKaCbP0B79hbIJ40+qddv11J8651rG7qiZ91py0EdkkCsGNLm9K+tDn9fKOX1kjEdyMBsA4J0CMA0p9nYM04F/xXAkCQLnivclW48Vvx9ENq1vkFgGzKqWMAgH+IAICQ5/nnSndIAey5828fmfPttOKoASAJwBoTTQAMKsP73mFn7AbgQwIA+hPw4+/t/ReplZDv81DszKXveOc7TgDL41x6qqUxSQbw7hibAf3v/rmfGsH/uu9z3YsAE+RjTwPw150kAM/Es33v//zTIwEguG+B/fQT9Bufb4kxkWc+lPe2ZT2WBABj8zYEgOr/zBeLPtDuO3N/BpDBHDZ3VKFf7GgCbH7fvTe1AhL4C/6VEgEtALQJgIckkAQAjG+SBzv4EAFzCIca5w9/23t3e59AIQLUAliHBNj1xYC7AOy7yGMfIB8Av4t8JQKmjgF8wSt/ZOyfrb6f/ZjLefjotxxEDj35GQJA0CZAE/jjZvBiIMQwyCeYxS4IrQDReFWSR+ZDOG7yT7tlVsnixXimM475IrX3yjcNkmfkmX1u/EjHM7EI4Bk1Am9BcoJ/7cYh7bhwWNTZNjJfwTqylueuvABdME49JAasU0rztFzLxN+0SQBoJ0/KslwkhnTmQdtXu++DNsv+Y3siad9qiAs5MHwo7Unx0L+gS66fl/+xKy3gB1BgRwImAS6qK7eAyDp+gmRlBdO4AfD3v+c/LLUDiKvfrsD93HysT6ue6UcdcftctIkATxJALQDalvZGY3NXr5/vJgmAXZEAgv+6yz/lrgTAFIA3TCmgx532Gi7YT/m+9733BHPPPfd8+Sbtyljyim+9bwT67vq3JIB+FfjnHRMHCfCZ2vmnjdf5huxbvGPBP5L+xSbTkgS4qQ2wl7FRAsBdfqUq/sM72Eu5m7zby04DCQI+AywD6Nk1R+MEkO4aAIkbf3fWcfNtb1J/3k+C9Tn2JAES9Av+Mxw7z8M3BwFQtQAS5GtPEgC7wF8SevFrKZs87qGlWW6K8f42JgDe9O73SgCMRNrUWgcGc64GQP4SgGAfYK+9JQX+VSYYAgQJ4JUVcLfcEgCpBbBOevLkUkBIjXXSjar/A/nRqtPWfuWOAAgAjgjM1QTYBQkwHucYzqfvAiC38rhMUgDA/nlf8IxPWq+067dKWn9JBEmA3mWA977+NaMmDH2NfpaG/kL/rUz8MDJd14mQ5zo1w8AkWBPwC+QAbQxeDISYCqoFhIBHgGEFi4JDQThxtCuNU/MWxKc0Tc3HOIanJH9N+mP3mZA+O89MfqQRTCfAzkkfu6A/Jf6msU0oT/Bc88VNePozSQv+sQPGzRe7+bek+WR5xCM9acnPPJXUHzKAcAx2/EhHfuZVpe+PNhTk238E/4SlIR5xln3w0JYAB14f2s6z/wAVAAS7ihoAhvbcuaxgZS6AERwrBcwJpKtdoI4/dqX++5K1HN3InpkiASBQaENJgF0fBeBbqATAtiRAgv///Xf/z09Ogf4MgwBIEqAF5HsAX6BfZeaRoF875/4BIoArxotNPz3GoRbor35zfhaQbwrgwzvP74d29Zupsn5bPTd5JvjnXZvv037i3z30+R/95JII4BwxAGTXO/H8CoCg391++uGmbX+LpLvBe3jqU5/6DH6pAsyGxgrkAAa3a4oFsb1xs/Au5oD+Goe5PME/c7hzvRI/tGL47vgG+e6mCACBv2QYJJqgP+Xi1wCuw3q5qwHw6f/kEyec858yHOUZjwAEATCudU4JgHafoOPMJQDQAnjhG9/TBPz8CkDrlwCqBgBEQAIg7QAh7OsC6BYJsG4elDtqNsz4mcA7fuw/nPCTf5vUdd16eTeA2gBzSYC3/eP7N/p5wF0Cf0EyYDrtCa57/hlnU7tAP0H6JmB/TvkSAI9+9KObxwD4NQBJJvt7SvpFEgB85HcMH/ECqLQ/3Kvr2yUAmOSYgDQJ3ADGjFUYQTUSoCjoFDAmaDQu6fCveQAqq5/uliQP8myF4Zdh2AWtWQ/i5fPkc5pHPpNAGxCtEfQD1LUrBeu2A3lSD/NU2l6E44ebtAJzJ3FAueXip11p/czPcjNP4pofUjv1x1imiwXi1/xsS6VtbfvZb/husOtve+PGf7HYtx9e3S/pEmpOW7L4AowCKFaZlhaAoEMg0wIsAv4qE0gLntNPO+ro+wL6q/KlDsbRbr16Mp+T9rCNJAEgVQCHtPuuFrx8J4BN8q5EAOAzVfrn2lkjJrBfx54EgGA+Qbx+SP2VU37ESeOuPwAE+6bq/8vPb1hgr7oLADKgdR8A7zR3/QX+LfBvn7B/tL6bKT/esQSA4D/jkz9rTIiAM2TAsBaBDGD8pM+MKsWnoOIMkT8HfDJ+HHf7lz3n4Cy823F+HtT3K8jvuZmzDXP+dn4fwxZkAJoyfAN+s2oBMAYB8gX87vyn7IF/iQD65sE15voVmiQA0NJJAqC6x5/3LOf/FxiiT46wIEIVg4F7jmEiyJ1+QD8XmQGCHvH5LzgTlvGmNAAqGFoXXEsCbHoUAABGmSvvBRh24gH/HH1YG8wPZdQ0Pqeyhi/dcTxgzk8EcifAK3/u769FAlQwrls5BwjPiTOVX4ZpV87JW7C/L6A/VQfKnjoGkKQR79t3nnYIn7ztE0bvmgxsORQuFw0sGKoGAM9bTYJlFhCCaYAgQFESADugUylQVAIosWd6w8hXu3Hwy/JIR5j5tOJlHtoFxMYXuFoPyuCZLYt4pPFZKI9n0gj0kVMEgACacswPib8GN+GWIRjPCRwCwDLxtx5VZp6Wh1+mHRcXQQAQRv65cJBwIC352B4pbUv6RvYXSQD8st8Yj/DFQvVIAORXOdOOuiUgFNBYwT+gpWV2QQIAnAX8yh6YFnwTD/tlkAHUzXogdffqjL8kgKBMwEf70daANgAjRwF2ofbK2Msim/xbJABlzgX+1HVb8J9aAIIEQb9upf5TkrjVsPsI8E8zjgkz+38vGmN33fFvuQFAeRyA96nhXdDmfi++/5akj+CfstrtR0i+S8E/79q0GUc7YRynwUAIVMMuIxdUY578g28/edYDbxpV0xdgo9dER/8r0gJz7wEQ+KdMwO8aAuCP/4te9MIzBADfO1rl9PseASApkMdn0KThG8KYDi2IK9K8U9WcTQBU8I+7RQDEZken3GERTiPyIuYQAMQDKLuzf/viIkABEOC4An/jJgkg8Em5BLwNsDwVBvDfBQlAGaj3o6rdKo9y7nj6DyzBWyvOXv0GgMjPt6z6ZQDCIQFQPYecWWUSZKddwNvyM6xK41ZJPP2m7DWs5n/I7ts+40knvWMA/hwg/SP7fMsOEeAHjgTMdL7eq+h9hgBg0cAghUQDIMGcIC6BXIJkASGAMYEmoFLwKIAkLgZ/7QBf7UiBcvq17ADfmm/Ny3QCYaX+GR87z4Ux3PjUF0OZAmmlu+dK/YlrOutpfkjDlJRp/oJxJ28ndPImDH/LQZIuyzNPpfkSl7zMT2l5hiHNL+ucdtuIdqNvCO7tO9lfiGvbEj4uUoc5b/hwjgTAuqPH0G7sPgNEE/wn6Ae84EamqYADdxrBh1IwnDLBM/7pbtkTgF+WnXpZtvZWXfHLZ7UdaCPblDYHxEHAsPNFP1/3FZ6JP7zP573kzR8C5FMG+fNu0+A3vrshzhQZwLpwHZX/lmZAEgAC+x7g13+OlARQ3d+df9zf8/rXPXCmTTZ33GAsa4H+9IMAeNMbXv0wO6YCfyRrcEk1v5v8PsZ3EKA/+0fLjp9psJM3fYf3afyWNE0tu7qpIxuHnEvHMMZu3nTHlIfUAoBpd/TnynE+X1z6xxoB0K9Me2oAjBo///qjD3MMQKCvzN1/CYLql27GsaENmdOv8t9sAkBNgMQJlQCA2Jy8ANCWWuenACEJAKHs/APoH/+GXxh3/yEAMPwiAP5JArQIAMmAJgBagKR1wLQEAFKQtU76jAsB0CIBxt3/Xdz83yE4aIusR8sOCQHj+v533Tmad7z1UQ9jV+ovCfDE+1/1iSkCQFCuFGDrVuq/S1nzru5dlnUReaEB0/s1gLuf9o0Pqzlin+f9+s71UxKW536u0eWAZwiA1ACoBIDgTgCXUgANMHQXHODIIkw3IDSBI3biAApNL5gkDHvGN0yZYeSj23Cl/kj80q29xuXZWnEpR5PAW9BfpXFIIwg3X91VUifTJfAXlONHOeMkXwgA0lm/LJMycJuvQJ+8LAM/7ZaFX+Zje6W07bI/SAIk+CecdMaDABgZ8ZsEgFPgUc5oARYUgBVARBoJAIFLSwogEnS0/AxPMJx2gXIPRPf8BeGHIKkj9WjVNZ+VtrCNaFPaHCDHO0ALYHEUYMab60dh7UfelAPA511ajoAUN3FaBIDpPjos5Fugfh2/FgHQIgIE/YYh+UlA/VP2wL8aAIwJ/dZZL4Q5JcF+yw74xzz4M28agTOAh/eZpJrfj+++Je0bfi/jexj6S/XHTX6+S+NX2UqffuZrXcgT4M9zsGO8XksdY89pAcZbwPgLn/3Z7//Jz/hjJ7/4GX98NNj5FYV9/Uwi8+Uc4J+g3/kbCeCvhnkeP74Jvkm/dSRH0BP4a/d+gAT6PTtpdqHJM+e97DHODQA7mxSMS3kJIOBe7WBAvwYiQHs9/896ehYBwAtf5x4ABgEBPoAU4CYBgBp0vQtAAkC5a/AvUN4lCZDgDDtn/28858eWgM0yL1oCECFgvu9dT3kI0N8zEAH+PCBaCz0SoILu6gY466dcBabnxjOfGr+6jXeIkrpaXyTHD1734j+3NLwnzN0veNLv8Q4E+C1pn8sw/Pzwudlzj4PPRWV9jgBgwKsaAHPAv8AWkMkEowREYgS6CR4FpoJI8zBOdetfJWWlX82v5mNdkKbLOCwe9VdaVwG2YBpZgX+6CTdNlpd1qHbzrICcCR3VPdvUcrIulpUyw7GbL5K8UubigbjkY/1siyppL4zgHpng3/akjQ0bFwg3wf9V3y24qO91WQ5tKpCQAOiBf4FClRV4CCzSP0GwdsEy7lX2BNiXBfitg0A/pXafI6XPq7R9AFyCc7UAIAHo88sXtIEFgEG+5M+7EuTjzndcw4lH/Ff89C9upfqfBIGgIIG9YB6/ll0/pfFwY3LX351/wf9i13CDVusn4VK2FvDHz93/f/TA94/AmeMI3IgOqJEA8F3Y3vn92BdaMv3STnreI/niX834zsM/y6thpqVu1Jv6c/fBAmT0G+UYslYL8E0D+gX8SoB/NYYRf1cAGOA4hwAgDnO3crQvgH4lAHD/vW/+0pEA4Bv1W0f+0w984CEAvMBfmWA//bQrjXcNjgF0NQAkAAT7VYIRKgEQ2o7T/Y8PGLZlzhEA4qDu5c8BQgA8+v53jwQAAA0CoHcXgMA/ZYId7QKhTcD1rkkANAHYuQVEu4O7Sb3mpOH558QjDmevBP+A/fe89glLjYD0n7oPIIEr70532tNvFQBfJ27Na5u0Na+LdFNv6+4lihIADHgSAH/66d/yEOF8L1Pv2G+gSo8FXAMSoEkAMHmlBkCCuQR5gj6kABqwCKDUCCh7QBKQCaA0vbKCzCk3ZZrPVDzDBLRK/ZH4pTvrjZ1yNAJwZQXm+BvXfCzDspGEGU580gnMsx21E2aZSv0sb0pmPhAKuEnvuzI861XbJduI929fqP2D94khvXEau/9HAmB6WXAulHPngkIlwCJBSwu4JKhIcCKgUAJ60y4ITilYxg+7Uv+UAm3koRjql3XJ+mrP57W9aEPalrZWC2AXFwIyzvr+APO+P4mAM+9ucQxgBIYLAoB4u9j9hwgQFCQBIKCvUoCf/tqngL+EAOrrjBvnOvmWHqylBT+VCHD3HwIA8IzWAqZHAmTb9+x+L+M7aWgAmM54yhrfeC1pGiThEChH8L9lR2klH8hpCCRAfe74C/L1TxLAsP/fp3zGqB3AfNfKek2/8TjLKhKggv9VBMDzn/83Ry0AvlO/dSXfYwX0AvtVmgCm29XlqGu21S6jNzUA+EWOdQmAxnpnup7bHANoaQHUuwDq7r8kAEAH+znAM4Bc/KbAUi9s1yTAeOcBWg7P+/mN6tOr57r+tgeSNr//Ld+2JAEE/ZUI8ChAvQ9A0Fol4Fk/gbTuVbLG132dJW2iYYefOzEEOCOoGVhSJkwGOMJ4bz1DvzXMvlG/C44F3PGqt7xt+JqvAoBp1bFLAEACMHBhKgGQgE+7wB2gJ3gVUCLxE+QmmBRkJqCcaycfDflrz/xrXhkHu3UiXobpBkjrT9wE1gm+KR9Df9MfaXyf07yU+iuJT7oz/XYA6E7ogvUsAzv+ltWS1sW4xMdOndMPd74v6mVdU2a72geQLOSRAn/jkdZw+tZR/X96DbAqlB1Tgb+7iqsIgAQPc+0JgNMOQK5u/QTPVSbYPjQ7daVOWed8Pu0CLwkA2p4dY48CbANk+S7Ij7wxkgASAFWOwHEA/cQjjM2g3MXfxg4YABykAcwnsBf49yQAX5CfO/76CTT2CRYYc1okQI8AgASgftQtvyvJmBYo35VflpH2Vv5oCQP8MfxywnHnf9WIOT+c3VqOUgjolQB7wb0EAOr/GEkC4yiZ/+aX3I4JEbGKAHDnX8kcbr9vSTbEvANA4I9kzEALQMAvoNddZY8QIB1rx/YTXQnfSQ2A/KWwqgEALhg1AAZs4C92jOuduTiBBfc6xwCIq6o/oCW1AMa7ALb8RQAAkIBXMDRXUp8eCbBpnqSDANi3FsCcZxQUzjkKADGAFgAm7wMQzCc4Tz/tyozXs68T1zw2SWPaQ5DUfzQDuJcAEPhzSymDFYskBrivuu9/GY+R0IfoS2nwG81wxwTaNRIBSPuE7x15BUiAU6B/9rK1m36oYg+GQaqq/1cCQBAHwMOuEfAB9ACgTEDV9MAkoFOg2JIJPLETJyV28qbcjFvzyrBMk/XCnm7AccYVXOOvof4tY7hpMl/ztDwk8UhDXmO/HUB6S2ZZlkE8y+lJ4wrwdSNJb76Ek0fWt7a5bet7z/6gn3HIy3DmtlCHsw9eiRXBoVQS7RwWYgAUjeDfHWQARAtEzAX+xhP4VglQxq8l0y8BNfZDA/6t+tQ657NLAADKaF/aGy0AjwIAZjcFY5UAIP9VJADAn7og0QjdBvRn2h4B0AP76S/AV71fNxLDLjsAAa0Jjk7sGygwDgGCUgsAAiDV/9UASEld/Y5a35LAPONot38Yp0rjpaxxzMM4hrvrT/35LfpDGZd2UI8bjG3MEa4rXG+MfYR1yp7/WAPRVwT9SMF8yg/d87TlEQDsU/G5H2CbatMGqwiAutbC3QL++AH+kXwDEEiVAMAtOSfgT6CfdsOVEgbIK34MYFIDAJAP8PcnOlNufAHgspMMHZ0GBKzMPQrABYBeBghQAQgB/j/ljs8bjQSB9wX0tABaGgCCHcAPdkHQbDncpN4jATbOc6gLII27AFqXBM6u25DPVNx83pbdtkHmUQDAPhoAqQ2AXS2AD/3OD41HGUagOrwrALQAvMoE1zWsujOfas98rrLdZ85nwI9dfQxtikHVn4GOwRMCACkBwPfFURKJJIB+NX/42947hn/qV/7kCYb+5s9T0ud89+MRnMO+E0CgNbKawzhz0419Af5bBACTMaaqdrOocpKugA9wywQEqMyJCYAp4CWOBgBawabgkTjYU1a7+VCedqVpdSuth2DZ8pGCX+26jYukzgJmJbv2GN1I4pnOMrMs/YxjvjwLJjUBtNcyKIe4pF1lenFJTx0s13rZXlX6fnz39AXthtn25EsYfYiF3MiGny7m6If7+DNf5T7KuLQ8acM8/98D/wAHQQNSUJ92/aoE9OKX4DftCfLxT3e1J6BuAe7L9qN+1CGldc5n1k672K60MSSMRwEAtPT1jTrH8E2g2VFJHHf4qwZAdf+L3/7ITjQABATu/ie4TzvgATdAGTtS0F93/AX+gAeBP211QSDhBruorAUkAeYQAJABPB8bbL7vnhSkt+RUGsLqd6o78yJe7vpz3n/fxMlGfXjNRJBlrC8Ayf/v/8ejHv72xz3qoWrue9KfOCEM89/80f/mZZAEaxYzN/qNet4/Qb92jtmwicSuP+CfP/qK4S3J/Di3EjXeSAwOa9d1SQD6e8tIAEiA8Z37zSMhAn/t1399vA9DYF8lY176sZ5GEwqp4ScCh2e5qnNwUwPAIwBoAAD6W+YMAfCXv/qv8f4WpPD8tmBgXEcL4MVvffCcFgA/hcYdAICXFgEgGeARgJSCG+U2QJ20U5oA2+QNIBtB3ADgqOsUmN9FWC3D9kHys4Wo9wv6U77t1XcsLwmUBODYAECV8+gVrCfI1a5M4Jv2qfCpsMzjEO3UfWkWIB+gT7vZfuOZ/wD/EgAAGn+nNAkAGE6A+6o+wYWTvFfi0s8kA5BL8mA4NgM5sIvfg66D/47cDDynBuClCT9AWY8AqOAft2AvgR9+gj6BJuAvSYAWsMSPOBVk4ja/KltxBb+tsPSzDgm6seOvX0rBMX6WgeQZNYByDX6CdOKZl+W2pHFMKxCvMsuwbCTxsm49u/llvcyHOvAekNYx263aeScY+4LvX3/iUw6SMPoNu//jZEgf3N3i4Gb/tk8jT8vY0Sd0ONnQjhIACf61V+AgAKkgf45b0KsUsAA+K0hOt/aWnAv43/ab/+XCNQaor2SAdffZlbabbUG7syBmAezPAo4k1wZdBjBEXr7D1ACgPNpdKQGAm7Xixz/+sU/kLv6mdkBAC/wD4gHECfwF/coW8McP4M/vhwP6NRc8X54jAQRAuevfs/N8EgG+mznSPoJsGfJoxaEsDBsWlE2bYwD+fP9XfWyDvBD0C+4F/v/Tl3/OCeYf/LX/9pzBH0KAtACrDT6xbhLmKHf2ezv/gHviYLTzXnS3wD9+kAVbEBc3OJIwRQDkGgs783wL/Kcf/d9vWQKAMUM7/S9BPna+4wr+E/j7KxqQAM/+th+/KIKv+063CGgSAI/7nt/6V6j39wgA/MG6d7zp3e/ljrDPHAiA8b2vu95hoURj97QAqj9uVP8F+oCW33fvTVJAsF9lgn7tgFnsCW6xJ1DXvQpAnQnfkyYAZYy7t4sd2jNlrtjh3zRubRvctBmEBJfNvefNf3AkAgD+aSQFPArAb9JLAAC+E6hrV2a4fsoE7vopW2Hpdyh26rs0C6DPLr47+0rAfRp+7pJ0EgKGkZaBsEUAMLjxjZx7/0Mf5ZK/c2bRj9j55x0D+JMQwP6IL3n7YZMADEILs9yFDTdjDoYBiwkaU3f/WXy48y+wkwRI4AeAFEwCMJ2gsAsuUwpgE2QSnu60U1a6sROffMy3FW48ATeSNOmudsMTVPMcgnxBOfH0E1QjE2xbN2WWRTzSk0+a9LOsLN+4tcysL3FwI4lXy8WNP+HWDVnbMN2+b2QL/BOXPAX/9Kdlv9sN+D8L/EtfHvv6FiuAQ03K5kCPAEhQUgGHwHWuFPAiBbkvfON7xt1uJPkTlkBZOzLD0h/7XBLgIuLV+tS6Zjtopw1tX9qc9tmJFsDQ6Xi/lcyZ0gIgjPls1wSAu/0CUKQmd/q1G6YU+Hs/gsAfyT1Xl/F9MlYBgtAEUAsAENQD/tVfjQfaG1O/t5bbftKS5qO07ZCSLfy833UB/rnbL/D/ss/79HGHH4mBCJAEwA7ghwz40a/7/JOfesnjRoOb9MwtuxinmZfIU1X+HpDf1J98tzkKwJgwlwBgDme9lWA/7Z7/p19JAPS0AMCglQSobgkAJKAfIwHAtw7Rt+mxqF282w3zOEcAAOgB9hAAgPzW7j8EwMa/AFAritoSA0MeA0jgjz3dvBhAfwX5uCUGWmH4Cf5TtkAugGkj8B9API8D0JA1v+o+B9IirwwbfyVgocq9z2MBWaZtlO32Ba/8kXG3313/lJIBagH88Ad+ZASzFazrVgLS094C7b3wnn8rj54fx0l6YT1/yu0ZwLpGtX3k1M8kCuyrhADAtAiA137na8fByMGT7wX1LRYnHJvJdznaAf/0rwkSwDS8+1E7YCAD0AigXtQBNbX6LR+IexzUmOzSsBDTDaveIwAE/gJ+AB4TcBpBIWGCTsClBABSgEkc7YDTGkY64lRDGdXPvACc5GW+glgBr/66BcXI9MOtETTjNn8kRkCeIJ34m5p18iEudbAs3dYt608c3EqeFbfPjDTMNrKNbUOl/r5r3r92w4hr3oS7+08/Wyz8Ae/b/J3RaDFfCCyIBuSQuQTBNuUcXFrAU48AADhWEALwELDOBf/GA/CSH4A/wb9uNA8JT7CvXZmA2t31XQF7dsF3kZckQErrzXO0jG1K+9IG7IzlXQCL/rdR/+Edk1++TwGkO/9qA+DPvLYLAsDdf8G/IBRAClhAMne2pH71jH8CfwHBNm2zUYNGIsaibUgASQHbiOfG8A4E8il5T+kmnsa05mV709YC//Gc/zBHxyMcqnU5JjMes45YjMNjfVk3VLAPiNcPO2Bf8I/E74k3PnUkBgDoEAAcrcVgVxtg3GXdolWYowT/U7v/2xAAXBaY7bFOdVcdA8j1FfN4An7tqv7jTvKLvpYEgJpDjAX00wr4casFwDyEW7V/CQBJvy992nefYLgbZdRc2Q3xv07TbRq3SwCgBQBuBexXTQCwLeHcC7bRBYBZWzo1DctLaJEADiKG4WZHeRXYTxIA4DpFABAuyFUCgLCnFBTNlS0SwDzn5tGLN+7QDkQAcld5Wpb5pcSeBACg8AXf+6ITtAAE/Eo0ACQE1ALg2AAAViBdAXu6tVdpWqRh6TfXPgfokz9GAJ+ygvOLcPcIAL6FnHhZmPjNMPEuCYAW2K9+hXTindsH6BuSTxAB1Gcx2OXnfAj2MwQAk5FGAgC3u/8tDQBJAEEfgA/wpzuBIAAQMAoYRDpJ4Y9fNUxcxjeMuILKVdI05KM9pf4CUyR+livAnwPCfZZV0vznSspeVX6rzFX50648H3nn82s3fbYX9mzz6vbd5zs3vm1LGH1GUD4C9e2A+XKRKXFFnyVfyuC7s6zhg7t2BAA7KSyuWIAJEOtusQSAgFEpqF9HAnzJX8BfSQAWgIYRD7DTAv6CaQH2LkC7efC82lNSFvVhh7wa/GtddCOraREA+EkCUAee32MAAN0t54AbLRKAcnif1N/3ih/z2iYEAIv8VPtV9R+Qm6BUoOpuf5XMrV4clmf8E/yzE8i3eQgTIWMGYxPjItoAHgcADAnwt5HZdtXey1fQD/DnZn92yxdj2CE02Zk6nBlvhw0PdrcB4wB2DW7A/XhufwH+cWMA9cQT/Kv+7+4/YB/Drj8ySQHckgBI3JTFPHOmkvMdNyhXAmBTkG+61nEA8h6PAWxex9umfg3ANQHzOHZBf0/Sx37sR39kJJns80kCOC5wrwjfdYsE0E8SQE2Acfd/OO4j+E/JmLYtWTP/tW4Vs0kA/MVv+cVfrgSARAASYoDwv/A1b3/n1gQA1Uf1gxcAyBe8KNNPEgCVDUDIOiRAJQQSzAp0qgT0JAASIK8jKwmQeVreOvllXNJLBHA8YNO6rkpnPZHZboBLwL4kgMBfIgCpFgAXArL7XcH7NkDevCpQ150S+9IM9UhAj/0iQPw2ZUgA1Dy46Z9vRRIAO7v/SBY0XNo49pkK9qfcCyIg37t2+y/HA2i3LReAW41ejcSCoSUJIPiHXcakm4UaJo8ACP6VgH6AngAwSQCBIBMSwJF4OUlVoInbyYu4hksImN+UNI1gNvMhjPLxwwiGjbtKknZVnAwXyCN5BgE45WKsg27jZB5z7Vk321g/3UkqUCZ5Uyb1QBIPaRtWSbvrN/UOCLONyY8+wXdA/xrB/+lOln2x0U27XqY503/tu/RVysGMIGPzcroVOIQAns3d/0oAAEABg4JEAWJKAesqEkBwi0wCQMCvFPynpF7UQZBdwTQgXbCdgH1TO1oI1EeQj3uuIQ31tGzrVeuMu0UC2I60Me1EPdz92vaMO9+LP/fou1X6npH4McdxOVnu3gns9UvpAh+pSfCPPUkA5sse6GfNyaK/B/xZ9C/A7CF8QmfrMIwT1A1wVYkAgZGyB9y38U/Qz64su/3Mw2creVguxti7v/CxI+hOYI4dMK4BvGPcyRfwC/p1J/g3rdI8UpJfagKkNgDzzbqtBSD1Z/zm7P4bRynwn5ISANscA6CearJW6XzPvN4D/fijBUA/h5Tie546BuAYwZq5dRSAcV4SACkB4D0oAn9JQO4AwaANwLy97nu64PhnCYDhLD9HACQAAPkJ/LXza3DE8fw/z7n2BYBnHnQYoJgEAC0J+HFXIwmAGkbvKECC/bQneK12AU6VAp6UI6Aqu6Wr/JIIqHlR5qr0U+Gk98w2ciru3DDrVNvDdlOjgp19CYAE/trf/647x58ERBNgHS0Ad/MF7YL9BO4VDM9xc4Z9TrxDisMzr0MAcLsphgUNixYu+Wuq+7dIgNKv6/vXTT+CdKJeIxg580FfqmMJolhcstBIAEVd053gn0k/gT8TLQZQCOiTBEiJvyCTeAJNJitAooASKSB2IjMcsJrAlDynDHmRhnxMq8QPk2DY8qbAdsYnHm79lK30xqP+GOqBESDrtn41L91VWgfLzGeyTMOqtMzqbztk/fL9pJ0ycLfeA/48K/ljp8/YrxoEAP0x/5b9c/A8bx/mQiZT8qGfki+GvklfpKzrTgD0zv8nIMSeoD/tAtYqe3FWEQASAcokArBLUgCyKyGwiggQhJtWgN+SrHkgfAH+hEsAaK/ScCXhgn/rZfk98C8hQFvSfrQ7z8tCmEUvC+Btz74yRrP+Y4FtW1JnQL91xx8CwAV7An3thrUkfgL+SgIIFNzhZzMKMCDorxf7udhnkX9IO/45yPTstDXjB2QAZ+4BRwIkgHo1AP9NyQGBP5oHXPA2EiSnpGWveofhP9RxOD/4AUB8D/wnWNcOoJcIEPCTh3alwF9peqTn/93910+3RwJ4h+s0Fm0vATAF4gkDyFezKo3pKOPpj/zTn1ynbjVu7y4A5m9MD/xX9X++c75tvmv6Inb6M/6MB9UwviTY187Yw9ivezwCsAD6EKEeCVDiN/oPcdZ9T7Ut9uxebjSwxmA3f7wDYFDtB/xjwK0CfyRu/CEA/vsvf/XmFwDWB6OhqhZAjwzQP48CqA2gTODfsgtkqxTgpATs4J4LnnvxkgTwXoDMN+29PKb8ST9eFDgAs13cD2B9kJraXhAOr3vxn/ukgL8lP/wv//xIAqQWgAA/pWB/KReX5PUuxjskkL7Pugj+W5oKLQ0AVJr8GRcIgNngX0IgSADfe0/S33hfI/CpH/XluE9BFQuNwQikEkwJqpCVAGAcShJAsA9o1J5SgCiAB/g6UQEQBfmCywxPICqY7IFOy0GSjvgCWsuhDpZNHEE14WmIJ4hWZnjPbn5VEh8/8sVQdhr9azrdtbyef8bL8syf8Cw3SQjCbJtsN/xJn+8JP/Kv78J3aBnkQ1+gz9CXxl2tRb8buv55cD/lF/2VfOybSPKXjJIAaBANl/O17aHUVAsHBGqSABDMTxEBxBG4mgeLOQ1+hFcCAFAv2Fcm6G/5ZbigdVPZA/L4s8gEgFKe8Xrl1HDSEBf/SlTMIQJoK9qbdqMN3AWjT27bDZIEcKHte1KqAeDCHeCPXQJAqZ/xkAn+BQECf4A+l+iyaO/t8Av6kZ713Zb42LbNdpD+BvMiO/IAdM9MSwqkTGIg/bED8DXkAbFAfgA55tcDWhvMajLGW3b/KwEgYFcCztOeQB57JQNaBECmEfzXnX/L0V8SYJxvZj3Rbbcxf0gATO3qG9YjAFqq/4J/0nAHwN/9Q496eGa12tGGuZA5tqcB0CMA9IcIoD9K9LERliQA3z0bZDk+aJ8iARiHHJuqZJ2tYYx2LIE85DtoP+il+54lAAYNAEA9qv1qASRm1Q4BkOr/y3XPlo8zngfjBQjw6+5/uokDYbDJUQBArDvYCWh7IAfQTVjKKSA+FWYjKmueljOVx6owwD/AHLNtfrVNbK9sv3tf8ncfagF//Tga4F0AT7z/VZ8A0Aryc0e/BXD3CayvSt60V69tIMH4DjB8O3wjEgBIBqq1NAAgAYIAsH/WfpBuSIA/+di//qHh+wf0XPbfGQLgtmEyYYACSGlYlGgEWAn8WdAKuAT7TEiAb90pBeUCRAClYFMQmlIwKvgcJ7sBdOI2D2WGmc68lfgTDyN4xk49LEN/3Br8ev7EaYWZtkrzEoy3ZE1T3bW86ia+fkjKUGq3HZC1zY1jubafUn+k7d+ShPt89JMkAJbAfAHo6X89MwKIRTjpMBJV5EkfpS9mX6M8+uyynMP45nb2zfNcLJ5YbAnakS3w7460JIBSckBJevIDtFZDmh4BINCvUrCvv+6UAG0Bdw+gC8YNT8CuvUriQvpWEqAVz3yrtJ74VyLAHf8qAf9JptCevCc0ACBsdtIBhm+BvOriOt3Mby7W58gE/tgF/W/+4TePC/be7n4CfkE/u/18l8OzHsI8t5MmP5PJ0P6MP4w7PGfLEOY8iiQ+BtVt5tlrQIrcxnl+VfhTA0CwrxSYp0xAr508BP/ITG8cpASAu/1K/MmDOwD0I/46qvbMIRIAU7v5FfjrnkojAUD+OyEAhk5Jnxrn49d854lEAPM0fgL9KQlhJQHgN89xADUBeiRA6z4AgT+yZRifmAuQV44EGL551x38nN8qAkD1fwkA3tO4FtnFmEhmNKBAJgF/yw4JQPwWCbBKE6BHAghwE+BgFwgJjvTTva6UAEBWbQDzVq6bt/ElApo/BVdAnmlSWj5SY/tk+/HTjIL9nvQowLt/5bVXTgX/MokCCZJeHSAA/AlAJEQAu/8a7gCoBMCn/5PGTwC6+6+M/uG770n6DHcCfOafesJPnFlQXI7jlABgQFoMbg5wLlx6CxzAVpokAQD5gL4EY9jxx1SgKKjMnWXi4AacGj5OcgtAiZ+AFv8aBz/SWhZ5GSeBL/EEqNgFzeaJrMY45FfDptymMw5ujXXQbRxkTTc3zHjmSRnYkbSBEnslAPJdYCeu7ZfSMpCZhna3DOLz3ukv9CfmLhbA9DUNi2HtKWs8wvCjf5IXebL4pv/V/oa/6enfwyd2rcAIbcAt8yy0pggAgHslBvBLkwQAC7SeIQ3lAYyVgnuloBnZ8stw7QBs7BWAV7fgvfrrznDtAlTqop/x58qsJ4B/lRaABIDtlccA6JO7Gu7p4x4JSPCPnfmN87ou7qckO/0s9AUA7E6zMw3JgAHQY9KOmx07v0G/7cW3tqtHPOZzwC0AsIYAWKUBACgHzCeIn7KvIgHc4QfkSwaklDiQBMBNP53TlMwjgPNVgN7wluyRAMQF/O+SAOCZmP8E/0s5zMk94O8RAM//59jAGFC1AAyvRCLaAYwzOfYI/BlbsSv1T2m6qgnA2HJg48i4Vmb9wfoFAoBjAKkBAOBPrOruv+r/pFuQfrtZhzD404AtwJ9+SRLA4nIfwCrQX48CJJhNew/o6J8geRt7Nix28qpl4N6mDNJKBMw9FpBlWh9ltlO2Jx9fgv+3fNMfOMHgp1QLgLsAeoD26P8PzrTNFAHAzwk+95u+e2meed+rlxclQQDAZo6XAArqBzkL/BO/QwDw/u0LVX7a835+9oQ0Z9LaMM45AoDFqQBLkMU4k4aJNE2Cf0EYgBDQJ/DXv0UCCC4FkQlGAZEtwKkf4YJQ8hGEWg5SMgHwSzriC36RGvNRGld3BeI13HjrSPNEalrpV5VlPhlPP/Izb5/V56f9MNnmhNlm+pMHeeMmPOuIv8ayfC/EJYz3Tx8SJEgC2N+Q+LUMYQJ/wumX5EW/ox8ifd/2M/yIZ9rh+7Cvb/ipHF4y2gACoAf+E+AnAZD2jIOdMIDylAEMs4gTFGsX7CsNR+qnzDDsLBKVc0B5Avm0kzbd2MnXC6gA4hmeZX3ZO08vC7RurToZRluhESAZsEoLgOeGiKAec4HI7B43kFv0c3aW/T7o+47fT33qU5+B6jrmG57//FdguFUeg92we+6558tJz7e2+F5mV+EY8dZsAQgAjgBwgR+77qkFoN3L/XBPgf4aJglAOrUBjJNgX3uSAcSTcJAEIJ9F3558WYyrEACAdHfsAe5pb7klAnrg3/SCf8rY9g6AeJAbzNlL8D9oAzDvQgAwJ7eIAHAIRJ/gPmU9CuBRoEoA4K6XAjJuCvJzbtJOuHOQfsQHy7JJjbYUOBWycc77ijbYp3VcPwDgGSMlAAD3HAHAJAFQd/9diyxIjd0QADwtjQQDk4B/yg4ZgFpcvRRwHUIggW3aK8ipIJ3wBEub2JMIQBuglqF7k7wzzTpEgM9Vnz/bRgIAP1T7JQAE/0pJgPxFAMDrumA/1eDTvm4+Vyl+7zkr+IcIQAMA9tLdf+wsAOsdALNIgA4BYH/gnWNX6k+9WLTtc9RakfcpKBoWkAxMCbKolwtIJkRNAv+0VxJAoCgw60kmLYwAsoJRQazhSgEpUhBrXkjL04/6EM/05As4NX+lADbzz7AMx14N+Ve/lrvm2YqDXyu/lp/pCWvljR/PW41tJ9BvSeKQfw2r9aPsliE9/YN3QT8SnCghBbRXyWQLuBHYuOsP0CdPpO9aKdmwBDP072u2+893zfcHoHUR5aJKUK/af4bPsQNW01AGbqR2gTALN8J0p+z5Z5xqb4Fu/OaYBPbVzg5TjwSgDpl/1kl/42SYdtq5RQRULQCPAYy7W7zA49+xBa5wCzAuf87nfM64+y8BAAmAwS3wJ84jH/nI8af+CBPET0lAPeFJAkgoAOwJT8AvCaA079QEwG/OUQDmDUG6oH5KCuyTFGiRAOZh3hAAc+ozt4tQ7+c//28ujwGMZMBijdIjAPjpP9a+7PonAaAmkEcBIAB6JAD3iSQJUME/Y6jzjiRznaucs/AnPUQAd4wc2C8E3IAAcG2MBkA9BvC0n/h3D2HOXP43xGNdw/fCOnt4n7sjAFi0owKWu/wSAPq1JCTAOqA/z7EnsNUuqGnJXYFyATrAv0cEGId6bFKu6Uw7936A+ty2izIJAM6BV8Av8Nc/7wK4/y3fNpsA6IHgqwTkN6lr77lb4B8CoKr/c0QG1k4CYBbwV1tgBgFAP6CPKLHTJw7gPoAlCZAEQAKxueBfQCYoAwwmKMNuGHbBOVIwSRoBZwtM4pdgFzegNgFq5qtdAsByzGNKWr5xWsA662O8lKvCjdvK2zBlL69Maxz9UmLHJAlAW1dgX90ZJ+2WZXzfA/4tQzz6EiBeQ3/gHdnHlJICAn/6I2H2MaX9izy0E+aEO+4g7HrSnbsi23M81K+TAHARVaWLKhdhShdqSOPol2Bf8J8ywT1pAMNKgbHSuFUarmShiL2Cbt3bStY8kADsxPN8NT/LTqmduNqRLUO7pyZAEgC0L9oalM+idqeLwD33s2P2xxZotMCNVP/3GECVT7zxqSNBoL8EgABfoN6SxAHAA/wF8umuYD/zyPiUSR7ER45ArPFAS69hvuACP7UAErhrb0mJgBb4NyzBPxcAcofCstwdWJhPxzl/cR+Ac3SLAMAPAgCwn0YiAD8vtEwCgPCqCQAJAO5kF985hDHTuQZZ56XqlrDWn3wgbg+IBDj3U4ASABwFAPQnAYBfqv/HWmQHbzqyYLFEw1egLxGANEw/AFD+MoAAdS4pILBtyQqGcQuo0y5Y31QmCeCxAMvJPDcp0zTkw70AqGwD3DPftBM/TatdbGPCUL8R7KdMIsBjAPwiwCZaABVI90ByjXfV3FPPhao/u/2p/l93/z/+8Y99gu8jz/9LAFQpQbCUgP84BpB9IO21PxCGH3dyAFjic75o6zkCQIZTEoDxRWDGriP1TVP9BPkCTYGZoD/dgFtAJXEFjQJeJROaYU5oVRo3ASqAsxIAU+WYR0rLSb9xgl0w69Yrw7G30tU4c91z8+rVhXKoM4bnTzvtVdtMQD8lbcdWevysS0ryo9/Ql+gzxsMPt4ZwCQD6IHbC7FdK322Cf8KIf913/xkk2EluEQAuulhIYXdBlnb9elKwn0QA9vTHLqgnH0GxdsP0X0dWcL6uWw0ApelVwweIs7jUn7ppR9a6Glb90+3z0s6Af8gASQD8CLf8S9b8uug55ljeNWgBdj8ZmwGtw+UtHwDcV4CfO/8Ab4A4wFyw3pOCd8N1IwXzaZcUyHjaja/EP+vCXLLqdXA8JkkAgHuaFgGQfkkCpH8lAJirVtVlnXDe0ZOf/ld+c1yjLI4BMP8nAeD5fyQEAOr+An1lEgL6JQmQBED+ogjraMZE5gDGPI2gHul9M3Mk8cmLIwGsBdZpiz3EXd6VxfoijwF4F0Du/uOHlgDxiM+7Gep0ut7edeXYDeAnWgT4An7lOiSAQLUnAS6EVVCDO0FPtQOY8UvgvK29kgASAZZt/puWazqOBEAC3HjOj42/GJD5Wpay1S7ZloRzGaDAX9Cv1N9jABABHBuYAuZTIHgq3XUNgzBhsVXBP0QA34Sq/8qN1f8D/Pf6hN9Fr1/w7hggdj0mrJHfcmCDHU8CgAkKI2hj8hSwJQmAHfCVBqAPAEzAj50JSdAGkBQICxZxAxYFl8YxvCVJgz9xSSd4xa0dWfOy7JTkM06gizwN0083MuuS/tVOvOq3yj2VphVmXTLfrDN2DG2gybbKdsLeCvOdWIbulIRZFyX5aads7fhnP6J/0dc09jdBv30pwX/aiX9m939fE+4aH9e+onL8b4oAYPHF4qkagOgqQxriJOjXXf3wFwiTTrvS8J40HjKBtvZdSuruUYAeCZD1STv1SHe15/Nhp/1Z5EICuJD15wB3vfDfVx875ntsAVqA3UuAP7v+gH939JGCfqVgGzDv+fuWur6AHSnwR+rO8GoH3EMCVCJA0J+StLg5ToB9jto9cwgEAOBdTYAkALQnuF9lr+B/cf5/d+rgi65K3e+996tO1xtoAgzzcRIAaeeyP9T8VfUX7KfMMIgBNQSSBMAOEYBkfc08sAn4lzBVJknAJjfrgkv8IkfwfuYYQOPXAM5c/rdQ/2dNHQTAfh4BEsD7AHgJPfCf/lUTYK4GgASAsgVuBMRTEtBEuOBpU1mJAO8HyPwtR7lJWezYPuLzXzDe5N56rtoOtk9K7JieFoAEAISAWgCv/Lm/P/sYQIL6HjFQ/as787hqdtX+W+Afksyf/hP8cwaqpf7v7v9yt1+V/ypDC6DVJ/Cr/SLdfHOLowD7GRhW53pGC6ASAIIxJABLUJbATQJAKWAD6DEBJXATIAIa0y5IRALqkMSpoN08UwooyY/4AlLc2Ht5EW4denbLMTwlYa/9ztcu86hxV7kzL+01jf6rJOmm0iYBIBFgO9E+Gv2ULX/LMQ6SPJGGISV66A+4q0nCiL5T+5f9yHzsF9YJt4b0LH5uhd1/PulVBIAgHjBajSBef9wa/FzAYTduhle7+QiKJQKU+iOJm+6WXdBPmPZtZObjUQCJADUBMs4U2J8K89lsD6S7XiyIOQYAMU1fXT0sH2McW+AwWiDBv0AfCdhPAyCfAv4VyFe3RID+EgK6q5QASMDfspOO+hp/VMde0bQvfPZnv18SQMA/V1YyoIJ/1P+Z61ZUYeNg5s3nfs1zxvsAmHMT9KsBgJ/gXwnwf/Bn3jRqBAj8M0zNgBYJoCaAGrXOIYx/aRLUA/TTSJi2/MiPe1QWd6jsnDiZ2djjPQBslLHWYHcfNX8MFwF69n+p/h/n//dOAAwPcCMvBUygXzUAMgxQ5HGAdQgAQW2CGe2CnhYgaoHyTcB4K00lAtQIyDKrvZVPzw9wyW/N8+z5bD53S9pOSA3x2NVPsI+9pwWwq2MAVw3MZ33nkBT041T3TzuEwPizSPHTfwxW/KRTqv8D+Hvg/5x/gH/7VfaL/A6m+gaaJTPYzVOgvvtdzSUBwCDF4AaIYoBz918SQPCvTMCfdoEbQI0JCPAKOEQKArEL7gVxglwBHlJwWdMa1/yUglvyxuBPHhjchBsXab5K/Vpuy1QSFwLA/PRfJWsZc+NnOtLoRlqPzItnxa3UTjtwYZDtgrSt9SOO70E/pG1qO+tnudTFevFeJX8IN8xw8pcEoP9giG//IT1x7B/Wp0ri01dvFfDPYqUSAO64IFksYRKoC0r1m5KkZTFGXqQjrjLt+pm3MkE9eekmvGXXDynATsCvf