[{"data":"REJEVAAAAAFA1wAAeyJmcmFtZVJhdGUiOjMwLCJuYW1lIjoibWVsbG93ZHJhZ29uX2xpZ2h0XzAzIiwic3RhZ2UiOiJhcm1hdHVyZU5hbWUiLCJ2ZXJzaW9uIjoiNS41IiwiY29tcGF0aWJsZVZlcnNpb24iOiI1LjUiLCJhcm1hdHVyZSI6W3sidHlwZSI6IkFybWF0dXJlIiwiZnJhbWVSYXRlIjozMCwibmFtZSI6ImFybWF0dXJlTmFtZSIsImFhYmIiOnsieCI6LTI0MS4zMiwieSI6LTMyOS40MSwid2lkdGgiOjEwNDEuMzMsImhlaWdodCI6NjIxLjM4fSwiYm9uZSI6W3sibmFtZSI6InJvb3QiLCJ0cmFuc2Zvcm0iOnsic2NYIjowLjgsInNjWSI6MC44fX0seyJuYW1lIjoiYXR0YWNrIiwicGFyZW50Ijoicm9vdCIsInRyYW5zZm9ybSI6eyJ4IjozMTcuODgsInkiOi0xMjguNzN9fSx7Im5hbWUiOiJib25lIiwicGFyZW50Ijoicm9vdCIsInRyYW5zZm9ybSI6eyJ4IjozODIuNjEsInkiOi0yNTkuOTd9fSx7Im5hbWUiOiJidXR0b25fYnV0dG9uIiwicGFyZW50Ijoicm9vdCIsInRyYW5zZm9ybSI6eyJ4IjoyNy45MSwieSI6MTM2LjE2LCJzY1giOjEuNiwic2NZIjoxLjZ9fSx7Im5hbWUiOiJlZmZlY3QiLCJwYXJlbnQiOiJyb290IiwidHJhbnNmb3JtIjp7IngiOjQ1NC4xOSwieSI6LTk3LjE2fX0seyJsZW5ndGgiOjUzLCJuYW1lIjoiZWZmZWN0X2JsdWUiLCJwYXJlbnQiOiJyb290IiwidHJhbnNmb3JtIjp7IngiOjE0LjA0LCJ5IjotMjc3Ljk2LCJza1giOjIuMjUsInNrWSI6Mi4yNX19LHsibGVuZ3RoIjo1MiwibmFtZSI6ImVmZmVjdF9ib3R0b21fMSIsInBhcmVudCI6InJvb3QiLCJ0cmFuc2Zvcm0iOnsieCI6NS42OSwieSI6MjcyLjUzLCJza1giOi05MS4zNiwic2tZIjotOTEuMzZ9fSx7Imxlbmd0aCI6NTIsIm5hbWUiOiJlZmZlY3RfYm90dG9tXzIiLCJwYXJlbnQiOiJyb290IiwidHJhbnNmb3JtIjp7IngiOjUuNjksInkiOjI2MC40Mywic2tYIjotOTEuMzYsInNrWSI6LTkxLjM2LCJzY1giOjAuNjc3LCJzY1kiOjAuNjc3fX0seyJsZW5ndGgiOjYwLCJuYW1lIjoiZWZmZWN0X2Rvd25fMSIsInBhcmVudCI6InJvb3QiLCJ0cmFuc2Zvcm0iOnsieCI6LTAuOTQsInkiOjkyLjM5LCJza1giOjkyLjcyLCJza1kiOjkyLjcyfX0seyJsZW5ndGgiOjYwLCJuYW1lIjoiZWZmZWN0X2Rvd25fMiIsInBhcmVudCI6InJvb3QiLCJ0cmFuc2Zvcm0iOnsieCI6LTAuOTQsInkiOjcyLjI4LCJza1giOjkyLjcyLCJza1kiOjkyLjcyLCJzY1giOjAuNzM2LCJzY1kiOjAuNzM2fX0seyJuYW1lIjoiaGlwIiwicGFyZW50Ijoicm9vdCIsInRyYW5zZm9ybSI6eyJ4Ijo0Ni4zMiwieSI6LTE2LjY2fX0seyJuYW1lIjoibGVnX2wiLCJwYXJlbnQiOiJyb290IiwidHJhbnNmb3JtIjp7IngiOjcuOTMsInkiOjM4Ljg0fX0seyJuYW1lIjoibGVnX3IiLCJwYXJlbnQiOiJyb290IiwidHJhbnNmb3JtIjp7IngiOi00Ljg3LCJ5IjoxLjUxfX0seyJuYW1lIjoibWVsbG93ZHJhZ29uX2xpZ2h0XzAzX3JvY2tldF8wMSIsInBhcmVudCI6InJvb3QiLCJ0cmFuc2Zvcm0iOnsieCI6LTE0NS44MSwieSI6LTE0My4yfX0seyJuYW1lIjoibWVsbG93ZHJhZ29uX2xpZ2h0XzAzX3JvY2tldF8wMiIsInBhcmVudCI6InJvb3QiLCJ0cmFuc2Zvcm0iOnsieCI6MTcyLjgyLCJ5IjotMTI5LjA3fX0seyJuYW1lIjoibWVsbG93ZHJhZ29uX2xpZ2h0XzAzX3JvY2tldF8wMyIsInBhcmVudCI6InJvb3QiLCJ0cmFuc2Zvcm0iOnsieCI6LTIuNiwieSI6NTEuODd9fSx7Im5hbWUiOiJhcnJvdyIsInBhcmVudCI6ImJ1dHRvbl9idXR0b24iLCJ0cmFuc2Zvcm0iOnsieCI6MjYuOSwieSI6NDEuMjEsInNrWCI6MTgwLCJza1kiOjE4MH19LHsibmFtZSI6ImFycm93MiIsInBhcmVudCI6ImJ1dHRvbl9idXR0b24iLCJ0cmFuc2Zvcm0iOnsieCI6LTMwLjE1LCJ5Ijo0MS4yMSwic2tYIjo5MCwic2tZIjo5MH19LHsibmFtZSI6ImFycm93MyIsInBhcmVudCI6ImJ1dHRvbl9idXR0b24iLCJ0cmFuc2Zvcm0iOnsieCI6LTkwLjA0LCJ5Ijo0MS4yMX19LHsibGVuZ3RoIjoyMywibmFtZSI6ImJvbmU0OSIsInBhcmVudCI6Im1lbGxvd2RyYWdvbl9saWdodF8wM19yb2NrZXRfMDMiLCJ0cmFuc2Zvcm0iOnsieCI6OTcuOCwieSI6MzMuMDYsInNrWCI6OTEuOCwic2tZIjo5MS44fX0seyJuYW1lIjoiYnV0dG9uIiwicGFyZW50IjoiYnV0dG9uX2J1dHRvbiIsInRyYW5zZm9ybSI6eyJ4Ijo5MC4wOSwieSI6NDEuMjF9fSx7Im5hbWUiOiJlZmZlY3RfMDIiLCJwYXJlbnQiOiJlZmZlY3QiLCJ0cmFuc2Zvcm0iOnsieCI6LTEuOTcsInkiOjI2LjQ5fX0seyJuYW1lIjoiZWZmZWN0XzAzIiwicGFyZW50IjoiZWZmZWN0IiwidHJhbnNmb3JtIjp7IngiOi0wLjczLCJ5IjoyNS4yfX0seyJuYW1lIjoiZWZmZWN0XzA0IiwicGFyZW50IjoiZWZmZWN0IiwidHJhbnNmb3JtIjp7IngiOi0xLjQ4LCJ5IjoyNC42NH19LHsibGVuZ3RoIjoxMCwibmFtZSI6ImVmZmVjdF8wNF8wMSIsInBhcmVudCI6ImJvbmUiLCJ0cmFuc2Zvcm0iOnsieCI6LTEwMi44LCJ5IjotMC4zOCwic2tYIjotMTc0LjU1LCJza1kiOi0xNzQuNTV9fSx7Imxlbmd0aCI6NTUsIm5hbWUiOiJlZmZlY3RfZmlyZSIsInBhcmVudCI6ImVmZmVjdCIsInRyYW5zZm9ybSI6eyJ4IjotMzYuMTIsInkiOjI3Ljg2LCJza1giOjEuMTQsInNrWSI6MS4xNH19LHsibmFtZSI6ImVmZmVjdF9saWdodDMiLCJwYXJlbnQiOiJlZmZlY3QiLCJ0cmFuc2Zvcm0iOnsieCI6LTQuMTQsInkiOjI2LjE2fX0seyJsZW5ndGgiOjM3LCJuYW1lIjoiZWZmZWN0X2xpZ2h0ZHVzdDMiLCJwYXJlbnQiOiJlZmZlY3QiLCJ0cmFuc2Zvcm0iOnsieCI6NC43MywieSI6MjEuNTQsInNrWCI6LTEwLjA1LCJza1kiOi0xMC4wNSwic2NYIjowLjc4Mywic2NZIjowLjc4M319LHsibmFtZSI6ImVmZmVjdF9yZWQiLCJwYXJlbnQiOiJlZmZlY3QiLCJ0cmFuc2Zvcm0iOnsieCI6NS4xOSwieSI6MjYuODh9fSx7Imxlbmd0aCI6NTcsIm5hbWUiOiJsaWdodGluZyIsInBhcmVudCI6ImJvbmUiLCJ0cmFuc2Zvcm0iOnsieCI6MTUzLjExLCJ5Ijo1Ny4wNCwic2tYIjotODkuMDksInNrWSI6LTg5LjA5LCJzY1giOjAuMzQ2LCJzY1kiOjAuMzQ2fX0seyJsZW5ndGgiOjU5LCJuYW1lIjoibWVsbG93ZHJhZ29uX2xpZ2h0XzAzX2JvZHlfMDEiLCJwYXJlbnQiOiJoaXAiLCJ0cmFuc2Zvcm0iOnsieCI6NC4yLCJ5IjotNS42LCJza1giOi02OC4xMiwic2tZIjotNjguMTJ9fSx7Im5hbWUiOiJtZWxsb3dkcmFnb25fbGlnaHRfMDNfZWZmZWN0X2xpZ2h0IiwicGFyZW50IjoibWVsbG93ZHJhZ29uX2xpZ2h0XzAzX3JvY2tldF8wMSIsInRyYW5zZm9ybSI6eyJ4IjotNTIuNzMsInkiOi0zMC4yMX19LHsibmFtZSI6Im1lbGxvd2RyYWdvbl9saWdodF8wM19lZmZlY3RfbGlnaHQyIiwicGFyZW50IjoibWVsbG93ZHJhZ29uX2xpZ2h0XzAzX3JvY2tldF8wMiIsInRyYW5zZm9ybSI6eyJ4IjotNDMuNjEsInkiOi0yMC4zNn19LHsibGVuZ3RoIjozNywibmFtZSI6Im1lbGxvd2RyYWdvbl9saWdodF8wM19lZmZlY3RfbGlnaHRkdXN0IiwicGFyZW50IjoibWVsbG93ZHJhZ29uX2xpZ2h0XzAzX3JvY2tldF8wMSIsInRyYW5zZm9ybSI6eyJ4IjotNDIuMjcsInkiOi0xNy4wNCwic2tYIjotMTUzLjk3LCJza1kiOi0xNTMuOTcsInNjWCI6MC43ODMsInNjWSI6MC43ODN9fSx7Imxlbmd0aCI6MzYsIm5hbWUiOiJtZWxsb3dkcmFnb25fbGlnaHRfMDNfZWZmZWN0X2xpZ2h0ZHVzdDIiLCJwYXJlbnQiOiJtZWxsb3dkcmFnb25fbGlnaHRfMDNfcm9ja2V0XzAyIiwidHJhbnNmb3JtIjp7IngiOi00Mi45NiwieSI6LTIxLjE0LCJza1giOi0xNTcuOTIsInNrWSI6LTE1Ny45Miwic2NYIjowLjUzMSwic2NZIjowLjUzMX19LHsibGVuZ3RoIjo0NCwibmFtZSI6Im1lbGxvd2RyYWdvbl9saWdodF8wM19sZWdfMDEiLCJwYXJlbnQiOiJoaXAiLCJ0cmFuc2Zvcm0iOnsieCI6MjAuMjcsInkiOjguODEsInNrWCI6MTUwLjQ0LCJza1kiOjE1MC40NH19LHsibGVuZ3RoIjozNSwibmFtZSI6Im1lbGxvd2RyYWdvbl9saWdodF8wM19sZWdfMDIiLCJwYXJlbnQiOiJoaXAiLCJ0cmFuc2Zvcm0iOnsieCI6LTQyLjY1LCJ5IjotMTkuMjYsInNrWCI6MTUzLjYxLCJza1kiOjE1My42MX19LHsibGVuZ3RoIjoxOSwibmFtZSI6Im1lbGxvd2RyYWdvbl9saWdodF8wM19yb2NrZXRfMDFfMDEiLCJwYXJlbnQiOiJtZWxsb3dkcmFnb25fbGlnaHRfMDNfcm9ja2V0XzAxIiwidHJhbnNmb3JtIjp7IngiOi0xNy4xMSwieSI6LTMwLjQ5LCJza1giOi0xMzguODcsInNrWSI6LTEzOC44N319LHsibGVuZ3RoIjoxOCwibmFtZSI6Im1lbGxvd2RyYWdvbl9saWdodF8wM19yb2NrZXRfMDFfMDIiLCJwYXJlbnQiOiJtZWxsb3dkcmFnb25fbGlnaHRfMDNfcm9ja2V0XzAxIiwidHJhbnNmb3JtIjp7IngiOi00OS41MSwieSI6LTE1LjAzLCJza1giOi0xNTcuNzMsInNrWSI6LTE1Ny43M319LHsibGVuZ3RoIjozNiwibmFtZSI6Im1lbGxvd2RyYWdvbl9saWdodF8wM19yb2NrZXRfMDFfMDMiLCJwYXJlbnQiOiJtZWxsb3dkcmFnb25fbGlnaHRfMDNfcm9ja2V0XzAxIiwidHJhbnNmb3JtIjp7IngiOi0zOS43MywieSI6LTIwLjE1LCJza1giOi0xNTEuOTcsInNrWSI6LTE1MS45N319LHsibGVuZ3RoIjozMywibmFtZSI6Im1lbGxvd2RyYWdvbl9saWdodF8wM19yb2NrZXRfMDJfMDEiLCJwYXJlbnQiOiJtZWxsb3dkcmFnb25fbGlnaHRfMDNfcm9ja2V0XzAyIiwidHJhbnNmb3JtIjp7IngiOi0zNC4xNiwieSI6LTE1LjA1LCJza1giOi0xNTAuNDQsInNrWSI6LTE1MC40NH19LHsibGVuZ3RoIjoyOSwibmFtZSI6Im1lbGxvd2RyYWdvbl9saWdodF8wM19yb2NrZXRfMDNfMDEiLCJwYXJlbnQiOiJtZWxsb3dkcmFnb25fbGlnaHRfMDNfcm9ja2V0XzAzIiwidHJhbnNmb3JtIjp7IngiOi0zNy4zLCJ5IjozNS4xMSwic2tYIjo5My4xNSwic2tZIjo5My4xNX19LHsibGVuZ3RoIjoyOCwibmFtZSI6Im1lbGxvd2RyYWdvbl9saWdodF8wM19yb2NrZXRfMDNfMDMiLCJwYXJlbnQiOiJtZWxsb3dkcmFnb25fbGlnaHRfMDNfcm9ja2V0XzAzIiwidHJhbnNmb3JtIjp7IngiOi0xMjQuMDksInkiOi0xNy43LCJza1giOjkzLjE1LCJza1kiOjkzLjE1fX0seyJsZW5ndGgiOjI2LCJuYW1lIjoibWVsbG93ZHJhZ29uX2xpZ2h0XzAzX3RhaWxfMDEiLCJwYXJlbnQiOiJoaXAiLCJ0cmFuc2Zvcm0iOnsieCI6MTMuOTQsInkiOjQuMSwic2tYIjo2Ni41OCwic2tZIjo2Ni41OH19LHsibmFtZSI6Im1vbnN0ZXJlZmZlY3QiLCJwYXJlbnQiOiJoaXAiLCJ0cmFuc2Zvcm0iOnsieCI6OC43OCwieSI6LTMwLjk0fX0seyJsZW5ndGgiOjExLCJuYW1lIjoicm9ja2V0XzA0XzAyIiwicGFyZW50IjoiYm9uZSIsInRyYW5zZm9ybSI6eyJ4IjoxMzAuMjIsInkiOjQ4LjQsInNrWCI6OC41LCJza1kiOjguNX19LHsibGVuZ3RoIjoxMCwibmFtZSI6InJvY2tldF8wNF8wMyIsInBhcmVudCI6ImJvbmUiLCJ0cmFuc2Zvcm0iOnsieCI6MTM1LjAxLCJ5IjozOC44NCwic2tYIjoxOC4yOSwic2tZIjoxOC4yOX19LHsibGVuZ3RoIjo5LCJuYW1lIjoicm9ja2V0XzA0XzA0IiwicGFyZW50IjoiYm9uZSIsInRyYW5zZm9ybSI6eyJ4IjoxMzEuMjIsInkiOjUxLjE5LCJza1giOjYuNzMsInNrWSI6Ni43M319LHsibGVuZ3RoIjoxMCwibmFtZSI6InJvY2tldF8wNF8wNSIsInBhcmVudCI6ImJvbmUiLCJ0cmFuc2Zvcm0iOnsieCI6MTMzLjA4LCJ5Ijo0NC41Nywic2tYIjoxOC43LCJza1kiOjE4Ljd9fSx7Im5hbWUiOiJyb2NrZXRfbGlnaHQiLCJwYXJlbnQiOiJib25lIiwidHJhbnNmb3JtIjp7IngiOjE0MS4yNiwieSI6NDYuOTl9fSx7Imxlbmd0aCI6MzMsIm5hbWUiOiJib25lMjYiLCJwYXJlbnQiOiJtZWxsb3dkcmFnb25fbGlnaHRfMDNfbGVnXzAxIiwidHJhbnNmb3JtIjp7IngiOjQzLjQ3LCJ5IjowLjY3LCJza1giOi0yMC4zLCJza1kiOi0yMC4zfX0seyJsZW5ndGgiOjIzLCJuYW1lIjoiYm9uZTM0IiwicGFyZW50IjoibWVsbG93ZHJhZ29uX2xpZ2h0XzAzX3RhaWxfMDEiLCJ0cmFuc2Zvcm0iOnsieCI6MjYuMjQsInkiOi0wLjEzLCJza1giOi0zNS4wMiwic2tZIjotMzUuMDJ9fSx7Im5hbWUiOiJlZmZlY3RfMDEiLCJwYXJlbnQiOiJidXR0b24iLCJ0cmFuc2Zvcm0iOnsieCI6LTAuODgsInkiOjAuOTMsInNjWCI6MC42MjUsInNjWSI6MC42MjV9fSx7Imxlbmd0aCI6NDIsIm5hbWUiOiJtZWxsb3dkcmFnb25fbGlnaHRfMDNfYXJtXzAxIiwicGFyZW50IjoibWVsbG93ZHJhZ29uX2xpZ2h0XzAzX2JvZHlfMDEiLCJ0cmFuc2Zvcm0iOnsieCI6NTcuOTQsInkiOjEyLjUxLCJza1giOjEyNi40Mywic2tZIjoxMjYuNDN9fSx7Imxlbmd0aCI6MzQsIm5hbWUiOiJtZWxsb3dkcmFnb25fbGlnaHRfMDNfYXJtXzAyIGNvcHkiLCJwYXJlbnQiOiJtZWxsb3dkcmFnb25fbGlnaHRfMDNfYm9keV8wMSIsInRyYW5zZm9ybSI6eyJ4Ijo1NS4zLCJ5IjotMjkuNzEsInNrWCI6LTEyOS44NCwic2tZIjotMTI5Ljg0fX0seyJsZW5ndGgiOjMxLCJuYW1lIjoibWVsbG93ZHJhZ29uX2xpZ2h0XzAzX2Zvb3RfMDIiLCJwYXJlbnQiOiJtZWxsb3dkcmFnb25fbGlnaHRfMDNfbGVnXzAyIiwidHJhbnNmb3JtIjp7IngiOjM0Ljk4LCJ5IjowLjE2LCJza1giOi0xMDkuOTEsInNrWSI6LTEwOS45MX19LHsibGVuZ3RoIjozMCwibmFtZSI6Im1lbGxvd2RyYWdvbl9saWdodF8wM19oZWFkXzAxIiwicGFyZW50IjoibWVsbG93ZHJhZ29uX2xpZ2h0XzAzX2JvZHlfMDEiLCJ0cmFuc2Zvcm0iOnsieCI6NTkuOTIsInkiOjAuMDksInNrWCI6LTExLjIyLCJza1kiOi0xMS4yMn19LHsibGVuZ3RoIjoxMiwibmFtZSI6Im1lbGxvd2RyYWdvbl9saWdodF8wM19zY2FyZl8wMiIsInBhcmVudCI6Im1lbGxvd2RyYWdvbl9saWdodF8wM19ib2R5XzAxIiwidHJhbnNmb3JtIjp7IngiOjY2Ljc3LCJ5IjoyMi45OCwic2tYIjo3OC4zNCwic2tZIjo3OC4zNH19LHsibGVuZ3RoIjozMSwibmFtZSI6Im1lbGxvd2RyYWdvbl9saWdodF8wM193aW5nXzAxIiwicGFyZW50IjoibWVsbG93ZHJhZ29uX2xpZ2h0XzAzX2JvZHlfMDEiLCJ0cmFuc2Zvcm0iOnsieCI6NDguNzcsInkiOjEzLjExLCJza1giOjY3LjczLCJza1kiOjY3LjczfX0seyJsZW5ndGgiOjIwLCJuYW1lIjoibWVsbG93ZHJhZ29uX2xpZ2h0XzAzX3dpbmdfMDIiLCJwYXJlbnQiOiJtZWxsb3dkcmFnb25fbGlnaHRfMDNfYm9keV8wMSIsInRyYW5zZm9ybSI6eyJ4Ijo1Mi42MiwieSI6LTI1Ljc5LCJza1giOi03Ny45OSwic2tZIjotNzcuOTl9fSx7Imxlbmd0aCI6MjUsIm5hbWUiOiJib25lMTkiLCJwYXJlbnQiOiJtZWxsb3dkcmFnb25fbGlnaHRfMDNfd2luZ18wMSIsInRyYW5zZm9ybSI6eyJ4IjozMS4zMiwieSI6LTAuMTQsInNrWCI6LTM2LjcyLCJza1kiOi0zNi43Mn19LHsibGVuZ3RoIjo4LCJuYW1lIjoiYm9uZTI3IiwicGFyZW50IjoiYm9uZTI2IiwidHJhbnNmb3JtIjp7IngiOjMyLjg4LCJ5IjotMC40Miwic2tYIjoxNS40LCJza1kiOjE1LjR9fSx7Imxlbmd0aCI6MTEsIm5hbWUiOiJib25lMzEiLCJwYXJlbnQiOiJtZWxsb3dkcmFnb25fbGlnaHRfMDNfZm9vdF8wMiIsInRyYW5zZm9ybSI6eyJ4IjozMS44NCwieSI6LTAuMzQsInNrWCI6MjAuNywic2tZIjoyMC43fX0seyJsZW5ndGgiOjE5LCJuYW1lIjoiYm9uZTM1IiwicGFyZW50IjoiYm9uZTM0IiwidHJhbnNmb3JtIjp7IngiOjIyLjkyLCJ5IjowLjM2LCJza1giOi0yOS43NCwic2tZIjotMjkuNzR9fSx7Imxlbmd0aCI6MjIsIm5hbWUiOiJib25lMzciLCJwYXJlbnQiOiJtZWxsb3dkcmFnb25fbGlnaHRfMDNfd2luZ18wMiIsInRyYW5zZm9ybSI6eyJ4IjoyMC43MiwieSI6MC4wOCwic2tYIjo0MS4xNSwic2tZIjo0MS4xNX19LHsibGVuZ3RoIjo0MSwibmFtZSI6Im1lbGxvd2RyYWdvbl9saWdodF8wM19lYXJfMDEiLCJwYXJlbnQiOiJtZWxsb3dkcmFnb25fbGlnaHRfMDNfaGVhZF8wMSIsInRyYW5zZm9ybSI6eyJ4Ijo3Ny4yOSwieSI6LTM4Ljc2LCJza1giOi0xNTEuNDgsInNrWSI6LTE1MS40OH19LHsibGVuZ3RoIjo0OCwibmFtZSI6Im1lbGxvd2RyYWdvbl9saWdodF8wM19lYXJfMDIiLCJwYXJlbnQiOiJtZWxsb3dkcmFnb25fbGlnaHRfMDNfaGVhZF8wMSIsInRyYW5zZm9ybSI6eyJ4Ijo2NS44MiwieSI6MzQuMTksInNrWCI6MTUwLjQ0LCJza1kiOjE1MC40NH19LHsibmFtZSI6Im1lbGxvd2RyYWdvbl9saWdodF8wM19leWVfMDEiLCJwYXJlbnQiOiJtZWxsb3dkcmFnb25fbGlnaHRfMDNfaGVhZF8wMSIsInRyYW5zZm9ybSI6eyJ4IjoyNC40NSwieSI6MjEuMzh9fSx7Imxlbmd0aCI6MTUsIm5hbWUiOiJtZWxsb3dkcmFnb25fbGlnaHRfMDNfZ2xvdmVzXzAxIiwicGFyZW50IjoibWVsbG93ZHJhZ29uX2xpZ2h0XzAzX2FybV8wMSIsInRyYW5zZm9ybSI6eyJ4Ijo0Mi44NSwieSI6LTAuMDQsInNrWCI6MTE4Ljg2LCJza1kiOjExOC44Nn19LHsibGVuZ3RoIjoyOSwibmFtZSI6Im1lbGxvd2RyYWdvbl9saWdodF8wM19nb2dnbGVzXzAxIiwicGFyZW50IjoibWVsbG93ZHJhZ29uX2xpZ2h0XzAzX2hlYWRfMDEiLCJ0cmFuc2Zvcm0iOnsieCI6NzkuMTMsInkiOi02Mi45NCwic2tYIjo3NS4zMiwic2tZIjo3NS4zMn19LHsibGVuZ3RoIjozMSwibmFtZSI6Im1lbGxvd2RyYWdvbl9saWdodF8wM19oYW5kXzAxIiwicGFyZW50IjoibWVsbG93ZHJhZ29uX2xpZ2h0XzAzX2FybV8wMiBjb3B5IiwidHJhbnNmb3JtIjp7IngiOjM0LjU3LCJ5IjotMC4wMiwic2tYIjotMTU4LjEyLCJza1kiOi0xNTguMTJ9fSx7Imxlbmd0aCI6MjAsIm5hbWUiOiJtZWxsb3dkcmFnb25fbGlnaHRfMDNfaG9ybl8wMSIsInBhcmVudCI6Im1lbGxvd2RyYWdvbl9saWdodF8wM19oZWFkXzAxIiwidHJhbnNmb3JtIjp7IngiOjk1Ljk5LCJ5IjotMTkuNjUsInNrWCI6LTE4Ljg0LCJza1kiOi0xOC44NH19LHsibGVuZ3RoIjoyMiwibmFtZSI6Im1lbGxvd2RyYWdvbl9saWdodF8wM19ob3JuXzAyIiwicGFyZW50IjoibWVsbG93ZHJhZ29uX2xpZ2h0XzAzX2hlYWRfMDEiLCJ0cmFuc2Zvcm0iOnsieCI6NTguODIsInkiOjIzLjY5LCJza1giOjYwLjAzLCJza1kiOjYwLjAzfX0seyJsZW5ndGgiOjE5LCJuYW1lIjoiYm9uZTEyIiwicGFyZW50IjoibWVsbG93ZHJhZ29uX2xpZ2h0XzAzX2dsb3Zlc18wMSIsInRyYW5zZm9ybSI6eyJ4IjoxNS42MywieSI6MC4wOCwic2tYIjo2LjczLCJza1kiOjYuNzN9fSx7Imxlbmd0aCI6OSwibmFtZSI6ImJvbmUxNSIsInBhcmVudCI6Im1lbGxvd2RyYWdvbl9saWdodF8wM19oYW5kXzAxIiwidHJhbnNmb3JtIjp7IngiOjMxLjMxLCJ5IjowLjA2LCJza1giOi03NS44NSwic2tZIjotNzUuODV9fSx7Imxlbmd0aCI6NTIsIm5hbWUiOiJib25lMjAiLCJwYXJlbnQiOiJib25lMTkiLCJ0cmFuc2Zvcm0iOnsieCI6MjYuNjgsInkiOjAuMzEsInNrWCI6NzcuNTYsInNrWSI6NzcuNTZ9fSx7Imxlbmd0aCI6MTIsIm5hbWUiOiJib25lMjgiLCJwYXJlbnQiOiJib25lMjciLCJ0cmFuc2Zvcm0iOnsieCI6OC42OCwieSI6MC4wMiwic2tYIjoyOC4xNiwic2tZIjoyOC4xNn19LHsibmFtZSI6ImJvbmUzIiwicGFyZW50IjoibWVsbG93ZHJhZ29uX2xpZ2h0XzAzX2V5ZV8wMSIsInRyYW5zZm9ybSI6eyJ4IjoxNC41NywieSI6MC42fX0seyJsZW5ndGgiOjEwLCJuYW1lIjoiYm9uZTMyIiwicGFyZW50IjoiYm9uZTMxIiwidHJhbnNmb3JtIjp7IngiOjExLjM0LCJ5IjowLjA3LCJza1giOjM5LjI2LCJza1kiOjM5LjI2fX0seyJsZW5ndGgiOjI2LCJuYW1lIjoiYm9uZTM4IiwicGFyZW50IjoiYm9uZTM3IiwidHJhbnNmb3JtIjp7IngiOjIyLjg4LCJ5IjowLjEsInNrWCI6LTg1LjQ5LCJza1kiOi04NS40OX19LHsibGVuZ3RoIjozMiwibmFtZSI6ImJvbmU1IiwicGFyZW50IjoibWVsbG93ZHJhZ29uX2xpZ2h0XzAzX2Vhcl8wMiIsInRyYW5zZm9ybSI6eyJ4Ijo0OC4zLCJ5IjotMS4yNCwic2tYIjotMjQuMTcsInNrWSI6LTI0LjE3fX0seyJsZW5ndGgiOjQ2LCJuYW1lIjoiYm9uZTgiLCJwYXJlbnQiOiJtZWxsb3dkcmFnb25fbGlnaHRfMDNfZWFyXzAxIiwidHJhbnNmb3JtIjp7IngiOjQwLjc3LCJ5IjowLjUxLCJza1giOjI4LjUxLCJza1kiOjI4LjUxfX0seyJuYW1lIjoibW9uc3RlcmV5ZV8xIiwicGFyZW50IjoibWVsbG93ZHJhZ29uX2xpZ2h0XzAzX2V5ZV8wMSIsInRyYW5zZm9ybSI6eyJ4IjoxMy40NywieSI6LTI2LjY5fX0seyJuYW1lIjoibW9uc3RlcmV5ZV8yIiwicGFyZW50IjoibWVsbG93ZHJhZ29uX2xpZ2h0XzAzX2V5ZV8wMSIsInRyYW5zZm9ybSI6eyJ4IjoxMC45OSwieSI6MTcuODd9fSx7Imxlbmd0aCI6MzYsIm5hbWUiOiJib25lMjEiLCJwYXJlbnQiOiJib25lMjAiLCJ0cmFuc2Zvcm0iOnsieCI6NTIuMiwieSI6LTAuMDksInNrWCI6MjEuNDgsInNrWSI6MjEuNDh9fSx7Imxlbmd0aCI6MzAsIm5hbWUiOiJib25lMjMiLCJwYXJlbnQiOiJib25lMjAiLCJ0cmFuc2Zvcm0iOnsieCI6NS42MywieSI6NC40NCwic2tYIjozOS41OCwic2tZIjozOS41OH19LHsibGVuZ3RoIjozMSwibmFtZSI6ImJvbmUzOSIsInBhcmVudCI6ImJvbmUzOCIsInRyYW5zZm9ybSI6eyJ4IjoyNi4xNiwieSI6MC4wNSwic2tYIjotMjIuMjYsInNrWSI6LTIyLjI2fX0seyJsZW5ndGgiOjIxLCJuYW1lIjoiYm9uZTQxIiwicGFyZW50IjoiYm9uZTM4IiwidHJhbnNmb3JtIjp7IngiOjIuMDYsInkiOi0zLjU1LCJza1giOi00My42LCJza1kiOi00My42fX0seyJsZW5ndGgiOjI3LCJuYW1lIjoiYm9uZTYiLCJwYXJlbnQiOiJib25lNSIsInRyYW5zZm9ybSI6eyJ4IjozMi4wNSwieSI6LTAuMDksInNrWCI6LTE5LjEsInNrWSI6LTE5LjF9fSx7Imxlbmd0aCI6NDYsIm5hbWUiOiJib25lOSIsInBhcmVudCI6ImJvbmU4IiwidHJhbnNmb3JtIjp7IngiOjQ2LjkxLCJ5IjowLjA3LCJza1giOjE3LjE5LCJza1kiOjE3LjE5fX0seyJuYW1lIjoibWVsbG93ZHJhZ29uX2xpZ2h0XzAzX2pveV8wNSIsInBhcmVudCI6ImJvbmUxMiIsInRyYW5zZm9ybSI6eyJ4Ijo1Ni45NSwieSI6LTQuNzQsInNrWCI6MTc2LjA5LCJza1kiOjE3Ni4wOX19LHsibGVuZ3RoIjozNywibmFtZSI6ImJvbmUyMiIsInBhcmVudCI6ImJvbmUyMSIsInRyYW5zZm9ybSI6eyJ4IjozNi42OSwic2tYIjoxMC4yNiwic2tZIjoxMC4yNn19LHsibGVuZ3RoIjozMywibmFtZSI6ImJvbmUyNCIsInBhcmVudCI6ImJvbmUyMyIsInRyYW5zZm9ybSI6eyJ4IjozMC43MywieSI6MC4wMywic2tYIjoxNy4xOSwic2tZIjoxNy4xOX19LHsibGVuZ3RoIjoyNSwibmFtZSI6ImJvbmU0MCIsInBhcmVudCI6ImJvbmUzOSIsInRyYW5zZm9ybSI6eyJ4IjozMS4yNCwieSI6MC4wMSwic2tYIjotMTkuNTEsInNrWSI6LTE5LjUxfX0seyJsZW5ndGgiOjIxLCJuYW1lIjoiYm9uZTQyIiwicGFyZW50IjoiYm9uZTQxIiwidHJhbnNmb3JtIjp7IngiOjIxLjU4LCJ5IjowLjA3LCJza1giOi0xOS41MSwic2tZIjotMTkuNTF9fSx7Imxlbmd0aCI6MTMsIm5hbWUiOiJtZWxsb3dkcmFnb25fbGlnaHRfMDNfam95XzAxIiwicGFyZW50IjoibWVsbG93ZHJhZ29uX2xpZ2h0XzAzX2pveV8wNSIsInRyYW5zZm9ybSI6eyJ4IjoxMS41NSwieSI6LTguOTgsInNrWCI6LTkwLjksInNrWSI6LTkwLjl9fSx7Imxlbmd0aCI6MTAsIm5hbWUiOiJtZWxsb3dkcmFnb25fbGlnaHRfMDNfaGFuZF8wMV8wMSIsInBhcmVudCI6Im1lbGxvd2RyYWdvbl9saWdodF8wM19qb3lfMDEiLCJ0cmFuc2Zvcm0iOnsieCI6MjguODYsInkiOjAuMjksInNrWCI6LTM4LjIxLCJza1kiOi0zOC4yMX19XSwic2xvdCI6W3siYmxlbmRNb2RlIjoiYWRkIiwibmFtZSI6ImVmZmVjdF9kb3duXzEiLCJwYXJlbnQiOiJlZmZlY3RfZG93bl8xIiwiY29sb3IiOnsiYU0iOjU5fX0seyJibGVuZE1vZGUiOiJhZGQiLCJuYW1lIjoiZWZmZWN0X2Rvd25fMiIsInBhcmVudCI6ImVmZmVjdF9kb3duXzIiLCJjb2xvciI6eyJhTSI6ODh9fSx7ImJsZW5kTW9kZSI6ImFkZCIsIm5hbWUiOiJlZmZlY3RfZG93bl8zIiwicGFyZW50IjoiZWZmZWN0X2JvdHRvbV8xIiwiY29sb3IiOnsiYU0iOjUyfX0seyJibGVuZE1vZGUiOiJhZGQiLCJuYW1lIjoiZWZmZWN0X2Rvd25fNCIsInBhcmVudCI6ImVmZmVjdF9ib3R0b21fMiIsImNvbG9yIjp7ImFNIjo1Mn19LHsiYmxlbmRNb2RlIjoiYWRkIiwibmFtZSI6ImVmZmVjdF9saWdodGR1c3QyIiwicGFyZW50IjoibWVsbG93ZHJhZ29uX2xpZ2h0XzAzX2VmZmVjdF9saWdodGR1c3QyIn0seyJibGVuZE1vZGUiOiJhZGQiLCJuYW1lIjoiZWZmZWN0XzAxIiwicGFyZW50IjoiZWZmZWN0XzAxIn0seyJuYW1lIjoibWVsbG93ZHJhZ29uX2xpZ2h0XzAzX3JvY2tldF8wM18wMyIsInBhcmVudCI6Im1lbGxvd2RyYWdvbl9saWdodF8wM19yb2NrZXRfMDNfMDMifSx7Im5hbWUiOiJtZWxsb3dkcmFnb25fbGlnaHRfMDNfcm9ja2V0XzAzXzAyIiwicGFyZW50IjoiYm9uZTQ5In0seyJuYW1lIjoibWVsbG93ZHJhZ29uX2xpZ2h0XzAzX3JvY2tldF8wM18wMSIsInBhcmVudCI6Im1lbGxvd2RyYWdvbl9saWdodF8wM19yb2NrZXRfMDNfMDEifSx7Im5hbWUiOiJtZWxsb3dkcmFnb25fbGlnaHRfMDNfcm9ja2V0XzAzIiwicGFyZW50IjoibWVsbG93ZHJhZ29uX2xpZ2h0XzAzX3JvY2tldF8wMyJ9LHsiYmxlbmRNb2RlIjoiYWRkIiwibmFtZSI6Im1lbGxvd2RyYWdvbl9saWdodF8wM19yb2NrZXRfMDJfMDEiLCJwYXJlbnQiOiJtZWxsb3dkcmFnb25fbGlnaHRfMDNfcm9ja2V0XzAyXzAxIn0seyJibGVuZE1vZGUiOiJhZGQiLCJuYW1lIjoiZWZmZWN0X2xpZ2h0MiIsInBhcmVudCI6Im1lbGxvd2RyYWdvbl9saWdodF8wM19lZmZlY3RfbGlnaHQyIn0seyJibGVuZE1vZGUiOiJhZGQiLCJuYW1lIjoiZWZmZWN0X2xpZ2h0IiwicGFyZW50IjoibWVsbG93ZHJhZ29uX2xpZ2h0XzAzX2VmZmVjdF9saWdodCJ9LHsibmFtZSI6Im1lbGxvd2RyYWdvbl9saWdodF8wM19yb2NrZXRfMDIiLCJwYXJlbnQiOiJtZWxsb3dkcmFnb25fbGlnaHRfMDNfcm9ja2V0XzAyIn0seyJuYW1lIjoibWVsbG93ZHJhZ29uX2xpZ2h0XzAzX3dpbmdfMDIiLCJwYXJlbnQiOiJtZWxsb3dkcmFnb25fbGlnaHRfMDNfd2luZ18wMiJ9LHsibmFtZSI6Im1lbGxvd2RyYWdvbl9saWdodF8wM193aW5nXzAxIiwicGFyZW50IjoibWVsbG93ZHJhZ29uX2xpZ2h0XzAzX3dpbmdfMDEifSx7Im5hbWUiOiJtZWxsb3dkcmFnb25fbGlnaHRfMDNfdGFpbF8wMSIsInBhcmVudCI6Im1lbGxvd2RyYWdvbl9saWdodF8wM190YWlsXzAxIn0seyJuYW1lIjoibWVsbG93ZHJhZ29uX2xpZ2h0XzAzX3NjYXJmXzAyIiwicGFyZW50IjoibWVsbG93ZHJhZ29uX2xpZ2h0XzAzX3NjYXJmXzAyIn0seyJuYW1lIjoibWVsbG93ZHJhZ29uX2xpZ2h0XzAzX2Vhcl8wMiIsInBhcmVudCI6Im1lbGxvd2RyYWdvbl9saWdodF8wM19lYXJfMDIifSx7Im5hbWUiOiJtZWxsb3dkcmFnb25fbGlnaHRfMDNfYXJtXzAyIiwicGFyZW50IjoibWVsbG93ZHJhZ29uX2xpZ2h0XzAzX2FybV8wMiBjb3B5In0seyJuYW1lIjoibWVsbG93ZHJhZ29uX2xpZ2h0XzAzX2Zvb3RfMDIiLCJwYXJlbnQiOiJtZWxsb3dkcmFnb25fbGlnaHRfMDNfZm9vdF8wMiJ9LHsibmFtZSI6Im1lbGxvd2RyYWdvbl9saWdodF8wM19sZWdfMDIiLCJwYXJlbnQiOiJtZWxsb3dkcmFnb25fbGlnaHRfMDNfbGVnXzAyIn0seyJuYW1lIjoibWVsbG93ZHJhZ29uX2xpZ2h0XzAzX2JvZHlfMDEiLCJwYXJlbnQiOiJtZWxsb3dkcmFnb25fbGlnaHRfMDNfYm9keV8wMSJ9LHsibmFtZSI6Im1lbGxvd2RyYWdvbl9saWdodF8wM19hcm1fMDEiLCJwYXJlbnQiOiJtZWxsb3dkcmFnb25fbGlnaHRfMDNfYXJtXzAxIn0seyJuYW1lIjoibWVsbG93ZHJhZ29uX2xpZ2h0XzAzX2xlZ18wMSIsInBhcmVudCI6Im1lbGxvd2RyYWdvbl9saWdodF8wM19sZWdfMDEifSx7Im5hbWUiOiJtZWxsb3dkcmFnb25fbGlnaHRfMDNfc2NhcmZfMDEiLCJwYXJlbnQiOiJtZWxsb3dkcmFnb25fbGlnaHRfMDNfYm9keV8wMSJ9LHsibmFtZSI6Im1lbGxvd2RyYWdvbl9saWdodF8wM19oZWFkXzAxIiwicGFyZW50IjoibWVsbG93ZHJhZ29uX2xpZ2h0XzAzX2hlYWRfMDEifSx7Im5hbWUiOiJtZWxsb3dkcmFnb25fbGlnaHRfMDNfam95XzA1IiwicGFyZW50IjoibWVsbG93ZHJhZ29uX2xpZ2h0XzAzX2pveV8wNSJ9LHsibmFtZSI6Im1lbGxvd2RyYWdvbl9saWdodF8wM19qb3lfMDRfMDEiLCJwYXJlbnQiOiJtZWxsb3dkcmFnb25fbGlnaHRfMDNfam95XzA1In0seyJuYW1lIjoibWVsbG93ZHJhZ29uX2xpZ2h0XzAzX2pveV8wNCIsInBhcmVudCI6Im1lbGxvd2RyYWdvbl9saWdodF8wM19qb3lfMDUifSx7Im5hbWUiOiJtZWxsb3dkcmFnb25fbGlnaHRfMDNfaGFuZF8wMSIsInBhcmVudCI6Im1lbGxvd2RyYWdvbl9saWdodF8wM19oYW5kXzAxIn0seyJuYW1lIjoibWVsbG93ZHJhZ29uX2xpZ2h0XzAzX2pveV8wM18wMSIsInBhcmVudCI6Im1lbGxvd2RyYWdvbl9saWdodF8wM19qb3lfMDUifSx7Im5hbWUiOiJtZWxsb3dkcmFnb25fbGlnaHRfMDNfam95XzAzIiwicGFyZW50IjoibWVsbG93ZHJhZ29uX2xpZ2h0XzAzX2pveV8wNSJ9LHsibmFtZSI6Im1lbGxvd2RyYWdvbl9saWdodF8wM19qb3lfMDIiLCJwYXJlbnQiOiJtZWxsb3dkcmFnb25fbGlnaHRfMDNfam95XzA1In0seyJuYW1lIjoibWVsbG93ZHJhZ29uX2xpZ2h0XzAzX2pveV8wMSIsInBhcmVudCI6Im1lbGxvd2RyYWdvbl9saWdodF8wM19qb3lfMDEifSx7ImRpc3BsYXlJbmRleCI6LTEsIm5hbWUiOiJtZWxsb3dkcmFnb25fbGlnaHRfMDNfbW91dGhfMDEiLCJwYXJlbnQiOiJtZWxsb3dkcmFnb25fbGlnaHRfMDNfaGVhZF8wMSJ9LHsibmFtZSI6Im1lbGxvd2RyYWdvbl9saWdodF8wM19leWVfMDEiLCJwYXJlbnQiOiJtZWxsb3dkcmFnb25fbGlnaHRfMDNfZXllXzAxIn0seyJuYW1lIjoibWVsbG93ZHJhZ29uX2xpZ2h0XzAzX2Vhcl8wMSIsInBhcmVudCI6Im1lbGxvd2RyYWdvbl9saWdodF8wM19lYXJfMDEifSx7Im5hbWUiOiJtZWxsb3dkcmFnb25fbGlnaHRfMDNfZ2xvdmVzXzAxIiwicGFyZW50IjoibWVsbG93ZHJhZ29uX2xpZ2h0XzAzX2dsb3Zlc18wMSJ9LHsibmFtZSI6Im1lbGxvd2RyYWdvbl9saWdodF8wM19nb2dnbGVzXzAxIiwicGFyZW50IjoibWVsbG93ZHJhZ29uX2xpZ2h0XzAzX2dvZ2dsZXNfMDEifSx7ImRpc3BsYXlJbmRleCI6LTEsIm5hbWUiOiJtZWxsb3dkcmFnb25fbGlnaHRfMDNfaG9ybl8wMSIsInBhcmVudCI6Im1lbGxvd2RyYWdvbl9saWdodF8wM19ob3JuXzAxIn0seyJuYW1lIjoibWVsbG93ZHJhZ29uX2xpZ2h0XzAzX2hvcm5fMDIiLCJwYXJlbnQiOiJtZWxsb3dkcmFnb25fbGlnaHRfMDNfaG9ybl8wMiJ9LHsibmFtZSI6Im1lbGxvd2RyYWdvbl9saWdodF8wM19oYW5kXzAxXzAxIiwicGFyZW50IjoibWVsbG93ZHJhZ29uX2xpZ2h0XzAzX2hhbmRfMDFfMDEifSx7ImJsZW5kTW9kZSI6ImFkZCIsIm5hbWUiOiJtZWxsb3dkcmFnb25fbGlnaHRfMDNfcm9ja2V0XzAxXzAzIiwicGFyZW50IjoibWVsbG93ZHJhZ29uX2xpZ2h0XzAzX3JvY2tldF8wMV8wMyJ9LHsibmFtZSI6Im1lbGxvd2RyYWdvbl9saWdodF8wM19yb2NrZXRfMDFfMDIiLCJwYXJlbnQiOiJtZWxsb3dkcmFnb25fbGlnaHRfMDNfcm9ja2V0XzAxXzAyIn0seyJuYW1lIjoibWVsbG93ZHJhZ29uX2xpZ2h0XzAzX3JvY2tldF8wMSIsInBhcmVudCI6Im1lbGxvd2RyYWdvbl9saWdodF8wM19yb2NrZXRfMDEifSx7Im5hbWUiOiJtZWxsb3dkcmFnb25fbGlnaHRfMDNfcm9ja2V0XzAxXzAxIiwicGFyZW50IjoibWVsbG93ZHJhZ29uX2xpZ2h0XzAzX3JvY2tldF8wMV8wMSJ9LHsibmFtZSI6Im1lbGxvd2RyYWdvbl9saWdodF8wM19lZmZlY3RfMDgiLCJwYXJlbnQiOiJidXR0b24ifSx7Im5hbWUiOiJtZWxsb3dkcmFnb25fbGlnaHRfMDNfcm9ja2V0XzA0XzA1IiwicGFyZW50Ijoicm9ja2V0XzA0XzA1In0seyJuYW1lIjoibWVsbG93ZHJhZ29uX2xpZ2h0XzAzX3JvY2tldF8wNF8wNCIsInBhcmVudCI6InJvY2tldF8wNF8wNCJ9LHsibmFtZSI6Im1lbGxvd2RyYWdvbl9saWdodF8wM19yb2NrZXRfMDQiLCJwYXJlbnQiOiJib25lIn0seyJibGVuZE1vZGUiOiJhZGQiLCJuYW1lIjoicm9ja2V0X2xpZ2h0IiwicGFyZW50Ijoicm9ja2V0X2xpZ2h0In0seyJibGVuZE1vZGUiOiJhZGQiLCJuYW1lIjoiZWZmZWN0XzA0XzAxIiwicGFyZW50IjoiZWZmZWN0XzA0XzAxIn0seyJuYW1lIjoibWVsbG93ZHJhZ29uX2xpZ2h0XzAzX3JvY2tldF8wNF8wMyIsInBhcmVudCI6InJvY2tldF8wNF8wMyJ9LHsibmFtZSI6Im1lbGxvd2RyYWdvbl9saWdodF8wM19yb2NrZXRfMDRfMDIiLCJwYXJlbnQiOiJyb2NrZXRfMDRfMDIifSx7ImJsZW5kTW9kZSI6ImFkZCIsImRpc3BsYXlJbmRleCI6MSwibmFtZSI6ImVmZmVjdF9saWdodGluZyIsInBhcmVudCI6ImxpZ2h0aW5nIn0seyJibGVuZE1vZGUiOiJhZGQiLCJuYW1lIjoiZWZmZWN0X2xpZ2h0ZHVzdCIsInBhcmVudCI6Im1lbGxvd2RyYWdvbl9saWdodF8wM19lZmZlY3RfbGlnaHRkdXN0In0seyJibGVuZE1vZGUiOiJhZGQiLCJuYW1lIjoiZWZmZWN0X2xpZ2h0ZHVzdDMiLCJwYXJlbnQiOiJlZmZlY3RfbGlnaHRkdXN0MyJ9LHsiYmxlbmRNb2RlIjoiYWRkIiwibmFtZSI6ImVmZmVjdF9saWdodDMiLCJwYXJlbnQiOiJlZmZlY3RfbGlnaHQzIn0seyJibGVuZE1vZGUiOiJhZGQiLCJuYW1lIjoiZWZmZWN0XzAyIiwicGFyZW50IjoiZWZmZWN0XzAyIn0seyJibGVuZE1vZGUiOiJhZGQiLCJuYW1lIjoiZWZmZWN0XzAzIiwicGFyZW50IjoiZWZmZWN0XzAzIn0seyJibGVuZE1vZGUiOiJhZGQiLCJuYW1lIjoiZWZmZWN0XzA0IiwicGFyZW50IjoiZWZmZWN0XzA0In0seyJibGVuZE1vZGUiOiJhZGQiLCJkaXNwbGF5SW5kZXgiOjEsIm5hbWUiOiJlZmZlY3RfMDUiLCJwYXJlbnQiOiJhcnJvdyJ9LHsiYmxlbmRNb2RlIjoiYWRkIiwiZGlzcGxheUluZGV4IjoxLCJuYW1lIjoiZWZmZWN0XzUiLCJwYXJlbnQiOiJhcnJvdzIifSx7ImJsZW5kTW9kZSI6ImFkZCIsImRpc3BsYXlJbmRleCI6MSwibmFtZSI6ImVmZmVjdF82IiwicGFyZW50IjoiYXJyb3czIn0seyJibGVuZE1vZGUiOiJhZGQiLCJuYW1lIjoiZWZmZWN0X2ZpcmUiLCJwYXJlbnQiOiJlZmZlY3RfZmlyZSJ9LHsiYmxlbmRNb2RlIjoiYWRkIiwibmFtZSI6ImVmZmVjdF9yZWQiLCJwYXJlbnQiOiJlZmZlY3RfcmVkIn0seyJibGVuZE1vZGUiOiJhZGQiLCJuYW1lIjoiZWZmZWN0XzA3IiwicGFyZW50IjoiYnV0dG9uIn0seyJibGVuZE1vZGUiOiJhZGQiLCJuYW1lIjoiZWZmZWN0X2JsdWUiLCJwYXJlbnQiOiJlZmZlY3RfYmx1ZSJ9XSwiaWsiOlt7ImJlbmRQb3NpdGl2ZSI6ZmFsc2UsImNoYWluIjoxLCJuYW1lIjoibGVnX2wiLCJib25lIjoiYm9uZTI2IiwidGFyZ2V0IjoibGVnX2wifSx7ImJlbmRQb3NpdGl2ZSI6ZmFsc2UsImNoYWluIjoxLCJuYW1lIjoibGVnX3IiLCJib25lIjoibWVsbG93ZHJhZ29uX2xpZ2h0XzAzX2Zvb3RfMDIiLCJ0YXJnZXQiOiJsZWdfciJ9XSwic2tpbiI6W3sic2xvdCI6W3sibmFtZSI6ImVmZmVjdF9saWdodGR1c3QiLCJkaXNwbGF5IjpbeyJuYW1lIjoibWVsbG93ZHJhZ29uX2xpZ2h0XzAzX2VmZmVjdF9saWdodGR1c3QiLCJ0cmFuc2Zvcm0iOnsieCI6MzQuNTMsInkiOjMuMTMsInNrWCI6OTAsInNrWSI6OTB9fV19LHsibmFtZSI6Im1lbGxvd2RyYWdvbl9saWdodF8wM19yb2NrZXRfMDNfMDMiLCJkaXNwbGF5IjpbeyJuYW1lIjoibWVsbG93ZHJhZ29uX2xpZ2h0XzAzX3JvY2tldF8wM18wMyIsInRyYW5zZm9ybSI6eyJ4IjoyOS45MywieSI6LTAuNjYsInNrWCI6LTkzLjE1LCJza1kiOi05My4xNX19XX0seyJuYW1lIjoibWVsbG93ZHJhZ29uX2xpZ2h0XzAzX3JvY2tldF8wMiIsImRpc3BsYXkiOlt7Im5hbWUiOiJtZWxsb3dkcmFnb25fbGlnaHRfMDNfcm9ja2V0XzAyIiwidHJhbnNmb3JtIjp7IngiOi0xLjk5LCJ5Ijo3LjY4fX1dfSx7Im5hbWUiOiJtZWxsb3dkcmFnb25fbGlnaHRfMDNfam95XzAzXzAxIiwiZGlzcGxheSI6W3sibmFtZSI6Im1lbGxvd2RyYWdvbl9saWdodF8wM19qb3lfMDNfMDEiLCJ0cmFuc2Zvcm0iOnsieCI6LTI0LjY5LCJ5IjotMTQuNTJ9fV19LHsibmFtZSI6ImVmZmVjdF82IiwiZGlzcGxheSI6W3sibmFtZSI6Im1lbGxvd2RyYWdvbl9saWdodF8wM19lZmZlY3RfMDUifSx7Im5hbWUiOiJtZWxsb3dkcmFnb25fbGlnaHRfMDNfZWZmZWN0XzA2In1dfSx7Im5hbWUiOiJlZmZlY3RfbGlnaHRkdXN0MyIsImRpc3BsYXkiOlt7Im5hbWUiOiJtZWxsb3dkcmFnb25fbGlnaHRfMDNfZWZmZWN0X2xpZ2h0ZHVzdCIsInRyYW5zZm9ybSI6eyJ4IjozNC41MywieSI6My4xMywic2tYIjo5MCwic2tZIjo5MH19XX0seyJuYW1lIjoibWVsbG93ZHJhZ29uX2xpZ2h0XzAzX21vdXRoXzAxIiwiZGlzcGxheSI6W3sibmFtZSI6Im1lbGxvd2RyYWdvbl9saWdodF8wM19tb3V0aF8wMSIsInRyYW5zZm9ybSI6eyJ4IjoxMC44NywieSI6MTguNzMsInNrWCI6NzkuMzQsInNrWSI6NzkuMzR9fV19LHsibmFtZSI6Im1lbGxvd2RyYWdvbl9saWdodF8wM19mb290XzAyIiwiZGlzcGxheSI6W3sidHlwZSI6Im1lc2giLCJuYW1lIjoibWVsbG93ZHJhZ29uX2xpZ2h0XzAzX2Zvb3RfMDIiLCJvZmZzZXQiOjAsInVzZXJFZGdlcyI6W119XX0seyJuYW1lIjoibWVsbG93ZHJhZ29uX2xpZ2h0XzAzX2V5ZV8wMSIsImRpc3BsYXkiOlt7InR5cGUiOiJtZXNoIiwibmFtZSI6Im1lbGxvd2RyYWdvbl9saWdodF8wM19leWVfMDEiLCJvZmZzZXQiOjMyOCwidXNlckVkZ2VzIjpbXX0seyJuYW1lIjoibWVsbG93ZHJhZ29uX2xpZ2h0XzAzX2V5ZV8wMiIsInRyYW5zZm9ybSI6eyJ4IjoxNi4wMiwieSI6LTExLjYzLCJza1giOjc5LjM0LCJza1kiOjc5LjM0fX0seyJuYW1lIjoibWVsbG93ZHJhZ29uX2xpZ2h0XzAzX2V5ZV8wMyIsInRyYW5zZm9ybSI6eyJ4IjoxNC45NywieSI6LTExLjU2LCJza1giOjc5LjM0LCJza1kiOjc5LjM0fX0seyJuYW1lIjoibWVsbG93ZHJhZ29uX2xpZ2h0XzAzX2V5ZV8wNCIsInRyYW5zZm9ybSI6eyJ4IjoxNC45NywieSI6LTExLjU2LCJza1giOjc5LjM0LCJza1kiOjc5LjM0fX1dfSx7Im5hbWUiOiJlZmZlY3RfMDEiLCJkaXNwbGF5IjpbeyJuYW1lIjoibWVsbG93ZHJhZ29uX2xpZ2h0XzAzX2VmZmVjdF8wMSJ9XX0seyJuYW1lIjoibWVsbG93ZHJhZ29uX2xpZ2h0XzAzX3JvY2tldF8wNCIsImRpc3BsYXkiOlt7Im5hbWUiOiJtZWxsb3dkcmFnb25fbGlnaHRfMDNfcm9ja2V0XzA0IiwidHJhbnNmb3JtIjp7IngiOi0xMC40MSwieSI6NS4zOH19XX0seyJuYW1lIjoiZWZmZWN0X2xpZ2h0IiwiZGlzcGxheSI6W3sibmFtZSI6Im1lbGxvd2RyYWdvbl9saWdodF8wM19lZmZlY3RfbGlnaHQifV19LHsibmFtZSI6Im1lbGxvd2RyYWdvbl9saWdodF8wM19yb2NrZXRfMDFfMDMiLCJkaXNwbGF5IjpbeyJuYW1lIjoibWVsbG93ZHJhZ29uX2xpZ2h0XzAzX3JvY2tldF8wMV8wMyIsInRyYW5zZm9ybSI6eyJ4Ijo0Ny42OCwieSI6LTMuMjUsInNrWCI6MTUxLjk3LCJza1kiOjE1MS45N319XX0seyJuYW1lIjoibWVsbG93ZHJhZ29uX2xpZ2h0XzAzX2FybV8wMiIsImRpc3BsYXkiOlt7Im5hbWUiOiJtZWxsb3dkcmFnb25fbGlnaHRfMDNfYXJtXzAyIiwidHJhbnNmb3JtIjp7IngiOjE2LjY3LCJ5IjotMS45OCwic2tYIjoxNjguNywic2tZIjoxNjguN319XX0seyJuYW1lIjoiZWZmZWN0X2ZpcmUiLCJkaXNwbGF5IjpbeyJuYW1lIjoibWVsbG93ZHJhZ29uX2xpZ2h0XzAzX2VmZmVjdF9maXJlIiwidHJhbnNmb3JtIjp7IngiOjY3Ljc1LCJ5IjotNC4xNSwic2tYIjo5My4xNSwic2tZIjo5My4xNX19XX0seyJuYW1lIjoiZWZmZWN0X2xpZ2h0MyIsImRpc3BsYXkiOlt7Im5hbWUiOiJtZWxsb3dkcmFnb25fbGlnaHRfMDNfZWZmZWN0X2xpZ2h0In1dfSx7Im5hbWUiOiJyb2NrZXRfbGlnaHQiLCJkaXNwbGF5IjpbeyJuYW1lIjoibWVsbG93ZHJhZ29uX2xpZ2h0XzAzX3JvY2tldF8wNF8wNiIsInRyYW5zZm9ybSI6eyJ4IjowLjQ2LCJ5IjowLjM0fX1dfSx7Im5hbWUiOiJtZWxsb3dkcmFnb25fbGlnaHRfMDNfcm9ja2V0XzAxXzAyIiwiZGlzcGxheSI6W3sibmFtZSI6Im1lbGxvd2RyYWdvbl9saWdodF8wM19yb2NrZXRfMDFfMDIiLCJ0cmFuc2Zvcm0iOnsieCI6NDQuMSwieSI6LTAuMDYsInNrWCI6MTU3LjczLCJza1kiOjE1Ny43M319XX0seyJuYW1lIjoibWVsbG93ZHJhZ29uX2xpZ2h0XzAzX2pveV8wMSIsImRpc3BsYXkiOlt7Im5hbWUiOiJtZWxsb3dkcmFnb25fbGlnaHRfMDNfam95XzAxIiwidHJhbnNmb3JtIjp7IngiOjIwLjU1LCJ5IjotMC45Miwic2tYIjo5MC45LCJza1kiOjkwLjl9fV19LHsibmFtZSI6Im1lbGxvd2RyYWdvbl9saWdodF8wM19lYXJfMDEiLCJkaXNwbGF5IjpbeyJ0eXBlIjoibWVzaCIsIm5hbWUiOiJtZWxsb3dkcmFnb25fbGlnaHRfMDNfZWFyXzAxIiwib2Zmc2V0Ijo0ODYsInVzZXJFZGdlcyI6W119XX0seyJuYW1lIjoiZWZmZWN0X2xpZ2h0ZHVzdDIiLCJkaXNwbGF5IjpbeyJuYW1lIjoibWVsbG93ZHJhZ29uX2xpZ2h0XzAzX2VmZmVjdF9saWdodGR1c3QiLCJ0cmFuc2Zvcm0iOnsieCI6MzIuNjcsInkiOi0wLjYzLCJza1giOjk4Ljk0LCJza1kiOjk4Ljk0fX1dfSx7Im5hbWUiOiJtZWxsb3dkcmFnb25fbGlnaHRfMDNfam95XzAyIiwiZGlzcGxheSI6W3sibmFtZSI6Im1lbGxvd2RyYWdvbl9saWdodF8wM19qb3lfMDIiLCJ0cmFuc2Zvcm0iOnsieCI6MTEuMywieSI6LTkuNTJ9fV19LHsibmFtZSI6Im1lbGxvd2RyYWdvbl9saWdodF8wM19oYW5kXzAxIiwiZGlzcGxheSI6W3sibmFtZSI6Im1lbGxvd2RyYWdvbl9saWdodF8wM19oYW5kXzAxIiwidHJhbnNmb3JtIjp7IngiOjE2LjgyLCJ5IjoxLjk0LCJza1giOi0zLjksInNrWSI6LTMuOX19XX0seyJuYW1lIjoibWVsbG93ZHJhZ29uX2xpZ2h0XzAzX2Vhcl8wMiIsImRpc3BsYXkiOlt7InR5cGUiOiJtZXNoIiwibmFtZSI6Im1lbGxvd2RyYWdvbl9saWdodF8wM19lYXJfMDIiLCJvZmZzZXQiOjc4MiwidXNlckVkZ2VzIjpbXX1dfSx7Im5hbWUiOiJtZWxsb3dkcmFnb25fbGlnaHRfMDNfc2NhcmZfMDEiLCJkaXNwbGF5IjpbeyJuYW1lIjoibWVsbG93ZHJhZ29uX2xpZ2h0XzAzX3NjYXJmXzAxIiwidHJhbnNmb3JtIjp7IngiOjU0LjgxLCJ5IjotNi4wNSwic2tYIjo2OC4xMiwic2tZIjo2OC4xMn19XX0seyJuYW1lIjoiZWZmZWN0XzAyIiwiZGlzcGxheSI6W3sibmFtZSI6Im1lbGxvd2RyYWdvbl9saWdodF8wM19lZmZlY3RfMDIifV19LHsibmFtZSI6ImVmZmVjdF9saWdodDIiLCJkaXNwbGF5IjpbeyJuYW1lIjoibWVsbG93ZHJhZ29uX2xpZ2h0XzAzX2VmZmVjdF9saWdodCJ9XX0seyJuYW1lIjoibWVsbG93ZHJhZ29uX2xpZ2h0XzAzX2pveV8wNCIsImRpc3BsYXkiOlt7Im5hbWUiOiJtZWxsb3dkcmFnb25fbGlnaHRfMDNfam95XzA0IiwidHJhbnNmb3JtIjp7IngiOi03LjY5LCJ5IjotMTkuNTJ9fV19LHsibmFtZSI6ImVmZmVjdF9yZWQiLCJkaXNwbGF5IjpbeyJuYW1lIjoibWVsbG93ZHJhZ29uX2xpZ2h0XzAzX2VmZmVjdF9yZWQifV19LHsibmFtZSI6ImVmZmVjdF9kb3duXzQiLCJkaXNwbGF5IjpbeyJuYW1lIjoibWVsbG93ZHJhZ29uX2xpZ2h0XzAzX3JvY2tldF8wM18wNSIsInRyYW5zZm9ybSI6eyJ4Ijo0NC4zMiwieSI6LTguOTQsInNrWCI6OTEuMzYsInNrWSI6OTEuMzZ9fV19LHsibmFtZSI6ImVmZmVjdF8wNF8wMSIsImRpc3BsYXkiOlt7Im5hbWUiOiJtZWxsb3dkcmFnb25fbGlnaHRfMDNfcm9ja2V0XzA0XzAxIiwidHJhbnNmb3JtIjp7IngiOjYuNjEsInkiOi0yLjEsInNrWCI6MTc0LjU1LCJza1kiOjE3NC41NX19XX0seyJuYW1lIjoibWVsbG93ZHJhZ29uX2xpZ2h0XzAzX3JvY2tldF8wMl8wMSIsImRpc3BsYXkiOlt7Im5hbWUiOiJtZWxsb3dkcmFnb25fbGlnaHRfMDNfcm9ja2V0XzAyXzAxIiwidHJhbnNmb3JtIjp7IngiOjQ1LjAxLCJ5IjotNy4xMiwic2tYIjoxMzguNTksInNrWSI6MTM4LjU5fX1dfSx7Im5hbWUiOiJtZWxsb3dkcmFnb25fbGlnaHRfMDNfcm9ja2V0XzAxIiwiZGlzcGxheSI6W3sibmFtZSI6Im1lbGxvd2RyYWdvbl9saWdodF8wM19yb2NrZXRfMDEiLCJ0cmFuc2Zvcm0iOnsieCI6Ny4xNCwieSI6MTEuMzF9fV19LHsibmFtZSI6Im1lbGxvd2RyYWdvbl9saWdodF8wM19qb3lfMDRfMDEiLCJkaXNwbGF5IjpbeyJuYW1lIjoibWVsbG93ZHJhZ29uX2xpZ2h0XzAzX2pveV8wNF8wMSIsInRyYW5zZm9ybSI6eyJ4IjotOC4xOSwieSI6LTIyLjUyfX1dfSx7Im5hbWUiOiJtZWxsb3dkcmFnb25fbGlnaHRfMDNfZ2xvdmVzXzAxIiwiZGlzcGxheSI6W3sidHlwZSI6Im1lc2giLCJuYW1lIjoibWVsbG93ZHJhZ29uX2xpZ2h0XzAzX2dsb3Zlc18wMSIsIm9mZnNldCI6MTU3NiwidXNlckVkZ2VzIjpbXX1dfSx7Im5hbWUiOiJlZmZlY3RfMDciLCJkaXNwbGF5IjpbeyJuYW1lIjoibWVsbG93ZHJhZ29uX2xpZ2h0XzAzX2VmZmVjdF8wNyIsInRyYW5zZm9ybSI6eyJ4IjowLjI1LCJ5IjotMC4wOH19XX0seyJuYW1lIjoiZWZmZWN0XzAzIiwiZGlzcGxheSI6W3sibmFtZSI6Im1lbGxvd2RyYWdvbl9saWdodF8wM19lZmZlY3RfMDMifV19LHsibmFtZSI6Im1lbGxvd2RyYWdvbl9saWdodF8wM19yb2NrZXRfMDRfMDMiLCJkaXNwbGF5IjpbeyJuYW1lIjoibWVsbG93ZHJhZ29uX2xpZ2h0XzAzX3JvY2tldF8wNF8wMyIsInRyYW5zZm9ybSI6eyJ4IjoxNi41NywieSI6LTAuODQsInNrWCI6LTE4LjI5LCJza1kiOi0xOC4yOX19XX0seyJuYW1lIjoibWVsbG93ZHJhZ29uX2xpZ2h0XzAzX3JvY2tldF8wMV8wMSIsImRpc3BsYXkiOlt7Im5hbWUiOiJtZWxsb3dkcmFnb25fbGlnaHRfMDNfcm9ja2V0XzAxXzAxIiwidHJhbnNmb3JtIjp7IngiOjE4Ljg0LCJ5IjotMS41OSwic2tYIjoxMzguODcsInNrWSI6MTM4Ljg3fX1dfSx7Im5hbWUiOiJtZWxsb3dkcmFnb25fbGlnaHRfMDNfZ29nZ2xlc18wMSIsImRpc3BsYXkiOlt7Im5hbWUiOiJtZWxsb3dkcmFnb25fbGlnaHRfMDNfZ29nZ2xlc18wMSIsInRyYW5zZm9ybSI6eyJ4Ijo1Ny41MSwieSI6MTcuOTEsInNrWCI6NC4wMSwic2tZIjo0LjAxfX1dfSx7Im5hbWUiOiJlZmZlY3RfMDQiLCJkaXNwbGF5IjpbeyJuYW1lIjoibWVsbG93ZHJhZ29uX2xpZ2h0XzAzX2VmZmVjdF8wNCJ9XX0seyJuYW1lIjoibWVsbG93ZHJhZ29uX2xpZ2h0XzAzX3JvY2tldF8wNF8wMiIsImRpc3BsYXkiOlt7Im5hbWUiOiJtZWxsb3dkcmFnb25fbGlnaHRfMDNfcm9ja2V0XzA0XzAyIiwidHJhbnNmb3JtIjp7IngiOjIxLjU2LCJ5IjowLjYzLCJza1giOi04LjUsInNrWSI6LTguNX19XX0seyJuYW1lIjoibWVsbG93ZHJhZ29uX2xpZ2h0XzAzX3NjYXJmXzAyIiwiZGlzcGxheSI6W3sibmFtZSI6Im1lbGxvd2RyYWdvbl9saWdodF8wM19zY2FyZl8wMiIsInRyYW5zZm9ybSI6eyJ4Ijo4LjMzLCJ5IjotMi4yMywic2tYIjotMTAuMjEsInNrWSI6LTEwLjIxfX1dfSx7Im5hbWUiOiJtZWxsb3dkcmFnb25fbGlnaHRfMDNfZWZmZWN0XzA4IiwiZGlzcGxheSI6W3sibmFtZSI6Im1lbGxvd2RyYWdvbl9saWdodF8wM19lZmZlY3RfMDgifSx7Im5hbWUiOiJtZWxsb3dkcmFnb25fbGlnaHRfMDNfZWZmZWN0XzA5In1dfSx7Im5hbWUiOiJtZWxsb3dkcmFnb25fbGlnaHRfMDNfbGVnXzAxIiwiZGlzcGxheSI6W3sidHlwZSI6Im1lc2giLCJuYW1lIjoibWVsbG93ZHJhZ29uX2xpZ2h0XzAzX2xlZ18wMSIsIm9mZnNldCI6MTg3OSwidXNlckVkZ2VzIjpbXX1dfSx7Im5hbWUiOiJlZmZlY3RfYmx1ZSIsImRpc3BsYXkiOlt7Im5hbWUiOiJtZWxsb3dkcmFnb25fbGlnaHRfMDNfZWZmZWN0X2JsdWUiLCJ0cmFuc2Zvcm0iOnsieCI6MTIuMzgsInkiOjAuMzUsInNrWCI6LTIuMjUsInNrWSI6LTIuMjV9fV19LHsibmFtZSI6ImVmZmVjdF9kb3duXzMiLCJkaXNwbGF5IjpbeyJuYW1lIjoibWVsbG93ZHJhZ29uX2xpZ2h0XzAzX3JvY2tldF8wM18wNSIsInRyYW5zZm9ybSI6eyJ4Ijo0NC4zMiwieSI6LTguOTQsInNrWCI6OTEuMzYsInNrWSI6OTEuMzZ9fV19LHsibmFtZSI6Im1lbGxvd2RyYWdvbl9saWdodF8wM19yb2NrZXRfMDMiLCJkaXNwbGF5IjpbeyJuYW1lIjoibWVsbG93ZHJhZ29uX2xpZ2h0XzAzX3JvY2tldF8wMyIsInRyYW5zZm9ybSI6eyJ4IjotNC41NiwieSI6LTQuMjZ9fV19LHsibmFtZSI6Im1lbGxvd2RyYWdvbl9saWdodF8wM190YWlsXzAxIiwiZGlzcGxheSI6W3sidHlwZSI6Im1lc2giLCJuYW1lIjoibWVsbG93ZHJhZ29uX2xpZ2h0XzAzX3RhaWxfMDEiLCJvZmZzZXQiOjIyNDksInVzZXJFZGdlcyI6W119XX0seyJuYW1lIjoibWVsbG93ZHJhZ29uX2xpZ2h0XzAzX2hvcm5fMDEiLCJkaXNwbGF5IjpbeyJuYW1lIjoibWVsbG93ZHJhZ29uX2xpZ2h0XzAzX2hvcm5fMDEiLCJ0cmFuc2Zvcm0iOnsieCI6MjIuMTMsInkiOjEuMTIsInNrWCI6OTguMTgsInNrWSI6OTguMTh9fV19LHsibmFtZSI6ImVmZmVjdF8wNSIsImRpc3BsYXkiOlt7Im5hbWUiOiJtZWxsb3dkcmFnb25fbGlnaHRfMDNfZWZmZWN0XzA1In0seyJuYW1lIjoibWVsbG93ZHJhZ29uX2xpZ2h0XzAzX2VmZmVjdF8wNiJ9XX0seyJuYW1lIjoibWVsbG93ZHJhZ29uX2xpZ2h0XzAzX3JvY2tldF8wM18wMSIsImRpc3BsYXkiOlt7Im5hbWUiOiJtZWxsb3dkcmFnb25fbGlnaHRfMDNfcm9ja2V0XzAzXzAxIiwidHJhbnNmb3JtIjp7IngiOjMzLjU1LCJ5IjotMi4wNywic2tYIjotOTMuMTUsInNrWSI6LTkzLjE1fX1dfSx7Im5hbWUiOiJtZWxsb3dkcmFnb25fbGlnaHRfMDNfcm9ja2V0XzA0XzA1IiwiZGlzcGxheSI6W3sibmFtZSI6Im1lbGxvd2RyYWdvbl9saWdodF8wM19yb2NrZXRfMDRfMDUiLCJ0cmFuc2Zvcm0iOnsieCI6MTMuOTIsInkiOjAuNTgsInNrWCI6LTIzLjUxLCJza1kiOi0yMy41MX19XX0seyJuYW1lIjoibWVsbG93ZHJhZ29uX2xpZ2h0XzAzX2FybV8wMSIsImRpc3BsYXkiOlt7Im5hbWUiOiJtZWxsb3dkcmFnb25fbGlnaHRfMDNfYXJtXzAxIiwidHJhbnNmb3JtIjp7IngiOjE5LjMsInkiOjIuOTgsInNrWCI6LTU4LjMxLCJza1kiOi01OC4zMX19XX0seyJuYW1lIjoibWVsbG93ZHJhZ29uX2xpZ2h0XzAzX2hvcm5fMDIiLCJkaXNwbGF5IjpbeyJuYW1lIjoibWVsbG93ZHJhZ29uX2xpZ2h0XzAzX2hvcm5fMDEiLCJ0cmFuc2Zvcm0iOnsieCI6MjQuMjcsInkiOi0zLjgsInNrWCI6MjkuMjUsInNrWSI6MjkuMjV9fV19LHsibmFtZSI6Im1lbGxvd2RyYWdvbl9saWdodF8wM19qb3lfMDUiLCJkaXNwbGF5IjpbeyJuYW1lIjoibWVsbG93ZHJhZ29uX2xpZ2h0XzAzX2pveV8wNSIsInRyYW5zZm9ybSI6eyJ4IjotMC42OSwieSI6LTEuNTJ9fV19LHsibmFtZSI6ImVmZmVjdF9saWdodGluZyIsImRpc3BsYXkiOlt7Im5hbWUiOiJtZWxsb3dkcmFnb25fbGlnaHRfMDNfcm9ja2V0XzA0XzA3IiwidHJhbnNmb3JtIjp7IngiOjQxLjE0LCJ5IjotMjcuNDIsInNrWCI6ODkuMDksInNrWSI6ODkuMDl9fSx7Im5hbWUiOiJtZWxsb3dkcmFnb25fbGlnaHRfMDNfcm9ja2V0XzA0XzA4IiwidHJhbnNmb3JtIjp7IngiOjQ2LjI2LCJ5IjotNjAuNjEsInNrWCI6LTg1LjQ3LCJza1kiOi04NS40Nywic2NYIjowLjc2LCJzY1kiOjAuNzZ9fV19LHsibmFtZSI6Im1lbGxvd2RyYWdvbl9saWdodF8wM193aW5nXzAxIiwiZGlzcGxheSI6W3sidHlwZSI6Im1lc2giLCJuYW1lIjoibWVsbG93ZHJhZ29uX2xpZ2h0XzAzX3dpbmdfMDEiLCJvZmZzZXQiOjI0NTgsInVzZXJFZGdlcyI6W119XX0seyJuYW1lIjoibWVsbG93ZHJhZ29uX2xpZ2h0XzAzX2JvZHlfMDEiLCJkaXNwbGF5IjpbeyJ0eXBlIjoibWVzaCIsIm5hbWUiOiJtZWxsb3dkcmFnb25fbGlnaHRfMDNfYm9keV8wMSIsIm9mZnNldCI6MzM5NiwidXNlckVkZ2VzIjpbXX1dfSx7Im5hbWUiOiJlZmZlY3RfZG93bl8yIiwiZGlzcGxheSI6W3sibmFtZSI6Im1lbGxvd2RyYWdvbl9saWdodF8wM19yb2NrZXRfMDNfMDQiLCJ0cmFuc2Zvcm0iOnsieCI6NDkuMjMsInkiOi0zLjYxLCJza1giOi05Mi43Miwic2tZIjotOTIuNzJ9fV19LHsibmFtZSI6ImVmZmVjdF9kb3duXzEiLCJkaXNwbGF5IjpbeyJuYW1lIjoibWVsbG93ZHJhZ29uX2xpZ2h0XzAzX3JvY2tldF8wM18wNCIsInRyYW5zZm9ybSI6eyJ4Ijo2OS41MywieSI6LTQuNTcsInNrWCI6LTkyLjcyLCJza1kiOi05Mi43Mn19XX0seyJuYW1lIjoibWVsbG93ZHJhZ29uX2xpZ2h0XzAzX3JvY2tldF8wM18wMiIsImRpc3BsYXkiOlt7Im5hbWUiOiJtZWxsb3dkcmFnb25fbGlnaHRfMDNfcm9ja2V0XzAzXzAyIiwidHJhbnNmb3JtIjp7IngiOjI3LjYxLCJ5IjotMS45OSwic2tYIjotOTEuOCwic2tZIjotOTEuOH19XX0seyJuYW1lIjoibWVsbG93ZHJhZ29uX2xpZ2h0XzAzX3dpbmdfMDIiLCJkaXNwbGF5IjpbeyJ0eXBlIjoibWVzaCIsIm5hbWUiOiJtZWxsb3dkcmFnb25fbGlnaHRfMDNfd2luZ18wMiIsIm9mZnNldCI6NDAxOSwidXNlckVkZ2VzIjpbXX1dfSx7Im5hbWUiOiJtZWxsb3dkcmFnb25fbGlnaHRfMDNfaGFuZF8wMV8wMSIsImRpc3BsYXkiOlt7Im5hbWUiOiJtZWxsb3dkcmFnb25fbGlnaHRfMDNfaGFuZF8wMV8wMSIsInRyYW5zZm9ybSI6eyJ4Ijo1Ljg2LCJ5IjozLjM2LCJza1giOjEyOS4xMSwic2tZIjoxMjkuMTF9fV19LHsibmFtZSI6Im1lbGxvd2RyYWdvbl9saWdodF8wM19oZWFkXzAxIiwiZGlzcGxheSI6W3sibmFtZSI6Im1lbGxvd2RyYWdvbl9saWdodF8wM19oZWFkXzAxIiwidHJhbnNmb3JtIjp7IngiOjY3Ljg3LCJ5IjotNy4yNywic2tYIjo3OS4zNCwic2tZIjo3OS4zNH19XX0seyJuYW1lIjoibWVsbG93ZHJhZ29uX2xpZ2h0XzAzX2pveV8wMyIsImRpc3BsYXkiOlt7Im5hbWUiOiJtZWxsb3dkcmFnb25fbGlnaHRfMDNfam95XzAzIiwidHJhbnNmb3JtIjp7IngiOi0yNC42OSwieSI6LTEyLjAyfX1dfSx7Im5hbWUiOiJtZWxsb3dkcmFnb25fbGlnaHRfMDNfcm9ja2V0XzA0XzA0IiwiZGlzcGxheSI6W3sibmFtZSI6Im1lbGxvd2RyYWdvbl9saWdodF8wM19yb2NrZXRfMDRfMDQiLCJ0cmFuc2Zvcm0iOnsieCI6MTYuMjksInkiOjEuMzIsInNrWCI6LTExLjU0LCJza1kiOi0xMS41NH19XX0seyJuYW1lIjoibWVsbG93ZHJhZ29uX2xpZ2h0XzAzX2xlZ18wMiIsImRpc3BsYXkiOlt7InR5cGUiOiJtZXNoIiwibmFtZSI6Im1lbGxvd2RyYWdvbl9saWdodF8wM19sZWdfMDIiLCJvZmZzZXQiOjQ2NzcsInVzZXJFZGdlcyI6W119XX0seyJuYW1lIjoiZWZmZWN0XzUiLCJkaXNwbGF5IjpbeyJuYW1lIjoibWVsbG93ZHJhZ29uX2xpZ2h0XzAzX2VmZmVjdF8wNSJ9LHsibmFtZSI6Im1lbGxvd2RyYWdvbl9saWdodF8wM19lZmZlY3RfMDYifV19XX1dLCJhbmltYXRpb24iOlt7ImR1cmF0aW9uIjozNSwibmFtZSI6ImF0dGFjayIsImFjdGlvbiI6MCwib2Zmc2V0IjpbMCwwLDBdLCJib25lIjp7Im1lbGxvd2RyYWdvbl9saWdodF8wM19lZmZlY3RfbGlnaHQiOlsxMyw3XSwibWVsbG93ZHJhZ29uX2xpZ2h0XzAzX3JvY2tldF8wMiI6WzExLDI3LDEyLDM3XSwibWVsbG93ZHJhZ29uX2xpZ2h0XzAzX3JvY2tldF8wMV8wMyI6WzEzLDQ2XSwibWVsbG93ZHJhZ29uX2xpZ2h0XzAzX3dpbmdfMDIiOlsxMiw2NV0sIm1lbGxvd2RyYWdvbl9saWdodF8wM19yb2NrZXRfMDEiOlsxMSw3NiwxMiw4NiwxMyw5NV0sIm1lbGxvd2RyYWdvbl9saWdodF8wM19hcm1fMDEiOlsxMiwxMDVdLCJtZWxsb3dkcmFnb25fbGlnaHRfMDNfZ29nZ2xlc18wMSI6WzEyLDExMV0sImJvbmUyNCI6WzEyLDEyMV0sIm1lbGxvd2RyYWdvbl9saWdodF8wM19oYW5kXzAxIjpbMTEsMTMzLDEyLDE0M10sImJvbmU0MiI6WzEyLDE1M10sIm1lbGxvd2RyYWdvbl9saWdodF8wM19qb3lfMDEiOlsxMiwxNjVdLCJib25lMzQiOlsxMiwxNzVdLCJtZWxsb3dkcmFnb25fbGlnaHRfMDNfcm9ja2V0XzAxXzAyIjpbMTEsMTgxLDEzLDE5OF0sImJvbmUzOCI6WzEyLDIxNV0sImJvbmU0OSI6WzEzLDIyN10sIm1lbGxvd2RyYWdvbl9saWdodF8wM19ib2R5XzAxIjpbMTEsMjUxLDEyLDI2MF0sImJvbmUyMiI6WzEyLDI3MF0sImJvbmUzNSI6WzEyLDI4Ml0sImJvbmUxMiI6WzEyLDI4OF0sImJvbmUyMyI6WzEyLDI5NF0sImJvbmU5IjpbMTIsMzA2XSwiYm9uZTM5IjpbMTIsMzE3XSwibWVsbG93ZHJhZ29uX2xpZ2h0XzAzX2VmZmVjdF9saWdodDIiOlsxMywzMjldLCJtZWxsb3dkcmFnb25fbGlnaHRfMDNfZWFyXzAyIjpbMTIsMzQ5XSwibWVsbG93ZHJhZ29uX2xpZ2h0XzAzX3JvY2tldF8wM18wMyI6WzEzLDM2MF0sIm1lbGxvd2RyYWdvbl9saWdodF8wM19ob3JuXzAxIjpbMTIsMzg0XSwibWVsbG93ZHJhZ29uX2xpZ2h0XzAzX2hlYWRfMDEiOlsxMiwzOTBdLCJtZWxsb3dkcmFnb25fbGlnaHRfMDNfcm9ja2V0XzAyXzAxIjpbMTMsMzk5XSwiYm9uZTIxIjpbMTIsNDI3XSwiYm9uZTgiOlsxMiw0MzldLCJib25lNDEiOlsxMiw0NTBdLCJtZWxsb3dkcmFnb25fbGlnaHRfMDNfZWZmZWN0X2xpZ2h0ZHVzdDIiOlsxMyw0NjJdLCJoaXAiOlsxMSw0ODEsMTIsNDkxXSwibGVnX2wiOlsxMSw1MDEsMTIsNTExXSwibWVsbG93ZHJhZ29uX2xpZ2h0XzAzX3NjYXJmXzAyIjpbMTIsNTIxXSwibGVnX3IiOlsxMSw1MjcsMTIsNTM3XSwibWVsbG93ZHJhZ29uX2xpZ2h0XzAzX2hvcm5fMDIiOlsxMiw1NDddLCJtZWxsb3dkcmFnb25fbGlnaHRfMDNfcm9ja2V0XzAzIjpbMTEsNTUzLDEyLDU2M10sImJvbmU2IjpbMTIsNTczXSwiYm9uZTQwIjpbMTIsNTg0XSwibWVsbG93ZHJhZ29uX2xpZ2h0XzAzX2hhbmRfMDFfMDEiOlsxMSw1OTYsMTIsNjAyXSwibWVsbG93ZHJhZ29uX2xpZ2h0XzAzX3RhaWxfMDEiOlsxMiw2MDhdLCJib25lMjAiOlsxMiw2MTRdLCJtZWxsb3dkcmFnb25fbGlnaHRfMDNfYXJtXzAyIGNvcHkiOlsxMSw2MjYsMTIsNjM1XSwiYm9uZTE5IjpbMTIsNjQ0XSwiYm9uZTM3IjpbMTIsNjU2XSwiYm9uZTUiOlsxMiw2NjhdLCJtZWxsb3dkcmFnb25fbGlnaHRfMDNfd2luZ18wMSI6WzEyLDY3OV0sIm1lbGxvd2RyYWdvbl9saWdodF8wM19lYXJfMDEiOlsxMiw2OTFdLCJtZWxsb3dkcmFnb25fbGlnaHRfMDNfcm9ja2V0XzAzXzAxIjpbMTMsNzAyXSwiYXR0YWNrIjpbMTEsNzI2XSwiZWZmZWN0X3JlZCI6WzEzLDczM10sImVmZmVjdCI6WzExLDc0MSwxMyw3NDhdLCJlZmZlY3RfYm90dG9tXzEiOlsxMSw3NTUsMTMsNzY0XSwiZWZmZWN0X2JvdHRvbV8yIjpbMTEsNzczLDEzLDc4NF0sImVmZmVjdF9maXJlIjpbMTEsNzk1LDEzLDgwM10sImVmZmVjdF9kb3duXzEiOlsxMSw4MTEsMTMsODIyXSwiZWZmZWN0X2Rvd25fMiI6WzExLDgzMywxMyw4NDZdLCJlZmZlY3RfbGlnaHQzIjpbMTEsODU5LDEzLDg2Nl0sImVmZmVjdF9saWdodGR1c3QzIjpbMTMsODczXX0sInNsb3QiOnsiZWZmZWN0XzAxIjpbMjEsODgxXSwiZWZmZWN0XzAyIjpbMjEsODg3XSwiZWZmZWN0XzAzIjpbMjEsODkzXSwiZWZmZWN0XzA0IjpbMjEsODk5XSwiZWZmZWN0XzA1IjpbMjEsOTA1XSwiZWZmZWN0XzUiOlsyMSw5MTFdLCJlZmZlY3RfNiI6WzIxLDkxN10sImVmZmVjdF8wNyI6WzIxLDkyM10sImVmZmVjdF8wNF8wMSI6WzIxLDkyOV0sImVmZmVjdF9ibHVlIjpbMjEsOTM1XSwiZWZmZWN0X2Rvd25fMSI6WzIwLDk0MSwyMSw5NTBdLCJlZmZlY3RfZG93bl8yIjpbMjAsOTY0LDIxLDk3NV0sImVmZmVjdF9kb3duXzMiOlsyMCw5OTIsMjEsOTk5XSwiZWZmZWN0X2Rvd25fNCI6WzIwLDEwMDksMjEsMTAxOF0sImVmZmVjdF9maXJlIjpbMjAsMTAzMiwyMSwxMDM5XSwiZWZmZWN0X2xpZ2h0MyI6WzIwLDEwNDgsMjEsMTA1NV0sImVmZmVjdF9saWdodGR1c3QiOlsyMSwxMDYyXSwiZWZmZWN0X2xpZ2h0ZHVzdDIiOlsyMSwxMDY4XSwiZWZmZWN0X2xpZ2h0ZHVzdDMiOlsyMCwxMDc0LDIxLDEwODFdLCJlZmZlY3RfbGlnaHRpbmciOlsyMCwxMDkwLDIxLDEwOTZdLCJlZmZlY3RfcmVkIjpbMjAsMTEwMiwyMSwxMTA5XSwibWVsbG93ZHJhZ29uX2xpZ2h0XzAzX2VmZmVjdF8wOCI6WzIxLDExMThdLCJtZWxsb3dkcmFnb25fbGlnaHRfMDNfbW91dGhfMDEiOlsyMCwxMTI0XSwibWVsbG93ZHJhZ29uX2xpZ2h0XzAzX3JvY2tldF8wNCI6WzIxLDExMzFdLCJtZWxsb3dkcmFnb25fbGlnaHRfMDNfcm9ja2V0XzAxXzAyIjpbMjAsMTEzNywyMSwxMTQ5XSwibWVsbG93ZHJhZ29uX2xpZ2h0XzAzX3JvY2tldF8wNF8wMiI6WzIxLDExNjRdLCJtZWxsb3dkcmFnb25fbGlnaHRfMDNfcm9ja2V0XzA0XzAzIjpbMjEsMTE3MF0sIm1lbGxvd2RyYWdvbl9saWdodF8wM19yb2NrZXRfMDRfMDQiOlsyMSwxMTc2XSwibWVsbG93ZHJhZ29uX2xpZ2h0XzAzX3JvY2tldF8wNF8wNSI6WzIxLDExODJdLCJyb2NrZXRfbGlnaHQiOlsyMSwxMTg4XX19LHsiZHVyYXRpb24iOjYwLCJuYW1lIjoiaWRsZSIsIm9mZnNldCI6Wzc5LDk1OCwyODkyXSwiYm9uZSI6eyJtZWxsb3dkcmFnb25fbGlnaHRfMDNfYm9keV8wMSI6WzEyLDExOTRdLCJtZWxsb3dkcmFnb25fbGlnaHRfMDNfYXJtXzAxIjpbMTIsMTIwMl0sIm1lbGxvd2RyYWdvbl9saWdodF8wM19nbG92ZXNfMDEiOlsxMiwxMjExXSwibWVsbG93ZHJhZ29uX2xpZ2h0XzAzX2pveV8wMSI6WzEyLDEyMTldLCJtZWxsb3dkcmFnb25fbGlnaHRfMDNfaGFuZF8wMV8wMSI6WzExLDEyMjgsMTIsMTIzN10sIm1lbGxvd2RyYWdvbl9saWdodF8wM19hcm1fMDIgY29weSI6WzEyLDEyNDZdLCJtZWxsb3dkcmFnb25fbGlnaHRfMDNfaGFuZF8wMSI6WzEyLDEyNTRdLCJtZWxsb3dkcmFnb25fbGlnaHRfMDNfaGVhZF8wMSI6WzEyLDEyNjNdLCJtZWxsb3dkcmFnb25fbGlnaHRfMDNfZWFyXzAxIjpbMTIsMTI3Ml0sIm1lbGxvd2RyYWdvbl9saWdodF8wM19lYXJfMDIiOlsxMiwxMjgwXSwibWVsbG93ZHJhZ29uX2xpZ2h0XzAzX2dvZ2dsZXNfMDEiOlsxMiwxMjg4XSwibWVsbG93ZHJhZ29uX2xpZ2h0XzAzX2hvcm5fMDEiOlsxMiwxMjk3XSwibWVsbG93ZHJhZ29uX2xpZ2h0XzAzX2hvcm5fMDIiOlsxMiwxMzA2XSwibWVsbG93ZHJhZ29uX2xpZ2h0XzAzX3NjYXJmXzAyIjpbMTIsMTMxNV0sIm1lbGxvd2RyYWdvbl9saWdodF8wM193aW5nXzAxIjpbMTIsMTMyNF0sIm1lbGxvd2RyYWdvbl9saWdodF8wM193aW5nXzAyIjpbMTIsMTMzNl0sIm1lbGxvd2RyYWdvbl9saWdodF8wM190YWlsXzAxIjpbMTIsMTM0N10sIm1lbGxvd2RyYWdvbl9saWdodF8wM19yb2NrZXRfMDEiOlsxMSwxMzU2LDEzLDEzNjRdLCJtZWxsb3dkcmFnb25fbGlnaHRfMDNfZWZmZWN0X2xpZ2h0IjpbMTMsMTM3Ml0sIm1lbGxvd2RyYWdvbl9saWdodF8wM19yb2NrZXRfMDFfMDEiOlsxMiwxMzk4XSwibWVsbG93ZHJhZ29uX2xpZ2h0XzAzX3JvY2tldF8wMV8wMiI6WzExLDE0MjEsMTMsMTQ0OF0sIm1lbGxvd2RyYWdvbl9saWdodF8wM19yb2NrZXRfMDFfMDMiOlsxMywxNDc1XSwibWVsbG93ZHJhZ29uX2xpZ2h0XzAzX3JvY2tldF8wMiI6WzExLDE1MDNdLCJtZWxsb3dkcmFnb25fbGlnaHRfMDNfZWZmZWN0X2xpZ2h0MiI6WzEzLDE1MTFdLCJtZWxsb3dkcmFnb25fbGlnaHRfMDNfZWZmZWN0X2xpZ2h0ZHVzdDIiOlsxMywxNTM3XSwibWVsbG93ZHJhZ29uX2xpZ2h0XzAzX3JvY2tldF8wMl8wMSI6WzEzLDE1NjVdLCJtZWxsb3dkcmFnb25fbGlnaHRfMDNfcm9ja2V0XzAzIjpbMTEsMTU5MywxMiwxNjAzXSwiYm9uZTQ5IjpbMTMsMTYxM10sIm1lbGxvd2RyYWdvbl9saWdodF8wM19yb2NrZXRfMDNfMDEiOlsxMywxNjQ5XSwibWVsbG93ZHJhZ29uX2xpZ2h0XzAzX3JvY2tldF8wM18wMyI6WzEzLDE2ODVdLCJsZWdfciI6WzExLDE3MjEsMTIsMTczMV0sImxlZ19sIjpbMTEsMTc0MSwxMiwxNzUxXSwiYm9uZTM1IjpbMTIsMTc2MV0sImJvbmUzNCI6WzEyLDE3NzBdLCJib25lNDIiOlsxMiwxNzc5XSwiYm9uZTQxIjpbMTIsMTc5MV0sImJvbmU0MCI6WzEyLDE4MDNdLCJib25lMzkiOlsxMiwxODE1XSwiYm9uZTM4IjpbMTIsMTgyN10sImJvbmUzNyI6WzEyLDE4MzldLCJib25lMjQiOlsxMiwxODUxXSwiYm9uZTIzIjpbMTIsMTg2M10sImJvbmUyMiI6WzEyLDE4NzVdLCJib25lMjEiOlsxMiwxODg3XSwiYm9uZTIwIjpbMTIsMTg5OV0sImJvbmUxOSI6WzEyLDE5MTFdLCJib25lNiI6WzEyLDE5MjNdLCJib25lNSI6WzEyLDE5MzJdLCJib25lOSI6WzEyLDE5NDFdLCJib25lOCI6WzEyLDE5NTBdLCJib25lMTIiOlsxMiwxOTU5XSwiaGlwIjpbMTEsMTk2OCwxMiwxOTc2XSwiZWZmZWN0X2JvdHRvbV8yIjpbMTEsMTk4NCwxMywxOTk0XSwiZWZmZWN0X2JvdHRvbV8xIjpbMTEsMjAwNCwxMywyMDEyXSwiZWZmZWN0X2Rvd25fMSI6WzExLDIwMjAsMTMsMjAzMF0sImVmZmVjdF9kb3duXzIiOlsxMSwyMDQwLDEzLDIwNTFdfSwic2xvdCI6eyJlZmZlY3RfMDEiOlsyMSwyMDYyXSwiZWZmZWN0XzAyIjpbMjEsMjA2OF0sImVmZmVjdF8wMyI6WzIxLDIwNzRdLCJlZmZlY3RfMDQiOlsyMSwyMDgwXSwiZWZmZWN0XzUiOlsyMCwyMDg2LDIxLDIwOTJdLCJlZmZlY3RfMDUiOlsyMCwyMDk4LDIxLDIxMDRdLCJlZmZlY3RfNiI6WzIwLDIxMTAsMjEsMjExNl0sImVmZmVjdF8wNyI6WzIxLDIxMjJdLCJlZmZlY3RfMDRfMDEiOlsyMSwyMTI4XSwiZWZmZWN0X2JsdWUiOlsyMSwyMTM0XSwiZWZmZWN0X2Rvd25fMSI6WzIwLDIxNDAsMjEsMjE0OV0sImVmZmVjdF9kb3duXzIiOlsyMCwyMTYzLDIxLDIxNzRdLCJlZmZlY3RfZG93bl8zIjpbMjAsMjE5MSwyMSwyMTk4XSwiZWZmZWN0X2Rvd25fNCI6WzIwLDIyMDgsMjEsMjIxN10sImVmZmVjdF9maXJlIjpbMjEsMjIzMV0sImVmZmVjdF9saWdodDMiOlsyMSwyMjM3XSwiZWZmZWN0X2xpZ2h0ZHVzdCI6WzIxLDIyNDNdLCJlZmZlY3RfbGlnaHRkdXN0MiI6WzIxLDIyNDldLCJlZmZlY3RfbGlnaHRkdXN0MyI6WzIxLDIyNTVdLCJlZmZlY3RfbGlnaHRpbmciOlsyMCwyMjYxLDIxLDIyNjddLCJlZmZlY3RfcmVkIjpbMjEsMjI3M10sIm1lbGxvd2RyYWdvbl9saWdodF8wM19lZmZlY3RfMDgiOlsyMSwyMjc5XSwibWVsbG93ZHJhZ29uX2xpZ2h0XzAzX3JvY2tldF8wNCI6WzIxLDIyODVdLCJtZWxsb3dkcmFnb25fbGlnaHRfMDNfcm9ja2V0XzAxXzAyIjpbMjAsMjI5MSwyMSwyMzExXSwibWVsbG93ZHJhZ29uX2xpZ2h0XzAzX3JvY2tldF8wNF8wMiI6WzIxLDIzMzhdLCJtZWxsb3dkcmFnb25fbGlnaHRfMDNfcm9ja2V0XzA0XzAzIjpbMjEsMjM0NF0sIm1lbGxvd2RyYWdvbl9saWdodF8wM19yb2NrZXRfMDRfMDQiOlsyMSwyMzUwXSwibWVsbG93ZHJhZ29uX2xpZ2h0XzAzX3JvY2tldF8wNF8wNSI6WzIxLDIzNTZdLCJyb2NrZXRfbGlnaHQiOlsyMSwyMzYyXX19LHsiZHVyYXRpb24iOjE0OSwibmFtZSI6InBvc2VfMSIsIm9mZnNldCI6WzE2MCwyMDI0LDY4ODBdLCJib25lIjp7Im1lbGxvd2RyYWdvbl9saWdodF8wM19lZmZlY3RfbGlnaHQiOlsxMSwyMzY4LDEyLDIzNzgsMTMsMjM4OF0sIm1lbGxvd2RyYWdvbl9saWdodF8wM19yb2NrZXRfMDIiOlsxMSwyNDI4LDEyLDI0NDBdLCJtZWxsb3dkcmFnb25fbGlnaHRfMDNfcm9ja2V0XzAxXzAzIjpbMTIsMjQ1MCwxMywyNDU5XSwibWVsbG93ZHJhZ29uX2xpZ2h0XzAzX3dpbmdfMDIiOlsxMiwyNTAyXSwibWVsbG93ZHJhZ29uX2xpZ2h0XzAzX3JvY2tldF8wMSI6WzExLDI1MzIsMTIsMjU1OSwxMywyNTc4XSwibWVsbG93ZHJhZ29uX2xpZ2h0XzAzX2FybV8wMSI6WzEyLDI1ODddLCJtZWxsb3dkcmFnb25fbGlnaHRfMDNfZ29nZ2xlc18wMSI6WzEyLDI1OTNdLCJtZWxsb3dkcmFnb25fbGlnaHRfMDNfZXllXzAxIjpbMTEsMjYwOCwxMywyNjIwXSwiYm9uZTI0IjpbMTIsMjY0MV0sIm1lbGxvd2RyYWdvbl9saWdodF8wM19oYW5kXzAxIjpbMTEsMjY3NywxMiwyNzAzXSwiYm9uZTQyIjpbMTIsMjcyOV0sIm1lbGxvd2RyYWdvbl9saWdodF8wM19qb3lfMDEiOlsxMiwyNzY1XSwiYm9uZTM0IjpbMTIsMjc5M10sIm1lbGxvd2RyYWdvbl9saWdodF8wM19yb2NrZXRfMDFfMDIiOlsxMSwyODA2LDEyLDI4NTYsMTMsMjg2NV0sImJvbmUzOCI6WzEyLDI5MTVdLCJib25lNDkiOlsxMiwyOTUxLDEzLDI5NjFdLCJtZWxsb3dkcmFnb25fbGlnaHRfMDNfYm9keV8wMSI6WzEyLDMwNDBdLCJib25lMjIiOlsxMiwzMDUzXSwibWVsbG93ZHJhZ29uX2xpZ2h0XzAzX2VmZmVjdF9saWdodGR1c3QiOlsxMiwzMDg5XSwiYm9uZTM1IjpbMTIsMzA5OV0sImJvbmUxMiI6WzEyLDMxMTJdLCJib25lMjMiOlsxMiwzMTE4XSwiYm9uZTkiOlsxMiwzMTU0XSwiYm9uZTM5IjpbMTIsMzE3NF0sIm1lbGxvd2RyYWdvbl9saWdodF8wM19lZmZlY3RfbGlnaHQyIjpbMTMsMzIxMF0sIm1lbGxvd2RyYWdvbl9saWdodF8wM19lYXJfMDIiOlsxMiwzMjY0XSwibWVsbG93ZHJhZ29uX2xpZ2h0XzAzX3JvY2tldF8wM18wMyI6WzEyLDMyODQsMTMsMzI5NF0sIm1lbGxvd2RyYWdvbl9saWdodF8wM19ob3JuXzAxIjpbMTIsMzM3M10sIm1lbGxvd2RyYWdvbl9saWdodF8wM19oZWFkXzAxIjpbMTIsMzM3OV0sIm1lbGxvd2RyYWdvbl9saWdodF8wM19yb2NrZXRfMDJfMDEiOlsxMywzMzkzXSwiYm9uZTIxIjpbMTIsMzQ1Ml0sImJvbmU4IjpbMTIsMzQ4OF0sImJvbmU0MSI6WzEyLDM1MDhdLCJtZWxsb3dkcmFnb25fbGlnaHRfMDNfZWZmZWN0X2xpZ2h0ZHVzdDIiOlsxMywzNTQ0XSwiaGlwIjpbMTEsMzYwMywxMiwzNjMxXSwibGVnX2wiOlsxMSwzNjQ4LDEyLDM2NzZdLCJtZWxsb3dkcmFnb25fbGlnaHRfMDNfc2NhcmZfMDIiOlsxMiwzNjkzXSwibGVnX3IiOlsxMSwzNzEwLDEyLDM3MzhdLCJib25lMyI6WzExLDM3NTVdLCJtZWxsb3dkcmFnb25fbGlnaHRfMDNfaG9ybl8wMiI6WzEyLDM3NjNdLCJtZWxsb3dkcmFnb25fbGlnaHRfMDNfcm9ja2V0XzAzIjpbMTEsMzc2OSwxMiwzNzk3XSwiYm9uZTYiOlsxMSwzODE0LDEyLDM4MjBdLCJib25lNDAiOlsxMiwzODQwXSwibWVsbG93ZHJhZ29uX2xpZ2h0XzAzX2hhbmRfMDFfMDEiOlsxMSwzODc2LDEyLDM4ODJdLCJtZWxsb3dkcmFnb25fbGlnaHRfMDNfdGFpbF8wMSI6WzEyLDM4ODhdLCJib25lMjAiOlsxMiwzOTAxXSwibWVsbG93ZHJhZ29uX2xpZ2h0XzAzX2FybV8wMiBjb3B5IjpbMTIsMzkzN10sImJvbmUxOSI6WzEyLDM5NDVdLCJib25lMzciOlsxMiwzOTgxXSwiYm9uZTUiOlsxMiw0MDE3XSwibWVsbG93ZHJhZ29uX2xpZ2h0XzAzX3dpbmdfMDEiOlsxMiw0MDM3XSwibWVsbG93ZHJhZ29uX2xpZ2h0XzAzX2Vhcl8wMSI6WzEyLDQwNzNdLCJtZWxsb3dkcmFnb25fbGlnaHRfMDNfcm9ja2V0XzAzXzAxIjpbMTIsNDA5MywxMyw0MTAzXSwiZWZmZWN0X2JvdHRvbV8xIjpbMTEsNDE4MiwxMyw0MTk2XSwiZWZmZWN0X2JvdHRvbV8yIjpbMTEsNDIxMCwxMyw0MjI5XSwiZWZmZWN0X2Rvd25fMSI6WzExLDQyNDgsMTMsNDI2NF0sImVmZmVjdF9kb3duXzIiOlsxMSw0Mjc4LDEzLDQzMDBdLCJlZmZlY3RfbGlnaHRkdXN0MyI6WzExLDQzMjIsMTIsNDMzMSwxMyw0MzM4XSwiZWZmZWN0X2JsdWUiOlsxMSw0MzQ3LDEyLDQzNTYsMTMsNDM2M119LCJzbG90Ijp7ImVmZmVjdF8wMSI6WzIxLDQzNzJdLCJlZmZlY3RfMDIiOlsyMSw0Mzc4XSwiZWZmZWN0XzAzIjpbMjEsNDM4NF0sImVmZmVjdF8wNCI6WzIxLDQzOTBdLCJlZmZlY3RfMDUiOlsyMSw0Mzk2XSwiZWZmZWN0XzUiOlsyMSw0NDAyXSwiZWZmZWN0XzYiOlsyMSw0NDA4XSwiZWZmZWN0XzA3IjpbMjEsNDQxNF0sImVmZmVjdF8wNF8wMSI6WzIxLDQ0MjBdLCJlZmZlY3RfYmx1ZSI6WzIwLDQ0MjYsMjEsNDQzM10sImVmZmVjdF9kb3duXzEiOlsyMCw0NDQyLDIxLDQ0NTddLCJlZmZlY3RfZG93bl8yIjpbMjAsNDQ4MiwyMSw0NTAxXSwiZWZmZWN0X2Rvd25fMyI6WzIwLDQ1MzQsMjEsNDU0NV0sImVmZmVjdF9kb3duXzQiOlsyMCw0NTU5LDIxLDQ1NzRdLCJlZmZlY3RfZmlyZSI6WzIxLDQ1OTldLCJlZmZlY3RfbGlnaHQiOlsyMCw0NjA1LDIxLDQ2MTNdLCJlZmZlY3RfbGlnaHQzIjpbMjEsNDYyM10sImVmZmVjdF9saWdodGR1c3QiOlsyMCw0NjI5LDIxLDQ2MzZdLCJlZmZlY3RfbGlnaHRkdXN0MiI6WzIxLDQ2NDRdLCJlZmZlY3RfbGlnaHRkdXN0MyI6WzIwLDQ2NTAsMjEsNDY1N10sImVmZmVjdF9saWdodGluZyI6WzIwLDQ2NjYsMjEsNDY3Ml0sImVmZmVjdF9yZWQiOlsyMSw0Njc4XSwibWVsbG93ZHJhZ29uX2xpZ2h0XzAzX2VmZmVjdF8wOCI6WzIxLDQ2ODRdLCJtZWxsb3dkcmFnb25fbGlnaHRfMDNfZXllXzAxIjpbMjAsNDY5MF0sIm1lbGxvd2RyYWdvbl9saWdodF8wM19tb3V0aF8wMSI6WzIwLDQ3MDRdLCJtZWxsb3dkcmFnb25fbGlnaHRfMDNfcm9ja2V0XzAxIjpbMjAsNDcxMiwyMSw0NzIwXSwibWVsbG93ZHJhZ29uX2xpZ2h0XzAzX3JvY2tldF8wNCI6WzIxLDQ3MjldLCJtZWxsb3dkcmFnb25fbGlnaHRfMDNfcm9ja2V0XzAxXzAxIjpbMjAsNDczNSwyMSw0NzQzXSwibWVsbG93ZHJhZ29uX2xpZ2h0XzAzX3JvY2tldF8wMV8wMiI6WzIwLDQ3NTIsMjEsNDc4Nl0sIm1lbGxvd2RyYWdvbl9saWdodF8wM19yb2NrZXRfMDFfMDMiOlsyMCw0ODM2LDIxLDQ4NDRdLCJtZWxsb3dkcmFnb25fbGlnaHRfMDNfcm9ja2V0XzA0XzAyIjpbMjEsNDg1M10sIm1lbGxvd2RyYWdvbl9saWdodF8wM19yb2NrZXRfMDRfMDMiOlsyMSw0ODU5XSwibWVsbG93ZHJhZ29uX2xpZ2h0XzAzX3JvY2tldF8wNF8wNCI6WzIxLDQ4NjVdLCJtZWxsb3dkcmFnb25fbGlnaHRfMDNfcm9ja2V0XzA0XzA1IjpbMjEsNDg3MV0sInJvY2tldF9saWdodCI6WzIxLDQ4NzddfX0seyJkdXJhdGlvbiI6NjAsIm5hbWUiOiJza2lsbF9hcHBlYXIiLCJvZmZzZXQiOlszMzEsNTE3MiwxNzAwN10sImJvbmUiOnsibWVsbG93ZHJhZ29uX2xpZ2h0XzAzX2VmZmVjdF9saWdodCI6WzEzLDQ4ODNdLCJtZWxsb3dkcmFnb25fbGlnaHRfMDNfcm9ja2V0XzAxXzAxIjpbMTIsNDkwOV0sIm1lbGxvd2RyYWdvbl9saWdodF8wM19yb2NrZXRfMDIiOlsxMSw0OTMyXSwibWVsbG93ZHJhZ29uX2xpZ2h0XzAzX3JvY2tldF8wMV8wMyI6WzEzLDQ5NDBdLCJtZWxsb3dkcmFnb25fbGlnaHRfMDNfd2luZ18wMiI6WzEyLDQ5NjhdLCJtZWxsb3dkcmFnb25fbGlnaHRfMDNfcm9ja2V0XzAxIjpbMTEsNDk3OSwxMyw0OTg3XSwibWVsbG93ZHJhZ29uX2xpZ2h0XzAzX2FybV8wMSI6WzEyLDQ5OTVdLCJtZWxsb3dkcmFnb25fbGlnaHRfMDNfZ29nZ2xlc18wMSI6WzEyLDUwMDRdLCJtZWxsb3dkcmFnb25fbGlnaHRfMDNfZXllXzAxIjpbMTMsNTAxM10sImJvbmUyNCI6WzEyLDUwMTldLCJtZWxsb3dkcmFnb25fbGlnaHRfMDNfaGFuZF8wMSI6WzEyLDUwMzFdLCJib25lNDIiOlsxMiw1MDQwXSwibWVsbG93ZHJhZ29uX2xpZ2h0XzAzX2pveV8wMSI6WzEyLDUwNTJdLCJtZWxsb3dkcmFnb25fbGlnaHRfMDNfZ2xvdmVzXzAxIjpbMTIsNTA2MV0sImJvbmUzNCI6WzEyLDUwNjldLCJtZWxsb3dkcmFnb25fbGlnaHRfMDNfcm9ja2V0XzAxXzAyIjpbMTEsNTA3OCwxMyw1MTA1XSwiYm9uZTM4IjpbMTIsNTEzMl0sImJvbmU0OSI6WzEzLDUxNDRdLCJtZWxsb3dkcmFnb25fbGlnaHRfMDNfYm9keV8wMSI6WzEyLDUxODBdLCJib25lMjIiOlsxMiw1MTg4XSwiYm9uZTM1IjpbMTIsNTIwMF0sImJvbmUxMiI6WzEyLDUyMDldLCJib25lMjMiOlsxMiw1MjE4XSwiYm9uZTkiOlsxMiw1MjMwXSwiYm9uZTM5IjpbMTIsNTIzOV0sIm1lbGxvd2RyYWdvbl9saWdodF8wM19lZmZlY3RfbGlnaHQyIjpbMTMsNTI1MV0sIm1lbGxvd2RyYWdvbl9saWdodF8wM19lYXJfMDIiOlsxMiw1Mjc3XSwibWVsbG93ZHJhZ29uX2xpZ2h0XzAzX3JvY2tldF8wM18wMyI6WzEzLDUyODVdLCJtZWxsb3dkcmFnb25fbGlnaHRfMDNfaG9ybl8wMSI6WzEyLDUzMjFdLCJtZWxsb3dkcmFnb25fbGlnaHRfMDNfaGVhZF8wMSI6WzEyLDUzMzBdLCJtZWxsb3dkcmFnb25fbGlnaHRfMDNfcm9ja2V0XzAyXzAxIjpbMTMsNTMzOV0sImJvbmUyMSI6WzEyLDUzNjddLCJib25lOCI6WzEyLDUzNzldLCJib25lNDEiOlsxMiw1Mzg4XSwiaGlwIjpbMTEsNTQwMCwxMiw1NDA4XSwibGVnX2wiOlsxMSw1NDE2LDEyLDU0MjZdLCJtZWxsb3dkcmFnb25fbGlnaHRfMDNfc2NhcmZfMDIiOlsxMiw1NDM2XSwibGVnX3IiOlsxMSw1NDQ1LDEyLDU0NTVdLCJib25lMyI6WzExLDU0NjUsMTMsNTQ3M10sIm1lbGxvd2RyYWdvbl9saWdodF8wM19ob3JuXzAyIjpbMTIsNTQ4MV0sIm1lbGxvd2RyYWdvbl9saWdodF8wM19yb2NrZXRfMDMiOlsxMSw1NDkwLDEyLDU1MDBdLCJib25lNiI6WzEyLDU1MTBdLCJib25lNDAiOlsxMiw1NTE5XSwibWVsbG93ZHJhZ29uX2xpZ2h0XzAzX2hhbmRfMDFfMDEiOlsxMSw1NTMxLDEyLDU1NDBdLCJtZWxsb3dkcmFnb25fbGlnaHRfMDNfdGFpbF8wMSI6WzEyLDU1NDldLCJib25lMjAiOlsxMiw1NTU4XSwibWVsbG93ZHJhZ29uX2xpZ2h0XzAzX2FybV8wMiBjb3B5IjpbMTIsNTU3MF0sImJvbmUxOSI6WzEyLDU1NzhdLCJib25lMzciOlsxMiw1NTkwXSwiYm9uZTUiOlsxMiw1NjAyXSwibWVsbG93ZHJhZ29uX2xpZ2h0XzAzX3dpbmdfMDEiOlsxMiw1NjExXSwibWVsbG93ZHJhZ29uX2xpZ2h0XzAzX2Vhcl8wMSI6WzEyLDU2MjNdLCJtZWxsb3dkcmFnb25fbGlnaHRfMDNfcm9ja2V0XzAzXzAxIjpbMTMsNTYzMV0sImVmZmVjdF9ib3R0b21fMSI6WzExLDU2NjcsMTMsNTY3NV0sImVmZmVjdF9ib3R0b21fMiI6WzExLDU2ODMsMTMsNTY5M10sImVmZmVjdF9kb3duXzEiOlsxMSw1NzAzLDEzLDU3MTNdLCJlZmZlY3RfZG93bl8yIjpbMTEsNTcyMywxMyw1NzM0XX0sInNsb3QiOnsiZWZmZWN0XzAxIjpbMjEsNTc0NV0sImVmZmVjdF8wMiI6WzIxLDU3NTFdLCJlZmZlY3RfMDMiOlsyMSw1NzU3XSwiZWZmZWN0XzA0IjpbMjEsNTc2M10sImVmZmVjdF8wNSI6WzIwLDU3NjksMjEsNTc3NV0sImVmZmVjdF81IjpbMjAsNTc4MSwyMSw1Nzg3XSwiZWZmZWN0XzYiOlsyMCw1NzkzLDIxLDU3OTldLCJlZmZlY3RfMDciOlsyMSw1ODA1XSwiZWZmZWN0XzA0XzAxIjpbMjEsNTgxMV0sImVmZmVjdF9ibHVlIjpbMjEsNTgxN10sImVmZmVjdF9kb3duXzEiOlsyMCw1ODIzLDIxLDU4MzJdLCJlZmZlY3RfZG93bl8yIjpbMjAsNTg0NiwyMSw1ODU3XSwiZWZmZWN0X2Rvd25fMyI6WzIwLDU4NzQsMjEsNTg4MV0sImVmZmVjdF9kb3duXzQiOlsyMCw1ODkxLDIxLDU5MDBdLCJlZmZlY3RfZmlyZSI6WzIxLDU5MTRdLCJlZmZlY3RfbGlnaHQzIjpbMjEsNTkyMF0sImVmZmVjdF9saWdodGR1c3QiOlsyMSw1OTI2XSwiZWZmZWN0X2xpZ2h0ZHVzdDIiOlsyMSw1OTMyXSwiZWZmZWN0X2xpZ2h0ZHVzdDMiOlsyMSw1OTM4XSwiZWZmZWN0X2xpZ2h0aW5nIjpbMjAsNTk0NCwyMSw1OTUwXSwiZWZmZWN0X3JlZCI6WzIxLDU5NTZdLCJtZWxsb3dkcmFnb25fbGlnaHRfMDNfZWZmZWN0XzA4IjpbMjEsNTk2Ml0sIm1lbGxvd2RyYWdvbl9saWdodF8wM19yb2NrZXRfMDQiOlsyMSw1OTY4XSwibWVsbG93ZHJhZ29uX2xpZ2h0XzAzX3JvY2tldF8wMV8wMiI6WzIwLDU5NzQsMjEsNTk5NF0sIm1lbGxvd2RyYWdvbl9saWdodF8wM19yb2NrZXRfMDRfMDIiOlsyMSw2MDIxXSwibWVsbG93ZHJhZ29uX2xpZ2h0XzAzX3JvY2tldF8wNF8wMyI6WzIxLDYwMjddLCJtZWxsb3dkcmFnb25fbGlnaHRfMDNfcm9ja2V0XzA0XzA0IjpbMjEsNjAzM10sIm1lbGxvd2RyYWdvbl9saWdodF8wM19yb2NrZXRfMDRfMDUiOlsyMSw2MDM5XSwicm9ja2V0X2xpZ2h0IjpbMjEsNjA0NV19fSx7ImR1cmF0aW9uIjo3OCwibmFtZSI6InNraWxsX2Rpc2FwcGVhciIsImFjdGlvbiI6NjA1MSwib2Zmc2V0IjpbNDEyLDYyMDYsMjEwOTFdLCJib25lIjp7Im1lbGxvd2RyYWdvbl9saWdodF8wM19lZmZlY3RfbGlnaHQiOlsxMSw2MDU4LDEzLDYxMDFdLCJtZWxsb3dkcmFnb25fbGlnaHRfMDNfcm9ja2V0XzAyIjpbMTEsNjExMCwxMiw2MTE4XSwibWVsbG93ZHJhZ29uX2xpZ2h0XzAzX3JvY2tldF8wMV8wMyI6WzExLDYxMjYsMTIsNjE4MywxMyw2MTkxXSwibWVsbG93ZHJhZ29uX2xpZ2h0XzAzX3dpbmdfMDIiOlsxMiw2MjQ4XSwibWVsbG93ZHJhZ29uX2xpZ2h0XzAzX3JvY2tldF8wMSI6WzExLDYyNjUsMTIsNjI3M10sIm1lbGxvd2RyYWdvbl9saWdodF8wM19hcm1fMDEiOlsxMiw2MjgxXSwibWVsbG93ZHJhZ29uX2xpZ2h0XzAzX2dvZ2dsZXNfMDEiOlsxMiw2Mjg3XSwiYm9uZTI0IjpbMTIsNjI5M10sIm1lbGxvd2RyYWdvbl9saWdodF8wM19oYW5kXzAxIjpbMTEsNjMxMiwxMiw2MzI4XSwiYm9uZTQyIjpbMTIsNjM2Ml0sIm1lbGxvd2RyYWdvbl9saWdodF8wM19qb3lfMDEiOlsxMiw2MzgxXSwiYm9uZTM0IjpbMTIsNjQxNV0sImJvbmUzOCI6WzEyLDY0MzFdLCJib25lNDkiOlsxMiw2NDUwLDEzLDY0NThdLCJtZWxsb3dkcmFnb25fbGlnaHRfMDNfYm9keV8wMSI6WzEyLDY1MDRdLCJib25lMjIiOlsxMiw2NTEyXSwiYm9uZTM1IjpbMTIsNjUzMV0sImJvbmUxMiI6WzEyLDY1NDddLCJib25lMjMiOlsxMiw2NTUzXSwiYm9uZTkiOlsxMiw2NTcyXSwiYm9uZTM5IjpbMTIsNjU4M10sIm1lbGxvd2RyYWdvbl9saWdodF8wM19lZmZlY3RfbGlnaHQyIjpbMTEsNjYwMiwxMiw2NjYwLDEzLDY2NjldLCJtZWxsb3dkcmFnb25fbGlnaHRfMDNfZWFyXzAyIjpbMTIsNjcxOV0sIm1lbGxvd2RyYWdvbl9saWdodF8wM19yb2NrZXRfMDNfMDMiOlsxMiw2NzI5LDEzLDY3MzddLCJtZWxsb3dkcmFnb25fbGlnaHRfMDNfaG9ybl8wMSI6WzEyLDY3ODNdLCJtZWxsb3dkcmFnb25fbGlnaHRfMDNfaGVhZF8wMSI6WzEyLDY3ODldLCJtZWxsb3dkcmFnb25fbGlnaHRfMDNfcm9ja2V0XzAyXzAxIjpbMTEsNjc5NywxMiw2ODU0LDEzLDY4NjNdLCJib25lMjEiOlsxMiw2OTExXSwiYm9uZTgiOlsxMiw2OTMwXSwiYm9uZTQxIjpbMTIsNjk0Ml0sImhpcCI6WzExLDY5NjEsMTIsNjk3NF0sImxlZ19sIjpbMTEsNjk4MiwxMiw2OTk1XSwibWVsbG93ZHJhZ29uX2xpZ2h0XzAzX3NjYXJmXzAyIjpbMTIsNzAwM10sImxlZ19yIjpbMTEsNzAwOSwxMiw3MDIyXSwiYm9uZTMiOlsxMSw3MDMwXSwibWVsbG93ZHJhZ29uX2xpZ2h0XzAzX2hvcm5fMDIiOlsxMiw3MDQzXSwibWVsbG93ZHJhZ29uX2xpZ2h0XzAzX3JvY2tldF8wMyI6WzExLDcwNDksMTIsNzA2Ml0sImJvbmU2IjpbMTIsNzA3NV0sImJvbmU0MCI6WzEyLDcwODddLCJtZWxsb3dkcmFnb25fbGlnaHRfMDNfaGFuZF8wMV8wMSI6WzExLDcxMDYsMTIsNzExMl0sIm1lbGxvd2RyYWdvbl9saWdodF8wM190YWlsXzAxIjpbMTIsNzExOF0sImJvbmUyMCI6WzEyLDcxMzRdLCJtZWxsb3dkcmFnb25fbGlnaHRfMDNfYXJtXzAyIGNvcHkiOlsxMSw3MTUzLDEyLDcxNjFdLCJib25lMTkiOlsxMiw3MTcwXSwiYm9uZTM3IjpbMTIsNzE4OV0sImJvbmU1IjpbMTIsNzIwOF0sIm1lbGxvd2RyYWdvbl9saWdodF8wM193aW5nXzAxIjpbMTIsNzIyMF0sIm1lbGxvd2RyYWdvbl9saWdodF8wM19lYXJfMDEiOlsxMiw3MjM5XSwibWVsbG93ZHJhZ29uX2xpZ2h0XzAzX3JvY2tldF8wM18wMSI6WzEyLDcyNDksMTMsNzI1N10sImF0dGFjayI6WzExLDczMDNdLCJlZmZlY3RfMDMiOlsxMSw3MzEwLDEzLDczMTZdLCJlZmZlY3RfMDIiOlsxMSw3MzIyLDEyLDczMzAsMTMsNzMzOF0sImVmZmVjdF9yZWQiOlsxMSw3MzQ2LDEzLDczNTJdLCJlZmZlY3QiOlsxMSw3MzU4XSwiYnV0dG9uIjpbMTMsNzM2NF0sImFycm93IjpbMTMsNzQyNV0sImVmZmVjdF9ib3R0b21fMSI6WzExLDc0MzUsMTMsNzQ0NV0sImVmZmVjdF9ib3R0b21fMiI6WzExLDc0NTUsMTMsNzQ2N10sImVmZmVjdF8wNCI6WzExLDc0NzksMTMsNzQ4NV0sImFycm93MiI6WzEzLDc0OTNdLCJhcnJvdzMiOlsxMyw3NTAzXSwiZWZmZWN0XzAxIjpbMTMsNzUxM10sImVmZmVjdF9kb3duXzEiOlsxMSw3NTUyLDEzLDc1NjRdLCJlZmZlY3RfZG93bl8yIjpbMTEsNzU3NiwxMyw3NTg5XSwiZWZmZWN0X2xpZ2h0MyI6WzEzLDc2MDJdLCJlZmZlY3RfbGlnaHRkdXN0MyI6WzExLDc2MTAsMTIsNzYxNywxMyw3NjI0XSwicm9ja2V0XzA0XzA1IjpbMTEsNzYzMl0sInJvY2tldF8wNF8wMiI6WzExLDc2NDBdLCJyb2NrZXRfMDRfMDMiOlsxMSw3NjQ4LDEyLDc2NTZdLCJyb2NrZXRfMDRfMDQiOlsxMSw3NjY0LDEyLDc2NzJdLCJyb2NrZXRfbGlnaHQiOlsxMyw3NjgwXSwibGlnaHRpbmciOlsxMSw3Njg2LDEyLDc3MjYsMTMsNzc2Nl0sImJvbmUiOlsxMSw3ODA2LDEyLDc4NDhdfSwic2xvdCI6eyJlZmZlY3RfMDEiOlsyMCw3ODU2LDIxLDc4ODNdLCJlZmZlY3RfMDIiOlsyMCw3OTMyLDIxLDc5NDBdLCJlZmZlY3RfMDMiOlsyMCw3OTQ5LDIxLDc5NTVdLCJlZmZlY3RfMDQiOlsyMCw3OTYxLDIxLDc5NjldLCJlZmZlY3RfMDUiOlsyMCw3OTc4LDIxLDc5ODRdLCJlZmZlY3RfNSI6WzIwLDc5OTIsMjEsNzk5OF0sImVmZmVjdF82IjpbMjAsODAwNiwyMSw4MDEyXSwiZWZmZWN0XzA3IjpbMjEsODAyMF0sImVmZmVjdF8wNF8wMSI6WzIwLDgwMjgsMjEsODAzNV0sImVmZmVjdF9ibHVlIjpbMjEsODA0M10sImVmZmVjdF9kb3duXzEiOlsyMCw4MDQ5LDIxLDgwNjBdLCJlZmZlY3RfZG93bl8yIjpbMjAsODA3OCwyMSw4MDkxXSwiZWZmZWN0X2Rvd25fMyI6WzIwLDgxMTIsMjEsODEyMV0sImVmZmVjdF9kb3duXzQiOlsyMCw4MTM1LDIxLDgxNDZdLCJlZmZlY3RfZmlyZSI6WzIxLDgxNjRdLCJlZmZlY3RfbGlnaHQzIjpbMjAsODE3MCwyMSw4MTc3XSwiZWZmZWN0X2xpZ2h0ZHVzdCI6WzIxLDgxODZdLCJlZmZlY3RfbGlnaHRkdXN0MiI6WzIxLDgxOTJdLCJlZmZlY3RfbGlnaHRkdXN0MyI6WzIwLDgxOTgsMjEsODIwNl0sImVmZmVjdF9saWdodGluZyI6WzIwLDgyMTRdLCJlZmZlY3RfcmVkIjpbMjAsODI1NSwyMSw4MzI4XSwibWVsbG93ZHJhZ29uX2xpZ2h0XzAzX2VmZmVjdF8wOCI6WzIwLDgzMzgsMjEsODM0NF0sIm1lbGxvd2RyYWdvbl9saWdodF8wM19tb3V0aF8wMSI6WzIwLDgzNTJdLCJtZWxsb3dkcmFnb25fbGlnaHRfMDNfcm9ja2V0XzAxIjpbMjAsODM1OV0sIm1lbGxvd2RyYWdvbl9saWdodF8wM19yb2NrZXRfMDIiOlsyMCw4MzY2XSwibWVsbG93ZHJhZ29uX2xpZ2h0XzAzX3JvY2tldF8wNCI6WzIwLDgzNzNdLCJtZWxsb3dkcmFnb25fbGlnaHRfMDNfcm9ja2V0XzAxXzAxIjpbMjAsODM4MF0sIm1lbGxvd2RyYWdvbl9saWdodF8wM19yb2NrZXRfMDRfMDIiOlsyMSw4Mzg3XSwibWVsbG93ZHJhZ29uX2xpZ2h0XzAzX3JvY2tldF8wNF8wMyI6WzIxLDgzOTVdLCJtZWxsb3dkcmFnb25fbGlnaHRfMDNfcm9ja2V0XzA0XzA0IjpbMjEsODQwM10sIm1lbGxvd2RyYWdvbl9saWdodF8wM19yb2NrZXRfMDRfMDUiOlsyMSw4NDExXSwicm9ja2V0X2xpZ2h0IjpbMjEsODQxOV19fSx7ImR1cmF0aW9uIjo2MCwibmFtZSI6InNraWxsX2lkbGUiLCJvZmZzZXQiOls1NjUsODcyMiwyNjY4MF0sImJvbmUiOnsibWVsbG93ZHJhZ29uX2xpZ2h0XzAzX2VmZmVjdF9saWdodCI6WzExLDg0MjcsMTMsODQ0MV0sIm1lbGxvd2RyYWdvbl9saWdodF8wM19yb2NrZXRfMDIiOlsxMSw4NDY1LDEyLDg0NzVdLCJtZWxsb3dkcmFnb25fbGlnaHRfMDNfcm9ja2V0XzAxXzAzIjpbMTEsODQ4NSwxMiw4NDk5LDEzLDg1MDddLCJtZWxsb3dkcmFnb25fbGlnaHRfMDNfd2luZ18wMiI6WzEyLDg1MzddLCJtZWxsb3dkcmFnb25fbGlnaHRfMDNfcm9ja2V0XzAxIjpbMTEsODU1MywxMiw4NTYzXSwibWVsbG93ZHJhZ29uX2xpZ2h0XzAzX2FybV8wMSI6WzEyLDg1NzNdLCJtZWxsb3dkcmFnb25fbGlnaHRfMDNfZ29nZ2xlc18wMSI6WzEyLDg1NzldLCJib25lMjQiOlsxMiw4NTg1XSwibWVsbG93ZHJhZ29uX2xpZ2h0XzAzX2hhbmRfMDEiOlsxMSw4NjAzLDEyLDg2MTNdLCJib25lNDIiOlsxMiw4NjIzXSwibWVsbG93ZHJhZ29uX2xpZ2h0XzAzX2pveV8wMSI6WzEyLDg2NDFdLCJib25lMzQiOlsxMiw4NjUxXSwiYm9uZTM4IjpbMTIsODY1N10sImJvbmU0OSI6WzEyLDg2NzUsMTMsODY4M10sImJvbmUyMiI6WzEyLDg3MTldLCJib25lMzUiOlsxMiw4NzM3XSwiYm9uZTEyIjpbMTIsODc0M10sImJvbmUyMyI6WzEyLDg3NDldLCJib25lOSI6WzEyLDg3NjddLCJib25lMzkiOlsxMiw4Nzc5XSwibWVsbG93ZHJhZ29uX2xpZ2h0XzAzX2VmZmVjdF9saWdodDIiOlsxMSw4Nzk3LDEyLDg4MTEsMTMsODgxOV0sIm1lbGxvd2RyYWdvbl9saWdodF8wM19lYXJfMDIiOlsxMiw4ODQ3XSwibWVsbG93ZHJhZ29uX2xpZ2h0XzAzX3JvY2tldF8wM18wMyI6WzEyLDg4NTksMTMsODg2N10sIm1lbGxvd2RyYWdvbl9saWdodF8wM19ob3JuXzAxIjpbMTIsODkwM10sIm1lbGxvd2RyYWdvbl9saWdodF8wM19oZWFkXzAxIjpbMTIsODkwOV0sIm1lbGxvd2RyYWdvbl9saWdodF8wM19yb2NrZXRfMDJfMDEiOlsxMSw4OTE1LDEyLDg5MjksMTMsODk0MF0sImJvbmUyMSI6WzEyLDg5NzBdLCJib25lOCI6WzEyLDg5ODhdLCJib25lNDEiOlsxMiw5MDAwXSwiaGlwIjpbMTEsOTAxOCwxMiw5MDI4XSwibGVnX2wiOlsxMSw5MDM4LDEyLDkwNDhdLCJtZWxsb3dkcmFnb25fbGlnaHRfMDNfc2NhcmZfMDIiOlsxMiw5MDU1XSwibGVnX3IiOlsxMSw5MDYxLDEyLDkwNzFdLCJib25lMyI6WzExLDkwNzhdLCJtZWxsb3dkcmFnb25fbGlnaHRfMDNfaG9ybl8wMiI6WzEyLDkwODhdLCJtZWxsb3dkcmFnb25fbGlnaHRfMDNfcm9ja2V0XzAzIjpbMTEsOTA5NCwxMiw5MTA0XSwiYm9uZTYiOlsxMiw5MTExXSwiYm9uZTQwIjpbMTIsOTEyM10sIm1lbGxvd2RyYWdvbl9saWdodF8wM19oYW5kXzAxXzAxIjpbMTEsOTE0MSwxMiw5MTQ3XSwibWVsbG93ZHJhZ29uX2xpZ2h0XzAzX3RhaWxfMDEiOlsxMiw5MTUzXSwiYm9uZTIwIjpbMTIsOTE1OV0sIm1lbGxvd2RyYWdvbl9saWdodF8wM19hcm1fMDIgY29weSI6WzEyLDkxNzddLCJib25lMTkiOlsxMiw5MTg0XSwiYm9uZTM3IjpbMTIsOTIwMl0sImJvbmU1IjpbMTIsOTIyMF0sIm1lbGxvd2RyYWdvbl9saWdodF8wM193aW5nXzAxIjpbMTIsOTIzMl0sIm1lbGxvd2RyYWdvbl9saWdodF8wM19lYXJfMDEiOlsxMiw5MjUwXSwibWVsbG93ZHJhZ29uX2xpZ2h0XzAzX3JvY2tldF8wM18wMSI6WzEyLDkyNjIsMTMsOTI3MF0sImVmZmVjdF8wMyI6WzExLDkzMDYsMTMsOTMxN10sImVmZmVjdF8wMiI6WzExLDkzMzAsMTMsOTMzN10sImVmZmVjdF9yZWQiOlsxMSw5MzQ1LDEzLDkzNTNdLCJlZmZlY3QiOlsxMSw5MzYzXSwiYnV0dG9uIjpbMTMsOTM3MF0sImFycm93IjpbMTMsOTM4Ml0sImVmZmVjdF9ib3R0b21fMSI6WzExLDkzOTQsMTMsOTQwMl0sImVmZmVjdF9ib3R0b21fMiI6WzExLDk0MTAsMTMsOTQyMF0sImVmZmVjdF8wNCI6WzExLDk0MzAsMTMsOTQzOF0sImFycm93MiI6WzEzLDk0NDddLCJhcnJvdzMiOlsxMyw5NDU5XSwiZWZmZWN0X2Rvd25fMSI6WzExLDk0NjgsMTMsOTQ3OF0sImVmZmVjdF9kb3duXzIiOlsxMSw5NDg4LDEzLDk1MDJdLCJlZmZlY3RfbGlnaHQzIjpbMTMsOTUxNV0sImVmZmVjdF9saWdodGR1c3QzIjpbMTEsOTUyMywxMiw5NTMwLDEzLDk1MzddLCJib25lIjpbMTEsOTU0NSwxMiw5NTU1XSwibGlnaHRpbmciOlsxMSw5NTYyLDEyLDk1NzcsMTMsOTU5Ml0sInJvY2tldF8wNF8wMiI6WzExLDk2MDddLCJyb2NrZXRfMDRfMDMiOlsxMSw5NjE2LDEyLDk2MjVdLCJyb2NrZXRfMDRfMDQiOlsxMSw5NjMyLDEyLDk2NDFdLCJyb2NrZXRfMDRfMDUiOlsxMSw5NjQ4XSwicm9ja2V0X2xpZ2h0IjpbMTMsOTY1N119LCJzbG90Ijp7ImVmZmVjdF8wMSI6WzIxLDk2NjZdLCJlZmZlY3RfMDIiOlsyMCw5NjczLDIxLDk2ODBdLCJlZmZlY3RfMDMiOlsyMCw5NjkwLDIxLDk3MDFdLCJlZmZlY3RfMDQiOlsyMCw5NzE2LDIxLDk3MjNdLCJlZmZlY3RfMDUiOlsyMCw5NzMzLDIxLDk3NDBdLCJlZmZlY3RfNSI6WzIwLDk3NDgsMjEsOTc1NV0sImVmZmVjdF82IjpbMjAsOTc2MywyMSw5NzcwXSwiZWZmZWN0XzA3IjpbMjEsOTc3OF0sImVmZmVjdF8wNF8wMSI6WzIxLDk3ODZdLCJlZmZlY3RfYmx1ZSI6WzIxLDk3OTRdLCJlZmZlY3RfZG93bl8xIjpbMjAsOTgwMCwyMSw5ODA5XSwiZWZmZWN0X2Rvd25fMiI6WzIwLDk4MjMsMjEsOTgzNF0sImVmZmVjdF9kb3duXzMiOlsyMCw5ODUyLDIxLDk4NTldLCJlZmZlY3RfZG93bl80IjpbMjAsOTg3MCwyMSw5ODc5XSwiZWZmZWN0X2ZpcmUiOlsyMSw5ODk0XSwiZWZmZWN0X2xpZ2h0MyI6WzIwLDk5MDEsMjEsOTkwOF0sImVmZmVjdF9saWdodGR1c3QiOlsyMSw5OTE3XSwiZWZmZWN0X2xpZ2h0ZHVzdDIiOlsyMSw5OTI0XSwiZWZmZWN0X2xpZ2h0ZHVzdDMiOlsyMCw5OTMxLDIxLDk5MzhdLCJlZmZlY3RfbGlnaHRpbmciOlsyMCw5OTQ4LDIxLDk5NzFdLCJlZmZlY3RfcmVkIjpbMjAsOTk3OCwyMSw5OTk2XSwibWVsbG93ZHJhZ29uX2xpZ2h0XzAzX2VmZmVjdF8wOCI6WzIwLDEwMDA5LDIxLDEwMDE2XSwibWVsbG93ZHJhZ29uX2xpZ2h0XzAzX21vdXRoXzAxIjpbMjAsMTAwMjRdLCJtZWxsb3dkcmFnb25fbGlnaHRfMDNfcm9ja2V0XzAxIjpbMjAsMTAwMzFdLCJtZWxsb3dkcmFnb25fbGlnaHRfMDNfcm9ja2V0XzAyIjpbMjAsMTAwMzhdLCJtZWxsb3dkcmFnb25fbGlnaHRfMDNfcm9ja2V0XzA0IjpbMjEsMTAwNDVdLCJtZWxsb3dkcmFnb25fbGlnaHRfMDNfcm9ja2V0XzAxXzAxIjpbMjAsMTAwNTJdLCJtZWxsb3dkcmFnb25fbGlnaHRfMDNfcm9ja2V0XzA0XzAyIjpbMjEsMTAwNTldLCJtZWxsb3dkcmFnb25fbGlnaHRfMDNfcm9ja2V0XzA0XzAzIjpbMjEsMTAwNjZdLCJtZWxsb3dkcmFnb25fbGlnaHRfMDNfcm9ja2V0XzA0XzA0IjpbMjEsMTAwNzNdLCJtZWxsb3dkcmFnb25fbGlnaHRfMDNfcm9ja2V0XzA0XzA1IjpbMjEsMTAwODBdLCJyb2NrZXRfbGlnaHQiOlsyMSwxMDA4N119fV0sImRlZmF1bHRBY3Rpb25zIjpbeyJuYW1lIjoiYXR0YWNrIn1dLCJhY3Rpb25zIjpbeyJ0eXBlIjoxMCwibmFtZSI6ImF0dGFjayJ9LHsidHlwZSI6MTAsIm5hbWUiOiJhdHRhY2sifV19XSwib2Zmc2V0IjpbMCwxMDE0NCwxMDE0NCwzNDIwMCw0NDM0NCwxMzY0LDQ1NzA4LDQwNjgwLDg2Mzg4LDYxMTAwLDE0NzQ4OCwyMDE5Ml0sInRleHR1cmVBdGxhcyI6W3sid2lkdGgiOjEwMjQsImhlaWdodCI6MTAyNCwibmFtZSI6Im1lbGxvd2RyYWdvbl9saWdodF8wMyIsImltYWdlUGF0aCI6Im1lbGxvd2RyYWdvbl9saWdodF8wM190ZXgucG5nIiwiU3ViVGV4dHVyZSI6W3sieCI6NjA4LCJ5IjoxLCJ3aWR0aCI6MjMzLCJoZWlnaHQiOjI2MiwiZnJhbWVYIjotMTcsImZyYW1lWSI6LTEsImZyYW1lV2lkdGgiOjI2NiwiZnJhbWVIZWlnaHQiOjI5NCwibmFtZSI6Im1lbGxvd2RyYWdvbl9saWdodF8wM19yb2NrZXRfMDNfMDQifSx7IngiOjU0NiwieSI6NTYyLCJ3aWR0aCI6NDExLCJoZWlnaHQiOjE0NiwiZnJhbWVZIjotMjQsImZyYW1lV2lkdGgiOjQyNSwiZnJhbWVIZWlnaHQiOjIxNSwibmFtZSI6Im1lbGxvd2RyYWdvbl9saWdodF8wM19yb2NrZXRfMDNfMDUifSx7IngiOjc2OCwieSI6ODQ5LCJ3aWR0aCI6MTI1LCJoZWlnaHQiOjk2LCJmcmFtZVgiOi0xLCJmcmFtZVkiOi0xLCJmcmFtZVdpZHRoIjoxMjcsImZyYW1lSGVpZ2h0Ijo5OSwibmFtZSI6Im1lbGxvd2RyYWdvbl9saWdodF8wM19lZmZlY3RfbGlnaHRkdXN0In0seyJ4Ijo4NDMsInkiOjEsIndpZHRoIjoxMjgsImhlaWdodCI6MTI4LCJuYW1lIjoibWVsbG93ZHJhZ29uX2xpZ2h0XzAzX2VmZmVjdF8wMSJ9LHsieCI6OTk0LCJ5IjoxMzEsIndpZHRoIjoyNSwiaGVpZ2h0Ijo2MywiZnJhbWVYIjotNiwiZnJhbWVZIjotNiwiZnJhbWVXaWR0aCI6MzcsImZyYW1lSGVpZ2h0Ijo3MywibmFtZSI6Im1lbGxvd2RyYWdvbl9saWdodF8wM19yb2NrZXRfMDNfMDMifSx7IngiOjcyNiwieSI6OTQ4LCJ3aWR0aCI6MjYsImhlaWdodCI6NTksImZyYW1lWCI6LTYsImZyYW1lWSI6LTcsImZyYW1lV2lkdGgiOjM3LCJmcmFtZUhlaWdodCI6NzQsIm5hbWUiOiJtZWxsb3dkcmFnb25fbGlnaHRfMDNfcm9ja2V0XzAzXzAyIn0seyJ4Ijo5OTAsInkiOjQwOCwid2lkdGgiOjI2LCJoZWlnaHQiOjU5LCJmcmFtZVgiOi02LCJmcmFtZVkiOi03LCJmcmFtZVdpZHRoIjozNywiZnJhbWVIZWlnaHQiOjc0LCJuYW1lIjoibWVsbG93ZHJhZ29uX2xpZ2h0XzAzX3JvY2tldF8wM18wMSJ9LHsieCI6MSwieSI6Njk5LCJ3aWR0aCI6MjYwLCJoZWlnaHQiOjE0MiwiZnJhbWVYIjotNCwiZnJhbWVZIjotNSwiZnJhbWVXaWR0aCI6MjY2LCJmcmFtZUhlaWdodCI6MTUwLCJuYW1lIjoibWVsbG93ZHJhZ29uX2xpZ2h0XzAzX3JvY2tldF8wMyJ9LHsieCI6OTQsInkiOjkyOCwid2lkdGgiOjk2LCJoZWlnaHQiOjg4LCJmcmFtZVgiOi04LCJmcmFtZVkiOi04LCJmcmFtZVdpZHRoIjoxMDksImZyYW1lSGVpZ2h0IjoxMDQsIm5hbWUiOiJtZWxsb3dkcmFnb25fbGlnaHRfMDNfcm9ja2V0XzAyXzAxIn0seyJ4Ijo5NTksInkiOjU1OSwid2lkdGgiOjU0LCJoZWlnaHQiOjUzLCJmcmFtZVgiOi0zNywiZnJhbWVZIjotMzcsImZyYW1lV2lkdGgiOjEyOCwiZnJhbWVIZWlnaHQiOjEyOCwibmFtZSI6Im1lbGxvd2RyYWdvbl9saWdodF8wM19lZmZlY3RfbGlnaHQifSx7IngiOjYzMCwieSI6ODQ5LCJ3aWR0aCI6MTM2LCJoZWlnaHQiOjk3LCJmcmFtZVgiOi00LCJmcmFtZVkiOi0zLCJmcmFtZVdpZHRoIjoxNDQsImZyYW1lSGVpZ2h0IjoxMDQsIm5hbWUiOiJtZWxsb3dkcmFnb25fbGlnaHRfMDNfcm9ja2V0XzAyIn0seyJ4Ijo4OTUsInkiOjk1Mywid2lkdGgiOjEwOSwiaGVpZ2h0Ijo2NywibmFtZSI6Im1lbGxvd2RyYWdvbl9saWdodF8wM193aW5nXzAyIn0seyJ4IjozMzAsInkiOjU2NCwid2lkdGgiOjEzNiwiaGVpZ2h0IjoxMzEsIm5hbWUiOiJtZWxsb3dkcmFnb25fbGlnaHRfMDNfd2luZ18wMSJ9LHsieCI6NjM4LCJ5Ijo3ODAsIndpZHRoIjo3OCwiaGVpZ2h0Ijo2NSwibmFtZSI6Im1lbGxvd2RyYWdvbl9saWdodF8wM190YWlsXzAxIn0seyJ4Ijo4MDQsInkiOjUxMCwid2lkdGgiOjM3LCJoZWlnaHQiOjIyLCJmcmFtZVgiOi00LCJmcmFtZVkiOi00LCJmcmFtZVdpZHRoIjo0NSwiZnJhbWVIZWlnaHQiOjMwLCJuYW1lIjoibWVsbG93ZHJhZ29uX2xpZ2h0XzAzX3NjYXJmXzAyIn0seyJ4Ijo4OTUsInkiOjg0OSwid2lkdGgiOjEwMCwiaGVpZ2h0IjoxMDIsIm5hbWUiOiJtZWxsb3dkcmFnb25fbGlnaHRfMDNfZWFyXzAyIn0seyJ4Ijo4MDQsInkiOjQ4Mywid2lkdGgiOjM1LCJoZWlnaHQiOjI1LCJmcmFtZVgiOi00LCJmcmFtZVkiOi00LCJmcmFtZVdpZHRoIjo0MywiZnJhbWVIZWlnaHQiOjMzLCJuYW1lIjoibWVsbG93ZHJhZ29uX2xpZ2h0XzAzX2FybV8wMiJ9LHsieCI6OTU5LCJ5Ijo2MTQsIndpZHRoIjo1NCwiaGVpZ2h0Ijo1MCwibmFtZSI6Im1lbGxvd2RyYWdvbl9saWdodF8wM19mb290XzAyIn0seyJ4Ijo2MzgsInkiOjcxMCwid2lkdGgiOjc3LCJoZWlnaHQiOjY4LCJuYW1lIjoibWVsbG93ZHJhZ29uX2xpZ2h0XzAzX2xlZ18wMiJ9LHsieCI6NTIyLCJ5Ijo4NDksIndpZHRoIjoxMDYsImhlaWdodCI6MTI5LCJuYW1lIjoibWVsbG93ZHJhZ29uX2xpZ2h0XzAzX2JvZHlfMDEifSx7IngiOjk3MywieSI6MSwid2lkdGgiOjQ3LCJoZWlnaHQiOjQ4LCJmcmFtZVgiOi00LCJmcmFtZVkiOi0zLCJmcmFtZVdpZHRoIjo1NCwiZnJhbWVIZWlnaHQiOjU0LCJuYW1lIjoibWVsbG93ZHJhZ29uX2xpZ2h0XzAzX2FybV8wMSJ9LHsieCI6NjMwLCJ5Ijo5NDgsIndpZHRoIjo5NCwiaGVpZ2h0Ijo2NCwibmFtZSI6Im1lbGxvd2RyYWdvbl9saWdodF8wM19sZWdfMDEifSx7IngiOjQ2OCwieSI6NjMzLCJ3aWR0aCI6NzMsImhlaWdodCI6NDgsImZyYW1lWCI6LTQsImZyYW1lWSI6LTMsImZyYW1lV2lkdGgiOjgxLCJmcmFtZUhlaWdodCI6NTQsIm5hbWUiOiJtZWxsb3dkcmFnb25fbGlnaHRfMDNfc2NhcmZfMDEifSx7IngiOjUyMiwieSI6NzEwLCJ3aWR0aCI6MTE0LCJoZWlnaHQiOjEzNywiZnJhbWVYIjotNCwiZnJhbWVZIjotMywiZnJhbWVXaWR0aCI6MTIxLCJmcmFtZUhlaWdodCI6MTQzLCJuYW1lIjoibWVsbG93ZHJhZ29uX2xpZ2h0XzAzX2hlYWRfMDEifSx7IngiOjI5NywieSI6OTY1LCJ3aWR0aCI6MTAyLCJoZWlnaHQiOjU1LCJmcmFtZVgiOi00LCJmcmFtZVkiOi00LCJmcmFtZVdpZHRoIjoxMTAsImZyYW1lSGVpZ2h0Ijo2MywibmFtZSI6Im1lbGxvd2RyYWdvbl9saWdodF8wM19qb3lfMDUifSx7IngiOjI5NywieSI6OTQ4LCJ3aWR0aCI6MTksImhlaWdodCI6OSwiZnJhbWVYIjotNCwiZnJhbWVZIjotNCwiZnJhbWVXaWR0aCI6MjcsImZyYW1lSGVpZ2h0IjoxNywibmFtZSI6Im1lbGxvd2RyYWdvbl9saWdodF8wM19qb3lfMDRfMDEifSx7IngiOjcyNiwieSI6MTAwOSwid2lkdGgiOjIwLCJoZWlnaHQiOjcsImZyYW1lWCI6LTQsImZyYW1lWSI6LTQsImZyYW1lV2lkdGgiOjI4LCJmcmFtZUhlaWdodCI6MTUsIm5hbWUiOiJtZWxsb3dkcmFnb25fbGlnaHRfMDNfam95XzA0In0seyJ4Ijo5NzMsInkiOjUxLCJ3aWR0aCI6NDYsImhlaWdodCI6MzksImZyYW1lWCI6LTMsImZyYW1lWSI6LTMsImZyYW1lV2lkdGgiOjUzLCJmcmFtZUhlaWdodCI6NDUsIm5hbWUiOiJtZWxsb3dkcmFnb25fbGlnaHRfMDNfaGFuZF8wMSJ9LHsieCI6NDg1LCJ5Ijo5NjUsIndpZHRoIjoxOCwiaGVpZ2h0Ijo5LCJmcmFtZVgiOi00LCJmcmFtZVkiOi00LCJmcmFtZVdpZHRoIjoyNiwiZnJhbWVIZWlnaHQiOjE3LCJuYW1lIjoibWVsbG93ZHJhZ29uX2xpZ2h0XzAzX2pveV8wM18wMSJ9LHsieCI6ODg2LCJ5IjoyNTUsIndpZHRoIjoyMCwiaGVpZ2h0Ijo2LCJmcmFtZVgiOi00LCJmcmFtZVkiOi00LCJmcmFtZVdpZHRoIjoyOCwiZnJhbWVIZWlnaHQiOjE0LCJuYW1lIjoibWVsbG93ZHJhZ29uX2xpZ2h0XzAzX2pveV8wMyJ9LHsieCI6OTU1LCJ5Ijo0MDgsIndpZHRoIjoyNiwiaGVpZ2h0IjoxMSwiZnJhbWVYIjotNCwiZnJhbWVZIjotNCwiZnJhbWVXaWR0aCI6MzQsImZyYW1lSGVpZ2h0IjoxOSwibmFtZSI6Im1lbGxvd2RyYWdvbl9saWdodF8wM19qb3lfMDIifSx7IngiOjk5MCwieSI6NDY5LCJ3aWR0aCI6MjgsImhlaWdodCI6NDEsImZyYW1lWCI6LTQsImZyYW1lWSI6LTQsImZyYW1lV2lkdGgiOjM2LCJmcmFtZUhlaWdodCI6NDksIm5hbWUiOiJtZWxsb3dkcmFnb25fbGlnaHRfMDNfam95XzAxIn0seyJ4IjoyOTcsInkiOjkyOCwid2lkdGgiOjI1LCJoZWlnaHQiOjE4LCJmcmFtZVgiOi05LCJmcmFtZVkiOi0xMCwiZnJhbWVXaWR0aCI6NDMsImZyYW1lSGVpZ2h0Ijo0MywibmFtZSI6Im1lbGxvd2RyYWdvbl9saWdodF8wM19tb3V0aF8wMSJ9LHsieCI6ODg2LCJ5IjoyMzUsIndpZHRoIjo1NywiaGVpZ2h0IjoxOCwiZnJhbWVYIjotMTUsImZyYW1lWSI6LTIwLCJmcmFtZVdpZHRoIjo4MiwiZnJhbWVIZWlnaHQiOjQ1LCJuYW1lIjoibWVsbG93ZHJhZ29uX2xpZ2h0XzAzX2V5ZV8wMyJ9LHsieCI6NDAxLCJ5Ijo5NjUsIndpZHRoIjo4MiwiaGVpZ2h0Ijo0NSwibmFtZSI6Im1lbGxvd2RyYWdvbl9saWdodF8wM19leWVfMDEifSx7IngiOjQ4NSwieSI6OTgwLCJ3aWR0aCI6NjMsImhlaWdodCI6MzQsImZyYW1lWCI6LTEzLCJmcmFtZVkiOi03LCJmcmFtZVdpZHRoIjo4MiwiZnJhbWVIZWlnaHQiOjQ1LCJuYW1lIjoibWVsbG93ZHJhZ29uX2xpZ2h0XzAzX2V5ZV8wNCJ9LHsieCI6NTUwLCJ5Ijo5ODAsIndpZHRoIjo2MiwiaGVpZ2h0IjozMCwiZnJhbWVYIjotMTMsImZyYW1lWSI6LTEyLCJmcmFtZVdpZHRoIjo4MiwiZnJhbWVIZWlnaHQiOjQ1LCJuYW1lIjoibWVsbG93ZHJhZ29uX2xpZ2h0XzAzX2V5ZV8wMiJ9LHsieCI6ODQzLCJ5IjoxMzEsIndpZHRoIjoxNDksImhlaWdodCI6MTAyLCJuYW1lIjoibWVsbG93ZHJhZ29uX2xpZ2h0XzAzX2Vhcl8wMSJ9LHsieCI6OTU1LCJ5IjoyOTYsIndpZHRoIjo2MiwiaGVpZ2h0Ijo1MiwibmFtZSI6Im1lbGxvd2RyYWdvbl9saWdodF8wM19nbG92ZXNfMDEifSx7IngiOjc2OCwieSI6OTQ3LCJ3aWR0aCI6MTI1LCJoZWlnaHQiOjcwLCJmcmFtZVgiOi00LCJmcmFtZVkiOi0zLCJmcmFtZVdpZHRoIjoxMzMsImZyYW1lSGVpZ2h0Ijo3NiwibmFtZSI6Im1lbGxvd2RyYWdvbl9saWdodF8wM19nb2dnbGVzXzAxIn0seyJ4Ijo0NzUsInkiOjU2NCwid2lkdGgiOjU1LCJoZWlnaHQiOjY3LCJmcmFtZVgiOi04LCJmcmFtZVkiOi04LCJmcmFtZVdpZHRoIjo3MSwiZnJhbWVIZWlnaHQiOjg5LCJuYW1lIjoibWVsbG93ZHJhZ29uX2xpZ2h0XzAzX2hvcm5fMDEifSx7IngiOjQ3NSwieSI6NzcxLCJ3aWR0aCI6MzksImhlaWdodCI6MzMsImZyYW1lWCI6LTMsImZyYW1lWSI6LTMsImZyYW1lV2lkdGgiOjQ2LCJmcmFtZUhlaWdodCI6MzksIm5hbWUiOiJtZWxsb3dkcmFnb25fbGlnaHRfMDNfaGFuZF8wMV8wMSJ9LHsieCI6MTkyLCJ5Ijo5MjgsIndpZHRoIjoxMDMsImhlaWdodCI6NzYsImZyYW1lWCI6LTgsImZyYW1lWSI6LTcsImZyYW1lV2lkdGgiOjExNiwiZnJhbWVIZWlnaHQiOjg5LCJuYW1lIjoibWVsbG93ZHJhZ29uX2xpZ2h0XzAzX3JvY2tldF8wMV8wMyJ9LHsieCI6OTczLCJ5Ijo5Miwid2lkdGgiOjQ1LCJoZWlnaHQiOjM3LCJmcmFtZVgiOi04LCJmcmFtZVkiOi00LCJmcmFtZVdpZHRoIjo2MiwiZnJhbWVIZWlnaHQiOjQ1LCJuYW1lIjoibWVsbG93ZHJhZ29uX2xpZ2h0XzAzX3JvY2tldF8wMV8wMiJ9LHsieCI6MzI2LCJ5Ijo4MjcsIndpZHRoIjoxOTQsImhlaWdodCI6MTM2LCJmcmFtZVgiOi00LCJmcmFtZVkiOi0zLCJmcmFtZVdpZHRoIjoyMDEsImZyYW1lSGVpZ2h0IjoxNDMsIm5hbWUiOiJtZWxsb3dkcmFnb25fbGlnaHRfMDNfcm9ja2V0XzAxIn0seyJ4Ijo4MDQsInkiOjQyMiwid2lkdGgiOjM2LCJoZWlnaHQiOjI5LCJmcmFtZVgiOi00LCJmcmFtZVkiOi0zLCJmcmFtZVdpZHRoIjo0NCwiZnJhbWVIZWlnaHQiOjM1LCJuYW1lIjoibWVsbG93ZHJhZ29uX2xpZ2h0XzAzX3JvY2tldF8wMV8wMSJ9LHsieCI6NDc1LCJ5Ijo3MjcsIndpZHRoIjo0MiwiaGVpZ2h0Ijo0MiwiZnJhbWVYIjotOCwiZnJhbWVZIjotMTEsImZyYW1lV2lkdGgiOjU4LCJmcmFtZUhlaWdodCI6NjMsIm5hbWUiOiJtZWxsb3dkcmFnb25fbGlnaHRfMDNfZWZmZWN0XzA5In0seyJ4Ijo0NzUsInkiOjY4Mywid2lkdGgiOjQyLCJoZWlnaHQiOjQyLCJmcmFtZVgiOi04LCJmcmFtZVkiOi0xMSwiZnJhbWVXaWR0aCI6NTgsImZyYW1lSGVpZ2h0Ijo2MywibmFtZSI6Im1lbGxvd2RyYWdvbl9saWdodF8wM19lZmZlY3RfMDgifSx7IngiOjYwOCwieSI6MjY1LCJ3aWR0aCI6NDIsImhlaWdodCI6MjAsImZyYW1lWCI6LTcsImZyYW1lWSI6LTksImZyYW1lV2lkdGgiOjQ5LCJmcmFtZUhlaWdodCI6MzUsIm5hbWUiOiJtZWxsb3dkcmFnb25fbGlnaHRfMDNfcm9ja2V0XzA0XzA1In0seyJ4IjoxOTIsInkiOjEwMDYsIndpZHRoIjo0NCwiaGVpZ2h0IjoxNSwiZnJhbWVYIjotNCwiZnJhbWVZIjotOSwiZnJhbWVXaWR0aCI6NTEsImZyYW1lSGVpZ2h0IjozMywibmFtZSI6Im1lbGxvd2RyYWdvbl9saWdodF8wM19yb2NrZXRfMDRfMDQifSx7IngiOjEsInkiOjU2NCwid2lkdGgiOjMyNywiaGVpZ2h0IjoxMzMsImZyYW1lWCI6LTksImZyYW1lWSI6LTgsImZyYW1lV2lkdGgiOjM0NywiZnJhbWVIZWlnaHQiOjE3MCwibmFtZSI6Im1lbGxvd2RyYWdvbl9saWdodF8wM19yb2NrZXRfMDQifSx7IngiOjUxOSwieSI6NjgzLCJ3aWR0aCI6MjEsImhlaWdodCI6MjUsImZyYW1lWCI6LTE2LCJmcmFtZVkiOi01LCJmcmFtZVdpZHRoIjo0OSwiZnJhbWVIZWlnaHQiOjM1LCJuYW1lIjoibWVsbG93ZHJhZ29uX2xpZ2h0XzAzX3JvY2tldF8wNF8wNiJ9LHsieCI6OTkwLCJ5Ijo1MTIsIndpZHRoIjoyMywiaGVpZ2h0Ijo0MCwiZnJhbWVYIjotMTcsImZyYW1lWSI6LTE0LCJmcmFtZVdpZHRoIjo1OCwiZnJhbWVIZWlnaHQiOjczLCJuYW1lIjoibWVsbG93ZHJhZ29uX2xpZ2h0XzAzX3JvY2tldF8wNF8wMSJ9LHsieCI6ODQzLCJ5IjoyMzUsIndpZHRoIjo0MSwiaGVpZ2h0IjoyNywiZnJhbWVYIjotNCwiZnJhbWVZIjotOSwiZnJhbWVXaWR0aCI6NTAsImZyYW1lSGVpZ2h0Ijo0MywibmFtZSI6Im1lbGxvd2RyYWdvbl9saWdodF8wM19yb2NrZXRfMDRfMDMifSx7IngiOjQ3NSwieSI6ODA2LCJ3aWR0aCI6NDUsImhlaWdodCI6MTUsImZyYW1lWCI6LTIsImZyYW1lWSI6LTMsImZyYW1lV2lkdGgiOjUyLCJmcmFtZUhlaWdodCI6MjIsIm5hbWUiOiJtZWxsb3dkcmFnb25fbGlnaHRfMDNfcm9ja2V0XzA0XzAyIn0seyJ4IjoxLCJ5IjozMDQsIndpZHRoIjo1NDMsImhlaWdodCI6MjU4LCJmcmFtZVgiOi0xNSwiZnJhbWVZIjotMjcsImZyYW1lV2lkdGgiOjYwOSwiZnJhbWVIZWlnaHQiOjMwOCwibmFtZSI6Im1lbGxvd2RyYWdvbl9saWdodF8wM19yb2NrZXRfMDRfMDcifSx7IngiOjEsInkiOjEsIndpZHRoIjo2MDUsImhlaWdodCI6MzAxLCJmcmFtZVgiOi0yLCJmcmFtZVkiOi01LCJmcmFtZVdpZHRoIjo3NzYsImZyYW1lSGVpZ2h0IjozMDgsIm5hbWUiOiJtZWxsb3dkcmFnb25fbGlnaHRfMDNfcm9ja2V0XzA0XzA4In0seyJ4Ijo1NDYsInkiOjMwNCwid2lkdGgiOjI1NiwiaGVpZ2h0IjoyNTYsIm5hbWUiOiJtZWxsb3dkcmFnb25fbGlnaHRfMDNfZWZmZWN0XzAyIn0seyJ4Ijo4NDMsInkiOjQyMiwid2lkdGgiOjE0NSwiaGVpZ2h0IjoxMzUsImZyYW1lWCI6LTQsImZyYW1lWSI6LTYsImZyYW1lV2lkdGgiOjE1NywiZnJhbWVIZWlnaHQiOjE1NCwibmFtZSI6Im1lbGxvd2RyYWdvbl9saWdodF8wM19lZmZlY3RfMDMifSx7IngiOjgwNCwieSI6MjY1LCJ3aWR0aCI6MTQ5LCJoZWlnaHQiOjE1NSwibmFtZSI6Im1lbGxvd2RyYWdvbl9saWdodF8wM19lZmZlY3RfMDQifSx7IngiOjgwNCwieSI6NDUzLCJ3aWR0aCI6MzUsImhlaWdodCI6MjgsImZyYW1lWCI6LTEyLCJmcmFtZVkiOi0xOCwiZnJhbWVXaWR0aCI6NTgsImZyYW1lSGVpZ2h0Ijo2MywibmFtZSI6Im1lbGxvd2RyYWdvbl9saWdodF8wM19lZmZlY3RfMDUifSx7IngiOjk1NSwieSI6MjM1LCJ3aWR0aCI6NTgsImhlaWdodCI6NTksImZyYW1lWSI6LTIsImZyYW1lV2lkdGgiOjU4LCJmcmFtZUhlaWdodCI6NjMsIm5hbWUiOiJtZWxsb3dkcmFnb25fbGlnaHRfMDNfZWZmZWN0XzA2In0seyJ4IjoyNjMsInkiOjY5OSwid2lkdGgiOjIxMCwiaGVpZ2h0IjoxMjYsIm5hbWUiOiJtZWxsb3dkcmFnb25fbGlnaHRfMDNfZWZmZWN0X2ZpcmUifSx7IngiOjEsInkiOjkyOCwid2lkdGgiOjkxLCJoZWlnaHQiOjk0LCJuYW1lIjoibWVsbG93ZHJhZ29uX2xpZ2h0XzAzX2VmZmVjdF9yZWQifSx7IngiOjk1NSwieSI6MzUwLCJ3aWR0aCI6NTYsImhlaWdodCI6NTYsImZyYW1lWCI6LTEsImZyYW1lWSI6LTQsImZyYW1lV2lkdGgiOjU4LCJmcmFtZUhlaWdodCI6NjMsIm5hbWUiOiJtZWxsb3dkcmFnb25fbGlnaHRfMDNfZWZmZWN0XzA3In0seyJ4IjoxLCJ5Ijo4NDMsIndpZHRoIjozMjMsImhlaWdodCI6ODMsImZyYW1lWCI6LTMsImZyYW1lWSI6LTMsImZyYW1lV2lkdGgiOjMyOCwiZnJhbWVIZWlnaHQiOjg3LCJuYW1lIjoibWVsbG93ZHJhZ29uX2xpZ2h0XzAzX2VmZmVjdF9ibHVlIn1dfV19MwA5AAAArwAmACsAJwALAA0ADAAwAA8ADgANAAsADgALADAADgAxABAADwAwADEADwAxABEAEAAKAC8ACwAvADAACwAxABIAEQAJAC4ACgAuAC8ACgAxADIAEgAyABMAEgAuAAkACAAHAC4ACAAGAC4ABwAFAC0ABgAtAC4ABgAyABQAEwAvABkAMAAYADIAMQAwABkAMQAZABgAMQAEAC0ABQADAC0ABAAyABUAFAAuABsALwAbABoALwAaABkALwAWABUAMgAXABYAMgAYABcAMgACAC0AAwAtAB0ALgAdABwALgAcABsALgABAC0AAgAeAB0ALQAAAC0AAQAfAB4ALQAsAC0AAAAgAB8ALQAqACwAAAAmACEALAAsACEALQAhACAALQAmACIAIQArACYALAApACwAKgAlACIAJgAoACcALAAnACsALAApACgALAAkACMAIgAkACIAJQADAMwANwA+AE4AAQAAAAEAAAABAAAAAgAAAAEAAgAAAAEAAgAAAAEAAgAAAAEAAgAAAAEAAgAAAAEAAwAAAAEAAgADAAAAAQACAAMAAAABAAIAAwAAAAEAAgACAAEAAgACAAEAAgACAAEAAgACAAEAAgACAAEAAgABAAIAAQACAAEAAgABAAIAAwAAAAEAAgADAAAAAQACAAMAAAABAAIAAwAAAAEAAgADAAAAAQACAAMAAAABAAIAAwAAAAEAAgADAAAAAQACAAMAAAABAAIAAwAAAAEAAgADAAAAAQACAAMAAAABAAIAAgAAAAEAAQAAAAEAAAABAAAAAQAAAAEAAAABAAAAAQAAAAEAAAABAAAAAQAAAAEAAAACAAAAAQABAAEAAgABAAIAAQACAAEAAgAZABcA7wGRAQUABAAGAAMACAAHAAQAAwAHAAYABAAHAAwACwADAAsACQAIAAMACwAIAAIADAADAAsACgAJAAIAEAAMABEAEAABAAEAEAACAA4ADQAMAA8ADgAMABAADwAMAAAAEQABABUAFAASABgAFQAAABUAEgAAABIAEQAAABQAEwASABYAFQAYABcAFgAYAAQAUwJNAFIAUwBDAAIAAAABAAIAAAABAAMAAAABAAIAAgAAAAIAAgAAAAIAAgAAAAIAAgAAAAIAAQACAAIAAwACAAIAAwACAAMAAwAAAAIAAwADAAAAAgADAAMAAAACAAMAAwAAAAIAAgADAAIAAgADAAEAAwADAAAAAQADAAMAAAABAAMAAwAAAAEAAgADAAEAAgADAAEAAQABAAEAAQABAAEAAgAAAAEAaQAAAPUC6gEDAJkEQQBRAFkAAQAAAAEAAAABAAAAAQAAAAEAAAABAAAAAQAAAAIAAAABAAIAAAABAAIAAAABAAIAAAABAAIAAAABAAIAAAABAAIAAAABAAIAAAABAAIAAAABAAIAAAABAAIAAAABAAIAAAABAAMAAAABAAIAAwAAAAEAAgADAAAAAQACAAMAAAABAAIAAwAAAAEAAgACAAEAAgACAAEAAgACAAEAAgACAAEAAgACAAEAAgACAAEAAgACAAEAAgACAAEAAgACAAEAAgACAAEAAgACAAEAAgACAAEAAgABAAIAAQACAAEAAgABAAIAAQACAAEAAgABAAIAAQACAAEAAgABAAIAAQACAAEAAgABAAIAAQACAAEAAgABAAIAAQACAAEAAgABAAIAAQACAAEAAgABAAIAAQACAAIAAQACAAIAAQACAAIAAQACAAIAAQACAAIAAQACAAIAAQACAAMAAAABAAIAAwAAAAEAAgADAAAAAQACAAMAAAABAAIAAwAAAAEAAgADAAAAAQACAAMAAAABAAIAAwAAAAEAAgADAAAAAQACAAMAAAABAAIAAwAAAAEAAgACAAAAAQACAAAAAQACAAAAAQACAAAAAQACAAAAAQACAAAAAQACAAAAAQACAAAAAQACAAAAAQABAAAAAQAAAAEAAAACAAEAAgACAAEAAgACAAEAAgACAAEAAgABAAIAAQACAAEAAgABAAIAAQAAAAEAAAABAAAAAgAAAAEAAQABAAIAAQACAAEAAgABAAIAAQACAHcAkQC7BsUEbABUAFMAawBSAFEAYgBJAEgAYABHAEYAXwBgAEYAXABCAEEAWwBAAD8AMQB2ADIAMgB2ADMAdgA1ADMAMwA1ADQAdgA2ADUAMAB2ADEAdgA3ADYALwB2ADAALgB2AC8ALQB1AHYAdgA4ADcALQB2AC4AdgA5ADgAXQBFAEQALAB1AC0AOwA6AHYAdQA7AHYAOgA5AHYAdQA8ADsAKwB1ACwAdQA9ADwAKgB1ACsAPgA9AHUAdAB1ACkAKQB1ACoAWwA/AHUAPwA+AHUAKAB0ACkAJwB0ACgAXABBAHUAdABcAHUAQQBAAHUAQABbAHUAYQBiAEgAXgBfAEYAdABCAFwAJgB0ACcAQwBCAHQAcwB0ACUAJQB0ACYARABDAHQAJABzACUAYwBKAEkAXQBEAHQARgBFAHQARQBdAHQAIwBzACQAIgBzACMAXgBGAHQAcwBgAHQAYABfAHQAXwBeAHQARwBgAHMAIQBzACIAYQBIAHMASABHAHMAYgBhAHMAIAByACEAcgBzACEASQBiAHMAYwBJAHMAHwByACAASgBjAHMAHgByAB8AcgAeAB0ASwBkAHMATABLAHMAcgBlAHMAZQBMAHMAZABKAHMAHAByAB0AGwBxABwAcQByABwATQBlAHIAGgBxABsATgBNAHIAGQBxABoAZgBOAHIAGABxABkATwBmAHIAFwBxABgAZgBPAE4AZABLAEoAUABPAHIAZwBQAHIAFgBxABcAZQBNAEwAaABnAHIAFQBwABYAcABxABYAVQBUAHEAcQBUAHIAVABsAHIAaQBoAHIAZwBRAFAAUwBSAHIAbABTAHIAUgBrAHIAawBqAHIAagBpAHIAFABwABUAVgBVAHEAEwBwABQAbQBWAHEAaABRAGcAEgBwABMAbgBtAHEAAgABAHAAEQBwABIAcAABAHEAAQAAAHEAbwBuAHEAWQBYAHEAWgBZAHEAAABaAHEAWABXAHEAVwBvAHEAagBrAFEABQAEAHAABAACAHAAEABwABEADwBwABAABgAFAHAADgANAHAADQAMAHAABwAGAHAADwAOAHAACAAHAHAADAALAHAACgAJAHAACQAIAHAACwAKAHAAAwACAAQAaABqAFEAaQBqAGgAbgBXAFYAbQBuAFYAVwBuAG8AAwCXCEIAUABYAAIAAAABAAIAAAABAAEAAAABAAAAAQAAAAEAAAABAAAAAQAAAAEAAAABAAAAAQAAAAEAAAABAAAAAQAAAAEAAAABAAAAAQAAAAEAAAABAAAAAQAAAAEAAAABAAAAAQAAAAEAAAACAAAAAQACAAAAAQACAAAAAQACAAAAAQACAAAAAQACAAAAAQACAAAAAQADAAAAAQACAAMAAAABAAIAAwAAAAEAAgADAAAAAQACAAMAAAABAAIAAwAAAAEAAgADAAAAAQACAAMAAAABAAIAAwAAAAEAAgACAAEAAgACAAEAAgACAAEAAgACAAEAAgACAAEAAgACAAEAAgACAAEAAgACAAEAAgABAAIAAQACAAEAAgABAAIAAQACAAEAAgABAAIAAQACAAEAAgABAAIAAgABAAIAAgABAAIAAgABAAIAAgABAAIAAgABAAIAAgABAAIAAgABAAIAAgABAAIAAgABAAIAAgABAAIAAgABAAIAAgABAAIAAwAAAAEAAgADAAAAAQACAAMAAAABAAIAAwAAAAEAAgADAAAAAQACAAMAAAABAAIAAwAAAAEAAgADAAAAAQACAAMAAAABAAIAAwAAAAEAAgADAAAAAQACAAIAAAABAAIAAAABAAIAAAABAAIAAAABAAIAAAABAAIAAAABAAIAAAABAAIAAAABAAIAAAABAAIAAAABAAIAAQACAAIAAQACAAIAAQACAAMAAAABAAIAAwAAAAEAAgADAAAAAQACAAMAAAABAAIAAwAAAAEAAgADAAAAAQACAAMAAAABAAIAAwAAAAEAAgADAAAAAQACAAMAAAABAAIAAgAAAAEAAgAAAAEAAgAAAAEAAgAAAAEAAgAAAAEAAgAAAAEAAgAAAAEAAgAAAAEAAQAAAAEAAAACAAAAAQABAAEAAgABAAIAAQACAAEAAgAwADcATAvRBi8ABwAGAC8ACQAIAAcALwAIAC8ACgAJAAUALwAGAAQALwAFACoACwAKAC8AKgAKACkAKgAvAAMAKAAEACgALwAEACoADAALACoADgANACoADQAMAAIAKAADACoADwAOACgAKQAvAAEAKAACACcAKAAAACoAKwAPAAAAKAABACgALQApACsAEAAPAC0AKgApACYAJwAAAC0AKwAqAC4AKwAtAC4ALQAoACcALgAoAC4ALAArACsAEQAQACwAEgARACQALgAnACwAEQArACUAJwAmACMALgAkACUAJAAnAC4AFwAsABcAFgAVACIAHwAjABkAGAAuABgAFwAuACMAHwAuABcAFQAsABUAFAAsACwAEwASABoAGQAuABQAEwAsAB8AGgAuAB4AHAAaAB4AGgAfACEAIAAiACAAHwAiAB0AHAAeABwAGwAaAAIADAxEAEkAAgAAAAEAAgAAAAEAAgAAAAEAAgAAAAEAAgAAAAEAAgAAAAEAAQAAAAEAAAABAAAAAQAAAAIAAAABAAIAAAABAAIAAAABAAIAAAABAAIAAAABAAIAAAABAAIAAAABAAIAAAABAAIAAAABAAIAAAABAAIAAAABAAIAAAABAAIAAAABAAIAAAABAAIAAAABAAEAAQABAAEAAQABAAEAAQABAAEAAQABAAEAAQACAAAAAQACAAAAAQACAAAAAQACAAAAAQACAAAAAQACAAAAAQACAAAAAQACAAAAAQACAAAAAQABAAAAAgAAAAEAAgAAAAEAAgAAAAEAAgAAAAEAAQABAAEAAAA2AD0AAg0SCC0ABgAFAAEAAAACAAAALgACAC4AAwACACwALgAAACsALgAsAC4ABAADAC4ALwAFAC4ABQAEACoALgArAC8ALQAFAC8ABgAtACkALgAqAC8AMAAIAC8ACAAHAC8ABwAGADAACQAIACgAJwAuACcALwAuACkAKAAuACYALwAnADAACgAJADAACwAKACUALwAmADAAMQALACUAJAAvACQAIwAvACMAMAAvACIAMAAjADEADAALADEAMgAOADEADgANACIAIQAwADEADQAMACEAIAAwADIADwAOAB8AMQAwACAAHwAwAB8AHgAxAB4AHQAxADIAEAAPABwAMgAxAB0AHAAxADIAMwAQADMAEQAQABwAGwAyABsAGgAzADMANAARADQAEgARABsAMwAyABoANAAzABoAGQA0ABkANQA0ADQANQASADUAEwASABkAGAA1ABgAFwA1ABUAFAA1ADUAFAATABcAFgA1ABYAFQA1AAQA2g0jAEwAMgA9AAEAAAABAAAAAgAAAAIAAgAAAAIAAgAAAAIAAgAAAAIAAgAAAAIAAgAAAAIAAwAAAAIAAwADAAAAAgADAAMAAAACAAMAAwAAAAIAAwADAAAAAgADAAMAAAACAAMAAwAAAAIAAwAEAAAAAgADAAEABAAAAAIAAwABAAMAAgADAAEAAgADAAEAAwACAAMAAQACAAMAAQABAAEAAQABAAIAAwABAAMAAgADAAEAAwACAAMAAQADAAIAAwABAAMAAgADAAEAAwACAAMAAQAEAAAAAgADAAEAAwAAAAIAAwAEAAAAAgADAAEABAAAAAIAAwABAAQAAAACAAMAAQAEAAAAAgADAAEAAwAAAAIAAwADAAAAAgADAAIAAAADAAEAAAABAAAAAQAAAAEAAAABAAAAAQAAAAEAAAACAAAAAgABAAAAAQAAAAIAAAACAAEAAgACAAIAAwABAAMAAgADAAEAAQABAEQAAABLD80IAwBbECsAMwA/AAIAAAABAAIAAAABAAIAAAABAAIAAAABAAIAAAABAAMAAAABAAIAAwAAAAEAAgADAAAAAQACAAMAAAABAAIAAwAAAAEAAgADAAAAAQACAAMAAAABAAIAAwAAAAEAAgACAAEAAgACAAEAAgABAAIAAQACAAEAAgABAAIAAQACAAEAAgABAAIAAQACAAIAAQACAAIAAQACAAIAAQACAAIAAQACAAIAAQACAAIAAQACAAMAAAABAAIAAwAAAAEAAgADAAAAAQACAAMAAAABAAIAAwAAAAEAAgADAAAAAQACAAMAAAABAAIAAwAAAAEAAgADAAAAAQACAAIAAAABAAIAAAABAAIAAAABAAIAAAABAAIAAAABAAIAAAABAAIAAAABAAIAAAABAAIAAAABAAIAAAABAAIAAAABAAEAAAABAAAAAQAAAAEAAAABAAAAAQAAAAEAAAABAAAAAgAAAAEAAgABAAIAAgAAAAEAAgAAAAEAAQAAAAEAAAACAAAAAQABAAEAAgABAAIAAQACAAEAAgCKAJsA5xFvC0oASQBDAEoAQwBCAEsASgBCAEgARwBEAEMASQBEAEkASABEAEYARQBEAEcARgBEAEEASwBCAIEATABBAEwASwBBAIEAQQBAAD8AgQBAAD4AgQA/AD0AgAA+AIAAgQA+AE0ATACBADwAgAA9AIAATwCBADsAgAA8ADoAgAA7AFAATwCAAH8AgAA6AH8AOgA5AE8ATgCBAE4ATQCBADgAfwA5ADcAfwA4ADYAfwA3AH8AUwCAAFMAUgCAAFEAUACAADUAfwA2AH4AfwA1AFIAUQCAADQAfgA1AFcAVgB+ADMAfgA0AH4AVgB/AFYAVQB/AFUAVAB/AFQAUwB/ADIAfgAzADEAfgAyAFgAVwB+ADAAfgAxAC8AfQAwAH0AfgAwAIYAWAB+AH0AhgB+AC4AfQAvAC0AfQAuAIYAWQBYAHwAfQAsACwAfQAtAHwAhgB9ACsAfAAsACoAfAArAFoAWQCGAIcAhgB8ACkAfAAqACgAfAApAFsAWgCGACgAewB8ACcAewAoAHsAhwB8AIUAXABbAIUAWwCGAIQAhQCGAIcAhACGACYAewAnACUAewAmAHsAgwCHACQAewAlACMAewAkAIIAewAjAIMAhACHAIUAXQBcACIAggAjAHoAggAiAIIAgwB7ACEAegAiAIUAXgBdAIUAZgBeACAAegAhAGYAZQBeAF4AZQBfAGUAYABfAGcAZgCFAIgAhQCEAIMAiQCEAB8AegAgAGQAYQBgAGUAZABgAGQAYgBhAIgAaQCFAIIAeQCDAHkAiQCDAIkAiACEABoAegAeAGkAaACFAGgAZwCFAB4AegAfAGQAYwBiABkAGAB6ABoAGQB6ABwAGwAdABsAGgAdAB0AGgAeAHoAeQCCABcAFgB6ABYAeQB6ABgAFwB6AIgAagBpAHgAiQB5ABUAeQAWABUAFAB5AGsAagCIABQAEwB5ABMAEgB5ABIAeAB5AHgAiACJABIAEQB4AHgAdwCIAHcAbgCIAGwAawCIABEAEAB4AG4AbQCIABAADwB4AG0AbACIAA8AdwB4AA4AdwAPAHEAcAB3AG8AbgB3AHAAbwB3AA0AdwAOAHIAcQB3AAwAdwANAHYAcgB3AAsAdwAMAAsACgB3AAoAdgB3AAkAdgAKAHMAcgB2AAgAdgAJAAAAcwB2AAYABAB2AAYAdgAHAAcAdgAIAAAAdABzAAUABAAGAAEAAAB2AAQAAwB2AAMAAgB2AAIAAQB2AAcADxQ6AFwAPABLAFUAVABbAAIAAAABAAIAAAABAAIAAAABAAEAAAABAAAAAQAAAAEAAAABAAAAAQAAAAIAAAACAAIAAAACAAIAAAACAAIAAAACAAIAAAACAAIAAAACAAIAAAACAAMAAAACAAMAAwAAAAIAAwADAAAAAgADAAMAAAACAAMAAwAAAAIAAwADAAAAAgADAAMAAAACAAMAAwAAAAIAAwADAAAAAgADAAIAAgADAAIAAgADAAIAAgADAAIAAgADAAIAAgADAAIAAgADAAMAAgADAAQAAwACAAMABAADAAIAAwAEAAMAAgADAAQAAwACAAMABAADAAIAAwAEAAIAAgADAAEAAwABAAMAAQADAAIAAwAFAAIAAwAFAAIAAwAFAAIAAwAFAAIAAwAFAAIAAwAFAAIAAwAFAAIAAwAFAAIAAwAFAAMAAwAFAAYAAwADAAUABgACAAUABgACAAUABgADAAMABQAGAAMAAwAFAAYAAgAFAAYAAgAFAAYAAgAFAAYAAgAFAAYAAgAFAAYAAgAFAAYAAQAGAAEABgABAAYAAQAGAAEABgABAAYAAQAGAAEABgABAAYAAQAGAAEABgABAAYAAQAGAAEABgABAAYAAQAGAAMABQAGAAEAAwAFAAYAAQADAAUABgABAAMABQAGAAEAAwAFAAYAAQADAAUABgABAAMABQAGAAEAAwAFAAYAAQADAAUABgABAAQAAwAFAAYAAQAEAAMABQAGAAEABQADAAUABgAEAAEABQADAAUABgAEAAEABQADAAUABgAEAAEABAADAAUABgABAAQAAwAFAAYAAQADAAMABQABAAIABQABAAIABQABAAEAAQABAAEAAgAAAAEAAwAAAAQAAQAEAAAAAgAEAAEABAAAAAIABAABAAQAAAACAAQAAQAEAAAAAgAEAAEABAAAAAIABAABAAQAAAACAAQAAQAEAAAAAgAEAAEABAAAAAIABAABAAQAAAACAAQAAQAEAAAAAgAEAAEABAAAAAIABAABAAMAAAAEAAEAAwAAAAQAAQADAAAABAABAAMAAAAEAAEAAgAAAAEAAgADAAUAAQAAAAMAAAAEAAEAAgAAAAIAAQACAAIAAgADAAIAAwAEAAEAAwACAAMABQABAAUAAgAFAAYAAQAGAAEABgABAAQAAQAEAAIABAABAAEAAQAEAAMABQAEAAEABAADAAUABAABAAQAAAACAAQAAQAEAAAAAgAEAAEAWgBmANUXeg5OABgAFwBPABQAEwBQAE8AEwAKAFQACwAHAAYACQBUAAoACQAGAFQACQAIAAcACQARABMAEgBUAAwACwBUAA0ADABTAFAAEwARAFMAEwBTAA8ADgAQAFMAEQBTAA4ADQBUAFMADQBWAE8AUABTAFYAUABWABQATwBTABAADwBTAFIAVgAFAFQABgBWABUAFABNACQAIwBWABYAFQBWABcAFgAEAFQABQBWAE4AFwADAFQABABWABgATgACAFUAAwBVAFQAAwBKAAAASwAAAFUAAQBVAAIAAQBKAFUAAABWABkAGABEAFMAVABWABoAGQBGAFQAVQBHAEYAVQBKAEgAVQBIAEcAVQBEAEMAUwBWAFkAGwBWABsAGgBFAEQAVABGAEUAVABJAEgASgBCAEEAUwBDAEIAUwBZABwAGwBBAEAAUwBZAB0AHABSAFkAVgBZAB8AHgA7AFIAUwA8ADsAUwA9ADwAUwA+AD0AUwA/AD4AUwBAAD8AUwBZAB4AHQA7AFcAUgBZACAAHwAhACAAWQBSAFgAWQAiACEAWQBXAFgAUgAjACIAWQAkAE0AWQBYACQAWQBNACMAWQBYACUAJABYACYAJQBYACcAJgA6AFcAOwA5AFcAOgAoACcAWAA4AFcAOQApACgAWAA4ADcAVwAqACkAWAArACoAWABMACsAWAAvAC4AVwA3ADYAVwBXAC4AWAAuAFEAWAAsAEwAWAAtACwAWABRAC0AWAAwAC8AVwAxADAAVwA2ADUAVwA1ADQAVwAzADIAVwAyADEAVwA0ADMAVwBMACwAKwBRAC4ALQAFAD0ZOAAeACMAJAAKAAEAAAABAAAAAgABAAAAAgABAAAAAgABAAAAAgABAAAAAwABAAAAAgADAAEAAAACAAMAAQAAAAIAAwABAAAAAgADAAEAAAACAAMAAQAAAAIAAwABAAAAAgADAAEAAAACAAMAAQAAAAIAAwABAAAAAgACAAEAAgACAAEAAgACAAEAAgACAAEAAgACAAEAAgACAAEAAgACAAEAAgACAAEAAgABAAIAAQACAAEAAgABAAIAAQACAAEAAgABAAIAAQACAAEAAgABAAIAAQACAAEAAgACAAIAAwADAAQAAgADAAMABAACAAMAAwAEAAIAAwADAAQAAgADAAMABAACAAMAAwAEAAIAAwADAAQAAgADAAMABAACAAMAAwAEAAIAAwADAAQAAgADAAMABAACAAMAAwAEAAIAAwACAAIAAwABAAMAAgABAAMAAgABAAMAAgABAAMAAwAEAAEAAwAEAAQAAQAAAAMABAAEAAEAAAADAAQABAABAAAAAwAEAAQAAQAAAAMABAAEAAEAAAADAAQABAABAAAAAwAEAAQAAQAAAAMABAAEAAEAAAADAAQABAABAAAAAwAEAAQAAQAAAAMABAAEAAEAAAADAAQABAABAAAAAwADAAEAAAADAAMAAQAAAAMAAwABAAAAAwADAAEAAAADAAMAAQAAAAMAAwABAAAAAwADAAEAAAADAAMAAQAAAAMAAQAAAAMABAACAAMAAgACAAMAAgABAAIAAgABAAIAAgABAAIAAwAEAAIAAwABAAQAAQABAAIAAQAAAAEAAAABAAIAAQADAAMABAACAAMAAQACAGUAcwDFGxARVQAPAA4AVQARABAADwBVABAADQBVAA4AVQASABEADABVAA0AVQATABIACwBWAFUACwBVAAwAVQAUABMAVQAVABQAGAAWABUAGAAVAFUAVgAYAFUACgBWAAsACQBWAAoAGAAXABYAGQAYAFYACABWAAkACABXAFYABwBXAAgAGgAZAFYAVwAaAFYAXQAaAFcABgBXAAcAXQAbABoAXABdAFcABQBYAAYAWABXAAYABABYAAUAAwBaAAQAWgBYAAQAWABbAFcAAgBZAAMAWQBaAAMAWwBcAFcAAQBZAAIAAABZAAEAXQAcABsAWgBbAFgAVABZAAAAUwBZAFQAXQBeABwAUgBaAFkAUwBSAFkAUgBRAFoAUQBfAFoAXwBbAFoAXgAdABwAUABfAFEATwBfAFAAXgAeAB0AXwBgAFsAYABcAFsAXgAkAB4AJAAjAB8ATgBNAF8ATQBgAF8ATgBfAE8AJAAfAB4AIwAgAB8AYQBdAFwAYABhAFwAYQApAF0ATABgAE0AJQAkAF4AIgAhACAAIwAiACAAKQAoAF0AKAAnAF0AJwBeAF0AJwAmAF4AJgAlAF4ASwBgAEwAYQAqACkASABhAGAASwBKAGAASQBIAGAASgBJAGAAYQBiACoAYgArACoASABHAGEAYgAsACsARABiAGEARwBGAGEARQBEAGEARgBFAGEAQwBiAEQAYgAtACwAYgBjAC0AYwAuAC0AQABjAGIAQgBiAEMAYwAvAC4AQQBAAGIAQgBBAGIAPwBjAEAAYwBkADAAYwAwAC8APABkAD0APQBkAGMAZAAxADAAPwA+AGMAPgA9AGMAZAAyADEAZAAzADIAOQA0AGQAOgA5AGQAPAA7AGQAZAA0ADMAOQA1ADQAOwA6AGQAOQA4ADUANwA2ADUAOAA3ADUABwBZHUAATwBXADsAXgBWAF0AAgAAAAEAAgAAAAEAAgAAAAEAAwAAAAEAAgADAAMAAAABAAMAAwAAAAEAAgADAAAAAgADAAAAAgADAAAAAgADAAAAAgADAAAAAgADAAAAAgADAAAAAgADAAAAAQADAAEAAwABAAMAAgADAAQAAgADAAQAAgADAAQAAgADAAQAAgADAAQAAgADAAQAAgADAAQAAgADAAQAAgADAAQAAwADAAAABAADAAMAAAAEAAIAAwAEAAIAAwAEAAIAAwAEAAIAAwAEAAIAAwAEAAIAAwAEAAEABAAEAAMABQAGAAQABAADAAUABgAEAAMABQAGAAQAAwAFAAYABAADAAUABgAEAAMABQAGAAQABAAFAAYAAgAEAAMABQAGAAQAAwAFAAYABAADAAUABgAEAAMABQAGAAQAAwAFAAYABAADAAUABgAEAAMABQAGAAQAAgAGAAQAAgAGAAQAAQAGAAEABgABAAYAAQAGAAEABgABAAYAAQAGAAEABgABAAYAAQAGAAEABgABAAYAAgAFAAYAAgAFAAYAAgAFAAYAAgAFAAYAAgAFAAYAAgAFAAYAAQAFAAEABQABAAUAAgABAAUAAgABAAUAAgABAAUAAgABAAUAAgABAAUAAgABAAUAAwAAAAEABQACAAAAAQACAAAAAQACAAAAAQACAAAAAQACAAAAAQACAAAAAQABAAMAAQADAAIAAwAAAAEAAAACAAAAAQABAAIAAQACAAIAAgAEAAMABQAGAAQAAQAEAAIAAQACAAIAAQAFAAEABQACAAUABgACAAYABAABAAYALwAyAK4f3xIqAAYABQAqAAUABAADACoABAAqAAcABgAqAAgABwACACoAAwAKAAkACAAuAAoACAAqAC4ACAABACoAAgArAC4AKgAuAAwACwAuAAsACgAAACoAAQApACoAAAAoACoAKQAuAA0ADAAuAA4ADQAnACYAKgAoACcAKgArAC0ALgAmACUAKgAlACsAKgAuAA8ADgAkACsAJQAuABAADwAkACMAKwASABEALgAtABIALgARABAALgAjACIAKwAtABMAEgAiACEAKwAsAC0AKwAhACwAKwAhACAALAAUABMALQAVABQALQAWABUALQAYABcALQAXABYALQAZABgALQAaABkALQAsABoALQAgAB8ALAAbABoALAAeAB0ALAAdABwALAAfAB4ALAAcABsALAADAGogJAA+ADcAAgAAAAEAAgAAAAEAAgAAAAEAAgAAAAEAAgAAAAEAAgAAAAEAAgAAAAEAAgAAAAEAAgAAAAEAAgAAAAEAAgAAAAEAAgAAAAEAAgAAAAEAAgAAAAEAAgAAAAEAAgACAAEAAgACAAEAAgACAAEAAgACAAEAAgACAAEAAQACAAEAAgABAAIAAgAAAAIAAgAAAAIAAgAAAAIAAgAAAAIAAgAAAAIAAgAAAAIAAgAAAAIAAgAAAAIAAgAAAAIAAgAAAAIAAQAAAAEAAAABAAAAAQAAAAEAAAABAAAAAQAAAAEAAAACAAAAAQADAAAAAgABAAMAAAACAAEAAgAAAAIAAQACAAIAAgABAAAAZABkAGQAAAAAAAAAAABLAGQAZABkAAAAAAAAAAAAZABkAGQAZAAAAAAAAAAAADkAZABkAGQAAAAAAAAAAABkABQASABkAAAAAAAAAAAAZAAyAFsAZAAAAAAAAAAAAAAAMgBbAGQAAAAAAAAAAABHAGQAZABkAAAAAAAAAAAAZAAyAEMAZAAAAAAAAAAAAAAAMgBDAGQAAAAAAAAAAABIADAASwBkAAAAAAAAAAAASAAyAEMAZAAAAAAAAAAAAEgAZABkAGQAAAAAAAAAAAAAALgeQcHsUXjBZmYSwT0Kc8HheszAcT1qwdejgMAUrlfB9ij8v7gePcH2KNy+pHAdwT0KVz8zM+vApHDdP4XrqcAzMyNA7FEYwK5HUUB7FC6+heuJQAAAEECkcK1AexReQJqZ6UCPwpVAuB79QDMzy0BSuO5AzcwQQQAA2EBxPTpBheu5QLgeYUFxPYpA16OCQQAAIEAUrpVBzczMPilco0GF69G/9iisQYXrccA9Cq1BAACowMP1pEEzM7PA7FGWQT0Kz8B7FIJB16MAwT0Ka0GF6x3Bw/VYQVK4SsHsUUhBj8JxwRSuO0GPwo3BmpkpQUjhpsEpXBdBheu9wSlc/0BxPdTBhevBQArX58E9CldAuB73wc3MzD4fhQHC16NAwHE9AMKPwq3AAAD0wfYoAMEUrufBUrgawa5HycGamVHBPQqtwaRwacEK14/BcT1ywR+Fc8Fcj3bBuB7ZwexRNMEAAI7Bw/VAwT0KQ8E9Ct/ArkdBwClcjz+F65G/rkfBQMP1qD7D9RBBzczMvnE9UkGuRxHAj8KNQSGwAj/ByiE9RrYTP+/JQz0AxiM/QWV8PauVMT+8kbk9Mnc9P98yBz55dUY/bhc6PjDYTT/Qs3k+1/pSP8H/lj6Sy1c/+3S8Ps/3Wz94udg+iBFiP8jS9z7UfWg/uK8DP5hpcz8Mdgs//vF2P90kFj9bX3Q/aXQnPycxcD9iEDg/nbpqP7ubRz+ZDWI/whdWPxlzVz9SSWU/sD1LP0s8cD/ZWj8/Fk13PyzUMj9QAXg/GlEqP6qCcT8OSig/xcllP8o3Iz/tmVU/HhYaP/yMSz+Dbg8/CktEPyBj/j5Olz0/8PnhPi6QOD8Wh8M+lE0xPxn/nj76Cio/+wV7PueMID/PFDo+fEQUP3BCAT6Z9QI/6zmpPYT13z7Mf0g9J2u0PvFGZj23f5U+MiC7PcSUaD7WiwE+ATA+PoI5Wj7uJc09JTuWPjPcgD2HosA+BkdJPf3B4D5WDi09OPMrPgE1FT7mV8M+0T8BPvoKAj8DlYE+KVw3P5RN6T7TTUI//RMUP1DfSj8QdSc/7pRGP76kQT/9nzs/jPhePwAAgD+6ox5BedP9wAAAgD+wa01BLX0iwQAAgD+b7XxBS6xAwRjsfj/VnJdB46VQwSegiTuXXYTBfGXqwJVIej/v5rFBvvhUwW/YtjwmE1nB/NMLwQbYbz8at8pBD59NwZM6gT3TDSjBcH4WwUTdVz+SGeVBfSo7wVGIID7mVeDA7uEXwce6OD/YoPlBdPcpwSKJjj4gXYfAWU4WwU7R8T5V5glCZO4KwbEWBz8s8ve+nsYLwbq9hD78IhRCe9npwFxyPD++VhlA/akFwZm7ljvPGUTBosRcv+DWnT16QSBCZZvAwC7FXT8J8bVAWYIDwWDqZz1i+xnBYcI1wGACtzyMeyhCWwC8wAEwVj+2IvVAqPwMwXFaED7PgwfBY4yRwJNXZztWdTNC0PbMwIkMQz95oyBBeXAkweAtcD4OwvHALg3mwGL4MD/9B0RBkQIhwe0Nnj4cnLbAtsQGwdPeCD9k13BBlo8BwQtB7j7W0xLAkMYKwfFjnD7YtYxB4b68wGDNMT/x2Yc/2zUJwVN5+z0wkJ5BCa1hwC6QYD8KS4lAZmsCwQTKpjyugaxBtjkgvwjJej8VNu9AFUbgwAAAgD+adC5B8AOwwAAAgD9am1lB5RZdwAAAgD+ynnhBUJOmvwAAgD/DboJBtPuhPyQLmDnMJz1Co7SWQRe3UToz2KlBaatHQUG3fz8HLnhB1FhWQAqdVzuWkTVCtuSLQWVwFDwl1JdBBSs+QVLVfD+nRFZBfhCKQBNm2jwjrylC3Tl/QZKWij2igXpBEv83Qa7YZz9nNSlBjcfDQMO2xT3elR5C9Dd+QSBeNz4Rn1BBFL9GQVBwOT+5HBJBKNEHQXRBXT4YERRCOZWDQfVKiT70bCxBAv1dQYEJBD9/ywRBELgwQQfO2T5IWgZCo2iPQVABkD5+eAFBc8CDQQoulj7OnftAEQxsQaZhGD9hm/VBCY6aQYKQbD6XRbxAzleWQajjMT6h9fNAXZmPQRB1Pz847tpB1WqkQZfFJD5ozExAjP+oQZS8uj1wseBAIqGrQWGJXz9zWrxBg96xQc6luD19LmA+1mPAQVcJFj1uC9JAYNXMQVIncD+LTp1BEhG7QQX6RD12UUDAxvfTQWUZYjyNubNAZVDsQZuseT8AvndBGXbAQQ5PrzwApNXAO9XkQQqdVzvec4NAxvoFQo82fj9ZAi9BKd69QWwm3zsEsTDB8ULvQazFJznBmsY/PRIVQkq1fz+1+9RA8am1QYIclDrrlXbBXrLzQQAAgD/wUBdACE6nQQAAgD8FRxA/I5mTQQAAgD9Za4K+81VsQQAAgD8q25e+2A0/QQAAgD8GjTM+K+exQAAAgD/hCAVA5AuVPwAAgD8C35xAXwYfwAAAgD+kOeVACJijwAAAgD+cqAm9YsUOQQAAgD+bo/hA2tzMPQAAgD/MhYlBlFPQvQAAAD8E2wFCgb81vwAAAD+J2+c+LQ0RvwAAgD/sduBA0CfqvAAAAD8BaDNBF4pfvQAAAD9pgjW+2kGDvAAAgD+6zp9ASuGqvgAAgD/GvjFB5+oVP6RwjkK4Hs7CKdycQq7HwsIfBahCAIC9wmbmtEJcD7/CXI/CQs3MwsKk8MxCKdzDwq5H0UKkcL7CrkfRQnuUq8IK18lCSOGgwhSuwEIAgJjCrse4QuxRlsJ7FLBC9qiYwjMzqkKF65vCw/WoQj0KmML2qKNCzcyTwpqZmULs0ZPCZuaQQnsUnMLNTIlCClehwnE9b0Jm5qDC7FFKQlwPocJcjzlCFK6qwjMzLEKk8LbCrkccQo/CyMKuRxxCzczbwnsUf0LNzNvCzvz6PnJQQj6sqBk/BruxPmB2Lz9KQdc+W5lIP7A4zD5PQGM/BruxPrGKdz8mAao+AACAP4ei0D4AAIA/mGkrP3R7cT9rfVE/sp1fP3dKbz9BK1A/sAN3P341Pz/ovG4/p7MzPxgmYz+uRzE/1PFwPyv7Jj8AAIA/G0wTPwAAgD9YVgI/iZhiP8H/5j6/1E8/E/KhPsR8UT8jvjM+Ne9QP8Go5D2qty4/c/R4PeIeAz8AAAAAtU+HPgAAAAAAAAAA9dbAPgAAAAB0RsQ+PiRhQaGWecF32x0/x71yQTANO0FWZU8/a18MQfDMrcAKaEI+9PgdQa3erkESFF8/Y0HaQKopAkBL5W08dHT9QB6X6kGInek9a2gmQXrHc8G3C90+rkgUQXA7HEF9eRE/Z5BNQeks8MCm8vY9hU5SQTvHjUEEIWE/H8uFQUGS5z5VGFs9uexvQVvNv0HTTXI/OZqUQaOR1kBoeR49LrBCQQAk2kHCF3Y/6Pd7QRz2H0EAAIA/Fz+FQDzZQkHjwgE7HRj3QAW51UGVfX8/tytRwIKGDUFV2Xc9Qf7BP7x2sEHDgXA/NJcXwd8DhkB0JBc+1Js8v2qpi0H18yY8c+h0wZjchkFrmlc/uaA7wY4W076amak+AVOcvhd/PUGlFHQ9TgFuwXTlM0FB8Rs/lLk0weHYwMC37h4/GjSCP5tc+0BPO7w9M9hYwVQp6EAfEZM+eZAfwTs9IMGG5lI/jDDBvxxY8UCv6xc9ZKKAwdYk3kBeaA4+Dv1HwXo/JcFN+HU/5z2XwBzcmEC5cCA98HV7wXp9UcGbVX8/ERG8wH/Es7/9vCk728aawc9IykHY2EU/453nv2l/9sBzuuw9OQmDwVjZBMGSeeQ96nh0wT3ll0GaJeE+G+gKP82qT8HvOEU+NHBgwXBEWcGfPLw+rNZOwWFfW0Gq8dI9WcbivxFNvsHe5SI9wLuCweIZw8HFcls/+N1zwTLAOUCjBlM84K9zwPyTDMI+s3w/kziKwcBFB8EXt9E6Ce+QP4OdJcJ9ln8/TGdFwdxra8EAAIA/To2ywJ/focEAAIA/nj+OQOd32cEAAIA/gh6BQRUU68HX+uI9ZAKmQT+p0sH9n2M/Kc+uQUEVdT/NzB1Ccb0Pw+xRKUJSeAzDexQvQqSwCcNI4TVC7NEBw0jhNUJSOPvCSOE1QgAA8sK4HjNCFC7pwoXrLUIAAN/C4XolQuxR18KkcB9ChevRws3MGELh+svCSOERQuH6xsJcjwpChWvBwh+FAkJxPbzChevxQVK4tcKkcOFBe5SwwoXrzUEzM6vCKVy3QVwPpsKPwqFBw3WiwvYoikHXo5/CXI9WQR+Fm8JI4RZBZmaXwj0Kz0BcD5TC7FFYQKRwkMLhepQ+KdyNwoXrIcDsUYzCXI9ewfYoiMIfhYvB7FGHwj0Kp8HXo4bC4Xq4wQCAhcJI4dLBPQqFwuF67ME9CoXCFK4LwgCAhcI9ChbCexSGwkjhH8KPQobC16Mqwh8Fh8IzMzzCzcyIwpqZRcKuR4rCcT1NwlyPi8LXo2XCpPCPwgAAbsLNzJHCw/V3wtcjlMLNzH/CXA+XwhQuhMLheprCAACIwpqZncKamYvCHwWhwh+FjsJSuKTCZmaQwsN1p8LsUZHCuJ6pwincjsJIYbDCZmaNwgrXssKamYvCCte1wo/CiMKambfCXA+FwmbmucJSuH7CZua8wuF6b8KkcMDCpHBiwqRww8KF61XChWvGwsP1ScL2KMnCmpk/wgpXy8JcjzLCPQrOwsP1JMKk8M/CAAAZwuxR0cK4Hg7CuB7SwgrXAcJ7FNPCmpnpwRQu1MIfhc/BZubWwtejuMHNzNvCSOGiwexR38IfhYXBFK7jwtejVMEAgOfC7FEgwY/C6sLsUdjAXI/uwuxRaMBcj/HC7FE4Pilc9cL2KFxAZub4wsP1wEDh+vzCCtcLQY9CAMMK1ztBzUwCwxSua0FSeATD16OMQY+CBsMpXKFBzYwIw8P1tEEp3ArD7FHGQYUrDcMpXN9BZuYRw9ej/EFm5hHDpHAOQmbmEcMzMzJCChcGw83MtMCuR4vCj8IBwexRisLhejDBrkeJwoXrAMLsUYXCheszwj0KiMKkcFXCuB6NwjMzXsL2qI7CXA+QwrgercLsUQxCmtkKw9ejGUIp3ADDPQrhQc3M5sLheoxB7FHNwtej0D+kcMHCKVx3wT2Ks8K4HgLCheuwws3MU8Jxva3CSOF4wgAArMLYDXM/ndfYPDI9eT9sIYg93lR8PyECzj0AAIA/GcpJPgAAgD9txX4+AACAP1lMnD7Th34/ufy3PuW4ez9O7tc+mC93P44G8D4483M/93UAP6ZhcD8hyAk/YKtsP+CcET+twGg/T1gaP3ZsZD9jeiI/H0tfP420LD+g4Fo/8MQ0P8uhVT82PD0/749PP5hMRT8zxEk/AvFKP+hqQz+/YE8/eSM7P5nTVT9ClTI/G0dcP588LD+hhGE//5UlP842Zz/t9R4//z5rPxHkGD+Or20/R3cAP3IzdD8Xt/E+44h1Pxzr4j5PknY/SpjZPiFZeD9JaMs+hxZ5PzSdvT6HFnk/w56mPiFZeD8DeJs+uHV3Pz7tkD6zKXc/8l6FPkT6dT/ACWU+BipzP0XYUD5F2HA/1H1APg7bbj/sFww+e/dnP18k9D1WDmU/PWHJPeVhYT9n1ac9LspcP/rygj2Dblc/MXxEPSeIUj9EbgY9fCxNP4FDqDzZWkc/Ug9RPMcRQz/RVxA8QKQ/P2AfnTzIBzU/1ZXPPL4wMT+xogY9eH8sP8dLNz1nuCk/tMh2PREZJj9Ldqw9I2chP0vl7T2h2xs/JvwSPrMpFz/P2i0+bHgSP5+ORz7wMw4/6MFdPljKCj9oy3k+24UGP+F/iz61iQM/yVmYPiNnAT/ZCKQ+dR8AP6Q2sT4TRP0+ZDu/PtPZ+T4lQM0+KlLxPqGE2T4B9uE+sTPlPq3d1j4F+vQ+/DXJPhnKAT8TRL0+ecwIP6MGsz7Zzg8/uhSnPiuHFj/esJ0+Y7QeP/W+kT7DtiU/oKaGPpZDKz+ns3M+HhsxP52FXT4SiDc/A+xDPgb1PT+inCg+RBdEPwgDDz4WpEk/3dLqPTLmTj/IzbA9OpJTP2iRbT3kSVo/AAAAANklYj8AAAAA7s5qPwAAAABxA34/8FAUPpwzEj9dUG8/ke0MP9HLcD9RpQY/oGxyPw4tsj5/pHg/TOB2PnVZdD+T4y4+4GdsP+IGHD6y9Gk/Z9VnPL8rOj9Lq2k/dAexPbfRcD+k5FU+5L1aPyJxvz4oCkQ/q7IHP5XUIT9pUho/TkX6PsUgMD9y4bA+YTc0P91eMj6kNjk/VoLFPZnwOz8AAIA/C+lpwWARO0EAAIA/lZpbweMzykAAAIA/BrNCwWqaLkAAAIA/FFa8wI1JpMAAAIA/mzHnv3dWB8EAAIA/tEgqQP6VQcEAAIA/UlHvQBmcbsHqyn8/Ev9WQV9ijcEXt1E65skCwoKiO8DqeHw/OpiWQa5JlcGRm2E8wXrjwTXhy8BNhHU/SxC1QeujmsG0sCc9m0LLweNuDMGUTWk/wJLWQSqJoMEijrU9z6CwwYvINsH92Vc/vuH0QV/rosFslSA++yGXweLnV8G37j4/Df8KQvtLpsHzH4I+a0x3wSRzfcHJqyM/RGIbQhoUp8Eep7g+jnE+wUgOj8Hzcf0+jZEvQr0lqcFfRgE/+/DywIIkpMFAwcU+WwlAQkxqqcG4Hh0/pl5/wEMZtMFAE5E+hCtSQtl+p8G4dTc/fC7dPe24w8G14EU+5QllQj/focErh04/ONaSQBjL0MFTIgk+O4t0QnNQmMHDtl0/2AoJQT4y18GInak946mBQsxaisHHnWo/v1RKQcUK2cE0gDc6Cxcjwlm9fcGTHRs9j8CLQiTlcsHaj3Q/OLKQQWFy3cGmft47pfIOwmDxj8G7fkE8wQeWQm04T8HQ1XY/RVa9QV5l4cG8XMQ8g2r0wajooMHNr2Y7DvGdQm9uNsEteHE/lA/fQfSb5cGzB1o9nnHVwY7mrsHDZCo6X1SmQlZlHcFXeGc/akIBQsaf6sE/48I9RQ21wbkrvsHF/lo/XQASQgrU6sFLAhQ+uB+VwQBDyMG0cUw/6oEgQiY/58GPNk4+0bJwwRRqzcGvJeQ+nRhZQgpKz8GB7A0/8LQkv7/518GSrqk+3ThqQjrGxcEPKCs/VBhzQDEC2cGX4mo+qsd6Qmjcu8GyRkU/9ecBQTZT2cG+EzM+FPmCQs/buMFpOlM/eFkuQYsO3cH7IuE93NKKQod1rsH52mM/JH9wQRNn3MF+xoU9jjmSQrNPosGIRm8/4h6YQQCM2cG9UpY8SWeeQgXWi8HCTHs/ME3NQQB50sGMvgI8WR6kQlukfsFe9H0/4NbmQdlFzcFivjw7B7mpQrFMasGaQn8/yUL/QVsuysGWJiU6bpWvQlfYTsEP1n8/ctsMQuD+w8EAAIA/j1IiQqA2t8FY/38/B7ItQue+rcEAAIA/9+s2Qq6qpcEAAIA/pVJUQgppisEAAIA/8FBeQoOQfsEAAIA/xTFqQkfQYsEAAIA/yE1zQlc7QsEAAIA/uDJ9QkNZHMEAAIA/yAGDQmy688AAAIA/hRuHQvksqcAAAIA/h1SKQrWENMAAAIA/e12MQhJKgb8AAIA/BUWNQsSOxT4AAIA/6XOJQv6djkAAAIA/U1yHQtUDvUAAAIA/88iEQhWQ9UAAAIA/hA2BQtbGCUEAAIA/HWF4QgliHUEAAIA/U4RpQiotNkEAAIA/y8BVQomiUkEAAIA/TdlEQlOyakEAAIA/r5g0QkNlgUEAAIA/QhglQl5fjEFSSR06pUibQpZ/6EEG2H8/xrUXQuzqlEHACYU7cHaSQsCc6EGd9H4/at8GQll0n0GB7HU8hLKJQoJ+5EGmJ3w/hQjrQeHhpUEL0gw9hiCCQvCG30GQMXc/BqPMQSIWqkE98oc9tOl2Qu/m2EERAW8/OTCxQaKkq0F2w/Y9Bs1nQkOw0UHpJmE/uS6SQSivrUGcUAg5NCaYQu7pQULF5mM+Va1XQrpmykF6/EY/iXFiQcFAsEEx68U6Zl2QQhaTOUIeFro+DwRGQpObykGskCI/hhMfQa7jukEErcA7kRmHQo86NkJPQAM/0CI0Qqpq1kEQevY+l3bDQEK90EFkXVw8UMl+Qvg+MUKu9R0/ojYkQqRf3EHLLb0+H6EhQHfX30EWMAE9ir5qQmroKULpmjk/ZRkPQhmc4kG3RXk+7lwSwIxH8kGI13U9AZpYQmvDIkK62ko/KX73QX5f50GXHBc+/HTXwG8iAUIuxdU9afRHQv08G0LufE8/iQ3TQRQK6kHpSK4938YvwfrKB0JpUio+AUs2QtGaFEKkGUs/M66tQdc970EhByU9nxt0weLMD0LwbXo+nJcmQiw2DUL76Dw/eweLQZg88UEwR488VJGawa7fFUKJJLo+cjETQklyBELc1yE/FiNBQdtZ9EHQm4o7FjbCwcKiHUJeovo+BwkCQvvN+kEXnwI/LcLuQLtZ+EHNr2Y5w0Lkwe3+JEKvzhk/BeXjQZ+d80FSYcw+rd9fQBeyAEJWtzI/tA3FQXbK6UEEkJo+/Jvzvki9A0Jk6Us/k0miQX5s30HRV1A+NTidwEl7B0LJ5V8/SCd9QZ301UGdYwA+pGgWwRfYC0LZd20/N4Q5QU/AzEH3O5Q9XKFawfveD0LHY3Y/SVTyQPOPxUEPuRk9RAWNwTVkFEJi1ns/T5VZQBYqwUG4HoU8q3SswTFtGkJioX4/xVwNv9vvvkEr+6477kzJwTv+IEL92X8/gG3zwHSOxEH3zBI6oTb4wYXuMEIAAIA/aPUnwXgvqEEAAIA/3eBawT/yiEEAAIA/LL4UwcjaXr+0cUw/Pe0vQp824MGPNk4+j54xwSvPz8G0cUw/kTc8QsJQ28GPNk4+loT/wA1l0sGvJeQ+DrZKQpgK1cGB7A0/5VOJwNX31MF+xoU9bUSYQl7hlsGIRm8/05ayQQrF1cEAAIA/8S4YQnXYvMEAAIA/ZchAQoARnMEAAIA/dFhLQtdxksEAAIA/ek+LQmajH0AAAIA/VMTNwAMIQUEAAIA/1bUeP9Hgcj8AAIA/4j2uQdR/jz4AAAA/KOMpQjY67D4AAAA/r3K8P/viWr8AAIA/3rO1QRIMKb4AAAA/tRg3QqHVvb0AAAA/0gyRv9SaOD4AAIA/UR+iQT006D4AAIA/l3Y3QnN6QD8AAIA/OgRmQgjrMz/NzJtC1yO6wh+Fm0IAgL7CrkebQnG9wsK4HptCCtfGwnE9nEKFa8vC7NGdQq7Hz8KuR59Cw3XTwgpXoUJmZtfCSGGjQpoZ28JxPaZCuB7fwhQuqUJcD+LCUrirQhQu5MKPQq5CZublwqRwsUJIYefCw3W1Qj0K6MIfBbpCuB7owlwPvkK4HujCexTDQgCA5sKk8MhC4Xrkwkhhz0LDdeHCHwXUQsN13cLDdddC7NHYwhSu2kJcj9LCmhneQoXry8LsUeFCj0LFwvYo5EIfBb/C4frmQilcuMIzM+lCH4WywlI460JI4azC7NHsQgrXp8LXo+5CZmaiwtej8EIpXJ3C9qjyQuxRmMJ7FPVC4XqUwoXr+ELs0ZHC9ij9QpqZjsIpnABDKdyKwtcjAkP2KIjCj0IEQ4/ChMLDNQZDKVyBwoVrCEOamXvCKRwKQ83MdMJcDwxDFK5twgrXDUMzM2bCuJ4PQ4/CXsLhOhFDhetWwgoXE0Phek/CPcoUQylcScLsURZDhetBwo+CF0PhejvCPQoZQ9ejM8I9ShlD4Xopwq7HGEMUriLCFG4XQ+xRHsLX4xRDhesawh/FEkPNzBnCPcoQQxSuGcLX4w5DFK4ZwgBADUNSuBnCcX0LQ1K4GcJ71AlDj8IZwo8CCEOPwhnCClcGQ4/CGcIAAAVDzcwZwgAAAkPNzBnCAMAAQzMzGsJmZvtChesbwhQu+EI9Ch3Ccb30QlK4HsIK1+1CKVwiwtej6kIUriTCrsfeQqRwLsIzM9xCheswwj0K1UJxPTjCzUzQQo/CPcLh+spCuB5Ewo9CyEJSuEfCMzPDQnE9T8IAAMFCFK5SwlI4u0LsUVzCmpm4QkjhYcKux7NCw/VswoVrqkLXI4XCPYqoQhQuiMI9CqVCheuPwlyPo0IAgJTCe5SiQpqZmMJSuJ5C9iipwhSunUIp3K3CrsecQsP1scIzM5xCzcy1wkhhA0MK1xnC7NH+QsP1GsJSOPFCzcwgwgCA50IfhSfCFK7kQlK4KcIzs+FCexQswgAA2kKuRzPCmpnXQlK4NcKux9JCw/U6wvaozUL2KEHC9qjFQs3MS8J7FL5CUrhXwmZmtkJ7FGfCHwWyQqRwc8L2KLBC16N5wo9CrkKPwn7CzUysQjMzgsLh+qZCmpmLwvaooUJSuJzCFK6gQuH6oMIp3J9Ce5SkwqTwvELs0dfCClfJQhQutMIK19hCw/WQwuH67EKF63vCw3X8QgrXWcIpHAhDuB5Ewo8CEUOPwjDCptUQPZ61mz4noAk9yhWOPtVbAz1vu4A+klz+PKzFZz4Xghw9DAJLPj9SRD25iC8+HhZqPYNpGD60PI89aof/PVluqT3+SNE9pffNPQzInj0HsfM90ZZzPR4WCj5iLT49uVMaPuELEz0exC4+eR7cPBFwSD7lRLs8fsZlPlIstzzEmX8+SkG3PFfsjz6TGAQ9ZqCiPn2uNj3pQ7c+TUqBPREZxj434LM9oRDRPv8J7j27Yds+fjoePktZ5j5790c+ZarwPtmxcT4xsfk+rHOMPqdcAT8qUqE+U+gEP9unsz4UIgg/U1zFPq62Cj/UK9U+NJ0NPxQ/5j711hA/RQ32Pg4QFD9j7gI/9u4XP93vCD/2Cx4//yENP6rUJD9VMBI/5lcrPyQLGD9UOjA/AU0cP7ADNz+AnyE/dEE9P/7xJj+gT0Q//YcsP/28ST972jE/wvpPPyJxNz8+rlU/SUs9PxNhWz8YJkM/+IhgPw9FST9FgWY/Nh9PP6Luaz9k6VM/D9FwP4vDWT+dnXQ/idJePwqAeT9382Q/clB6P0LsbD+jr3g/wD5yPx1adD8ktHU/CThsPxBdeD8yd2U/gT55PzYfXz8QWHk/bAlZP8pUeT990FM/KlJ5P7IuTj/kTnk/jNtIP0RMeT+rBEM//kh5P4WxPT+3RXk/hGQ5PxhDeT/Zzi8/2T15P33QKz8s8Xg/AwkiPxyZdz+94xw/Qbx2P8heFz85YnU/3lQMP2WNcj+YLwc/ibVwPyx96D44FWk/vTXgPj8dZz8YQ8k+T11hPw0auj63C10/Wg2pPhMPWD+MZ6A+NjxVP/EpkD6kU08/1xeJPoyhTD8CSG0+gxdFP7aEXD4fukA/lZo9PrD+Nz9EwAE+l/8gP+hq6z0+Pxw/yXa+PdYcED8Xmqs97usIP/cGnz2ifwI/KZZbPfj80D5jC0E9eTvCPuf7KT0wZLU+AFIbPdJSqT65NjQ/2T15P9SCJz+CVng/trkRP5/Icz8XKwI/pn5uPxJO+z6XxWw/gsXxPhTtaj8fLtk+u0RlPz900T4cX2M/xhbCPkpBXz/ZsbE+3V5aP+YFmD5kBlI/Ap9/PkuwSD/hXU4+nZ08PzdxMj4U7TI/x2MmPvYLLj9YVho+4BAqP7PNDT4snyU/1ILXPWbaFj93hJM95gX4Plbxhj2Kq+o+c/R4Pche3z6mYXg+LnP6PanZoz6taa4+XW3VPvZ/Dj9a8Ao/zEUsP9y6Iz9gAkc/71VDP+YFWD8G2F8/zjZnP9yAfz/i8T1B7unUQQ74/DoRjzLCV/MnQSrjfz/fyRNBSS3PQZ9x4Tni/zrC0jgMQVj/fz9Ty9VA9XHJQQAAgD++LYdAzI/DQQAAgD+OF98/jti2QQAAgD896wO/eE+oQQAAgD+lUxnApXGbQQAAgD+Y3onAbFGLQQAAgD/7qcLA3Fl3QQAAgD+BM/zAf0VPQQAAgD9wZBDB8u4pQQAAgD/KOBzBJwkLQQAAgD9aRCTBGt7aQAAAgD/u9yfByxuVQAAAgD/vMCHB/4gJQAAAgD9oLRPBBUUQvwAAgD9SFwbBcPQ8wAAAgD/4Ac3AMPiywAAAgD+b0oDA2WEKwQAAgD8Dq2+/H4c9wQAAgD9pkxdAMHhcwQAAgD/F3rlALPxtwQAAgD8YlyJB+Ct4wQAAgD//fGxBh4KBwTJafz/A9ppBlPSFwZYmJTuSXKDBGezPwTfgez/UFL1BmEiJwSbkgzygvn/BS/3EwTGZcj88J+FBQNaLwXhiVj2f1TvBq4y4wWtIZD/uLwBCTOGMwWu33T0MAwLBw7eswV3cTj+uKQ9CEk2NweuLRD5HCJbAq9agwdhHNz8RYRxC/7SMwbFtkT5wLNq/TnmVwS80Fz9BuCpCfoGMwVOW0T5/Lcc/BIyJwZIF7D6QQjhC0c2NwTVjCT8bv5ZAW0l/weqyGDs6JKXBvoC/wRCSpT4F0UVCWzKPwT5cKj/D+PtAFaBrwYyENjzxcZDBzO6twRY1WD7N21BC1GyUwbvyQT9WkCpBtRRjwQfr/zzqj3nBOZqiwUesBT57QlpCKEiiwcIvTT/6N1hBy/dsweIeiz14L0vB5c2fwQ4yiT0oT2VCsR+xwfcGTz8XWYZB8fN1wQCR/j0vqBbBtHabwf5D+jxgcXFCpkW+wV6dQz8V36FBZxJ6wck8Uj7dlcLAVWeUwdgNWzySTnpC0l/IwZ4kNT+CLrZB3Px9wbbbjj4XgmbAoJuPwVj/Zzse5IJCuezWwd3SGj/sE9FBKt+CwfiIyD6qQ4i+rniKwZxQiDm1fYhC5d3jwXqN/T4j0OpB+oGFwUImAT9FajhAkIqEwRZqvT5AdANCK3+JwU1KIT9mn8tAJDx+wV8piz4Xbw9CvzuKwalqOj8nkxNBb/JvwRdlNj4BmBxCtFKMwRNmUj8Or0ZB+qtiwS7n0j16gClCZ46MwXOiZT9boHdBrDdSwd8aWD2ZXzZClduMwap9cj/hPJRBpPBBwY8ZqDyhB0NCBDyLwYy+ej86oKtBfE4uwVXBqDuuLFBCzh6Mwdatfj8KwsRBrsYewffMkjpNkVtCSBeOwfK1fz8779pBm5YTwQAAgD/1JfFBAvoAwQAAgD8WmAFCVjnfwAAAgD807wxClXa2wAAAgD8E+BNC85BCwAAAgD+WrhVC5v5cvwAAgD/NQRJC85GQPwAAgD+UAglCr0hjQAAAgD8pSgBCqyKjQAAAgD+nNe9B0ivJQAAAgD89aN5B26bsQDSAtzk2U21CB601v2jofz99289BM3YFQYyhHDvLUGdCxcBlP7difz8FS8BBFOUVQf3ZDzxwnGFCrucZQPC/fT/+kLFBqDclQQPsozyTZVtCZSKCQPjfej+xeKFB9DU2QeXyHz3TsVVC4O6yQCoAdj/5s5JBtc1FQXpwdz0uFVFC2dDZQFGIcD9lzoZBZSNSQU9YAj7g1kZCNr0YQZ1oXz9hjVhBNyZuQWTpIz6+NEJC56IpQf8EVz+YgkFBRw14Qfa0gz6oODZCQFNQQd0kPj/6jAdBVHaGQYlBoD6Jsy9CFAZkQZTeLz/f69BAm4CLQfXWwD5bSyhC12p3Qd6THz9mPIxAZtGPQTASAj/MMBlCg7KOQQLZ+z6pIBo9eOCXQb06xzl4a7JCPEiBPxHkED/mmxFCw2yWQcAE3j7ecgTAoDeaQTZZIzy72KdCIB7hQOdvQj/X5ehBCBWxQfMCbD7cxiDB3lKgQRnKiTzlVaVChvMEQahvST8uj9tBnUW2Qd4CST6yYT3B+dygQQn+Nz2uG55C6tU8QeC5Vz9HvrVBeu3DQXwn5j235IbBn2ShQZ4knT3I7JhCbL1gQTNQWT9CeptBK9HLQYtUmD10S6LB6UCgQUcD+D2bApNCtGKEQfRsVj8QZXtBFGTUQbQfKT2zPcHBX5yeQZTeFz65x49CSVaOQeRJUj+4q1tBEy7YQeC59zw6eNHBPgCdQZhMVT7nSIlC8S6gQaNARz8gph1B49LdQfW5WjzCnvDBzi+YQXV2cj4kXIZC/M2nQR8uQT90DwJBlPzfQQTnDDzeXP7Bf7eVQcmroz6Po3xCD1e7QcKjLT9Dg11AF6TkQcAJBTvplRHCcOWNQXehuT4k8XNCOTvDQYAOIz9+bIk/9rfkQYKo+zljnxrCP7iHQURu5j5672JCOg/RQY/HDD8y1WDAdmjjQdXKLD+HrjhC15flQbZnpj6YOGPBW4rTQe31Nj8W+C9CEpDpQYgRkj41IoPBAwfQQSEHTT/70xpCa5XtQd/gSz73WqvBNGLCQTcaWD8AzA5CvyrtQeaRHz49I8HBuCa4QZTZYD9PTgRCmSnrQR8u+T2gddPBRbutQXi5eD84BrRB/5niQRe86DwskA7Cg0mDQT7Lez9eG5xBvejfQURuhjwb7BjCaRNuQQmnfT8oQYdBtYbdQdMTFjxW8iHC56ZYQfvLfj/3TGhB9gzaQZKumTsn8ynCfKpCQU9YAj7Jg0tCsHAEQZ1oXz/Y3XBBXBZhQWTpIz7J7zxCiZ46Qf8EVz8wCShB+5mAQTASAj+0YiBCyQOFQQLZ+z5KiQhAnW+TQb06xzkYeK9CJxIlQBHkED+qpwlCpQudQcAE3j7tBIfAn0SbQTZZIzzFBq1CvMSAQOdvQj/l1AJCBZejQfMCbD6iKsPAnvycQTZZIzykbKpCv4KxQOdvQj+YLfdBFHKqQfMCbD4BcgHBq7meQRnKiTyeDKNCY/EVQahvST/IvM9BUke6Qd4CST6KWFbB7MegQQn+Nz1/oqBCerIoQeC5Vz8oFsNBE+G+QXwn5j35Q3HBG/2gQQn+Nz2wlZtC1s9NQeC5Vz8eD6lB8onHQXwn5j2eD5TBrKegQUcD+D132JVCwjV0QfRsVj8FQYxBxafPQbQfKT2r77HBLOaeQZhMVT6eUIxCDFWXQaNARz9TAztBFLbaQfW5WjxXuuHBvgyaQcmroz6MMoJCPomxQcKjLT/za7dAPAziQcAJBTsElAjC4mORQXehuT7HAmxCZ23JQYAOIz+Xtoa/cuDjQYKo+zlfhSLC0luBQURu5j7Q2FlCOCPUQY/HDD+4yrfAF8beQURu5j4wAlFCWurXQY/HDD/YfP7AmfvaQdXKLD89aklC0sHcQbZnpj6K6x7Bhi7ZQdXKLD9rKEFCJXbhQbZnpj7J50DBSrbWQe31Nj/lnSZCPGfrQYgRkj6685TBSgzKQZTZYD/lofNBf9foQR8u+T1FpuXBPAajQW/Ybj/C5N1BAZTmQUw3iT1EjvjB7g6YQXi5eD82ictBZ6DkQRe86DyiQATC68KOQQAAgD+d8YM/kD+BPwAAgD/+68RBMpJkPwAAAD/JUEJCqTCSvwAAAD+1fls+MF5QPgAAgD+h4YtBQPJhvwAAAD87+v5BqXYtvwAAAD+4kcY8fgkdvwAAgD8r1WFBj9DAvgAAgD/GN9ZBNFhhvmZml0IAADvCHwWfQlyPOMIULqdCAAAzwlyPrUJSuCrCXA+yQhSuIMI9CrZC4XoTwvYouUJI4QLC7FG6QjMz6cHherpCuB7HwexRuUK4HqXBHwW2QvYohMFI4bFCXI9WwUhhrUKuRzHBXI+oQkjhEsEAAKJCcT0CwWZmmkLhegDBuB6SQo/CAcEpXIpCPQoDwXsUhEIpXA/BAAB+QrgeIcFI4XNCZmYawSlcaEJmZiLBrkdbQnsUNsHXo1FCpHBdwcP1SUJSuIbBZmZEQq5Ho8G4HkJCFK69wfYoPEKamc3B16M5Qilc6cGkcDxCcT0Cwo/CREKuRwvCmplNQpqZEMJI4U9ChesdwmZmVkIfhSXCexReQj0KKcJcj3JCuB4swjMzgEL2KC3CCteDQqRwNMI9io1Cw/U5whSui0L2KCDChWuWQhSuCsIAAJxCXI/SwVwPmEJ7FJzBKVyOQilcZ8Fcj4FCj8I1wfaokUIzM9nBj8J9QlyP4MG4nqlCw/XewRdIID+ZKhg9kfIzP0sCVD0j80g/6UiuPXR7WT8IVQo+ehllP+krSD5wX28/X5iMPp1odz9lwr8+qWp6PyKr6z6fzXo/YhAQP8jSdz80Syo/OlhvP3iXQz/bomQ/SbpWPxMKWT88FGU/k4xMP5zEcD/ImDs/dCR3Py0JKD8p0Hc/tqESP/NUdz/nOv0+vtl2P3O63D78HXI/+5HCPp5Baz+Daag+f9ltP3mvij7BxWo/3/1RPtszYz9aEiA+rhJUP//n8D1uo0E/0uO3PYKoKz9SJ6A9m1UXP06XRT3rHAs/XacRPTqS6z5t/0o92bHBPphpuz0dyaU+Vz4LPlaClT6D+hY+X9JYPsDPOD4rTSo+8IpgPu6xFD4yA6U+dY4BPkPFyD4XZfY9/IzbPrTlnD2azgY/xY8xPQMJAj/AJks+u7gdPzempz6cFiw/4UUHPwr0IT/HLjE/p+gIPw5KUD9lws8++FNjP+Z0ET+2LQI/8PnBPhni+D6rPk8/bob7PjAvID/HcCdBk3nAQQKfvz5YbhTA+lrDQelIPj8f37dAUYC4Qd9sgz4Z7OPAY9y/QdPZWT/Z7Dw/kpqoQRSWGD5WQ0XBocS0Qb4Taz9De0fAolqSQdFcpz2W3YPBIkmiQfrQdT+MrLjA91hwQd7lIj1KBZzBLcaKQUpefT901ADBhHYsQYFDKDx8HrLBd2hWQQAAgD/Z5BvBJAywQAAAgD9h9CPBtRqBPwAAgD+bWCHB/RKKwAAAgD9HkBHBWVwZwZDafD8vEtnA7wdqwQ4ySTxC3L/BzKk/wfrQdT/kOoDAOg6Twd7lIj3WUq3BfkSAwcNHbD/184a/XjepwWu3nT3edZjBQAuZwWyVYD/WlwRA1AC7wWFP+z1gtYHBnaOtweNTUD/4Y8dAacXDwdatPj4zYkPB9j66wfvoND8Sti9BX/7CwWsrlj4Za+/Aj+29wZlkDD9nKoFBjSbAwc425z7b9xPAFfK/wc78yj774KdBmG+9wfGAGj8DJiJAVsnBwdUEkT5C3MZB7DG0we58Nz9zetBAbz28wTeOOD5vrt9Bv9qnwcvbUT92bhxBrOSywUeP3z1tKPlB3MyqwW8NZD/QV05B5824wUi/fT2F1gpCaGKkwWQjcD+yPoRBVMa1wbAD5zxJ3RpCI3yWwTvHeD+utKVBMLqrwTgVKTzcSiZCNnN5wQNbfT9UbL9By9KUwZ9xYTrfIy9ClqA7wfzGfz+BntRBw2VwwQAAgD9F6uRBug0rwQAAgD+v2OxBrvbTwAAAgD/AEP1BAZqIwAAAgD8B2wJCBgKnOwAAgD81hABChFqJQAAAgD900e1BATTpQAAAgD+HrNhBcSUSQYIclDoBKSJCY5SDQUq1fz+GQNVBEF5VQWjLuTsTjRlCb8CVQcGLfj81SMZBK399QaEtZzzcvg9C0JedQaJifD+dubNBetWIQbKFoD0s+etBecGiQaLuaz/UKoFBmv+TQaqaQD6CSclB8aSjQa7YTz8Dpj1BHPKYQZtVjz70NbZBbOy0QYtUOD/6zhtBa1esQb1S5j6qFoVB6E/AQfrVDD8jpHNAhGi9QXk7sj7Nj5FBlVmAQZzhJj/2Yo1AoNl4QVDfKj8xKD1B0SAQQRBAqj4zDS/A6QAVQQAAgD+Vqw1BuGLLv9NNQj8rvztBCoMfwRXGdj6DfqHACGEYwaIL6j68zpBBgJl/wYf5Cj+DihI/EN+BwVjKcj6VQtJBKJqbwcJMQz9CpQRBDCelwQAAAD/mH3RBnkBvvgAAAD/zFNC+6SSJvgAAgD84HTZBdDKmPQAAgD89YoM+or+XvWZmcEJxPYo+16N0QuxReEAzM3NCAADgQEjha0LXoyhBcT1kQlyPWkGkcFlCheuHQY/CQkLsUbpBpHA3Qj0K0UHD9ShCPQrnQdejG0JSuPRBj8INQvYoAUIfhfVB16MHQj0Ky0GuRxFCFK6rQexRGUKuR49BXI8dQqRwWUEpXCBCw/UYQexRIkK4HrVApHAlQo/CNb/heitCKVy3wB+FK0LhegTBuB4lQs3MGMGamRxCZmYuwUjhD0JI4TLB7FEAQrgeKcGuR+tBZmb2wJqZ2UGamYHArkfFQcP1iL8pXLVBcT3KP4/Cm0HhemRArkd9QaRwtUDNzDRBSOEGQY/CtUCPwi1BhesBQHE9dkFcj6K/9iigQUjhesAAAMBBuB69wPYo7EG4HgXBSOEHQrgeBcHhehVCZmb+wLgeJkIUru/APQoyQrge5cAK1z5ChevZwLgeTEIfhcPACtdaQlyPmsAzM2ZCKVw/wArXTUIpXKFBAAA+QkjhSsDNzA9CKVxPQI/Cs0EfhStBpHBlQT0KoUFmZsZAXI/wQYXrMUCF6wVCUrievilcDEL2KKTAMzMNQkuweD+SBSw+AU18PxNJdD6tF3s/5E6ZPmPRdD/Ut7w+f01uPy7i2z7/IWU/3Cn9Pj3VUT9qGB4/MC9IP91BLD+H4Ts/OBA6P5eLMD+0jkI/c7okPzANSz8qkRQ/7C9TP2N6Aj8dOF8/TkXqPg9FaT+BJtI+n5NuPxu7tD4EHHI/ijyZPhiVdD9ma30+lnh4PzWYJj4AAIA/+mHEPQAAgD866X091Ql4P917OD1uaW0/pn7ePIF4XT9Uxr88N/1JP/mDAT2dnTw/TfOOPQOVMT9NMvI9ZeQkPymzIT7o9ho/vMtFPpn1Cj/T3mA+u37xPuJ1fT5HPcQ+N4mRPjjziz53FaI+hA1PPk/pwD5J1ww+hXzgPqTHrz38jPs+gLdAPX2RED8AAAAAQbcfPwAAAADLSis/uYjvOz90OT+4HoU8Bp5DP3C2uTxOf04/3/3xPJXUWT8zxDE9iV5mP5nwiz1HA3A/+KrVPVc+Wz/kgw4/HclNPyntzT3RdCY/HThnPkok8T5MbL4+Ksa5PgtBDj8KaII+I/g/P0gzVj5AE1E/OPMrPi8XWT8C1NQ9gSZaPwAAgD82oljAlVE1wQAAgD/G6xPAa5R+wR2sfz/wh4g7IaeYwSF2pjqGpwfCL2sGwnQpfj9mqYVAyWquwVLy6jsCc+jBj9UKwjkLez/B1wJBKCLAweSDnjznSMTBFZcNwgT/cz+Qq1JBb8fPwT4FQD0QbJnB3AAOwu2ZVT8rvLlBWZvqwauVKT6oagnBJqMMwi6QQD+4XOBBUVn1wam8fT4sB2bAY/kKwkMEJD9itQZCKGn7waK0tz5+svk/VAAGwm8SAzrgaRrC5G69waoOCT/MaBlCY9v5wUME7D4klchAvpH9wUvlbTvy2AfCuLC4wVey0z7FsSxCiYb3wYofEz/HBStBVwDuwbt+QTwDd+nBpRKzwSgsgT5eWUVC/C7uwa8INj9YhIBB5CHUwVcJFj05IrnBl42lwcWs1z1UY2JCWvPowXztST8MLLVBQBO7wRni2D0fbn/B4GCbwYzzNz0WZXhCfRjnwQaeQz/7zt1BxxCqwWaIQz6TCijBTcWVweSDnjx/OYVCdc3ewYtPMT8azPxBmsKVwVx3kz5nAsPAc2yKwUjElDtxe49CU5TPwUATCT+4/w5CxX5ywb4w6T5swZK/tIBvwWVwlDuWy3vBVTwJwZxQCDmj2ZhC0fW/wfZFoj6Z3B1CSTI7weFFHz/doFZAIfpJwYLKeD1MmyrBxyEKwVrY0z36aS1C058JwerPJj/pl/1AbLQqwY3Rej5Qu7bAGRQRwf+VhT7E7XhBbgn3wFk0PT+bUBpAth0hwazFpzft71dC1GWHP/uWOT106aVBbr+FwJlkdD/zZApBLkwWwdvcGDxI4rFB9hs6vz2bfT8pkzlB8cnhwAAAgD+UJU5BZoeHwAAAgD8yAWJBYfnKvVMiCTwSvZVB8+UsQSfafT+YCF9BxbeYQKMG0zv/DDRCVkyEQa2GRD3umYFBRwZSQTgQcj8nDE1BARkAQWjLOT0/WiJCpzV5QXfzND6H3TpBWv1VQcQlRz/WJA9BZrslQaOSej704AxC2iZiQVYroz643MNA1JFWQQmK3z5EBYJA9TZQQc4ZCT9sVfdBJD9OQSUjlz4SKNI/fKlVQd9PLT6Tj7M99DtxQdEiWz+Dyc1B3fxOQadc4T2tklbAPnFsQS/6Cj1DM2nAEoSVQSegiTrWWYdCs4DTQABXej+3IaVBLH5fQRY1mDypTf/ARPmIQbnfITtWstPAK4O3QV4R/Dz+ZHpCuNYjQY8ZeD847WlBgsp5QazFpzi9i1XBKnGiQd0HQD4th2BCaGBqQWjoTz9y1OBAoAaMQffMkjlUVKHBxynBQYKo+ze8vGDBfogLQj1Esz7F9ExCC/OIQelIJj+gOco/rvqQQffMkjmjBMrBLoLRQYKo+zfzhozB9lYcQm6LGj9AHTFCWE6PQZ/Nyj58KqfAVJ+DQWK+PDlLBQHC5xXTQazFpze/LL3BLEEqQs+DUz/YcBZC8IOPQRDMMT6YyzfBHZ9iQc2v5jgImxvCxbzOQazFJzdmGu7BXOI0Qra5cT/qOABCwjCNQbYQZD2cxITBTm0/QYKoezjCpDHCEqDIQRU6fz9IisRB6euGQVWkQjvhxrrBERoKQYKo+zf4N0/CKkO9QbD+fz8T1Z1BsO9hQazFJzdwkGHCNxWkQVj/fz9IFYJB5vM5QVj/fz+WVUBBn+cIQVj/fz93vw9Br4XLQFj/fz8oELdAmTKAQAAAgD9EuSJAME+ZPwAAgD+jWyu/j6cdwAAAgD8d2SfA5uPGwO+PZz+bP5JBGyLdwUp7wz1s1VzBKCsNwgAAgD+BGQNBvC02PgAAgD+Uo8VB1GOpPgAAAD+55S9CHbICPwAAAD+dQgc/FTLQPAAAgD8Hk4BBwqVYPgAAAD/bhABCkD2ivAAAAD/x9h2/E8cVPwAAgD9vOqpAtLECvwAAAD8PShpBbzSAPAAAAD/m1lg/Cq3qvgAAgD+PqdtA4A9uvbgecUKuR5PBj8J+QuxRjsEUroZCAABwwa7Hh0K4HjXBH4WIQilc98ApXIpCpHB9wLgejUKkcD2/exSQQqRwDUDDdZJCKVyHQGZmlULsUchAPYqYQnsUBkGk8JxCZmYmQUhhoUKuR0VBClemQoXrWUG4HqtCj8JlQUhhsUJSuG5BexS3QlK4bkGambxCUrhuQQpXvULD9YhBPQq8QkjhnEE9irhC16OwQQCAtEIpXL9BM7OvQilczUGF66pCuB7ZQWZmpUL2KORBhWueQhSu7UEKV5pCAADyQaTwlUJcj/ZB9iiIQrge/UGPwn9CZmb8QaRwdkJcj/pBKVxtQlK4+EHXo2VCXI/2QYXrXUK4HvNBrkdVQj0K70GuR0tCuB7pQc3MQEIAAOBBH4U5Qo/C10FmZjNCj8LNQc3MLEIzM79BUrglQs3MrkEpXB9CH4WdQbgeGkKPwotBzcwVQsP1dEGamRJCpHBFQVyPEEKkcB1BXI8QQlK43kAzMxJCw/V4QArXGkLD9ci/rkcgQilcj8BI4SZCrkfxwNejLkJcjyLBmpk2QnsURsHNzD5C9ihkwdejREI9CnPBexRLQpqZgcEAAFZC9iiKwR+FYkJmZpLBPQqOQqRw+UFxPRZCcT2qPxQug0JSuILBhetBQj0KH8GuR1JC9igcv2ZmYUK4Hg1BSOF9QnE9WkGPwpBCPQqXQVwPoEIpXJ9BrsevQkjhnEHjiNU+XKyoPMWP8T5L6gQ9DcMHP2kArz0MBwo/Q+IePg2JCz+SeWQ+Dk8PP+HRlj62+BQ/RQ22PrQCGz8om9I+B+sfP3U85j4G9SU/wt35PltfLD+QMQc/rW41PzYCET/+fT4/1GAaP/uuSD/onyA/on9SP3sxJD/zVF8//N4mP5oIaz+k3yY/6lt2P6TfJj+U3nc/W5QxP5c5dT/Tnz0/RQ1uP0urST9Iv2U/4ZdSP6LuWz8fEVs//B1SP0Q0Yj9Ty0Y/YOVoP7ByOD/EsW4/NxowP2dEcT+6FCc/IAx0P8HFCj8TD3g/kpHzPgqddz/DgeA+B3x2P6LRzT6RYXU/pfe9PtAKdD+PNq4+WvVxP0t2nD6neW8/EOmHPtbiaz+Q2mQ+Ol1mP5T2Rj7UZWE/+b0tPqhSWz+kpRI+qn1SP2tg6z03jkg/GxK3PYwQPj+LGow9wkwzP0M5UT3Azyg/8uocPc11Gj9GlPY8xlAOP+ik9zwQXQA/2v4VPRzr4j5+AJI9Ke2tPmbavj3SxpE+Dwv1PZ7vZz49SRo+RiU1Pn/7Oj69GAo+TpxcPlBTyz2wrHQ+woanPRKIhz4oRIA9tvOdPnqlLD2Yo7c+PUm6PG/YFj/p1HU/eUBZPX8Tyj4LmAA/7yB2PQyTaT6hhDk+vVKWPh04tz5aR7U+YFkJP2XC7z4fuiA/xm0cP+IjOj/M0Ts/bTk/PwYSXD99sz0/chZ+Pyr9ZcDGApDBBHP0OzrTYsGZDP7BEk57P3cXmL9T1qzBzCiWPOw4IsGUTgXCrvV1P6HTdEClPcPBqpogPfWgjcDe+ALCB5lsP4UdBUEtqbnBTS2bPalbt79Hd+nB4UBYP/3wSUFzya7B2/kePsW4pz/3z8zBtrkxP7M4i0GSPqjBQWWcPgA3mEDxgLHBnFCIOdm9ksC6tOTBr18AP/dArkHpG6jB9DL6PuJUBUECSp3B5WEhPBr1LsDi9cTB2LufPrk0z0Hk9qnBDvgkPwBvPUEI5ovB6pUyPah8RL8G8qfBB5lEPr545kHt2qzBqTA2P8DbZkEm6oDBLT7FPZ6mTD8vIpTBQ8rPPSnx/kGIRrLBscQzP26UikE+n27B3gJJPn3cLUCFT4DB38MlPV9RDEJ5QbjBQiYZP7UNo0GE7VrBsfm4PmpkmEBpPVfB4ukVPDv1GUIYasTBYtvCPkFfwEFRiE/BADocPwPq8kD4QTDB4C2QOo45J0JGHdHBy6ElPtZj3UFa4UXBz05WP4QPJ0FYFgvBfcscPQxG+UFE20nBoDJ2P310WUFNwOXAFFysO4DBCEJ9Q1bBoKZ+P7rZhEHNM8vAAACAPwVQpEE9yrjAAACAP1jMwEEfabzAAACAP2Ji3EG96r/AAACAP/rH4EHY3FDAAACAP0QT20HdyAG+AACAP1leykHV1UFAAACAP1zDtkH5C61AAACAP71Un0F6D/ZAB0KyOUfGKULffpI+EOl/P/Hoh0H87hlB7C+7PIagIUKf8mNA2SV6PzWGWUHVRTdB/vHePUnfFUJRmeNAGCFkP+yDFEETR1FBbCFIPhKYDkI9WxBB/fZNP2Qo2EA2Xl1BMiCbPnG2BkJ3GTFBP28yPx/tgEDiKGpBijwpPwoC10E7mYNBnYWtPj5+kcCP7X5BlialO6MeXkJO1idAaOhPP6JCs0EEgJhB7C87PuCPG8E0wn9BRdhwPBVvWEKayKVAGZBdP+cznkE7vKJB8l71Pd1ISsEVpHxBoRABPQ3eUkJFcvVAbm5kPwyoiUEMqKxBxvmbPc7Od8E0fHlB3e9QPQXLTUIv/xtBOl1mP4aYb0EOdbRBkSdJPapHj8FXUHVBotGdPQ78R0Kg/ztBsKxkPzA0SkEK5bpBh/nyPPC0osGw8W1BZ0TpPR5aQULZlV9BH9dePwwOIEGx2sFBB+t/PDd1uMEMH2VBRnwnPg39OEKzyoNByqZUP3to20AxoshBYr68Oyiu0cGv6ldBdAxoPh6NLkJbTZdBGqNFPwB8VEDwocxBfPKwOqo67MHeykJBSFCMPmQ1JkKq6KNBYM05P0orNT+5Yc1BUkkdOUO//sHgWy9BzselPs5uHULi+qxBcRstP5qv3r8MvcpBhxbJPq3NEUIB47RBFXQbPzEDlsDI3cNBGH31PlnhBEL9+rxBJUAFPzpC/cCXqbtBC5gQP8ye70E2/MJBms7ePh5WMMFFlLFBcAglP9sK1kGiLsZB0O21PljmXcHohKVBJa82P+PtvUHQgcdBZqCSPi91g8E/xJhBP+NKPw9/n0EPC8NBZXBUPrfRmcGGpYNBIlRZP2OHhkFNyb1B2qwaPuk/q8HwBmJBDMhmP/0zWEHYVrJBXrrJPcVSusFT8jBBKCdyP+geI0HvX6JB/YJdPdrlxsEurPBAUkR+P/AsoEB3tHFB/YLdO+AR0cFhrJU+AACAP4v5FUD3nEFBAACAP3eIsb68AQtBAACAPzPWGMDlJqVAAACAPzuHfMAaQuM/AACAPyitosAyR8G/AACAP3uZrcBfY2nAAACAPwATucCj2L/AAACAP9PxtMDehxrBu5t/P8L8qMBLKVzBvTrHOi7wj8EVAurB0Ar8PuKm7UEblWBB8PkBP1NLZL943XNBKCdyP9tV+EB/7o5B/YJdPcewy8H4RYRAYOV4Px+gtT80grjB/z7jPDhU5cD7GQTCAACAP+udhD72Q4S+AACAP1ziT0Ez2qC+AAAAP19/zUHkbRA9AAAAP94rDL+qQjq+AACAPz0II0FdapY+AAAAP/zcuEHIQDs9AAAAP6Bboz54/De+AACAPz6wHkEe41A/AACAP2DOnUGq1e49FK5wQjMzOMKF63BCZmY/wq5HcUL2KErCXI9xQjMzU8IpXHJCpHBewuF6dEJSuGfC7FF8Qq5HbsIUroJCCtdxwjOzhkKkcHHCCleLQilccMLh+o9C7FFvwhSuk0LXo23CuB6YQmZmbcIAgJ1Cj8JswtcjokIpXGzCFK6mQgAAbcJ7lKpCPQpuwuH6rUK4Hm/CKdyxQmZmccIK17ZC16N1wincukJI4XnCAAC+QpoZgMKuR8FCXA+DwmZmw0KamYXCKVzGQq7HiMIAAMlCXI+Mwtejy0JcD5DCcT3OQuH6ksKFa9FCCleUwsP11UIAgJPCClfZQpqZkcI9Ct1Ccb2Owtcj4UJIYYvCcb3kQq5HiMJxPepCPYqDwq5H70JmZn7Ccb3zQo/CdsLhevdCrkdwwvao+0L2KGnChev/QoXrYMKuRwJDAABYwjNzBEOamU/C16MGQ7geR8LD9QhDZmY9wlzPCkNcjzTCXM8MQ8P1KsLh+g9DH4UbwgCAEUN7FBPCrkcTQ3sUCcLDNRVDpHD7wVxPFkOuR+nBPQoYQ1K40sGaWRlDMzO9wVK4GkPXo6bBFC4cQ9ejjsE9Sh1Dw/V4wcN1HkMK10vBhWsfQ1K4HsHsUSBD7FHYwNcjIUOamWnAcX0hQ0jhur8pHCJD4XqUP7jeIkPhemRAM7MjQ3sU3kDNzCRD16MsQYVrJUMUrmNBPQomQ4XrjUEKlyZDAACqQTNzJkN7FMJBChcmQ8P11EHsUSRDCtfdQaQwIkM9CttBAMAgQ3E90kFx/R9DAADGQVK4HkNmZrZBrocdQ3sUpEEKFxxDuB6RQVyPGkNI4XpBpPAYQ9ejUEFx/RZDrkclQTPzFENSuPZAe9QSQxSup0C43hBD7FFIQADADkPhelQ/PcoMQwrXg7+aGQtDmpk5wFK4CEN7FK7Aj0IGQ3E9+sA9igNDj8IhwWamAEPNzDjBAID5QgrXR8Fm5vNCCtdLwa5H7UIAAEzBAADnQrgeOcGkcONC4XoYwXsU4kIpXNfAM7PfQh+Fe8D2qN1CFK7Hv1K41kJmZua+9qjSQhSuR7+k8M9CKVwfwDOzzEJmZq7ArkfHQvYoCMFSuMNC16MowcP1vkKkcFHBKVy4QjMzg8Fm5rFCSOGYwR+Fq0Ifha3BPQqmQrgex8HXo59C9ijcwQrXl0K4HvHBexSQQgrX88F7FIhC16MCwrgegkKkcA/Cmpl7QvYoHcKuR3RCpHAqwgAAcUKPwjDCZmYOQ3E9I8KF64JCSOFJwh8FmULD9UrCZuazQmZmSsLNzMJCpHBjwlK41kLD9XvC7NHsQnsUVcIKlwFDcT0uwj0KC0OkcBDCFG4RQ2ZmxsHX4xhDexQawezRG0Ncj0K+AIAfQ1K4MkHsUdhCXI9mws3M3ELsUTTCH4XfQnE9A8LsUd5CMzOdwfaoAEPD9djBj8LxQuxRIsIKV7VCCtcAws1MwUKuRy7C/bwpPKTHjz4zxDE8YAKHPqTfPjxNoXM+09lJPJ2FXT6p9mk8Xi5CPn3LnDxBfSs+K/YXPTCBGz7zcW09PL0SPtl8nD0AxhM+ZTbIPTpdFj7y7/M9c/QYPsxdCz6DFx0+SzwgPjSdHT5blDk+qisfPiJxTz4NNyA+FNBkPjarHj4vNHc+OxkcPqSNgz5Ahxk+sb+MPvnaEz5ybZg+zo0JPmreoT4HfP49IlSpPgmK3z3ECLE+k6nCPXkBtj7v5qk9vva8PvH0ij31LcM+M6dLPSxlyT7ekwc9qIzPPlJJnTwRAdc+8kFPPIqw4T54uYg8xqLpPpsb0zxhVPI+7EwhPUME/D50XmM9aD8CP7D+jz2Atwg/W0K+PVGlDj9crOg9JuQTP6gYBz62Shg/0NUWPnMuHT87Uyg+VTAiPwNgPD6Hpyc/RUdSPqnBLD9JumY+LewxPzdsez5wXzc/6ZqJPj24Oz/XaZQ+wW5APxQioD6L4Ec/6PayPsVySz/OU70+6KRPP8R8yT7kLFQ/TWfXPnbDVj+if+I+Rs5aPxdI8D7z5V0/4nX9Pr0dYT+nlgU/441kP4nvDD90JGc/s3sSP1DkaT/uXxk/pidsPyhEID+zQW4/WP8nP3YycD/VlS8/5wBxP772ND/NdXI/3lk7P588dD/iO0E/Yi12Py14ST9Mw3g/7+FSP4s3ej/USFs/yat7P6HbYz++9nw/z2tsP9uifD8JxHM/98d7P4eKeT99lnc/9zt8P+qVcj+hZ3s/1zRvP4m1eD/HaG0/Bfp0P6lqaj+9NXA/UaBnPx+daj/3O2Q/xM5kP3+kYD/7y14/6NlcPwdfWD+BQ1g/VrxRP1N5Uz9hT0s/B3xOP/FLRT+f5Uk/fh1AP1PoRD84hDo/RFFAP170NT+PUzw/LGUxP5C9Nj+lLCs/y/MwP/JeJT+skCo/rMUfP/fHIz+WPhw/MZkaPwH2GT/zAhQ/wVYZP1g5DD9xVRk/odYEP/c7HD9/pAA/rTQhP8oV/j4kCyg/fH74PpzhLj9XsvM+T680P/hT4z4YYDc/Tb7ZPhqLNj/VW9M+E2YyP/fHyz7IJCs/uAG/PsGtIz8SoLY+Y7QePxV0qz7dexg/fuObPjxmED8kuYw+i8MJPxV0ez4MdgM/MJ5hPulD9z5Ke0M+YmfqPkPiHj7bit0+O430PaHb2z6tNKk94jvRPsR3Yj20k8E+MbYQPRjPsD5Bt5c8C5igPlg5NDxp45g+pidEP36MqT7t03E9zVh0PjhnJD4QzHE+73KRPnkjcz79h7Q+lQ42PtiB4z55kvQ9hLsLP9k9WT4QBiY/ixqcPj4/PD8Bh8A+PURLPzrM9z7eyFw/avYgP3qqYz8kCzg/AU1sP47MUz9KQec+LJouPhDM8T4+s5Q+Lhz4Poei0D67RPU+PnkIPxzTIz+9b+w+kIgRP/2kqj7x15Q+d4TTPiUGsT4W+5s++KV+P6XVtcC996BA96+sO7/99sDjPoVC0Vx/P87xssCt+DFAf4ciO2dcH8GTqYVCTu5/P76crsDyshS/nFCIOef1VMHNSIZCAACAP3Iyq8C87lnAAACAP6VuosAuT93AAACAP+CZjMBA+xzBAACAP4AG97+Pgz3BAACAP0ESZz+AAU/BAACAP3+CWkB4u0zB+I1/P7H6yUBABEfBK8HiOtgTS8ETfMbBGHh+P2taE0E8gEHB/Z/DO0E2KcHgabbBLuJ7P5FLOEFq2TjBPKWDPPrFEMH55qfBZmt1P5+vZEHcWDfBKT8pPbwt3MCKB5rBSiRpP0Q7jUHvxzPBb9i2PT47isAAhojBraNSP5dspEEZdzHBrW41PhJHBcDldHPB3/0xP3Iiu0EtWzTB8wKcPmUjmj7ZnVrBO6oSP92mzkFkSjnBRtPZPjg5HECiO0fBRfXWOrl4jcG3XadBfO3pPnmr30GFdT7BkIgJPz/bikCIBjfBPgXAO2lJgsE5SJpBAB2mPrEb80E/mEnBJ6ApP0B/1kD3tCjBWthTPKRxbsGxW4lB4xk0PjUKBkKOdF7B9wFIPwDBH0EXkRvBg24vPTtNVsE1RmJBZ+22PS8gEEKWYXPBAONRP3+aTEH/NxTBWvW5Pfx2RcF9DzhBu7gNPYEHGEIlYonBLzRPP8i1eEFVeRrB2LsfPmMSQsFXpAtBBwjmO41HIEJJEpjBJo1BP/xckkEeSh7BiZhyPuBQPMGPrL9AZRliO2KfJULxsqTB1osxP6B6okEnwSXB0SKbPpOpPMEyBHtAs+8KOpgTLUJ3f7TBOukdP/rft0FXQS3BxebDPtnEOsEoz5o/9n8OPw3OzUG4eDvBxf7iPgs0P8EKVdS/JV0DP+Lj4kF2dEfBGEP5PjHSQcFhm4zA1PH4PvYQ9kHlDU/BboYDP/L6QMHXyNrAFanwPqlsA0KqtkbBzqoHP9OaMcFyXwzB4gHlPnU1C0JtnyTBZ34NP1mbCcF6byPBNh/XPuQUD0LZEwHBZXAUPzsex8Dn5yrBweLAPvQkEkJB5KfAc4UfPyxkU8CmJS3Bgqj7OE3fhMHWRcLAQ3OdPhlAFUI6pwHASKcuP//WGjyzLS7B2EcnPLONYcEyswPB9wFoPnLAF0LbdmA/jZc+P1miPkDQ8S3BqtTsPPXJPMEKyiHBCfngPUKRG0L0BqpAQKRXP2GH8EC/ji3Bcr9DPRqVBMGNwE/BCf43Pb8RH0JoCBZBeXVuP1HGOkHnOi3B2CrBPFQ5osCI4HnBSkZOPAEzIkLiZ09B/Ix7P2R/dUHBGC3BjKGcO48RD8BOmI/BK8HiOr/EJEItz39B+I1/P0N9k0GptCzBAACAPyfxrkH3uyzBAACAPwOEzEE2BSnBAACAP1yj7EE/LyXBaQB/P0pjBUKEYSHBX+9+O9qhqcG9gBnAacZ6P/2YFEJMiB3B5x2nPPKejMEYSmTAVkhxP8FOJUIYpxbBJnBrPWGGWMGgSpbAHLFWPwSEM0LRBQ3B7zglPhsdIMGT/a3AxJQ4PyzpQkKIcgLBKNWOPifgxcBZaMfA5dXpPmh+W0KXquHAZhQLP85ZfL3Ao+7A6xyjPjEfaELn4sjAO3AuP244SkDUkvzAyTwyPhoBd0KD+6rAJnBTP8XZ3kD5KwbBcqd0PbzHg0JBn4bA4bRwPxS1M0EQgQ3BpKVyPAOOiUL9JDzAf/Z7P4IeZkGsjQvBVWp2OvYIvMFdf5PAgqj7OX1rkUJ9hdS/6Lx+P0EVlEFliw/BiSmROyPlm8FK4bLA+zp4P6n7sUHdWA3Bl4v4PAyOfMGw28PAIuBoPwBQ0UEy/ArBsfm4PSl6PsHhh9XArMUnN00Zp0Kt7kRAa7dNP1qn8kF4hAjBFR1JPszX+MC+bejArMUnN3PkrEKpwYpAOdEuPw/0BUJCvgbBn1miPnHQlMC87fbAvvYEP8QlFUIK2gDB5A/2PpfYWL8KfgDBmyC6Pv7YI0Ixgu7AC+8iPyQROECJhQHB7yBWPhboM0Loy9LAHXdKPwtj30A6qP7AfzCwPYeOQ0K1M7XASPlpP7/tL0EK1vfARrbzPM0KTkLGVZjApmF4P0nFW0EpX+rAIXamO1sPW0IAz3nAbLJ+P9+5iEHQ7eHAAACAP+L+oUEWY+HAAACAP4aexEERxNfAAACAP36j7EH7jdLAAACAP6ikB0JhFMDAAACAP+BMGUKJv6zAAACAP7DZKkI+wJbAAACAPwr3OELxL1nAAACAPyGmQ0JZBQTAAACAP+E5RkLZoO8+AACAP3NNQUKInzdAAACAPyndOUJ6MYVAAACAPxNrMULtao9AAACAP3wxJkIM7adAAACAP994GUJYOrlAAACAP+T8C0JkEtNAAACAP/7f+0H+Pe9AF7fROvPleUJ8LVNBLZV/PwTJ3UGhUQZBrMUnN8vvS0IM0GbC3zc+PK9aaUIhFlxBU+h8PwgFvkFG3xpB+u3rOTK4P0Lib1vCdR8APdv+WEIybmdBsp13P/DVnkGSsDFB7Q2+Ol0BNELoq0/CmKPHPUMcSUIRmXVBHLZlP87VgEG+8kpBw2SqO+EVKUJ6mkPCdbA+PqIwO0I1KoJBZmtNP8OATUG8XGNBaMs5PM3ZH0IijjjCU7OXPgsOLEJtDIpBwhcuPy29FEEhqX1BrKjBPDHGFUIMmCzCKH7MPsc8H0JBl5JBEHUPP/mpykBQzYtBRZ4kPZPHDULssyHCmYH6PtYCE0IjtJhBBOLlPoCLXUAoLJZBmdh8PdOQBUINJRjCw7sUP5U0AkKPwKFBNQyfPhg58b4iEKVBXeHdPY7s9EEyvgrCB0KyOiKijULfAPNB/BgjP7XV40FtQqxBb4FEPpHPh8BgNLVBPq4tPo1n4EH8FvrBaAUGPJO+hEJbOfNBZMwdP1rUwkEEfLlBvVLWPTsmAMHKGMhBb56KPsUazUE3OtzBxF+TPFHSeUISBPtBx50KP0GGqEGINcxB5NpQPXY/LcEaNd9BYr68OGfXc0L5H3fBrmTHPm9zwkEtv73BJqq3PO3uZ0IplQZCKdDHPvLgjUHQMupB5j+kPAwBV8FNuwBCF7dROhnWa0LGji3B5wARP+cGvkHo35XBlUiiPPx3XELltg5C8DOOPqf+fEFB3QBCVd4OPIjkbMGrrQ1ClialOmwuaELEie7AGEMxP9oQv0GfkHPBUI0XPJjXT0LsaRlCvrwgPvqqXUGscQ9CFFwsO2KqgMGCax1CoMNUP2ogw0Ff3THBjKEcOwO5R0LjFihCYYmHPf3wVEHTEiBCgqj7OfkRfsEQLC5CxlBuP4fH0kG5Du3ArMWnOFGRR0IhoDVCBYvDPMwwaEHsuSxCGt15PzdB6UF2rbDAK6T8Ox6aiUFkUDZCEAZ+P5TxAkL4xKPAvTrHOXy1nEHfJkJCceZ/P5iUEUJ9n4LAAACAPzr6HUI5H0zAAACAP/upJUI0d3A/WHMAOmaGSUKyAHhCO99/P39NJULui2BAjzYOO4nIQkIYaG9CrMUnN+CLhUI+ModB0m9/P9asHUKk1q5AIXYmPMXIOkJEjWBCrMWnN3yXqsE2N1lCW5RZOikde0LjBpJBIy19P7ECEEJOAf5Ah20LPbVWLULyKFFCEQGHOrG9rcHC1kRC4Ln3O/OyaUJ3a6dB5BR1P+iIAkLhdjxBCHdnPQuCJEIZ80ZCn6stOyqwr8HsXzdCz72HPFMpXkK3b7VBpptsP+wq80F74mRBMevFPe2xGEJwHjpCylTBO2RIs8HrBiZCnFAIPS+LT0JMdshBRzhdP23c3EEqQo1BprgqPtxOCEL7dClC42tPPPegucGf3w5CRs6CPQ5jPEKqO+NBZ7hBP8MrwEEjKLJB2CqBPlOA8EEfzBtCd76fPF8Jw8G0pfRBvqSxPdc+LEJ3Wv5BuTYkP2ZYqUFJm9VBzzGwPhDH0EEByg5CK97IPOnozMFY08xB7iXNPWHHHEIEpwxCGvoHP1PCk0EFf/hBBOfsPpSYtUFzZP1BPE7RPB90z8FIxqJB64vEPQamCkIaYBdCL93UPrTpbkGv2QtC5dUZP5bGlUEM4OJBOBWpPNka2cHN/HRBtVSePaDa9UFq2yRCZyyaPgXGQkFLYB1CL25DP+3oXUELachBMSUSPBpm6MF5IxxBDi0yPSlM1UFpyzVC0ZE8PpGXGEEwXjJC+RRYP59bEEEPv8RBliYlOxKlAsK8ys9AO3DOPDc7y0F2m0hCPUQDPkaZG0Hn00VC9E9oPxtQgUCwrK5B5UQ7PNLVrkEIa1pChBKmPTbM9EAACltCHAhxP/fJrz7zeI5Bb9i2O70oikGtUmZCN45YPTLLhEDx1GtCk8Z4P3H0FMBsDVhBs++KOmJGSUGb/W1CrWnePApLcT6as3hCCKx8P5vFksCjZxVBrMUnOYGKAUHjIHRC7DRSPHgDZsDC7oFCJ9p9Pxkks8BJY+tAUyIJPFWVrcB8doRCxJQ4P6k4T0ILafPAKNWOPquoR8A6M9vAAACAP1K2dz+MNea+/wl+P4eDbEGKbzG/j/zBOfrgtj91DiFCLjnuO9/PgMHoYjxCAAAAP/Ok/EGOus6+AAAAPxypuz7O7WO9AACAP0w6SEHdXy2/AAAAPyOH2EG5Rzk/AAAAP9hv+T70WpO+83F1P/kLl0HEG1m7TdYoPcs37EAh4T3BAACAP2yPFUJROio+AAAAP/SuUULaadK+AAAAP0smtD1OVcK+AACAP3iRgkEJbka/AAAAP3zDFULWwaS9AAAAPzZ+OT83BFq+AACAP8tEUUEdzbm9AACAP78L4EHjFwK+AACAP5WmXb6O2Ua+AACAPxOze0G+VW++AAAAPycN+UFgUz8/AAAAP0FzGD8oEhE/AACAPxoTiEH4tkG/nPl1Pg1aR0Kxd4RBa9TjPux8eUA124JBieotPf0sJ0IfnpbBh22LPlPkn0ASR6rBfdArP2os/EEwCCFBPj8MPWBheME/K4hBww04PoBQvEGml0LBPDHrPUmQJ8EnWxjBY5y/PtdLAUL4trRB3si8PSGQTMEhjpZBXp1DPnhy2kGYu9ZBGGCvPrjjlEDNAdVBh4pRPgmVH0JxDAdBSKdOPsAq3z9oFUBBWTTNPv/UaUEDK4hBol1FPib8JcFe9adBj8J+Qs1MnMJSuH5CCteVwlK4fkKuR47CCteAQqTwiMIAgIJCw/WDwsN1hULDdYDC1yOJQo/Ce8IzM41CUrh0woVrj0Lhem7CSOGQQj0KY8Jm5pBCexRZwjOzkELhek/Cw/WPQlK4QMLheo5CexQ2wj0Kj0JI4SXCFK6OQq5HFcL2qI5CpHAFwj0Kj0LsUfDBhWuPQsP1zME9Co9CMzOtwVK4i0KamSnBXA+KQo/C5cAfBYhCcT1awMN1hULsUbi9het4Qilcx0C4HnBCexQKQT0KZUKF6zFBmplZQuxRWEEzM05CexR6QWZmP0IfhY9Bw/UxQuF6mkH2KB9CuB6hQT0KEEJcj6JBSOEDQq5Ho0HheuxBZmagQfYozkE9CplBcT2eQY/Ci0HD9YJBmpmDQYXrTUFxPW5B7FEUQTMzT0GamcFAZmYqQYXrUUCamQVBSOF6P2ZmvkCF65G/j8JFQLgejcB7FE7A16OwwMP1yMCF6/nA4XpUwXsUCsEzM4fBcT0Owa5HpcHD9QjB7FHGwQAAAMFI4eLBhevhwFK4+sHXo7jAH4UJwuF6jMBcjxTCH4ULwHsUIcIAAAA/hesswlK4PkDhejbCCtfDQOxRP8KkcBVBUrhGwj0KQ0FSuEvCw/VkQbgeU8IUroVBKVxcwuxRmkEK12TCcT2uQexRbcL2KMJB9ih2wkjh1kEAAH/CFK7tQVyPg8I9CgNCcT2HwlK4DUIzM4rCZmYYQnsUjsIUrh5CMzORwgrXI0JxvZbCH4UnQj2Km8IzMytCrsejwgrXZ0LNzKPC4XqAQs3Mo8KkcC3AH4VrvoXrtUGamZFBexSBQkjhOkDXo4xCuB5dwY/CjUJxPY7BpHDVwB+FH8HXoxlCmpl1waRwQELD9RTCUrhpQuF6eMJSuG5CSOGQwuF6VUKuR6HAcT2CQB+F4cE9CiNBXI8awdejG0I9CndA1hxgP7WJEz0uHGA/wVaJPS4cYD+fyNM9WFZiPwk4BD5J12Q/w7scPp1LaT/j/C0+Bd1uPxiyOj6k/HQ/OPNLPjtTeD+7YVs+ZY16P3OFdz5ljXo/lgSIPvZFej/M0ZM+4Sh5P+z6pT637nY/DhWzPl3Edz98D8c+fjV3P/J72z5+NXc/uAHvPrXDdz+KWf8+7FF4P/uRCj+1w3c/P1IUP4PAcj/vjy8/6j5wP9P2Nz8bL20/D0VBP/5IaT9QcEk/NLpbP94CWT+3C1U/eeleP+6xTD9nCmU/thBEPwLxaj9+bzs/SilwP61MMD+R1XU/jiMmP1Q1eT+V8Rc/T0B7P/2HDD9OtHs/P1cDP6Luez/GFvI++wV7P5ZD2z6twHg/ahO3PrmqdD9jeqI+FytyP35SjT52T24/FTpvPi+LaT/hQEg+QN5jP77ZJj75MV4/qwQLPrZKWD/l0OI9yEFRPxTokz1eukE/VB1yPaUxOj/OcAM9c/QoP2fttjzmBSA/81mePGXHFj89J708t5cMP/2H9Dwk0QM/2EcnPcP1+D4sn2U9mPrpPrk2lD0UXNw+pKrJPZHtzD5XIQU+Dme+PuQxIz7ZmbI+Wg1JPqK0pz6OBnA+uqCePps4iT5ybZg+BwiWPopZjz5vgaQ+/ACEPpMYtD7aIHM+2iDDPh09Xj4gKdI+T3VIPvW+4T7jqjI+ZQHzPhSzHj7JsAI/pIgMPiLDCj/iBvw9JNYSP6Tk1T0/kRc/nge3PVx3Gz+PjYA9vD8eP3CxIj3ECCE/AAAAAOHRTj8AAAAAIchhPwAAAAAO+Lw93xVJP7jkyD5fe3Y/ea9iP/XWUD8HJXQ/Ap8nP1PQdT8e3B0/Ecc6PR4bMT/3xxM/HNMjP/kPMT/D09s+oztQP8rDQj7zAlQ/gjm6PRv1QD9jRT0/r18wPrA4BD8hPHo+I9sxP0BNFT/+K1M/AACAPyYApkHn/ThAAACAP1E9hkEiAWhACtcjPGFmkUJ5EAlA/G99PwgvQkGf+I9A4LkXPirli0LtzIdAOBBaP2hxEEHy0MBAc52mPlHkhkLvuctAn7AsP24lxUAD3vNA6rL4Pvs1hELLXw5BPKUDPxpOi0BBfx1BDwsVP7PugkJaIzpBDM3VPpNrTEA5b0ZBcjNcObBLTsK1sFBCvfsrP5q9gEJq7mxBa5qnPoYuwD9Y2HRBW5RZOn7IUsJBB0RCYYk3P7lPfEJjlIZBoiiQPucQIr54N4hBBK3AOkXDU8JugTpCuY1GP9dmcEIRA5hBICliPn0tYMBdrpRBk1dnOwziT8ImRCxCXYpTP/7dZEJVYqFBqmUrPl7l0cCpYplBdcjNO9TIScJ8aSFCSbpeP5SLWUJsZqlBBHP0PVR9GMGY15xBn6stPPdtQ8J8OBdC5dVpPx28R0LIt7NBCTiEPYFiYsEjCKBBUU60POS3OMK0FQhCjBBuP5YDOkKJw7ZB4C0QPcKzjMERrp1BY7QOPUbwLsK6rvxB7IZtP5K+J0J7dMhBZXAUPDz8s8Fe7KdBFjCBPZQqJsKcEthB7rFkP1onFEIOQNZBs++KOiAa3cG/1K1BVDrYPZMlG8LF3LRB1SFXP+fCAUI36uRBDHYjPtRVEcJRd5JB0uNHPxls5UHsDPNBGm5gPub4CcLZTGlBdAcxPzsdvUGHpAJCyO+dPrXK/8EgiBpBYoQYP9yQl0GTKAlC7fXOPsKN6sGwrq5A4zZ6Pndbq0DKCxZCn3FBP9iZpcFzB7HAkq4ZPvUngD9KkRhCtJNZP16CjcF70gvBA3iLPcA0dsAQ3BpCsI9uP40TZMETWEPBqRPQPG21BMFbGxtCu355PxQNLcHUeHDBAACAP+GhAcCAApnBAACAP/Bb7D9VCKPBAACAP6SazEC0BqvBAACAP6W8L0H/yrHBAACAP+0idkEmFrbBAACAP/alpkEr7bfBAACAPzGiykFmRLPBAACAP1Wc90HVTKPBAACAP3awDELCN5LBAACAPwMiGkLXAITBAACAP1sTKEIrGWDBAACAPytKNkLTsirBGHh+Pyk/TELSb6XA/Z/DOwD12UBrY3TCODKPOynczsHX4xRCEOl3P72PWEJLoPq/gufePAYBIUHQPWjCFeP8PCnc8cEKFw1CPq5lP4fvY0LFwPI/CVCTPW/XUUHVeVnCWp6HPRTuCsLXYwNCA2BMP7LObkJaOsdAiqsKPtqLgEE/yUjCpyLVPa4HG8Kux+9B8KIvP3Mjd0K2ZStBTOBWPu8qk0EUVDfC0h0EPkjhKMKux9hBSikYPyyDfUKavW5B5ZuNPhDCoUHt3ibC32wTPkhhNMKux8BBM6cDPzrMgELZl5dB2/muPpixq0GDAhfCHHwhPuH6PsIULqRBjKHcPm3hgULi7bpBF5/SPu34sUERfQXCOC0YPntUT8L2KEpB9OCOPos1gUJc+QBCQYISP9I3s0EU68PBlrIMPkjhVMLD9QxBrMpePqmyf0JGBRFCCCAlP2yPr0HKkqPBmpmZPXtUYMKPwnU9Q8rPPQ9keEIYHTVC3dJSP9X1pEEKYTXBIAw8PRRuZMJI4Y7AuYhvPSAHc0Jj4UZCY0VlPzI3nEEFeNrAbheaPOG6ZcLXoxLBNIXOPEriakLu31dCy7l0Pw7VjUEqPR7AqTC2OuhCX0LdBWlCQKR/P80JcUHW/fs/AACAPwZFR0HY9bRAliYlOvNpzcDCfnXCD9Z/PxXwG0FWgwdBLLc0PPavEsCcLHXCfCx9P62a00BtgjJB8KfGPBSzxj//6XPCGcp5PxQsYkCAsFdB98ySORQuRMLDtQbCngd3Pb/MxkABfm/C3XtwPxcBLr+yHnxB3V5SO67HNsKPghXCJLTlPXBPLkGokmjCUkmdOegHE8KmUYXCzGJiP9JnqsDNqYxBYqHWO0hhKsLDdSHC28QpPrcmbUH5hGHC9DehOk3+BMLJVIDC845TP0vhFsGxDJdBMC9APBSuGsKPgizC4V1uPgvJlkF7EVfCwypeO7N17sEBR3PCUYhAPxnIYsHP45xBGxJ3PHuUCsKPwjXCtwudPtbzs0E+k0vCvQD7O5tS1sGRKmXC46UrP0d1lsFXJp9BHSCYPPao+MGPAjzCptXAPkksykFIrkDCbCZfPDjExMF+UVjCQ1YXP0uLtcHyrZ1BEr2MPMN148GPQkXCaW/gPqg940GfSjrCA8+9PAeqrsHCnE/CTHEFP/rB0MEh1KRBfnRqPMN1y8Fcz1DCsyQAP3bPAELNdTPCoYQZPfiFk8G59EXCwi/lPi+G8MGX2q5BhLszPPaoscH2aFvCPzoNP0d0D0KLcCvCfnRqPVrVc8FHPTvCeJzCPn2HCMKGYLZBCp3XO4/CmMGPAmbCGosWPyruHUIw1iPC3UGsPQH0QMEL9zDC83akPrBkGMLdTL5B5+NaO1K4f8FcD3HCjBUdP/PSLELEZhzCxf7yPc9NDMEexibC0VyHPhd1KMKZB8dBIXamOoXrS8EpHHzC8UsdP3DnO0KQgBTC2ZQrPs6RrsBnFxzCOuldPij4OMKLUM9Bgqh7OYXrEsFIIYPCDaYZPySiSkKsDwvCBahpPspdE8AD9w/CPX4vPu8+SsLd1NRBIeoOP5LaWEKWVgDCaoefPqe2KT8NrgLCLT4FPu/+W8LlwddBb2T+PiCyZEJJau3Bq7LPPvhLRkC32+3BWp7HPWg+a8LCJdlBArfOPhGsckI/3tvBBDkIPz4qw0ApNdfBWVGDPZaDe8KBqN5B846jPvDVfELVHNPBR1oiP2wNBkEPqsrBA889PacBg8J7p+VBMnJWPr0LhkLzdtHBVitDP9JEQUFhHMPBt+7mPDD5iMLbu/hB0/YPPoV4jEIN39HBGxJXPxXYc0FYgr7BF/GdPFmzjcJgEgVCuB7FPc/ilkIQsNjBR8ljP+IcpEHPFr3BmWRkPMtWlML+ehVCw2QqOnsIpUIvFxjBSaJ/PwpBwEHefqDA09lJOvNMtsLbqudBAACAP+zey0ENvSxAOC0YPnvURsLh+oJB9OCOPjQzgUKhjd9BQYISP5FHsUEvQubBGHh+P30sQUI1P/nA/Z/DO6a/eUB9PH7CqRPQPBzlTMHhjRZCu355P72B0sA3nYfB4zZ6PkPeFEE0LhJCn3FBP9N8ucFyJBTAYoQYP3iJYkFpZg1C7fXOPg3l0cF+pNI/mpmZPUihWsLsUYZAQ8rPPfOYe0Lj5yNC3dJSP+Z1qUGB0HrBAACAP9ej2D+PwiHAAACAP8f+0EGOVwK+AAAAP4Yqb0Jz3IE+AAAAP3CnIb5DwQo+AACAP8bvTEGWFze/AACAPxt6KD/CT7S/AACAP6Bnd78L556/OnWFPntUBsJSuJJA9u6fPuEIM0Jd8PFBMZnaPlh3HkCWH8vBAACAP07zrkG5ygrAexSkQdejwcLXo7JBzcy+wuF6uEGambjCzcy+QXE9s8IUrsNB9qitwsP1ykHNTKjCj8LTQRSuo8JmZuBBzUyfwsP17kH2qJvC4XoAQo9CmMJxPQpCw3WVwh+FEUIfBZPCPQoZQsP1kMKuRyJCSGGPwrgeJ0LDdYzCXI8pQlK4h8IzMylCj0KCwq5HJ0K4HnjChesiQuF6bcLsUR1C16Nnwh+FFUKuR2HCH4UMQnE9W8J7FAJCZmZVwlK47kEzM1PCw/XYQXsUWMJSuLxBzcxYwgAAoEF7FFfCFK6HQfYoVMJI4VZBPQpPwoXrMUEUrkrC7FEAQbgeRMJSuLZArkc/wsP1WECF6zrC7FG4PoXrOcIfhWu/rkc/wsP1aL/hekrCCteDv7geVsIfhau/uB5fwh+FG8DNzGnCexSGwLgeccJmZs7AMzN3wrgeCcEK13vCuB4xwXsUfMJSuGLBZmZ4whSuicHsUXPCZmaewZqZbsKuR7PBH4Vpwq5Hx8GF62PC16PcwQrXXcIUru3B4XpYwlK4/sFI4VPCuB4Iwo/CTsJI4RDCFK5KwqRwF8IzM0jCcT0fwlyPRMJcjyTCw/VIwsP1JsIUrlHCmpkiwrgeXcJSuB3CCtdmwrgeGMI9CnHC7FERwnE9e8KuRwrCUriCwsP1AsLs0YfC7FH2wUhhjcLNzOTBcb2SwjMz18FSOJfCMzPHwSlcm8K4HrnB4XqfwsP1qMFIYaPCKVyZwa7HpsIfhYfBPYqqwkjhasHsUa7CpHA5weH6scKamRHBHwW1wj0K18AzM7fCmpmBwB8FucIAAMC/Kdy6wo/C1T/sUbzCw/WIQGZmvcIUrv9ASGG+wo/CIUGaGb/CPQpDQezRv8JmZmJB4XrAwmZmfkE9CsHCexSSQa7HwcJ7FBVCw3WBwgAA7EHheovCrke9QexRlcLNzKhBZualwlK4lkFm5rbCFK6JQY/Cr8K4HjFBAAChwgrX20B7FJPCheuJQEhhhsJmZsY/XI9pws3MBEFxPbTCmpkJwNcjr8J7FEbBXA+jwoXrtcFSuJTCPQrrwSlchcKPwg3Cj8Jowrx0Oz+XkA89GM9APyS5fD368kI/4Nv0PRNERT8qjC0+NQxHP9f6Yj4PuUk/iQyLPuHuTD8MH6E+vJFRPwcItj4Y7FY/CHfHPkSGXT8wu9c+EapkP3oZ5T5sBGo/0LjwPqiMbz+Amvo+tVR2P5AUAT9H5nk/Gw0IP2iuez8TYRM/fm97P4NpID8mAXo/xTgvPwTKdj8E/zs/Ka5yP0D2Qj8O+Gw/QYJKP5JcZj+Lw1E/za9eP8e6WD+A1FY/l1ZbP6PMTj9EhlU/XHJEP3qlVD826jk/hqxWP6D9MD8oJ1o/WaMmP0I+YD/92R8/MndlP4e/Fj9ATW0/0/YPP/Qacz8fLgk/41N4P9BEAD90e3k/LgT5Pq0Xcz99Bfk+ArxlP5xQ+D6Sy1c/e4j2PgYNTT/WHPA+eEVAP9/D5T6fjjc/ho/YPl5LMD9eEcw+wcUqPwVuvT5jeio/GTmrPtjTLj+eXpk+mus0PzI4ij4vhjo/srp1PvGdQD8AdFg+d0pHP80GOT7Bi04/3QcgPjnuVD+NCwc+3nFaPzuq2j2giWA/XD2nPYF4ZT9CsoA9B19oP034JT0kuWw/QlvOPD1+Zz8cQpU8wAldP087/DyuZE8/SkE3PffHQz/v/ng91ZU3P9B+pD3OcCs/Ke3NPfs/Hz+Cyvg9gA4TP7A9Ez4dyQU/vvYsPgwH8j5q9kA+RIvcPviIWD5wzsg+JUBtPk0QtT4KaII+A32iPpHVjT55O5I+L/qaPoJWgD6BQ6g+2XxcPmJnuj5jfzk+CwzJPjp6HD7k99Y+fZYHPn2u5j4UXOw9R6z1Pm2QyT15HgQ/WrutPebLCz/b3Jg9Ja8WPw1Uhj1c5hw/W5lwPRUAIz9wCFU99MMoP3h/PD384y0/j6omPejZND+62go9cqdsP09YIj9T0FU/NV4KP0+vRD+PwuU+Iy09P9uFlj73kjY/66gKPjvCMT8/HU8+mrYfP1X2rT4TYRM/93XwPqHbCz9pjBY/3LoDP6qaQD+7mxc/mwMkPlji8T5A2VQ+ob61PpMYpD5+AHI+WYboPi3PIz6N7hg/taa5PVGDQT/sF+w+ReLkQUzdg0C78gk/U7FjwMvswEB/+wI/iHfSQcqIu0BkBvo+9yKvwMS5d0BpHSU/GKKyQRO8t0Dfw7U+iFy1wBgb2L3vIE4/wrOWQSmXukBEbiY+YP7AwGgPZcCMLQQ9Q9u6wMA5s8BVavY5tuvjQdFYZkHxY3Q/pVh0Qb9atUCbyTc9Sr/EwGO05MAKndc8TmzNQVoAREFTs3c/YN07Qf3YvEC9Osc7jRnVwEVdKsHfbPM9S2m3QeHqKUG8kWE/LI0JQfGAz0AP7p4+ihWeQcktF0FRiDA/QiiuQLby9UBHrA0/7NOEQW5CDUEipuQ+RRAqQGy+FEFaKkc/oldRQbQgCkH4U2M+F2D5vRJxN0H1LWs/XTgZQXYYDkEai6Y9A2MmwA9cX0GhoXc/KMzaQDMjDkF32wU93yGVwCU6fEECvH0/b2aFQMQAEkGm1RA8MFnQwBKejUGynX8/tE+cP/ylHkEbTMM6b10DwSrloUEAAIA/OKeGvzDnE0EAAIA/j45VwJu35kAAAIA/Ea6kwNYPikCPpX8/W+LZwPdgQz+SkbM6sjwxQFY6N8Ihdn4/IgXxwORsMMCmm8Q7BALLQMbDNcKLGnw/BRnjwKvqp8BdM3k8Om8JQe0dMcIahnc/AdDFwCsaBMHekwc9yvgyQfUDKsIGTHA/HMicwHZDNsErNXs9NaxcQbRcIcLIXmc/Nl1NwASca8GBBMU93rmDQWHpFsJRMV4/ILFPv2JQicF+NQc+/ZWQQXfWCsJCQ08/cSE3QHZajsFa8EI+JJWMQYEi+MGc+S0/ocrUQN6KoMF4C6Q+stiUQb/E1cHEXwM/yTMhQTchuMFivjw5UrW5wVQvJsFCJvk+eyGjQZ6NtMF7vbs+MYhLQf0jz8EXt9E4y+m4wWyxZMFlGSI/Y7yyQUd2mcFDBFw++dx3QQNz7cFI/kg/vQDJQZp0dsFubgw+fweJQWOwAcK941w/rf7ZQV5QUMG9b3w9OZ6ZQYIjEcJcOHA/aX/yQachHsH3deA88AumQeSZHMKp+3g//lECQplW8cAfuiA8MzqzQemXJ8JwfH0/ldQKQumrpMBo6J86VPzKQSQUMcJkr38/IlEQQtUGzb8AAIA/vrMLQvlP0D7T2Uk62ZzsQahvI8KcUIg5ab+/QUtjH8KCqHs4EaDOQPH8H8Katn8/SoX8QShVsT+9Osc5wNX9QVCxF8JV3g47OQixQS/SEsKWJiU6SCJrQJyZFsKhLX8/MfPgQUfCI0DN6TI8VnunQXuECMIuVlQ7HB/YP517DsJbX3w/Rz/MQbB8bkBtkEk9kTmiQdCt9MHCUXI8DebqvSn/AcIKnW8/Pbm1QWJJv0C6ZvI9DCWnQS3F28G/fR09GisTvy7f6sH92Vc/GiepQTDDC0FiEFg+Y/KxQZfEwsEr+649/Bixvo2yz8HaGzQ/YfigQdS3P0Ep0Jc+MIS9QSGNrcGrPhc+mLMGPsvVt8H3zJI5/bczQhSD9ECYNA4/JdibQVTzbkG+pLE+QDrSQWiJn8EjLYU+fk3+P1W1o8GAK8k+GViiQXyfj0GwVaI+c0jxQZiGlsHcRuM+pqCoQNXXkMGpwXQ+/fCzQX3AqkGg4GI+zNwIQrLIkMFzuiQ/G6MNQaeYgMFVMAo+x7nIQZdQxEH3AQg+dvIWQna3jMGH/kk/LgZAQae1ZsFh/Z89jl/bQQDR2UG5GW4961slQmtMicEDPmc/MRR0QV8DTcGU+x09zvDuQU9B70F5WKg806gzQpORh8E9D3Y/nmuUQf6lNsH4qpU8x7gBQqyiAUL9vCk71P9CQgruhcFkzH0/j8qwQRMRH8HDR8Q7DsoMQuxJDEJXeH8/Zm7IQcXQDcERAQc7vDoWQnCbFEJx5n8/zZHeQf149MC9Osc5KMIeQsgxHUIAAIA/Vhr2QWCazsAAAIA/Z8oFQrBcosAAAIA/rUMNQgxqe8AAAIA/bdUWQl23LMAAAIA/h48WQnvWCr8AAIA/lcgPQnAk3D8AAIA/dSQBQjFSNUAAAIA/0prnQc5GX0AAAIA/n9/KQbTdgUAAAIA/7E2sQf6bikAAAIA/H16NQa50kUAAAIA/EwFcQdQWlkAbTMM6glonQmQHuT+ynX8/xCoYQaSQnEAzMxM+G+YWQvo8MkCLMls/qPClQLYAmUCbrLE+ybEJQv2Gf0ALKSc/N9vVP0MmmkD7Ihk/5V/3QbEzmkC7uM0+tvTzv1WljUCpalI/Bm/dQch9uUC9UjY+oD6pwBR8iEB6jXU/R+bBQWB1z0DnHSc9bzIMwfXQcEBY/38/KU6oQUqG3kBY/38/6GGLQbWY7UBY/38/ZU5cQUdb/EDfFcE8PrUWQvida0Cp9nk/TYcUQQUo90Ab2Ao+BRYJQu2In0BSSV0/e2W0QOl99EDvrI0+L8r4QQIluUDhKDk/IncZQJK75UBkBvo+0uHcQdiRyUB/+wI/5zODv5mlykDjNjI/6yLCQUJC20DrkJs+7IKKwNB9skB96GI/XaOhQdD54EDYtug9vH0CwSiKhkC2EGQ6okz6QTtOgcFmFHs/2v2GQSFI40DMKJY80D80wXqYQECrsm88wnT1QXNlOMGOQHw/hzxDQeej20AwnkE9HnbzQSKTDcF15XM/2jsYQaxr2kAz4dc96ZHxQVoNx8AyA2U/KAncQLt92UCbj0s+z7LvQcjNb8BxG00/v4qMQJFA2EATSZQ+0+LtQXeIxb/P2jU/3lcLQO2R1kDecco+UF7rQQCNtj9pxho/osZOv6QA1EAAAIA/watSvt10yT4AAIA/LZQ1QXCTND4AAAA/pLOmQVoDmz8AAAA/yThVP2QxRj8AAIA/Srk6Qashtz4AAAA/o1C1QXEQvj4AAAA/eByTvkFHRr4AAIA/oVFLP5hnIr4AAIA/i0lMQaWEIz8AAAA/6yS3QaIPYL4AAAA/tcOqP5FEKj4mjVE8WiLpQLCPz8Gc3O86CJNewTTcAcKOQHw/wqQdQT8yfT8AAIA/AwmrQf+plz+MuWs/7IdPQbWjDz9eLqI9pR2iQJIFKEEAAAA/RCjTQeYyUb4AAAA/G4SgPmn3Fb4AAIA/33JyQZJ20j4AAAA/ECT3Qe9IB74AAAA/clmPvtv7f75Jun4/SEdGQdiN2z