/qtY8/02AX/SkmAVp7EX2Xqc9kOSNqLNrAt0QI4XgQ4c7l9jHbpLQBY9rx/C/RLALDDngRABfOA8FWAvgL8Ve4W2G/5SQBQf+xzwDdzCc9USYApjYAeQUAaDMAfs9BC2BuIZR3HUQAvBUwCADskwHe96puXBACgXwPgx66EFNiUBGDMS/AvGZpAP+0J/LVzlIrxE/DP2AmByty38i6H/Xw5S21Z+kfrGABEwJIAGAgC1tFjXS/iLiIKAvSkJsAU+PfIQIsE2CUZUEGRbkFTyh74nutfLwmEBJjSCJibL/EAahwFsP4CvBa4w6+Cf/1G/+FOgde9+M99UhKgJVGdUgugdRkgoDiBsXZlAui59m3Szi1jnXjUZ1Wdbv+KV46ESmvXXxIA0gvA784/Em2Aqv4vyFfO0gCACBhM9ou0r+of3C8x40LAcfC57eZAsitC4GY+Q95M+IwjlQBg0tQI1pQAMECaYE4AB5hL0AdwEygKDivAI34CvASY5mUeAkn9dQNSNQJP3YLhTKO9l2/1T7fAO/OwHsZDtvwyPO2r4hqe0nqsKkvgTnsksE87eaRbO2nM3/bUjzhZH9z13fqMpCEuhjj0F9PTZwT+2Q96duJDUDEh02+Dad/bAms/a4v1cm0RACyUNILPCvTZhdZkGH66SevCTOCaYdjNX6kf7jSAZ9wJoqs7w7ADxPVrgfJ1/Fr5AfgF/0i0AogHGYzhJ/5qGdanJ32mlNgxtA1lqAFwIATAtf4+1vuajrF7LcC4qtq/YL8l3V1fBdq3DQfgZx64Aeot4K8f8anfOscAaA/mlR7g1z8l9p4R/KP6v5ijek2+E38IcY4CQAIwzyYJ0CIAOA4gCaCUBJAAQFYtgHopYGoCgC+TBGBOSSPIn5KMnwJ/wL+GywEv4SjVSgJgCf7j/P+ocXJz3b6T99vNhA+29csAueuvXcmL8jgAPxE4F/wLaFNWsCNITkCUdoFTSuzbmhYR0NMImFvWnd/wi0tQ7zPU59Vdwb+7/+mfxwDq7r8aARIASHa4EzwLjlfJTNOy9wB2z7+VB37rxu/lM9f/EV/y9pPbv/j+ky96whNO7r777pOnPPel44V/lQignyfw185i7863fnD583+zQb/HAOin2CcIAPtDldkPCOPdrmCml4NPGVBuAvjV2gHGzfFDvzP5exRALYAe+E8SAIAnsE+QJzAE5AHYMp5gT0mY4FHQh1ugKXAUTCotA7cgN8G+8ZTmk5KwdGNPYG1apeHGwW2YeaU77Rk37b046a/ddEjqUP1x2wYpacuqAWAb2864NfhhyIOyMOmX5ZIGN9L3V6V5VJnxLBu/mpdu+gz9T5a9fBfZx6+dvRIALeBfgT67KGkIx60U5JOXBACLM0kAwazxdCPnGMAz8QTRaddP8F8B+CZu8jS/avcogMCcZ2I++MFf+8jS5CWC1m9K+jy1LSiDhSvtzGL2An8JIEH+zXH+5jxR/fxOMp1+R3kLtgDzPz/lN2f3PwF3gvRd2ikj87PMOVKiAAJj7qvk+IMgv+7w98B+9Rf8I8Fnc8veNh5rLUgA5u1KALzpDa9+2J1+gT7uKSJAYgCtAI8BKPNOgEoCpBZAEgA5x1QSgDDGZMZLDPMUbsZWSYVLuBdgXCND4Lg+rj8HeOkEAJ2GTgYIEuBXWbUC1ARokQCbkAEV7GxCApBGYLWN3BURsPw1gAGsCf59rvq8Ce7STjzc+n3BK3/k4dbOf/rlZYDv/pXXjkARsJi/DLCKAGiFbwPYE+invQL3qbBtyrecP/30b3no+971lIfe/647T1783Dsf/ouPecwpGfC0b3zYnX/6dt35d/d/q7P/Av+FzD7Rstc+kn2B/sDFkI+964UnI4jpj/w3CGenE7MEPLCLNxnGXNRlTunfti/ysQzGEcBVHgGACEjQn7v+2BPUCSbxA6xpJAGQGP0FgABI7QLAzIv8BJ09yaSnIU5Nk/XUbjzdVWZZGZYEAP4Zzzz1a4WvCjON0jxxYyhfAkA/86zSNhHAtyRpANkZRros13zM37r5ngTwgvV8n5mP9SWd7zrTtuzmRX+jf9JPl9/CKbjJfn8t7RIAAn+kwJOFkuAfqVvw74IqwX9rgZWLskoCUBb5uijTndL6AJq1p5wC04YJ4CUA8Nc+JY1X89GfetMO2U7UrZIAqQ1gXj2Zz4adMhL844YImKHttWmfFbjfHN8XYzqL1ikzzh/n5xDrYb66r6xk4f6spz7lBajvMnZoRnXewc8wJf5pBxCTZhxvrmwrzK84z4sGwBQBAKBWA6AC9ATr69hb+STIz7zSv2enflxaSDj2+S1w222seQDvAvtKBFS38ZCCf8iHiwT/PB99lKMAz3zmM5YkAJuOGAkASQDBvTKJgH/0wPeP2gHpV0mAJAC8FBAigLU3P7MtCZAEQM4vaSeOYynzGnMPfv7MqnHxuwwS4AwBMIwP+XOASwJgMb4w3hB/eB2Oyet0vc3jMki96NX/85IEEORLBiQJkH6QAExa62gCJKgV3FbAI1hugSP8APnKbQB/L23rfoDUCOil03/8KcBBAyDrX59Rd20P3UrBH6rf6xwDgADg/WA4tsH75V1pIAY0uyQIBPJKAfg6cpu0WQ67/jzbc17ydQ9/+F/++ZM073jrox6++wVP+j2IADQCaKcE/3kBIDs9rd3/lhZAy2/sF5IAi76bfQO7/aFKvxH7gxJ1VMD1xFc/DiKAfyYTjETAEgAtFnwx4OTi7XQQMk4u+BZ+DFbkRb6ynIwlkgA98A+QB8QJ6JCAN8C9fgJ9JeEtEgCAKMgTFApGBY8CT6TgNGULoFIP45hPBe/EST/BNf6mqfaMn2FZx3Xt5tNLR7gm66hfTZfPjd32rNJ06Z9tWeulW5npWuAdP+JYT9NRbqbV3svjVgb/jA8QAIBXCQAXTIBMDGECfO243VFJEsB4pCMfd1hYYLnYQrKIS6LBMqsEIJuX0jiGIdOvgmqBP/7aE/Drn37GM8w8qz9udvcpPwkA7PglCYA905tnS5IWf/NVXdV8aQvafccEgOP76djOQnMYywX7jOUaxvSWMRxpOvLozCF0vyv3x7NxUXbt04IKwQQbB3cPGwhfeM/XPMwaohr8x7AhDt8geZL3lWuQuRUe+gFn1i+aAEiAn3YBvn4Cev2nJAQA4H9dAoCmYi1EO0gETIF+CQDB/2JN53c6t+V3Eg8CBy0ALgVkHk8CQGCfJECC/PQnrvGVq0gAiQDW4ODNSgLk3JJ24tXvNMPT7nfLd7iTBludybmLANUC8EJAf/6PdTPjbRAAq3PfZQxefpIACfTTnmSA9koCzNUESHBTgY/uCpRabgAW/ikF49vIHhGQ9wTU/PkZQEAo9c+6+jzK+uwCO8IzTH8kQDZ3/Ks9fw2A3+0E+EsCrJLEhSHjXSaIxi4gR65rTG868043dv13IRP4oxWRwF/77/7OHScYSBUmafqyu/2AfwkA5Na7/4L/GRoA9o+Urf7AexoXh6eLr9ZQcLrIG8IZWBhgMJUIGBck5HGaz82FoSzk4E8czRiv+JF/EgCMJZIA7voDzgDzArp0A9zd3ccO0BP4r5LEJ0+kRuAIUBQ8JqgVuLak8RJsZj4J4NPfcgw3b/2VcwC4aXchLVdp/XQjfY5WebQH7avUjpu01d88zF+3ZaR/pk3wThkY/UxrmdbZeIRrz3Skp19lvx/7r3279dVcQz8JAMBmGgEtoL6aBP+VACCuYD13XXKxBVhiwZUkgGmQgF9k2vVTZl2rnThpBN4tiV81mbbazQN/wD8EMLv7tldKCBDCJQKIl/lR73Rr93kYxwX/2PWnXWjnJ37py1dpeq3TY5dzguCdcZ3xW8M4PscYH0ke5neVvy+eA3DAO7UvC/rpx8+879UnrBUe/ehHn6Dq/sc/67NWGuIZl+OHHLld54VdtbjsgK8iANjhBlgDwAXn+5JTID/DKD/d1m8TAsB3xjooiQDBfpWAf44P8N2Z9rIk7w8SAE2ASgAI5t35V1YiALckgJK4kAD+PGDVAtCtJoAkAHOIxm9yG0lejLEXRAKMBCtjJOtuNYckARL8E874c6njJwulJAEE+Mhq109/Lsvhp+82Bf+CnAQ+AGjcCaTTnoAf/wrGd+XuEQEtrQAu/6Mdsp75TNh9VmQaw1p+hHEMYJUWAICXXwKAtNH0wH8SBNgleniX2wLxFqhv+WU5q8IzbrUD+vHLHX8AvoAfKejX/zd/+ZQAgMVH9SgJgDz7P+fm/+bOfwL/FeC/9hHdvb7CMQC0AADancliudhjYGGA4ftmUkImKCJ8OfgM4P7MIDS4CXPB50DFgk8/ZBIA1ImJBAkoB4RVlX+AveRA3dkXJM4B/+QvUEwpIBQ8IjUASexVGt6T1qvKBNVpr/F0z4lj3F1Iy0NqJ1/tynzubBvstKd+xiMP/Ko/4dY741Y/0/quetI8kD4DduKbZyst/Yr+Tp+ljwa7zrdxy/xxkVyCdoE3QLYCf9wV/EsAAFCNT1ryYTGl2mVdmAGe8CNcYKtM4N/yAyhnnHQbXzDdkoJ4ZStOyy/jC/4960+5Cf61A/olAaoWAGlqOTwXaSv4tz2RxoEAoP9u2Fnt58u5QKCeYzpjN2WkcY6oMuNgJ63zAHma/5k5ZMPKX2QyFue8e/uwBBbHYwH9n/vffe4S7Avq50rSGpf1NWPSRT7bRZZFf1ELYIoIEGDvC/hnvpYFwE+7gL+Cf/2Nv2378V3wzu/+wsee+SlEjkOwfll8K9sWs7P0rNuSBOAIgEBeEiDvAgDYqwGgPeNr34QEcG7ZNQnAZucFkADLu7JcHy9JgGG8wX5w6xM+YBpHMCjAF/Drr0x/Bst1SYAKdgU+LZmgutpbZMCuSYEpIgCtANT0R/X/AaxTf+uYz5KADv9017ZI9xhvyB9Wru78p5ufT3nf+957AqD13SDxSzd23iEGgiDfJ3FZgFSQfUhuyAIMgJ/z/fe+5O+OZ/wF+gJ/QX/6cw8A2hKQKbQnzP6v/fqvLzUABP+04UjyAN4Xpgv0I45xl5f+LcC/fdR+obSvZD/R3u0fQ1+IM6K9wX+58GMS4ttmwGGAR7q4YyHHIo44mnFSGsC/knDimQaJX7q1kzfgHkCOShsgTcCfgE3gn5J4Ajsmx7kkQBIBCQYrOK3uBJe9MP2tO1LQ3LJnWKYxriD2smSrHvhlW2jn2X1+/aak+SC1E193+uGf70q7ZSLx0217fd8bvn/MT7fxjIuk39DPs28vFlqCot43c+38WegA3AXtgkvBfMoE/4wvuokjEZB5AXDZHUUVU/CEFPy7g8oCTm0AyhfEYwcgpyQs3RluupSE465Aext3gv/c3Rf0p6Rs4miSRMg68EwV+NPGEAGE+UzYjQvJy3i6Racc5wCBOeM743aCfsftcXE63Ej90pe99AcfeMcDD/70/+fnf+OfffCDv4rBjt/3vuENb3zRi77x7xDXdHxjGMkAyrC8od6nc9AWD7DXpMMcx668fdd+i3o/xwPd5RfAbyPJCzKB8mijvT7XJWXOe2fcTRIAIkCDar3EQILxfWkFCOKzrAT4PfDvJYCk21VTesae3XUMqvYjAbCrAnaYD9+2xwGSAHDXXzAPEQDobxmBv9I0xF2lCaBGADhFEsBvlLlE+6aSPMC5bFTtsNlqVsuxN9fPjOe5/mbcHMcD1tuHMF7y8jfVBCAdZ8t3qQmQAEnQ1JICrLrzT9zqt427RQSMBMBw7p8LAClPAJeyB+YE+sStcaofxwCmtADG31RdaGxU4C8JUCXxAMD/9AMfeAi76ViEHAroB+jTr1gseWkfN/kD4AX37uwn+DcMmcCfiwAlACCuUu1fTYCn/cS/e6ju/gvuZxEB3PgvMYC9c/6/11/qu7efKGkLFogMIHXkWbhPF1/DwMLELGBngk7jYCRYIh4DUjWEu+jLQUx7SvKvu/4AMyY8DOAPmeAfu4BfoGh8pGHKDMOuBgDlCAYFq+anGwlwTLf2nj/hCWRbdkHpVZGAaeqaz4LbtujJVnvql3m12gw/2zgl9p4hT+qaxnpmmgT/9FX78q0K/hkH+C4F+QJLgKh+SsYTAb9q6UkCGCYBQB7kB3CtBIALMwkAJfEkAgS8SPPBLqDPcPyIMyUzbQLvdeyA9wr+BfZI6p7gXzv+xiN9lkkc2tY2xW5bI/PZbQv8SLdCy6sz7I+gm7DlGX/Gcr6FCvwB8t/z+tc9ANn9v//u//nJ//x7//khzEnnz3DiQgyQFlVWvrUeEXDI3x5kR/bVcWdwUNVfBfwN78keUcDxAb4fzgD3Xt6V9x/WGyMhNICrYRHxAUE/UnteBogdI+jO3ft17YJ700kA6J8ywX/aiUN9TLuj93FDAkBgfcgEAM/MO6TOzK+CeGWC+Rb41494rTT5E4GC/fozgfqDRyoJ4De7jWQuAq/uURNguf5ujb+0r+sT1udDkx8OWcpE4U8E5u5w2gWLVTKIAtZ2fTmgYLoF/lt+Aq5twH4vLeVx3h8yANCP6v8dr/zI6JYggBQQ3AnalBXc6a7hupHEeeL9r/rEFAHAzjasHO+ESV2wX8F9vjPiAIAhAao/C5KLJgEE+/QhjiPQnzii4JEF7cq3/eP7z5AA7vojUfPnwj/aLA0EAIZBmHzc9Rf83/+e/3AC+O8RAEtgL8Cvcib4553aR7Cn8Z1nH0g7xwBYVK5gMc8NQizWkgDQDlAQ4Ds4MUBhdCOJZ5opWQkAgaGgH9CuXVCvFDhWkD/llgBAVgJAIMtkpr0FRC0346TdZ6jyEAF/guUpO3XPcNw+Xz572glPN3b9alrdhtd0q9yky/ppJ12Cf+z0H/rkEfzfXLbSFoJ8gKV2pTv7AnykYFV7hpkOgCp47REALNAE/ymJnwA/7eaJFPBneNpbcUiTccxDUM58oj3lqAJe1PlTtR+Az86RoL9Knok4PKdlCvwB8rSh4B/3FPjnubYgAG4bQfcAxFhY1sUn/QHQzq4+QL6D9U8E+8pWPMLIg7zQDCBv5gjWj2cWt0NdFgvcmx3zkm3UkffJ+0KyoaCqfwJ4QT5+hHOW/8v+6j1nzkmzETFqEw47u4ShPZB5pJ0jh7xf2umSm2CvxdP3eG5Bv1oAgn9BN7vs7tAL3KsEjBs/7cbDr2UyX8J1t+Kmn2QE8XfUSGcIgEPXAPCZ+UYgAfhpQIE8EmBfSQBBfcokAnrx8+cBV5EAOc/wzW5DAJCW/MAYrBl85h3L5fo7x2LHRsbmcaw+JPBvA1DhFgkASFxFBACqmOTmHAkQ9CS4wU8AZDgSsATwYSfc3Xb80iTwx7/l7gH7df0B/Twj6v+AQsF/S45aAovnymdNu8+tX7qxz7kHgEs4BPISAD23/oD/HgnAYgZQvksigPzSuLufgJ+jCYL8OTKJgAT+7vZLALzmxX9oBP/4w8ZSjr8AQBuwiONdbUUAQAhIAmyx+28/aEm+A44vLG6K9rNtyXEniIGGAYeFBws1Bj3IA02CeckA4mpIozEuaQH6AHNv/UfiJygEwAHK8QOg4T8F/gkjvoARew/4G4ZMkwRABf1zACdl98ymYN/8ALAJstPeqpvpWjLjZ3irjgLnKklX/XSbj3lbHm7s1h27fsZNaTql72SVzDIo680//OaxruaDpJwj+G999qd+zOPP/vo3PgxwB1QK4JEJ7LUL/lMapjQPgAy7363FGMAqF2hJABjGzk5qBAjoE8BjF1BPSeKZXmlaQb/+5JNG8O8ufk9S754WAHkTxjPRzrSfgB8p6FcSvz6nz0CYeawgeOuLP7PgZKHJIt4xvwf8BfJsGqju/9a3vOWdqPxjsHssILUFkhSQCEiNAIkA+uChLXTZhad/sguoun8CdYA/bgA/gO27XvXNJ6wx+IWlVYZ4EAJ5/t+8KWv8fq75hYD0OdX93eVH4qfKv4BcIF8loFzgr0yg3rOTr0SDeaybnnS7JgC8YZ856/nP/5sHewQgBxXWjI9/2uMehASoxwEE+An6e3bjpsy4EgEp1QJAglUYW5ME4PttzT0576yykyffI2vbfO4d2s+MyYyFmjImEu+w/qgotwjXc+ICxynJwMpkB9DjSEDvWADAFsCFSaCDf8sA5GRc7339a86A/yQCVoF/w9cF/cZHA+DOQe0fqV9KnqdFBOBHGOXzfPnMU3biAvp4/jz3X+0wdLyXBP9pzzD9VYFvkQBoD/D+eZ8sZADrmgTx1W4cJWkB+OTDgix39gH4lIGZA/Yzjn0TUopn93x/Bf60G+Df/gPIgSzhmd35Z8eHd3MG/AvkAfWrjHFTDvbaL3XzTu0Hrb4+1T8kAPjGWOitGDnOqIMyObuTzwIzwTtuAT5S0K8kXU3LTj5gDOnOPxKTeesnoCe+u/76JQHARJnAXsAPwK/+uPHXCC4TLKYfeWcYboygdxOZeWivMvO1PONkfba1m6eSctNO/8dNOQJ+AbbuKrPuhpHefJHEIUz/fI5s//RfZSdP62Zc64LbnX/6tex6TK4rPo3rH/z/etbLPwx4F7gjBfNVJvDXThzsKckDoMoCqrfIEugrMx5+GBZwLOokAgTGVSZYniICSFfD9ZMQUBKP8nuAP/2tL3UlPwB6ywjiE/xjp+3089nymUyXedPmjJ8ze+i40GTN1tr1R10forsF2gH5AnfH+SlJXNJwDKBqEeAmjPR8j5IAZbdr5iPtLxp1g0AHmAv2085O/jqgv0UKsE4V+Cspi7sAeM8cwdjfE15uzrz3FgHQAuYV+AvWq+wBfkG+4UkAmLdhc6TEBHXdUSuOGgDMf6w5MdhZ6+wo//1mM2wesVajP7dIgATyaQfMp7uCf9wZjj0JgLRLAjD+YhL4pz3nmFV20zGHQZIzZu2hIU8JAHf5h7aMtYlheyh2h1lyTkKgNQX6DYMlxg7IA6AAAlcdCQDsAL7Y2U8gnMCIDgiAw494uNEGEFD1JMCcsJSCdf11z5GkYde/B/5beeyCEFiHAEig73vxeIBu46gBkERAxhGcV5lAvNpr3FXumj7dmRagrwYK5ESt+/e++htPKvhP4A9wIL3AX/CP2j/v6My7E/AL6HX3pPFSLvpe7Zv04bEfDTL7OPbs/z075BODFovEGbtEpwPNMPi4OJQEqARAAnbslRBIcgC78ZnMEggCzAT8KZlIMAK3HgFAuAC1An7chAv2kYJLZBriGYZdk3UVTFYpoG35Z1jm1bOTh2Hm18rD+iEJT3fLPhXH8ixHNwA90xkuqAdszzE8B3XyeUhPOvNW1nr7PpSEa6+SPKyLZfEzp5ZN/4GQOoL//oTPLwEAQHsEgEBfSVzmbaX+KckL0MpibNVCy/AWEUBY+pMfCzIJgQqS0y2QRmIE/sZJP8OQGMpJgD9lF/xbT/JvgX/8rBN2Ab/tiNu6taTPQVral/aeQQAwtvO3vHU6d/4Bmezqs8sv+K+79YJ9vqFq1CBIf+MjW1oFlEWZlE26QyUBaFuBuZIdetaV7OJrWuB+jh/p0TJMgoFy0AwYv8dTLQDf3+lbvCb/WWf0CABBuOA8pWFTUoBuHIkC3QB3jPkSv6Yxbkrio53gEQB+nm9Hr+MG6yPmL9bgV44AOG2EG6zj+DYgxjwSoGp/BfLplghQCvznEALmIxnApiXzA6bOPQJ655s5kjQY5hvW04xVO3rnNRvBfkvWuIfnZrEPEBN8JUBs2SEBMKTh4jYWFPVIQAIfgU7PD/DL7i5q8AInJB1ylSZAgi8AHu6U1X4GBALmigH8Q0BU/7XcA4jskQL4+4wJCOcQAADg+j7c6U//JAMqiJYIAGDzvgXjAnHc2jeRpjffdJuf/ayC/Hpe37oK6IkPSQQJUIE/Ay/Pmnng5sK/c+8OkO977wH+9CdudQ9+2feqPft62vkW8r37baSkD0oAsMCfMWKcDjyFBOC7ThIgwTp2Ab4yCQHspiUuQBzApgHoZ36Cf6SEATKNO/uZF6AQk4Bf0GiYwBH/KUPdBKxzpM9CXO0pe/4ZB3vGs1zjZNhU3eeEkWfGq2VYdsZJu3UVzAu+qwSEY/TXTv7kZ7mZ9yZ28iNv6mOZ+NEX6EeAEEDGcee/PwLwjQI4RtDR2P0X7AtUlfqnlAQAoLJomrPIqnEE0soMF2zrx+KMhZ7EgHbdAnoAteBbiZ/hgn5+to8yEvDrVhKmHVkNZa8iAKiDBAAyyYEW+Lf+pFuTAODFLzW8Kvhnl17gDzBnTZa7/QJ7Fr4CdfLoGeOZTjKAPMlbomFZViEB0FCIHbB+p72YkBtcVCf4r8AfAD8H6LfiSB4864E3nXzeFzzjk5aBhBDAj/e8x0vILqYF+6Xc4NcABOMpBd0C9ATwgvUpafqWJB3EA2Fcio2k7DkEAHG5s8C49O3+460VsiQAWItfUQJgfGDmEo7EgDOmSADBfk8C7FtEQJICaU8igDYEJ0gCCOKRzhtzpWkZ09mwRltu1FZa6/XeIpHZafFegAST1c5EgB8SA5hD9ZvFQ0sbAMCLOQNwhp1Q/ARGnLcHAOtW4sfAjbsCrOoG0OknuMOt3fB0Vzv1GM/8Cw53KFtHBmwb6gHpsOqXAN7z2icsCYAK/BP0+86I0yMAANW+P96h4FxZgXu6p8C96clToE89WmA/Af6U3WcA3ANK6BMYwALl8RySBBIAtMGXvPVfnN31z/cpoMdPe5XG11/3IO1rVdp3q5wD/P1GkgBg0Jo5BM0iAQD7CdzTLhGAFPzrl6BdAJign91a3O76CwiTACAP1fkFkkiBPuGma0nKrf6CWvoCxp3uKg237pmPflXWNISTrsbDTVxlpkt7prf86lfdxutJ4m+ShnpJBAi+p6TP5/P36jPXnzpTHgsmDWXQP+iTR/A/76unnZh7JQFSCugB+Qn0dROuXYkf4IVF09yF1qp4gOwapwLvnpt0LuSqFPCbVnCve11pHSE/aIOWkYAgTPAv6DdMd0rCkgCgvRljV7zlLvhnzkvwzzl+duX9bnJ3XgKNxa9nVKskDCM5ABmQRAB5U4YkAGVTh6oJcEgkALu87sp/37ue8pDAfY4E+PdIAtN/2TsfHH+qmF8ASBIAO++XPkI7rnjHVzKYzYUE/mkXZAv+cbcMu/Gk894AZY0r0Af8E2a+lokfcXqG+KSFACDOC5/92e8fGp310i7+zhAAzGmsZ1j37CLzi86Db551HOtrjgSoBSCgF6wrV5EApkvAv8pO3mAHxmEMc1GO/Y7TPUlc5w3SYiAUOKZ8JAEmehQTAPcCCNwEklUy8KchHFBYtQG8GyDB0BLkLNSjuf2e33oHAGc87AByOqJhAOa3/eZ/GcmDCrx6boE/4dpTYtcN8DKe/vuUPI/gE/vj3/ALo8bDC773RU0yoP4UIO1egX91C54ByNqVFXTjrwGw1/fe6xcCfEF+5i8gr2XNdZuXknSAfupCH8RtGUj8UPmffG8AesF8gnv9lcRJu2kG2epv9Fn8az/WPZcE2JAA4MtukgCQewL6BPyr7IB/AB2gXqApiMct6GfCYMIDvEkA4BaYuvOPJD/yYJI0T0GjRABu0xqmFIgSLoitYD/dGd88qjQv65OylT7DtWc860UY9gyrZa9ykwdxlC17hmV+PX/jEI6BVBOMI2k/3YJz3DyHaatcVVbGJ27NnzLpH/Q5QYyAZdmvJ+auWzUIwJYEgKA//QT3ufuvH5K4SuJsuvvfW5DhDxg3vGXXT9BuGt3rykoGpDvt5mvdkCwgBetJAiTAp40S4GMX5Ff/DJM4oL1XEADjWA6g5jsQkAO4c+c/z+X73RBX0C/Qj535kVQY3YPGWPU3vmSA5ZI3hp/Xy7sBmG+TBDikb5Z5DzAOQF+XABDkVykxgD/rNdav3P5fSQAvBLyuWgC853oMIN0A7QrkcQv6E7xPAX/SENe8yde0SsvpEQD4k5542CEvdjhfnCEArrIGQLYJ3w6/EgAJAKYQtAv8q1xFBBDfPKpMkiHDaEvH0koE5HitXeDvGI5b8A8BwPjM/AYJANGRz7uJfSRZBxI317+sbag3mAipFqVrUi5dfdnLXvYd99xzz5ePZOkmBe85zY3evQAM9oBCZMsAyrwgsKUNABACzEsCqPrv7r/+AiYJACTACvAvAWCcFhDDD4BnmGBPf90pAV3ULf0uzL4AmVxQx6TCUQiOPmAgAyBBUH1PAoAOVgF6ug1P4DwXdFdQvU66XcXNemtX1voB/LnkD3X/kVQJoN59hwL7Kk2rP+60R7+yfyntk1XOBf72f74HjgCww8RPGK35vTdJABZvq0gABjJIASRAXjuDGkYw64CHn4Afibvu+OMnadDa4Sc8waF2QbNuJf4OpmnXD2la8u7lb35I4tQ0pk2ZabQbnumx6047cTOd9m1k5mk+1a+6Mx5h1JF2w45k4moZJrPMi3TmlTLjpJ04lsGiQkO+9Bv6pyCGBeYZcLLmR3CrRAegJdhPAiBB/hw7aVH/Z9HkompKAp7XDc802lP27JRDWJr0Qxsg3RmvZVd7wDTINCw8AeuCeiX+EiQsMF2gKjOefkrCkgBgkd3pp2fAP2CexSbfBufv3fkHiAPI8fe7OQf8JYVv7ngutQrGBSgkQIYt4lciwPIpp5IA1KlVfuTbecy9e4/HADiXvysCQELglT/390/ufOsHRwKAOboSAF4IiFbt3p/ykgpAw0JgjtQOMBeUKxP465eS8DSGkac/Nyjgb0ni9wgA60Y48Ybm4vva1d+1JABoHMYA1oD+VKDgPMG/wL/ll2GZVntKSQClYaxDGD8ZO5GMvYD5qSMCAn/Bv2StZC7z3MaaAMN4CYHEepdfe0jjphZ1ZjOU9Q12Njuwg1O4rNVfJmPcZCxlDt9VZ9xZPjwkYL6169sC//oBQjlvQSOz6OBugNYlgYAkQK0/+yf4UQLGAcKAX+IC/AF47O4CuAB6uAVfcyRgkHgpsY+3/g8EQPXHvXcjuEQuDEQAkwvPvyQDBi0JCAEWLgJ9Qb7ulkzQvCtwvu98ss5pt1x3/Olz9AeOV8x+T7Y371a7Mv2qfdEXev2MPkpYBf+67ddz5JYEgGPAuNBzJ8cFHN91a+cfUJ8mAT12gSwSECdJAKgnXA0AwrSzo4sbQzxNBYuEp592QT3hglT9AI3Y8U+W1fLMw/rqbknTENdw/SwbaVhK45FWY70MU2Y67earxF+7ssbNOIbNkTU/87GNkExYAvOWNC6TGvllnmlv1Ydw2ibz5d3RfwBDgAgBzBH8+xmvlDdYzDDfsruBdO7t7fj3yADSschKILyuHbDdStPzN64gHXfLbvqUaScdCz9M5mFeVWa52lOyeBTMK92FMh55urgU5LtYdcFa/VmE8l6e+KUvn/p5qiVI53tggci3wQ38quAjezfyL3aWTong893nBvm96EXf+HfuuuuuL8Ye8TP2ORKCuM4jSQJkXYhDncc8z5ILmfeF2QGp6xAA7vArBfxVSgAA/tEAoAx2/flpwTwOAJFPm13YA19sQeNdAIJ0gbpEgCBewJ4gvYYZB0kYZID5CuAzjnbimVeLACDtE2986pKQ2PHuP619hgBgbrvKRwBa3YexhznauwEA5wn4sQv2lTVct8C+ygr8Dac9WZOAKQXwjsc5tiYxgD3HZeKbVslcty4JwHfM2jZBf9q5P4FfGMFwQaiGn4hkvQRugbQFx4DdXAfxfM966lNe0Gr7S/VjIPdIgAB/SgLWMMRBTZszFyw2mOzOXRI4AG4IgBHgD3Z2+QFHACbAPyCIcCQgD0OYBIDaAIKuHjDTX3CPW7ugkd3/euu/8YyzcynoRK4w/nSdxABn2zl/xm8cv+Knf3EkBVBr1EDaSNy0AHR9h7QlfsoaTof13bbyE5jvQwr2yZt6SQIht3ontv8C2M/Jy75UJf0SP8F+Svt0ylUkQBIADFJbDAJLdU+IABdvTIKoWksECPzd8dedwB9AJ8BFZhwJAAZHQSHgH8AvK4p/qvgLEI2PxI84hlGOgB8p0E+JP2mJi7/5ZB6EWY7+VZqH8ZTES3tNl+GWg9SYFmncVh5TfqaditPKu5cu/a0zfhja0ImpSiYx2psJi3RT9ckyrJt5O/nhph/V3cMj+F/vi+dbFvgL/nsgf8ofYMrOigB3rhSI9+JneNqNn37akWknrn7K9Evwb74Zbl76ZZyenbZwMalWROZDOvxdiAr6XaDqNhyJnwQA66vOm74BgGbMFnRzEZ8/9Qfg5jw+3w1mHdBNvgD/3/7IR/4VBiLgMY95zGNHjZv2zmiTjKDcvBOAhS11ZI6hPuTXIRY6j7wfb9qY3XkAPKBe86Hf+aGTTYzpuQDwD3/be0fwz0//AfrvvvvuUWPvjj9z18NoAGAgBFhD7+fpZud6w/l/12QExK0AHQJAox9S4M9Z/Hp+XyCPBMzrNp9KKhhepSSAZUEGCP6tAxcXzm6x+RFvsP5hjnNeYw2D3/wsrkDMgcxjnslLAltEgEB/DikgyFdKAlRJOGsOjpkzfgrit5XMhX/ysX/9Q4txavIlEIc1bQJ+7bQJYwwkYJJ/uPVDMj7wHPYT7GkOkgQYWuUGqpk0PjvMAnzAGGoOFSziFiQS3wsCaezWsQAvvkNyngqjyjt2AR+gCZAl8JcUQBNAACYIqwCt5RbwQTxAAOgmrnakbqVhq9zGa0mA/NK/gP9P/yefOJljIA0e9Z7/45NpIAYwtJnthmo8xvdk+ykJw67Un/jYTYeUCFD6nnUjNzGZD4CfPCiPOkFq8K45GuF7qm2/bMs1wHwzzQQpQJktY99L0F/tqwB/Dc8bprckABjUTneChgGcRQALIhZvTNySAICwCv4T4AP2EohjZzBkktMA/t35F/xVAqAHGAWfGY4f5QISe0bwbzrSpJ/5Jsg1LpJw3ZaXcWt4TZNpMz15aPDXGL+Xz5S/abNOPb85cUxbJWkB/kxStDtSu5MXbVzTTbnJM/Mif/Kg/9EXWZTSL8eJ+AB2DSdXAgcYyHfN/CoJMAXyp8JQ/++B4Yvwr+BaoK+kDsZJqV210FZdjaNsxWn5pUZBKxw/SALBPrJlF/yzaOU9sfBcjM21R50B3JK2qfrP3Mi5+02+Hb4xzp8C/jlKAHD/nte/7gHyGwmJ9vfXrBNpqItHEupRgEP5npnLOAKwCeCHdMl0/GY5BMxX/urvjFqaf/rp3/KQu/4QAWgEoKnJYh8wAAmAH++qvuiLcPMOICD4tiGeqMv4XnZV+NBfANgAcmQ1AHKBvyDduIL4TAPgZ8e+EgDGTZIg/cxbSZ7kQRz8kIyTu3rsks8N11SAOPDSTtu4FHaZTsg9vicwmhoBCfoT+Kd/TzMgwT/AX/Cf/tpZN7CxnNoA25AArLOZD1mHrGpTjsW7gZWS3f0E+kkAYCcMcsAjQrhZCwn82VTRzn0Lq+pxaeF0cH8lgEE/iQDc+uGvERimNgANnscCAODseEIA0KkwXAoI2ANwAUIBVIAkwD4TltoAhEkACLpIg70F1qofIJDfXHf333D8sbdAYs+/FbfpJ8gswD+1ACAAcKespMCdv/FQlyhIUgD7//2X/uvDTFiSJkjAdRraUrd2pMZ3rMQfu1J/pCSAu/dKJk/txrEfUTb1grhoqfTTTz7teT9/5l0123dbEqCR3n7Rkva7KiuoJ7z6pdsLM5E7JgAYM86RAC4smawq+BfUJwkAYNMIbo2HTAIAMFhBKO7qJ2g0zHAkZQn8GSSrXaBuHkrzsg64rW+GGV9pmPnqRhonZfob13JSGpZp024+SsOqW3/lqnDjrSvJlwnJSUq2WiIAybvJfHle3LVOuAmTODAv4h5V/nc7lfNzocytm2oAAA4Asj2Q2wLOLT/SV3/dyl4Z+td46dauzDTuxgvaM0y7sqbXf1MpwFdWEkBiQAJg4uddm7v/gE4BO7v2Cf5HYNMG7uc6GcAE4C4BkOAdfxb4C/DCnJF/Iwkgiez8wa4/a7KsG2GHpAVAXVhXJpDf1M4ahuf99OFtYNDERPV/3OEbjgKwaYV2ABoHqAJDALD4v6S7AG4A/hkTICeoI6Bk12rw3gWQQF67AFwQjtswpWC/An/9iZfAP/PK/PUnHXkZhmSdk535aN+uBfjGWTeyESQRAFBP0N8jA2ocAT5SEkCpn3EgAVhP7EobwPmSMWKqRVgLC/xz7YMWAN8V33kF/6sIgAT/rrmm6nDpYUwMMCEwMGoDCPYBfoI5/QR5SOLn3QASAQAewY+ACDeACUAIwNcfsIkfbsJxVwKgAjFAG34VvAEeW7v/xiNcO1J3BZ2GVf9Jd5IAAM4gA6ZAvySA4B85x5iuSogBDQTBKkPbVyIBP4kDJe+lGsOIj8mfRZxqK96v4ZBCkAC+F/33JS2nJ+1Xtc/ptp/af+dIyDB+TUMSAMZ+Rx9+lwTwXgABPxLwxg6+IJ9BTwIAKbgT+CtV/Sdc44DZchsmaCYO4JPBsRrLF3CatictD0madNc0hmU99KtxW27j1nJ0m4Z42ufIVfEzPO3k3XNX/6wHYdRZ0I6WF8BdKQEgQYBs5YcfYZmW90nfmgAvFXTsqOtf/2xYkCUB4MIGv2o4klf9IABUc98UBO863VyQnvFU2Z86ErCPeko+QAAkCSDwV7ITS9t3QdgA5FlnsRsvyM7d/9xl3wRk9wgAADykADdU830udkvr93iOnCBur35LrZ720YIL/SgBK5uC/pruhz/wI6P25Wf87icfvv23//XH3eHjLgDubOJ+AO8MkAQAgEOwXNhDD/0I8P95X/CMT1ZgsmtVePqUYH6OFNgrW8A/8yEeboC8BrCfBn/imCduCQEIigtr91usIMYJdtBXEQEV9LfcgnxBvyRAlYTvUhuAuXKCkB3fKOMcu/0YQD9kgEcAOOvPGAAJkESAbv3QCnJt5dqWdZbg/+v/1tf+0pXoPjQGqsns7APsBfoAf+wtAoCdX/z9pQAXKBwLqPcDAJQAiewGC5oEjroBWasIAIBbgrQK5Fq7/zUO4BK/KvVL/7WBaBIBhQToEQHrgv8eQVDJgE3dEgjKBPbjTn4815z2AfBjuAdiJGgGDQ36h1oavLN9kwC1D1S3AL8n6aOE2VfXkeP5/+HuDO7PgATYIQHg2NIlAqo2AKCeAQsJEYAdUKcB5EESCP6REgACUOIIELXrNo7S/B0ckQyO6c60AteWX4YRTt4Y7MZXWn4rXi++aVrlmEZpnJSEpRu7fsoM10+ZYdVe41S38Vv++DG5AtyrkQRQVk0A86WdeW/Ew5AffoAe5g6AwXLXcubOpZ33KPstgFo54JK5VVOBfs8NQBUY1x10/adkgnDjtfwMyzLSTvhUOtOnND5SIO5dBuZtnEy3aztlSgBIAihpX3b/VTtdAOz6Ms/tstcddtx8Q5ADGL8lQBjmNr6njiEc0qClAaAmQOdIQNZzJAGSoGjVMes21ueSSQCeHVBewfwmbggALmn2omZ2ADkKwO7/k3/w7UvwnyQAIHxxnK+SKtm2O7Hzbj7zTz3hJwAej3zkI0cjCKEe/7c/9sc+sJOCIpN6F0AC+ATmlA/gx2inbgB33AL4CvozjwzT3zxxSwxg3zP4P11L0bc739zQRDfjRHtdNyvfF0QAmjapEQBYb4H9Kb8kAlg7VAJAN/FYZ2x7JEBSlu9m6r2MRMeCBODcv4QAUu0ASIEMkyxwM4Q1Fc+Uhmf49pff/1uryp+q22WEjT8X6C8FCP4lA3pSIgDywMmQRUm9HwAAKHCq4F+ABUHQA2FT/gA6waWgtIK8KXdNk27t52SCfXf9BzneB5AgOeyrQHkF9zDS1a+6V+W5KjyPJqTmwjk7z7imoc0B9wD+T3nyPzhjeF/kR5wbz/mxnd4HQJ7mXe24q6Fv4dfqY/ZN++4qmdov2PkmAP97JAAYK7okABO5RwLc/Rc8A/AE/0rCJAAA/xIADIjEB1D2jOFK8mQwbBnC1Dwgfs8kqK3lUtf0q3kY5vPizjQ1fnWbvkri4Vfj6+6F9fxb6VbFNc2UJA/aXuDek0xitEvNCz/IGsJJi+S90Z8ELUxyS/BvP7yM2esalgnBsgkBwO4/4BWwLGDeNTjeJr91wTtaAABvn6mWvW5+Nf2Um/azfMkAd/9V/1+c/2/1wCW4BqjzzXA+X/V/d//xB8Sn4Vz/HEOa21/0mu+uRwAkAJSUBbAHyI/Ews1vtakF8M8++MFfJS115beuqSPPwPce6VvPfGF+fB9c4rcJ6M80XLwM+Ef9nx1/jgAg8ft7v3Sq/i/4V6IJwF0BzK/7fGDyB+AL/JEA7CQAANoLUmbXVblB+WgYAL41AHbqRBh9gb5BHMF+EgFqA2RaAX/1M71p3PXnuABhewT/y/UTz4NhTqOvp8EPM/Z/CYKb39Gu2/4g8uObZ75PIgDAnqBeUqD6Tbl7RABpCNv2bgB+rWPOMRHGENbFgn8APusm1qasfagLWNg/xkPXUayHqmG9hVb92EcO4g2uWQk+ZlSNeAF5/rtHAKQ/8TnLMUUEAKBSE6AHqABjhLVAWcsPkPn77/rOkQgQ9CUIrKCv5a7xca80CyKgB/xXAXDCK6iv7h4RMJV3Anvitdzpdw7wB3Gxsg067UQbSwAgMaj9u/tvvpBDkABI/PL9GacnjduS+PUMdbAfEUd7SvuffZQw7XNk7v5LAOzgEsCpL3rJXDuBseDjm2agYyBnsAPgs9Mv6Ecy2DHoCcwF/xIAxBcgMkAmQE07cXALHiv4lynFn/K2AeSknUpvPY2XcQ3LZ9JeZX2+Go57ThzT1bjVbbwqe/Fa/vjxLgXvTlpV8t5retpJ4M/kRxrc9B360rndQBZD13whNPXR7TFs+ZOAqzQA8hgAwFTwvw4B0ALSLb8pwJxhmTbtGadrH34e1zC1AADieaxh7TwHbQTzXFdSbhIBkADsNPFeOuqmI6hgIQiIcBxmjSSw9mf/APGcKQekb2o8t+9CtSUhCfi5P75h5of4ZpdEhfXMnyikzvndLxa3PN+l/z3lq5/y44B5iQBlAvxV9koAsPsvIWBagX9KQBHz6j4agT4DqE7gD7DWoH7sRWT4AdT2UY9Fnjd4TuoD8B8vWTsd888USR8hHLAOiKfugnnBPlKgj8TdiuvRAMLJc1/tPDzAEvy7ZqIt/Q54Jg1+mDNE2C0y99EfJQJe8a33nXDB3T964PtPMO7gV2KguluEwBwiQG0r5rU5hnEZAmCdtTZkFs/H2tj1MGtU1k9scjueYm+BfohdLoxcjKtnvour6Bh/KYAGRMWfRSAPnmB/ys4xAogAdiJUUawaAXMAlIArQVnLTl6f9rlPO/m0z3rcKCEC8jiAoLIHBtPfuErCeuBzBM2C3wURUIF0gu8pwA7oJ7yC/57buDVPQX31T3fG0Z4S+znDc/qMPvMMOdl+kZ73BQngu+i2+SJN5qs9pfn0JP2IsFZ/0s8+ilv7lMzdf+K586+EGFtnUNpw4Dg3oeVkBivKuW13+QV7ADwGPsAgwBwDAJUAUAOgglLdCSLNQ7A/JS2TNOahNG+lcZQCe901XfpnXOwZlunSbrlTssZPt3Zlzaflv42f+ZOHAD4BP+O4Bn/fsensC0xwAn8mQfoAE2SCgHGiu0UWPxt+hztJxmI7tQCcT3sSQApQ3YQAWBcUZ/we0VBBenVnHj07eQu+PQrQi7tvf48FSADwHrrgZPg+BBWMwQB9gTpS9X/8uVNHzQAXm/uQ7uhTJkBGMC9RgR/f+bljAEN8ngEgEN/+Tvr4NplQH8CIP+cnAaAUwE9Jdv4f9bMf/TgSlX8kBADEQKZL8I+dMXGbuvfSMkcD6gX/aCRwHAEj6OeXCVBNVhNgX3U5V8cG8M849CN26iUCKtiXHEj/tEsY6Dfu+q8oM8vfwH7umM7Y/4f+zjfCdzAa3YO8ledBxgfmpMc/7XEPslv+Xa/65jNkgKRAyh5BUAmBjJd21o+sZ+ZeFAjuhABgJ36T/sCYwvcEoP+G5z//FZChaEFhIFDxI+ypT33qM/jJ1cUYukFRB56EB4Pd9pJAQP8cIsA4XhSYREDrfoApUJXgS2BW5ahefsfnjeD/EX/hpSeP+PwXnIxysFMe6uY9ILjKXyIgAenyZ/8ExCmxh0ngnfYE/Pj3gD7++9AAoEzqWWXW/Yw9wHq2xa7s7Mjf8fQfmDwKwLvK99Fyr3qf9h3iaa+S/ojfVL/MsAr8cbP7z3Eawb8aAJ3don2MBCuJALUBAPcMsO7WC8oBhuz8ayoJUN0CSSR5tIA/4JJyKM9w3IDWFvglr/Sv4D2Bfc1DN9J4KTM8666dcO21HjUs4/Xs66SZG7fG4/loTwC+YL9K3oHpkBABmcZ3xHtnMdpc8BzB/z6+2XN5ArqSAADg98A//sy1uyAAWkC95dcD/hWIt9LWOFNugXdqALTiWx9lK862fuTNcQDXNSyKz704dhaHbwSwTPhIAAxgQpDvrrpg46IIAEmFPBJAHVnrZV2pV2or8EsFPAPPEgQAc8yl/7FzByBPEkACQJlAvtr5qWUvTAb8Y/Cr8XBLAqB5sOsHB3i46w+wB/iz28odBdSJSwm5nwB/fpkA8KVGwB7V4zd+TPoQ9eKZ2Mn3Yj/sLUM4mxPOOXw/Gxc+P+E57ReBP0drqkkyoEGIHcT3MP/Rt4vJ80MG8M7YJJhDBqTGQCUAdCf4r3bWKWinQwaAS9UOYNffnX/Af5eU3e6Rb83UsCHsXNLogHoB/pQWQJIFlQjoXRSYoCrtCca0C9qIx+7/7V98//LIAH6AMM+eoxEASYAK+qZkwCTQBfADkJEdk+C/Z68kQAL/tNd4vfym/Kmn4dpTNp/DZ9wTGYAWACSAIN42F+jrTmmYaaYkfYZw+05L0nfwt/+lXb85EsAPAaDBzeL9ggemJQngYpRFBgP3ODkPEzST7XgGahjABYIMshiJAIBggv2WHSCZhrQAyZ4hf+IDWCEDMJSPXwXbCahNY1kCet09aTykeeiHu5aR7jn2dfOYG7/Goy49P9u8An7dqvL73MZXS4B3xXtgMncRlouckek+XZSd9qtbczq88KeGNGTs0EwRAKhIelYeoLpPIDwHSLeAf8uPvKbqSpjExpxy9xnHurDgXGh0tRb+587Wp1o9ANwxGFBx0QQARABrNI8EAOyZGyQrqBt1JB6kBXVnLJAAWOx6tZ77wr8P6vLkp/+V32yRABIAyhaoTwJAIqDu/mc6LvgaHnKnz854624+9wsApqgzhrpwJwG/PADgR3o3AWQA6QDZF97wV7/AMyQdfV7wf8eb3v3e24dfhNDc8ZO/8muj34IUIB7xnR8P6Xu4lNcyrAvG8WHoxxBy3IA/lxBIUqAC/p4bskDNADSAWBPxa1scX+e9XEobXPNCx3NATHjeD7ApEcCLYhGzybGABGiAM0D9pwy7/wBHgKEAL0EaZADxJAR6ZAD5TQHIBJ7VfkYroJAAAG0BtXbBt27Bt/4V5LfcGVe7MvNbZTccOWn2BPxtS9q+pwVAmO8331HLL8Ox8159t9pbMvtW9p9VdjUAlO7+w1BCACAhAPh2FhPFRQ8Vp4AN8DYYdnB6RAADKSAQgO4OPUAR4JnAvweKAZem74F//QX8AlIk5bcAruURZjwl+Wg3vXmkmzgZL909YJ3lrrKvymObcJ/HOijx5/l5V6t2/XmPPDPvlncg8CcteXAsBIIqFzb0lbLjt9OF70V/CFexPBZWzJcSAEh3n5WGsyPCLrlmClRXkNwD5jXeJu5d5M0zrXqeDE/7JnVupSFP6qEGwAShu9xZBDTzTT3wjgceBFDz58V6+AMmLoMAoB55JIB+pqFe1JE4/FF3/CQKDg3wsEnFmXwAs7v0AmglIB57gvnxJwAH9X+BP5LdduMpM81dd931xbsaR2hHdskB9gD/epyB8qkP6v9cOsgRAMgA6s1z+rOEqNzvqk63UD5LAoB+T/8ed/wH4P/pD52ctAwbcZACkAEQd34T4/fA+mrHxNAVfhc3WGMyPkoIQJxBCkgM0Nc3NeaDhgwbVGxiTYzFV7gZD6zqdHTOVnzDS35g/AlAdpc2IQIgEQBFEgHrHg0QrKHqf9tnPGm8ANAdfn52TuCX4A3Qh5t4j/iSty9vpadsLqcTJFYAWd0C1qYcQHTvQsBJcD2k86f3lIL5lBAB6Z6yC+xrnOqvOyX2phlIgCXZsQdCgPeQdwHQ9raz9pT13VS377QF+NPP/mR/IUx7Twr4DcfdAv+QAJz/v0D1/96osSQC+I5bRACDKIMpQBEgLwmQGgGCz5QJwvHHLchsSfwEnoDYBOMV7KYbe41vWqRhxqvSONU/nyXtxEv3uvZV6XvhPX/KJwwDoBf497SxaGfenaBfbQD8eb+0BxM0C2gWMyyEmLiPwL/3CV2Of+snASUEIAEkBQCmgv85gLkFcjf1awHuCvx1K2tZrTyMMzfMeEiNeWwryQ8NC4gWdpsmesM5AiB31A+FABjR/fDPIwGMARrq6JEFNRYOlQDgPQCkAQYSAFMaAQJ6dtcB2AB/dtWR+AG8NUkcoDEx8c7XDuLn/djFp96WlxKgD+BH/R/wz+4/6v/E4fm8B+CoAbB205PgDAEAEQe4bwH/lt8dr3rL2yQACkm+UWWOiY4tcGVagIlgk/sB6tGASgQAziuwEmBVSTwv/MPuLj8SIMmt8i0yQOBHfqidQwBICCQZYLwKKgWkKZeguAecV/gz8fjziNg1kgFIATmAfgqsZ3jaTdPyM++uBOzzDHsA/ZknbQ0BkEc1DK/vYcqd7057leP7nwH0a79rue2zkFrs+KdR/R+QdSAf+CwigB1hAKJEgKBd4FjBsCrlgFLiQAIgSeduc5WSAEkgCHBbINgw6jVljNeSpEv/+hyEVb/qrnG2dZN/zaNVpu+DNgXMt4A//tnOELT4Jejn3XJ+z8X+CuB/3PW/5A8XYs5d/gr8042afCUAdg2CNwHRPcC/k7wWvxiQz6lduUk5NQ150ba0Mer/fDsT3WJJALi7mGfquTXab+8yNQAkAJCMJe5qUrc8ssDPAuJ3yATA8C5uAIQrCTBFBFTw7+5/gnDtC/C/07EQst38U0I6/MePfXhcB3Ixobf+ownwyp/7+0uS4957v2r8ST40+yb64jGo3QLnCAB29tnlbwF+/dQC8BgA30QQAO2Sjr7HFriOLcCkABPO/QBMcHO1AZIIIB2/NsBO6TPve/V4NIDjAeNN/gNIbwEuwBxg/faveOUI9AGD+BEXMPb77n1wDF9FBhA/03E8gEsELZuwKaBpmCAVuZYGwAJYv+03/8tJy0AKSAYIzpMUqHbjtKTAn7C0p7v6n8lnBglAe2RbVDdh6addSThtjzEuYXOM7yol9imT7594rb7W8hPwK4mT4F/V/1T/H77/nS4edjCeLIkAFhCpEeCiFdIiNQIAkRq1AgTUAlbc7kwnEO3ZBaaqqAOEe2DYMMpYZYybebX8rHfG00/ZC6v+1W165apw46XkOSVhAPKMsauMgJ/3YLuiKseFPYBJwccR+O/gK7qYLG5ULQB2/tMASqcIAABsBbW4p8D5LgG0ZbfKq3WrbtO2pHWckq106/qRv7v/E2f/7Q1dAgCwfWgaAOz0XwMC4DbmMdThOQ6QmgA9EgDALwmARAsggbj2fYB/Ogr5UgaA/6MffnA0aifwSxGf/9FPjvVDS4CfJ4QMUCPh+971lIfQCkBjy053lGu1wBkCgDkRAoxjAOzuc+6/kgGCf8I6BMChrfHWapBj5GMLbNQCAAUmxU2IAMkAFq1cGIhWAEcMPB7Q0wpA/Z/z/2gBuNtfd/xbZABxajyBIPHJN4GdADJBKLfW6xaoIpdmANmTRMAQV60B6iL4B+wDur/oZ/7rQxgIAMPwB/DjTmJAzQH9Ulsgwf0ZMD/ktZabZyNNPuOadtor0/fctC3vPNvYtm7JjOe7mpIJ6NcB/aTLfpFuLt/KXX/tkAKo/3PJz0Yf1sUkahIB9Z4AVMUBpqqeA9wB9cgWGTCHCOCb12Q+PaCMvwatAQ1lpV1yoJdPAuyWvZeu59/KQ7+pNK0w/HiWVNtfBfgZQ/NdkJ426IH+BP7l/OJpX7iYfncsZY0WUAtATYAE/9ghAACoqQHgMQABtXJd8LtO/F4ZLeC/Tr6tuJSF6T2z4b06tfJs+VmGu/8zxvNzBIBHAA6RALgORwD8lCCyUa3nYkCMP3nLWOg5ZMkBCYAE/4ZJGuwL/FNffk5MwF8l6v9cUAjoB/w//g2/MP4igAQA5/8PSKvQ5r9K8jwBwDEACYBBG2C8/I8LADX4DeQAcSAAnEfHOfTwNniu0rs41vXKt8DAvqJWyi4+O/oCe+RcowZB1QqQDHBnHvDF7f+AfzQB2LlXfV+AD9gEMAryJANGrQBunB9+HtC4AkvyHzULhvwrUBzzCeBvmgSgCXABzJIAZ2QB0xIAML6A/swDdxIA1U0Z+KU/9jGPdUF+L36pb9Zvjp12ynjp1p4SO+8hjwHg1zK8kzH+Bjv99ot8z3PtSQQI/l/4xvcsSQDtEACXePnfukPKOSIgtQLcNQaI8J0DMKuKPyA+jwAAZo0HQBXsT8kkAkgrkFaSp/km6E+74UjTbSJ76Vv+6Zf2XrnEwfCM1N1dftvJ8VPw//GPf+wTGMdI2pC42d7kxYIXsqbu9LtY4Z1i2C0bzenC5bhzse7XcgnxOXa3LgFQSQAA7raAuAWS9+HXqyf+mgr+q9t429SPPM7s/vPtTP8tCQBUhBk7r9olgFnfQ78EcPpVjJp3I9hjvGPsYyzknTiXMV7y037cXg5JIAkAQF+R91bB99xzz5dX4K/b+wm4AwADSWEYGg5zwT/PO/6qy3BHAs/Lsx8B6/jaVhMAkgDIBP+LCwBpy+VceiQAtvoWjomvSQuwc8hCxYsCXcjOJQGM50I3tQI478jxAM6JYwRxADKJgHXIAI4KADa9MwB7gjsBIeUINgWiCfz1Q7qzfw6EN4A08QHsPKsEAH6kNQx/DEQBcVHXgxRIUI1dogBNgDNhPWDf82/U80x+hC9M1hW/6p4TjzTVoNHBu6j+un0Xvpc5kndJPN/pOtI+oTQt4B+tlxe/9cETQL/AXw2AK7D73xp13AUeJ8i8MLBqBbCIYvEkyAe8A0o1CeYFufhNEQCGmUcCXEGzkjwpW6N/lT0Qnv6kSXe1t8JbfjVduolPXdGiYIefZ+M5eWbGAEF+SxJOPNuUZyc/b8HNM/28FxYnGN4ZhoXKcrf/FMD4nlt94Oh3gC3A+3vil7581I7z4j81AfwJwAqAdVcgjHsuKF4n7tw8M17mn/aMo51wjM81R67K07xb0rLW2P2n55wjANhJ9lI9ATXf6VX4GUDqzljieedrDyAZH0/HyP2OAkMZHgEQ3CvRBgX0owGAJgAaAYRBTszQQFnWmz7Grww84hGPOHnkIx85/mwgxyTIg/dJX11GvrUsy2+Uvs2O/pkjAIJ+dv8L+D+q/99aHeX4tBu0AB/VLokAtQIAXCx+AFeoRQGMBYAAsyYZMIDJ3PEHmAoGiQ8R4L0BgrsqLQMpEO1JgS9SQkBpmGmf9hP/bjx/x/PxLPojCZMAIJ0EAH7mo4QAwP8cATCkM85SAv7xrzLjGpZ+Yad+y/wG/55b/5ZMP+xpWscAbPt8F6vsrfdY/XruCviNhz+7+wD/agD/+HEPAP1/+HSu6gQrQDyzewKQFFTyjbPA0ABCAaQCXMAqRpCLFMACfrEL+JGSf1Uah/Sk88gBIJiyJAIAxJoE3hdlt2xAvnUT6PusLXDf8kvAj3YAefMctC+7/PU8P++A94ER8E+A/qvaJzeYia5XEnbxWloAvSMACZAFzwJiZQv4TvlNpcuwtE/lNyfMvJD5THPspp1TTsYhHebM7v+88Xy5uwjI4psEXEgAMNc7ZgImLvpnAFX5p16OEUjrSt2oI8cVqDN1J64EwIWA4+v12XafBnJF0K9k99+7nwD/uAX/fP/dzBoBzAUAfgiAavDn1xNuUSJgNQHQUv0fvoVLV/+HnMIc/y6sBfhG1iHeLqxih14QkwlACMDEbj6Lexa3dZE/x+2imCMGGMAWP8nDICl4BhAmUFMzgOMCaAcALJMMIB1AViLAtD0p4ASs9rQAyI8w5BTIJUwCAACfABg7YB5wQNuQFwQAIF8NAOMThh+TNWnwx280Avme7MXTv8jMW/scSZw5hjoTr/4agO0+R+a7sz8oM6xlb4F+/ZBoi7TAv5oAEgLP/vo3Pszke+jf58z6rU0GsFABpAJYAcOA2DzXDqiXEEBOff98944Z2nWbBwBbbQHKqsSAJIAgHdnTHDBulaZNgO9zSWhQH4yEBvVsAXz9CM+2kNywbtRhDuBP0D8uDm4uEm6+u5kv+xjtsFuA+bSSAK1LACs4FtAmIE57gt+WfZ24rfTr+lleSuw+F8C8Gnbq04+4pl+nfNJYlrv/a4Gv4fuTLB0JgAHoM3cDqpGAatZGF0kAsD7gAkLKZEHrTj6S8QO/sU5D3c7UdYjPMzjGjOPLYX8iV6Z2tCu7+oJ/pOBfLQDDiLvJg5GuRwJACqgRsFiv3Crk8EgALPv80Mf9FQAu+/PCP34acHkHwHD+n+82CYDFt3AxbeacntIOkX4tO/H0N81RzmoBvgu+kTv+zF0PM6bPSnSMdLYFJALYGQW8wzC7mJ9a/Ncw0pmWhTOkAvkBvCQCemSAu/wQAcujAoN2AKCup/5fQWIFoIDVJALS3gO85EEYEsDO87ALUOMTRhtJDkAWpNv4kwRAAfBLYgD/SgpMxV0Ac9NTtmC95WfdUho//aqd9htJmqf/wJl7AGq799y8L8JS1nc4153AnzSPvv/d486+IL8nIQjWWiye/VQO3XUTUC4mFAZFF7sMliw4MHzzGtoDDYEkBdQUEDwD4t0pd2zYRDJmMDa0jADdsnrSeORBftRD0L6pJA/rRv6pzQDgh2BQpb+e46cdbVfaGGO7j5PSzcn95vuZt1t56P3tWL/SArzvehRgDgEgGBbczgHGc+IArOfEyzib2knHcyTIxw5IT6MfMstalwQgPZsMM27+P/uWhu9RYO1YyDzvrjo/s8c3DZh43kve/CF25Tc1gnXy7v0x7rDbTJnjeHE6NoxjRa1n/gQgdXbsYcyRNDj7sEfXNi1A+0LyehxAAsBz//jfddddX7xFGTd4d+xgAmQ4ClC1ASQCmKcX73iL4q5E0ht8B0sCYAD2gH1/7q8lIQWSAFjOuxc1zzrH70NeiVd2OZXkUlHAPwaNmcupxTUplckQIMCEyo3/62oFEJ9JiQktjWQAeXIWe4oMAMwB7pIQeMSXvH2pObAKIFbw2QKx+EkGIEdQupCZXgLAnfvM63vf91sjiJEcUFtAt3EB1pAEAAzi6I8UnG8jaz66U2Kfa5IIoG3QyBhJGIiYwaihYbxsr5Y939fYzsP7Tb9VdoE+8bRXCahXvT+BP/0t3aH6f02+2MnHuAk2F5MSiwcmRoxAVeDKQicNFxkBdPmpQRZAubMOOeDuOiDdXXUJAb/9XQDzTQF9K10F+dRdzYQ8qqB2wXO/7nn/ludnTKQ9sn1sN9sRadvelouAWMxPvq1j4LVpARbqqQUwlwCoJMBc8F6B8xSozrC01zx6btLUdPpRfwmABPyMwbq1sw7A73U/+7+dMJf2ykt/y0VSDulp2w3UP5cqxoKM73n96x4QoAP2/dYhAdJwORyG8ClJGm4k/+2PfORfmW9Lpsp/APgl+GdMoY4SFcQ3H+pMPQhn/In01+ZbOpAHuUEfgwAG+EMCcO7/TW949UjA7KiOI+gd55kByLSIAPz+7B//jB+nLwxl0keu598wf9Lv7fMA+6tGAPA9nlkH5JpgU/v1fNsbPxX9A+D/eV/wjE9q6DcbZ3hMuGiBoYMyEP0PT/umnwVYsYsPiHcB7QI/JeHES7+WnXjGZTFQCQFBpMCQYwKt2/8N70nzGUHnAGQBwIJ+7YRhz7hp5+eRAPQA9/QnDf6QHSxeCCMOz1XJAjQeJEXUfiB9NeuSAKYXiOueI01jmaY5A/gH7Qt/lQHgT90xHHXI58h20c47wd6SvfdV/QX51T/d7vpX8J/AXztx6M9DD7++E2d/ADtHBjA5TRECTr4uhJEAG0gBNAUgBQDIgGXV71Xd72kPJFnA2NAD6TnOYNe04qcf8fgGISTUHnAnvx49cFef+rOw41lU5wfw53Njpz0wTOwYwf444eSEfhbw34p9rd8Lb6GQPAoASP3G1zw47owLkqekgFrwK/DV3ZKtOC2/Vtp1/MxTSVrsGJ/JHX5Bf5WMxbQHu/frEADWk7Jy938BfNfpXct7APiW+a4B7O7W5zGA/O751ilrLC+/+WInHFBOnj0CgDJU+V+ChbNPsCQpqANjEECo1tExaTkO3Zrz29mW25OL98SOI79IADHMGnkvRQ39ifc9gv2GRgAXB0JIbNDv91LdPWS61AAYybcZBABaAZemAVC+f/qJ5rYStjP3Hhr9qmXp7r/gn1+fO2oB7PYt3mCC+aInfdV3oAoHmBLM5iKdxTz+cwgASQHTs1hHc0AygMsDU0OA4wBzwGACw7QLSjeRgPseAUAYzwzgJ+/UFsAtqAYsEw+TwNnwKhOcE1bdxte/FacCe92Zhtv83d0H6Eu0JOgnToJ+699qS9oc/5T5Hja1++5TQki0dv0F+/SlNEvwz2B8/LtJBghWY5JKYOsk5iLYhWgFx7hZDAGcK0EAuJYg8Ow8u+3uuKtZgBviQO0CAHvLGCfTk7+79gJ6ygXQY1isQVpQNxZOEBnjTstQ79az5PPaBtkuZyZx2/CmPPawYwvcxuIcTTp/EQCwC2gVJK+SgmpB76aSfATpc6TlmC7T1DDjWFckz5UEAAS/u/3aBf9oZDGPQrSbd09mWZRBHvzKAt/yht3tHMDO3XW1ABgLAPOC/6GsWaQe779HAEAKvOxlL/sOxp4RuJ/Pc6wbYb3d/6wfY9QCDM6q24btdUx2wS3AO6V/czSgdSzg2l4SOKxH6PuuNwD2dwxn/HtaAMt7AQaNG7450o3f1el6bz/fRKyZcj3At0jZSOqR64cMM84qmXl37fbLrJN+11TSbu7+P/auF55gJAKGR97PO7+mbTnvsYbOpVYAl6oB2tltc3cON0ZgL9BHEi/d1W4aSQTyZ3EAyOMXBbgDYFMAWdO1wGv1Iw1gVwIAe8bBDTGQ5IAEgNoCAHPSEJfnIq7gfRuZIH4qHwH+CPIXu/leupj3LOBH+6raT33Z5XenH7fPQrtkO+huyfTDvo4R7Nc0+NMf6BsJ8BP4a1cSl4X4YoE0r6/ferEYMG+amEhoNwZbjROakklO0wLT1Y8xBAMQhzCYMpIJgPcpo5o+i6VaXsttfVP6PEqfF3lm4s12Ok40t96XssYT0/c8CuAxgEoCVHcSAwmsW0C8B5YzbuaR9oxjPjVcfyXhPbth1D93/AHq7vhrhwxhbpcAYJ413yrNNyVtxk8rLn7JZY03sow6jnWObYLs1g4775BxgnFhORbM+O7Ju0UAANzxp8zFnFQXq+e0E6jDi170jX+ntfu/CTmxbIWj5Sq0wHhHAGD/j3/WZ527HwBygPl0nKOuwtPMq+OoAcB3R9/nu+Q4zfiTf8Pt/xABafwpQOL5va7zrc6rUiNWrJNcIzBO5Loixw7HkE2k+a8lG1W+Ll6sH1sEAFoA4/dwXR70EJ+DSYfFNirVAC2AP7v/AF3BvCB/Ffg3ntL0kgHkz0IB4IfKt6YHEito3NQN8HV3AjBNPoBfJBoKEgDEw5+41FkCQKBMXPwJ1w8pqJ4C8ZuGAeof8RdeurxMETc39wP02T13Zz/BfgX81o+65rPrTj/sm5p8j2knP93U+89+zQ98kkUj/YGf3sEI8iED0i45QHz66GKhdYif0qHW6SYZIOAtk10CZO1MbGnqRNhzM2nvwrTyz/pot75Vjv0kn9NnPysP9Z0d63WALZBHAdQCEPQrE/SnHdCbpoLj6hYkp3+mTztxjK/MdFN24yszbhIA7PgD+gX+SuZzxuZxPB/mxR4BUPPHbf5oVrAO2eKVj0Cbb55xgbGDMSi1AJi3AeuCCuItx4gVJADxuCPAIwCAd87skx/5jAv583k060Qa6uLZ/+buP+PW+fy2aJ5j0gNrgVEbt6UNwN0AEARj3zywSm9UnaEvMzf7TU4RAOOvALzp3e+FIJAAkBRbfGMbVWFlIr63hnEsse45dhDGc2Uc4rX80t/w5bjRKNe6zIlj3JXPeMAR+A7c8VeqBcDRgAOu+vWqGh2VXTx2WT0CIIgX1G8qzYfJj7wlA77hJT8wEgKSAoBaweKmQLSmA8ijmsjOvgSAcQD1SQ4AiomLH2G4NeRD/T0qoH9Prgv6vdeA/EyLGj9mFdCHAMBUsO9zKskbe5WG70sK/HnP7CLRBzBJACQRkHYWl+MOEYPl8W8XLXCeFGDBSfsWw0KESWuOYcLalemVt1y0l3ou6326cG493y7a7ZjHLdwC9D3mRjQBUFkHBAP8WybBf9oBvmkScFeQnGHr2ufklXGsk+Xg5rlSA6BFAqgBwBg9jtnDvGkeSstJaZugTbHF7n/2xnOq9oAI7hUBbPPTfA+844EHJScBFoxVy/FkAnATh9vhIQAw7OA/5jGPeSxj1FCB87v+i7GUdJRBWZZLHagLdaJu1JF1l0BnrM/5PPM5j/Zr0gL0H8B+65JA7gygTwyPWvvXVXv62RoAh0oA+O2yUYrhe51rJA0yPmMC7x6pWa5fFuuajFPDZruvQE9hh7/u/nsMQBJgfN4r8CzXpop0VokAgDqgF+APiBfIb0oEmA8SjYIkBACGLCQAiUtCYNgx3pYQSAIA8I5bgxuwjwT8ArQhADAA6gTLpCEuUtA/xmn86oDhSEF5lRmn2iUAeHbzEOCbT6apwJ2wrLvu9Ktp1nX7XpSkr3a0PHiXz/2m7z4D/AX/9K8E+2m3P9AXr83HddgP0gLOZ/0WE9TsSWhX8U8XQmfr0vY77BY+1u5KtwBzIwQAJi8ErCQAABc/ga5SoK0UJE9JgfNUnKmwTJ920+inxB97PpNEQN4BoBYAc/azv/6ND3PcD206801JfmloD9LTjgsgvW2/OLPjLujOn9oDePsTfbxH4rjQDuDdAlw3iAvwhwjAHvGz3uP4RJgLfOJSFkCg1sWfKCQO9RjzZLy8+qAv2+Ron2qB4X0DglraAPhd+SMBw/PxLdDH0X4ZNQAGtX/P+is9BsARgAvXAOD98N0Nhu8Q4/eL5NvlPQD+UVfHzjftGJLSb13SIKVpkJaR5ejXktZvIznV/y45jD7Orr9gH/udf+lvjHcA6Dd+A5dcz1u1+FFViU7vEYFdkwFJCGAnf44hAAzr/QGbHhnIXX6Afhp3+wH1AFhAthoBagDgD4CWLJAYQEokYNdAIhCfSxCR2xgBNXkI0NNu3Qyr7ho3421qt06t9IQJ+lHtFPgD7N31TyngR6Yd8M9u2/HjP7ihZw4I30ecg2uIY4VuzRZgIZgkgOA4AbPgXykBoBQMC7YTLPf8apzqJs/qt6mbvKirz+QzKpMIkKhFm4+fyWVOrXXxec2XvHe4+29HXGoBsIh2MZ5HAVDflwRgcZ6LcQB4AHvHMPJekgsNkG68sWzCXdRbPuVQpuf+2f2vqv+kibJ9nqO8NVrgBgCZXf96QSDaAay/F33j6rXGAKrp234LEgDc9N8zaAIQj++GdiH9CHz38fRD/RJUt8A3dRf88y7YkJIESIDfshNPYzj5pXG8SGk49ck66UZmvWfb99GGG+bJM7r7LwmQu/8SAGjJbFjEMdkuW4AXlpoBAHUB/C40A8irGgkBQCOEgIsNNQQAm1OAVJAKOAfQC9hTAuwJJ65kASSARICEgWSBcQH6hJEXfuaJHfD/4X/550+e9cCbzhAAlLEOIfD77n1wfL5MYx4pqx33Lky2bdozb/xR8Rf4sxvErhDvCiInAb92fjIKu8RAStJCOI2D3C478DGvYwscW+DYAjtoAeZBSABITi8FBBwLmKsU+CsTEAvSK2jWX5nhPXsrrn4pMz3+1a0f/tY5pc/HM0MGMNY/875Xj2M6WgC2Rc0309F+rCl28DrMYgTjgnDAA/nXc/cAcXffWZQTh7jMNyzCST8CLsCBWkbY04S/8V3AW64LfspK8M+ahjpZrmUuy/JpihR0LOKV0KPzqrcA/aB3JODK3gswfDM8l9/hLAJg0AJIAmD8FvelFZPf9GBnDMBQ3zR8e4J/LjRm/Pf7Vgr0U0IcYPQzbubdsmc860Q7avDD3pO3ledaug/oI6E9E/hjf8Tnv2D5KwCSAfiP9T+gut/yVWGS4wUC1ADmgLl9aAdUQiCPDVAmAJPFB2cRuU04tQQSsKY9wWu1A+oF8kgAvsAfQgC3aQyHNKjpIAAA/xhu5TfNOjvyxJUAIH0lAcxz13JOWxGHtuZCP8gYQT+XQnFxn4BewK8U+OtGGpd0LCLpV7f8B3ZsgGMLHFvgoFuAcQotJUkAVNoFvgLdKhNEA44FyFUK1vXXvY3cZV4SBDwPz8hzQ9wy/qMFQFn6E2Y8/Ahjvv6Tj/3rH9rDC17u1rM4FoxXEsA7AfBnse0iXCLAhTWLbAF+lbkYz7LIizzJO8/8s/NfwT/pRoDDgn0FyAF48FOrz/265/1bfkmF/kcdlm045GGdeA5Ax7Oe+pQXYAAhlHVcSC9b6zAtwzvkvbWOBFxJEmDRJ5ffxLCz3/sJQDUCOAZwjgAY8tnLCyPfYvhOHA+UfM98b3yDGtwC+5YU/EMWaCee4D6l5dhOxkv/tFNHvvU5sj7fXtpxg0y54E8CQOmuv+BfN+23QRHHJBfRAnRCPgbIANQAAeVoB/irAfvSDpAcYFLF+AsGkgIsSFJTgF1qgOscgFtBNQAfoO/uP+GCfkgBwDnhGIgBCIAn/+DbRwKg5lXdPVIAf3/ar6bZlXtuWxAvL/JTvZ8F39ROPwB/CvQbRj5cBnVmQXMRnfdYxrEF5rTAsEhgnGPSZnJ2YY184bM/+/3HCWpOI16/OIA3xq0WCdAiA1oEQAXm1b0O6K9pq7vmtSrc+JDgGN1Vkg/gniNfELnGxV/wjyQdfrTXji7/y06FBgB/XRLgn33wg78KEOcPEmAE5At1Y75tF9njBsdCK4DvvmeMZzoX9dwXQN5e+Ed5lJ07/+Q5F/zzUOQNAfDmH37zaN70hlc//O0vv/+3vv5vfe0vYbB/16u++URD+I/96I+cvOOd7zh598/91Al24gBgGMPGdiLj49+htUD3VwJGdWgA61X5G+rKmo7vg/4LsL/jVW95GyQA5/8F/Ur8CDtHAKwgxzZqDtqxGL5J62ud/ab5Zvh28meMmffxxwjyUwL+NWCkjE8a805pXoY7tsyVLWKgPufo3qjRdpRoaPcE/QJ9/bgHIEmA468B7Kjd950NnU8ywPPfgEAmQwD7ri4SFPz3JOVhJAUAqYBMCAF2rTHsYANqtyEGAOIVwFf3NmAdAgAtgG3y2DRtgv4e4Kd9Nbmr3wP+An7jQtYcz/rv+6s85j+3BVgAMBkL7AH373jrox5+/7vuPNG8581/8ATztlffMfr/7u/cMYaRdm45x3jXqAWGxcwuSACAMUaQ3ALZ+hmvF9d4LZlpW+EtP3b1Na1w/TgO8JTnvnQE/fpVCRGA+j/rhD31gtNz+cN7cTEMUGcBDQDn/H0Cc9Tz8RN0uBivC+4K9g03PpI8yCtV/ilrzD/U/gUai4W4xMXK5gDoA+znmO97w/efGA/SAAIAIgCD/zOe9cxfB5CsLPQY4VJagD5S7wXgTgCA4VCh2X3mUip/s9DxVwD4dvw+uOSPXX7O+nv5H3L8FQDIAX4GcKGZQ7qRJNvH8w7jw/j9LaTfJJJvm/rS1mkA8xIAX3HvV/5C7u7zLTGmpSEc0mCKBMj8sZMP8bHn2FLt1hF/x6IqHf/yOc/Yb76nC7VRZ8F+Av1qNw5y0Q8utJ7HwrZoAT4kOjOLI0AeAPyitQOSIPD4gKRA1RSAHKgaA0kOzN0t3xRwt9JdJAHA842gf/gpRsgR1DRpI8A6bSapkrIH/gX4ygr88adPLBYgV2Uy2+JrOCY95BZgQgLoC+4F+G/5pj9wUs2Ln3vnw/gpIQAwkAWH/IzHuu21BW60SICWFgA75fvWBAB0J6FQQXh1T5EChHH8DVCLgQio6dMN8Y8mYPqlnWeHUGaBu9c3MoAGFo0ugiUB+NY5l+9PBLI7z59EAGGVDCBNzxCXNBX4kydlEEZaFufUQaCxCbABGCSo176OTCIAYgAgQ/32/C6O2W/QAvSVSgL88c/6rF3fnbFBzWYlGYk4+vmSABiA/UgADEB/BPwLEmC0QwoUAoDn3+Q7WVm7BehPMOx3qeR7FZyzThWcJwGQJIDAX7D/RU/6qu/wuABpJAKIR349Y3rLtA7KHIfwS3faJQN4Hkw+69K+sqH2EwFNlh7Yr7v/xuNZ91ObY677b4HhgxsnwKHzc1RA7YAkBC5KO0BNBMkBiQGArYCVetVfIZAgUHsgNQgqUbArsmDfBAD3E2A4ujCqaA6X89EOtInvwyMc+GVbCf4lVJAsFG3DlqRdef8MbkOnOwL//X95xxJmtADgvQL9uW40A9QCYIybUdwxyjVtAcY1dref8Tf+4fgzdxAA65IACdxbwNzwnhRsewYfqd82Ug2AKQIA1X+eFy2AVt0pH38uTtwz6BzBx9DNmscBKLulDQBoZ8ceMoB5EFD/1re85Z3f8/rXPQCQx+DGEEYc4qZGgXm4609Z49pnAf5HQDOsh8a6rTkHks+X/dV7Tp75zGecPP/5f/PkFd9636jyDwGQRwPc/VcSnnbj5/EAtAsWi+zjvLzd+DQST4Au3hfvX/Am6AMEAoKmDHFIR5p6JwBuiK3tqnkhqce2aBIACy0AiYD8CUCPytCGF0EASBIqeW++O9qfdwEwx44E+KNBgwHcE24cwgX7SAmDSgKYBpn9QgIg/Qm3D6Xs+Tvm8Ay0oc/VJAIupBucLQSVfoH9XEm7nM3l6LqyLcBHTSdN7QAANyAywacg/bJkgl4BL8BWgsCjBex4eOeAREGVEAYt4zGElrzj6T9w8mnP+/mdHAEA6HOHAWCfRRhgvQf2a3vbDj0CINsGewX/nAsF+PPOr2ynPVb82rYABAAq/XNBf42nFsDrXvznPnltG+n4YLNagEUXYx0g14sBWyRAagFgT0Bfgbph+DtuM3ZXQ5ggG+DP/IQhfSvP6jflbuXRik88CIAe8UA42mUsXmc16PaRliSAC+HUBki1/QrkAfP84Z/m1Pfsf8LVIlCDgL5wbtf/Jvjf6MloN3aFAYF33333SY8QmKsVkMcD0A6ACFi8myMRsMYbAlwB2nw3vB8MO/bjrv2gvo8KfzX1p/90ZzzS66+8IvcBnCMAAPyc9fe8v8cARiJg0ADg29krAcD3V0yCZL5ZjeSNoFwJmAf8cyEnUsBPOPY0xIUwwDzlq5/y4xkXLQHSSAZglyjQrxIBfJuYnr8EQZIAPE8+45nnX6OP7yIq2E/VfsH/E7/05WfO/OuPNO7xHoBdtP5h5jFeekKHlhBo/bJABaWX5U4QzAJM8Kus4Fc3pEEanrFnWLQRhuRCwdbxgJYfFxMK8rmMkB2ZXDDaZu7u654jJQHqotPnTilJ8ryXvPlDDHIMQIfZ9Y61OrbAbbexaEPtvwL7uW7IA0iA3/zlO/Z5tvn4qq5QCzCfrdIESBIAYNwzjOGMv6iUP/x/fexkyjC2M0aTN/MHR+96YLwF4HfhBwEA6dHLi1+NGXej9v8+BbFdEoC5icUywIOdfi7rc1e/RwgkKaC2AGkT+JPvrsF/NpebKPQzwCBjGEZC4Llf85yTF73ohScvf8XLT7g80F3/KWIAAgCtAAwXBpI3pEmWe7S3W4C2AvAD3AXp+5SUc4EbKsvjNLEjr5ZNu0FOfZfaEOM3NhwBAOh76V+VkAKESwCMfQ+wvqamTLdCBfgDhBMY881qqC9GLQzBvyBfAiBJAIE/QF+T2gItEoD8JAJIb5wsj76VxjD8tCshB6iz9Uf6TDzrOO7Wdug22O4DqBvAXtCPRGsu3UkAaB9/NYZ6H/+ufQvcYOKkI0sIAJxZ1LAIAqyqlj4HuO4qTgL/BLuVBNCtNG516z8lAdKEA+T92UFl/kQhv71M/tk+gnzltu1A3hrKqoZ68p7QhuC98aEvJotr32GPD3i1W4CFs2Cfs/2vefEfWlsbAPAPCcBdAkNrCDyudsMca79VC7D4QhuAHW8A8SpNgEoAAKAZc6cAfy+M8d7xGCKgB8Z37c8ztC4C9NkgI/b0E4C9d+W3OAIW5iRM1QZwkcw7A4Bwkz8q//yUH+r8EAMY7Pi99GUv/UF3K11sm0cF/gU09eq5E3/Koj6AAwDFk5/+V37z3nu/6gRCgGMDkAL8UoCkQI8QgAwg7AX3veA/AWaYz3dSwWuaCevV1k79PkkACIe9EDQD0KIvSyypyaBWAs+Jn4Z4I7A8/26XBAD58V1xzl8NgCrHywCH8LH/DhjgsggAv2ck/Z53C8AW4AvUAf/f8q3feoIBuOPPt4I9DfEkCgT4mZd20kIsIPUT2EsSZD2qHbcEAPXG+CyOTZdNANBXkgAA/HMnzCoCgDSMq+e72NHn2rcAAwGdmY+ABRULGwBnAt5tAe6q9JSVoJfycSOrXb+e/6p0liMBIIhfJVc9wy7DbQ/q6M/4MfjsZUK69j38+ICX2QKol3GuloUxk/kz73v1yd/75i9dSyNALQBIgOOFgJf5Ng+vbOYtjgSsQwJA+jJe9wD+HH/SMzaz445GwK7Bfis/AD53/Bgm8EdSB9oBcHoJb8kdy6U2QBIBLIxZYLpQVrqArtJwpaCffJgDyXsE/qe7VpZ9CY99223Uh7lZQAcpoKZA1RJIQoA7BjD8cgBaAQATnvdSHuLwC71BGwuKP+dzPudEo98mkjwE3pVMGP139z5GTVzIcOpJ3rW8npu4pGmQAOO3Rv/j++AbgjRT7b/K3P0nr/L9bN8Dys633yrS7xjpty6IRkqooaKvAayzXoBMgygT3CMJ0wD+Ccdg55iNhrz4rgT/pDGfJAIkBPAzjfVAEi4BQD/EWH+ex+fjWTG3lbbYvnHn5QD5KwEA6Af8c1waexp3/lPyPPNKOca61i3AgEKn5qPkg0DVHCAKcE5SQMC8LfAV7ArMBfBVJuA3TDJAtzLjpt1wJM+E2bb+26TPNrRuEDC0OTv9DDTjgHKte9zx4a5zC0AAcIcHAIW+zfEbdm1HIDOc61c7YJXMCwGP38R17jHrPxv9ASIADanUBKDPpQEoC/7nqPyvIgL+6Qc+8BAEAP05QTlAnTsKIAioE0ZNAco37rqSPHg+0iX4pzzAP3PG0Hruyq/fkLtJcQrIh0WwQJ01Be9IA2CZY4yPJA/zGxfYp8952c/aarEb1JcFNaAB0AcpkJcLAmoA/2gNeE8AJID3BIyLcUDE8e9mCwztIdAVRCb4Isx+Ql/J/mK/QRpGXAEp6ywInATnkAPkebMCm9kogz4wB/SPpMMA+AX91EdDfUsNlmSbz4IWwGg461/NEGZ7EZ+2GPLbDXlGX10Y8sbQzkoBsu9N8CyYRvKtALYB6EoJAI7aAO4Jwwj6CecCzjxegx3jxZ18axy5IQ/iZz7gG4kApPmnTAIATEQ9MdjHflMIAJ/b9hhleXH7cNJXE/wD+L0rzWMAkgAJ/LXzTPuo1zHPa9ACDBZ8xHT4ccdlAKgs5HdFDKwiAQT6VQqaq7/uDK92CQBJjW2A/Ny0AH7i+rzUgXbkZ/tYvDGo0M4XNWhcg655fIQDbwEWVvRxwT92DL9rPp6jHtRm/dm/VSSAFwIetQAO/KVfUvVYfDE/eTYfYJwEQIJ/CQDlKrDfC3/f+947AnwAP/0ZsE/59HdAHeEYFqKo7xNvXeBPfIC/JII7/jwf/oB/tPcObN4QXCyBSgIwF8oChpSEaUgzgpU/sjyvbL6X1Ms2KnbcAR4BwzAeqiXA8QGIAO8SoI+gJQCAQQJKAE0blXhMtG4L3KDP0d4A1HEdtiWZRj4A+NbuvmCfcAgC5kn6x0g6RF+n7/NtDA9Tya7xO/CbIh11pv5LIkBCoIB/nnMxVtQ8122z0/jUd2HIm/pSl2p6BADrXgw77Qm+2dXnmwDMIwHwgHncaM6wlmZNzV0hUybX3Xxb5JVEAGWqUVAlYWoAKCUBeL88Uz6n45jtsZSbtezsVPSdJAAA/V6ejn0VCXC8CHB2Ux8jLlpgZLr5APh4WXiNNzQvNAYA4YBuAba73X6MCZoFxMQXqCvNJ6UAX9mKa1hNZxn7JADqs1o/FoUsDmknd/gZPIb23M1AfOyaxxY4sBZgshT0tyQgBjJgzrEALhOEBEAbgAnvwB71WJ0DaQEWYcxHgGMJAEAz8wxjM6B/W+CfhACaAGi0MLYD9nt5//MP/uPxCAwXGK5DAgj++VYE/RAJaB6QF/PJCJIPpP0X1cg5bQQrg/9IBrAopr5TJhbON9Me1vNtVRvmfdZNagi07hIArEAiLX9GcGi3rQo9Jr7QFgDUt8A/fu7y0wdGQL7ZGnBJrpFHkgCC7QSojIvEW4wVflfbtQl9cjACX8tIUIzd+tTdf55fw1qBHXdBOCAdcozvgHGVcRbc4EWign7X24kp0k54psFNfmgP8G1RTstQD7UEqJcGIoD1hwSAz8ZzZjvQLmfMdi09mRo8UQmA//H+nx21ACQAkgRw5195wXfHTD7LMfBqt8ANBiI+Dj7sJAYAAFVrwA+1kgCC5ioT0BuWYD/tvXD8qQeAXILCekxJBxpkxiOPrD91IG9U+QX7tAVtcoALtavd2461P+gWYFLnW2iBf/34FgE5aAKs+slALwQk3kE/+LFyl94CLMYkAhiTGbMZu5MA6IH1BPhz7P/xYx/uAv9MTzy0BDifCTkxdSQA0mLUkhmIBQA/34jAn11/8kB77ArNKW1S4BT8CEiU9p9Mo991k8tjA6wTkhTgmIC7oP56wHV7+Ov6PADCngZAEgPE4b1v8B2ffisLoEl6d+ATiArKx/yJe/N7277pF2VbhuVLAAiOlS0CwB11pFoA7P6r4s/a2l8NAcjn+jvX79ghCarJOM4BkgfERaOAsrxLwPsEIADUSNAOCUA9IQAkASQCfGbbAnlBBMCNP/30b3lIFX+APnODBAB2SQDjIAX/SH4ScKzr9j3imMOxBdotwADER8FgUAkCmDgAs6AA0OAuvTLBfdoB9OsaQTqDQwJ77QJ8wiUSrIeAhoUcCzBBvgMDz7f8+NtNcfQ9tsAt0QLsgvi9+G1XSTg7outoAUAE8L3dEo14fMitWoBF6bOe+pQXcMu84/2ugH+C+3XsLDpZhAHqWyQAO/1oFKDGCeivwJ8FHeTGcdG2Vdc46MT0W9YSAA3GUYiBxz/tcQ8edKWPlcsWWF7+x45/gv6WHSIAEJkZzLRLmi01bBgXloB/sC/GiZvxZmY8Gc18B8l6FyMIFvC71q+AGTekB0bgD/iXAACQo/3Cehzwr8HNGK4BwGtHsrNfTY1DvB4RkHcFAPpTM8DjANa7EgA8q89ve4ztHu002Z4bBlJmiwBAQ4x7AJIAmNICYON2wyockx1bYEctMHwsTHyqM0EUOFiw4NEAujESB5AHmgowcAMy0uCXhINpkeaNWg3lMUDx0VMPP3I+8PHj3kx1a0eNdczm2AKH3QKcLVtFAPAtQsgxUX3xF33qyl8IUAuAIwHD098KO4SH/ZKvSu2GueWee+75cn5m7hd/8f0fv2wSgAXuF97zNQ9zfMBL/TgOA7EM8GcB1wP+4/xzVdr9WM9jC9zKLTCMO4A01pCQOFNaAVuQALZwgvy0G747OTwXa2DGot7Of+745zraNT1+EgCq27OmB8Qn6JcIYOdeoA+wJ54AXzfjahrjSAwQzzQSAZRFGaSDBAD4p0aAxwEgKHwOMYHPKOnBu842oY2WZnetv8yJCx9zZx+Qz9GwJACSBDBuagBg5zmWmR4txxY4tsCxBY4tcGyBbVqAs2WctZsiAdjphABA3fn2L77/5O6nfePD9z3pT3QvB/QuAIgAJuRt6ndMe4u2wLAoe+pTn/qMt77lLe/87Y985F+ts3u/y7iod//FxzxmvCCQSwLp+0hU/DUs5tA0Y+F5BP63aH89PvZ1aYHxuAcAuEcEoO0xPOzhE9sLYMuYJOB1B9ydf0FyBfyCaME/8zgEAMdcAOcCcjVxkZ7jx84lgAJ6JKQA6fDnzoA0+BmG3bQtEoByCUcDASLA4wDs/lM/6pkkAM+FSRLANrBdluB/0V677sh3vOotbxPUIyEA2PlPAgC/VSQA72LXdTvmd2yBYwscW+DYAlehBYYJiolMdVN2K7ZhhWGmbzznx5a3orc0c/SDIOCIjbufTGBMWlyO1fqVALUAuBBwmzpehddyrON+WwBV2bvuuuuLX/ayl33HA+944MGLIgS4D+CX3/sTJ49+9KNPPve/+9xRG4A+DwEAccZ3yOKSBeXQAocPCPb7mo65H1vgWrUA4w7f97jrHz//dxUJgJYGAPMyzwew1AigE0wn+AfcA8KRAnTAvWr7hEEEAPpbYB4/wD9HrDQC/tQK0M982f3HSDKQv7884Pn/JAF8HggOSY5x7TQcA0gtYdvlDAmww15MH3ryD759PE4mCcAcggYZdwAA+jX4a4hbNQDQeN5h1Y5Z3cIt4GLlVpG38Ks+Pvo1aIEbLDo+5Y7PO2mZT/usx3nrvt/zykcmv99/13ee/MGv/Y1xZ5/JWLDfkxAAaANgiINGACw2v7X+ouHnArkj4HUv/nOfhBAA+H/4X/75k7vvvns8NrCyQscIxxaY2QIsqh7zmMc89mu/9mu/7nvf8IY3/rMPfvBXd7nrD/DH8KsAz/2a55wAAPheWFSymFwA/pm1PUY7tsCxBa5wCyw1Avj2AZFXQsvH3eyFpM7ufLv7XwkAgL436SO9YA87av+CfwG/IB8JGYDJOAB6gbxkAXFZa6B1qCEOJrUCSGsa8gT8IzFJAqAJwHEASQCPKUhkOGa3tADUAIAEOEMA0GY7+qPNv+ydDy4JAAE+GyiVAFilAXD8KcAdvZQDzyYX8S27ftvKA2+GnVXv2E47a8pjRhfdAiw6WqC/5QcRAFBhgu/VkwmJ3cs7/9LfOPm0z33aySP+wktHNnrqCICEAAQAdrQAJAKQEAGehYYQYFJ+5jOfMe6YcpM6atPHyav3Ro7+O2iBcZH+ohd9499RQwAtgVXmox9+cAT53DeQhl1/fuedRSULxx3U75jFsQWOLXBsgYtrgSAAALrudDP/SwAwtrG+cLdc8C/wRzIGomoP6Gd3HwkwB8hLAFSgD0BXC4AwCQLAO2kB+oJ/JOHES80ACIHc/Zd0kAywDNJwDEACIOuuFgPPyLNKAqgBQFtIAiD3QQJ85l/+6r/2+Df8QpMAQAvA3X+lBIHaAqkFcPwpwIv7fC6ypApQKVu/KXsNm3KbX0rst4LJdvH58ZvzZ/x1JXmbptrnlHuMc4u3AOw8O48toL/K746n/8DJH/62957891/+6u9214JJD3Lg9q945ckf/a5/c/JHvuf3Tu78hl8cCQBUmiEA3NkX8Ffpr2xUAiDJAAkBGG7y5I9J+7bPeJJaCrf4mz0+/rEFji1wbIFjCxxbYI8tMJMAEPy7Y+7OP4AaYA2ZD0BPtf8E/gnc3e2XLGDerwQAYfipBYBMAgBCAFCf4F/iQD/cGEkA0qgFQL0lA5IAkASoxwCSBNgHAXD7i17z3QB9Ab0An/URRuCvNNz4SQAcfwpwj9/LFln3gJ7+q2QWbVz8ql03UmO8VW7jbStrHcxv3/6Wsytpe62SWR52/nzWU9d5d42T8dNu+qM8tsCZFmCSWgny/8xdD7ODfwdy2PknPj9dhB2A/8if/sTJ7a//9ycAfuKx43/7337XySPf9F9H8H/HKz8y2pHcdM5ELAkgoK8EAOFcBmj4HMmkzR95UcfhQa/mN8CC6qrW/UzvOjqOLXBsgWMLHFvg2rbABPhXAyC1ACABUv3fnX8IAMA64F8VfOZzATtrBoG8O/qSAMQnnWQBO/8Cd9X9SUv+hOFnfrg975/gHz/KJ1wyABKAOHkhYBIAEhxJAFwkCYD6P0AfQC+4R3Jx7LoEAGTAqKlwbTvu1XmwuohNd9p9ouqXbuwa4rfsxp8jM455HeXNdrUtbOu5sqZruVt5pV/aST/lzrDTmMf/174F2KVfBf4B+QB/wT9uQD439GM+7Xk/fzIC/IEEgAj41K/8yZM7v+X/OwJ+SAEIAsJHggCSYCAGYKmZhFF/ZlJOMiCJAAgA3FUL4Fte853niAF+Po18WAhAAjCBcXHhVXmJLJZYQHB8ASKF3/I9TsBX5e0d67mLFmCxjBl3x7bJcAAl/HQweamKy7eEarLqyVuXsU39jmmvegu4HlNe9efZvP6FAOA7Yy7TjNqAg0ag3yLgWBJAFXpANKA+gbjgW1CvKj+X8WlIwzqCuIJz3BIA5CfgJz1hAHjy1G2ZpE+gj534xE0SgPUF/q37ACA2eDaeURLA8cd2oF1oI804DtmGm7+F28j3aT/x7x4C8M8lANAEkChoaQGQ5xZVOiZd0QKCMqK17OnXi5P+ORhpNw/dNb7uGq778qUfxz7lecB+2c+d70V7ldRxld8iykphXpnfykTHCFe3BQDHc8D/CPgH0P/I4WZiSADU/e/4sf8wgn2APuf6H/H5LxglZMDvu/fB0RC2BP0LIgD3eBzg5f9pJAn4nXMIAC5AY5IF8CcZoLsSAD1tAOIxYfPHBH7oRwFYFHHbLuftOErBryRgIEmQ+B0n4av7jR1rvlYL3Hjhsz/7/e9466Meftur73iYxTSL5nVyAPSTjstByaca8sXgT1lD3jnvrVPUMe6t2wK1z1T3rdUysS6XXGPOwgh6Bf+A4SQAUJuHBGD3H1ANuAagM3djWBNIALBOYNce8M8OvCQAfsQhHSCeNBjcgHskbvInT0kB8iOMMi2XMO3EJw6S/ElrGcSjfI8CtC4DlAjgmZMEsG12TQDwK0utCwAB+ez+owWg6r9yCvyzgcJ7u7U688U/bQ4eabcm+rUkfqsNHyjx4kOdY+f2Y+KlxL5LIyM/JSmP8Cqn0uwzbJfPX/OyvfFPe8bDf2NjP5jTb9px6Jetvoj/8e+KtMCqnf/c7ZckGFX7B1B/5288dPLp/+QTo2HHnx1+wD47/4/4krePErtq/0kCpB0i4Pa/++/HtI++/93j5X5JBkAEaHoEQNUEQAsAjYGPf/xjn4AEgCig/uyqH8pkxqII0M8Ov4B/SrJguiLd6ljNYwts0gI3+Da5+ft9H/jyEZwD4F/z4j/08N0veNLvsXiemyn5vOWb/sAJaTX8Skg1hPHLIZAFc/M+xju2wNAC49qH9SW/DDKuw26uh27NBirrUYGtBADfZAJ/d//59iQAANOAagwgW/AvAVBJAAgAjEcB2M0nrumxC/bTD7skAeGCf/1ZM1C+4D8JAPOUNKBOXgjoMQDIjCQDeFbMbAKAttzw73kvefOH8icABfeA/d4RAIgB47U0ANYZezes9pVPJhjiQbQj2+b0BZ+GlQ/ntsGdQK/ap0AtHx3hfnwtCTuukYWaK1m0+kHL6m0jGRTmpjcucpeG8jO/nlv/OZI4+zBTbT/3HWY8+0FL1r5jv5rqf7WvVjd9+4zpfR/z/K/8oHGZD0A/ENS3JEB/aYadf3bRcQPq+Rk/LvMD3I+q/YMmAGSApACaAYRhIAWIiwTsj4CfIwANc+dCIwANgj/7NT/wSUC8jD0TL8D+mfe9enlxYE8DAH/IAjQH+Kk2Jngus+E5ITUgAujHF9j+443x4xg2HLcA9OdOfw/4ZxzGkwus77GoYwvstQWYX5gfkJBbgH2A//e96ykPPeclX/ewxFh+A3NJMIjNCvZ7brUDmAP3+sDHzK9TC4xrfMD/y172su+gHy8ebvS/Tg86+1nK2s71outN182ASQEx4N8LANlFZ653513wD8BOwzoAgx/AHPAPCYAGgOr8gHPAvHngBvBLAgj49QfwE47RTv7kl+DfekgCkB+GOlB/jUQAz8YzYioBQHvQNq6zz6yLacsN/mjz+9/zH5rn/yUA3PVPKfhHtggA6r5Bda5FkjaAT4BSOj4vsgKfKdBkB1C2wBh+fkhVTgHNBLbVLhuF7BkmXMKQuzB0JPNp2fVbJVt56NeTU3n2wsyrhuOvX8/eCzfPi5K+v9471p/+gb32E9wO3r2+Rp90QKv9E3erT9vflVPfSP2exgm3fnd8k/jlt9m3X4vBaZuHQKW/CfwXZ/sB+2oA+PN9kACo+qvez06/u/0A/BH0L8gAtQMgAzgugDo7wJ54gH8uBsRUIkCSYCQDIBkG9Xd+MYAJngUCwB4SAKNGAERBJQMIw58JmkmdXxPgmX7/Xd853lnAs/ENbtOGU2np1+QP2TBehjic5wfo0w6q9ifwT6CT/tqPAGWqta9uGOMmC0SPgPDzlWnwZ1xejG1X90FLzVXzB4CzC48E+NPfGS8cM+q3wvfEnFKyO+Pku+sB/uqvFsDiKMCZfI6OYwtMtMC43liAf3HCRPRrHlTWY67rcj3oOpLxjG+UNbK7/4B45mpAuMAdwM2cr8Et+Aa8E0+gDgiXACAOeRHH+AJ8QT4kQNpxs05AkibLtB5JBlA2+ROfcO4CQBOgRwLwrK6vc61sO43je7bhBt2Fn/9rnf9PsN+6BHCVBgCE6gbVuRJJZOz8gFfLxUuqoKQCGF9sygqE8uNIOx2kmhYw04+O1TN8aC1Dh+wZGatkr7RvIpMJq+kf/7THPZh+6V5lN3xbSfnmkfaWX4ZXe+s50y/tpN214X2SZ0v23nWrb6Rfr185mNkHU9a+qzv7eNrzu8jvBXv9rtJdv8Ezg2gf/NdvnIHKcaDar8Qgtm4lWUR3CQB3/iECBsNFdCNIB8ATNvhx1v9TnvwPRm2AFhkg0PeXASQD7nzrB8eFPeEs9CEDJAJamgH+egDxKQ+Qzz0BkAEAfDQCIAd6WgGEpxYARwzIR40EQDfn7unL67bhufjDvDD282GyJE8uRkTrYGy/DuinDVrAnza1jYxDvz9X5tHjSrYA75IxFlVRFo6eY+Uoy7O//o0Pu2BzZ4ZdGfrUdSKBkgAA/POrIAn+KwkgcYY/8RjDmB9aHYDv+e4vfOzJM5/5jJN77/2qkwr6q9v7AJjDWvkd/a5UC+Rcvs+KZzmuKfZZ3mHnneB1sDPG8X26znMNyDfmmpIxkHUp62LmdAA5wL0SAABvDWBb8C1hABAHsCcBgJ95EZ+8AesJ9AX86SdpIHFAeZSd2gCGEZd8kRAQlQCA3HA9zrO6ZrYtbBvaaRzLsg03eNuo/7fO/zOPOKe0pPNMTwOAsXaD6hx0Ej9eP9y+XLyUCjYSiNjZfZHIBDW+6CrtCMoEUWn3g6kygVrae2BPYDgFPPkYWwYwjD/yaC6vDXwHrXeUfrxj3FPvOsOm+kz2Le21L+rOfpt2+3jK+j3o9tvJ7wl7/eZ012/zNgfSzUmAgx68tqkc7091fmRqAQDuJQbYIWeh7S49clT3H0CzcSAE0AhgV52jAZIBSLUDsHtcgLsCOCYw/lzgAIrHSwMHMgGwO6UVIEkAYQCI59cDAEtMul4WCBGAceef3X/sGCbo//ixD59w2SBlpRYCxAPPOQIs2mbu39DH6N+w4yPgH4gSwby7lpAA+lFGmp7/E+9/1SfYCUUl2kvMACxDtZyz5tbwGO/AWoAxjDEXQE+/ZFH5jx74/jMGP/ru8+67aby4iXTj93tgz7VJdWgHdt8B/5zxHzVzFkSZ4D+lPy3KmMN3xHfMN4SGBN8hc8dQj/EbYY5Bi8IjQ8/9muec3PekPzFJBFAPvjfmkk2e55jmIFogx0jX9AdRsWtfCddcg3TdxvrMNR3fpOtB1oquI1l3ApQB8ABxwDqgG+MuvOBfKQkgAUA6gLhpAejM+YRjBOoA/vqX4N+4piMfy6QulJvg33wpm3FbAsAjAEkA8Jw8M89uO9Amtg9tdlu04Whfo9MwbqH+/wWv/JGHmScE9S3AX7UAVmkAXCcCoDVAOFCclYuXUcGFoANpR0cKWpC+VGQCnrTbCZQCqJR+JCl7QC3BXLUnMNQ+F8Q/+el/5TeJmxL7uoZJnjSbyEyDfY7beC1pPVphNe+Mq30TSZpNTW3/dM99j8bz/VdJn8Gv9h3dvX6XfVN79mHt9vMq85vIAdFvKL+r/N7yO9Se3+pyMJ1HAuRQm2NE+l99O2Pa4iy/u/kQACPwHxbWEgKEuTvvWX6kIH0E0Pz030AYkN4855AB5CMRwPEAFvakhwxgYT+GL44HVK2AejyAewIAUuweMFGjISARwOI/jwZAGDCBf8lb/8XD3GFg3kg1DQAUTHb0vcbLvkH/pI8TZ9zZb4D+BPmVABD0KzMuzwIAQR26mgUB0KjS0euKtMAN+o0LM/opwP/Bn3lT10BuJQmgnQUdeV2R556sJnMB3xLgP78JCDTBP3bGo8/5nM8ZQTykAd/DX3zMY044WmM64kHEQcgx56AVxBhwxgxEQN391y0ZwXw3Welj4EG3gGuErSo5zJOsKWbkcahrBeuF1D7jcbaIssBLrLt4B+Ij13HMnXzvrgcZw1hT8r1x8ae79ABs5mmBN8Bag18F4oD13N3HTV4SAIQZvgr8Gw9Jeuoi4CfParIM6pU/CSgJgJaX62rX0LQBbeF61z6LpP1Gs+arQP3/K3/1d8a7k5xnKglQgX+SA8ZVC4Db/zWMq2tW52CiZ+f3Y7gpF42dwAG7gCKlL0lAYsdW8jLTVKCTnT8/Aj4EjR0kpQCsygrgdAv0WnJdAJpgWNDbA81H/1NiYpftYJujxljt+lW57jsmfquv2J9asvZF3dlvtdu3U9r/lfVbye/IQdLvDOk36DepzO+1ftPLgfXmAHtzHDhPEjCA5dhxMAPaNhVhsT0C/2FBzQ6/u/8AeUA4hgX1EhAvLvJLEiCJABbpgNyRAFhoD4z3Bgz5e0wADQAANzJ/IQASAQKA4wHkOcZfkAmjmv6KuwKsI/lIBLBQYJEA8JcIAGyxG4imAH8f/fCpej13DOT9AxIBaDkA7gESYz8bxmcBfwJ27O70V3/dlQDQn/qixUA9IS+QP/WSx43An53INJABx/PJ2/T6y0/L2MeijJ38b/ru//UM+JcIaEn6rsA/5XUiARiXx++roS3D9wXIZ/eebyKJMdze9M+cy7fm90WaJgEwEAL497QByJPjAP9/9v4GaL+uru9DH9qpbf9HsEWdyeh0zkyd5GSa0eSYk0kbIVpDJRGdRqKBKIMiNdYgKpUITyIIIeQBoxQN+AZRwWMgk2gEqsGSMYQHFCcGIUcM2BwT2+ZUPU1Nz0xzzgR4/md/1nV9rvt7/e6197Wvt/vtv++Zdf/WWnvttddee738vt/1W+ui319/q1lKsGcNtPn6qU996h/Hre+dmsPrtYvw0CbRKfZ8/k1LfvE+F/rNecqoTrWW1N0YASAOYkxER0R3/CuveumvA7oB7wBuwDTzOPM58yNkKNukkJL9WgEkCCcP85EYIOwqfxIAxGk5UNNkPuSPA/xLCCglGkhPHOcYaAXAWQCSAGkJwHtXAgCdVh32oazLPb4W5v8sbiT4T4A/xy/4Jw/BP/I2EAA09m0XFSkYSIBgAxVMIAUZFYAQFqQIWpQJbAQ9SoFRyh6ggiWqjsaTzsMlUtLYdJiN4k/58MMvvv/CH3h4y7XDKkpcTXNs+KVv+cvtmVWS75y4mobwXXYMHLxfSuvKOMO1HryOJA1yyvH9uY7c5Wg/rQ1FO7O9KbM9Ouhlu63tmsGwuuwf+O0/yuxjDqD2PwdT+mftt/bnMdIgxwPHiM0AXMeTi/Aew/LNSUodAPRRjnP1XxKgWQKw8v+t728EQDP3HyEAJAQEzdxDnloDJCFAPJYB/nqAZMDm8MDh3o1lweCXCCAv/Lu2B1AGHGUCWLPih+KAgiARIAHAhM+vArzsrStSgvuSBLAckAuNoBhIEuoMILIL7LsSKQhBcpI5ZAJ+ygagQ4mhfJp+q+Ro7p/gX/9CANycfnRISTBTRwEDxKPAsvIv4E+/cbaNMQKAfFDWGO8OKc9NvIdxXcIs+xJ+9+jTHyAB7BfK97z5320r+80qZ+ir9DcJAOYvxgQlFkNj5wJoBbD0tytpIdv6+mnm15rn9IsMGKH9jN9FKu6f+tt1fereq7pmGe8x58f7GX/6cgTWQn8SW6l/qZcJ/tHZ6O/od+h7zImAaAA18zYEAPOic6MEgGelJBEA8BaIJ+ivoD7BP37BP7Je417ymgL+9ZmkpXzoxerB6r7nJgDQXTH///w3/Hw7xT9X8xP4awGgzGt5z00mAGjE2y4aHxWRSr2sClKgXxtlNs4eyK/gQ1Bi403wUoENYRsBZi49R2MRTCFhw5QJ0ARtCe4wayUMKLRzIDOsH/mmN7ym/WQFfjoR7rv+3n/blJKepAMSj/yxD1yfe92Hf/A+jjLoTzkWn2mm/N5/ne/YezYDIfEp8R/rNK+akg7AKVFee862hMx2qJ823XO9/mBcry994Rf/me/sOftokgJJDOxLDjiGSAogmdg2ro5Bq/DpJ9YT5vh//l2/6wMcSgejK1gXsANymxXAk39861R/APEcIgDATDpMecnHfCUCDI9ZBUAOtHMCBouABr7XRIB5UV6Uep7BdVwF7hIBWgRIBLDyr2PShgBAkq5aAWSem2cMK4uQJjwfEqCCE+J1lSgA0EACQETQjwB7yOxDhOk3CXIENsoFkJywI1x1VsO4AQGFsgWgF+QL/A2n1E+7yJX/9JPfemXmfIr9FdcVVjeAePqY/QwpMKc/VCsA4lj0gGDL+yQAtrYADEQAOhPWQV/4lKd0LQHsh8wZV/z6D9LjVjo8cypzJ1L/cbWwjQ12zcvDM9fWHvv2IZ9zXGnPd3d7n2c961nPefjhF/2F9WP2fcd5pfPbhRR3VazVIwDQ85gDxwgAdcrEPeiVxHMfOqzWABIAPVBfQf5Ymgr+0RV0kg1K4gH+3kO5KgHA+7mohZ6qXirupI6sL/TOh6Ie532Ahx769Gf8+RfX/f8J7uf6xywA0BvnluXYdDZS5LRbV5RKukq70kqtwJ8Kt/KRgn5lggiBBTKBfw/8H7qyz2ppXUUl/IIXfEv7bUkkE9wpHSvFzVJgbQmQfq5dlYOI8Fn4M2z8gyT9xryz38S4c0nbV0r86ThECUec/tpmc9Vfv+RXyl4/SRKt9rPsgw6g9lH7bPZn/U4+9n/GA8cGpOOGcjPw9sedY8e1a72fegNMo/g2AmAN0gHmxOMw3ffgvocGIgCH2b4m/676j0lXzwHybeV+/QxIAN3meQOghyyo2wMkAjZ5sQ1gANHeLxFAGfYhAgDckABM3BAAuO9664fvf/Jf/F8vEQmVBGhEABYAQzkAGGkJkIC/XRvAi6CfU82ZOFFUAHsJ+tNPuSBmBR6C/pQLAXCt3eeohzOeoVjV1X9BvkRAT9JOEvRXP/mS/1EFvEk3DzodZJtAHgm5hok/5v7ZJ/BjNUMfZMzBkVYLJ0gXFlAgACAD9BOWBGA8/PI/9WWXiABIBvJuc8JNqp+7U5bNT+g5J29I9l2gfbwOEi+QynDvDq4d/Meqeqys75vPrmfX6zU853ncs3LgJP1z7tw3DfmHU89CqoOpk40RAID4JAAIS5QnAeCCKGSAJIAEgEB8DNhXAqAX5l6cgD6tAAD76A/pJAZIh9uHAKAuqBfrSLyadTnzU9zDotGf/3Mlv4L+XPVPf6bz3moBcBUEQDbyi8Z70XAv4taNTcVd6UCCtDKRAgCklW2DRAoilIILpQCkAhPCCVzwV3CTwAe/wEhZQZRhWKQGAENqjo20I+gHMBKXkk4ieNYvwBZsz5FYABziWHHnvpTVP7Uqf5uu+Z75fofUGffwTZRzvo9p+Mb46zfPNpFtJP3ZtqqftpjONprS9qys7Z5w7Ru179T+Zb8bA/0OoPZl+zaSvp5jgGODY4WyDba9MWY18uaYNHMsvpnJAPgM4ii/SEE/ElDegDmm+n/i72w5SADiWC0HGM+1BhA0a2kggFf63HZ9+Fk+tgW4NQASoBIBPBflnvTkIREgUbBZrR/KKICvFgGAAFbif/u3f+tjbgPgvXrbAMxDSf6NCFkDfFf8G+hfWwgAPAQdADeUAZ7pSkWC/vRLAFRwk+GFALiZ/WpXqRiDUKZQsurqv4BfIiAlft3UNgDOFKDNMZ7tKsttuM6YDhHptplKAEACfPt3PL2RcKz40w8hAEjXgP8wnjE24CDgXP1nrtMvAUDf1EEE8JOBOA4F9KDB3/8Zn/YTt6Hebl0Z0eGHeZd5+h9/8IO/8spHXvkjhGM+PviVAObPfdYzX7jOYO4cvl+6NQY5uJAXN449l3jdRer9fJl3+vfLZVdq62KQjHfiL/WxxFhgKvQ5dT10QCw+KwHgNoBKBDCXOnfm6j+g3NX/HrDfN64SAW4FqCSAFgASAJQtLQDQh9F997ECaH3AOt1V98N16rln/p/AXv8Y8Od6gn/mrCQBzk0AZOO00Y/LoXJU4JEq98pU/BlgcDZGpIAhG2YP/CcAyUabjTdBTAU4hBMIcdga4d4hbU9//jf8Jo7VVeVmpXWIgwwgfIpVYABhIxf2WOkXZE7JQwFvvS9B9FWSAJTD5+lPWct5SJj6476xeuTbcC0l/jF3SHuwHfVkxuFPh3Jk27S99tqycbR1DhdE9vpG9h389itk7XuScUj7qtL+nH3cfp9jgeMD0vGjDbYXE21vzJkxBN/sJNQPgBtlF0W3HdK3JgQkA8YIAMB/zxpgFxGgqT4AGuUc0M4zJACUEhFYDPCsXUQA+XEmAGcKkMc+ZwQA9gEMAIcXvfbR+xw0SF5zCACeK8nQQMcA+qk7QIdAg8lfpQSJQ2GZQwD8te/+jkurm0kA0D9uditbSterAfb+o1gB1CGfAP0V+Gc4SQDjpwgALALIn3Gx9/xbFHcP83/JSPoV/axHANDf6LuC/3YQ6UDMAfrzDAC23kBmC/Ib8F8TAVgAcBZAA/5BBDhGNiJvSINkLrpF9Xg7igrAWRMA/Dzr93/f697W5uJ1/MyXYL7OvxZmzo9DAPP6XL/5IvWP3bvrevc+9JOwIOjlcQ/zfdJ1M7gJkXyrcOpa6mHqZehpjE/qd8xlYiMAMuQcgJ9Vd4G2q+zE64xz1Z206SQADrUAEPSn1BKglivLwjWfnQQAC2QSALxv6rjqsdYRdWb9ITf1OuM7a/4PuBfEC/inZCUD8v4E/1iMnpsA4DWzs+m/2Bs0NDSV9lTk8VtxKv02QKQVrBQ02Cj5ELgKOGysSD5cdRXQJNDX72poylw11Z+m1gA6wmPAjglt6hpAketjgLEXn4BzDJjWeEHsISC43lMBP9czroYF6TdB1rLVdzskTF1zX63zsXDvm2ac7WGs3ewTn221kQPDIGc7dsDL9o5f4st+MYcQyP6HP/unfdZB1D5tH0c6BjAmOD7UccPxBNkG3Isx6GL8uRiAe5P0xdUb7GMViwEchRflGdANCYCfeAkBwDQr79UKwLBEAKAZgN/A/Y5DAgXOgG/y75EAAPkkAiiD1gD+ckA+UyDeiIAhT4mABggCqPPsdBuLgMFUGADRfmlg8GeaXX7y4Pm8DwAD4P5L7/2prROLXaFASgBkXPVjAbAQADe4Ax1YNMYnwT9AvYJ7AX6Nd+VfuYsAQMmDaDiwmDfiNn4FQPCPZDygP+sA9p7c78p/Iw0HIlCSgLSNDGC7ztoqAEAP2MdpAUAcY2FuAxD4I3X0U1YgGSPbHHEjaurOFGKzBUC9vczDvqjzrtJ45K44rvfSZB49f73n0HxG8+adgwAgnc/0WffQW25suwvgj+5EWcViibvEWepzFfyjM2K5CqAGeAOkBdt1tV0iAJlnYBHmftJz/zEEQAL+LIdlyTLU5/Js5vu0AEDXrav/6LLqrqmrqqc2XdT67bWg7bhm/v/l73h0FPwL9Kus5IDkgav/SQKcmgDYNPJ1w1+F1y9No8elwm7lIOk8KvjZ2KhMwYANL8FCgggbpDIBPh+s5zycrEoacZpI64fZ0tHIq8NEdJdTgezJqkgSduUJaZhD5Ain7B04d+o4ADp5pqz+mwDid5XBd8iy17hT192++dXvazuobaTXjjJurD3SdrlmG04/cbZzpX0gJf2GvpL9J0mBXp/LfmlfRWZfzj6e/V9CIMcKlQ3HE8cYx5zN4HuZDNgedm9P6B4KNQM4ii0S5RrJ6hYkAL+nTVxTqMsWAMG/UhKAMCAYwLzLGsD9+g1cDyvnKvpaAaTkGmHAeZIAEAGeR8DztDDgED/SsvrXiIABEFAuQLpEQQX1xrdDBwcCY64FQOZDHtz3uS/9uQbeAWv0NfuS/a6GjU+5iwDgbADa++1pcg98Se8xRiX4B8QD+HWC/hoW9Gf8LgIA64LbfBgg47djgpK+zBkhgPs8Z6ORfAO418wfSyAcablGnza9EsJAs/8kA/AL/LEEqI5rEADMdVgnPPCt+rQVcLG4x1x7AXjEBr2ncW3O31QevftrvvfQB9AVWrkuwDn31rS9/Gqc91guw+ZnOKV+09Q854bJRzf3nul0fquQCf7FZOhizFuMhepxufLP4hD6ITojAF7wnWAboC+WYS6t+ilxXOf+HvjflwyQhCA/n03+jAM6yYceAUD5eCcXw3oEQIL/YwkA7sf8P1fvK7CfG848EvwfYgFgg7sso9GodKuE24hU0lNxt1Gp1KeiX8F+goPeieHE9cBGApP0904vNy4bpMqeMpU8/QKzMWkjS2mDQwIMDff8xiFpoBnO+6fiuXZqJ3gmX/09Sdxdcvm+p65T2hB5psRygLbWk7ZLruHHooD2i992bFzKBvAHZUnwX6WgX5mgXz8Doi4tBJIAwM8EkX3TiQPJRELf3ZcAyEHWsQUCIMcdx6I24TNGXUyajGH8KVehW/KfsRGlGsAP2Ge139V/wjgUZJRlVs9YfXffv6C/JyUCBOVziADSNLC9VuAF+4J3iYCNNcCg2OeWAEkA4iQBzBPQDwggD/KDFJB4GAP4Y/EJ9Kf83I/j2QAMDvJjjM2x3j5nXE9CAPzg333mJ9LkP/0QACgNt6TJPdDFRE9Js38P7eO7A+oT4OvfJXcRADwD8NrGrltW+9QX/V3gn5J+nOCeMQpCgPGLdFjgMGa56t/IgsFSQJJAAkBJPGMdwN5+Sb/NbQCSABIDkAT0acZJrBQo7xVX8T3mL3Ra5BU/+9yPu4wPtufZdp25eShIpj2mXLvm8XYdPeGRRx75zvWzed6u+6bK1Lu3xhFeESGneddVftt51WdOlXn8WmA4xhwXU+gbuMRoEgDobBIBaT2NzodeCN5xCwDgG+xCHLqt+ql6J3omfsZU0gH8e3v89wX/mQf3YgHgfE4ZeB7loVzEVwKA9OjRqeeemwD4g1/xmtfvOvwPAgCSuFoAGJYg0AIAeSwBkI3HRtdvkOvGpAKOtEEhVdhtXEobGTLJgFwN1F8JAYFEkgMJOqo/yYDqlwio0saqFGBV6UQ0JnsKo3E0xgR/6T812OzllwD+LoH2c7wLoJt8U+Lf1wHMuQc51+V2gPQzkBrWnwcAsjXALSdjEoDPtgBZTwc/ZYJ9/BXwC/pzUkjQL/B3Asm+bP9GOgbkuIDf8YJxxHFF4J9jDhNZc9sTZo5jt9LvvlqBf139b+B/bSoPmAVYY1ovwO+Bf+NI82/9oe9rablHsAzwHnOu3JMWhV2FX/CfkmuAAID/lDUAeQnme9sCpqwBLPMxspEAgyUCdUlfcHxWcVF5ML4nf+YVTx49AwACgLZ8KxvgA1JoxhaAP4pTrvwDzgHwgHxX9SUCMqzfdCnnEABf901vfIyx7jZVN+MvP00q4edYkJL+D7GH49c1kiyQyGR7QCUCAPsSAWkVwPggEQDYZ94T7I8RAepZPI/nMweds575jjyD9oRlB+/dzjYY3vNBGweYqwHi9K8T1/k9dIIhT/FJZr/ZnrC+bpqU4pm8r/pN/xC6RTP5R89Y/V1cW5eB6+0n+/ppat67wqvykZfuQrfZde/0dfNbS76Ni7fqW+ph6mXqaupvkgHod+At5sQ5BAD4ibS7gD95TREAU9eSCMAPwcDzGAd4NrISAJYdvIfuq64rllSP5f3VV60j60z9dPO9qN+pv+E6p/9/3V/+iTbnCOSrrEB/7HolAJIEYAFpqijHXLMjXch1w6IiUklXcVdaYXNIAirbxqi0USptnEgBR8oKTBK06K8ApwIgwoKjKqf2/u/apy2QO4WcCyxNJyDdF8ySXrCdfuNuo4Qoodwpe+TJOeIYmKhHJYMVYWUlmfh+gpRKTBFmMKtSQkuJAtVzrvwrbesSaPQD/NlfHCyVtb9lX8y+moOqfdvBFekA6zjhuOE4gmScYbwZBrKLcejCz/hG/K37Q8FuQHpQXFW0tQZgVQsTdsAvq9iAdgD64//2v2xhgP4uawCJAoiAdnL/kA/5tXwKEUA8eQu2n/jOjzXFva3Yr03/8e9DAqDQU/ZNnuvT+gEM5jXHGsD750q2HpiWd/qUf/ixtuWAZzKOA+joW5oeqzzQF3XEkY7D4fjJsVz1Tz8nktNmb13jewAKzHdhXEJZQrFipQXnyj/g3e/Mt3a1X7/S+J6cQwDwPPSY21TlrKgLqusYRT8C9ArikfZp70HqZ/uS2wUkA9q9gufBegAiQDJAIoB76KP0WVf/KxHAdRR+vgOHEwLIAebMNUfWd9vnzfxEXtRHBfwCfyVpjnzmbbq9AfEG1Lfn5lO8w72W78W87vye8z/PyfgWLkA+0+g3D8MPoV982Zd92Vc0PYPYy3/30EPW5wLk/ZdTzotp5eaZb3v72x6N+cP3mZdLLxXfojjyp/xI9S2keph6GWOU+Er9Dn2PBVSANo4tAABu+lzOm/ingL9gnTx2AfzedeJ0APpKIlg2yiUBQFlZ+Sctlgu8xy7wTx1QH6mbUm/tG5V67VW/cZ/+x77qq1/8xveM7v1nHkqwn1YA6TfN1BaA9RYzH312aQfoyiQF8Kcir98KVar8Z+PMBsrHsJEqJQaUCToSjOC3MSslBFJ6Ijqgx5PSe5IT1onnkDVPXfc09l1EwNzrEAWklTBIv3FjEuDINQmAORIgSjrkvu7bf/FN7R6ANfemvG6SIIF+Bf5j4XOA/8yTwSnD+Gscg2nPAU5y0CVciYNeOAkEyQFktYwxLBHQkxIAVabFjn77pH1UaR92oM3Bln7veOD4wLiR48pmgrsgAepYdPZB8NgH8J65mqaSDQGggwAAvAJiIQAA05IBKMm7CABJAokAJCv2EAAA5C1LgOEZn/qef/VxXHveGjjzfBRcy5oEAH6IC2Q9HNAtAUqexTO1BkDZFzQAEHgfrnkGgAB+rqygHwIDx7tQZz4L8EJ/4HBADxoT9CsBevQz2HuACgQAvz2ewF8/BEBrj8c2iOX+k9YAY43AX8Cf8lseeXf7xoB8gX71C/jzOnGG8WeeU370kJO+4BkzY1xOAG/fp6+3Fe8BsGu6XyWgnT7meMbYQP+m/0H24ehTEgGMLY1QGIA78RIBSvLHeieBP+ej4LAOcMsAfZd0jVhYb0cAkDO3zKkq5pc2Hw3nCXAf5KyEggB/l3xAziJIkJr+OdW8K82c/HaZ4qcusHreANz4vgTQLcqvEOQz8970Z7mNz7h9/e2ZlCMsKE6R70U5ClhFl6okAH1DbKVu1iMA0AMB0wBpzwAQaCMB1wDtHnAX+AvGx9KQzj/S8CzDSkE/kueZp/He57W8ztYAFrxc9AXnocOCCRmbeW/qoKeTqodu9E7r9qK2L/me94o3fwjwzsq9IF6Z4B9gX8OZLi0ENP9nXksLgHMTAK2xDm+Y0sZ6Wa4rJxV2/RIAKa1cJR20EgH7kAGCDmWSARIAKZME0J8rnxICNByAvw2ogf/BnCQlQB0yICX+fRzgPdOPAf2x+DkEQAX8U+BfgJ8SPw4QPSXzWvp33XfIde7pOZ+beeKXrOC6fmQNE3eIm0O8AEBMx/cElI99V+PrNgBW+GkvdRsAgx0rJzj8rvKntC0ra7u3Pyiz3zhwZv+yzzmZKBlUc2DtAX77v2ODY8Zm0L0M9i8NurcpgrpRsVY2K4BBeYYAaAr4oEwDwHEA8ye89YMNwAOqAdya+8+RkgBuC0DB3hABAf59lmQA4Sf82ifu82wV+0oCUH7iBPtjkq0ClQgA+LOXmHJxH9f3IQEE/o08CNAPcACMADzIH+DBO/M8/AAHQD7AAtJMwg1wx6q/YII8APljBAC/S36b2t0DUNZ2yB9K1RggZ7WYsx12Af4K9iUElLSZsWfU+Nv0SwCAX8cgxyb7uH1JoE0/058S8KxVkyThGBEgadAjAsiffmt/lghAQgIgccyl9FvL4D2AdoC5AJD2jx+dkjGYawD+CvZreAz8c9aB57Uw/z0A/ctXTDxAnGGvz5Xep5y6jzT3wAhNL9jWCep9m/zQLdo9Q4qNXlFTr8It/7hkHsYbjiSj3rxHv4mTxCDO6/vkb159KUhdS+rgGAKA1f0E3oB+Abar+gBwQThpiSedJAHXBPNTknTcSx6k8z7juZZ5Uzae4z3c5/P1M8dXPTcJgB4JIA5VN93ootZtv+YfQr91xV4wrxTs94C/15AJ/L3XbQAJ/jkE8NwEQH3NbKx9vxU0SDuckkaIX0XfRmkl01F1fgCZKqWAQinQUApEEpzgrwCGsOBGWUGQjUaZAAo/4AoAphS8A9hafEhB3JgUvHNdYDhHAlBJNwVUBbYp8eMEx71wBdWm954pWa9579hzjB+TvJ/X9FdpPSitkwzrRx7j/I7koX9K2jb2kQB40ldiSauTKrVKQeJ6VizESWzZ3m3/KWt/yf5kH1Pa95D2ywT99mUk/dv+nuOAY8RmoN2eGB1r6nh0K8PUm8o1CrL+XHlDCZUAUDbAPJj/70sCSABoFeC2AEiAHuj3ecpP+52PP4YfJV4wkEQAcYDt3nkAlRBgRV7yAeAO6Pe9KB95sPI/hwjIlX5AAoo6IEWg0oDAOq923gAkwbAVAQKFyRPlndVDwCDyj37X33gMENFAyUAWINnn/543/7tdC4AXf91//Au3sgHewUIzpnzJs1/yrgq+M/yS1/90+8498E+c4L6C/961MQIA5S2fiZ9y3YYqZ3xmDKJf5LhE/wagM27Yv+gbrc/R7zpuA+xji1MjBYZ87J+QcaSzzzHmaTVg/oJ5JWkB/Zj/Q+RBBKDgAzSoe8YSykN6DyFESd4C+8M4MQbqiR8jAAD8uKe98Iv/NeQf5KCOMf02fOMDyyhoPfD27m3O6UoS4R/7a+nUH4ZENe1WmHRNl9jWI8zbtCnxN3N/9JJ1/l73vjlyVVfgIJ6t3C5ve1a7flG+OXnPS8Mzw4mzkOpiiafQ29TlxEoAZPRDcA5jnaCaFXZdgm7jIAYA5ay6M6fSL7m3B/oF914jLNAnH8Pcjx/pc5A+h2fh5x4JAu8hTDlYLAPHab2qfsv78u7qsOqv1A91pa6a9dn8I1/Cg2bHVv8T3AP203GthnsEQJIAV0UA1I7Qa8CX46IRquCnpEGOEQISAUgbLdKGi/RjIf2AShs0MsGLDdwGcAoiYIoMAMC5UjsFEOdemwtaAb/PfdtqhVsgDICuoFlQfRPkLtLgqsuYdWUdpuRbEJ77TSQLlGPfnPbiNf20I+IqgSD5hNRVooqwJBZS4K9M4I8/+wb+2n+yb9nfkNkfs59m/3UCZ2Cl/zsGbA2wF5OiY8rIcHs7o1FGBf1VqnijcDcT9mEFnhV5ADhgGZC8LwEg8JcIaNsB1ocEAsgB0oJ9n8XKv3FISAAcCnKCf/yUGXJgDgEgIcBz08SfMNd8v2otYFqBPHWDgg9Q4NmNnGClf8jH7QQtLT87uAb+XMMRBiBQdvoX+/UEIUgcQAJFfwz8sw1gIQBuRv9j7OGwvQq8Mwz4R5GdAv8C/SolBownjFKZ+Y/5UehuCwHw+z/j037CLUj0aQnJHgEAiIf0o69IAKTfOMeLlkeSAcP4llsDBPxIADjPpk+TJ31VAkBJurb6P/RfLAAAAXzfzXPXpIT3mu8U8PeaBABgn2dANDBOYKX36r/0bc0qSOCvpA3ejN5wtlJUDHDMg1pemME/91nPfOE6o6n8N9fYO4+LezbXskDoFUOYa+kySfW3fDjsD9P89UXvrWnHwhvwz/PRccA3a8DY8h+78aTxgbt4tiBWPUzdTH1NHQ69Dn0vwT86JWOdYF+ArQSIswIPAAfs0wfdikqfJJ1AXqCPNA5pPKBdR37kzXVBP9fIj+fpKglAPOl9LmHKz9Y/+jC6MHqveq26bOqv1o/1Zf2172jddj4Y33wM+DMPJMDv+Y1L2SMAWLzQnfvskdpoDdsxpqWVNUg7wlwCgEofIwGmiIBKBviBlQlmKtAhXMGQ5wMoaTy5supqa08C1ogXtOn/ylf8xU8Q15OAPOLzmnFd+X2vbWDxK2dIgCekQEr8GfY6YBt/yqsG4Kd8nuQC++7Jtyfr/vxThDE3JR8kZIESP2aLSAbM9BtHPN/GAZVBLP3u70cB0rnP3z39Sgby3r5+42RGq6RPuK9fSR+yPzl5KJ1UkA6kSAdTZJIA9HMGTpxjw2agvTx5O/50ht/bE9UjANrq2KAgJyGAIgrIbVsABkAO6GX1GidYBjDv4yQBJAW0BgAsA/QT+Dfzf7YArJ0kAOVAobasEgKUaR8SgLQCfa0CUNh9H0A41zdAfigj6QAFbSVyAAiACO7ZAv0A/jXo5/4GIoa6fNzjHtcce5m5DqnQlH1WBAfAQDocz0X5Z/Xf/f5Vcg3AdHta3Z0s6T1WXMbAN+b+jKsogK7qC+J3SUF/T3LvXAIAhZBVasbHm/wFGHsZgzT/B4Drb2PTeuVeC4CUrOQn8KYP1TD9zDEupcQdeWgRYF+kn7o1gDjBvH6kZwQwLwI4CGsFwHUd97ZyDXm2swyqFYDxg+S9JReYTwEOOrbbCfpT3vTvewPbXjtoEV1gKFviiLGitjQbHeHinrH0xs/VGVr+HPZ31IF/YJ7hDxIBEFrezzKdVwbuQpeSjFAHUy9TV6Ptos+h61XwT/unb7kiLwivwJ++x5hIWvRSiAABvKBe4G8YcI9fMoD6ErxLKBD2WYB50mhlQBriTGuY6z6DclAe9WJJABbCeF90Wd7furBurCv1UyR1uXGdL0gdAvQhowHu+lOOEQEJ+tNPPoRzC0BaABxCAGRn6/t5UTtYvvTgtwOmVIHvSSqu53aBez6AH0PpR0rJx0snMFEm4NfPh6+uAn/CCfpdLU3wrx9gj79HAmRcJQTGSADjJQK6cgD8m3j9yD0dIJ97kMe6JAsqeVDDPXBvmt61c8f57J4ciyMeVwkUwLjESkoIHMJI0iB3OQYs0tAmdIB5/K74I3et+u9a+a/9wb6itD8hs79lX7SfKh1EE/DnGOEYEoNqbzzqDLW3O2qMAHDFrSrIKLGCcwEySq4gXsB8qIQEgBgALAvyN88LAgAigOufMnD2SMgJwL9EwNxtAFoBKFmVlwBooHwIe84BaXhXnoUCzzNwTbHXvD8Af7t/UPZZzQM8CPqRn/VZn3X/aU972v3f95/8vrbCKEnQAAEAYKhnnoUJNMr92N5/4ttPAA6WHLe7Jd7e0jO2jJn890A/oH0u6J+Tbi4BgMIHAdD2ig96B2PeTax1xnX6MWMQ448EAMAdsg9Hv0vgn36ukUbAjaxEgNYAOb7hZwwhL0mAJBTIA5KgEgE+h/EQP8+GtHNsMF5JGv2tnEN/591wAH6+D1vqAPhf+7XP2QB+gb9yjABgHryJ3/WGlmnbNF6MscIcU0VGP/Av/cYpV3rEdr7qFqapsl6v4Zq+F968F5YNb33LW95x5QSA7xxS/KU+pn5Gm0WXo++j54F5wDnokuiUtHmAMwAagC9gB5ADsgXfFfwzNgrWAey4CvIF6FzTL9A3b8A7VgUCfvyAfJ9vmGfpSMt18iQuCTz1ZXVldGLemXenHqgP6sZ6Qlp3D0V9Nn/n6//J577qo4J9SABcgnn9pEkiwPie3GUBMOd8GRvyZRkvpTKeMpX19FspVU6BeivVxpcyQUT6E2ikP8GIjVegoqyAxvAY0J8L+OeAfcAZ6QRsSMF6+omrYdN1ZQJ9rAT2APsA1VMBfYGvgJ9w+r/8HY9uhbmWcfi5R2l+hpW9NKY9RPr+U3JOnQLISdek32FttdH9bjOv2V5sF0kejfkhnnrgnoG819btB0r7CzL7VfY3B0f7ZvZd+zUygT5jg2NGjilNAXbckWTclp2h9W5FUZ+CZhTg9KscSwYgUYBRYAHdrL4D9AXPAPdDgX/e57YAAHCzAhhAviv/PSkRAFGA0s07oMhbrn0lyjlEgBYBSMLkAzjQUgGiQOCOZUBLP9QN4MJVxgT9n/GZn9lAP8o9Cg0rFJytQRrKDLFAfoAO7v/yP/VlDdyPgX8sAQD/7AHmO96tlnk73oZxCAUqV/5Z7UfxzJV+Qb+yXjOsFPgbRvYc6SAZ8vn6UeL0p0SRgwhgzyblv2k1jTVLjkOA4mYBEKBeAi6Bf/UneBekpyQPwDzPcqxTVmuAJBDIl/twAPg2XqzBv+Ce9ElCCPi9bjmIJy1mtAB6gU6CBQF/ld/+HU/vWgDcxG96YBsTJxx4+87bVvmjA2zP+6d87sYUvz1jW9+YKuAGwK/LNpV27Nq9jY7D+81/9lh++8X7vLVUD0Oqq6G/0V6Zv8RP6IrojOiSPQKAeRNADZAXgBMGhEMAaPrPGAxIB4jrBPneRzxxhHWEyY+8uB9H3uSHzOfgJw/SmxZ/Po/8KLNgPyXvmDoz767+S71QP9RV1t3mO1q/5atwj6Ae4F/9hI2rkl8cYt5QJhHQswDQ/B/JYlIpyiZIh+LPjrUt1y9SlXPCKu5VUiHpDgX8NkAqOx0NsucSmCRgSb+ApsoeCDIuV/gBUnQAV/WrHANgGQ+AI6wEyBE+GBQm4K/+A8D/FPDdF1BXkE54Hye4z3skCjJul998Un7pj/ydRjCMSdJ6zTohTn9K/DudJIDfyPBM4C/gt73YfrJtpZ/Bawz406Zt38raJ7LfZN/Cn/3Pvkl/TedEkv3fcaGOGY4vnQF0ezxajVOOV23guqv/qNeqAKt8K1WKkZIAgFUAL6BYwAxgP5QE4D7vZcVdEgBioJ0FsF7p7xEAxmkNAACn7Ny7zzaAShRwb1oD8L6ZH35W+d0WgB9QkKAfP6v8gPmmwK+3yLi690c+7/M26SEIJBWogz/+hZ90H/A/RgAA/rEOaL8AwBy6/F1ZDTCWpMk/oB8lD+VTkF9lgvkxgJ/xmT79mQY/zx4D+wn8qx+FDhPOtnJzg9oPp//n2LMhIAewzbgDeAY046YsASQEEohzj+DbvJp5/5r8zLGukQPr7QCAfvLJ+3NbAPEJ8n1Gjath0hnHlgFJgAr2e+EeAcBYwJx4ZR3hjA+ijw3Zix2Of1K/jTdg/KxnPes57OdHokusH3bsszegG50Ec350kqZ/zHuvkz2/PZP3x8179roKjhA+LyT1QB3QRtXj0EHUA9ETwT49AoA+4Mo5Y61gPgE4gJwx2BV7wLhOsC9YJ61gHfCuHyKAMIAfEoB0ho0jXrKBa5bBPHwWJAX3C/oT7PueSPVjpHWBDkzdSABQd+37RX22cPlEjOcAew4nFezr7wF70hDvNeYJ5xOkbpcFAOUtRbkUvKxox8u0Dj+EVdRpKPirIm8jQuoEAAKCKm1sKQUVVSbwwF+BiR8oZQU2hPOjpj8/vH6ZIGWCLBoP4ZR1hZZwgrcK9FkhphFs4gWIc0BlJ00PpBI35QDQXBdIp9+4uyp9V8E+Usc1/cqMA/QTvxP853dK4E+8Yf17EAK2GdrgGCFAu+W67bnKbP/4a3/JvlT7W/bH2lezP2efdzxAOkYgcyxxnFG2wZTxaDVBXh6rLuIvDWy3NYL6QNlOxdcwirfxxhluQJdT7jGJHYA/wBWHMptgPlf2p/wA3s996c9tLAg2Zvf8LN/gUNZd6Rfwp+QaYVfkKR/3JWCvAH9uGOCPc28/knt5H2Q7zG99wF+SAE/7gie1Ff4N8B8UGFb/v/ApT7kP2H/iE5/YJCTAV37ln2krgG1LwAA0sGag7JgDc/hfJQHc84vCT5+4re3vNpabcQQTSxSlr3/pu5pDMQSM95zgXeBe03gdqTNN71pNAwFQwf3cMMofezp5H8bPG/A97iUBkONOs6wZfgaUnwIV/M8hACACSCd4ZyypDiDeAH8ZC4lrVkVBBEAGmBekwGZbAHv5sQAqToCvTNCfablOvuz5lwhQ7kMABIC9AZ/zRhWhAurNHP/KR175IzgOA6R/D6X22jEvsFnFJ2/A4GZP/0rPOCbvufeu3uNCr+G+U7zb7ufzzHDqX0jGGnQ35i70PfS/1BHRH9EpBc4p3RIAAKdOIQIE4IBxATv+dKYRvCO9rl8ATx6QDIzrkgnGSTBkPt7HM3CQCFooYM1D+Xkf9WLON5jSgakP6oX6oZ6oL+qttc2o0/oRuM5BoQJ6Tf9bOKwBwIIAe8Z/5Cb9mgjIsGmQkADMFxDHuf8fCwDKW8tjmAbHnw1v0yhVvlOmkp5+K0DJQJdKv/4EBforcCCcwEJ/BR8JTPTXD2c4G3D6+eiu8NfVfMOAJ/zIKZcATL8AbZZMANjzE7eHE5imFMQeIiEAuE8iQP/nv+HnN3FeQ2Z8+jPNof4/8db/4bF9783y5vtTtgzv8vMzYKbhexhGGk75RS/97o/piMevbP4B8I/JXrtBCTF+qj3mNduvbVqZ7T/7RfrtQ0r7mjL7pX1VWfu2fV7puKDskQM5zujPMUn/ZkKrY1k/vBr1bvh/Dm/ZAPveSth65Z80kgIo5jqU5KbcDivg7nt3NX8K9HuNtI/86AfvP/b/+60mJRAkAQgD5lG8Afmu9OMX+PNcV+hZkSftMdsAKjkAGJcAAJxDNBDHO1A+SBC2RHANh2KPmTUndbva/7mf+7kN9AP8Bf1sAdgQBIN1AGmwGgDs8AzeiZVBzP0hAVz1lwCgv9zw5nWnisfYAFgG+H/LI+9u5veC9SkpkCeN/pT6zYNwdd5b06Ko5qpNBf8oeDWuhlHsUBYZM6/1gw3KLedjOLakZJwBuEMAIAHmcwmAtAYwD/KpTmsAx0Oe34iBQgAkCUBfb+VYHwTaA/iCf2UCf/xJSND3If4YFxg7NmPEEJYIAFSMWQAwV13rN7xdD28gfTO/r8ouTjn2TVre4BX24UMCrMmZU+W/V/kYuzYExF53Hpg4gergF7ehhzHOoLeh16njIdEJBclVVkIAIgDgLdAW4BOHE9wD3I0DtCeAJ41xNR3jqiQAacgDQkBSgDju5z6kwB/w71kCpKXPJgEg+Od9U6+1HtBr1WmrDksdbnRQ6rf8kUeCd4E/EgDvNVf1d4F/00kCpBVAJQAocynOKrgekLY6mkq20saBVEFXYVdaGUorSSkgQGbF6reCUwo4lAlK9NeGaJgG2XOAomSs9DOQ02iROgb46gD2xgHC8CNdwUdWv3FKwN+3vuKvNzBfJddYNUD2/Kw+E5+r0ILRXpzXUgKcCfdkBdUJ3PUrAeHp517ibqKjnJIGVVrulL4XEpf1N8c/hxTwG1cpQSDIR0oQZNwufxIAY377iP1Gaf9KaT9UZl/Fb19WZp93HFA6TigdR1I61uT445iUUgVBuRmE+8DfCR7Jn3IVumH/qUMVXiVAX+XbuJ6UEGAVjJVwgDiWAG4HABwL9MckaX78Z3+hmfQxiX7XWz+8AdaSANwLCYCijdIu8Gd7AM8DjAOWcZIBKO6nsgJoK/3DCl0jAQZgLgnwhFf97ytLgKFslBUSgLLhKBuHgX3RvU9qoB7gz+p/VegZ3znsi20CpHELAauLkAA8ExLgPd/zlPtvecm/s9n3u/z039V2JMaV573izR960Wsfve9P+f3Se3/qfjoBfE8mcO/5E/AL9qvM+3wGSmYF9IeEm4I4kAC859XW7NbTuhYAjkWcjdEA9jAG0D8OIQG4Z4oEIF/IwxzvuAfQ33NaAyC9bhzPYSycBPwDAcAzcYB/SAjeEwKRsQGZwB8/BD0/DSoRqGzbgW74fLP1ta8/kHP1ZsV+KNYp5uyWd8M/K7C2yl//ad99Z3nRdb7xG7/x+Sd6t92l5z3XTv1K3QudjHFGPQ7dLvVA/OiAgGX86oxI9UlwFYcC5mo7+kMSAZIAgHeAOuBfEA+AN454Qb6kQBIAXDcP7ietBIDkggQA4B9SguvgPfEf5ab8lQBQh1VvVVa91Tq0TpvMrzDUNeS0IB8sqL/JYWxHSgTsAv95L2mxLECOWQDwbbM4G39+dF/Kl0RaAUobhT/1NSapyOr8KbEq/QmynqQRvekNr2kHNfjRZX5sLEiZI6WNYK6kselQeHe5n3nfL9/XkRb/rnvGrr/6ne9v977uXf/kPn5dDRs/RwrkSYv/2T/1m58wricrKD4HiKcM5JsS/yHOfDIv444pu0RBSupLIiD9EAFzyQEJAe7Rj8RBACA3wH9N/oyFJQPo9JIA6U8LAa5PgX+vOQDmYI6/N/BLACDPSQJIACAdYBP46xf4p9wMxNMkwGYcvKke3jGVXUC9wL6tgA0r/22VH+V7UFBRVAH7zQ1x3ssqmwCcVXiuu0Iu+E9AbxySsY2xiJVVTPoI99JqDcBKWvsJQAD/X1yt/ksAIM9hBUB5IAJa/gMwdwsCz2oWA0FQaJ3QrAEGhR6Tf6wB2k9krlfy2A7ALwGw4gnoB/yzBYDtAJAESIAA+UMCsEXidS/7Ax+HBFj2/V9db6J/cMr/i9/4nvs4fj5V8D1HJmhPfwX3u8ISBPWZ6CM9wI+ylvE1nNfSj4LIWHh1Nbz9pLoFQPDvOMNYJKA+hADQGgCQXi0AMsxYxzN5fj0UUKCf0jIlEWAcRAB+ZSMI1mAfwM+zkjSQOIBAxBrAQwEJN5JgSN8jABZScLstzQxtkwCnAf8+epX3AM46+oJpjpE7gf8680zn+x7z3Hn3rt9b3SqxINgPrKd+p66XEn/FeOqP6JOSAOgMWgJACEgCAOYB6IJ6sRtS3Ca2I5xpxYJeNy/vA8sRJ/BHWg7i0/Rf0mKMABAPi4+V1pf1x1y0aUe2qfWXAD8naNfPArD+QyVzB84tAJIAeQhgK1uvVXCBF0DJ9oWUvqgVoJQMUEoKZIOpxEBtKBmuhEAN94gB4viIEAQ6GgV+G4eSRoIfWR0KA3Ep8dMIkemncQHilVwbA/W9eMA48XMA/Jw0gFEBfgX1AGPilOmvoHkuYK73Ed7lXvqef9nKgDy321UWy7/rfRP8C/x3SQA8aQT1uyQgXtCP/1AHwOdeQL9OUM/qhP4p6XYAJIOgskcASAgw+KdzolDmmOA4gXQMSek4o3T8UUoEONAiGbd6LkmALXa/TwQwJObk2xsirzWOOlPRRbL6BfDcrEoNiitgnpV2zeABpbhKAjTl1K0Awz0A4wT6PVDP9Xd/6KOPsfIPwIcE+O3f/q2PEZf3pp90rPq72p/gHz8r80jeBZBA2gbSh/IcK3kH8mN1XqC/2RKwPhcBBd5rzVphWLFkhV/LL7YAAPhx/jpAswx47feuSALkQBRADPAOzeJgqG8sAQD/tONrbTQPyMMZB1hVAfi//Ad+sRFVrPhXEN6Lq2kS/Pf8AvyelBzI+8xfAmAuwE+wP+ZnTLiuT9z7aVJJgCQkGWvo2wJugf0+knsT9Fc/1x0TE+yP+QXxlsnyAf7btQD9bcV/TQowjkoONIJ1GH8Zg7lHawCBf5MDacA44Mq/kl9QuK7v9oA9d585XcCtPEVV+fx7nFuAnjIj0809M9JOJfE9zK+fVoA6SMrHWKq+xfyFfjamw6njIVMHFNMJpAHWrLKDrwTfSEkAiQAXXgXvyiQESCMBgF8cZxriyA9wj19CQODvyr/gv2f6b/l5J95dvVVdlXqxjpDqo9bfJfBPHa//yA/L7nQJ+KeIAO5hSxuSe5Tez9ziNgDBf24B4BdlhmJMtoeN+Usq0LxYdb60SvkUcaBCb4OyIq1YZTY0/NnA9GdDw68ZioAkJQ2wOlmelBUUaQ5CPH4VwrbiMwAtpauuYzK3ADTz7uHeauY9Fuajcg05x9S8lwYg6ur0GHAFBHttFyDm+i5wPQfc/+Q//f82EgB5Ssezye9HPvzPNnJOecbeaU59UHe1Dq3PMdn7VlNxtoFsE7QNt43Yhlp7W1sN6E+Jv4WHdqilgJIBmnasOZRtP2X2Gfy1b2Xf01/7q/1YWfu8Y4HSsQKZ40gdhHMcYmyq41WOZ5sBepwMcLy+dsl7oWyz2o+S2RTLQSFFAW0m/cMqu0AfoK15P0QA4BrJdeTW3tlhha7tm12vnAG4Bf5I/QnoAfuv/cmPbg4QxMyaSZy0gP1Mm37KIQlQLQEoG4o6AHpf0L+LMKBc5MmzBfpttX+wRmDbAe9PPRLnlgDABT9nBuhn1Z/tAP4kYLMMWIN+zH6JhzBwOwD5NRJgIB3Wk+21t5+7XgDGBcE/5BTt8Vc/+A8a+O8BcQF5lZk2/TVdDZsWqb+mISwBMAbmD4nH4uG6vi/jbwL+DejHEmntjGPs2hq3IOAmHICc9EjT4W+E3dA/KwFAmGs8h/RjwL/GVyKAe5MMEOxLCtC/JWEdHzgPhOeSppEFa0sBxtpv++L/aLMVSPCPXAiA62q1V/7cFdgaACC/XoBOsi7BJAg7QSnJv+e2swaYhhPTCW7Vt9TBCOtHP0vdTX1OfU8QjY4IhkKvBGwD2BmjsQSQBJAIAJQL3AHvOokApIDedAJ/0xBvfrvM/imT+i76rGX2HXgn3pF39b2r3qmuqcz6bP7tGn+IfATuSvT69BPuOdKYju1tNY0WAOj0PQKAc6RKcbrBSw0nlWf9VcE2bCNSpmJuw1LawFJa0SkFA1VmA9RvQ1T6MVMCTggLUlJWUGO4kgRjYVZfuSawkhwwnJIV2xYeQBt+wBkSQIdkZRi/K8RTq8kASK4DOpW7wH8CVEFsD/T2APIUsBaAT4F7mDiup8S/r6t5TD3TaxIFY+/Qe1/jqB/81lP6jUvpdWS1vsjwy966stJAYs1R5RxLkLxPq5WU/BY1YWT1G5cSaxnCWtAgNyAoV0EHP5Y4XKtWOtWKJ8MOuD1ZLYcI26ft6w7OOS7kuIHfscUxB+mY5Bjl2IVkfOuOilcY2co3TDyASBVnVp8AsoJ9JAonSmkzYR2uAfLTaRGQ95GfSiyKK2AX81WUY0mAHgFAHBMrBwEC9nGw0UziXAPwY/6uXwKAdMRRLoiA6tIKAAV8F6i3jAIEwlP38GzS8FxIAA8nxEqivcdAPPBctiokSQDZwp5/LMlQXHCeAwAp4JYAwL9EAWBgIQGurqPQvzkUj5V/LOqwSPnffuujG/BfQfkcC4AeeB+LE/Arx9Lx3F0EwCGWARAfV1fbl5/kNoAE/An6G2Beg2bGGsYYxqpGXg59jn7Xc1jQME+h4CYJQNq22l5IAIB6IwDW42EF+lNhxgfKxBkAONIa1wiAYbyU4Mu+ztYfxgcc/R9CgDGJ8jGm9lb+JQEWAuByW7qjMYmleEXD53zd1TMA9j4v/flk4sOh/6ATpa6UfnUpdazUu9TJ0NHEWuh1AGsJAEkA5lTAOSQA+j46hFYAru4D5HUSAUium1YSwOumR09JcgG/hAPjMHN5LmZRPhe0KHvVM3nPni5JXVlnWY9b/qzvwY8eC3gXzCsTzAvyU+LnPl2GTUceUxYAuwgAGg5/NtILGY1EAiBlKtD6Va6RKLRK/Nmo0m8DS2ljqzIbn34bYZV+0JQ20pQQAfw+YxIC6ZcMSImZ9BgZUOMlB5AN6A8rrsi5bg4RUEkClPIkBRL0V38CV/0A13RjoFlwPSbHgD0ds7r7wx9xKfHzl/H1Pp5BXO9ZY+UiHsJi7L2Iz/evfuqJuKyvGpdAn7QZFvgT5zYOwf9c0D+Vzq0mKfHPcUke9PyaXymTKMDvlhxkJQYynKRA+ucSAwyq2ecdDxy469jh+JJjD37HqdUweHX/GTPbBDOs9AP6m5I7rOwn6AewAuQF+PibY8UJtyYHjBdwk4enWtvfUbAZg5g4JIIgH1F+BdgowYJ4JOFKAEAGALpMx0QLGANYG4ck3MowlLESAIQhM1D0sQKYAvOUDdcO7FoTGYAMnsF9U/eahhV6SQC2BPBePLdZUwAs1r9aQDr28rYzAQaFAUWfvf+CARR+zwKA+KKNsxWNeEkAvgHWG1fXkh6cJ9FfWeWgvXEWBe2QX6iYIgDGAPq54yEAGD9Z5WfrTK72o7RleB8/5Md1fHF0P8ZWQL2ONt/IyqFfAvAZwxoxOYBrSceWdrhGPGON4L+CfMYnxiXGJ1y9Tv6u+pMXz/J5bTwYiIIp0F+vMQYwpjhWcp1nkmcjAYbxlb6OtQ/jAOAfEpA4wD8O8o843pXykVbAr4QUwFF31/HdlmdeeQ1sH1gIjlrhq3MWpOE2dIqHH37RX+CXDdaLGuK7i2cHrgO0gtG4r8rUk9SdUqdS31IHkwQAJ0kAALIlAgDgzJUA9wTnrtwL8F3BF9gjuaarZIHpJQDIWyzANZ4JCYHuKeBPLIdfAsB38d2afjZYQPD+1Ad1pKPuLrmLWt7yYbUliE/pWIdkTuAaknCmS3+mw4+DSGZRuWcBMHfcuQD+SQasX7I1psFfCQDCgn+lFYRsq1oD+E+ZDQu/javKbGzp9+Ok9MP1ZBIA+pMASP8UEeDPBdbGA+AnrgJ/mHrjAPv4Bf2SAYarTNDPtQrwMwzYJ5wSpV8SoPoFBILXKivY7YHkKWBt50uZoH0F6U/3P/PelwjovVt9/wT6ta6oS+Ks0ympZUZK/Di+nzK/bfVr9q9spv2DtYiSQQB/Svw4rFKUWqikZJCkjSoZuAkrkz3VX/tCEmf6s3850NoPkbXPZr/Ofp/+HCtyPHGccQxyTELm2NUG7hznzj9BtwmBcjHGAPhRGFFkc8W+An6BvzIBP4oqABuHIqtCjCLNhOBEAlBNC4+cdIiXBEAh1gngCVcCAJNrJllX+QFgEEuVACAPHGBfYiKJgH2tACQAAO46ADxlnCIBvA7wx+QfIgDAzz0ABxwKP3E40lGHKPgCfxR9AADWANUahjgIANJiQQCJwHvSrre0gCVwVA3Q5zX7Z1uK4J/29xsffbT703ynXv3flzTARNWfJVRZA+y78k+c4L8X57WUV0UAMGYy5tKOWUWCcLwE8iEhB/C7Af0A/3QA4zVhQD/DDwEA0NZJCKC8MjYRdk+s15QCdIG/knLNOQywkgCEKS/9lTGAMM9qY+t6iwGEIP2f8QDwD+AH6GsNwGGh9P1GeAzjMGfvVPB/x1f/BZkVQxzV32/wzfV9a1FbPTzyyCPf+axnPUvSx7qpaU8VbvnTZ7//+173Np5ddJyL56wxXbs++LkHvcSwulPqVfrVu9TF1NUYI9Dl0O/UCdURJQEkAjy7DWCfYB09I8kAAT9y6prXJRXAAMSxGIUuazmQlIEFJsqJTB1VXZR38v18X9+fuqn1Zb1dVPBlnxYACeTn+iG7SavM+5g/0N+YOzwEMPf/Y5WETny5RBcxNmZibKSX5dBQfNFUpPVTKWPOBqVUSUdasVVS8cT5AVL6caq0MVZZAYbhBCE23gpWUNZ1NhZJAqSNHQnLowQ4SQCMSYA91yr4Nwz4E/wrKyCsYQEo8fp3yQS1gt0KgntAuUcCAPqJT/CvP4F6ruofQwWQp3lNgX/L1Stz793y/bN+9E/VqcQLUlKG76EfcJHfzTDfGL/ff65E4SAtEge5lJK2qCNef0otWpB5CCDt2XZfZe0rtT/Zz5S1X9b+m328jgeEHTccRxyMc9xxPFI6Zo2MbRej4Jl8lJt6QYEG9DMgNwV5vZIP4J8C/QD+vA7YF+ij9NJeGPxRnFltBIjLmDNp4gfko1AL/PHrvI82A4BPSwABPhMrh6wRxvGLABIAtGkAmFsEBP1K0jfgPmIFwLvxHpgTo9xPregnASBwx/QYhX2KAOCdKA8ScK8lAGCf+gU4QChQDrYENGuBAcTzjC//7E/pgn5WMwAAAALAP4cFAv4BEdwP0QCooI2fqWk9UNkyNrjyD/inzaVj/7+m/8p9wfo+6dP8P/3kAemA+xe/+o52YDBbZnASAEpBfZIAxk3JMxEA9xhHqWfHKle1BdlbwD5B/kACZBrHJyUAGuDvtiNOpxb8K+nDjGUSADybMco40kkCCNp9ppJ+TJoK8rm3xtUweXjGAH7yYTwwjr4N8Nf8HwJAUoC+DznA4aG8K2M00pX/Ow7+N+MQcy573oeIxBSb63fE01b3edf1e9Z33WAnVuHX9cGr13Snro7NOW7oPK18g1w/d/vZxO9w6lbI1MVSR1N/Q69DxxNDoSeKiyr4BpDjJAOwoENHQVcRJyDRL3ACf8M96X2mx8KA1X7KwPMtC4BffRbd1fKqxxLmPXgf3i3f1TpQ9+zW38QXJc8E8T0wn8A+01Z/pnMuYU4AA7SF5ae/6r4kAGPuug1MlG76UjaeTeNeZzoenmhgKudKJh78qcjrt8JTCgSUfpyU+fHSb6NVVlAiWFHSKKqzwUgMVEkHkBzokQKA/iQF+HBziYAEjgkqBZcp8QNUlT3Q6uq1wFaZAFh/Dyj3AHXG2TmrTDJAv0BeQiDBfV4T6HtfzZtwlqHn770Lcb5rSutEST3i79WncdZ5fqP67cbCtAeuIfdxWpWwqo8/Af4Y8CeNgF/pgInFSwX9tGvbv7L2D/uOg2n2MfudMvtm9l/89m9k9n/8jg9KxxLlZoCeIjVX416Ob9Mj4YyrlJX3pZ5QAlVOAYOs9BPGEQb8urKvzBX+dk+s7qMM4xj0AfWAfZhuJj5MoHFOgkycXGNyJZ3gn/vc1kE8DlNq4lGUtQBAApopKyutTFgSANzDcwjTzgFiHAxIWOBfJe/Ou/FO6SQ4eDYgHNDtij2APV2PAOAe7s10Y37y5VoD+QNt6AGAhCUByCtJANj1/IlAQP/TvuBJDfAD/DVv/tT3/KuPa0GgmXL79gM4oj2s58sZLWhJUmuAsQCFhjbWA/+0PwC3wF+5D6A/NG2Cf0E/wN/+iAlqD/xvFLe1BYAkgPLMBMA9xlDGYMbuBPyu8o+C/QD+jmXNAmBtAs+Y55yl5VlPko6+pqsEQAJ/6oQxC6LT9Dyb8cAyODZMWQF4L7ISAIQZH5ol0LDyz/tTJuoj43ILgOb/jAkcDIojjjGMe3hHDgRkjqpt+o6G7zH/Du920jn1ptUVfQcz+4nvKi6y6DVs/Knl9taDC91n93M6eI33U9dCqp+lzqYeh67HWKJO6Oq6uqSr7wB/SQH8SQSwpVQyAP0i9Xp1fXV/r6HnMMZiaeV2PCT5UoZ0lM1y4U89lbB6rO/ke/reWRcb/dJ621HD6IUJ3PWjV0kGKAX8htkabFxK/M4jYxYAjO07inbtlx0setKOsy2t9JAq/kqBQUo+IC6BhR/Xj620ESR4wZ+NxgaDxMSDRlTJAMKQAEr8OomAKplAKyEgIORD94AjwJP4lILROVJAK8hVJhDWPwae2VO/6yBAwXlKO/O+EmBvPj2QX+Mo2w+879e7+/59tyqthyk5p37zu/S+31Qc7YHrKlZVomARB/CvEiJAM3/AfiUGkiRgsCbsoJ2yEgG09XTZF/BnP8Gf/ci+pbTPIe2PKe2v9l8H4uzb+O37yjZIX0yC22PIiZSUHuBH+QPkAuoT0At2ud6UZpTpARQbjwQoq9gK9l2lZ6IDWLjyCTAX8AP2pxwgHyUaoK9jhU3lHKDLyhyn5AOSUYYF+DwHM2YJAPLiWYQBN5TH6xX4EyYdedZtAL47ZwGkJUA7rHBQyHNVX+UchVyiAEUbP8p7gv68L+N9LyTPlgDAIgDLABR+CQVIgLZdYFjNp8/8V//ppz7GSl877Gx47mZ1cL1tgPSAEcCFwAEJIGllPlF7u/bZ+ooLwDiA5QztbAz80/7ObQEg0E9ywTjIA7Yg2C8F/0j6CdYzKmpjEsDPNYF/+o1T7mkBcI8xirGWcVlikvZLe+0B/WYJM1zPa6Q1XiKSsYNxgy0xmNuiwOfp3O3greGaY4ySe3D0C0E5fSW3APAMxqnWh4ZrhFV4ieM+ytSAf5ASjAlc7wF87mElnz4+RRQI+JHt+fTh4RkQezyTlX5BPxYBWAMQhzUQYwTEIM/hntuggJ+oS6u/m10NG3+b5eqdBtxBn1rrF7xP712JSzf3vTMv/co5eeQz9e++L7BUe691WF0LmTqZOhvjirhIHTD1QvyAbnRJV+MNq18mIYB1ANZ1rOA7nvgrAJADnvrPNYA+6SQVfAb3SwDUslBG4tBnq15qmHfy/XxndU/0TPxZR7srt6W497xXvPlDgHoAPVKAX0E9YZ1pxiTzBGMpc0LT7YdtVK7+o8/dhbOIbPw9aQPvy9KoBQZIwYMflg7tx0baAJAClQQxNnoaDeC/OokAGnsP/PdIAMBbBf40GuKnACLX3D+eQHMOMAXYmm4K5HKtguMMu3o+Rg4AxrlWQfmpwhIPPmOsHJSZa1n2nn9XXXidusOf0vpU8m3wI6ccnZnrSPb4V5lx+On43bMABiJA0I9E8UqJP4F/+h2MHawdpJHnIgGyr+HPfki/1NlXkfZfZfZt/JsBensSruMEI7PjyqxxnOfR9+nTKKUA9gr202Tflf2UgM+2Cr5WwskDx2o63xzFl8kOcC+oQALEXdmfAvtegzAArLNiT54QCYJ+JgucSjzX8KMYu1IuAcCzKRthAD1ADEcYcJPXuXeMBOAdeXeJEQkAJUQA5rMN1MfPFALodxEApOF7vOfN/+79v/X8z5ncSgABQBl5rtsBPBcAAkQSgBV94gH3Yyv9gCJBAhMu9UidQ0yyVQLCgFPTZzWuJdFWDTDvoszQJ6jT7AvVf0oCQJA/JrUWcMU/SblaLvor/Y932MdJCHCPwF+JjrBVUSXA+IheAvhMK6QE9Lv89CXuRaJ/MNcA9FMpVxmvUhIAqaLO/TjGGMcefoVEMI9kcYPxCT/PTQLAOOoDPw6Qz3sAynH46Y9TJIAEQPsFg4Es6BEF5qv5P2HyJG+teyg71gCY/rsFiNV/yABIAQgB7oFE4FuUT3TXgs6hzq937f3yfXxX4s75vvmcfP4c/2H3FrykDqW+hUzdTL0tSQDaukSAYDsBv4QAcRkveE/9Uz+kAOcGAOzdQpB6KX7zQ7rFAH3VsoDP8FM+HOUgjC4nvkuZeijvnXVgvWzknC8ypKEMCf4lAXKFP4G+8WMSXcM5hbGzdwAg7zSzeFeWLBtnz2+ckoJVv+GeJO7ClUadQEHwgOQDCzTGGrkNJIkAGxTSRjZGBkgKCP5TMqkTRqZj8pUYAOxJBuBP4J9+QaZxgE/8AtI5MkGtYHdMAqC51gPSvTgBeMrqJzzlyNd7es+ocZZv7B3G4qkrrs2pM+vYekfOcX5Tv/W+EkDPPUiVqwT1u/xzwD6DaY9NdYDNwZW+kH3EfqN04shB1j5nH3TQVWZfzT68B9h3TNhvoBvGD8qdgB8AC8gX6AtqE+Trb0A/zN6J/+wf+53WVwCIKLkM3nw3QL8AYp/V/QT8gn4AU89xXTKACaT6AVxaAQDwWdmnTKy0EQaI8zzyJvzan1xZJCRBMEYCEE99ZL0J/qkX/O1nDoc0rA4Cnttq3QDW26r9oOBDUBCHco30OgTAz7ziyRv3nu95SrtnyhoAEoDypCUAoJ+VQvIFVGzM+iEDBmsAAICgnzIy6VKH1CvfLL8ffq7xHrTf/RreA5x66HOMIdQtCg4A2nodk2OHAArW58gxwG+8eSTwd7V/rFwQAJDTKHEqa1Mygb/pBP5KxqOx1sH4KRgeA/n05Vw5p+8yT/E8Vp6wFALUA94F/eyr7QF94hLwC/q511+H8dBMwD9b0TyfhjEPQE5/A9D3CADicF5nzJIA6FkBALjpnxB2jBECfNLilwBw7DDedCmpP0kA6pT8sNziGVyDREjQzxYAfy2AeA8GJC3z4dg3u0Pxh82xt7ECwBXbuOTUb3GP8wMOmDf4Bvm33zcpeOmhdTgBMGVCX1OPU69T50tMpM6o/oieaBxS4J6AvkcMCPwlBUhT8zFMXlgASABkedRNkUkA+C4p1Unz3a2Pjcya3uEnP8ZXAb0EAHEC/zF/7x7SOkcwtnIIIPqbFgDs/z+g/ex4i+u9bONOWf02+MuSxkynRa5dggkqCyfoYDK1EWSDp5HURk/jz4YmMIIMsGFKAKRMEgCgRhiZJAB+AJ6yBxDnAM2aBlBL3Bxw20sjMO7JMUBd4wHqxukfk6ZDmqb6M036KT/hlL132hWHskSaWpe7wnwz0vS+3Zy4CvIJq0xN7e9P8O8Bf7nXn0Gy52yzStszMtu5A6qDv/0C2RtM7U8V6Nv3lNkv7asbmQTfhZ+RybEA/1F/vA/9FOUNkAg4FbgK7sdkgn7S0O4gqwACrJyzsu+qIaARQA3IAVRr0j+20k+81wCdOvLFryRP05JnOp6TwB+lWjKAeICtq/i0d8ANZIUEAHkB/AmTF9eTIGCljxU880iJFQAgX+Dfk1xv1gBDWoE+Sn9TyNcmvMYjIQdwrP7zXEA/ftwUAaAlAGkqCcC7ARJQ9tnfn6AfczuAD/WQwI+wdY4kzNklfJPFCmB3d6TPM19i9cZ+fxz9IomVrG/89qNDCQDB/ZQE+FfQn+WYIgFoB2w7o++j5AFmVdrmSoE/Eh1gqMnRcY4xtxIACfiZa5xLUCAF+7Rnf1e7B/QB9L14wT/X9afMeyAEUFTTMXfRtwHiSQDgd4yinDjC1JnpkQB2xoXq6K+OEaYjrXH0bfzE8exGOA7+JADwNxJwIP0gAngG95CWcQEn4McagFX/Zik0kA8QBZRhU64hzFy5uxcsKe5IDYg/9n0d+/a9pz71qX+8LXCscjB+Vn7oUZ/3eZ/3pKYzzbojEq2x0UbfWocTCKvHqeOp96kHJh5Sd6T961eqX0oECOwzLOjPhSquk4f3IzNP0koAZJnwW1bSUyZ1Vd8pZeLBWh9RY7O9zG+AeZwEQPUz1nFN0N+TEgbobW0eWW8BEPxjjXjTtx/1GnTG6a+Syq5xhHVeN3xZlgYu2BB85EcXqGSjqI2eBpSNjEals1EiJQOSAMDPYWvIJAOSCJAQYPKWBFD2wKNAcxconbouyE25Cxz3rifoTkB+HX7KV8tT43rvkHFaVxCHX2l8ldRxjSOMBYdSM/5JOQD+dj0l/gmX4L/6czCVfd1FBGRbdvC0nWf7d4B1YLW/ZB+iX0m0ObHY/+yPnQE3+zL9/Dx/w/gg6BegjoF94vk5Oy0C8BMHQYXiDxAXpAhYEijid7UfoAigFjwmmMRPXjqBP9K4TJ9x+pHmzXME/ikBBKzMaQUAeIcE4F4mHVbxKbOn/lNmyg+Y5j5W3nEo+Qn8tQogHXW1iwSg3klD2vYtBgUa5TudSjx5kj/PlQAgDgLgBS/4lr1JAMgAVv4FDAAIJlbqhvoT/PHeWef4reOMhwQg/i7sxztHh0vgz5YSFB5+apK2ZV3vkvQxgLpA3tX6MWm6MbkL9Gd5sn9nPH7agQQAJNpc0F/TSQKgQ+z6BoynnJsg+ERH+MG/+8xPvP2tn/rYL/zdJ9zX0V94/wTpY35X9hPc9/xT93NNEoCxQiJAKwBAM2MRfRgCAD/KMECaOPxICQCAewPvAzB3VZ4tRL430hV/SQDGD1f/8dPH/+pXfNb9H/7q33Mfs/5KAFQSgOdwHySApIDWBptzXYbnQhw0AmBI19IOxCX3Mcft+n635HrOxfjzr4bz2oPhH3SIAO/HvvPe9Yl+1X6BAKxzyB/3dZy6GlJ9Tv0u9T4xEfohuqL6ofqikvGM6wJ5dUzDSPRT9VV0VMLEm3fVRQmTRgKgliv1UvIwzPvke+H3fS/VxSF1urqnnQWQoJ9xTZAv+BfgK72uNJ4xkrniOd/845e2ANxVfSM7g/6U+MddNGqBhlIAIgEwBf5p9Nmwxhq4DRqZjbqSADRYQD9kgOBfWcEbEzpxPfBvHGARPxIQqpwC/XOvAVxJK/hNgHyMX3BOHhIE6Tcu5Ze/49GWtie5l3gd9+k/h6Rzkm/K577tTfd1xONX0tm9pl8pKOO6fiUmlfhTamZZJaux7J3K/VOaU7lXCnOpb/pvvvEXcQy0+mmTycTqz3ac7Ru/AzvSPoHMvuKA68ThRGJ/y4HXPmkfbZMqffhyH18NrxfkoOG95ac/48+/GOA5BvoF+aQBqNLOJHkA/pxrgfLvymAC/gSG6ScNDkAPOAcwCjB7YD+BJv7qMm/9piHMsyQB2HdLe2KFDZBLG/IsAIE7EnDGPZSL1VkAPnmRL9cbSH7Ni5piT9h7SZdhViQF9xIsVXIdk3sO50Ppbod2Dab0HsKnIk88YB8HOOA5+FnV//bveHrbErDLCoD0lJF0AH+tAfj+KO+Y1vHe/PlNrNO5knvJ465Oynt3svUNjAWs+NO2IJWwLGG1nPZZwfRUmL7GKr2A/hjgzyn+WBRMAfupsuQ1SAwJAN5r1y8CVOBvGAIAy5M2/s2sbMbd173sD3xcwN+TkAKNHBjA+Rh4z3jGBkB8xu3rlwSQAGhnAQz9WECfq//NImkgBgDwOlfs6ZsCe8C+JEASAMQ1iwgA+xqEJwFAXhAASA72GyMBIALcDuB4BOCXBOCZDfAPcZydAMFBXWk5wXtAFNwRAkD9etUSL+bjmS1zSTajBsQ0vaTWv2mUpr2wcr7Qk7y2nwy89NDaLyhGqrupyynV96rulzph6orqkcYZRgr6c4Gq6ppV3zQtuirPFK9ZPiRlz3gJgNQ/8fveG7lfDV5KzXPQ88EBAPmU+LlmfE1nGIlDb2OOYCz1DABW/3F8g0sPvwUR2ZjTX4ue1/T3JHEXbt2IE1DgF2gI/vnwAJJdDZxK3tWoaawJmvDbQFMCuHQQAWPAX/CPrCvAgn6JgAwnKWA8cZIDykoECPgFOVzPOMNeH5OAY65VYH4OMH6qPF/9zvc3UN+TxPXct//im7rxvbS74gBkpEHiyFu/gI0w/p5D2SIeqR/FhBNUkek4UbXnJASqlBCoEla35xzcs7/gd7JA1gHa/pfkQPZV+/FmcF73760+f9H/GUMcI/B3/3jWJz/82tcD8JMISD/EDIrzR/+f/7f7v/MvHr9xhAEQAEMOgpsLEE0H8AFQAxwwfwb8G2cagbzS+LmS+0gLmOXcAdqC7cFDAgHYgusE8gB/AA5ABtCMn7Lix/217/6O+w8//OI2IbXVuiFO8K/EvJ6Vup4VgMAf8N8U7UHxR2GnLBAHbYVufTaA8QB38kbpRkoIaJFgHCuwgEyvVykJwLPbfn9WEwfgQP9houV78DNEfI9ddd1LAwlAHgsJ8NBD9DEIboC/4J/vQ9tMAL3LL0hHAvqnCACvVVlX+3c9c5/rgH4IAEkAFDxB/b5yzup/HdDQY178df/xL9TV/0oGcP1Nb3hN29qyC9AzRjBvZDq3DyjzGpYCdY7i3dFBAMuMNW28Gfq6JABjB4772jgSBIA/uce9WCpJArj6r2T8wDVCYOjHjBfs25cAYEzheYL+JAN6lgBdEmDINwE/72odIK0H/JABN90st7afTnijS2Oi3szML+bXnXNrJ78lar8a2NT/cFv+7B+59Oq/F7ffE9Wp1pIxRZyEVEdTqsOp19VwxUzogKkb6kdKAICTxFCC/6pHGiZ/70sCwHIgLSvSePwCfqT+jm65X/11UlNG5gLBv4C+AnyIAFf7TU8a4yQAIIeTAMACrJW78+zbGJWNeMzPe3kNuXKl8VIpgoYEEn5wpGCj10hs1LUR10ZLA9TZcJGs/Cfoxy/oR1bQX8MC/h74b2A+TcTX4F6Qf4wEuHN/SvwAIeSUE/iTBj/3GCdQ95rhej3jqz/vNe+axvieJO6q3Uvf8pfbM3uSuJ4TrHMNv/KFP/BwN0warzW5tgTYZQ3gz6pgDaAD/NtOK+AnnG1csy7bf/YNB2ll9icHYmX2P/sk/TP7rX25DXbZ1+3/l6Xjn2OF4UuScmP+LhEAcUWdV9CfBID+933gKx7jZHJ/2nIXYMzrgEfAOcATRdmwaQTwhqskPQ5Q1HMSB0pAKRMKRF5bZRsUY5RjHEqvQBkgDUimTvB7PgD3Ew8pALjSZJc0PUdaHKb9kgDUscB7C/gPin9T6NkSMFgDkL7taYageNzjWhkhAJj8MPnneZSXuEYADHE8i7MHAG4AMa7zLcnXd1OSlnt5DvcAFmDT+RYAH1bxyYc6p46te/3WvdLrSkgA8qL9X2pwD0gE744SA5kE+GfVn+9Cm98HXGfaSgBUkD8WxmrgVKv9WR78vI8EABJ36DYA+tYhBMC6Sd1jLP7J1zx+awtAJQEIQ2oCYhO46k/JihP9gbaMU4FlvGI+ZixhfMDlinz1t9V5VviHsUbSURKAsQhrAMaXJAE4N4C99wBv0yLJS9CfwJ+8IfJcoadPY0lEPPdJADDWYQ1Af8fPs5Hp2liyPhOA/EjLPCvozzqqftJAwt8BArDp1m99y1ve8fDDL/oLtrFrGr5Wev72PH9NRTn7Y1fvOug56kHDE33/8z48dau13zKkTJ0tgbY6nTL1PnVBZA9XoVuCk9QnCZs289HPM7iuTooel2WxjJQbR9jrhB/qvOsm7oS1TLkE9ehfU37GWK4n+M8x158B9AyAOzDG7KxpGr5/doJt2fmQdbVfJosPD8iwcdgoaoPNxoo/wY0NVGkDVE4B/13gX+A/KgH7Y+Df+D0IAQAxgD+BcQ3ntZvot7zKfCfjpiTX9nbWNfJMrpJCU+E8+K/6sTLB1XZJ2DartE0rs93XPuFAjLT/KLN/CeqR9D+c4F5gn3IzCNOvLya+7T7viHAqOTwL0g4CRXA/V/7TX3r8fYgAgDZEgCBRMDglBZAM/JigYwkAqPAeryN7IJ90PFcTZIAH+6rz8Ex+jcBtDpjg4wf0othKBLgyJ7BGogSzii8BwORFmNX1171jBbBJoxsjAQDdPBewDbjHnBaF3GcC0CEGuI50m8AmPACH9ksBw7MBCOxpFsgD4t0CQBwAkzoAbFJO6ozym75KngVBQVl4BhMr3wLQQ70C7qjjqW/qN/KbmR4SgK05tPtTNdPbkg8gFuBPm2nt5YBV/wq0Ce9LAJwT+Fs+vj/tDpdEAO8OuNzHAgACAIuJY74zY/BcawAseSifID5lgnjGigasBxP4jD/ETz6a6TP+MBYg6duQAJSHOIg9SABAPeF0kACa/DfgP4wRlIWxBCcx4HOahc8A+tuhn8M4AgEAIcCztD7g+ZUEIB/iOGkbMgRgnyv+Ffwb1hKA+fOYb3mN967m22FedN4eyuIcnMXqxeX1U/h7K+A8967+beoe8uWRRx75zvWLXt07o3sVp96WUj2POP1KdUFl6ovVj26pzpmSeO8fk6RHf6WvkcbnZznFf3mtvt8mfIZWxXsI/AX4KfNa9UMApAUA58Kx8o+7xePLrFq2wa86xMUAdLH3Zd1IpwA/DYFBzI+PzMaUjTFBToKfbJSCJWUFVq6gpgS8scraA3H/9Sue/9gYiASQcG1SDgC2XV8D2fRXYDsHHM8F+ZipkzZl+ve5VtNmGH8vbPyhUlLA+w3XOqvhrfrdkwjIb60/Jf6eo90QX9sPYJ+4BP3Z7mrb3AX6s83jz/6Q/ST7Tw669C36mkqDg7CAH9kF+9m3t/2zBopTJeIdWUGbC/4zHUQAgAMAuA8R4Iooyi9KL0qk4ELQD8gA5AMw/FlMz8gQ3ANkp5zpkIJsiAAUaRTwZjoLEB4UXoByAnqAAUAfSTn52UD8gLtM1/NzH/nxLPJ2BRBFvZECBfhbNqSkAco9ij6rgVgAAPoB/40QGMIo89QHdcSzXGlmJZ9yVuBPmPt5Bmc9kHcjGYZVQ0A7JACTLvU+RQIk+MefJAD3QQLcAXPg2d2Lvg2AddUfMopvQd3Ypo+RcwgATf3PteJfy883r+CffsqWrn3Av2k5K2GocHWf2XVfEt5j/J5jDcD5AZjpMw74SwI9yfVTkQD0Z4mAJAEA+ZAm9GvqA8ke/AT/+hP4C/grIUF8K/NAIngAIGMFBIDPkAToWQL4zoyNDywJsGpYqYOXpnbW4Oa56vANqF3oCGd9+DVl3t6ZsfS5z3rmC9shfxfve+y4MP+V1thqA4yHsPrcmEyMpb/qir0wepcYK/VO4nvpzRuJjsq93Kcu2iuf78E1nXHzK+XwlJ/+x77qqwHzFeATduW/+iGRJQAA/taHBADvcXiJrv/OqcbstdYZhqJeyKEhCiIEFn5QpAOFjaQ2ICpRJ8Ch8aSzMSIF+soEVYAtTKMTdGlOLeDH1FrHgWwJ8ACThJFzHGCUdJgo40+JHweg1Z9h45Hf9ff+2y1QDXBP8G74rsneu4/VUdah/jnfqKaBwMlvvq8/wT/3SgLQpvBne6MdQgZke8z2qt+2jMy27kBqX7B/IO0zSvuV/UzZIwDol/ZV+66yDcLZv/t+RivHhLOOXJSLesFUNgH+XD/WAOy5TyJAII9MAGG8AIkJAKUTyeDvSr6r+FMAn2sJ8uf4BdukBZCzUubKvKAZUA+I1xoA0A+ohgTArzRdjwQgL8B/U9pZRVyD+1zxtyw9CRFAGckHs2BIAB2KPfGAf0z+KSur99QfYZzvkrK971AOnke5UPIlQbQCgOzge/EtE+zXcL3GdRxnCUAG0Z/O2mhvQOb0f3/aT5N/vokEV7b7Y/x5CGCa/Odqf+1nxzxv1718ZwiASgIcug0AQMpYeYpPyjep1gBj5wRABECsMcc87YVf/K+bG1bgId1wAOYGpgdAzhhVwfbB4SE/+l8SAYB+iQClwF9JesoxBv4tD9chNHgHgD8OP/XM+yB5xhgBwDMcG7BIgCDM7ROu+vcklgBsHWBOPMX3vIY8LvTui3m5V4ycm72nl27fuE1er3zklT/y3ve8531FX9g3v7npfa5y7n29dObRk730xGn1kH7uv9q/AWu1+u7IBj7X8eIvxi11PaQ6YU+qPyLRKdU51S+RXOvdm3Gk8V7TZ3l65ef6VvwV1SrlY45Ev5vjAP8Q6ujfrbxDOfFjqXjXFhZs3NudZN3ABAuCCBvaXLCfQAa/DQaZAAjTRcFRbw80wKoekmYYQJYnrzf/CLB3b7dgHoCZfgHnlATEcx1Z/QB34noyQf3rPvyDLQ1x+pWZ7jb6E+xTTxIgtU7H4pNg4dtIvqTfuLTSEPArBfwZTr/XU/ZAP4ciCf6VaQEAEZDgv2f2b9tWZtuv4J++kf2mDswMZg64OSD3CIDst/Zl5Xpg2+73F8qG48IVDdEXj+HdWUFjZX8u+Dcd9/zcL39PM+kHAAISXMEHKLiKXwG+4JfVcoE0wJ54wf8cYL9vGvJ3Nb4pzgMRgFLeswZgdRcTe4E/YcAOSjbg23KnBGyTFyQC78GzfNe5knsgDFi5R3FHGQeUAOqpR1b7yR8zauqaskBUQAQk8NevBQB5agGhot/AwshWAMA+3zNBf8ZxLR1WAFynPV20rrvlY2yg3qnrU5r898B3JQAS+PfSnzuOtlbBv1sBBJfIuY7+xLh6yhZC23vty/79nWcD1PMCJNkgDXSMiZADjQyAzDuBa3kx5qy3BADy6ds66g4/8YwjEASmbeGhDBIBjdjrlInxiTGJMYK8APw8F0sf8iAOmQ7wLwHAwYKc8I+VlucB9EB/jYMEQG8cvue1zWWnbEuRl3P2Kmqtq8f1U3g31r4cRshqOHpD6AyneEbNI8H3Q/Gs+v18/540T68Rvrel81BfF3oO1/PP+6rMNFfr9/tOSHFZSvypH/b8jHeMUeqY6pY9/ZL7K8nAveirpr8E8CfK/BDXrvbvHpYdEgH1gHCIAa6BRdt7lLKhp3MmCe9bLt2qIA3bv9rIN52eDiN4oDJ0CfyzsdiAkDQKHZWlq6CHsIAICfB3pRSZq6n4c8XVlX1lEgAAOlf8JQPawWwTpADgMl0Fq1PhJAFIJzEwVybIlwRATjmJg0xv3D4y0+I/xvXe1/pACviVtU6pf+LyO+zyt2893JcyAf0hfgA/9yFRuPAD/GlrPeBPHA7gb5ul/e5LBNhPkPYfZPat7HMOugzM9Ev7KNK+q3QC3Eziq8H3cv+/PDHmeOG4cXZJOVlBO9QagIMEWU3GzBygiRTIj0nAu6AYZRYFFEKAOK5x374Af5/0gnOe68qcoLkCfAA2TlP7et37fA+uo4AT3hAOw3v5vnNkK99f/F83oJ68ANyUg/xZ/dcSwPJZjpTcR72QH8BC8K/kHABctQLYBf6TGJAIgARgrzF95OyN9oofwNigyb/gn/c+F/CWAEjgf5Ur/vW9kgAQ+CshROYCf9NRl9TpqT+jY9mYBUAF/7vCEAoQZacgAMwDQM6+fcG9q/2Ac7cCNMC/thrAT1pcJSTo3+abknGNtOSd1gUJ/PWTlnuxioIAwLkVwJ/+q4C/F4YEYC4+9Te9zvzaHB6kBnP/2lydYp1qvm5YYKMvkO+2znDqKtjoIvzyAaTD+l2M93kbjNLKQ5kuynWRZuW796xnPes51A9pNvWWfu+4LOtzL6e4qhjebw+n/qdUB0QSJ5BHokOiX/b0StLWPAwruY8xU12U+H3KelVVWJ5zj3LmO1MX1E9JtxUEr7IF4DbqEg4KNuoLuW5YdA6dDYZKwiXot9FYeYITGkG6BDMJ/BPwnwP09wBjgn8YZNJUWcHoWDjBfg/wZhxgmnCC9ClQX68JzqfuzzT1/npfph3z9/IYy8d3Q5KfEn8645FTjjrnesqx78A35Frve++KA9CTZl9yAAKgEQODlHhKUgq/BEDKJLXw1z6Q/SP7TfYn+1kdrOmPOPoozj5rH7ZPKzeD8wXQvxgLtoa7mxGgDo6xBuDUbU7M/uQBuEIEzHWAUwA/q1dNoV2D5TFAn+RA+sfST8X77LbaNlgDoDALoAX6SoC2K/6mSQmBgdJNeuIhAUhPGXkO9TEH/JuGeyg7eVE3gn8AF2QEeefze34sAMiDvFD486fDIAFQ9Fkd7B0IWFf854QhAThIbNcEfzNa/LxSMP8K/k+9378CbcPs7Xd//3UCf8qDdU8SANUSgNUcgf1cSX0e8UsAOz8cYxng/RREwDlIgAa6B2uA3uF/jEH0Vcakpz3taasxaf0TgZIG3I81wC6LAEG+JIPSeGSPAGCcwPpoHysASYE7eGq383ZbKT/x2LYF9slb/QE5NHSf3ZNj/YC0/qX/Ig4sMvyxSsu2A/zxPILtXYmr+k3Tay7Ij025yMufUoQkId8NubB+3irjW/Cf8lpm/Tsk9aROiDSsTDynLqnM9On3XspCvDop9xEmftStv+Hm+i2odovInLs2/++1X5PdKJkF3XSKTeUPHyo7Ex9PNwb6E4jgF6QkcMGfoGaXeb97+TXpTynQyhV+/IB6HWDuVa9+VQODyHSARCYMJL/FPQYojQeAcuLsFFDl2o994G+0NIBj/Lj0GzdXem9PEre4H9z5Teo385vuI20rtCHusy3RxmxvjVAa2mBtk7ZVZLZhyYDe1pYkA7LP4M8+ZT9D2gcl4ZQO3EkGMFjr6OttQh36fRsDLk/kDF6OGcrrH9CG8lJPh1oDsD0ApZtvyBYQf0ILySFcrHLhXLVGgQU4A1KRKKQAW8kDwfscoD8njfmlBHADkNsK2tpEVxAv4EdKBIwBb56Pgg3wB4y3PAbFnTAAfvOcPawBrAfqhvxw1t1YOZIISAsA6rat8LHSNzgIAA4FxNwXAoDVe/bz5+p+D/T34rQC8FBArHiuvzEfXwL6M6CW/f6C/1Pv9xf0V+nZGTX+qsO8rwSA4N/Vf+QhBwGemwDgyzP+MpYB4HGQm4e4t7zk37kvCQBYHnO5Ar/LL3BvK/oD0BeYIwXnWB7wXEkCrQCUpEsSgGf2LAIob+av3+dcIgCGsQHygXGasQErAFb3BfhTknSkZz49vvfduBzU6ylY+g8tqHnc2zL9H/ImzIr6OuNVOnQJn3vhr88mrX/mbxjp9Waqj26yedZ2nhtiAmD/jz/4wV/xoD5wC/dkput8V3kOz+AnFSGDubel28673HpLgrzDHo56Yv7gHvzqjClNMybr87gXHRTJPfV6C9fqHJ7fja/pblb4Hu95s4o0XRo724UcKl4ggBQc8OEEDoJ/gYVS4JHAH0CSQAXgAuDXMdn1gA9xgCTAUYIl/AAowdVfedVLfx0/EuClFJghAW2AewF+lQB6wFzKBPpMDoSVAknCAHjCc4H8nHQJ8vVznyA//V732m2Uvk9PEndVjgOEeBaSb6rkO/vtaSM4wvpT2s5S0ibHXG3bGe71C/tNldnHemQAfdJ+iswBnf5M/9bR53MMaAMxA7IT+WU5Pcpc0VXekQOzDjkbwDMCkNyvmzK3zZW6l/25JzyGkuqWggTrc/2VDKjhXj6NBBjAOQqxSrZgOokA46rkGc2SYDDV5ZqAvRECrOAN4B0gz3N8lqv9uyTpyT/zrc8fC/Ou3M87aPrvrwFQXn6ysFoBJAkwZzuAaZCQCLhbf4DP0E85nEjwzxkQ1MtVA/Drfh7vnIAfEkBHfD0IEJPzXZYAWLEw7l7FcMZYzHiGfsRWJ8YXSYG5EhKAwwMFzVMSUD/mJA8a8B/IRrYC6CowJ40EAM/juuOSso2TwzaAKSLAa+bhc5DEMS40wmIYC3im6fEfYgUgCcDceBXf94qfIYA+1WMbXviBN7zhjfwcXtMPBp1AvDA8ZIUn0BkGpy5huvV1y7Iq25AOPSSuWeYmxR7mQf9Ah1mnv0g75EMcIJ7xfA3m76HTcE/Jn/s2+/95BoRBS0c+q7yGJJs/n2NEDRt/M6XvNFNaxwJ361DZ6mdGXuaD3NTtzayho0qlTn1UJld8sw24dQQ/qB3WDu0HtxP6ogko8DNh4RKA9AgAVzKZ3NIl4AH4E3Z1FGCECbUEgKuoSQZICijbSux6ZVYrgFy5dQUXWUmBjEtyAGAI4JMEmJKASa4jBerpN67KTJP+TFf9hO+yox55v5RTdT91je8519FuSIvc5cZW/mmPtFPd2LaAbP/6s3/Yb5QJ+vFnv7Mv1j5q36UvOyDTv3H2e8eBYSxajQvb8oqHqP0fR12wapag/ir8HMz1lV/5Z9pheKyC9wD7ueIE2w3Mx7aAXSQAWx9o1wAMwL5gHQJA928NRAD5AOZ5Dm4X+Pe6Wwgw6yd/8hkD/Rnvs7BCqMD/Cb/2iftPfOfHGmDDdL93FoCr+wny0wog/aZl9YdzCuhH+7e6G3HHPcG/e/4fRPAP+cA3lQBIC4CM2/ccgKskAC61pkHRZuymbTL+SwzsIgfo14wJFfwDlKdcTW+4nT3CLwOsHUSA15A8i3NxBOpeIywBoGQsELgjtUAwDpIPl9YA5GfepOM69xGnhZBnAcz9RQCtAyABmJvb/HfpAywR6xrYYAXxQNEXSLbRG9ApIAnWJvubFfpam+girMCTPq6RT/vDsmBjXTD0hSHSaz5rlZBrg6NsrPir1xC3StD+ey+Bdn977irNxRkCF8+IW7ee6/15/fb4ed8dju9CHfbkrnvzOmMXeWzibk8tzS4p79jeb/YdV5/Qhm+nuZD/waoxCAL46Do+HI5OJYCowELAkSAEvyBF0KJMYIMfwMP+Z6XAX5mgSSA1Cv4Ba5hgD7KSAMRBAvSkoFCSwLDkgGGlRIByCnTmNUA94bmAXRLA9BnWPya95yqk75Qy33uu3/o9RvJ9uR85x+2775/2Vff72y6zreLPXwCwPSPr3v9d+//pO/anMcBPP8y+aX91snYgt2/b3zcTIONATOBr/9WPVEc+kfc55pDAYwgDFGAAryQAYBbgPyZPRQoAugHnTZleK/2CaokAw0rKyTkIWDq0Vf+1FYDgXwkJgCN9IwEGAC7InyO5h/fkuRINlqEnqSvybdsQWOX72//y/qf8w4814I+VBfdg7ot1F5YAAF2dgH4M/PfivQcSgG0FTVk5sg1e9e2sTrvvn1+DeFDBfyUAEvRrBYC8VQTARGNirKO9MtbnAoxEAVYtuEGh+wAOoOwKvhKT/XQA6p4jfTt4b50HabQQkAAA4Av8laYR/Cu5XyAv8AfQ65cEIJzgH7/3kTdWQm2r0PoXAQ6xAoAIgARAH52o7rt+6QIT9AEw72+aVV1s6wzWT0tD2wT8A+4bOLpIazqk+aXcvs59F/eOpVvllWnTv+t9TLv9nCxH82MlsCEjLl29xRH5/mu/4L/Nh53rD82MM59N+ltcTbep6NlRLvzrj0bn1PmB+NCCBcEDMkGFYD8nmwT7gpRqpkzYlc0q0/S5+sfMp4kHrOPS5Bp/mmWnX9NtzbpTwhhXB7AmDoljktB/EyTAnnKkTLDvtYy7K/59iQYIAe7Zh1iQDEImaYRfckmLkyolBGp7ThKg9gPCSY5JmCntW/sSAPRh+jX9G7cHAeB4x/jBn3IVuuH/GbdOsS1gX0IA01tJAAEyIFZ/Tx5LBJAnz2B1vD1rUKRZ5ZtadU8CIIE5fsF/SkgArkFubJ4zPLf3PhkHAcDKPSA+zwbogX/iSMP9PCOBP+8CeHBbgL8I8I8+8IFP+LOOAF8BvTLJAa9XaVpIAH7u54Y37a3i0b/5uT8IAFb/sWS4bjP863q+BwAm8MdvWLnvQYD89vNVbQHY+rgnCDAOAv75uTxWyNMB6A1zXSCNxPom7yHuy//UlzVLJ+K1AACEQ9Yx3vQIAAA7wJ50gv+UxAP2Bf4pJQGQpJOYYCzwGs+lrJb9C77sGx77cy95/awzALQASMn8eoJqv21ZXGCEbVDee49e2kx3sZIeeKMBwG0douoT5kte+pXG5XN6/lV6nrudRy/tPnHk+5D4aH1ji9snk1uTdv3d2jc71M/Lru9F79R/a+rglhTUDnJZdj5cgv5TAP8E/z3QL6DpgZ0Kjmo4QRWAnzAS8KWTBFBKBgD0qt+4lBAEhF3JP1QCLiEU5q5075MO0E76KZnX0r/rvqnrvWsZh1+365mmmyPNa07aOWnqN+UevrnONvCmN7zmsWwb1W8bkxCwLTYrg3XbtM3WttwL9/pEJQHoUxIA+MdIAPphknNJ2knmOXlJBkgEIB0XhjHv8jhySwbCsWJSf5joH3s+wBwiwPMDIAGaUjysZgNoWdVGpiOu59JiQH8vHXFeR6I4Y4arkqxEAe+BbQkAypwEAGlRsBP8SwpAAhDfrAHWAH0XuSGYhwT4tN/5+GOk5xn1mZaRrQmAf9JzL+nayuMAQFDyJQD43V0sAOphgIJ7QL3+lGN+00MCYE4/1p5uWjxldfWfX1u4LvB9E56bBwAm8HcrgHJfAoAzAm4zMEQBlwQAIOMA/pUAANjr6GukY75Dl2JlnWuc9M/P4Ho/4wwAH0JgjACQBCAd/iQA8JOHq/pjBACA3/tJL3HQ4gcrBkgASYt9DwNMAgA/c+lN6+dnLY9YYfWQUXP9PcqwIQHQLYb7BMvqF72sahrTKnv3XGWc5eOZ6b/KMlzNs2wPU3JuSWoec+9b0p29BuxYm8760PCxBANIQYKrh0gAhKACmWAjQQigJF2CF0GNUqJACRCqZtK5eoo/za1dcU0pGKsS8kCz763V3Jkm4wLHfaSgcw5gvc1pqBPfdZ/62ZW2geyZ34e0+X31I+c42hDpsi3hz/amv7ZJwrXd7mveTz/JfjMH3NMPBfjZV+2/WyDfAfkOgv2xEZP6YVuARIBAfUxOHQA4do28OX/AZ9CGAMoQAXMcJ2KbTv+YJB3X0qViLfhXcq1aAwC02QKAlYTgW0n+lL2B9DXolxBwSwDXsAZwX36u+qdfgkBQDwnAPZAh5NGeMRACPjvJhUYCABoG5V7grwS8sNJXtwEA8AX5ruwb3iVJD4jkECn63Vh7uinxzL2u/nMewlWd+H8TwH6vDHzf/AUAAT8y3b4EwHO++cdvNQFAe2V+gAQAuPcIAEAz/QmHn3Rf+7XPuf/wwy9ulpYQ5OhOxEMEcE0igHGGswEA5TjGm54DwAPwSVNJAMkDiQBX+KvkOqv+jENpCcA2Bi0BDt0GIBHAogD1dcZ+fqF7X8zDxzxuc6L9AZm0sqDvY7J/wpPwN0QCdelP7g3lmwLP1ouvUcPGX4es5a7h6yjT+Z6pntiT+z4189j33iX9WWogG6+drC+Hj5ekQBIDAAsBhwAEOYcgkCyoYCeJAv0SBUqJgp6sAOzzn/3kR3uO/dn7OPb3kj4l/sXdvDqo32nqO/faRo3LNtVrc8TZNlPaflPW9m4/UCahhj/7UgJ9+pl9D5lgvwv4HYQvFI7s7znI5NiQ8bfdf49vw0nVAnXA+jkcJAG/FCCQroDd8JTk2tR1yQHToAy7mibwRzbFeFDIAdykFWhjQcA1gL1xSvICiAPkW1whAdo9QxxKuIC9RwQI/pE6zPohAaasASQWyLOlG8qaq/+SAAAVtgKw8g1odxUfICjYzzj9U5JrAGlM6elXN7nR/8nnvuqjEACc/E+5e6D4QYqjDnLlX5P/KiEAqLddp/9zvf1KwDe98THG8JvcFuaUjfbM794D4qvjUE3O1cDRpzjUFJN/gP4LXvAtzeoSEgBwrDUAeUACEHacmSIBuCbARzbiYLAASDKAMaVZFAwr/hX8Z5i8SAvRYDykICQABMcx2wAgArDam1OnB6Sp8+4GKB+Ql7echADg0L62Z3+Vq+X0GYfIpkuwd77kO5ZXeyaH+PkzfuuELZ+xm25AvOVT3oAiHVmEC33xyIyG280LufzdyBpoHW8oWV+uP+AUEZBkABONhEAFMIQryCEsAEpZwRLhBFP4E3BV/xhYS0CnH9CHv4K/DAMkCU8ByqlrlTwg7UIgbBMIWSf6p+rU75HfacrvN/a7K8faSm1Thms7NNxrs9mme22/An37jpL+pKtA37B9czPY0pdXA26vT9/IQeiKCnWPMYjvxLfEMgB3LDHgb3ZLKEACfNFLv/tjAORTOlf9yTP9gPsE/irXTUFm+8FwgB6gn/sA9W0FHuV7WIUX+Kdsq2vDfW0P/yAF/VoCKFHC8ZN3W9kfQLvAHwIBP3lIAGgJILhv9wzWDJaD51IO7tFaAInCXy0BACCAlb/613/yPvu/Bf3HSkmAd/79d//aek68oqY5/zGMKYBY3INu+g/J4TkQgn1X/A0jca9+5/v3OgSQ1f+nP/v1t94CIFsW8wqHAwKYAcs4yTT6E+CZOMz93fcP0McaACsAiAC2BZAmtwWwLYdxhz5Mf0VWS4AkAQDuhJMA0E8+kgUC/ColEZIEgBxsFgoDocG2TFf1D5FnOvehzcfM56y28y2Gb+McnZ+p+klzjr8tC+At/eE0T/PdUo7l3N6RelkTBt4zlv4mxLcyrwuS/ptQtptThpUuenPK84CXxIaqpDrwTzs+4uAEG0pBSEoBC1IggzyWEEDxqSBL8JVSoNaTrtiOgT7iBYZVAi6JSzkFOG/CNUgGy3GM3zxumszv4fea+ra0CdtAr31kO0p/bXeGE+Dr7wH9XtvPvpF9Bn/2J/32uZT0yebG++8DPtzNe32+Bd+Pb077kBxAYiovyN8lIQH4Le7f+zUv/4RAWXBeFWLMWXEqzKk8A+p3OS0ByINVOB17cjkTADAN6Aeg6wxzXeCd4D/9EAWAdu5tadeA3/dCQgI0B3Af0gLYWel3K0CCf663AwHZBrBe4UeaP8/YkACk/cT9DRHQVvzW2wGaue8AYAAsbAMQtOfqf/WTpsZNkQVYAqx/xmpeA7rCVOz9f963/WRb/X/QTf8hAKiDNP8X8EsEvO5d/2QD/nP1v63wDyv9Y9YAz/j6H71zBMC6md5jnINEA8gD+l39lwAA/KfTGgAiAAKAQ5I5IwDA7bYA0jAGAeQZ03B1zCOOVf6Wbtg6ABHRfl6wWAOYRwX+NUz+jK/EQwqQF1YJWCtwuv8h4J97eD/m8RN366ZzYxL/jz/4wV+JU+VTFz/xI3dmN7ZYsPPGGQnEFCRNf+/W1fXL+kwv7XXHbb4XekNscbjuci3PX2pgrxrYNOT1XXbSabnupAlE9AtWUlZwk8CnB4yM6wEpQVZPCsqqTCBX/T0QmHGCxSlQOXYNQMo1QDNSgEo4gWuGbxrAPmV5rAvy1I+sfuOmpN+INPiVxldZv3uGa3vJcK+dEddrm7bblNnW8de+0AP79qUqG9C/PEH2+modBGo/r9eX8K4aGOqdMY3vxffl+2fbMEy7ov3Q/lhp+/2f8Wk/8Uc+7/M2ijLKcjXBRQnOuPzZLVa1uF4diq7p8l79ba/sAMoF1IBs9v67Mo8C3gD8kCZBf/VzHyvymOa3bQRrwJ8kgEQAEtJAcA/g1wJA8J8EQLMAWBMBEAU8GxJAYoJnQihoDdBWCB/3uI01AGAFEsBtABXgC/p3yUoEZHq+5a6mcZXXaWeAf9yy+v9bbetDJQAq8Mfsn5//S/CfoH+MCIAA+KKnv+pOWQBkW2U++t1P+rMfAjDTjyQBCLMNAEDvdgDJAIkArAEA2QBlLAgY17Aa4DpjEH1VQrOSAIQZz9zOg7/17UoCDGMcxN8uawDGuiQBsL7iXY4hACABOOx3qK9Tzp1trmZeVxdoc/r0M+r8np9wjn9O+Y99xpxyzElzynLMee85ZZpMA/hn28KQ6EqeN1mY5eJSA2eugdpBL8ICEySdIcIJZFCiCSdBoL8HjiqAIpwAS2VcWYFZKunVj3JHXAK+nl+lPkHjmD+BJ2kIK/PaXfb7vllH+b5eN850hL1m3C7Z+141zm9cv7+grbYZw7WdGbYN2jZ77dY2nTL7Qfqzr1zyryaWi362Haa7j008Y/Hcs/xdYQ3QhgXrKLso2DpMZ7mG0owfh1/Aj2KdirLxxLF6hyKOJN58uB8luwfmAdqbssS5ADVthl3Nb2B+IAQS8CcRoDUAAJ7nCNwbEbBe/YcAGCMBqjUA+fBsLAFw5MN7Pm5NAmi67K8BCNwroD+EGCAvgCU/NUgfvsLmMvmoZfV/BfrzfAO+leb+gH9X/AX+PfAv6Fe65z/DXzfs/7/LBIANjfkSsvLpz/+G3+Q8AMYTHOAf838c/t62AKwBHv3ZN7WzAhjTIAQwv+fsAOqOcUgLJ4kAwDp+pONZlwCAEBhIAK6RfooI4BnkR5o/+l1/4+hzALQcOPFWgJzHqf5cffdzpLycfny+z/vSn8+4DTqB75zvMNuPXoU+NvuGi4RZN+m/SHHZl+mOKvflrK8/hrpEx0UfRoehL3zOF3z1/x3nYiaSRY6eY0zh3BEcYwx5DW+VdXb9L7mU4Ow10PvgdpbLEuLAgTFIBIFRAqfqT7CFn4HAuArSBG9Kwd1cKUickhVw7grTSRKsZhj/TXa9cmfcrnfnOnVpOv29+uUbEd+T+f34toT9xilre8i2YptJWduaYdvlpFwNepfb+sVg2Osj+3bMffLYJ+2+5VjSd2qAyVDgzfYA9hajIOOIF/wjVYqVWgGgYKNcu+rGdeLYlwsYNj0EAMpwgnhW41jNR1Fu6Qbw36wBhrhM1/OzbUDLAUC4q/UC/iQBJAfatfW2gDTlB+T3CIBqDUB5yauSAJSD+oAEAKSwBaD+GoBEwJjsEQRTad/29rc92vmkVx7FGMXK/9e/9F33ISYSBD+o/lz9Z48/oD+BPz+TmKv9CfQF+8h0pr+LZwBMNNp7zKmpY6C4s/LPqr4kAGGJAOLZEuCvBbjizhhFHCQAhALjXRIBjE2AesYI/QL9XUQA40KzMuocFMjWAsYMLAJ4riD+GMlYi94wUW+HXKq6QC+PTRr1kKZjXOgSvXu6caxQM3Z0L96dyKbTUFdrk/x93mxzL3rdHje2+/ZIfyOT0jbs+wB9fomNgzCxgPlr3/0d9+e6V/+lb7uPI71+JGMB4wfjBWd6QRY0YmAYb/as7xtZf0uh5tXAsZ3F+3uSuOPcf3D5fANBXpUMMhnnAL2PpNPNcUw+ptOfQLbnF/QmGD7GzzPMs/e8Gkd5ibPcuyT1ZhrrkLDxKb1eJd+DuPwu+ifB+fDdt64f244u7qdX9NpqxuP3b05a03jPIm9RDTC5Ar4B/BAAgHcAvwQAZABhwHw64gC77r1F0f7VD/6DZrIr6K+/2Y1iDXBHYcYB7BuQZ4/usKrGdgAIARzxPeCfcaQB+LuCj/wP/9r/PHo2gEQA0m0BEAEC/SnpOQKccQABgCMPLQE41BASAOsIwD/mywBiwGBd7Z8C+3ltys+1E68EHtRqKQPg/yWv/+kH/mf/JDz45myFSNDPij/Av5r8J+CvRIAEAKDfdA8YAdBtk8z7kJdYAADoUeSTBMDPNUC/BACAG6WfMYv03Md4BgnAWAQJqQXAKOCv2wEiDHHA/Zj6f+X3vfb+l/7I39k4Vv8hALgGeM8yHUoErH8V4Drm3vbM7/++170Nt/5AxM0tyyodOs78e9aPOUhYNuVBmZzoprl1tHkcvz4Q5ME+9/u+KTf53ijP0Bbo0xB9WNyygk8fFbgL9gnb3wHu9HH6un0fEvBpX/CkjWOb4+d+7ufeRxLvuCB5SF6MCRIDPIcwhADbdykP5Rrqap96v1FVuxRmXg3UD5xh/WOyPmEsXcbjP94lUCS/DM/wA0a5J0Gp/lNIwe8cmWmqn3A6ypbh6vf6PvKQ97XuepK4g9zx7YL2aNvSP0f20hC375/tfN/7lvTXVANMcv4mtyBfAgCgj8OkHVDD77sjAblMpEyekADsvUXhhgTAkY9bArAGYHIlH4AzIF4SoBEAw+F/kAaCewgAVtUbSB8At/E9CWlQ9/IT5l6eBdivTisBrrunfw4R4N5/ymfelF8SgPLxzqz0cRaA++EB6wnm68r+1LWalrBxN+CnAe897xVv/tCy9/9iC4DgPwF/Bf1jQF/AXyX7/iUAqGuIOpTTaxoubsZjh/kVsIDSL6BnPELJ/8KnPKXFCbQF3YxPEABYI+FIC8EJMVmJgL1JALYFDA4CNZ3jKZJ4iMFDQX+9j9Ppr/hjqFfcA5jGT+MZP6c4Ne259YXMvz47y+u1lHn9EL/PzjyNm8rPNHnfVPp6bXVf1UG39cJ6z5WH0dtZeUf3oM+iQ6A70F9dsadv08cB8b/vP/l99z/rsz7r/hOf+MS9HdZ5uN69n/GZn9ny5RmMCZV8gGzDAoExl0XAK6+o5YE3ugays2ZBa/xUOK/hP9zR6bk/ZR0IZoYBxeRzCDi+C/f47inxn8Qd840v30u7yzaTYf0p8eef7c84w0ri01/D9Zr5LPIW1QATHAdwAdQhANwOQJiftgP8QwQgIQCYKHGw5qz2M4HjUFR/46OPNsm9gHuUXxl2lG2JgB4BAJBuq/szrQFYfZcE0Jw/DwisBIBhiYAG4jkHIE7432UNgOUBJAZ5tZ8/ZBvBcD9lB6xBAFBXx/4c4Bg5IAkQq3BX3tIgjlj9B+BSTlfAH1TJN4H04bv3QL9m/BXg7wpDAOC4fyEAtps5bRBrABR3VvRwAAbGJAgAwITA2V8T+Pc+88n3cVjrsIoIAaBjbMIaQIuAvYiAgQCAYEgCoOd3K4AEheXbV0JoNB1tu0rOHVK3XD0HfeiybrBdhjlptu84VajpJWw3WJMV5NvTVXwnrqX/pOVYZ9Z7/pzn7HNfe4eqgze9tf/+c55/sjSUC3P7L7r3SW1lHh2CRYL/41//H5/4337row38A8YB+4DzHmg/Jo48Bf2Zf5IExEM4MJZALDKuaCnwnOd+7UcgH9miMFTKPt/lZHW4ZHR4DezzwXppMy79lMiwspbS+JRjfvPj+ukcg/GZXJuMhrx7sg5G5wrzbr28je9J4k7u+Gbke8pvR4u4yE//HEma/Ms214vPuMX/gNUAkxugHQIApZnVKwgAgE0SAJrSMYFrTpfWAO9733sbEcC9rLiRJ+kgApqFwACekwDAX1f50xqgnfg/AOyahjAWA5AA7LltSvugjPM8HEBf0F+lJADxPL8RCDO2BbglgGdzL9J7P/vHfqet9PHebgEQsCegT3/vunFV5n34r2ElsPUIzf9pEw8q6Pe9+Q5s+YAcYzuEYF+ZIJ+4DO/ySwAA/rl3sQC4NCDfA1AAGhyTICQB1BIAgGXAOONQ+8nONQEAYOfnRyUAqjUARABxs4iAYcyB8OyB/hrH+EeZjiUBWJm8VBvnjejpoqd64rF5q9dQHvN6iJ82nPx5w7X+pyXpRhdc5XHsu7UyuSV1nVmWs5e/15W9NFNxTffkffjZWFxbub7QR6fuPds1ytDO8PjsT7kP+Je0A1gzft4f/ugPh67yzyUFBP88B5CvZYGgn3AlBsibeAhDyquFAmTAepvA2eptyfhqa2Cs043FW7redeOUpk3ptX1kpsV/WudAsR4YW/76H3RJXVMHp67zy/kNj2jfdUzWNkC63l+m47ph09aw8cpd1023yDtUA0xqWANAArBiJfCXBMCUVWZcSwCJAH+OC2sAFHCsATBXJx9M5FHC3Rbw+7/hr38c01mAeo8AAFgTDxGAG0vTADhm/0NeKPg8RwIA5b0C/xqWCMAyoW0/WP8U4C5LAM4dgJggP+4lDDngOQCA90oCVEC/K5yAv6blGnXbSNcrbn+c/s9KN0SPQPhBlKxa8Q2oB/pHrv7vAvdzrksAkBYCgPADvwWg09ZZkcOcGCJACwBX1fkJPkA4q/5JADAWMc4xRiQJIBGgNcAWETCMMV1CYIjHcqqC/anwKX4a8I60hW29alvH6nztblTqKvh1Jq5h4jfPxZqKw1XbWHrxfO89SmKBsP5pvvF8hmdCFAwJ8j3G049fae8E4P7HH/zgrzD/tnx5p9V7jd954is8l/aJqf+XC/wHCYgG7P/Se3+qmf0D/vljxX0ukB9LB3jXTaWRAOCcAFyeH4CfcYR4CQLz4j50H0gAiYA70gdP/PXvdnZTnXTsmvFV9mqKNDVdjetdJy/TXZ90sEkZg20biPLaOf0+tz7jeuspv5P+Knvf17hMm36vK7k252/f9HPyXNLc8hpoJ/AOq1UAfrcAAHIAuKxioWjjWNlPIoA4twW40gVQAiShEAPOvZ9VOBRnQPyUY18/JAByzBoAggDT/Ab6BxIAIgBSoAL+sbBEAOXgJwYhAAD0PSIAsN9W/ZFDmciT+9gewCpw7yDAHpg/Jk5CgFWeK21qw1jKijTvyXd9EIG/7ywBgPn/y3/gFzer/3PA/dw0kgDU+UIATLb0Zg0AsIeAZOyBBJgiACAOACpsJfjk4UBSxwDGEPxuC8C6CCKAOMaU5jwI0PAgpwB/7xplo4yHWgPwjrd8FXIFwocx5YhV+Ka/cP96nzbhnrvceNZ64cMPv+gvPPLII9/ZIQDm5XM5Z2Na2dYB8/LahRzKsT7wL9NfXN/2TaVp9cl7QDxg/UC9PMR7rupkO6czhCTjWOnXQQDgIP9zrz/jJ3/0AUB2rr4LuufKfe8lPYC+RwCMEQI+A4JAi0YIDXSlM1TlkuUtr4GpjuqrmaZKrhtn2ozzGjL9Y2mMz7TVb16L7E8gu+qlV8fG7SNJy5/fZxVa/a9xNTyWNtOlP9Pv8h963658l+s3tAZQHvidXZRXzwIA+GkdwOQH2Gflv0cEuC0AawB/Ko6tBSjpTPooACixxH3uS39ukgToWQMA+CUO8mwB4iEa9iEAGogfFHyUfPw8j60FkgCAfoH/BvwPJAF+yAmfz8nfKPaAwmPPARDkj0kJhPXq0ZW0Ip7F/n9IoYUAWFkAaP5PvfRM/+eC/ZoOwG/cQgDMa978dG87TXwYU+iHjC2MXz0LgOw3gCZW8yAD6io/J/n/n/7ye9s2I/ztegB/SYG52wCSDDhmSwDEwZ/+ymf8/FAzN2VuthzKXR9tswoPCGfVOoDw3DzaMzr7/Xfdz/XN8/F3CADyXqXDd+Hflbdp200n+pflGMt/QwDwLrqrIgAAwoJ+peAfs38WB1hBB2BjUo+FHAQAcWMH9e1LAADS003db7opEgCwn4QApAF5cq/WAOhBjDsn+s5LNnesBnqDRS+u99qmU/bSGJdp9KdMP/cQ7sV5TZlpqt88brOc856mOYXMPPDXP+uYeP1K09ZwpjXNIpcaOEkNoCizhw8yIB0mtDLhEAFM8GkNwDW3BUACoLAC+CEDAMcAW4Ay11i1AzztIgJYccdUv1kErH8pAPCdDvCOpQAreAJ65ZgFQMaTtrlhVb/92sBgEQAZ8Ixf+Rcb9zm/8fH7OOP4GcJ2KOBQJkgAzeN3gXdAvEA+ZfprHvUa5qsn+dAzMgEkYerON1wIgI+2eoAA0PxfwH5KKRGAXB9ANeNLPbhJAD7tlwIG4A/YBmRDOnoAIH6uDzXUm0cf4v5KBrA1ACsAiABcjwjYdxtAEgGQFYdaAlzhCmStr6lwvdZrkCsAPqxQc57Je9/znvcdSADwrHS9Z2XcKi0r48VBevP9N/mV6y39SLvJBxT/vLooN3WC97By2Crf5UTb73ZRL5dTnjAGAFxB/3/1n37qY9/2xf/RfWQD0YOZP6b+uCQAANlTQJ1rcwkCgLl5pd+4niQd5v4J9Mf8lFUSAKnOw68Z0A+bxcUJ63XJ6ubXwJzOPectMp/0573Gj0nSei3vq/5Mg9/wHDknDc+bky7THOOf+7yxdPls02Rc+r2O9M/rhqdkptVf5dj9phu7vsQvNXCVNXAPRRomHBacfXFT1gBcAyxx6i8gFgdQ9ufzIAEkAlzZH5NuC5AI8GR+gbyEgOFDpEQA93JmARYNWjXwc29f/o5HN2ck8F7EQWIAFF79zvc38/gE6+mvoN5wL00vrqaPw67O+v05ABArEPaXLgTAigB42Vsf3RAAfP9Tgn/zes43/3jbAnDLTb7P2jZr5pAlrJBLAvhTgJCYaxBVb7kUpr5Jr9k/RABbAiQC2i+bsB1gbRGQoH5f/yFbAiAN/tzzn/e/zH2fSy84P6LqHhne+FmJD8uKTfzIYzYr1gBr3kE3pN9170iWO+/bPNNntboD6A/PvEQADJG0AUjWNTnBcynboeXj/n3/2rMoJ1sVSjmm8rqSMlI/uc8f0P/DX/177v+t539Ok4QB1FgB4CAAkMxh/LEC3wPmU3G7CAHBP1L/VH5cI92UNYCkQJIApmfho5EBQ1/EAgkCcb0lZer7LNeWGjhrDTgAVMlDjTukAPXeDOvfR2baff35LnnvVLzvbPpM67U5sne/cWNyTr5LmqUGbk0NoACkNQAgWWZciwAYfxRcD8YD1Aps2V6AsiwR0KwJhrMGxsC/pv+suEMAaBHAqj/AfxfY38cagLww+cW8F3NiVhNxlBWXfuOQX/TS7/4YZyZAdvDOFbD77vvIqbSsyDdF9sythgMAeS/A/4NOAPBdsWCB+DmnBYAkAL8CEODqzF/6bmRPn4C0gghghW5df87Ns1+SfFDq8+DAJAK0CMC6YF/gn+kZO9getY+DBOCwtdkvc0RCAHL7ab0VYL6UUyEALl0vEXyHZnq/tV99DcZL2l3BOd+0gX/eobqHLj+zlY3y0WawUChnDFCeOc/cVe6511vZKQtlX990lc/vlrOC/7/6FZ91/2de8eQtBxmAFYAEgCQA7ZY/gPUucH7IdYF/lVN5kXaONYBWC8j//m0/tDkY0AMCPSSQcYdFksVyq9t8lsgZNXBIJ9/nnkyrf5e02KYbCxt/TlnLMOdZ9Z4M6x+T5O+1Oc86NM1VPOPQsi33LTVQa6AdwuXP5XDgD0DeswGY9AXECWQByKyeowQDslGgcdwH8BkjATK+md6vDwqEEJAIyBX8HikwlwggHYeEQQDgEuj3/KbhrARWywGKWj30iICsD68fIjnNun6UU4f/5HNf9VG+10IA/Fb7CavXveufbBEA57IAoC9ANoXyf+pPu+Q3swZQ5j0roG4N4KcFE9Af4t+XBABIMdZeBcig/YWZvjWmrqIkPv2m68kGbMlzTWBy39x7e/lNxTWygXeAxOAAVSTheLb3W45GAKz7XSsr9wDETXhF0vL4uHPVkfnvlNQZv76B6T8WAD3wDxkAAdDOAlhbAEgE8EsA/KEzALwF6hWg71rtr+kzbJ5VZpqeH/N+wL2r/j3JfbwLBxtiAZkOAsBfPDL+m/6bb/xFSMi0DGDrxHJ+wM6mtiTYUQNXPRjU59VwFjev9fzGHSp9lvcTnuOv6cznKmSW7yqetzxjqYErqQFWBFCOPSCHSRDTfyZ5zf8BtziAMVsAXFnn5H5/xg8S4IXf9sL/nRU3wD77+hP0pz8tAuoZAVgEzAH6U2m4hhUAirngvgf8e3EAAO7xEMQpsJ/XxvwSA3ndOOrz0//YV331OT80FgCsei8EwG/df/eHPvrYd731w1sEgKv155CQL8O3XeaOczbwPfJmrHN7gEQABIBWQoeAf++RBADcz7EGuAIrgF67m4rrXevVLukybfp76Y+JawQA4B2Tfn7NAxJglADAKqC6oazcvyYEKMs5y9t7V5+n7KW5kjjArPv+WeGvK/+E3/M9T2lbASAANP2vBAAAuZnSD1sDWH0XrPeAeY2bSw6Yp7Lm0wuTVhP/HgEASVAJAC0AsIDEof/wfuhDSQh8/rOf/ChWOy6QfOnX/Jf/dDlD4Eqa7fKQK6iBax+cruAdl0csNbDUwEgNcGigK/lMfKxQARwBqUkAYP4PQGb1vxIAKMFD9vc0vd1FBEgK5C8GYBFAvETAFNDHSsDrSi0HCKOc8xN/Fehj7l/jCPNeOAEB73/KLQECf8kA6haigTob+SxHR0MAQNo86Ob/gAe+5yM/+sFGALzotY+e9BcAegTCmgA4+hsuGZy2BlgJxcwXKyHOAmCc8BcI6PuC+n0l93p46i4SAAKA81OuwArg0LHF+5DVHftBzJt80l/z3RAAWEvxqwOY9vcIAL5pW6lNAuCi3DXfBzIMgJUAYJ9/jwAwrhEA63MAWAyADEAvwAKANg7wB0wTD+jeB6j3wPtYnPki9Y+lNX5sS4CkBefhuMqPlATgXQD4hCEDeD+uP/qzb2qO92eLpGkkCtCdrqAfP5BtdnnppQZOXQNTE86pn7Xkt9TArakBrQE4fAsGHCVVU3hB68PDXn9AMj/bVwkAFOC1aWZ7Z4mABuYHUC/gT6k1ANsAkgjAMmAfIkDgLykAAfB7v+blnxDUC/CVADb8kgGkI+x1SQC2QQDU/RUE6sG6mCN3pUGheuZXPfNs+4HZT+0vADzIJADf4fXv+vX7WgBAAPAzgAJ3Du3TX2Wmq9emwpAvt6bzP4AFZaxiFQ/ik/5O34cwdCzYlwAg/b4kANZXN7jqBf4UMf1HF5ktBLEqP5bfZgsAq/jcA8hv9wH0t8mDZu6PBcCGCLic65juNxZvDruum+4my3ua/0MCYAHgwX8e/if4R9aDAAHDgGKIVAB0W2EfALMkAOb3cwG6QH2ONYB5VmkeY5LV/moFAAFAOdkCAMivJABh0gjwScN5ARAAgH/8OHQj6kLiQCIAgoV2epMbwVK2pQaWGlhqYKmBpQZGawClGHCPQpyr//ghAIivBABhlF8UsJoxe+ZQdCvwB/yn43qSAFgDeEZAAvsE+z0/4B+Hma+AHlmdin7GG6dEqQcUfPgjH5n8lYBdQJ/rNY0WAZAsrc5rxZ0gnAQAytuD6jD/f907VgTAy3/gF+9rATAF4LnmGQHKXenzOnV/gk+4ZHHmGgAwMj4J4BkPJAIY0/YlAriHn0/dtR2A66S7oauHgN7NCvx6XG9xR36OBqaLWf5Ylg3UQ9RUR9lGbmplLtfH0mYWmWaOP++9Pv8w30Lc04aYZyHddYSJlzRp+/oH034kBMC3f8fTGwj+gde8qIFZwpIAkAMAaAA+DisAJOCfOYTVckmA5l+HAd5joPyY+EoAGJ7Kk7K0Vf/hPSgr4J84wbwkQEqAPRYErPQT76o/75hkAPXhdSwiuAYRQDwWATPIretrM8uTlxpYamCpgaUGlhoYqwEUNJRiTP45C4BVZJwEgKv/SFbQIAB2mTynRQBWAQn+CesqEeCvBhC/iwgQ/JsOZVwwXyWKPnFaAQDeemQAeRCPCTmWALktooL6HtDfFTcYAbQ67pEnY99nbjx1rgXAgwr++V4/8L5fvy8BwM8A8ksAh6zsSwR4r+EE/vrPRerM/fZLuv1qQKIyiQDGB9y+RMA+JAD7i4eSJujcr+DnSd3Kw68EvPc973lfAJpDyjl1z9Q13ozrm9X9TXi/+hp/xgCg14ckPgTJ0KwHeOrqr93Hux/5/uZ3tKR8tFPGFlacBdyCdYBqXY0HLLP6T1rAP6AYsApoBeDqiHvdy/7Ax7EI4IBA8gQIE48TBDOPsErOcxr4XwNs/eQ/B6AneD+XNQDlANBTVsrFM3knDjT0/X0/JHXBu3EPYJ57qDfAPpYA3IMjDx3ECPd6Db9nBBz9wU+QwXjjP0HmSxZLDSw1sFUD7bdpYV5xTCrnUOy3nng3A6uJf/Vu6b+bb3tD3wpFA9CPgwxwZUwLACSOMwHmrni61QCQnkQA/lzRhyDQIgASYIoIEPhXycn+lFlgL+BHEifoN0xc9RNGocdRD6zcowQl+E+/K/sp8et6aSEBWDk4dTNgDIIAoLwP6hYA6h3zf9xrf/Kj7RwAtwA879t+ctT0XyCPnAL6mS791P2pv+eS3/lrQPKzEgGMDftYAzBezDkTgDQ3kCxqcy7AtwHkASgPNb/PPEza/DOszGvX6W/6GgVAVwugT1QrK78iABFCxLX+Dd8AIJ/AGT8AFbN0HKD1C5/ylMlVeNK7Tx6gzz2AVkAuVgA6gLCgGGAs0GUuAewCjpsVAARAsQhwtb2W1fAcwG/alBILKfVnuvRznXfGEc+7U34BPe/Gu/Ou1gPv7n3ECe6VpPe5vgv1gQWB5AJpvvhLv+TthVS6tiZkx6vy2gq0PHipgTtSA/dgZWFkGaAZ/NIRxzUPC2mkwB158TO9BmPUGOvv+HWmRy/Z1hqgvbKfWWAMCEa5FfxjAXDIiefkW60CKgkAIQAR0LYD/O1/ef/xumF7APEV8Ndw7+cAv+6b3thO+u+BfeJwADnf1zgkAACJSfkcEkCwL/hXEq8jjj/MgYsCWj/F3mHq+P3v/4XfpqwPqnP1PwkALQAqsH/G1//oLEJAoF/vNx55UxS/vRvNckOrAYlKQT/93jHBuF2ScXLXdgC2AjznuV/7keGhN21uW83Dq/agf58y3lv3gX3usfUdco/3HiLzefpTpv+Q/I++Bx0yga1+gKfgH5CO7um1ngQAA4YB76701z3tgFdX/90DzzOIg0jenAPg6n+HBCB/ntUrw1ScgHosjcBbSbr09+7jumnIX6DOu/l+SQIA+kmT1hH4JQDwSyjk88ib9+Y6RACSvo2ec3QD2DOD2mAN97KZutZLv8QtNfDA10DbezWs2gHwGYQT9OMnbsxxD4QAA8MDqCgy3uiyHa3iBqYb4AIY0hEOS4plvMpauyI/bZXVdBzWAAJiyIFj2zD3k387FGsA/WkJAKgn/IRvfX8jAJ74zo/dxzUyYCACIA0q8PceZCru+jH7V5knDsA2ds10SBxKPc6fSXRLQAL6BP7pTwIAv9eQkACMC6f+nP6EFgTAg2YFwLdx9f917/onzQLAgwC/5ZF3H7SyL+h3G0CCfv2HEGKn/u5LfqepAYkADkeVAHQc2EUAcJ2xYo4lwHWAhBk15Dy9/5w7zOOsnre5e/WgXXl4Xcld6Z9R3JMnue7ntxdCV0ygmX4AZxIAu0A3wBW9lHQQAJwHwP0JgCUAyBtSgTCAGGsBzwGADEDPJc2W61gDCL6z3Mf6zTPBvXG78ubdtQKQBCCcdQB4x2kZgCQsCbCLaKFOyZv03Lu28DtLezLTlNVPeMzRyEzfGtzyb6mBpQYu1wCTGRM1bOy+oH+MDCBeCwEsCU69Cnj5La4tpq3q834APuRaObgYlwalwesoXjhMMkkfJMAyVl3TJ+Tb8FvMgP6ztdWhDZA3v9nNQX6AfwE+YF8i4FP+4cfu4xoZ0LEI8L7cBpBgXsCfMv2mlRzgWl5HuYcIqT8VmMBefwL96jcMAcBq4anNgR955JHvfFBX/z38TxKALQBJAFQQP2UBMHe7AO1l+QWAaxqgzvhY5v3f/aQ/+yGIAEC94wP+XUQA48bUTwNiBcC+4aH4d2luO+Rdmi6AyT1zzfpzHpLPGVvC1WZNu5sCtAB0wCYO/xwQDHiFCOC0fwgAQb5gVyDsPnfiMYuHAGBlm/kEMJwEAFsPNkRAIQGI30VM9N5xyhrA9xyTvfyMI18BugSAYJ13xxHmFwOsE6UkAO9kfj3JM9DtSU+dkSd6frTrszQkO0vrSMMT5kgKkvedpWBLpre0BgaFHBD28MMv+gtvfctb3pGO32d93ive/CHcH/yK17yefcD8Vutm//stfeVS7Hu8D52XAe+UwH+MFEgLAUDwUB77ZynarQm203nbasof+6qv/vRn/PkXf/ogqVfiAPg6wsRzvaYJwuDWvPhS0KNq4J6Kt4De1f1KBEAG/Id/7X++tDXgk//0dzVlXYVdIC+wT2sA40iT8d5b5RgJAKgX2OtXSgog08/1gQNoeziPqrFyM3t4H0QCgNV/Dv7DVQKAXwI41AKANqIVgJK4dHPPwyifagne9BpAFxrORekRAceSADf0LIBDv8jh+spQx+iQ6APrhx+Sl78GcGj5b8x9AEYIceZB2h4ryeiHAl9X9AGku1alBaoSAIB/f/IPgCvwF+xKKpBeogFAy3wCqCV+A/rTEiAJAOIJD+4QEsAyV+n775L1Ps30Id2+53u/pwF03gnAzzuxYo+1A4QHYesiJenn1jXl417y4j6IvmjbR7czO0dK/Cs3dKaHppzptiWFMr+jC7hkcONroO3VwlxLkI/ZKKe//uMPfvBX/vk/+2f/owqk5q6srKBUqWApVbSQnLaMInRuxutctUu5HWyvAvSPkQHEM+BDQDAJnHLwOFfdXcp3GIPa4UoD8H/8d7/lJx//pp97L+6TH37t6xsZsCYEBP1NEleIgtaWGM+W8elSFd/1CNq9yne1CAD4f+p7/tXHn/Brn2hWARwY+O89793NeuBxf3hlsl/Bu6v5U/Feq6SB9yJR/DkXgbHR8bGC/wr0DWc64vh73/veq7ngqT7pvRzDHcvvuqQ+E/w7X2EB4E8BVgsAQPyUFUCC/DE/pAAE5qk+3pLPDawB5rM1EUD/r+PBGBlAOiwBAB/VIoC4pz//G37zVs7vp/lEG9yCrhB64yFY5JjzB07zNmfOhfqBGEhSAD2xAt5eGCCugwDg1wEAvBAAgH5APXGSC4B/rAG4BphlKxmO+EoCbCwBkgRYEwCQAKQXtPfKtm+cee2S5Cv4p+z88b6t/EO5fDcIAIC674usxAh1sC+ZgfWEVgaQAOuFvZO1kk3nGXK8OEBrGKhYNeu5h1Ck022TAHY65ckKumR07TVwj1UhTEMB+SiHu/aGokyNgf4e+K9EANYBp27w56hF+gkg29V+BgfdFEC/6mtJCDBZDnVxk/tpY+MB9YD/T33Xb/w2YA35+P/ulz+8cYUQgBzYEARra4GmHDFm3ez3HYq3/J2zBgBYbBGQCMA6gEMBn/Dy/0c7G0AigHMCIALYBpBgPv0o5YA5pIo8q/8cFtizAjBNyiQB+KnAMYBfAX8NSwKgLJyy/h7EbQB5+J9EALL+EoAkQAL/9I8B/bH4Zf//KVvuDc9rmItYJOAgVMYAxhXc1LYArlfwn+H1XuEb/uJnK17DMeg0a2u/sz3ojmbciA91WEFxBdUAe/RarqcFAMCXMM7zASAD3AoASMbvOQAAYfLZxwrAXwwYK1sta4YB8BnWb167JISF4B+gL9lhmdp7rMkA3lNSpBIAxPssy7BL5pYAiACeDYFzbDtU8W8dJwG9oB+maMyZJu8bCrTK60JSRp9jeWvY+EXe0BrgW7PCz6r+nNUflFNAv4qUQD+VKeME/F4zXKVbBQCDa6b7JrSjzSn+gv2UVw3uD3mehADKA+Dohk2ebVJiNZ9Vf8C/+7cBap/2Ox9/DPfJ//x/WhECWAiEkwTgvRrZsRAAN3SEufpiMa8lEQAh0M4JCCLgiW/6N/d//zf89Y8L8FHO9ScRgL8Cfq/Xa5UwIL8eCSARsI9kZYKf7mNl51Q1Sr+ZM+bflTTUd28uIk4CgF8CYBvAGJA/JJ7Vf9rjqb7bks/tqAHGIYmAPB9gzBKA8SRBv/47ehbAvh8xdcL075vPA58ePZB2CeBPgAp4BfQC4AH9rnoTFvz/red/TvOjj0oAIAGumLMzV3BfEgCb1X+3AwzPEFRvQLZxQ5parizjvn4BeU8CvgH/lJk/9vbzLsRRLmUrY5SPMO9rPUEEsD2AOtm3fKanfNQ5dUgZDlkYtVOk3Kz6C+oF/QCtMWca72nAAQX7QsnmGTo6lM984DvXbakAvj3Af44ZKCasY6C/p1BVgL9PmFOZ3SbQ2t0VVyj1gpINeKZDHwr6MQU6BLQfeo/P04Srlw/vghUD77ceYK6r37ZxiTI0AmBY8a/g/1M+cf++bkMCrLcItK0CAxnQSICBNCKfdVu5rve54la6PG5mDWzOCtAqwAMDkZwD8AN/853t1wv4FQMAexIBlRBIgK9fMqCmJew1lf8Pf+Qj7XBAgX+u9I/5TYvkb30o2MzX35ns3lzi9y6QAD/zvl/eEAB13qoHAbqPP1f9078PEUBerL7t/BpLgjtZA22e+7885aewCHAsYHzoEQGMGb2tAJwFcIqVwTtZwctLHVQD6EwSAV9075Pu4wC93/4dT28H+wHSMfn3TIAf/urfc/893/OU+0jiAcGSAPgBsMwT7ecAB5CcJAB5bREBAupBNqANOWDc4N/XlF4gPSYrAUA6nuvKv+Cf9yA+3YYAoHw6yjs4rPJ4b+TYs/eJh1SABOBnAtc6+kHfVnDeFG0+NA5gL+iH/cfxkHTGmy7JgEYAjBMBPjMLvCjkWRvX7R++HXv6ObBvl3k/HRmlE6UJAI/CpNsH0B+T9iWv/+kr2TdJ39A8SuB8KPDnfkG40jwPleRzzL1j92sh0PaLXZ2FQBsn2uQzPBMQj7k/BAAr/81MO8A/JMCWJYDbA9wasBAA1z2q3IrnM8e1Vdj1zwlCCDzhP//mBv756T4cZAD79lHOJQIE8coE9vrTQoA4yQGvI1H2kYypjq34cQn+p8L8ssCprQD49Ya7AO53vQN1XEF/nZsgAabOAZgD+nskAQQAetWt6ChLIc9WA1ir8ZOm+YsBjDOVCHj5a7/3EgkAKfDFX/olbz9b4R68jBdssv7m6L4SAEqBP+Afs39A/8+84smNAMAKwF8JSAIA8AquwGEOXwmAGt5YARTwLxFAeoH7PiB6LG3mBdBnzuCP83UA8IB+JOXi/XSbcgr+Q1JGCABID6wAxp49Nx6rBMrGdoA/9/zn/S/7zhs26qZkC9gT/FfQz6BUnYRAkgFJBJCfeQ9taPWsvnRYsVyGF3mFNcDPp/zAG97wxn1W+88N+tlCoAKWfuOUKGXnYr5p56yIC67pzDrjdskeuCYOMybkLpf517R5Lf2ky/A+/nxG7z5IAbcMtD5++nbaSEnGE8YdCAD2/feAvxYASKwAcJszAhYC4PRf5gHIEWIbIuDf/tIfvv+4z3lhU7752T4cBEASAYB+iYAE8+kHFEoOIJMMMN70rv4B8gHzUwRAjxQgDoUFJeVUnwpCeBd4vgvX3bLmvOb8UiXzjdsAPAdA4P/0Z7++kTvI9PdAP/cQj1v2/5+qtd6NfCoRwPhQiYAffMMPbZEAEAAQA8ybd6MWrvUtEo+k/1oLdY0PvwfgT/CfBECCfywAIAI8I0ACQOk2AEAxunQDzwOg3lr974QF/TUdeeyzJWDsPAABeDX7B/wL/Cv499yDRnYM9UOdVDKA92YLAHMkxAc6tc86VFJGygIJ8If+sz/8yn3bxQUgH1Z8x8B/gn4Ali7jkwjoWQRsEQHDs4aCXjz7wk/57WRK4pa/K6gBzPznKHCa+asg9Vb7BepVViXqlGHKwQnNtMtTVBfteMzEn8GmB4oPjUuwPebfRRQc+uw599Uy1XuoDwgSCYHW34//CO3wP75DHgDIKn8C/urXCqAdFshBgRIAwxkCjFPrsi3jy/Hf54HIgfZCu8YsF6COYxvAvkQAyrsAPyV+QGDG8QxJgN52gB7oT4uAJA4Yw07xoagHD2+aM0/cxjSu/vfmtN5cxTY0SIBKAPA9Bf9KyYEqvY5c9v+foqXevTyYt7AIYAxinMBJBCAx+/ccACRhxqy7VxNX/kYrnLKNWa68EDfpgbSrtgVgDXRd/QYEs+IP8E+HVQBgWOCPdBsAQBiTekB9kgCkrwC/hjcAu6RFVz0UUOd9AGvmO/4g1Qjr8p3zvSE8PPwQEkAigPfF0oF3h/jgD+Ijn3eoX0uAZ37VM39iTjtR8b2QNO7BMcHDGqJwC+gF+YD+9tNagxltlVwzHZJ7pywCmgK+fibPHQq96mR98G8557zbkuaQGhi+Aav+uxQ2lEr3Ro4pSBXwj4V7ylSN89458Shi7s1kO8C6Xe1dG7TNNPFnUEpXge8pwxVkG94F/Ek3txz7pN2Vp+VLmfdoIUB9rs2T9unLbUzge3DvPgQAhAAkwOaXAiQAli0Ae/eH5YaLGmBuBKAB/l2xHyMCVNBV1pXcN7bybxplkgAJ6AX6PRKgxqFo8NNgF29xnO+ubwNgzmFuq3POrjDbAZIEcEVfmSBfckDJNX5lAsdYedwXWu6+yzXAGAShBxlAv3ZLAGMFwB+ggsMqYCEATtMS+MWrb/zGb3z+kNs++stpHn4DcwEfCm6RCYY1/U8CAFKAdIBgSQD8mMG7DYB4CYAE+vqVDfQXwG9cSvTQNOPfB1wDqAHrEBM4gLor/8h8X1f+PfPA96YeiON6vrvvLdaC+NinbGNpKfMh236akg1YSvCPwg2IF9RXwL/53e31b2znde+RCJAMoNHgGMB0PBPXwNpQhiYXMuBKuzzfmp/ys0H2JAqnilFVjgTpPdmLQ5Eai89rqXCZPuPST5kE/4/86Afv477wi//Md+5Tka29D8wmgxCDx7lA/1wAnqC6+hNk9/xzn9G799i4WtYsi4QAhCFjwIzvc490fJujCADOAhgOAiQP8mpjzjKZz6j+JUmvBlDAf/eT/uyHAOoo3rh9iQDv7ZEB5LeLBKhAfyx86rMA2CKm0tabK25zHPMc80iS23W+y3kn/cxRzDtjJABgHzIgZZICEgDrsanX7Ja4pQa2a2DQmZlLISUZjwD9b/6xN7dDwYjfTryEDq0B+iTYZbh/IQDWlQgBJQmQgLhHABBHGsCzBAAAW5DNnMGvAQDy1bsTzOuXBFBmWuOU6vH7kACAaJyr9IB/TPYpN45y8B6C/ip77w4hkBYQWhBgss8f780C3z7lHCMB0K/3aaMr8E+jHgYSGjnKNg09CYAE91vAH/BfXVgH9IgAyQDy5zm4UTJgmgg4tC8v90UNwGyizI0pbZieouSkQoSio1MBEqAbr+R69RvnvUrzMNyTY2ly9R8ljNUYDuhaE0rxxtte2l6a+At+HVgM33aZIDzfZSw+05zCn6RA5ichwKoXY8H211mNSxsCYBhrAPGY9e/aArBYAJSaXIJnqQHmM5RvTHC1CkAy9uQZAcQJ6KsU7AMMvWZcSp7B9d52AC0CepI4/lA8TlQJ91BepuaNsfnkpsczvwj4lb15aCzOMwH8VQC+qU7wbxhJXJIAi/n/iVroA5gN+jugH32GOfMBrIJzvXKCfjHTuZ51a/KlrQGIkwQAEPe2AACMGwgeVrsB1wB/DgHEAsBzAJhPmFe4JthWD1dKBCiNRxqX0utzzgUA+AOsBf+UizIm+Of9eI8K/A333h0CQAKE1X/mYfIkb+dDwujIx5IA5AG23tWILjfoQgCg2AjgNwTAGuz/wa94zet7bosMCCKAhmJeaRVQyYCFCNj12U57nZWcsYP+UBpTGULhIaxTATKcspfW617rSfNUco/+KYmilqv/nsz8otc+On0g4NDm20AzDEqwhgDTBMTpT9Ba/XPT1fsetDD1NFZXmEHxLS6ZLA7faEMADGPKKQiANkAO+Q69KcfB03auJbcHqgYgr2i7mOMC2nVaBXBYIOcFVCJAgF+BP+DQOCVpJQEYnz0YkJX/sdV/4yEAOMAIcHCKD/OtL3jBq9kbeZcsAajTQ1f/nZ+43/knLQES9Kc/twfgX8z/T9E6lzyWGlhq4Apq4N7nP/vJjyYBwOp4zxQeEEw84ByAD/CXAEAC/HM+AXxjdv+qV7+qpQc4q6uTh8AeiR5tuAf+vYbuObZyDvjnOmVh+wxWNBABPBMn8Af895wEwOte9gc+7haAKhsBMpRdAgCJhQF/vL944FBrAN4BAmHfOWTFaI0QAID3JAB6wL/GjREB5pNkQBIC1SoARhP3EMo6brEIOFmfZj9TbwWnAv8ecEfZMV6QnrJ3La97v0pTLzz3Wm/lH+CP+5ZH3j25DQCFnU4nKHWgsCMSrzOuSq67P79ey7DPyDj8Y/E13W0OW4e9d4V4YYBFmi4a+eYXACALGVckAHb9CsCUBUCzNFiNJ/GoxbvUwPE1wHzFSbxJBADgKxEwBvwF+0jTKI2DBCAOcP///p3/z8cZsysJIPBPiaJBuYa3PJr4gpRDSVNpcyXjtkoOtWXO0dJN6Ty0jzWABADzD5YAPScJIAGA5PT/pu8c3wyXHJYaWGpgqYGz10C1AhAos+JdHavjEAQAX4A2RIBgGB0QkA/oB4Azt3iWhQdacqgl17/ne79n635/EUAyoOrK6vVez1V2V/0ph4doYvKfK/W+Uw/41zjeuQJ/w56DIKmA9BcBmDchHCg75TyUBIDg2OeXAFbgH4VgUIiZfJjYUZC1AEgCgD3Vgv0//A1/5x3VeU25RQRgPRBWAelPQkCrAMqAozyUq02MKO24CyKABn60MkMmD9LfI4888p1VUUNRFKQLyAXyGR7zm3ZMel9PEqfLMhg3JVlxwWn2n+B/FwGA+TkdLV2CVAcMOqXgVOkgYzil165TUp6x509dG7vn0HjrJe+nXts+rWHVHz9p/Ab4t/ri0N97FgD7EACPZ///cAgg4xFjzUIAbNXwEjhPDdxjtb1HBLA1AIdFAEDeVf0e+DeukgDkC6kAcMVJAkxJLAbYPnDJyubA9+cwQAmA224J8O4PffSxXP0X8Cudg2rY+JSQ0i9766ObnwecSwDse2bNgZ/N2xa9yZpY5FIDp6mBe+AltvF8ybNf8i4c4dNkfXNzQY/WCsCVcMBuEgCEcQDmlnYAvwmE9WsJChgGHAP4BeYSAkp/8YLrrNgnMdCzGEgdVH0T/ZPnkCf5YJnAs71/H/Av0B+T1Af5YaXg+/Ic5lDwGFYAlIsyqRcnWTFmvVDjv+C/+Pwf2qe1rEiAQdGuBIAkAGCdyQkFWnBfwX+GTZPyEhnQIQTmEAGNAOiTAMuENuOrV/CfP+eHElMBfMb1/BlX7xXMZ7zpkek3rfFzJMoYShs/+5cEAMAf88vnfdtPTu6HYeASoDogpOQag4Yd0gHEe1JyX4b1e89cyX1z0pp/yjn3XVUay1WfB/DHEZ91rZ/7ohmfxAKgEQAcALgmACAUhmcs40VU9OI9Tw0wp7o1wBV8wLxnBEAE4OeaRECC/dwKkPH4IQG4FyuAJAFy1T8JAfz8ncoKgPNjUF5uOwkAKcJcMuWYj+aA/5y3IAKcmyQE+LlAnBZqkgO75qojWmcd58bCxiuPeORy61IDD0gNDFgE3AI+woKHflzdXScCeP8Gatc/eQfIxdxf0I/ENN4w1yABEggLiJUSAYRZnQeUA84lBQD8EgMSARIDyLQaIK2WA9yvS3IBPxYJgn8P+qsr/GPhqZV/CQHS8O7k7XsiebYLsrwrujB1A+5AT96XBOCnuOf0vhzom6INuEZhYYUMc/wkANqK/QgB8Ede/v5fwiUJgD8JgOrfRQhIBqRFwGINMOezjqd57rOe+ULN/gX+Au8E6VN+FZxdaep17jNOv3kdIueAfwbe8dp46KEkAASsAtEquV7BLGHvU3KffmXvPu8duzYWb55jsncfaXvxxE1dG7tnKt5y1TRJotS6zTD3b32zYUyi3zMeMAaxBQBAP9sCYDgwMAkAxpOFANiq4SVwBTUgEfCkp754A/RZwe8RAfwqgGTBmAWA8YB5LAkYz+eQAFgBsNp9aiuA20oCQIrsAv7MTwn+079r7mLOMw2EQJICbhWADNg1V52oiW7rfKtMjRuTJ3r0ks1SA3emBu6xz5o++3Xf9MbHKuDP8HO++ccbIYAkPXrMnamFeBFAp1YAyB4JkEQAQLiC6QTF1a+ZP8AYP0CZ1XNAO9sJWP0X0EMMVHIAQiAJAv2QA9wP8MfxXAD6XAKgEh1TRADXqINqBcBznT95BwC/+rJEwFwSgC0N4Jr4NDu9DPwrtyYAUJCTANhsAwgCAEAv4JcAUBpfZSUBMrxFCMRWgVlEgOW/kDtf+gFMcO9tb3/boyg8KICpmCQwd8UC5QRHGAXGNMdK8+pJFaVdsilSsfqvIpUr/wzCgL2p79wjAASwyASm6eeaAFeWjnDeq990p5BTZaJ8Wa5TPG+fPHrv6yCG3FV265d08c22LQCCAPiUf/ix++zzn3L8UgC/GID5P8QBBAJtAjA2PEOFNx63eJcaOG8NQK7z80kSAazk984H0BpgDhFAWiwJ5pAAWAdgBfAFX/YNnAVw9B/v41kAKjG3ZTsA9cVcM0UAeM10u+am3nWBf89azS1rVwAMHO8u9L0LfanG0S5qetuK8YYXudTAg1MDA0YCyCfI7/kF/l4jrGOLQNuGeIdqDbxYCQAAvgA5LQD0c83rWgcgJQYEyg38D6BfqwDBPwSAfgE8ElIA50GDAPx0WgAgc9UfsF3BP+WzPCkte0/yDj0iQAKAfHpWAB58CAmBHiz4V6IjV3P/Xhh9+6Ghne7TvFYTQBAANFCUZSamDQEAMA8SIAG+4L/KTNPzJwmAf4oIoDw4yobTIqC97OqF60S2TFbrVsB35CTqn3nfL29WJCQBAPmAaAB0dSgoEgG7wD/Kj2l6fuNS4t/HqZClMqU5JWV3wJ2zoiIBIHgWxApG50ju6QFl8/K6spd2Thz3zy2Pzx7L99iyZL69Z40B//oOGdaP3Bq4hn7dswCYQwBgJSAB8MkPv/b1EABMVG28uFBwtx63BJYauIoaYDyuRIDWAP5iAOTAHCJAa4AxEqBuCYAA4Bn7nhY8Vi9YlgH+dRIASs0be1KLtN61c8YB/pmrnE/mSuYq0ir1O4cB9vW3NOtV/5yvJKwF/3PmqrG6n4hX9+npRPvG8RjvmXhku+Rzd6Vbri81sFUDzUpqGBc5xAzHXmbcTQLLgHd1zCor6K/XDZOO7QJ37XyAtAIQSAN2K8gnLAkgWAYc9xzXSU8+EAJpGQD47xEAkACQA7ucpEGu+rvyz7MS8Fc/19PV675zEgH4fZdKAFAWVv8hJSAr0LFTj55LAmABwL1rK9et/tUL5GC9GuAHhXvXNoDeYYAJ/J/8/b/+P2ZYf48AyDiUdAmBHhGA0oSDBECRTxKgreptkwC8r++n7NXBAxGHksE+eRQRFBPkGOivJIBh0nOfIH8fyTMzvUoScfp3yaakDQpVT5lK8M8ASxvZ9WElAACdu9xc8C04pvPqH8vb67sk9895vmnq88ifuF3P2ee6z8h7csCaKrP3Ul7TpYzvNmoB8Knv+VcfZ4U/LQBquEcANGViNU7EYxbvUgPXUwO0R88IAOwD+iUCPB+AOEH+lEUA18ZIgDwLQCsAxr9TvfX3f9/r3vYvfvUdjQRACv6VgPkE++mv184J/M0bInwu6Dcd85OAX+mctQv4p2WdwB/JGQCNlDzVh9jOR71npduhDzH27eMugP9FHhdxPC2fsf30VcjrvWtL3ANcA4x9gGDAPmQoVklsaaoO0H0TqgncI4g/lUQvbzrJTXjBI8sA6EwrAPwA3QTHAOAeOHaffMoeIWAcBAKukgJJEKQ/yQItB3rAn7ImsMef5W/PW7+XZEHK3vtKciDNi3wA9VlGgL/WCcSjW6tTSwAg0Zt7K//Gtesz8I+f2wF6NcAPkwNgmo9Jw2RyAky1FQssAIoVAIBdEC/QhwCozms96f0pJQP2JQI2k9vFJLV6L9/2AZQMsigbKCGCZ5UQwf1cyX0QCQnm9aMMCehrXMZnOhWoMdmUL1ZR1oc0UX7fwZUUyu6hf4D/uRPGPgSAoFUp2B6TpMsOnEDZa+ZlONOkn+tjz2FvUO9a5q0/8zzU38vLQYo8a1kNj0nKbp76t7roMB4xDjEGMRYwLrCnv0cAVDKgEgCMYW2yRQFe/pYauEE1QLusFgHs7QfQSwQA8D0foBIBhHWs7nMwYK78p9/DAH/wDT90nz5ximqg/PymsSTAlDWA4L9Kwfm5JVvgnE9OIZm7NvnEir/zlAfUOl/l3HuGVcBtfU49iDFv7dDv0qHrZVi/6TfSvHZLmlTVuyzXKZrbksctqwHaGGMNv4yCfva7n/RnP1SBPmFI0Iw33Obta3xn+umpQH/Nh3MEzjAOXEttgRfRqyUCAMQ6we9cAgAywBV0gb9hiYKMB2ALsgXxPNuyKC2PBIUg39X5JAFIy3Xz+aJ7n7T6FYM1CeBzUnpPvm/mbXzLcwD6kgAQE5IAbE1An1a3RkoC4J86EwA9+pB53QG7scRMApIAEgBk2giAHSRABf813CMBjEsSAP8lIkASYpCUh7KNWgMw4a0mIjqD74f/wfkb6uB5r3jzh1y9z5UKFBSUExSSuQSA6chvCuR7TSnolwiogD/L5bWmVI2A/yx3gn8IANrtnA98DAEgaFX2QLiAljRTgNs8lDWt8WPPqPGmr7KXb40bC5tXvc5gRBzXLYdp95XWV3y7SQsAAL6r/in1s00gDwBkvFi3jUUZjUpevDenBpjLJAJQhD0fABIAQoCwQF9ZLQSI30UCaAVwqsMAqcHcCrCLCAD899w5wb8HIG7A+o6T/2s6yeexeK8L/HPVv4J/5lxWFE/c8hzXUm5W/QX2jIHqdgCr6ryO9B7khghAr0p3oVvx3J7jNbNMGca//N2tGrhH2wHUYsIP2K+r+wL7lPh1jm3KfX7b/AxVeW/shP8K5o8Jn2E8OENV7M6SsaJuBxBsC34BxBXMC+qrNF2C/YxLokC/aSUFBOACdcuBJA3pkTVdAn/AP453WxM2bWxFr2QezbzTn88ifx1pqhVAnlvAmQfo1hX8SwS44l8l5MC+hFIOzlsTBpNDWgGQsVYArMhpsi9wF8gD+p/9U7/5iXR/4q3/w2OVDCDsPVWaJyTAGBHQKn+ECNhMUheTEq3Xd93dku9ACgYVV+1RTBKIC86RAPCpswAE/imrJUDmrV+ZwD/9XEehUlKOqmARVrlKpUriwkEX8L/PIHpKAqCCXcFwStNUEJ1h0yCNNy7zmvKb3vuPkWN5nRL4+wzlVrcbFE2UCfo5405aACQBwOr/Bviv/VgJJAEAWdgU2QdsDNiqzyVwK2pAIuCz/+hzPi4RAAkw53wAlWbM3AHUgP20ANDPWQBYAZyyQr71BS94tav/lQQgvgf6e3GnJgKwiDjE7N+5yPmnhhPsMzc5P42t+jtnnWnfv5/yAoSvgTrjnsBewE8bG3OmQXofefTcRs9aP2srfKF7XZRpVUr1MKVlX+Ttq4F7zK2cKeLqfgL+HqgnznFqjvzTX/mMn7+uauG91DGnJFu3vK5fSbx+pWlT3qEtAffa1jbM3IfVch2AGkAMCAZwV7Bfw2NAX4BfAX8vfiyNaZWSBZQPcG6ZXfUHL6CHjrVDxkreWQuAHgngeyN5zpgVAJYAkAHo2TqBv4QA+nIF/4QhAA493+dikB4GcycNXixJgLQCGCMBBPpJAOiHCNiHDOAEb60BAABj2wJmWgP4jnzHOz358N3YY8jqA4oJ4DpB/5ifdLnCnqC/+isJILhPmX6Avk6w38B/Av/07wH+YWlps2MdtMZLAACQ6UxKgahyLH7u9R5Y93lT4Nz8lb18enGmn8p717WxPM4J/H1mfKdtC4CyBUACAODfcwsBEDW5eG9lDTTCfdgfCxGA0ozymNsCeqv/qVD/ow984BOsfHsGgOAf6a8G7LtasKsie5YAPTJAoqBHABB3KhKA9wT8A9YF8PvIBP/6BfsCfmUC/7rqz9wJAYBF3j7z1K76Xl9Xl1G/2VrIAcSjD6Quh760y0kQeC9SQiBljxho75ikwDQZYPlnvu6S7DprgG/LuOEKv2b7PbCf49GhfvKlLV7HOwPKE6RX/xigp7+/5PU/3fRvxgXGCMePNhYNeq7jBmMF6cn7Lh0QyJYPgGtb6Q4iIEkAAHgF/oL2KgXrxtdwxqffZ5h+TCYwd8UfIoBV/7ljNv1CEkAyAYnT2oDn4+9ZAWD+71YAtgWgq0sCCP4N97YCHEMA2L9Wk8gZSIAv/Nl/8wncvmRA+/1vfgN8cFoEbIiA9baAPa0BnCh95zsnGbjmrP6PEQHEM0BV0F/DpDEPwLx+pGFBf0qUsBpWMcuBEn8OlK6iOBCz8o/bl/WSABB4pqTTEU5ZQXNer/7MK/0VsHut5l3Dpqv317DpkJYdvwOG+XrdsNL7DSu5Hz/XfaZpTy23OuIwBqFooqhuLACGn/UD3GPi3wP+xkkANNJwGCOaAoFCeseJv636WwJ3ogaaBcyaCEDZnksEsGUA8A8IThIAAgAHOTD3zJR9KnLMEkAiQAkJkP5KChxLAvDOzEPOK4fKnI+Yi5yPUOx1KPE65qjqmoI/gH9A9D51eUDaS/qbBIALOYyn6ktTshIEEgLIJAXSn8QAfsmBhxh7020TArymJIDygFdfbjlnDUhI1hX+Q4H93PsaATCAyXO+21je+5j/J+BngUv9N3Vi/D/y4dW4ZDxpX/3O968IwoEEeMbX/+jeZtxj5b/ueNoMurYr6kgtAVx1FxgD2itwT7A+dS3TpX/uPZRBwJ5lhcTYtw7HLAF8T8pHuXgedcEhhZ4FgB8CQAd5gu6d4F9rAHTvagWAfn5ImX1HgfGlSYRB3gmkKSRr4C0Qz+0AmvPnVgCBvyRAyjGLgLpFQCLgEgkwrA4CEJzMmLicpLqT0OXJ5k5NOrx7Xf0fG4wchMYkg5MMZQX/hkmT9/usBPjpF/xvFLLh/uZfy6pwubIi+K/7/vcx/behSwAIbJUCWsLpjO/Jem8vTY0TSCvzej43/abxnpReQ1oeBg3MfF/+l/7S/S98ylM2LvM0rfflNYkDrvmsfM6p/Tzb7zPIbQuAoX/T7x8PAfCu3/jtKQLgc37j4/cbATCklQBg/GoK6EXfj0ct3qUGbn4NNCJsIAKe8J9/czssCyKAbQFYBdTzAbAO0GoAAiBX/yUAANjkse4XJ62ASgL0gL6AX1mtAQ4lAHjfYw/7Yw5iTnIuEvjvA/4BBM6RrPwzL5+0kleZqbtc6G5roA34ruBfHamBOXW4EWnalJUUyDDvp+uRApIBbTVtIQPO0BROnyXfEUCTe/kZV+aC91Ok43nnICrn1NYuCwD6N/ox40LVg1Mn3uWXBHjxG9+zsQQ403gx57VPmoYxKM8FkARgBdyV8QTHCeAP9Vfgn+H0k38P/IMPjqj/e7yv2wB8T4E/z7cMdRsARABWAP4iAD8RiF6sLq6UGKhWAOjpxxAAfvityWRsIsntAEkAYLIPCVC3AiTo7/khAj77x36ne1YAiv/GzbAGcGLiIzKISQQ0ZYfJZwUEfE/f+07IuvrP4CIo3zUQjV1HERKAq9Qoic/8E+xXv2VBJuhPZSuVrnOAfz6yBEAFsQJg4vFPybxW8zlFuHb8LFvmT6c3bBok4P/NP/bmNqB8z/d+z/2//bf+RvvtVNP07uGagwx+0iT4z2d5/6kkz9vqgEM/pd824NMhAAD6rPhXWX8BgHGKMaD1/a0HLIGlBm5fDbT+0LEIqAcFSgJAErDaL/CXDOAcgLe/4+33UfDPUQtJArjaDxGgE/gjAf/KY7YAfPgjH2lzUZtbBgC/rxT41/lIAiBX/J2bAAAo7si68k8YMp5vdo46Lnmu9Jlh3BzT2QDzo+B/vZCy0esKMZBEwJhfvUtZCQHGc3WxHURA6mb4l78rrIG62n8M6OdeHRZM+JVzCQIIiCt8/c2jWFzS2rRK+jt67JjOvCt+zBIgSYDWRzalud0egGmuruvXIsA98oLyU5MCPTJBs39AuuUBvA81fdSYw/jHe+kgOgT+KYkHzKcVAKb/eSAgYQG/urkSfTytAAiflgBYr8SNTSibyWLkUEBIAIC9Zv894F/jTk0EVBJgM/FskwB+cOWt7G1Mrr3V/wTouwamsevkgdIj8E/JYOgzKugnLOBv/hHFTOCPdKVFpYpnnWLl348qASDIBcTqR1ZXQa5pa/yhYYG1MvOxLHZ6pHHKTI+feNJxmigkgEQA8ab13pTmTTmq875zScrh92kD8AQB8H/9xX+zBfyTBOAaVgIQhlgooazSL1qe8YDFu9TAba4B2jSTvb+jjRWAvxhQzwcAGKclAH4IANJz/7nq4ZWPvPJH5qz+J/g/hAA4hbl/zj/pr+A/SQDmp3QSAKz+C/4Zf85Vv5EvesvKTRAAW+AfwD/HFSJgo/ONxFdyQDIAqS7mosweZACveqt1s/hWN9bLVkrHk31BegXzAn3yYduAzjDX6z1jYe5pJP4V11zvEED69hzgrz68K20SAaRlO0CSAHdp4YL+j+4t2G4r4HE+gKvlgn+krgfgD40jT8F/loGynWqcSasHnpHAXz/laM9f/yQgK/5YAAD68XseABKSQAzgNgB05rQCQGffdzv0VJeaNalsJoQdJEAF+oZR2NMZjzWADoUeB6HQTvcefg+8ZxGwmdDWkxOTkROQk4+TTutYw2S5/uC+61R93PhrfHwUEpQUFBcUGQYVB6MxcL9PPPkm+NfPs8iHZ1XHigpxlKWtyqxlK1+YWhKeA/6PNQmTABAsJ6hNQJzXia/pMnxKf48IsCwOAimzzL1yEmeeNa35kH8F/d6z77vVMsy5n3tKB2s/KUT/ZYzJLQCY+EsCAP7TbQiAwVJoIQBKjS7Bu1kDwzym8s6+VUz7IQS0AsA6QAIA4I9FAHHnWv3PSv7+73vd23K1v+dP8/85pv9aNGDqz5yz70p/Tc+849wj4E8p6Fcm6E8/oF/T/zOa/Wf1Jihe6TBDW8gFG8ZPQflGV0M/Cn1NC84qN/rUFFGwzmsr77X+ZZzP7+ljk2SApMZlSR3ku2edLP49a6DNsQMR6P7+fcB5gnbuE/gL+JVPeuqL7+sH0Od9u/ykh7za87WOTg5WyJV/wX+C9n1057G0mR868sveujpHhGcfq+seXQmnzmAYnwDHAN8px+q4WwQOBfq9+wT+ueoPIQEm4Huf6nVprxIdSJ4r8E9JHQDoXfmHAAD8E8blwYD4qzUAOrpWAPhPQQDkwLqaVBhsy8QCoHZycaDPSaW3FUBw35NJAugnnSQAUiKgrfBBAkgETGwLcPKhrHuQAFkHp2oT587nHkqHqxBIwLnhSgyMDUZj8UkiMEiZvwQAylEF/oL+Jln5lwAIK4CqfJEPZTV/B2AP/DvFgJgEgOBU0CpAJj79NZ3hc8opAE7ZAO/s72elH0c43yPL5rt4n+lJw3Oqy3vn+n323PQ1XXSQNu4wIDflZFAoUU45BwQSkLFgjADgWiMK1wQA969N6W5jn44qWbxLDcyrAdo8v5/NWKlyDVgG/L/vfe9tJrhXqFDfwxIggb+AX7Bfw8anhMBgpZ/3cD5h7qhgfp9wnXumQL/zUgL+6k/wf8UrlqN6Gm0BHaiu/lewPzc8ixRIwmAPMoDxHsd4vbHUHPROdM+h5V+846obLOP5vOFgNBV1DQkIMBe8O17sI3ugn18vIV+kfgkA0vfytwz1OmF+dWD0Rc54wXMA0HPRX8f044yv6Wo401Z/05HXJADjCXrvKcy6z1hFB2XNmCQRAKitZACg2TjAutYBkgKsngvwE1Abl5K03Ece5pngHDxwhvH6ns9C8uwsp36tAAT7WgEgkwjACuBNb3jNY5wPwFkB6M7o+0gJAPznmNcvBt49SAAIgCQB3AqQ4F+gP0ey6rfl1lYBWxYBQQRsJqr1BCT7nCSAk02bYPqTzEGN+zpu4sMDmhM8C857knQoQHUAyjCKFuGU6UcpEqjzDPLjenVNKQvwr+JWFTCVLPOs4P+QA/9630ICQMCqFJASNq7KTKP/uiVlhAjwNFHBvWWnfPgZMExDuIL+KcLh3O/IN4lv1cYclED6ayMYB6VyFwHAOCIB4AGACwEQtbp4H7waGOY15gbGTpTZZvK/muuutC6e9axnPeedf//dv8Z2hPxVAoC91gmeT0AagL6OOWgfYL8rLfNOgn39zD+7XAX9hp2zsMBgzLqiyk0QvNLThm/LuIlug1LbIwBoCwJ+9bSeNM2hcqODSQiMkAGUEadudoBVANWddXFF1X97H8NKIXvrBd09QL4rrgHzYt4vgGmrlcPKPav3OMH/2Oq/5eA6/nw24es6B4B6om+nbps68i7/XPCfVgDkyVYALQEgAcAvt7e1jZb8HuSGQBkiIEG68cokBYwjPU6LAYG+0nQJ+NMPCcFYOVrCIy5Awvt8JGBf4J+SsnLdviP4pw9pCeAvBEAC/Pdv+6G2PQAdXvCPbOFhHD2iyFu35oC6mlzCEsBJhkHbSUZFXUsACQAPBYQEkABAWcdfwT/mvMZp2mtYOUoEeFjgQAQAABoIiMmHTtQjArbY5lvKNKPcoYygwKDQ4Fcp6REAxpFOUJ+DWcZVQJ9hBkbyID+endf09xSy6wL/tHAJAIGx4JYOZJx+wzWN4auSCc71KymDfkG+gwgHijCICPy5Ttrqzvkelm3qGR3TpXs9AsCxJMeOHDNY/SeNBEBTxi/Iva0BbgksNfCg1EADWIOydZ2KJP0Za4Cfed8vbwF8wsw9zBfMFc4NPdmbS+bEmZdgP6Wgn3lMRxx+rym9jvTwP1f+m3XaNZArQxu+pJ9JADD+qfeMWWr2wP+xcT3SYIsQmEkG8B442s6WnnYxpvvudOXUWR+Urr3few71BgnYA9oJusf8AnUl+sWrXv2q+xw0DDipjvOHOJBYEqCCe55jXqTplYvrxJ9hlXZ33Q31RV9n/GjjzLCQxTiVuvIcv0SActc9pJMEQLd++rNff/9cQHV3JZw3Bf0a/U+LgATN1V9JgATzPX/vftKBAc5tWcH34vmSGgD9BP76sVYwTVoCVD8kAHo9BABWc0gW+zwHgOvnbCMOtG07wENDx+DD0Sl7JIATgCQAijluLgkg+E8pAaCsRMAx1gBbE0xOqOdt+yfJXZYSJUXFpg1YwyAiGSDg70mIAtLloCR4n5Kk9zrPJh8GSeOQVTlTEUNaVu5lkJWwyJV/fhf11B2VFTEGAAEpYD8BP/EZl36v9aT5XacU2FMGBgdO/2dy5h28lvIUZa1118szSYBMPzEQTxIAbgNwLEBCCkgAMP6g+DalYRirTtLRlkyWGlhq4OgagIzgDIKcG3JemOvP+8f8Oc843yh7oD4BPn7nJmVez/nqVNZpR1TuSj9b62UogupmUwQA46RgH+K0Oq8dI12MQfK8LSKABZogAywrbaSRVgOBwXvgeKctPY1xfTW2X+imt0x3O+J7730r9Xnoqr8gHcDOTwtXwA/Q74F/QAppsQAAxPeIBQF+ypqOe1lR3fulT3ADfZsxw3EJcI5um/py9c8F+vW+DEsCQDRyuPcptr+eoDrOm8XQn2mnYBq2pyQp0AP4xgn0a5j4jCO/tZn8lZCFPE8rBSRgX+BfJRYCpGGxTmsASQAkAN9rkgBsrWNbgOTAejw82ze6GGgZeAe3iwRw4nDlDgU9rQBQ3F3B68kkANLPb4HrNkRAbgsYswYoWwJobE4uTjDrSrx414tJ5WwVe2jGlNmT/1FScqBiwHKwwo/y0iMAjOO6A1uC+PQzQGU4/T7fuKqUOYAiUwnjualMud8f1hOF4NC62XUf355BJskAwaugP8Gq165CJmDe9byxtMS7NQCWkLCu5jmWR6bLukh/ppny5z3U+XogHvtMlwgAxhLHEYjEBP9JAJAOJZO2Q/8YHnAlg/3YiyzxSw0sNbBdA+gNKtbMEzk3pH/qmunqPOM9zjEpmaN0Ceb39TNfMe9i8r9jHNt+8dOHHNtW+kroZYx9uThDOauVZhIAjq+VBDgmrP6nTDKgWWlpoTlCBDCGM0/zHriqq9GOmr7Ge1/oadt1cvo6v3U5AqhcXQdoV4A9Fhb4j4F+FhjSJQlgPHlAAPSeYf5YEkAUEO4RBcavdfOrrf+hbXG+VurW6NXq1gnaq580xCnTn3H1PsOkyV8GOPVi2NVW5MFP2xwIzXjAOEY9SBAAstEndYRxXMeRnjFkeLrjwsEF2fdGnp0EAFYAYySA5xaQ3oMBteSVAJAEQAL8f/WD/6A5+t2Xfs1/+U+v6h0vTTYMzAzQfKANozsM6k4wTiJaAqQJbyryCfJ7fn7729//5je/JQGQo0TAyNkAlDUnGCeXkUmFb3/lDWhXg8P0H2VE8J2D1EZBWjOWAHMGFJQdQX+V5IUCJYjfR6qItecMeRhWIbM8lDGVsDHwv+60u6rgFNfv9cgAAGt1ANwEsvqVUwD43NcE8Uqeh8k/JIDA32tVHlo231vZy4drOgZplJEZfakRAPTJNqYMYwkKYxIAEolKSAGuSwDwTRcC4BTdY8ljqYHz1AD9Gx2hN285XyjrPGJ8leRVnfMNcl+wX9MzX2Glxty7Hl/OUzn757rRy9BhKBv12+a2ta5TdTPqXh1NkK6u5lirzpYy0+zj5xwX3b5kAO+BW4iA/RoGK+eC/x4Ir3GCcmQP+LP6+Evv/anmfu7v/cwWASDoR5KO7QGAf/Kaeg5gBhADETBGAPzer3n5J2i/+739aVLzXMeQHKvQp9F3BezKjEt/D/Tnde9Xkh7neQBYxN6wMec0FXx3c7kHoPdMAvys9I+RAFgFcI30WC64sp8EAHESARwOSD9D/umvfMbPX0U1CoI3kw2sXJ1s2kSzJgCcYHJCcStABf+Ee8CfOIG/JAASEiCJgFESAIuAejZAsQbIiYUJdEME9Jnlq6jryWcApADwKCgMTio9VSFykGKgcbAhrcD7WBIAxYx8E/CnP8vDcx1IKTdl+PqXvqspVK78s6rCRD/58me8iNIEwwiLKHAV2CbQTb/Xr0IK3uc8CwKgt+9/zr29NPu8s3WHpC5hQ/f4bJMEQFoSSQAQxxjDeMP4Q39uffgGEnd71MOSdKmBO18D9FVW2XKuONTvPJhzzSmAv/MV4P8GrsRd6GWDPoZOxtjX5rKhbiUBGIObbobuE/qZOlolARL0H+rvEQSSAMokA7a2CKx1NMqcCzZJBPCO6J9bOht1MK23WV93um9xev4h4L8C/0d/9k0N8LviiIQEAHwk6E+/e/97gB4yQKKBZ0EA6IyvhAH50F6u5YMN7Ynxqadrp34NcCcsgFffJpx+r9e0Y2lIBwnwwGwFuJaPfJ6HYoUAoMexJQHpav8UEeAvBGANIOivki0BxGEp8MVf+iVvP88b9HNdEQAMsuvJZooEYIBnckkSgH28WgIA8MfAv8B/jASQCJhrDeBks5loyuTihOKkwvsNVXDxvjcAUDCRo4gAoAXUqfigPBFGMnjoGGAcZJAMaJUAIEy+pq0ywf0U+E8FzrKpiEk+VPDPqsoatPVb3RXH0gZQ9li5TkCbQFi/sgecrypOckBpmQnrKIvXlbvKl++mv0rz8JlI6m1P4O8XbuMKfVELAJVUxxCBP/LZP/Wbbf+/q/8ojNwbfdd8F7nUwFIDN7QGAHZsDagmt20em9gq4FyT84zzonMOc92hzvmK+Qmy4gZVXwLZCx2l6GSU+VgSgDG2OhZydHMJAgmBx7tNc704M5cM2EUEbOlt6G64G6a/nbv9oEPtc9ifoBswnmb8AH/APnuN9wH/EAHkOcf0X+CvxAqAe3sEwOe/4efvM7efu/56+dN/XHBLIkAdWz05wT5xhBPopz/Tpt/7iPN+DwW8oQRkr8qWuKEGaDcCfywA9GsJIBlQzwTQGoB72jkGa7BfSQDCEAEH6tlHf6PVpFMmHCebxjbHVoAeCaAVwNjK/xTwT2sAiYBLFgETZwMkCSDLTNmZMCUCGiC9PJFQcTn5Hl2RczNgAmS13MEIBUfFR9CvVDFSgRKwO1ghSdsjAsg301Xgb9i8U+ZzyV9ljOeoTDGQ4XgXTJvWByldS53OqXvaA1YXaRlQQbDgVzB8lVIwr+TZlifj0j+nfL7jrrQ+C3nAin/9BI0AQJmjP9I3KwGAMioJUM3/6SMLAVCrdAkvNXB7aoD+S7+faxmQ80zON/qRhxAAzFdYpa23Lt30CjwbCcAYWwmAGmY83pcQ2CIC5pABQ5toeuUgkwxAZ0u9TSJgRH+7qKeb/kX3LB/vzWF/Y6b3CazHgD8Avgf8/8WvvuM+pECu/KdfC4A5pv8AfUyXBf4pxwiAP/pdf+MxDvtekzp71szxyWlvLFoxJuxLAiSolwSo0jRKCYAkAdqhgN/0xsdu0kLZ8TV7t3NAHwbIp9MqIIkA/DqJASRpIQGw5nXVXyKARTZ05OuqwYuBdAcJkFYAruLBGueJ3seQAJ/yifttm0AlAka3BdzCLQEMQByO5+p/DkIoQLoE4AwyDZxjCRD7+wXwgnzuFZxrFcB9XDdtlS3fWJnhej47lbIp8H9LlKtNH2PwhXGTDEiwLRDeBZiv4rrgHdCv47n7kgCW1fx6kjjqgza6qajDPZcIAMi6NFFNhZRxhGua/zMgoggNj7+xhNLhVbPcudTAg1UD9Gd+QpD5pM4vznkV6Bs+BPQ7VzHP3nRiOlqCY91KJ1svWjBXMRZCqExZAjC+Mn7qcqxNfU3QL/maRKxxSnQ7xmnklIXA5hecBnDX/FoHrM8M0GoTWRdtXLhh3qGd4HpEQAON6zoZ6ky9leqz3qqf8K36a6TZ8DN/Yyvvgn+BP+E80Z/T/NnXn6v96Qf84wT6VUIGkAfm+mNl8Nlj4B8iAHLAsiq5DwLgCW/94H3awXV9GPS+URIg9GtB/JhMcJ9p8OsyjSQAWwHQz9fj0nVVw/LcfWpgGHcA6j0CAHAv6P/hr/49G79xEgGk81cN+IUvHDr3ifTtfd6mm3Yz6TjhONnI1jJw03Ex9coJ5VOHFXpJgCQAAPJzVv8T+OPPcJ4RkERAnWTqxEKlOqEwqDKB4hrrxiRyMYHk5NGtmFNFYorOSjlKSa7+o+ioBKkgKVNZEqxXEO9gg+Qa96IA8QwIgZrecM0vn2V5ctWFvKrJPysrN6UBH/qdaBdaBtDJ6ZQ6gfO5ZQX0hilHBfxe21Um7yVd+vM+3/MEK/696t/8EgBtRAU1rYhURhlPKgHQ+upFP+3lv8QtNbDUwC2qAa0CMMXPPbmCfeWhoN957+uGFTYUbJ53i6rHogpuG4kK8FUn433Uy9RxUj9zjJ0iARxzp4C/BECV6Hk9hw6YbosQGCEDNkTAoFf6Dr7TFBGw0eEu63Gpy6Xfer3Rkndm5X9sz30CadKwSp/m/oD5973vvZfM/SUA2PMv+O+t+ksG+LN/vVV8wT8AP1f8LYdxbEWwvEru/aKXfvfHaCeQAHz/6/og6HunIAG0AED3BuCnVC9PEoD0bgXAcvaWjk/X9dmu9bmMTQB4SQD9WgIgIQDSQQJICiC5VxIAPR6rgLWee63v5sNXE09MOE42bYBmoA4SANMvWWEnhd45APsSAZIAyq5FQN0WsKc1AJPq8NIXE+02i2x9nEYOz+I3QAH/dHoHHpUdpIC7Av9c/d8A9rUlgEAe6WCTkrwA7chMm/4E/fgth2VzJQUyAeICxzvg2u+arurxNPV0E3IZ3qcpIeufFxwDzoLoXddNd6g0fwaLdFP5eU8vjdeQuBOu+Pe+3vZBgLENALDP2IESioQAaKv/w/gCQ8+4EwRAL+8lbqmBpQZudw1sfh6KPg9gZwyAGHjJ6396s+0s56IxYuDh1/zNdqo/eTB+3ySl6sBPdKGbMMcOjnfqWQLwvgJo9TQJAGTPEoBVfcD9FAng1s6elBhA79sszLznX3184w9CYEMGjBABdfGGd2hz8PBeBxIBVHkSAOk/8HOc9zbmu8/+o8/5+BT4B0B7XcCNBLi76l/3+lfwPwX8JQAA9z5H8K6kDC94wbdsmf5TBqwGuF8CoGcFwL3kA/jfkADDtz5vzY7nzoIcunguxql/93TqCvDHwqmD408CAL8kALp506HHi7hcuWE1wIGAAn/BvGGJAAmA173sD3xcP5Lr3tPOBBjAPwuON+UVHSRXE896wpFx3kwyHRKAAR4l3smAw/xc+U/wj3/MueqfUgJAmURATjRzrAGqWVlTEJhYL0gAvoN1gP8kfwzsrJIL/gHQdHwUGYG/Co7hCsoNJ3BPP4NMhquf+8fizBuZ4L8H/AX/t2g/5bHfsPvzgj1gfUhcbyW/F0feY/FznivoN63Anz5xbAXtuL+7DUClNK2INqv/w/jCWNOY8Yv+ueMxy+WlBpYauEs1wPzM+AQYBNT3HOPIHQL8+fnUQ1a6GHoJY+HgeiQA9cSYCYmyIQLWeppEwBgJMEYAAPoB+T3wPxW30csOJAM2VgHDd/ddeDfeEYc+xdyQFp0bXY46utDnsg6zbm+efyg3K/8CZMF2SsF/HvI3B/hDALjyPwf8A+THykE8Lk3/3X4geQAZIAkAkdDLi4MAJQCaJcA1kgAAcBfkUidXZ65g3vBc8G96ZBIBkABsBWAhjXZ98xrlUqKRGrjHopmg39V8w5UEEPgbXwkA8hp5zrVGryae9YTDgOsk0wblYXJhYnE7QDsEZiAB6NSSAEwSu0iABPuAe4H+LikRANHQJpwRa4CcTJhEcDmBbCaOy5PG0ZVP3vx+K/v9Bf91oKnAXwDeBp9hgKiygvhjw+Sv49mUJ4E/5cUB/AH9KltHV87tzOBea0Nry4AE0xVge22unAvuSafr5W05qjStwJ/3uKJP0MYR+gL9jucyflQCoJr/k24hAK7oCy2PWWpgqYGbXANdEoAxdac1wEwSwNX8KntAH51O3Q5/OtN3f81JQiB1tUFn3BwgWM4KSN0tiQDmhjtFBAw6Nqf994CyBIDAW7ANyH77O96+OeSPVf9DV/7d8y85wDN6ZSEOqwBW/wH4pENqgSABQD4SABAFlt13QXIOACQADj+OOmj6+DX0RLYjVd18zBJA4J/AXv+ua5UAYCsA1gc8/xpee3nkoTUw9FlW7gH9Olf0kwgA7ONc+TdMGtNfoS6+99vuJAHqdgBW4iEBZIGZCMZW/Gu8oF8iQGl8T5KGMwJ8Hs/eWAPEhNImkzWj7AQii9wGneGDDrXD+/KnXIUO+E/eAGbYPcAzzv34AGyZxiQAXP134BGYNxJgfTAfrCGgv8Wt/Qw++xIBmbfAX/BPOQX9lJ/BqR3wt6qjA2rjbt4CoMWEDAZPwC3QPkaOkQFj8bueRdkE/tfENLfVK0nEJBAB/rqNBcDQTxcC4G72meWtlhpYauCgGrggAdBPmIsHV0kA5iQXaqo1wL6WAID5tAAQ+I+B/yQC8OcvOUkIbPQ0yIA1EbDR2QoZwOLS1tYAyIzQ4dTjXNBJfa7odFl3B1X+uW6inHNW/gHNAG1cHvIn8P/wRz7SJQA48Z/Vf0C5AF+gPiaxMOgRAIB/XK7+V/BPnjyHeEkA8uO+Xp68F9c4bJDtD9TFtQCioS+hr88lAQT8yingbxplJQH4RQD0bNrxudrZku/pa4C+W0kAgb2kgIBfabzp2E5w+pKdLseLgXM92ajE00lV5HeRAEwETAgV8Avwq+wB/ak4SYBZ1gAxgTBROmkwmTZ3Af4PJgHIk8FEoK/U7N9wgn9BeIL/S3v/tQgYCIB9AX+mF/zzLJ9LmSgf4F8zf0yjrgkwnq4FX1FOTemaeWZAD7DvAvdeR+qv+UhCpLxm4G/t79wGsAH/ayWP+mR1q/RJ81vkUgNLDSw18CDWwJZOxviIIoqbYw2wiwTQAqCCf1f2BflTJEDV8/IQZ4mAja52pFUAemglAnJrQJs/hjoaGor6XJXX2YbuffGXfsnbx4Ax4JhrmNED+gXbHvLnir/Svf4p9zH9B7yPmf9TDoB6HvxneZJIkGSoJMDYVgDeEfAvAQAJgGNh5ao/DDoHQPxQEkCAnxK9m7ASfxIA+LEC+Lq//BP3r+Odr7qO79rzJAFcza9SwF8JANKtTf8dj2501awmnWEgdZJpgCdIANlafh0gtwPI+PYIAEC9k4X+npwC/3mtRwSkNcCGTQ4SANaNd+JDtsliNVGs3veATwLrnr95LMhOoN0jACZX/xP4p19LgD0IgQT/rvgn8NfMHxLjgNdfbhlqgLo7xjJgDOAbr6wEQIYB/rCL9NMb8FEWAuAGfISlCEsNLDVwq2tAZVH9ZKOXobskCdDmoLAGcOVcs3q3YEG8aoHFGU4eDJgr/4J/pSRAT6rP9fQ99bMeIaCe2GRvi0BYc270uB0WAVt63VA/w5fPerv2hsACyy7wz+p5gn/AvYD/H33gA5/Ar+QalgASAAn+BeaCdcLkW+PHzP9dwXf1n3Tcb35Vmq9WAMgeCcD7V/AvCcCWAL7hVX4o9LZjSQDBfpVJDCQRwEIfOvhyGOBVfunTPWsXCQDY/6J7n9RO+5cgAPw3zHm6Ypw9p81kQ8GZYCoJMMcSwAlCKYAnrP9Y6URzaTLhBNphItlMIGtT4xESgArlnef+3WPwAFTL+DEA4ATdSImAuvovUWDaS6v/FeQPg4b575Lmmc+vK/6Y+UNerEmQue+8pNtRA/QV6nXONoEpYO81ZYL99Av8r3ri3FENbeygLuhrWg+lEpoWAFwn3XqAVGnb8Yjl8lIDSw0sNfBA1YBj40oCcgfHuMn4X0kAx90xEgACQJeWABX4j63+o3eNAX/1vSolA5BaB2zIgB4REDrcRo8bIQJ4f0mANpdQPxckAA2FeruWvy/4Lz7/h3aBf37iD2DNSnvu9xfgSwRUEoDrh5j+A9p5Zi0X4Vz9B/zvWv2XACDdFAlA3gL+MSKAc7TWusCVfCuAeN2y6wIdOrT6toCesDr/mDSN9yC1BEDX5zBAFt+GF7y2NnkllXtXHzKMLSy4sSVAkN+TXG/bqW9pPWwmGieY2SQAg/lg7pUTBEDfCUF/gn+uZXgfP/c6qUgEjFkDCDgaaLo8Scz6VEw2mPEA5BNwO1hk3BQJkOn0kwd+BoqN37hKDJSwefjMUeA/6y2XRMfUAO2Lzg8ZwECQwH2OX/CP1O99An+A8zFlPOO9l34OEEVUEgDZFNM1KUd/CgLgjMVasl5qYKmBpQZuXQ0IFFY6mcAW/WVwjJ24qqfNJQG0BBD8p6wr/+haGWcYma6n4xlnOgmBrS0C9ayA+ClBSIAxIgDdlPlQIoB6ac66Wn1y6/HKGgCAtoJsTOF1XHv5a7+3gWwAND/vB8jvAX5W/wH8SQKw8p+r/3V1fipsGVICzCEAWP0fA/81TwkArRd6JADvSd4J/J/01Bc3QkApORDbAs7/vYZ2AhhPEiAJgKaLh54tqFfXlwQwXKXpJQCQ6Odsv70hFptX1heWB92uGriYbIZOUieXnWcCrEkABnkH/B6o51ov/pA48uJ5u0gAOt4GdDBRbE8Ss74SkyvmQ3RkB4zs/IJx5BwLgHbvAPrbgFPAf+Zb/fkcgT/PA/xTtsXMf9bnPG+ioY1hGSBrKJAfkwL+KiESyKORV+ct8bG5bwgA+ppjBcBfRxx1wvX2Phf98NhnL/cvNbDUwFIDd7kGLnQzdBfGzsElCQAYZmzdkABshQwStm4H8Ged3Q6QIL/nR9ciXt2uJwX8U7qc902RAW0xx0MDY3uA1g1ueeBd1e2YUxqpTN0coN+dovEwv+0C/6zCA/xxAHmBvyv/KfOa/inwDzDX9L8nE/jjF6R78j/34AT8An3DyBrnu1QSAFIhCYAkAhL4p59tAdThKb7FVB48A11eEgDdWZ1e/brq3Qn8e37jJACQkgBuA7jNq8NT9blcu1s1sJps1hMMwHlrYhkmFZnZS2cCrEmAT/7n/9NvO9DPmRSmJow513jWhlUeytDOKSjbAZwo2iSxmiD4ansxjvxMHiAb4F0HCMIOHlwXnOv3mnKzDWB9Xy+/jPM+pHlX4L+c5n8zOyITzpRlQK76SwIA/Ndt9Wa+1Hapts4BqEpoKmwb8/8LRW07pyW01MBSA0sNLDWQNaCecokIYI7AoacdSwL0zP/RrQT+VarjpVRfazrZYAVqeEySDjJga4vA2ipgDhHQJQEu9DrrK+vyLH7q/+nP/4bfrCDbMGBb8A+QdmU/JX73/Lv6r+Saq/8VhCdAH/P39v8D0l39B8gn+M98pp7HNe7jfkgAzxFAfu3XPmdjBeCqv0SAYWUlAs696MFWAEkAD/DehwRI3Tz9SQBIAqDrQzKc5OcAB70JfRL9UJ3yiU984v3HPe5xzeFn4YhrpGmEykrXOku735npLSov4yd1Rv1xwN+DfHDjauAcPp6TSyUBYGMhAsZIgF2WAGMTwqHxTiRb1gAdEqCsPjqx7mzHJABgQwBkh0+/IF3QrzQeWU39KxHQ0gSZ4L3mJejPFf81s7jXu8x64SXRqWvgHgqLg4wWARIAt2jFv9ZLIwC6Y8V65V9F7Zj+Vx+6hJcaWGpgqYEHqAac41f6GUAX5X6tpzG2XlqwCUsA9LUxS4DP/rHfecytAGMWAOhYkgD4dehs+NXd0m/cLmlekgFNj4ufE8wtnr2zntBPUeCpA+ahoU1YR2dvHjzvT3/lM35esN+Tgn8AM2C+OoF/jTcs+H/0Z990aRU+wfqYv/78X2/1n7MIcGN5EC/gT1KgEgCAfx0Eg+Be8K80fkxiEXAuEMY3w1p216GAqd/rB9jrR/bCEgFaAaC3f+sr/vr9Qxtjw18DOAXoc+jcX/z3P/WxNzzx0+//d5/2u+6//9M+4/7/69/+tObwE8c10pCWe9A5yePQ5+97X5YXUsKFLbaz/pHP+7z7X/iUpzSHnzh0YdJIZlx1ecFQ7Ov3RH/kD3/172mn+Teddd8KuMXptyeZ9eQiw7xZ3RsIgB4JwEDdfgN2GLxvBAkw7ClzH9kICJn9qbgf4F07fA4GAvZTyQT+gn9ICMyXsEhg8p/9AkvCG1UDKCxMcLC1baK7vd9ypWwN5WewzJUo+xxxjCFNOVu9p+PMjfomS2GWGlhqYKmBG14Djp2rcXdNBDC2SgIw3jL24nJL1i4SAOCdlgAAc0G/UrCeUhKAOMF++o2bI813iwxIq4DeYYED0cG78t4bEuCK5hlWk3ug37hd4F+QPyUlABJ4V0AOEO8BdNJRltyeoIk+p/ezek8aziOQAPA5Sq5Xl89zCwDAnzwlAJB/7hv+6629/676SwQoja+EwLn6Iqvjz/j6H91sBcASQCsA9G4X49Tvp/T+mkYCAOk5APyC2L7vIpAW9APuBftzJfdIBpwbWFteQT/gXrA/V3KPZMC5y8v34Bms+P/Vr/isBvoB/vgNQwYwtuz77e5C+o1iz+RyiV3ekwQ4dEKYM2mYpk4aMseNBFhPEhsgsidLDOBmkGBwoMPXAcJBIOPHiAAHGAE+6fSnFPTzXID/133TGx9jwmGiuwsNbHmHO1MDbaxIJZR+JvC/aqXsztTq8iJLDSw1sNRAvwYuCIAREqAp5EECbC3asL9+ANP+OgALN1oCYJI/BfgF6ehd6TesPnasJG90OpzWnZRTvW7MGmAz3+yp4/WreTwW4l6gXyWr7gJjwHMF+GnezzWtAGq84P+Q1X8JgQT/lBPQDTCnfJTNZ0gAVLA/FU7z/wT+6eecAYE+AD/9FfBXImC89o+/gll+kgD7nAeQhEDPLwkAAYB+3xbs9igybUvgn6v8c4F/TUceEgFtwWmPssxJSp4C/1zlnwv8azrykAg4R3l5J8E/oB/3t57/ORuXJAAEQdtOMaci7liao0kABu46SRw7MYzd74SxdSYAB8q4HWAgAZgUmSAe2pMhxkyEAYPVd4mABPuVFBD8C+gB83McgxD5wxhipsQzGTxogK3cd6yBLa9zZ2pgyyRVMgCJi/6m4npnXnx5kaUGlhpYauCaasDxdGv8RVeAgB0jAVgU2WzhXBMBkgA9SwB1uJ5EHyO+6mW9uJpmbpi85hIBvPOhCz1zvyHPqMBaEmAX+E8y4MMf+cglciCvC84hAKaA+Ni1uv9f839X/1n553nve997L+UvgdCTPg8CIME+/moFYFxvS4CAf4wUmPs9DklHG0G/njoPwIW9XbKSABIALX44B2AuAUCZNPU/ZMW/Av8aJk+3BvCsQ+ot77G8n/GZn7ll3l8B/aFhiADypk5OUV7LDp4C2PfAf1oBaAnQzgV4ABdetyYXFHk+AhNLmpdtMcuYaAG63Q6A+dYVbQlwkqiHyrTyDCQA5cQkjvI3UHIAQ0zD8TDASgA4SBCfwB9QrwPcp+MnBgH7DBCQDOS/ISlW5bPNLnKpgZtaA4wT/K3GC8i1dMYv7XlVS8v/pQaWGlhq4LQ1cElXgwRAX9siAQb9Bz2IX2ipJEDV2dCjAN09a4AE/QL9KueC+33SqeNtWQTEtgB1vDOTAPcAjgL+lAn+AccA6wT0dYU/r1W/4B9ZzfF7oDzN8gHopKn7/wHhOFf/LR/PENTvI5MA6AF/yQGehx/LgzGwLxmQVgGn7SLd3O55KODXv/RdTTd3K4CLeOr1yAr06zWvH0IA0GYBuqzUV+B+6jDP4Fk8s1srMyItLyv1PYD/tC940v2veeLv/XjvvALfJ88tIC339PLiGceW11cC+6XZf678468EgNYAnNO1XsgyqwdGbhR7SQA+/k0jATQXkwDYsgQYJgm3AlD2Q6wA1l/73sOv+ZtbA4GDgMC/mu5rvp8r+oB9yrEmIh6YhrS86J2vgQtFdAH+d/5jLy+41MBSAzemBi7G3oGARbeQBJiyBmiWAOstAZUEcPFmFwmwD4g/Nm0jGgZyopEAw+JSbgtoOt56oedIPW/0o47t+98F/gH4/qRfBfuG3//+X/jtt739bY++8pFX/shzn/XMF+qe+VXP/Im/8qqX/vo+4Jy0kBNpqQD4xiQf4O7qP8/Gb96SDUrjezIJAMH+LglRkCTAmB8iYPQjnPjCH/rP/vArx34aUP0+pUCfOP092eIGCwAW9qaKTFvFhB6wLDg+t+RZPJNnT5Wtd417AOQc4FcBu6D/kK0L3EO5yKPmy7NOQQJw7pYr+xX8G5YE8GBASQDu7dXHXY+7NLFcYpZ3nQlwZksAmeFKAsgU+/OAMMQQF82chFXK1R/vN+uPSRUgDwnwktf/dHMMHDj26GuyX1f0F6A/q3qXRLe/BmpfquHb/4bLGyw1sNTAUgM3twYu6WsSASjum4WbtTUAoHmONQAkAA4Aj77VgHiY/xs+FuDPuR89z4WejY6H5akLPWs9r1h7Hv3FWLhJQO3qf4J/VrsTXAOwc+U//VwD8H/rC17w6qc+9al/fIee2H5JaA4RoIUAZbW8SMA2AB0w7+p/JQB6QN/8UpLOlX3ynLIA6JECHhCYK/7Vf/QH2yMDvq1bfOt5AAn+098D/UkK8Etf6wMAR/UgsAjA9irBv+QCz+TZDQ/NrCvLW8E/q/enfAfyqhYBkgD7lDdfi2/sKf+C/SoF/4B+0iqJJ7yLzMnn3TX/amJZs8t8hEO2AzBw5wQyZ8DflYb8KvjfsgBgclhvAygEwGjHvGsfb3mfpQaWGlhqYKmBpQaWGnggamBLX5MEUGfbEAF18SasATYWAay0l62cY4B/LH6XDrfP9arrdUmA/plPB+t71JtgWuCPrOAfYAyonnLv/Pvv/jVW98nzgJZ4jwUmniMg74F29v9j7m9Z8Xv4XyUo0gIg853Kn3RTwJ9fQBD4p984ZD0gMAkAfgrwgLo56hb6BCRAJQByu+8u0J/XuW/XCjsA/CrM/gX9VbodYG7FUd5q9v9Xnvypnzhkxb+WpYbJk7zTGsDtAHPLm+lc/QfUV+CfYUkApH7JgAfVCoB6XE0oyCNJgDqZ7DP4j6V1UpAdbpOCJmKFGW4M0soC4OAJIRvW4l9qYKmBpQaWGlhqYKmBpQZuQA2o16x0NnSdorMdag1QdberAPxV51PX0wpga7FnfSZAx9rTOjno82DdWQmACv57+/4lAgDZmPaz0s+3OKgQcRNgdcwaAOBO2SoBoPl/rv5TvkN/ASDBfFoApGVAphnz96wBWK2N170yL/0CgoWVe4iA3lkArvID9qvTQuBlb31052qxp/1X4HvVYQ4GnHPaPmk4lE9AfupV/7H3rtYA///2zu/1lqoM46cuIr79olARvejiIFaigSAinlRCPSFJKEVGYZ4jSJpKykHooiLhoEZe5Q88XngT0Y3kkf4Du0goybvEIKOL9CbwLsj8Np/Z88x+99oze2bWnv3ru58D66zZs2fWvOuZ+c56n+d919rY0Mfe9KHh3iqdvy0TQKQ/CgJss26ASjmFPG18jz7XgwopS5DpmcEkVZR5IROBLwrztcqSKMrpCz7ns7IA6sFA5L+K/o+0BsAe3WZ31QgYASNgBIyAEdhhBCb+WgjcKBtAftugbIBqOidCAD5XLDl+29Bz5OelIkAZ8ClsK33NJNuzSq3PFgDwHSP5ZxvCC9GNBSItwk8t0n/HHXd8qyO9P+vxok3WB2jKAMBGCQDahoCn0f8mAQABIbapTIC4X/P/I/FPCX4UAmIWQNzWObRz+vSpQ2UBjCGSZIEaTuLvhJRvCQKIAhD7pl/0ivs5riu7g789iPcqVvtvI9Jt+/XrANgUuj+zyXesGaCf+YP8r9N2rqUpAdjQe/2CQmxDLNC0AYSlKAJ0ZQNA/hEFvnnlZ8opAIgAvC9nwNmzD3MDyhgiAC/2oYNBejyDwsxAUKnBJflf0bywPbv37q4RMAJGwAgYASOwWwjUgRvIFeQRggNRkRDArySVpfCV8Jko6SKBaSAHn0siAP7YGH5c6tfFz1EAaMwAaJjuGQSAwSIAeNzwy9/UqfSQaUok/myzCr/IP5H+VZH+pkcOkhoJO9uQf+xkCoDS/5syFMgGiMQ+baftswQAEXjVIv1kIGjfkJoshU1F/5uwXdU+fod+k6n/qRiALdjU1l++U+r/usm/bI0iALYsspd+QNRZvR/yTq3IPWn8SumnpqQRf32G/OsYZQDsuwCgZ6QeUHjBIgIwmLSqyT0yAZYZPDj3k+/8s8wwKFXghPzzImegKx+CYgAsOiEhQ/1xbQSMgBEwAkbACBiBo4iAfJ56Gif+UAzgtPpvWhug8uPasjnxw5bx4yLZb9um/ZgBoKBP+YsAhX0x4FNG/qb+3qB7CjYp+YdME8FOBQAi688/98z5MsV/0FXGORgRABECwv7Ci+fmBAAi7HwnkUI1AkBK8psi/ukxUQBIswAkAqR1KgQ0ZQLcdMuN58ZBZHtbgYcQ/R86b55zmIPfVviedHkR5iE1tnA+tqXIsS9G/3OvMcSetmO5NlMQurIA+HuAsMc5/HyG/PMdggCfF2UDNJF/zqkExRSm+rP4cL3jiG7MDSZxIJGSzFysWknuEAEg8BpAhg4iHM/5SgHTIIAdDGoi/8uowUf0PrpbRsAIGAEjYASMwH4gMPHdIMZFwSeC7C6bDQARjxkBQ324NsLftJ+22zI+8TlbAj6D7i7ZD1EAgPyn8/4huQ8/+uDrmyL+sUNEziHqLADIiv/KVsBu7GxK/28SACLZR1RoEgRE7lNS37af45oIfzyf6QxFf3g2e//j2a3mgw86r/cFVnBgbvS/SwCQMMBxQ8UFCHdbFkCM/rMoXxs5X9d+LQzYlgXAu0zkXyn8EH0i+ewnI4A+IQbwmf2R7EdRQOdwHNdtWXvggP2xTY4vFwyciI8reIq2p8l6MJHyAdluVZIXiABNAwgvepWmgYB9fN9G/rGFgY2HgsGugG1i7/bgZ0uMgBEwAkbACBgBI7AuBOQHzWUDzAkBEOp0WgB+XOXL1dkAYX2AKAS0+W3L7K8FAM37x5Zq7r+CPgSkQsBnEK608enf/qVMoVcaPZFuCK4KxH/b0tVZGBCRIgoALLLXlP5PFkA6BSBOB4jbURSQyBDJuzCRAEAtwq99Oj79zP4c8o8/zz2gb5AtOMegm7yJgwubIeo58+f7CgC0z7FDCTk2cS641tBU9l599dXlHPwhwkKXvXyfk02ADUxDwKY5ewvDeRYg9JH8i9RLCIgigOb3K9U/1hIMIP8loa+BmW6wX23E67C9be+HqdXjbc0NJL0yARYMHpD5riLSr+OU9q/Iv6L+9SAweahl63i9d0tGwAgYASNgBIyAEdg9BCY+Ef5RUXYpG6AO+hS+pPw+kX9EjJL8Z/h9nIs/qei/IukQVxUWhituNdht1T/s0s/ryW6Ei3SBQk0BoE7JfddnhIE4BQACL1KvWmQ/1ul3+pxD/rlHiB1vv/P3ww//897hP956rVyYETKGz79VNyUYQ/p5DjmHzEdCna4fAJEmTR9CrDJUANA1sFEms027pN0PJevRXtnUVHPcEGEBOzUVANuivfA+iHck/5B37dPcfki+RAAi92yLxCsrgM+K/Jfkf/IuETRlTYBZx4n86xrUbaLBTCNH5EM9kPTOBGgSAaQiF7XI/aK6JP5xpf9CqRb5J+ofFOCte1kfkfvubhgBI2AEjIARMAK7icDEd4PQBhEAIrUoG2BmgcDKl8MfqzMCwq894cN1ZXIOyQhQAKj0/0LkH4e8Iegz6K7QL/pA5F/Rf6X+Q1bBZFCDazwY35eUf2UAKP3/T394ZW7+v0QAEf4Y8We7Lf2f4/lOBJ5apUkM0HFRDNB2ToSUe4ygQZ+wg6kN/37vrbJgG/O7IylcI/ydl4JspuS9L1GPhLqpDfZFgt233XgcbWCjOsI2qfb3fO4LH8Tj+mxHe6NdTdsc26fNeAxZAOk0AAh3jP5D/inaF8m50vtJ3+dvWgsGitCrrvBo5I88ZxxHW00CAPu2+X2h+zxGPTeI8CLmj5WXEspsOTerSiUrBw8GjaaBAxEgKTXRh+xTdG7xsqatqABzTaf8j3FL3YYRMAJGwAgYASOwBwhMfDgiXUEImBMBKl8On4syIwRU/lntv1UiQNP0ziGEPz0WQYFr4AeWvl+11tOy5B9flbZvf+l3Nfkngk60eVtJZXwu8Xsh/xIAyAaAFIvsq/7zG2/8T9sSAIbWIv0i+PocRQARfR2jzwgp+OnR9r7bnEfqP8RfaxiQkUB/YjbAIuLW91pjHwdBHRpJF+mNhLpLAMgh1FwH22LUmu0rvnTF4Og/bS2yl+ssm7FAG9gW7YXEx2h/EymXCKDvIPD83Rf3upzLT3vso61qf+tjwPeIIwgAiAzx2lyHfVFQaW3oCH1RDyK9MgEg8EEEmFGQecGL8LeQ/kj8uRm8HOpBwPP9j9Bj5a4YASNgBIyAETACK0RgLpADqcSnQgjAx6I0BnTkywV/ro8QQDQ/JfhNn5VBAEGn4BvK/8Mm7EvS/gfDVAaTirZv/enT/yV6Tho9ZJP+D25sQydcduK+NxEAsB/xomnxP5F/aqLpIv8xC0D7VEOyEULAgwKJj0X7VYvsx5rvxhJSyB7AHkQA+oh92KpsAPp1491feW2b7h2kMmf+fx9CHSPrQ1PqJTJgGzbq0WWbufY57S0SALjeshkL2IRt0V7INmn7EG9F/VWL+FOL/FMHAUDdPlZF7XkXLvzHu5F+tAkAXCvat7CxI/LlzACiwQNiXg8cQUGeUY/DwDFD/HPIPyq2BYAj8ki5G0bACBgBI2AEjMCaEKgDOaNlA5DVuSAjQAQ/1hB9Pov0qy79w0JwGGvFfzDFP6V9Fv+DPN/50P3vVinqnURgTfek12UuvPzmV7Cfwi8CLEr/RwCAPIvkxxpyDcEHA/z3MJ22jx0HpWhUpFfTBsT/muuuPdvnxCHHwC9Y9wC76SciAIU1AcgGoH8PPPTDf+VMNRhiR99jiXrnkOlUAIhkP25DunPb5xqci43qD9s56f+pvavKWMC2aC92IwK0peQrKo8owDFMD1g2Qp9mAKSCw74JAHp26gGkMRMgiAB1GhkCQCyK/sd9Vbq/lN9Sia7Sv1BteCEsqwKrA66NgBEwAkbACBgBI7CHCMwEc/CrFNBZKhsgEQJE6rvqOiiEPxjIP8QdshkIahZhV/Sfxf8g0dsUOR7w7B2QAQD5J3uBOfIx2q/tOAVAafSQaEg/hBrCX1wzC8cBto52KPdKIgCRf4QPhA1lA4DDbbd//dVN31PIOuQ4p8SIeiT9cZtjcqcYyCba041hO7e9aG8qANBmtDtXtFA7slc17wQIvoqIPxF/CDo15L+aPrDUc04bZB3ErAKup7LfAgAvkWo+GX98GjhE3Od+XiamkUXiX730y5f0jydzz6T+crN5YUkA4HrFgzAdvPRUuDYCRsAIGAEjYASMgBHoQkCO8cSXqvw4CQH4W22ZnXNBnSqYU08JQAToIQTUpF9ZoFUAKPX9ECaW8fvoh2xr+a3vLqy24ntwUPo/Cxh2pf8rA4AofUX6t6IfOUZgP/0lE4C6KRsAgWOT9xfSK6I9tI6EOpLnpm2OHdq+jqc94c/2GFMWmmxkH3bmkn/srX+6UAaHmvcU5FwigAg6nxEOEADK90Y4J2eTDAKmEah9apF/6n0VAITlzOAB4HMDR9PvzCIEtBQGl5gB0CEAyA7XRsAIGAEjYASMgBEwAsMQmAZUKiEAXy4GdfDDBq8NICEgqZuIv4I/JfnHZywyPyF9LYGfQb2jLbJPqQeduGUHg4cEAH65YFH6//lXz7927/fuOjMGCdoWGCD3EgHoO1kBaTYAwgDEcBP9HmsKQBpRh0SzLxJtSK5Ifd+6aQrAqgWAHDvVH2xLpwDwLPIcQMyZ+pGKAIr8894Y47nlbw4BAGEB8k+taQB8tgCgaHwYOOZEgOLFqxe7CH6TAKDvdCwvbAkADEblH3VxneLGTgesMe6y2zACRsAIGAEjYASMwP4iUAd0iLgPygaI2Z1tGQGVEFALAMoCrSL/TYGfMfw+2qA/u35b8aslALzw4rnG9P+zT5x96eTJk1/b9b622S8RACFARdkAZDxobYBT957+67rXBoAMjkGoUwFAhBgyLBEgJwsA2yJhHcte2dRW59hKn1N7eSa4p6TkQ8SpIecq9GesRSjj86csAK6pomtvMuMk2rjp7Xrg0KDBSxf1pFaOgwgAwRfZT+tI/lsFgMnLXCLApvvu6xsBI2AEjIARMAJGYNcRkF9VT+9UNoD8udqna8ruFKmn1jpPbTXHVJmgNfmvov8dgZ9dxzjLfmUAMP8f8qs5/9TPP/fM+euvv/5EVsM7dhLz/fXrAOCgbIAnn3qyXBchrg1AhBhOso4ucq3ciDckWQS6TQCIx+SQamzDRmGxKnvHylhI7cVuyDiRd831FxGXCLCq+027l1x66SHl+PHjJY68o4Tlvtetg8aibICa7FcDSf0ZsaAqHQMB1/U/I2AEjIARMAJGwAgYgXEQmPh0BFuKosDOIn8OEi9CP7PgcyoGRJEgCAC1CBAyP7lenfk5G/jZO98PX5gMgAd+8mxN/iHApPoXt3xv8CC4yOr/Wg9AmQDUZAP86umflQKJsgFuv+cbf1tHNgDktI28K4rfVkdy39bGshkAtIuNej3smr3YDRFXCj41RdkAiAGU2Ef1dYya7ALaRogbo72j2EbnoMFLTOS+rHuQfw0CpZI3OwgcRQzdJyNgBIyAETACRsAIbBKBiT8HuQwigLI7lREQ/ThldNZCQJwaEIm/toMAkAaAaL/F99skJhu7NlggAGj1f6L+7NuYQRu8MM8GIkDMBFA2gH4pgPUByI4gI4D1AiCP5XSQFdkNQcyJzCMKLBIAiKjH78kUaBMJ2gQGXSOmyK/KXtkQbc7BhXOivcVtOyDNPxUANDcf8o8YwH1e0S12sz0QaB00eFlp0JgTApKovyL/nMMfLSpwgwCwN6pnD9x9iBEwAkbACBgBI2AExkSgDuwoEwB/LPpzdVAnmRYwkxVQkf0ZcaDYJ9EgCgDR/7PvN72V11x37VmILov8IcpMv9m/LZ4L1jyIGQDa1rSApx5/rJ4WgBhw5rEz71fztsfnDsX9gJznrAMQybKmArTVOYsNYhPtzTwzI9nbJkYsk7HQZC/3m1T/RQIAIoAFgM2/C+ZEAA0ckPk4cPCibypSf03+N38zbYERMAJGwAgYASOwtwjM+XQ45Kk/lwoBkHoRfNUSAPRZdSkAJFM/8RUbBIC9vQnu+BwCB6T38xOAygCQCKCaaQFkA5A58cgjPzpEFHj40Qdf59maa23JHblp9X0FAEh1jsCQpv+rm2PYmwoAY2QsNNnLu8YCgO7cbtS1cozyJBEgDhwSAyD8KuyjzJH/oo2i2xqIQIBt/zMCRsAIGAEjYASMgBFYHQLyvcopAdGnw1eT/0ZApxYCIPRhmqfIfqzj9zpPGQBzPuDU/7Pvt7r7vHstF9wAIQBiT7p/FAO0VgCLBD5w/w8OqREEWCtg7GwA/gYg85BgpcL3qbsEAL7PXWBQhBzb0hu7Kntj9sLQjIUF9h4Q3SfNn7R/lXWtAZBi58/dCEwHDF7cEPiipEIAL/m0IBLMKL+c65d/N+I+wggYASNgBIyAETACq0Fg6tdV/px8ur5CwAzpl0DQEP2XAIDfWHRlet3V9MutHgEECB5KDGA9AGUCaFoAAgHZAIgAZAcgGvCcjdX13Kh6H6Eg55imaHrsa469XYKFBICcjIWF9hbvAezVfH/Ivwr7WCMA3hj75+3NIxBf3DNCAAOHBo9I+rW/fPHPvvzpDe35nxEwAkbACBgBI2AEjMD6EZj4dfhnRYl+HIRK2Z2a4qno/qJakX8ikyL/tEv7RffkR66/p77iTiLAM/jV277zC6YIKBMA8o8ogBCAAEDh+7F+KUBR9ZxU/RyCv+gcbICsN0X/dUNz7O0SAHIzFvrYK7td7x4CeoHPDBzly50XfFOZvvQ5h3+qJ5/8vxEwAkbACBgBI2AEjMC6EZj6dJX/1iYEQDQkBrTVHEOZI/+0PfX97AOu+y7v/vUOWFH+ru/e9TJkH9IfBQGyAShjZQMwtQASvIicr+M7bKimOSy8g7tm78LO+MutRUAv7umgMUvw++zf2s7ZMCNgBIyAETACRsAI7BkCU98tCAESAyD0MStARD+t07WfGqL/8iH3DF53dywEeKbShQOZKoAogAgwVjYAafDpAnnrIP26BtcuV/7vCdyu2cu7A+Hiqpu+/+vLTtz35oWfePtDlY9e89wh+/gO4ad8j/TEwYetHgG9xKeDxmIhYPUW+QpGwAgYASNgBIyAETACOQjM+nMNQoCmeUoQSGt9XxP/aeRfbefY5XOMwBwCEgLiwoFMC1A2ANkCyxBHnm1Ide7ifSLyOTXX5NrYMNfxlh27Yi9TiCD4Ivt9a8SAIXi0wOTdIyIQhQCabfs84iXdlBEwAkbACBgBI2AEjMCKEBBhr9d8OlaQeQiVisi+au0vSVclHhS2TduZGCofcUVmu9l9RIBnUAsHam0AhIAzj515nwhyLiZlhkvx033rFAG4Fovvce2hdm+7vZD4voS/7bihmPh4I2AEjIARMAJGwAgYASNgBLoREFGPBH6yLXK/qJ4l/mqj+6o+wggsiYCEAAQAfjIw/FxgVsuQ6nWl1yvtP4f8q3Pbai8iTRupH7Jf/XRtBIyAETACRsAIGAEjYASMwOoQEInPqVdnlVs2As0IHLBQJdMAfv7444enT586XOZXApRez6J8q/h1AK2ePzTtv7nrx45to71kYgwh+m3HtvXZ+42AETACRsAIGAEjYASMgBEYDwGIP/+GCAA6vjzR/xmBTSDAwpQ33XLjuePHjx8uMx0A27XaPpH6P15wydK/EkAbtNV3tf+h+G2TvQgwH7nqzOC5/1EIuPPuZw+HYuDjjYARMAJGwAgYASNgBIyAEVgegSgI0Fr6efkruAUjMCICpKBDiJdtkhT7iz570ROQdsh7TkYA54j409YyKf9d/dkWe7HjU188+eHHr7j7MGcRwFvvfPKQc7v66++NgBEwAkbACBgBI2AEjIARMAJGwAiMioCINWn7EgNYwA9yH7MD2GYf34n0c86qiX/a2S2w94A+SwQgGwAhgPKxb/++MTOA7zgO4s95Ywg4KS7+bASMgBEwAkbACBgBI2AEjIARMAJGoB8CxWKYTC2A3H75kgte/vzFF7/BKv6QfArb7OM7jimnIbCA5qb+bdjeci2Ay29+5cKiXHbivjevvOHUB4sKxzF9oPx1kU1h5usaASNgBIyAETACRsAIGAEjYASMgBEwAkbACBgBI2AEjIARMAJGwAgYASNgBIyAETACO4rA/wEDhRQQcxg67QAAAABJRU5ErkJggg=="]}]
DragonBones Name
Armature Name
Skin Name
Animation Name
X 1.00
Background Color
Show Grid
Show Bone