5/h6I7Ug+zQTnMJEIAAIA/9F3LQex9r70zM0dBPQowwq5Hi0EAACXCuB6tQRSuFsKPwsFB4XoGwnsU0kFxPeLBexTSQXsUqMH2KMZBhetFwXsUvkFxPQLB7FGyQVyPmsAAAJpBUrievsP1gEHXoxBApHBRQcP1iEApXANB7FG4QDMzc0DNzMxAw/WoP0jh0kBSuP6/SOHSQIXrqcCameFA9igUwa5H4UAzM1/BZmbeQOxRmsFmZt5Ampmzwc3M1EDsUcjB4Xq8QAAA3sHsUYhA9ijwwQAAAEAAAP7BmpkZvzMzBMKPwnXAPQoFwnsU5sCamQTChestwY/CA8IUrm/BUrgAwsP1lsFxPfbBw/WwwUjh5MEAAMrBZmbOwaRw4cEpXLXBCtf3wT0Kl8FI4QXCpHBxweF6C8IK1y/BH4URwmZm5sBI4RXC7FFowLgeHsKamRk+j8Imwh+Fe0B7FC7CzcwEQfYoMcI9CrdAuB7nwcP1GMEAALDBheuvwWZmgMEfhXvBpHAhwexRiMBxPQo/fJtGP1XeDj2nP1s/RGmvParUbD+ERxs+aod3P+V+Zz4AAIA/nPmlPgAAgD/UYOo+Gcp5PwTiHT8IlHU/EMwxP2l0bz89YUE/1NRiP+aWVj+Z01U/t7RiP600ST9YOWw/2PA0PyAkcz+SliI/Gyp2P4FDGD/3Bnc/on8KP/8Edz/VePk+Hy55P2OX2D4oLHk/opexPse6eD/ePIU+0Lh4P7/xVT6ASHc/PtAqPpW3cz/3x/s9/RNsP/RPsD3cY2E/YaZtPXwsVT9XeBc9kuhFP88sCT0+IjY/R3cQPVLVJD/A7B49Y38RP7hYUT2SXP4+GXOXPQ/W3z5WZd89sFXCPip0Hj6t3aY+iZhSPn9qjD6kwog+QQ5qPrU3qD6ynU8+hV/KPrcoMz7l1ek+KNUePnK/Az+vX/A9onoTP7gBnz3SNSM/hLszPc9mNT8w9fM8k6kqP+AtoD66LNY+zhnhPqm8XT62hAw/C++iPrKFKD+0HwE/L4ZaPx/0fD9+HZnBAhI9QUbOQjzjQyjC/IUpwtuFdj9cR7nBkg+/QMyXFz2qGhHCEO05wn7jaz8gQs/BNMHGvtPeoD0/pe/B80NFwrQ8Xz9HXtTBDmnLwJEKAz41+b/BOiZIwlDHSz896M7BooJXwSLgUD5GAIfBss9FwhakKT/yl67BCuGswYW2rD4x4ArB4Bo2wiBe5z7Ar3XBDqfzwUhQDD+ytYI+YLgcwvWctD4X/T3BEocKwt6wJT+XTY9AAAcPwjI9kT5XOgbBBRYWwr9gNz+LTO1Acz8BwpVlSD7uVB7AJZMjwvPlTT+A5y1BuozTwY51ET7jWx1ALCEowvWhWz+6NUFBvzeswXCZ0z3CKd9AdXEqwiqMZT+gdUtBAiqIwTTXaT3PKlRBDDomwuVhcT9r+ztBBoUrwT4FwDzAbpRB4Uofwi7/eT9jaiFBCeWswKzFJzwifqtByKEawkJgfT87aQ9BUkwgwNc07zt1eRhCMwFWQO8gfj8qneVAmgOdPySXvz7tDw5C2A3UQMYzID+c07xAm/emQEWBPj+Hf/9BTnYgQdf6gj59ZHBAVaQaQZ1LcT8d+NxBLPdfQbg7az2wj48/vnRuQe4Ifz/eXLZBOeCUQVVqdjvynOG/x2KnQQAAgD/BcZ1B8YmoQQAAgD8EeIVBKfC0QQAAgD/kOk1BbuC7QffMEjpz6ldC7diAwf3Zfz/yLQ1BfDi7QUinrjvc4llCFLxDwQqifj9XeqBAMmC0QQrcujwcglhCF0P8wHgoej+SYYU/3+6lQUaUdj34AFJCHH6AwBSWcD+XnALAICqPQec1Fj4rVUlCVLo0Pd5xWj+X0qPASplnQXUCqj4QQj9CN/KQQB7+Kj9VqgfB6UQpQeKSCz99NTNC0WgHQe3Y6D5IbTLBuQrNQO0qPD8ztyVCuzA1Qdaohz5VF0vByrsQQC0+ZT9KChVC9flZQVcJ1j2t9lbBCjwcwLthez9X8QFCbX11QaezkzyL0VbBEIHwwAAAgD/eZttBNuqFQQAAgD9EYq5B0V+LQQAAgD/xNYZB0BGHQQAAgD8bizVBU1+CQQAAgD/e589A1pR2QQAAgD+Mcq0/i8B7QQAAgD8MfILAfmyAQQAAgD9gOxXB9AOAQecdfz9zXmrBgvpmQZ9xYTtYfjLCT2oXwuC5dz99/EzApeqvvwEYTzofIWdBN4MNwqEQAT2zQOXBowXVwQEwdj/G4I1BcIsZv8KjDT3UydJAtkp/wQRzdDumI+nBLM61wAAAAD/q1QtC3lW2vgAAAD9IJfw+MqYfPgAAgD+M5DRB8EYCPgAAAD86vfZBqicnvgAAAD8s516/sZkEP2cTZxNnE2cTZxNnE2cTZxNnE2cTZxNnE28TbxNnE2cTbxNvE2cTZxN3E3cTZxNnE3cTdxNnE2cTdxN3E2cTZxNnE38TfxNnE2cTZxN3E3cTZxNnE3cTdxNnE2cThxN3E2cTZxOHE2cTZxNnE3cTdxNnE2cTZxOPE48TlxNnE2cTdxN3E2cTdxN3E2cTdxN3E2cTdxNnE2cTZxNnE2cTZxNnE2cTZxNnE2cTZxNnE2cTZxNnE2cTbxNvE2cTZxNvE28TZxNnE3cTdxNnE2cTdxN3E2cTZxN3E3cTZxNnE2cTfxN/E2cTZxNnE3cTdxNnE2cTdxN3E2cTZxNnE2cTZxNnE2cTZxNnE2cTdxN3E2cTdxN3E2cTdxN3E2cTdxN3E2cTdxN3E2cTdxN3E2cTdxN3E2cTdxNnE2cTZxNnE2cTZxNnE2cTZxNnE2cTZxNnE2cTZxN3E3cTZxNnE2cTbxNvE2cTZxNvE28TZxNnE28TZxNnE28TbxNnE2cTbxNvE2cTZxN3E3cTZxNnE3cTdxNnE2cTdxN3E2cTZxN3E3cTZxNnE3cTdxNnE2cTdxN3E2cTZxN3E3cTZxNnE2cTfxN/E2cTZxN/E38TZxNnE2cTdxN3E2cTZxN3E3cTZxNnE3cTZxNnE3cTdxNnE2cTdxN3E2cTZxN3E3cTZxNnE3cTZxNnE3cTZxNnE2cTdxN3E2cTZxNnE2cTdxN3E2cTdxNnE3cTdxNnE3cTdxN3E2cTdxN3E2cTdxN3E2cTdxN3E2cTdxN3E2cTdxN3E58TdxNnE3cTdxNnE3cTdxNnE3cTdxNnE3cTdxNnE3cTdxNnE3cTdxNnE3cTdxNnE3cTdxNnE3cTdxN3E2cTdxNnE2cTZxNnE2cTZxNnE2cTZxNnE2cTZxNnE2cTZxNnE2cTbxNvE2cTZxNvE28TZxNnE3cTdxNnE2cTdxN3E2cTZxN3E3cTZxNnE2cTfxN/E2cTZxNnE3cTdxNnE2cTdxN3E2cTZxNnE2cTZxNnE2cTZxNnE2cTdxN3E2cTdxN3E2cTdxN3E2cTdxN3E2cTdxN3E2cTdxN3E2cTdxN3E2cTdxNnE2cTZxNnE2cTZxN3E3cTZxNnE3cTdxNnE2cTdxN3E2cTZxN3E3cTZxNnE3cTdxNnE2cTdxN3E2cTZxN3E3cTZxNnE3cTdxNnE2cTdxN3E2cTZxN3E3cTZxNnE3cTdxNnE3cTpxOnE68TZxNnE6cTpxOvE3cTdxNnE3cTdxNnE3cTdxNnE3cTdxNnE3cTdxNnE2cTZxNnE28TbxNnE2cTbxNvE2cTZxNvE28TZxNnE3cTdxNnE2cTdxN3E2cTZxN3E3cTZxNnE3cTdxNnE2cTZxN/E38TZxNnE38TfxNnE2cTZxN3E3cTZxNnE3cTdxNnE2cTdxN3E2cTZxNnE3cTdxNnE2cTZxN3E3cTZxO3E3cTdxO3E2cTdxN3E2cTdxN3E2cTdxN3E2cTdxN3E2cTdxN3E2cTdxN3E2cTZxN3E2cTvxO/E68TdxNnE3cTdxNnE3cTdxNnE3cTdxNnE2cTvxO/E68TdxNnE2cTdxNnE2cTdxNnE2cTdxNnE2cTdxNnE2cTdxNnE2cTZxNvE28TZxNnE28TbxNnE2cTdxN3E2cTZxN3E3cTZxNnE3cTdxNnE3cTZxNnE38TfxNnE3cTZxNnE3cTdxNnE2cTdxN3E2cTdxNnE3cTZxO/E78TZxNnE3cTZxN3E2cTdxN3E2cTdxNnE3cTZxO/E8cTZxO3E3cTdxO3E2cTZxN3E2cTdxNnE3cTZxN3E2cTdxNnE3cTZxNnE3cTAACAPwAAgD8fhTtAH4U7QKRw/T+kcP0/CtdDQArXQ0B7FO4/exTuPwAAgD8AAIA/pHD9P6Rw/T8K10NACtdDQHsU7j97FO4/AACAPwAAgD8fhTtAH4U7QKRw/T+kcP0/CtdDQArXQ0B7FO4/exTuPwAAgD8AAIA/AAAAAAAAAAA9Cl3C4Xp8wVK4TULD9SjBSOEUQsP1KMEAAAAAAAAAAAAAAAAAAAAAj1XOvgAAAACPVc6+AAAAAAAAAAAAAAAAAACAPwAAgD9cj0I/16NwP8P1iD/2KFw/FK5HP1K4Xj8AAIA/AACAP1yPQj/Xo3A/w/WIP/YoXD8Urkc/UrheP5qZOUDXo3A/KVwvQPYoXD/D9Yg/UrheP/YovD8AAIA/FK5HP1K4Xj8AAIA/AACAPwAAAAAAAAAA/kLiPQAAAAC5AmG+AAAAAHkSdb8AAAAALM8QvwAAAAAAAAAAAAAAAAAAAAAAAAAA7FE9wgAAAAAULkdDAAAAAGYmJkMAAAAAAAAAAAAAAAAAAAAAAAAAACW8gr4AAAAAJbyCvgAAAAAAAAAAAAAAAAAAgD8AAIA/AACAPwAAgD8zM5M/MzOTPzMzkz8zM5M/AACAPwAAgD+ZDWk9AAAAAGHB2jwAAAAARkQTPgAAAAD7BEG9AAAAAOq6vD0AAAAAYcHaPAAAAAAAAAAAAAAAAOXdCr8AAAAA5d0KvwAAAADpJyS/AAAAAFI4Br4AAAAAOLEPPgAAAAAAAAAAAAAAAAAAAAAAAAAArkfhQHE9ekApXIfA9ihcvylch8D2KFy/AAAAAAAAAABEm9O9AAAAAPWWPz0AAAAANfqOPAAAAAA1+o48AAAAAESb070AAAAAAAAAAAAAAAAPi50+AAAAAHVTLz8AAAAAR0xYPwAAAADf3rk9AAAAAJZW6L0AAAAAAAAAAAAAAADyWJ69AAAAAIt65b4AAAAA9SETPwAAAAD1IRM/AAAAAPJYnr0AAAAAwriyPQAAAAAAAAAAAAAAANejcMG4HsXA16MKwj0KY8EAAAAAAAAAANejcMG4HsXA16MKwj0KY8EAAAAAAAAAANejcMG4HsXA16MKwj0KY8EAAAAAAAAAANejcMG4HsXAAAAAAAAAAAAAAIA/AACAP+xRuD8AAIA/MzOzPwAAgD8AAIA/AACAP+xRuD8AAIA/MzOzPwAAgD8AAIA/AACAP+xRuD8AAIA/MzOzPwAAgD8AAIA/AACAP+xRuD8AAIA/AACAPwAAgD8AAAAAAAAAABpXdT8AAAAApx/IPwAAAABQgNA/AAAAADg1sj8AAAAAjB2pPwAAAAAAAAAAAAAAAAAAgD8AAIA/PQq3PwAAgD89Crc/H4WrP4XrUT9xPao/pHC9PzMzcz8AAIA/AACAPz0Ktz8AAIA/PQq3Px+Fqz+F61E/cT2qP6RwvT8zM3M/AACAPwAAgD89Crc/AACAPz0Ktz8fhas/AACAPwAAgD89Crc/AACAPz0Ktz8fhas/hetRP3E9qj+kcL0/MzNzPwAAgD8AAIA/AAAAAAAAAAAAAAAAAAAAAEjhmr8zMyPBAAAAAAAAAAAAAAAAAAAAAPUPn70AAAAAXpH6vQAAAAAn7iu+AAAAAAAAAAAAAAAAAAAAAAAAAACC2rq+AAAAAHInAr8AAAAAtTcjvwAAAAAcl4A+AAAAAOd8mz4AAAAAAAAAAAAAAADCuLI9AAAAAMzr9TwAAAAAAAAAAAAAAAD6faC+AAAAAPp9oL4AAAAAR0bcvgAAAAAv+72+AAAAAG5GHb4AAAAAAAAAAAAAAACNqsW9AAAAABYTWD4AAAAAi3RpvwAAAABu0zm/AAAAAKK3wj4AAAAAjarFvQAAAAAAAAAAAAAAAIuElD4AAAAAoB4uPwAAAAAn5Hw/AAAAACj6oz4AAAAAO2iQvQAAAAAAAAAAAAAAAAAAgD8AAIA/H4U7QB+FO0CkcP0/pHD9PwrXQ0AK10NAexTuP3sU7j8AAIA/AACAP6Rw/T+kcP0/CtdDQArXQ0B7FO4/exTuPwAAgD8AAIA/H4U7QB+FO0CkcP0/pHD9PwrXQ0AK10NAexTuP3sU7j8AAIA/AACAPwAAAAAAAAAAV44XPwAAAAAO+IS+AAAAAHklnr8AAAAAAOJyvgAAAAA1+o4lAAAAAAAAgD8AAIA/mpkZPwAAgD9I4Zo/AACAP5qZmT+kcD0/9ii8Pz0Klz8AAIA/AACAP5qZGT8AAIA/SOGaPwAAgD+amZk/pHA9P/YovD89Cpc/AACAPwAAgD+amRk/AACAP0jhmj8AAIA/AACAPwAAgD+amRk/AACAP0jhmj8AAIA/mpmZP6RwPT/2KLw/PQqXPwAAgD8AAIA/t9wvvQAAAADXx3g8AAAAAIHAAb4AAAAAV44XvQAAAADXx3g8AAAAAAAAgD8AAIA/XI9CP9ejcD/D9Yg/9ihcPxSuRz9SuF4/AACAPwAAgD9cj0I/16NwP8P1iD/2KFw/FK5HP1K4Xj8AAIA/AACAP1yPQj/Xo3A/w/WIP/YoXD8Urkc/UrhePwAAgD8AAIA/XI9CP9ejcD/D9Yg/9ihcPxSuRz9SuF4/AACAPwAAgD9cj0I/16NwP8P1iD/2KFw/FK5HP1K4Xj8AAIA/AACAPxSuRz9SuF4/AACAPwAAgD8AAAAAAAAAAOkd9b4AAAAAmqowvwAAAADiIle/AAAAAEhqRL4AAAAAlUgnPgAAAAAAAAAAAAAAAMXokr0AAAAAr61+vgAAAABaR2G/AAAAAFEamr8AAAAAW9p5PgAAAADF6JK9AAAAAAAAAAAAAAAAz6wlPgAAAAACElM+AAAAAMb20z4AAAAA7omtPgAAAABKCVU+AAAAAAAAAAAAAAAAAACAPwAAgD9cj0I/16NwP8P1iD/2KFw/FK5HP1K4Xj8AAIA/AACAP1yPQj/Xo3A/w/WIP/YoXD8Urkc/UrheP1yPQj/Xo3A/w/WIP/YoXD8Urkc/UrhePwAAgD8AAIA/FK5HP1K4Xj8AAIA/AACAPwAAAAAAAAAAj8LrwT0K0UFxPRtCmplZP3E9EkJxPYLAAAAAAAAAAAAAAAAAAAAAACZF7L0AAAAA3lcZvgAAAADeVxm+AAAAAAAAAAAAAAAAAAAAAAAAAABcj4zBexSmQXE9QUKPwnU+4XpxQilcW8EAAAAAAAAAAAAAAAAAAAAAO+8wPgAAAAAAAAAAAAAAAMpWFL8AAAAAAAAAAAAAAACe9Mk+AAAAAAAAAAAAAAAAzcy0wexR4kEAABRC7FGoQHE9QUJSuL4/AAAAAAAAAAAAAAAAAAAAADvvMD4AAAAAAAAAAAAAAADKVhS/AAAAAAAAAAAAAAAAvlhyPQAAAAAAAAAAAAAAAFyPjMF7FKZBcT1BQo/CdT7henFCKVxbwQAAAAAAAAAAAAAAAAAAAAA77zA+AAAAAAAAAAAAAAAA5nLsvgAAAAAAAAAAAAAAAHkioD0AAAAAw8bzvQAAAABlHWg/AAAAADPMdz8AAAAA1InXvgAAAAB5IqA9AAAAAAAAAAAAAAAAGVF5PgAAAABRFuc+AAAAANwzMT8AAAAALuNNvAAAAABMvoy+AAAAAAAAAAAAAAAAH4VrP2ZmZr9Xjhe9AAAAAMK4sj0AAAAAAAAAAAAAAACbtii/AAAAAFGMyL8AAAAAVM3nvwAAAACfCby/AAAAAB0abr8AAAAANfqOJQAAAAAAAAAAAAAAAAAAAAAAAAAAXI/iQFK4DkEAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAADWuTe9AAAAAAAAAAAAAAAAAAAAAAAAAADjNEu+AAAAAFeOlzwAAAAAIxPDPgAAAAB8YEE/AAAAANdMUD8AAAAAAAAAAAAAAAAAAAAAAAAAADtokD4AAAAAa4+cPQAAAADQxBW/AAAAAAIQir8AAAAAp6BsvwAAAAAAAAAAAAAAAHkioD0AAAAAeSIguwAAAABuRp0/AAAAAKaPrT8AAAAAy920vgAAAAB5IqA9AAAAAAAAAAAAAAAA4ZW6vgAAAAAGWqM9AAAAAN01ej8AAAAAx5CdPwAAAADooAM/AAAAAAAAAAAAAAAAAAAAAAAAAADOG1a+AAAAAOzkID8AAAAAM0LZPwAAAAAIEaQ+AAAAADX6jqUAAAAAAACAPwAAgD9SuL4/AACAPx+Faz+PwrU/pHC9Px+Faz8K14M/heuRPwAAgD8AAIA/Uri+PwAAgD8fhWs/j8K1P6RwvT8fhWs/CteDP4XrkT8AAIA/AACAP1K4vj8AAIA/H4VrP4/CtT8AAIA/AACAP1K4vj8AAIA/H4VrP4/CtT+kcL0/H4VrPwrXgz+F65E/AACAPwAAgD8AAAAAAAAAALjeBMOamYNBAACAPwAAgD/D9cg/w/XIP4XroUCF66FAAAAAAAAAAAB71HrDj8JPwgAAgD8AAIA/zcysP83MrD8AAAAAAAAAAAAAAAAAAAAAAAAAAFK47kAAAAAAexQmQQAAgD8AAIA/AACAPwAAgD/sUZg/7FGYP/YonD/2KJw/AAAAAAAAAAAAAAAAAAAAAAAAAAAAAKRBAAAAAHE9AkIAAAAAAAAAAAAAAABxPQJCAACAPwAAgD8AAIA/AACAPxSupz8Urqc/9ii8P/YovD8AAIA/AACAP/YovD/2KLw/AAAAAAAAAAAAAAAAAAAAAAAAAAC4HoW/AACAPwAAgD+PwpU/j8KVP5qZuT/NzIw/AAAAAAAAAAAAAAAAAAAAAAAAAAA9CrFBAAAAAAAA7EEAAAAAAAAAAAAAAAAAAOxBAACAPwAAgD8AAIA/AACAPwAAgD+uR2E/AACAP5qZWT8AAIA/AACAPwAAgD+amVk/AAAAAAAAAAAAAAAA4fqRQgAAAAAAAAAAAAAAAB+FfEIAAAAA4fqRQgAAAAAAAAAAAAAAAOH6kUIAAAAAAAAAAAAAgD8AAIA/w/WoPwAAgD8AAIA/AACAP7gepT8AAIA/w/WoPwAAgD8AAIA/AACAP8P1qD8AAIA/AACAPwAAgD8AAAAAAAAAAM3MjL/NzAxAAACAPwAAgD+PwtVAj8LVQAAAgD8AAIA/AACAPwAAgD/hegRAH4XLPwAAAAAAAAAACIqDPQAAAAAAAAAAAAAAAJkNaT0AAAAAwrgyJQAAAABykv89AAAAAJkNaT0AAAAAAAAAAAAAAAByC189AAAAAAAAAAAAAAAA8lievQAAAAA1+g4lAAAAALOGHr4AAAAA8lievQAAAAAfhWs/ZmZmvwAAAAAAAAAAH4XrPxSu578fhWs/ZmZmv1eOF70AAAAAwriyJAAAAADY6Ze9AAAAAFeOF70AAAAAAAAAAAAAAABWdic+AAAAAAAAAAAAAAAARJvTvQAAAADdNXqlAAAAABjIj74AAAAARJvTvQAAAADXx3g8AAAAAIjD5DwAAAAAwriypAAAAADXx3g8AAAAAAAAAAAAAAAAMkMOvgAAAAAAAAAAAAAAAAAAAAAAAAAAxvZTPgAAAAAAAAAAAAAAAGHB2jwAAAAAwriyowAAAAC1M3A9AAAAAGHB2jwAAAAAt9wvvQAAAAB82SAlAAAAADg4sL0AAAAAt9wvvQAAAAC+WHI9AAAAAGOCiiUAAAAAP7TyPQAAAAC+WHI9AAAAAJ70yT4AAAAAn4UZvgAAAABqAoA/AAAAAJ70yT4AAAAAAAAAAAAAAADhlbq+AAAAAAZaoz0AAAAA3TV6PwAAAADHkJ0/AAAAAOigAz8AAAAAAAAAAAAAAAAAAAAAAAAAAP5C4j0AAAAAuQJhvgAAAAB5EnW/AAAAACzPEL8AAAAAAAAAAAAAAADCuLI9AAAAAAAAAAAAAAAAwrgyPgAAAADCuLI9AAAAAAAAAAAAAAAAcT0sQrgeIUIAAAAAAAAAAAAAgD8AAIA/cT2KP3E9ij8AAIA/AACAPwAAgD8AAIA/H4U7QB+FO0CkcP0/pHD9PwrXQ0AK10NAexTuP3sU7j8AAIA/AACAPx+FO0AfhTtApHD9P6Rw/T8K10NACtdDQHsU7j97FO4/AACAPwAAgD8fhTtAH4U7QKRw/T+kcP0/CtdDQArXQ0B7FO4/exTuPwAAgD8AAIA/H4U7QB+FO0CkcP0/pHD9PwrXQ0AK10NAexTuP3sU7j8AAIA/AACAPwAAAAAAAAAA2n75PQAAAADqQd29AAAAAHDzbj4AAAAAUqc2vgAAAADmcKM+AAAAAMIxEj4AAAAAAAAAAAAAAADafvk9AAAAAOpB3b0AAAAAcPNuPgAAAABSpza+AAAAAOZwoz4AAAAAwjESPgAAAABw824+AAAAAFKnNr4AAAAA5nCjPgAAAAAAAAAAAAAAAAAAAAAAAAAA16NwwbgexcDXowrCPQpjwQAAAAAAAAAA16NwwbgexcDXowrCPQpjwQAAAAAAAAAA16NwwbgexcDXowrCPQpjwQAAAAAAAAAA16NwwbgexcDXowrCPQpjwQAAAAAAAAAA16NwwbgexcDXowrCPQpjwQAAAAAAAAAA16NwwbgexcDXowrCPQpjwZqZub/sUTi/16NwwbgexcDXowrCPQpjwQAAAAAAAAAAAACAPwAAgD/sUbg/AACAPzMzsz8AAIA/AACAPwAAgD/sUbg/AACAPzMzsz8AAIA/AACAPwAAgD/sUbg/AACAPzMzsz8AAIA/AACAPwAAgD/sUbg/AACAPzMzsz8AAIA/AACAPwAAgD/sUbg/AACAPzMzsz8AAIA/AACAPwAAgD/sUbg/AACAPzMzsz8AAIA/AACAPwAAgD/sUbg/AACAPzMzsz8AAIA/AACAPwAAgD8AAIA/AACAP1yPQj/Xo3A/w/WIP/YoXD8Urkc/UrhePwAAgD8AAIA/XI9CP9ejcD/D9Yg/9ihcPxSuRz9SuF4/AACAPwAAgD9cj0I/16NwP8P1iD/2KFw/FK5HP1K4Xj8AAIA/AACAP1yPQj/Xo3A/w/WIP/YoXD8Urkc/UrhePwAAgD8AAIA/XI9CP9ejcD/D9Yg/9ihcPxSuRz9SuF4/AACAPwAAgD8Urkc/UrhePwAAgD8AAIA/AAAAAAAAAABI4bzBexTewAAAAAAAAAAAAACAPwAAgD8fhTtAH4U7QKRw/T+kcP0/CtdDQArXQ0B7FO4/exTuPwAAgD8AAIA/H4U7QB+FO0CkcP0/pHD9PwrXQ0AK10NAexTuP3sU7j8AAIA/AACAPx+FO0AfhTtApHD9P6Rw/T8K10NACtdDQHsU7j97FO4/AACAPwAAgD8fhTtAH4U7QKRw/T+kcP0/CtdDQArXQ0B7FO4/exTuPwAAgD8AAIA/AACAPwAAgD9cj0I/16NwP8P1iD/2KFw/FK5HP1K4Xj8AAIA/AACAP1yPQj/Xo3A/w/WIP/YoXD8Urkc/UrhePwAAgD8AAIA/XI9CP9ejcD/D9Yg/9ihcPxSuRz9SuF4/AACAPwAAgD9cj0I/16NwP8P1iD/2KFw/FK5HP1K4Xj8AAIA/AACAP1yPQj/Xo3A/w/WIP/YoXD8Urkc/UrhePwAAgD8AAIA/FK5HP1K4Xj8AAIA/AACAPwAAgD8AAIA/XI9CP9ejcD/D9Yg/9ihcPxSuRz9SuF4/AACAPwAAgD9cj0I/16NwP8P1iD/2KFw/FK5HP1K4Xj8AAIA/AACAP1yPQj/Xo3A/w/WIP/YoXD8Urkc/UrhePwAAgD8AAIA/XI9CP9ejcD/D9Yg/9ihcPxSuRz9SuF4/AACAPwAAgD9cj0I/16NwP8P1iD/2KFw/FK5HP1K4Xj8AAIA/AACAPxSuRz9SuF4/AACAPwAAgD8AAAAAAAAAAIXrQUHheuxAzcwMQM3MrEHNzExA4Xr0QAAAAAAAAAAAAAAAAAAAAAA02O+9AAAAAKegbL0AAAAATLIUvgAAAAAAAAAAAAAAAAAAgD8AAIA/PQq3PwAAgD89Crc/H4WrP4XrUT9xPao/pHC9PzMzcz8AAIA/AACAPz0Ktz8AAIA/PQq3Px+Fqz+F61E/cT2qP6RwvT8zM3M/AACAPwAAgD89Crc/AACAPz0Ktz8fhas/hetRP3E9qj+kcL0/MzNzPwAAgD8AAIA/PQq3PwAAgD89Crc/H4WrP4XrUT9xPao/pHC9PzMzcz8AAIA/AACAPz0Ktz8AAIA/PQq3Px+Fqz+F61E/cT2qP6RwvT8zM3M/AACAPwAAgD89Crc/AACAPz0Ktz8fhas/hetRP3E9qj+kcL0/MzNzPwAAgD8AAIA/AACAPwAAgD9SuL4/AACAPx+Faz+PwrU/pHC9Px+Faz8K14M/heuRPwAAgD8AAIA/Uri+PwAAgD8fhWs/j8K1P6RwvT8fhWs/CteDP4XrkT8AAIA/AACAP1K4vj8AAIA/H4VrP4/CtT+kcL0/H4VrPwrXgz+F65E/AACAPwAAgD9SuL4/AACAPx+Faz+PwrU/pHC9Px+Faz8K14M/heuRPwAAgD8AAIA/Uri+PwAAgD8fhWs/j8K1P6RwvT8fhWs/CteDP4XrkT8AAIA/AACAP1K4vj8AAIA/H4VrP4/CtT+kcL0/H4VrPwrXgz+F65E/AACAPwAAgD8AAIA/AACAP5qZGT8AAIA/SOGaPwAAgD+amZk/pHA9P/YovD89Cpc/AACAPwAAgD+amRk/AACAP0jhmj8AAIA/mpmZP6RwPT/2KLw/PQqXPwAAgD8AAIA/mpkZPwAAgD9I4Zo/AACAP5qZmT+kcD0/9ii8Pz0Klz8AAIA/AACAP5qZGT8AAIA/SOGaPwAAgD+amZk/pHA9P/YovD89Cpc/AACAPwAAgD+amRk/AACAP0jhmj8AAIA/mpmZP6RwPT/2KLw/PQqXPwAAgD8AAIA/mpkZPwAAgD9I4Zo/AACAP5qZmT+kcD0/9ii8Pz0Klz8AAIA/AACAPwAAAAAAAAAArkctQR+FB0GPwhXAuB7LQdejkD+F6xVBAAAAAAAAAAAAAAAAAAAAADg4ML4AAAAAtT0fPgAAAABMshS+AAAAAAAAAAAAAAAAAAAAAAAAAACF60FB4XrsQM3MDEDNzKxBzcxMQOF69EAAAAAAAAAAAAAAAAAAAAAAODgwvgAAAAC1PR8+AAAAAEyyFL4AAAAAAAAAAAAAAADCuLI9AAAAAAAAAAAAAAAAwrgyPgAAAADCuLI9AAAAAMK4sj0AAAAAAAAAAAAAAADCuDI+AAAAAMK4sj0AAAAAAAAAAAAAAAAPi50+AAAAAHVTLz8AAAAAR0xYPwAAAADf3rk9AAAAAJZW6L0AAAAAAAAAAAAAAAAAAAAAAAAAAM+sJT4AAAAAAhJTPgAAAADG9tM+AAAAAO6JrT4AAAAASglVPgAAAAAAAAAAAAAAAAAAAAAAAAAAGVF5PgAAAABRFuc+AAAAANwzMT8AAAAALuNNvAAAAABMvoy+AAAAAAAAAAAAAAAAAAAAAAAAAACLhJQ+AAAAAKAeLj8AAAAAJ+R8PwAAAAAo+qM+AAAAADtokL0AAAAAAAAAAAAAAAAAAAAAAAAAABpXdT8AAAAApx/IPwAAAABQgNA/AAAAADg1sj8AAAAAjB2pPwAAAAAAAAAAAAAAAAAAAAAAAAAAO2iQPgAAAABrj5w9AAAAANDEFb8AAAAAAhCKvwAAAACnoGy/AAAAAAAAAAAAAAAAAAAAAAAAAADl3Qq/AAAAAOXdCr8AAAAA6SckvwAAAABSOAa+AAAAADixDz4AAAAAAAAAAAAAAAAAAAAAAAAAAPp9oL4AAAAA+n2gvgAAAABHRty+AAAAAC/7vb4AAAAAbkYdvgAAAAAAAAAAAAAAAAAAAAAAAAAAgtq6vgAAAAByJwK/AAAAALU3I78AAAAAHJeAPgAAAADnfJs+AAAAAAAAAAAAAAAAAAAAAAAAAADpHfW+AAAAAJqqML8AAAAA4iJXvwAAAABIakS+AAAAAJVIJz4AAAAAAAAAAAAAAAAAAAAAAAAAAJu2KL8AAAAAUYzIvwAAAABUzee/AAAAAJ8JvL8AAAAAHRpuvwAAAAA1+o4lAAAAAAAAAAAAAAAA4zRLvgAAAABXjpc8AAAAACMTwz4AAAAAfGBBPwAAAADXTFA/AAAAAAAAAAAAAAAAeSKgPQAAAABQd1YlAAAAADaBLz4AAAAAeSKgPQAAAAB5IqA9AAAAAFB3ViUAAAAANoEvPgAAAAB5IqA9AAAAAI2qxb0AAAAANfqOIwAAAADZ91i+AAAAAI2qxb0AAAAAxeiSvQAAAACSCoYlAAAAAL5iIb4AAAAAxeiSvQAAAADM6/U8AAAAAMK4siMAAAAAgJ5iPQAAAADM6/U8AAAAAAAAAAAAAAAAKVy/wFK4qEEAAAAAAAAAAAAAAAAAAAAABuHDPAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAcT0CQgAAAAAAAAAAAAAAAHE9AkIAAIA/AACAPwAAgD8AAIA/9ii8P/YovD8AAIA/AACAP/YovD/2KLw/AAAAAAAAAAAAAAAAAAAAAAAAAAB7FCZBAACAPwAAgD8AAIA/AACAP/YonD/2KJw/AAAAAAAAAAAAAAAAAAAAAAAAAAAAAOxBAAAAAAAAAAAAAAAAAADsQQAAgD8AAIA/AACAPwAAgD8AAIA/mplZPwAAgD8AAIA/AACAP5qZWT8AAAAAAAAAAAAAAADh+pFCAAAAAAAAAAAAAAAA4fqRQgAAAAAAAAAAAAAAAOH6kUIAAIA/AACAP8P1qD8AAIA/AACAPwAAgD/D9ag/AACAPwAAgD8AAIA/w/WoPwAAgD8AAAAAAAAAAAAAAAAAAAAAPQotQq5Hn0E9Ci1CrkefQQAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAABWMNz4AAAAAFYw3PgAAAAAAAAAAAAAAAAAAgD8AAIA/H4U7QB+FO0CkcP0/pHD9PwrXQ0AK10NAexTuP3sU7j8AAIA/AACAPx+FO0AfhTtApHD9P6Rw/T8K10NACtdDQHsU7j97FO4/AACAPwAAgD8fhTtAH4U7QKRw/T+kcP0/CtdDQArXQ0B7FO4/exTuPwAAgD8AAIA/H4U7QB+FO0AfhTtAH4U7QOxRiECamWlAmpmpQI/C9T8AAIA/AACAP1K43j9SuN4/CtdDQArXQ0B7FO4/exTuPwAAgD8AAIA/H4U7QB+FO0CkcP0/pHD9PwrXQ0AK10NAexTuP3sU7j8AAIA/AACAPx+FO0AfhTtApHD9P6Rw/T8K10NACtdDQHsU7j97FO4/AACAPwAAgD8AAAAAAAAAAEjhvMF7FN7AAAAAAAAAAAAAAAAAAAAAAClcGMIpXBjCSOG8wXsU3sAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAACx3V6+AAAAALHdXr4AAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAIxPDvgAAAAAAAAAAAAAAAAAAgD8AAIA/XI9CP9ejcD/D9Yg/9ihcPxSuRz9SuF4/AACAPwAAgD9cj0I/16NwP8P1iD/2KFw/FK5HP1K4Xj8AAIA/AACAP1yPQj/Xo3A/w/WIP/YoXD8Urkc/UrhePwAAgD8AAIA/XI9CP9ejcD/D9Yg/9ihcPxSuRz9SuF4/AACAPwAAgD9cj0I/16NwP8P1iD/2KFw/w/WIP/YoXD/sUXg/9ihcPwAAgD8AAIA/PQoXQFyPgj+kcC1AuB5FP1yPQj/Xo3A/w/WIP/YoXD8Urkc/UrhePwAAgD8AAIA/XI9CP9ejcD/D9Yg/9ihcPxSuRz9SuF4/AACAPwAAgD9cj0I/16NwP8P1iD/2KFw/FK5HP1K4Xj8AAIA/AACAPxSuRz9SuF4/AACAPwAAgD8AAAAAAAAAAP5C4j0AAAAAuQJhvgAAAAB5EnW/AAAAACzPEL8AAAAA/kLiPQAAAAC5AmG+AAAAAHkSdb8AAAAALM8QvwAAAAD+QuI9AAAAALkCYb4AAAAAeRJ1vwAAAAAszxC/AAAAALkCYb4AAAAAeRJ1vwAAAAAszxC/AAAAAAAAAAAAAAAAuQJhvgAAAAB5EnW/AAAAACzPEL8AAAAA/kLiPQAAAAC5AmG+AAAAAHkSdb8AAAAALM8QvwAAAAAAAAAAAAAAAAAAAAAAAAAAAACTwuF66kFxvaZCAADiQYXrTUFI4SxCpHAJwuxROEIfhW/BSOFBQhSuQcIK10tCXI8dwh+F6UF7FGLCKVwPQTMzG8KuRx3BSOGKwmZm2sEpXEnCexQuwgCAksJxPWrCw/VLwsP1kMLD9ZPCM7OqwnE9qMIpXM3CH+WWQwrX/sIfhazD1+MAxHuUj0KamcDC4foTQ8P1oMGk8J9CpHAJwgAAAAAAAAAAAAAAAAAAAACxYra+AAAAAJBhRr4AAAAAfv/RvgAAAAB+/9G+AAAAAHVV+L4AAAAAdVX4vgAAAACziOe+AAAAAESlAr4AAAAApOeiPgAAAACk56I+AAAAAB2ZyT0AAAAAHZnJPQAAAAAAAAAAAAAAAAAAgD8AAIA/AACAPwAAgD9I4RpAH4UrPwAAgD8AAIA/mQ1pPQAAAABhwdo8AAAAAHkioLoAAAAAaNibPQAAAABbU1k8AAAAAAMqQz4AAAAAWKYHvgAAAAD3xh8+AAAAAHd54L0AAAAAUjgGPgAAAABhwdo8AAAAAAAAAAAAAAAAAAAAAAAAAADNzAzACtejPM3MDMAK16M87FEIwArXozzsUQjACtejPAAAAAAAAAAAAACAPwAAgD8AAIA/AACAP4XrET8AAIA/AACAPwAAgD+F6xE/AACAPwAAgD8AAIA/AACAPwAAgD+F6xE/AACAPwAAgD8AAIA/hesRPwAAgD8AAIA/AACAPwAAgD8AAIA/hesRPwAAgD8AAIA/AACAP4XrET8AAIA/AACAPwAAgD8AAAAAAAAAAOXdCr8AAAAA5d0KvwAAAADpJyS/AAAAAFI4Br4AAAAAOLEPPgAAAADl3Qq/AAAAAOXdCr8AAAAA6SckvwAAAABSOAa+AAAAADixDz4AAAAA5d0KvwAAAADl3Qq/AAAAAOknJL8AAAAAUjgGvgAAAAA4sQ8+AAAAAOXdCr8AAAAA6SckvwAAAABSOAa+AAAAADixDz4AAAAAAAAAAAAAAADl3Qq/AAAAAOknJL8AAAAAUjgGvgAAAAA4sQ8+AAAAAOXdCr8AAAAA5d0KvwAAAADpJyS/AAAAAFI4Br4AAAAAOLEPPgAAAAAAAAAAAAAAAAAAAAAAAAAA16OoQAAAwD8fhbPAexTOQJqZSUDD9UhA4XoUweF63ECamUlAw/VIQOF6FMHhetxAmplJQMP1SEDhehTB4XrcQJqZSUDD9UhA4XoUweF63EC4HqVAcT3CQLgepUBxPcJAKVy/QGZmvkApXL9AZma+QD0KR8AK1wNAPQpHwArXA0ApXL9AZma+QK5H2cDsUTg/FK53QY/C9b4AAAAAAAAAAESb070AAAAARJvTvQAAAABbU1k8AAAAAHkiIL4AAAAA5WQrPgAAAAB5IiC+AAAAAOVkKz4AAAAAeSIgvgAAAADlZCs+AAAAAHkiIL4AAAAA5WQrPgAAAAA1+o47AAAAAASx470AAAAABLHjvQAAAABNR/Y9AAAAAE1H9j0AAAAABLHjvQAAAAAEseO9AAAAAKpX7b0AAAAA/1pSvgAAAABEm9O9AAAAAAAAAAAAAAAAD4udPgAAAAB1Uy8/AAAAAEdMWD8AAAAA3965PQAAAACWVui9AAAAAA+LnT4AAAAAdVMvPwAAAABHTFg/AAAAAN/euT0AAAAAllbovQAAAAAPi50+AAAAAHVTLz8AAAAAR0xYPwAAAADf3rk9AAAAAJZW6L0AAAAAdVMvPwAAAABHTFg/AAAAAN/euT0AAAAAllbovQAAAAAAAAAAAAAAAHVTLz8AAAAAR0xYPwAAAADf3rk9AAAAAJZW6L0AAAAAD4udPgAAAAB1Uy8/AAAAAEdMWD8AAAAA3965PQAAAACWVui9AAAAAAAAAAAAAAAA8lievQAAAACJYKy+AAAAAFic2L4AAAAAWkWYPgAAAADAkgG+AAAAAFxrST4AAAAAwJIBvgAAAABca0k+AAAAAMCSAb4AAAAAXGtJPgAAAADAkgG+AAAAAFxrST4AAAAALES9vgAAAABWbPi9AAAAAGYvXL4AAAAA4H1KvgAAAADCKxY/AAAAAMIrFj8AAAAAVmz4vQAAAABmL1y+AAAAAHTC3z4AAAAAa4XtvgAAAADyWJ69AAAAAMK4sj0AAAAAdV8nPwAAAAAN7lU/AAAAAIT+Ir4AAAAAbkadvAAAAABMtN2+AAAAAP21RT8AAAAAwriyPQAAAAAAAAAAAAAAANejcMG4HsXA16MKwj0KY8EAAAAAAAAAANejcMG4HsXA16MKwj0KY8EAAAAAAAAAANejcMG4HsXA16MKwj0KY8EAAAAAAAAAANejcMG4HsXA16MKwj0KY8EAAAAAAAAAANejcMG4HsXA16MKwj0KY8EAAAAAAAAAANejcMG4HsXA16NwwbgexcAzM9HBKVwrwQAAAAAAAAAAmpm5v+xROL/Xo3DBuB7FwNejCsI9CmPBAAAAAAAAAADXo3DBuB7FwNejCsI9CmPBAAAAAAAAAADXo3DBuB7FwNejCsI9CmPBAAAAAAAAAADXo3DBuB7FwNejCsI9CmPBAAAAAAAAAADXo3DBuB7FwNejCsI9CmPBAAAAAAAAAADXo3DBuB7FwNejCsI9CmPBAAAAAAAAAADXo3DBuB7FwNejCsI9CmPBmpm5v+xROL/Xo3DBuB7FwNejCsI9CmPBAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAuQyQvgAAAAAAAAAAAAAAAAAAgD8AAIA/7FG4PwAAgD8zM7M/AACAPwAAgD8AAIA/7FG4PwAAgD8zM7M/AACAPwAAgD8AAIA/7FG4PwAAgD8zM7M/AACAPwAAgD8AAIA/7FG4PwAAgD8zM7M/AACAPwAAgD8AAIA/7FG4PwAAgD8zM7M/AACAPwAAgD8AAIA/7FG4PwAAgD/sUbg/AACAP4/CtT8AAIA/AACAPwAAgD8AAIA/AACAP+xRuD8AAIA/MzOzPwAAgD8AAIA/AACAP+xRuD8AAIA/MzOzPwAAgD8AAIA/AACAP+xRuD8AAIA/MzOzPwAAgD8AAIA/AACAP+xRuD8AAIA/MzOzPwAAgD8AAIA/AACAP+xRuD8AAIA/MzOzPwAAgD8AAIA/AACAP+xRuD8AAIA/MzOzPwAAgD8AAIA/AACAP+xRuD8AAIA/MzOzPwAAgD8AAIA/AACAP+xRuD8AAIA/MzOzPwAAgD8AAIA/AACAPwAAAAAAAAAAGld1PwAAAACnH8g/AAAAAFCA0D8AAAAAODWyPwAAAACMHak/AAAAABpXdT8AAAAApx/IPwAAAABQgNA/AAAAADg1sj8AAAAAjB2pPwAAAAAaV3U/AAAAAKcfyD8AAAAAUIDQPwAAAAA4NbI/AAAAAIwdqT8AAAAApx/IPwAAAABQgNA/AAAAADg1sj8AAAAAjB2pPwAAAAAAAAAAAAAAAKcfyD8AAAAAUIDQPwAAAAA4NbI/AAAAAIwdqT8AAAAAGld1PwAAAACnH8g/AAAAAFCA0D8AAAAAODWyPwAAAACMHak/AAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAADteYT4AAAAAO15hPgAAAAAAAAAAAAAAAAAAgD8AAIA/PQq3PwAAgD89Crc/H4WrP4XrUT9xPao/pHC9PzMzcz8AAIA/AACAPz0Ktz8AAIA/PQq3Px+Fqz+F61E/cT2qP6RwvT8zM3M/AACAPwAAgD89Crc/AACAPz0Ktz8fhas/hetRP3E9qj+kcL0/MzNzPwAAgD8AAIA/PQq3PwAAgD89Crc/H4WrP4XrUT9xPao/pHC9PzMzcz8AAIA/AACAPz0Ktz8AAIA/PQq3Px+Fqz+F61E/cT2qP6RwvT8zM3M/AACAPwAAgD89Crc/AACAPz0Ktz8fhas/hetRP3E9qj+kcL0/MzNzPwAAgD8AAIA/PQq3PwAAgD89Crc/H4WrP4XrUT9xPao/pHC9PzMzcz8AAIA/AACAPz0Ktz8AAIA/PQq3Px+Fqz8AAIA/AACAPz0Ktz8AAIA/PQq3Px+Fqz+F61E/cT2qP6RwvT8zM3M/AACAPwAAgD89Crc/AACAPz0Ktz8fhas/hetRP3E9qj+kcL0/MzNzPwAAgD8AAIA/PQq3PwAAgD89Crc/H4WrP4XrUT9xPao/pHC9PzMzcz8AAIA/AACAPz0Ktz8AAIA/PQq3Px+Fqz+F61E/cT2qP6RwvT8zM3M/AACAPwAAgD89Crc/AACAPz0Ktz8fhas/hetRP3E9qj+kcL0/MzNzPwAAgD8AAIA/PQq3PwAAgD89Crc/H4WrP4XrUT9xPao/pHC9PzMzcz8AAIA/AACAPz0Ktz8AAIA/PQq3Px+Fqz+F61E/cT2qP6RwvT8zM3M/AACAPwAAgD8AAAAAAAAAAMEP870AAAAAVM1nvgAAAABuzb09AAAAAG7NvT0AAAAA4Oz6PQAAAAB8z/E+AAAAAAAAAAAAAAAAAAAAAAAAAACC2rq+AAAAAHInAr8AAAAAtTcjvwAAAAAcl4A+AAAAAOd8mz4AAAAAgtq6vgAAAAByJwK/AAAAALU3I78AAAAAHJeAPgAAAADnfJs+AAAAAILaur4AAAAAcicCvwAAAAC1NyO/AAAAAByXgD4AAAAA53ybPgAAAAByJwK/AAAAALU3I78AAAAAHJeAPgAAAADnfJs+AAAAAAAAAAAAAAAAcicCvwAAAAC1NyO/AAAAAByXgD4AAAAA53ybPgAAAACC2rq+AAAAAHInAr8AAAAAtTcjvwAAAAAcl4A+AAAAAOd8mz4AAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAIxPDvgAAAADf6rG+AAAAAAAAAAAAAAAAwriyPQAAAADtfTU/AAAAAKNXiD8AAAAArRgdvgAAAABQd1Y8AAAAACZFbL4AAAAA8Cg+PwAAAADCuLI9AAAAAMzr9TwAAAAAAAAAAAAAAAD6faC+AAAAAPp9oL4AAAAAR0bcvgAAAAAv+72+AAAAAG5GHb4AAAAA+n2gvgAAAAD6faC+AAAAAEdG3L4AAAAAL/u9vgAAAABuRh2+AAAAAPp9oL4AAAAA+n2gvgAAAABHRty+AAAAAC/7vb4AAAAAbkYdvgAAAAD6faC+AAAAAEdG3L4AAAAAL/u9vgAAAABuRh2+AAAAAAAAAAAAAAAA+n2gvgAAAABHRty+AAAAAC/7vb4AAAAAbkYdvgAAAAD6faC+AAAAAPp9oL4AAAAAR0bcvgAAAAAv+72+AAAAAG5GHb4AAAAAAAAAAAAAAACNqsW9AAAAACqlLD4AAAAAbs09vgAAAAC2SRe/AAAAAJj1eL8AAAAAIFDKvQAAAABZtEg+AAAAAHbmx74AAAAAddpPvwAAAAB5IqA9AAAAAN3EgD4AAAAA5Ey7vAAAAACaGWG/AAAAAN3EgL4AAAAAjarFvQAAAAAAAAAAAAAAAIuElD4AAAAAoB4uPwAAAAAn5Hw/AAAAACj6oz4AAAAAO2iQvQAAAACLhJQ+AAAAAKAeLj8AAAAAJ+R8PwAAAAAo+qM+AAAAADtokL0AAAAAi4SUPgAAAACgHi4/AAAAACfkfD8AAAAAKPqjPgAAAAA7aJC9AAAAAKAeLj8AAAAAJ+R8PwAAAAAo+qM+AAAAADtokL0AAAAAAAAAAAAAAACgHi4/AAAAACfkfD8AAAAAKPqjPgAAAAA7aJC9AAAAAIuElD4AAAAAoB4uPwAAAAAn5Hw/AAAAACj6oz4AAAAAO2iQvQAAAAAAAAAAAAAAAAAAgD8AAIA/H4U7QB+FO0CkcP0/pHD9PwrXQ0AK10NAexTuP3sU7j8AAIA/AACAPx+FO0AfhTtApHD9P6Rw/T8K10NACtdDQHsU7j97FO4/AACAPwAAgD8fhTtAH4U7QKRw/T+kcP0/CtdDQArXQ0B7FO4/exTuPwAAgD8AAIA/H4U7QB+FO0CkcP0/pHD9PwrXQ0AK10NAexTuP3sU7j8AAIA/AACAPx+FO0AfhTtApHD9P6Rw/T8K10NACtdDQHsU7j97FO4/pHD9P6Rw/T8K10NACtdDQHsU7j97FO4/AACAPwAAgD8fhTtAH4U7QKRw/T+kcP0/CtdDQArXQ0B7FO4/exTuPwAAgD8AAIA/H4U7QB+FO0CkcP0/pHD9PwrXQ0AK10NAexTuP3sU7j8AAIA/AACAPx+FO0AfhTtApHD9P6Rw/T8K10NACtdDQHsU7j97FO4/AACAPwAAgD8fhTtAH4U7QKRw/T+kcP0/CtdDQArXQ0B7FO4/exTuPwAAgD8AAIA/AAAAAAAAAADhlTo+AAAAAJxVuT4AAAAA0dwFPgAAAADhBGu+AAAAAGC14r4AAAAAa4VtPgAAAADhDpo9AAAAABem8L4AAAAAv/U5vwAAAADcuAi+AAAAAG21TT4AAAAAI47rvgAAAAABf7q+AAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAADteYT4AAAAAO15hPgAAAAAAAAAAAAAAAAAAgD8AAIA/mpkZPwAAgD9I4Zo/AACAP5qZmT+kcD0/9ii8Pz0Klz8AAIA/AACAP5qZGT8AAIA/SOGaPwAAgD+amZk/pHA9P/YovD89Cpc/AACAPwAAgD+amRk/AACAP0jhmj8AAIA/mpmZP6RwPT/2KLw/PQqXPwAAgD8AAIA/mpkZPwAAgD9I4Zo/AACAP5qZmT+kcD0/9ii8Pz0Klz8AAIA/AACAP5qZGT8AAIA/SOGaPwAAgD+amZk/pHA9P/YovD89Cpc/AACAPwAAgD+amRk/AACAP0jhmj8AAIA/mpmZP6RwPT/2KLw/PQqXPwAAgD8AAIA/mpkZPwAAgD9I4Zo/AACAP5qZmT+kcD0/9ii8Pz0Klz8AAIA/AACAP5qZGT8AAIA/SOGaPwAAgD8AAIA/AACAP5qZGT8AAIA/SOGaPwAAgD+amZk/pHA9P/YovD89Cpc/AACAPwAAgD+amRk/AACAP0jhmj8AAIA/mpmZP6RwPT/2KLw/PQqXPwAAgD8AAIA/mpkZPwAAgD9I4Zo/AACAP5qZmT+kcD0/9ii8Pz0Klz8AAIA/AACAP5qZGT8AAIA/SOGaPwAAgD+amZk/pHA9P/YovD89Cpc/AACAPwAAgD+amRk/AACAP0jhmj8AAIA/mpmZP6RwPT/2KLw/PQqXPwAAgD8AAIA/mpkZPwAAgD9I4Zo/AACAP5qZmT+kcD0/9ii8Pz0Klz8AAIA/AACAP5qZGT8AAIA/SOGaPwAAgD+amZk/pHA9P/YovD89Cpc/AACAPwAAgD+33C+9AAAAANfHeDwAAAAA3leZPgAAAABJ+xM+AAAAAOOje70AAAAA46N7vQAAAADXx3g8AAAAAI0vnT4AAAAAhQqbPgAAAADXx3g8AAAAAAAAgD8AAIA/XI9CP9ejcD/D9Yg/9ihcPxSuRz9SuF4/AACAPwAAgD9cj0I/16NwP8P1iD/2KFw/FK5HP1K4Xj8AAIA/AACAP1yPQj/Xo3A/w/WIP/YoXD8Urkc/UrhePwAAgD8AAIA/XI9CP9ejcD/D9Yg/9ihcPxSuRz9SuF4/AACAPwAAgD9cj0I/16NwP8P1iD/2KFw/FK5HP1K4Xj8AAIA/AACAPxSuRz9SuF4/AACAPwAAgD9cj0I/16NwP8P1iD/2KFw/FK5HP1K4Xj8AAIA/AACAP1yPQj/Xo3A/FK5HP1K4Xj8AAIA/AACAPxSuRz9SuF4/AACAPwAAgD9cj0I/16NwP8P1iD/2KFw/FK5HP1K4Xj8AAIA/AACAP1yPQj/Xo3A/w/WIP/YoXD8Urkc/UrhePwAAgD8AAIA/XI9CP9ejcD/D9Yg/9ihcPxSuRz9SuF4/AACAPwAAgD9cj0I/16NwP8P1iD/2KFw/FK5HP1K4Xj8AAIA/AACAP1yPQj/Xo3A/w/WIP/YoXD8Urkc/UrhePwAAgD8AAIA/FK5HP1K4Xj8AAIA/AACAPwAAAAAAAAAA6R31vgAAAACaqjC/AAAAAOIiV78AAAAASGpEvgAAAACVSCc+AAAAAOkd9b4AAAAAmqowvwAAAADiIle/AAAAAEhqRL4AAAAAlUgnPgAAAADpHfW+AAAAAJqqML8AAAAA4iJXvwAAAABIakS+AAAAAJVIJz4AAAAAmqowvwAAAADiIle/AAAAAEhqRL4AAAAAlUgnPgAAAAAAAAAAAAAAAJqqML8AAAAA4iJXvwAAAABIakS+AAAAAJVIJz4AAAAA6R31vgAAAACaqjC/AAAAAOIiV78AAAAASGpEvgAAAACVSCc+AAAAAAAAAAAAAAAAxeiSvQAAAABWbPg9AAAAAMCSgb4AAAAAkOAhvwAAAABO0km/AAAAAB/Jqb0AAAAAd/K/PQAAAAAU7aa+AAAAAAKRLr8AAAAA8DS2PgAAAABPaRU/AAAAAOiKXL4AAAAAfFpFvwAAAADF9Iq+AAAAAMXokr0AAAAAAAAAAAAAAADPrCU+AAAAAAISUz4AAAAAxvbTPgAAAADuia0+AAAAAEoJVT4AAAAAz6wlPgAAAAACElM+AAAAAMb20z4AAAAA7omtPgAAAABKCVU+AAAAAM+sJT4AAAAAAhJTPgAAAADG9tM+AAAAAO6JrT4AAAAASglVPgAAAAACElM+AAAAAMb20z4AAAAA7omtPgAAAABKCVU+AAAAAAAAAAAAAAAAAhJTPgAAAADG9tM+AAAAAO6JrT4AAAAASglVPgAAAADPrCU+AAAAAAISUz4AAAAAxvbTPgAAAADuia0+AAAAAEoJVT4AAAAAAAAAAAAAAAAAAIA/AACAP1yPQj/Xo3A/w/WIP/YoXD8Urkc/UrhePwAAgD8AAIA/XI9CP9ejcD/D9Yg/9ihcPxSuRz9SuF4/AACAPwAAgD9cj0I/16NwP8P1iD/2KFw/FK5HP1K4Xj8AAIA/AACAP1yPQj/Xo3A/w/WIP/YoXD8Urkc/UrhePwAAgD8AAIA/XI9CP9ejcD/D9Yg/9ihcPxSuRz9SuF4/AACAPwAAgD8Urkc/UrhePwAAgD8AAIA/XI9CP9ejcD/D9Yg/9ihcPxSuRz9SuF4/AACAPwAAgD9cj0I/16NwPxSuRz9SuF4/AACAPwAAgD8Urkc/UrhePwAAgD8AAIA/XI9CP9ejcD/D9Yg/9ihcPxSuRz9SuF4/AACAPwAAgD9cj0I/16NwP8P1iD/2KFw/FK5HP1K4Xj8AAIA/AACAP1yPQj/Xo3A/w/WIP/YoXD8Urkc/UrhePwAAgD8AAIA/XI9CP9ejcD/D9Yg/9ihcPxSuRz9SuF4/AACAPwAAgD9cj0I/16NwP8P1iD/2KFw/FK5HP1K4Xj8AAIA/AACAPxSuRz9SuF4/AACAPwAAgD8AAAAAAAAAAJqZj0EUrjfCcT2mwa5HW8KF63PChespQbgeFML2qIBCZmbkwTMzY8D2KOTBj8JJQZqZ48GkcF3AzcziwcP1EEGF6+HB9igswc3M4MHsUZi/H4XfwY/Ch8F7FN7Bw/WewVyP3MHD9d7BzczawUjhlMGamdfBmpkhwtej1sHXo7bBH4XVwR+FMsKkcNPBw/UmwoXrXcGuR6FC9ijkwQrXAkOF613B1+MDQwAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAK88hb4AAAAArzyFvgAAAACSCga+AAAAAOTRkr4AAAAA5NGSvgAAAADGfXS+AAAAAIPmsr4AAAAA1aFHvgAAAADhDpq+AAAAAAAAAAAAAAAAAAAAAAAAAAA9CrlBw/U/wj0KZ0CkcCzC7FESwtejskF7FErBexSYQs3MhMBmZgJBCteDwFyPwkGamYHACtcDQc3MfMD2KKZBj8J1wNejcD/NzGzA9igoQVyPYsDsUajAPQpXwFyPAsFI4UrArkeBwc3MPMDNzNzAMzMjwB+F5cEfhRvAhesxwVyPEsAUrgPChesBwPYo8MHsUShBM7O4QgrXg8Bcjw5D7FEoQZqZD0MAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAACvPIW+AAAAAK88hb4AAAAAkgoGvgAAAADk0ZK+AAAAAOTRkr4AAAAAxn10vgAAAACD5rK+AAAAANWhR74AAAAA4Q6avgAAAAAAAAAAAAAAAJ70yT4AAAAAjapFPwAAAAC46vC9AAAAAJs9yT4AAAAAIfkJvQAAAABIZEg/AAAAACdekT8AAAAAFhNYPgAAAACgGns/AAAAALfcLz4AAAAAs45jPwAAAACe9Mk+AAAAAAAAAAAAAAAAPQq5QcP1P8I9CmdApHAswuxREsLXo7JBexRKwXsUmELNzITAZmYCQQrXg8Bcj8JBmpmBwArXA0HNzHzA9iimQY/CdcDXo3A/zcxswPYoKEFcj2LA7FGowD0KV8BcjwLBSOFKwK5HgcHNzDzAzczcwDMzI8AfheXBH4UbwIXrMcFcjxLAFK4DwoXrAcD2KPDB7FEoQTOzuEIK14PAXI8OQ+xRKEGamQ9DAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAArzyFvgAAAACvPIW+AAAAAJIKBr4AAAAA5NGSvgAAAADk0ZK+AAAAAMZ9dL4AAAAAg+ayvgAAAADVoUe+AAAAAOEOmr4AAAAAAAAAAAAAAAAAAAAAAAAAAD0Kj8F7FH5AAAAAAAAAAAC+WHI9AAAAAAAAAAAAAAAAPQq5QcP1P8I9CmdApHAswuxREsLXo7JBexRKwXsUmELNzITAZmYCQQrXg8Bcj8JBmpmBwArXA0HNzHzA9iimQY/CdcDXo3A/zcxswPYoKEFcj2LA7FGowD0KV8BcjwLBSOFKwK5HgcHNzDzAzczcwDMzI8AfheXBH4UbwIXrMcFcjxLAFK4DwoXrAcD2KPDB7FEoQTOzuEIK14PAXI8OQ+xRKEGamQ9DAAAAAAAAAAAAAAAAAAAAAB0eob4AAAAArzyFvgAAAACvPIW+AAAAAJIKBr4AAAAA5NGSvgAAAADk0ZK+AAAAAMZ9dL4AAAAAg+ayvgAAAADVoUe+AAAAAOEOmr4AAAAAAAAAAAAAAAB7FC6+heuxv3kioD0AAAAA3+qxvgAAAADPovY9AAAAAC3nAD8AAAAAWTMkPwAAAADyTm++AAAAAIR5y74AAAAAcgvfPgAAAAAXH1A/AAAAAG9ejb4AAAAATUf2vgAAAADfbwm+AAAAACL1Vj8AAAAAgs7CPQAAAAB5IqA9AAAAAAAAAAAAAAAAGVF5PgAAAABRFuc+AAAAANwzMT8AAAAALuNNvAAAAABMvoy+AAAAABlReT4AAAAAURbnPgAAAADcMzE/AAAAAC7jTbwAAAAATL6MvgAAAAAZUXk+AAAAAFEW5z4AAAAA3DMxPwAAAAAu4028AAAAAEy+jL4AAAAAURbnPgAAAADcMzE/AAAAAC7jTbwAAAAATL6MvgAAAAAAAAAAAAAAAFEW5z4AAAAA3DMxPwAAAAAu4028AAAAAEy+jL4AAAAAGVF5PgAAAABRFuc+AAAAANwzMT8AAAAALuNNvAAAAABMvoy+AAAAAAAAAAAAAAAAH4VrP2ZmZr9Xjhe9AAAAAMK4sj0AAAAA5WQrvgAAAADM9+2+AAAAALUz8DwAAAAAXfwYvgAAAAC1uMc+AAAAADV1t74AAAAAwriyPQAAAAAAAAAAAAAAAJu2KL8AAAAAUYzIvwAAAABUzee/AAAAAJ8JvL8AAAAAHRpuvwAAAACbtii/AAAAAFGMyL8AAAAAVM3nvwAAAACfCby/AAAAAB0abr8AAAAAm7YovwAAAABRjMi/AAAAAFTN578AAAAAnwm8vwAAAAAdGm6/AAAAAFGMyL8AAAAAVM3nvwAAAACfCby/AAAAAB0abr8AAAAANfqOJQAAAABRjMi/AAAAAFTN578AAAAAnwm8vwAAAAAdGm6/AAAAAJu2KL8AAAAAUYzIvwAAAABUzee/AAAAAJ8JvL8AAAAAHRpuvwAAAAA1+o4lAAAAAAAAAAAAAAAA5Ey7vgAAAAAAAAAAAAAAAAAAAAAAAAAA4zRLvgAAAABXjpc8AAAAACMTwz4AAAAAfGBBPwAAAADXTFA/AAAAAOM0S74AAAAAV46XPAAAAAAjE8M+AAAAAHxgQT8AAAAA10xQPwAAAADjNEu+AAAAAFeOlzwAAAAAIxPDPgAAAAB8YEE/AAAAANdMUD8AAAAAV46XPAAAAAAjE8M+AAAAAHxgQT8AAAAA10xQPwAAAAAAAAAAAAAAAFeOlzwAAAAAIxPDPgAAAAB8YEE/AAAAANdMUD8AAAAA4zRLvgAAAABXjpc8AAAAACMTwz4AAAAAfGBBPwAAAADXTFA/AAAAAAAAAAAAAAAAAAAAAAAAAAA7aJA+AAAAAGuPnD0AAAAA0MQVvwAAAAACEIq/AAAAAKegbL8AAAAAO2iQPgAAAABrj5w9AAAAANDEFb8AAAAAAhCKvwAAAACnoGy/AAAAADtokD4AAAAAa4+cPQAAAADQxBW/AAAAAAIQir8AAAAAp6BsvwAAAABrj5w9AAAAANDEFb8AAAAAAhCKvwAAAACnoGy/AAAAAAAAAAAAAAAAa4+cPQAAAADQxBW/AAAAAAIQir8AAAAAp6BsvwAAAAA7aJA+AAAAAGuPnD0AAAAA0MQVvwAAAAACEIq/AAAAAKegbL8AAAAAAAAAAAAAAAB5IqA9AAAAAA51dr4AAAAAWCGwPgAAAAArLE0/AAAAAAbhQz8AAAAAtCUvvQAAAABi2Uq+AAAAAJbPRz8AAAAAdeGAPwAAAACsh82+AAAAAOD8Jb8AAAAA8+3/vAAAAACuM4s/AAAAAP9a0j4AAAAAeSKgPQAAAAAAAAAAAAAAAOGVur4AAAAABlqjPQAAAADdNXo/AAAAAMeQnT8AAAAA6KADPwAAAADhlbq+AAAAAAZaoz0AAAAA3TV6PwAAAADHkJ0/AAAAAOigAz8AAAAA4ZW6vgAAAAAGWqM9AAAAAN01ej8AAAAAx5CdPwAAAADooAM/AAAAAAZaoz0AAAAA3TV6PwAAAADHkJ0/AAAAAOigAz8AAAAAAAAAAAAAAAAGWqM9AAAAAN01ej8AAAAAx5CdPwAAAADooAM/AAAAAOGVur4AAAAABlqjPQAAAADdNXo/AAAAAMeQnT8AAAAA6KADPwAAAAAAAAAAAAAAAAAAAAAAAAAAhPKqvgAAAADt+N2+AAAAADeP8L0AAAAA+nPxPgAAAADGffQ+AAAAAKIya74AAAAAXYO5vQAAAABU15Y+AAAAAAXTgj0AAAAAFQWXvgAAAAAnbQe/AAAAABi8Fz4AAAAAJ2cLPgAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAA7XmE+AAAAADteYT4AAAAAAAAAAAAAAAAAAIA/AACAP1K4vj8AAIA/H4VrP4/CtT+kcL0/H4VrPwrXgz+F65E/AACAPwAAgD9SuL4/AACAPx+Faz+PwrU/pHC9Px+Faz8K14M/heuRPwAAgD8AAIA/Uri+PwAAgD8fhWs/j8K1P6RwvT8fhWs/CteDP4XrkT8AAIA/AACAP1K4vj8AAIA/H4VrP4/CtT+kcL0/H4VrPwrXgz+F65E/AACAPwAAgD9SuL4/AACAPx+Faz+PwrU/pHC9Px+Faz8K14M/heuRPwAAgD8AAIA/Uri+PwAAgD8fhWs/j8K1P6RwvT8fhWs/CteDP4XrkT8AAIA/AACAP1K4vj8AAIA/H4VrP4/CtT+kcL0/H4VrPwrXgz+F65E/AACAPwAAgD9SuL4/AACAPx+Faz+PwrU/AACAPwAAgD9SuL4/AACAPx+Faz+PwrU/pHC9Px+Faz8K14M/heuRPwAAgD8AAIA/Uri+PwAAgD8fhWs/j8K1P6RwvT8fhWs/CteDP4XrkT8AAIA/AACAP1K4vj8AAIA/H4VrP4/CtT+kcL0/H4VrPwrXgz+F65E/AACAPwAAgD9SuL4/AACAPx+Faz+PwrU/pHC9Px+Faz8K14M/heuRPwAAgD8AAIA/Uri+PwAAgD8fhWs/j8K1P6RwvT8fhWs/CteDP4XrkT8AAIA/AACAP1K4vj8AAIA/H4VrP4/CtT+kcL0/H4VrPwrXgz+F65E/AACAPwAAgD9SuL4/AACAPx+Faz+PwrU/pHC9Px+Faz8K14M/heuRPwAAgD8AAIA/AAAAAAAAAAAAAAAAAAAAAAAAAAB7FCZBAAAAAAAAAAAAAAAAexQmQQAAAAAAAAAAAAAAAAAAAAAAAAAAexQmQQAAAAAAAAAAAACAPwAAgD8AAIA/AACAP/YonD/2KJw/AACAPwAAgD/2KJw/9iicPwAAgD8AAIA/AACAPwAAgD/2KJw/9iicPwAAgD8AAIA/AAAAAAAAAAAAAAAAAAAAAAAAAABxPQJCAAAAAAAAAAAAAAAAcT0CQgAAAAAAAAAAAAAAAAAAAAAAAAAAcT0CQgAAAAAAAAAAAAAAAAAAAAAAAAAAcT0CQgAAAAAAAAAAAAAAAHE9AkIAAAAAAAAAAAAAgD8AAIA/AACAPwAAgD/2KLw/9ii8PwAAgD8AAIA/9ii8P/YovD8AAIA/AACAPwAAgD8AAIA/9ii8P/YovD8AAIA/AACAPwAAgD8AAIA/9ii8P/YovD8AAIA/AACAP/YovD/2KLw/AACAPwAAgD8AAAAAAAAAAAAAAAAAAAAAAAAAAAAA7EEAAAAAAAAAAAAAAAAAAAAAAAAAAAAA7EEAAAAAAAAAADMzg8BI4bZCSOF6wOxRxELsUQjAKVyMQgAAAAAAAOxBAACAPwAAgD8AAIA/AACAPwAAgD+amVk/AACAPwAAgD8AAIA/AACAPwAAgD+amVk/AACAPwAAgD8AAIA/AACAPwAAgD+amVk/AAAAAAAAAAAAAAAA4fqRQgAAAAAAAAAAAAAAAOH6kUIAAAAAAAAAAAAAAADh+pFCAAAAAAAAAAAAAAAA4fqRQgAAAAAAAAAAAAAAAAAAAAAAAAAA4fqRQgAAAAAAAAAAAAAAAOH6kUKuR0HAuB5/QgrXQ8DD9dVCw/Xov3G93kIAAAAAAAAAAAAAgD8AAIA/w/WoPwAAgD8AAIA/AACAP8P1qD8AAIA/AACAPwAAgD/D9ag/AACAPwAAgD8AAIA/w/WoPwAAgD8AAIA/AACAPwAAgD8AAIA/w/WoPwAAgD8AAIA/AACAP8P1qD8AAIA/AACAPwAAgD8AAIA/AACAP8P1qD8AAIA/AACAPwAAgD8AAAAAAAAAAHu06cOa2QnDAKDFw6RwPcHh2tzDj8LJwfUVG8AAAAAANgwDwAAAAAAAAIA/AACAPwAAgD8AAIA/w/XoP8P16D+amTlAmpk5QAAAAAAAAAAAM7OVQq5HBUEzs5VCrkcFQfboMEOuRwVBAAAAAAAAAACVSKe8AAAAAAAAgD8AAIA/pHAdQK5HgT/D9VhASOE6P2ZmdkA9Ctc+AACAPwAAgD8fhTtAH4U7QKRw/T+kcP0/CtdDQArXQ0B7FO4/exTuPwAAgD8AAIA/H4U7QB+FO0CkcP0/pHD9PwrXQ0AK10NAexTuP3sU7j8AAIA/AACAPx+FO0AfhTtApHD9P6Rw/T8K10NACtdDQHsU7j97FO4/AACAPwAAgD8fhTtAH4U7QKRw/T+kcP0/CtdDQArXQ0B7FO4/exTuPwAAgD8AAIA/AAAAAAAAAADafvk9AAAAAOpB3b0AAAAAcPNuPgAAAABSpza+AAAAAOZwoz4AAAAAwjESPgAAAAAAAAAAAAAAANp++T0AAAAA6kHdvQAAAABw824+AAAAAFKnNr4AAAAA5nCjPgAAAADCMRI+AAAAAHDzbj4AAAAAUqc2vgAAAADmcKM+AAAAAAAAAAAAAAAAAAAAAAAAAABI4bzBexTewAAAAAAAAAAAAACAPwAAgD9cj0I/16NwP8P1iD/2KFw/FK5HP1K4Xj8AAIA/AACAP1yPQj/Xo3A/w/WIP/YoXD8Urkc/UrhePwAAgD8AAIA/XI9CP9ejcD/D9Yg/9ihcPxSuRz9SuF4/AACAPwAAgD9cj0I/16NwP8P1iD/2KFw/FK5HP1K4Xj8AAIA/AACAP1yPQj/Xo3A/w/WIP/YoXD8Urkc/UrhePwAAgD8AAIA/FK5HP1K4Xj8AAIA/AACAPwAAAAAAAAAA/kLiPQAAAAC5AmG+AAAAAHkSdb8AAAAALM8QvwAAAAAAAAAAAAAAAAAAAAAAAAAAcT0sQrgeIUIAAAAAAAAAAAAAgD8AAIA/cT2KP3E9ij8AAIA/AACAP5kNaT0AAAAAwrgyJQAAAABykv89AAAAAJkNaT0AAAAAYcHaPAAAAADCuLKjAAAAALUzcD0AAAAAYcHaPAAAAACuR2E/AACAPwAAAAAAAAAA5d0KvwAAAADl3Qq/AAAAAOknJL8AAAAAUjgGvgAAAAA4sQ8+AAAAAAAAAAAAAAAAFhNYvgAAAAC7ofG9AAAAABjIj74AAAAAFhNYvgAAAAAAAAAAAAAAAA+LnT4AAAAAdVMvPwAAAABHTFg/AAAAAN/euT0AAAAAllbovQAAAAAAAAAAAAAAAPJYnr0AAAAANfoOJQAAAACzhh6+AAAAAPJYnr0AAAAAtTPwuwAAAAByC189AAAAALUz8LsAAAAAwriyPQAAAAAAAAAAAAAAAMK4Mj4AAAAAwriyPQAAAAAAAAAAAAAAANejcMG4HsXA16MKwj0KY8EAAAAAAAAAANejcMG4HsXA16MKwj0KY8EAAAAAAAAAANejcMG4HsXA16MKwj0KY8EAAAAAAAAAANejcMG4HsXA16MKwj0KY8EAAAAAAAAAANejcMG4HsXA16MKwj0KY8EAAAAAAAAAANejcMG4HsXA16MKwj0KY8Gambm/7FE4v9ejcMG4HsXA16MKwj0KY8EAAAAAAAAAAAAAgD8AAIA/7FG4PwAAgD8zM7M/AACAPwAAgD8AAIA/7FG4PwAAgD8zM7M/AACAPwAAgD8AAIA/7FG4PwAAgD8zM7M/AACAPwAAgD8AAIA/7FG4PwAAgD8zM7M/AACAPwAAgD8AAIA/7FG4PwAAgD8zM7M/AACAPwAAgD8AAIA/7FG4PwAAgD8zM7M/AACAPwAAgD8AAIA/7FG4PwAAgD8zM7M/AACAPwAAgD8AAIA/AAAAAAAAAAAaV3U/AAAAAKcfyD8AAAAAUIDQPwAAAAA4NbI/AAAAAIwdqT8AAAAAAAAAAAAAAAAAAIA/AACAPz0Ktz8AAIA/PQq3Px+Fqz+F61E/cT2qP6RwvT8zM3M/AACAPwAAgD89Crc/AACAPz0Ktz8fhas/hetRP3E9qj+kcL0/MzNzPwAAgD8AAIA/PQq3PwAAgD89Crc/H4WrP4XrUT9xPao/pHC9PzMzcz8AAIA/AACAPz0Ktz8AAIA/PQq3Px+Fqz+F61E/cT2qP6RwvT8zM3M/AACAPwAAgD89Crc/AACAPz0Ktz8fhas/hetRP3E9qj+kcL0/MzNzPwAAgD8AAIA/PQq3PwAAgD89Crc/H4WrP4XrUT9xPao/pHC9PzMzcz8AAIA/AACAP0UidL4AAAAAVeXXvQAAAABFInS+AAAAAAAAAAAAAAAAgtq6vgAAAAByJwK/AAAAALU3I78AAAAAHJeAPgAAAADnfJs+AAAAAAAAAAAAAAAAwriyPQAAAAAAAAAAAAAAAMK4Mj4AAAAAwriyPQAAAADM6/U8AAAAAMK4siMAAAAAgJ5iPQAAAADM6/U8AAAAAAAAAAAAAAAA+n2gvgAAAAD6faC+AAAAAEdG3L4AAAAAL/u9vgAAAABuRh2+AAAAAAAAAAAAAAAAjarFvQAAAAA1+o4jAAAAANn3WL4AAAAAjarFvQAAAAAAAAAAAAAAAIuElD4AAAAAoB4uPwAAAAAn5Hw/AAAAACj6oz4AAAAAO2iQvQAAAAAAAAAAAAAAAAAAgD8AAIA/H4U7QB+FO0CkcP0/pHD9PwrXQ0AK10NAexTuP3sU7j8AAIA/AACAPx+FO0AfhTtApHD9P6Rw/T8K10NACtdDQHsU7j97FO4/AACAPwAAgD8fhTtAH4U7QKRw/T+kcP0/CtdDQArXQ0B7FO4/exTuPwAAgD8AAIA/H4U7QB+FO0CkcP0/pHD9PwrXQ0AK10NAexTuP3sU7j8AAIA/AACAPwAAAAAAAAAAxvZTPgAAAAAAAAAAAAAAAAAAgD8AAIA/mpkZPwAAgD9I4Zo/AACAP5qZmT+kcD0/9ii8Pz0Klz8AAIA/AACAP5qZGT8AAIA/SOGaPwAAgD+amZk/pHA9P/YovD89Cpc/AACAPwAAgD+amRk/AACAP0jhmj8AAIA/mpmZP6RwPT/2KLw/PQqXPwAAgD8AAIA/mpkZPwAAgD9I4Zo/AACAP5qZmT+kcD0/9ii8Pz0Klz8AAIA/AACAP5qZGT8AAIA/SOGaPwAAgD+amZk/pHA9P/YovD89Cpc/AACAPwAAgD+amRk/AACAP0jhmj8AAIA/mpmZP6RwPT/2KLw/PQqXPwAAgD8AAIA/t9wvvQAAAAB82SAlAAAAADg4sL0AAAAAt9wvvQAAAADXx3g8AAAAAIjD5DwAAAAAwriypAAAAADXx3g8AAAAAAAAgD8AAIA/XI9CP9ejcD/D9Yg/9ihcPxSuRz9SuF4/AACAPwAAgD9cj0I/16NwP8P1iD/2KFw/FK5HP1K4Xj8AAIA/AACAP1yPQj/Xo3A/w/WIP/YoXD8Urkc/UrhePwAAgD8AAIA/XI9CP9ejcD/D9Yg/9ihcPxSuRz9SuF4/AACAPwAAgD9cj0I/16NwP8P1iD/2KFw/FK5HP1K4Xj8AAIA/AACAPxSuRz9SuF4/AACAPwAAgD8AAAAAAAAAAOkd9b4AAAAAmqowvwAAAADiIle/AAAAAEhqRL4AAAAAlUgnPgAAAAAAAAAAAAAAAMXokr0AAAAAkgqGJQAAAAC+YiG+AAAAAMXokr0AAAAAAAAAAAAAAADPrCU+AAAAAAISUz4AAAAAxvbTPgAAAADuia0+AAAAAEoJVT4AAAAAAAAAAAAAAAAAAAAAAAAAAClcv8BSuKhBAAAAAAAAAAAAAAAAAAAAAAbhwzwAAAAAAAAAAAAAAAAAAAAAAAAAAIXrQUHheuxAAAAAAOxRkkHNzExA4Xr0QAAAAAAAAAAAAAAAAAAAAAA4ODC+AAAAADg4ML4AAAAATLIUvgAAAAAAAAAAAAAAAJ70yT4AAAAAn4UZvgAAAABqAoA/AAAAAJ70yT4AAAAAAAAAAAAAAACuRy1BH4UHQa5HkcDXo7BB16OQP4XrFUEAAAAAAAAAAAAAAAAAAAAAODgwvgAAAAA4ODC+AAAAAEyyFL4AAAAAAAAAAAAAAACPwiHBAAAAAKRwccEAAAAAj8IhwQAAAAAAAIA/AACAPwAAgD/D9ag/AACAPwAAgD++WHI9AAAAAGOCiiUAAAAAP7TyPQAAAAC+WHI9AAAAAAAAAAAAAAAAhetBQeF67EAAAAAA7FGSQc3MTEDhevRAAAAAAAAAAAAAAAAAAAAAADTY770AAAAAp6BsvQAAAABMshS+AAAAAAAAAAAAAAAAeSKgPQAAAABQd1YlAAAAADaBLz4AAAAAeSKgPQAAAAAAAAAAAAAAABlReT4AAAAAURbnPgAAAADcMzE/AAAAAC7jTbwAAAAATL6MvgAAAAAAAAAAAAAAAB+Faz9mZma/AAAAAAAAAAAfhes/FK7nvx+Faz9mZma/V44XvQAAAADCuLIkAAAAANjpl70AAAAAV44XvQAAAADCuLI9AAAAAAAAAAAAAAAAwrgyPgAAAADCuLI9AAAAAAAAAAAAAAAAm7YovwAAAABRjMi/AAAAAFTN578AAAAAnwm8vwAAAAAdGm6/AAAAADX6jiUAAAAAAAAAAAAAAABWdic+AAAAAAAAAAAAAAAAAAAAAAAAAADjNEu+AAAAAFeOlzwAAAAAIxPDPgAAAAB8YEE/AAAAANdMUD8AAAAAAAAAAAAAAAAAAAAAAAAAADtokD4AAAAAa4+cPQAAAADQxBW/AAAAAAIQir8AAAAAp6BsvwAAAAAAAAAAAAAAAHkioD0AAAAAUHdWJQAAAAA2gS8+AAAAAHkioD0AAAAAAAAAAAAAAADhlbq+AAAAAAZaoz0AAAAA3TV6PwAAAADHkJ0/AAAAAOigAz8AAAAAAAAAAAAAAAAAAAAAAAAAADJDDr4AAAAAAAAAAAAAAAAAAIA/AACAP1K4vj8AAIA/H4VrP4/CtT+kcL0/H4VrPwrXgz+F65E/AACAPwAAgD9SuL4/AACAPx+Faz+PwrU/pHC9Px+Faz8K14M/heuRPwAAgD8AAIA/Uri+PwAAgD8fhWs/j8K1P6RwvT8fhWs/CteDP4XrkT8AAIA/AACAP1K4vj8AAIA/H4VrP4/CtT+kcL0/H4VrPwrXgz+F65E/AACAPwAAgD9SuL4/AACAPx+Faz+PwrU/pHC9Px+Faz8K14M/heuRPwAAgD8AAIA/Uri+PwAAgD8fhWs/j8K1P6RwvT8fhWs/CteDP4XrkT8AAIA/AACAPwAAAAAAAAAAAAAAAAAAAAAAAAAAexQmQQAAgD8AAIA/AACAPwAAgD/2KJw/9iicPwAAAAAAAAAAAAAAAAAAAAAAAAAAcT0CQgAAAAAAAAAAAAAAAHE9AkIAAIA/AACAPwAAgD8AAIA/9ii8P/YovD8AAIA/AACAP/YovD/2KLw/AAAAAAAAAAAAAAAAAAAAAAAAAAAAAOxBAAAAAAAAAAAAAAAAAADsQQAAgD8AAIA/AACAPwAAgD8AAIA/mplZPwAAgD8AAIA/AACAP5qZWT8AAAAAAAAAAAAAAADh+pFCAAAAAAAAAAAAAAAA4fqRQgAAAAAAAAAAAAAAAOH6kUIAAIA/AACAP8P1qD8AAIA/AACAPwAAgD/D9ag/AACAPwAAgD8AAIA/w/WoPwAAgD9cj5NC7FHeQXsUnUIzMwZC7NGFQlyPD0LsUZ1CpHADQq7HlELXo/BBHwWaQoXrMUIAgJBCPQrhQbgem0LD9eRBSOGCQgrX2UGkcI1CZmb8QQCAhkIpXAZCrkeRQlyPFkJ7FJ1CMzMGQuzRhUJcjw9C7FGdQqRwA0Kux5RC16PwQR8FmkKF6zFCAICQQj0K4UG4HptCw/XkQUjhgkIK19lBpHCNQmZm/EEAgIZCKVwGQq5HkUJcjxZCexSdQjMzBkLs0YVCXI8PQuxRnUKkcANCrseUQtej8EEfBZpChesxQgCAkEI9CuFBuB6bQsP15EFI4YJCCtfZQaRwjUJmZvxBAICGQilcBkKuR5FCXI8WQlyPk0LsUd5BzczzQmZmWUJmZuhBuB4XQgAAAAAAAAAAexTuP3sU7j97FO4/exTuP+xRuD/sUbg/AACAPwAAgD8fhZHBAADwQa5HOcFSuJhBAAAAAAAAAAA02O89AAAAANugmD0AAAAAfNkgpQAAAAAp3JtCXI/OQSncm0Jcj85BKVylQtej/EG4Ho5CFK4HQrgejkIUrgdCmpmlQrge90F7FJ1CSOHgQexRokIAACpC7FGiQgAAKkKux5hCrkfRQa7HmEKuR9FBhWujQjMz1UEULotCAADKQXG9lULXo+xBrseOQsP1/EF7lJlCFK4OQnuUmUIUrg5CKVylQtej/EEpXKVC16P8QbgejkIUrgdCmpmlQrge90F7FJ1CSOHgQXsUnUJI4eBB7FGiQgAAKkLsUaJCAAAqQq7HmEKuR9FBhWujQjMz1UEULotCAADKQXG9lULXo+xBrseOQsP1/EGux45Cw/X8QXuUmUIUrg5CKVylQtej/EG4Ho5CFK4HQrgejkIUrgdCmpmlQrge90F7FJ1CSOHgQexRokIAACpC7FGiQgAAKkKux5hCrkfRQa7HmEKuR9FBhWujQjMz1UEULotCAADKQXG9lULXo+xBcb2VQtej7EGux45Cw/X8Qa7HjkLD9fxBe5SZQhSuDkIp3JtCXI/OQQrXKENSOIlCuB5xQnsUNkIAAAAAAAAAAC+MDb4AAAAAL4wNvgAAAADdNXqlAAAAABSuRz9SuF4/XI9CP9ejcD/D9Yg/9ihcP8P1iD/2KFw/FK5HP1K4Xj8Urkc/UrhePwAAgD8AAIA/AACAPwAAgD9cj0I/16NwP1yPQj/Xo3A/w/WIP/YoXD/D9Yg/9ihcPxSuRz9SuF4/FK5HP1K4Xj8AAIA/AACAPwAAgD8AAIA/XI9CP9ejcD9cj0I/16NwP8P1iD/2KFw/w/WIP/YoXD8Urkc/UrhePxSuRz9SuF4/XI9CP9ejcD9cj0I/16NwP8P1iD/2KFw/w/WIP/YoXD8Urkc/UrhePxSuRz9SuF4/AACAPwAAgD8AAIA/AACAP1yPQj/Xo3A/XI9CP9ejcD/D9Yg/9ihcP8P1iD/2KFw/FK5HP1K4Xj8Urkc/UrhePwAAgD8AAIA/AACAPwAAgD9cj0I/16NwP1yPQj/Xo3A/w/WIP/YoXD/D9Yg/9ihcPxSuRz9SuF4/FK5HP1K4Xj/D9Yg/9ihcP8P1iD/2KFw/XI9CP9ejcD9cj0I/16NwPxSuRz9SuF4/FK5HP1K4Xj9mZuY/exRuPwAAgD8AAIA/AAAAAAAAAAD+QuI9AAAAALkCYb4AAAAAeRJ1vwAAAAAszxC/AAAAAAAAAAAAAAAA/a0APQAAAAD+QuI9AAAAALkCYb4AAAAAeRJ1vwAAAAAszxC/AAAAAAAAAAAAAAAAe1RvQxSuY0IAgH9DCtd8QgAAAAAAAAAAgT1zvgAAAAC7oXG+AAAAADX6jqUAAAAAmQ1pPQAAAABhwdo8AAAAAAAAAAAAAAAA5d0KvwAAAADl3Qq/AAAAAOknJL8AAAAAUjgGvgAAAAA4sQ8+AAAAAAAAAAAAAAAA/a0AvQAAAADl3Qq/AAAAAOXdCr8AAAAA6SckvwAAAABSOAa+AAAAADixDz4AAAAAAAAAAAAAAADXoxTBheuRP9ejFMGF65E/7FHYwOF6lL/sUdjA4XqUv8P14MAK16M+w/XgwArXoz7XowzBpHC9vq5H+cDXo7C/16MUwYXrkT+uR8lAPQrnQAAAAAAAAAAA68j9PQAAAACP2qU9AAAAALBWPj4AAAAAtlWPPgAAAADt+N0+AAAAAHzlmD4AAAAA4Q6aPgAAAACTGMc+AAAAALZVjz4AAAAAQu6BPgAAAAB5GHE+AAAAAM4bVj4AAAAAsFY+PgAAAAC8uWE+AAAAAFXjjj4AAAAA4H1KPgAAAACP2qU9AAAAAFeOFz4AAAAADwZGPgAAAABAzGI+AAAAAOvI/T0AAAAAPy3SPQAAAADhBGs+AAAAAMrFRD4AAAAAmiVZPgAAAAAkHzs+AAAAAOvI/T0AAAAAe1KAvQAAAABEm9O9AAAAAAAAAAAAAAAAD4udPgAAAAB1Uy8/AAAAAEdMWD8AAAAA3965PQAAAACWVui9AAAAAAAAAAAAAAAA/a0APQAAAAAPi50+AAAAAHVTLz8AAAAAR0xYPwAAAADf3rk9AAAAAJZW6L0AAAAAAAAAAAAAAACZCyA/AAAAAAS7Ej8AAAAANocrPwAAAADvoR0/AAAAAOGVOj8AAAAAmQsgPwAAAAAEuxI/AAAAADaHKz8AAAAA76EdPwAAAADhlTo/AAAAAJkLID8AAAAABLsSPwAAAAA2hys/AAAAAO+hHT8AAAAA4ZU6PwAAAACZCyA/AAAAAAS7Ej8AAAAANocrPwAAAADvoR0/AAAAAOGVOj8AAAAAmQsgPwAAAAAEuxI/AAAAADaHKz8AAAAA76EdPwAAAADhlTo/AAAAANA/Pj8AAAAAmQsgPwAAAADQuua+AAAAAPJYnr0AAAAAwriyPQAAAAD2HWC+AAAAALkMED4AAAAAiVowPwAAAADQxt4+AAAAAMK4sj0AAAAA9h1gvgAAAAC5DBA+AAAAAIlaMD8AAAAA0MbePgAAAADCuLI9AAAAAAAAAAAAAAAAGld1PwAAAACnH8g/AAAAAFCA0D8AAAAAODWyPwAAAACMHak/AAAAAAAAAAAAAAAA/a0APQAAAAAaV3U/AAAAAKcfyD8AAAAAUIDQPwAAAAA4NbI/AAAAAIwdqT8AAAAAAAAAAAAAAADzcA4+AAAAAPNwDj4AAAAANfqOIwAAAAAAAIA/AACAPz0Ktz8AAIA/PQq3Px+Fqz+F61E/cT2qP6RwvT8zM3M/AACAPwAAgD89Crc/AACAPz0Ktz8fhas/hetRP3E9qj+kcL0/MzNzPwAAgD8AAIA/PQq3PwAAgD89Crc/H4WrP4XrUT9xPao/pHC9PzMzcz8AAIA/AACAPz0Ktz8AAIA/PQq3Px+Fqz+F61E/cT2qP6RwvT8zM3M/AACAPwAAgD89Crc/AACAPz0Ktz8fhas/hetRP3E9qj+kcL0/MzNzPwAAgD8AAIA/PQq3PwAAgD89Crc/H4WrP4XrUT9xPao/pHC9PzMzcz8AAIA/AACAPz0Ktz8fhas/hetRP3E9qj+kcL0/MzNzPwAAgD8AAIA/PQq3PwAAgD89Crc/H4WrP4XrUT9xPao/PQq3PwAAgD89Crc/H4WrPwAAgD8AAIA/AAAAAAAAAAC6GtE9AAAAAAAAAAAAAAAAAAAAAAAAAACC2rq+AAAAAHInAr8AAAAAtTcjvwAAAAAcl4A+AAAAAOd8mz4AAAAAAAAAAAAAAAD9rQC9AAAAAILaur4AAAAAcicCvwAAAAC1NyO/AAAAAByXgD4AAAAA53ybPgAAAAAAAAAAAAAAAMK4sj0AAAAAHjhavgAAAABYnFi9AAAAAHZrHz8AAAAAt2cDPwAAAADCuLI9AAAAAB44Wr4AAAAAWJxYvQAAAAB2ax8/AAAAALdnAz8AAAAAwriyPQAAAADM6/U8AAAAAAAAAAAAAAAA+n2gvgAAAAD6faC+AAAAAEdG3L4AAAAAL/u9vgAAAABuRh2+AAAAAAAAAAAAAAAA/a0AvQAAAAD6faC+AAAAAPp9oL4AAAAAR0bcvgAAAAAv+72+AAAAAG5GHb4AAAAAAAAAAAAAAACNqsW9AAAAALuhcT4AAAAA2fdYvgAAAAAzUU+9AAAAANp++T0AAAAAjarFvQAAAAAAAAAAAAAAAIuElD4AAAAAoB4uPwAAAAAn5Hw/AAAAACj6oz4AAAAAO2iQvQAAAAAAAAAAAAAAAP2tAD0AAAAAi4SUPgAAAACgHi4/AAAAACfkfD8AAAAAKPqjPgAAAAA7aJC9AAAAAAAAAAAAAAAA4XpIQYXrQcDhekhBhetBwArXl0HsUTg/cT0OQWZm3kBI4ZZBj8L1PEjhlkGPwvU8cT1eQR+Fi79xPV5BH4WLv83MqkEK1zdBMzMzQR+FC8AzMzNBH4ULwEjhgkEK12PASOGCQQrXY8DsUZBAw/UovylcL0FmZsY/XI8GQaRwlUBcjwZBpHCVQHsUbkEzM9NAexRuQTMz00AK15dB7FE4PwrXl0HsUTg/cT0OQWZm3kBI4ZZBj8L1PHE9XkEfhYu/zcyqQQrXN0EzMzNBH4ULwDMzM0EfhQvASOGCQQrXY8DsUZBAw/UovylcL0FmZsY/KVwvQWZmxj9cjwZBpHCVQHsUbkEzM9NACteXQexROD9xPQ5BZmbeQEjhlkGPwvU8cT1eQR+Fi79xPV5BH4WLv83MqkEK1zdBzcyqQQrXN0EzMzNBH4ULwDMzM0EfhQvASOGCQQrXY8DsUZBAw/UovylcL0FmZsY/KVwvQWZmxj9cjwZBpHCVQFyPBkGkcJVAexRuQTMz00DhekhBhetBwDOznkJmZv5Aj8KxwSlcZ0EAAAAAAAAAAM4lBb8AAAAAziUFvwAAAABbU9m+AAAAAFB3ViUAAAAAAACAPwAAgD8AAIA/AACAPx+FO0AfhTtAH4U7QB+FO0CkcP0/pHD9P6Rw/T+kcP0/CtdDQArXQ0AK10NACtdDQHsU7j97FO4/exTuP3sU7j8AAIA/AACAPwAAgD8AAIA/H4U7QB+FO0AfhTtAH4U7QKRw/T+kcP0/pHD9P6Rw/T8K10NACtdDQArXQ0AK10NAexTuP3sU7j97FO4/exTuPwAAgD8AAIA/AACAPwAAgD8fhTtAH4U7QB+FO0AfhTtApHD9P6Rw/T+kcP0/pHD9PwrXQ0AK10NACtdDQArXQ0B7FO4/exTuPwAAgD8AAIA/H4U7QB+FO0AfhTtAH4U7QKRw/T+kcP0/pHD9P6Rw/T8K10NACtdDQArXQ0AK10NAexTuP3sU7j97FO4/exTuPwAAgD8AAIA/AACAPwAAgD97FO4/exTuP3sU7j97FO4/CtdDQArXQ0AK10NACtdDQAAAgD8AAIA/AAAAAAAAAADG9lM+AAAAAAAAAAAAAAAAxvZTPgAAAAAAAAAAAAAAAPNwDj4AAAAA83AOPgAAAAA1+o4jAAAAAAAAgD8AAIA/mpkZPwAAgD9I4Zo/AACAP5qZmT+kcD0/9ii8Pz0Klz8AAIA/AACAP5qZGT8AAIA/SOGaPwAAgD+amZk/pHA9P/YovD89Cpc/AACAPwAAgD+amRk/AACAP0jhmj8AAIA/mpmZP6RwPT/2KLw/PQqXPwAAgD8AAIA/mpkZPwAAgD9I4Zo/AACAP5qZmT+kcD0/9ii8Pz0Klz8AAIA/AACAP5qZGT8AAIA/SOGaPwAAgD+amZk/pHA9P/YovD89Cpc/AACAPwAAgD+amRk/AACAP0jhmj8AAIA/mpmZP6RwPT/2KLw/PQqXPwAAgD8AAIA/SOGaPwAAgD+amZk/pHA9P/YovD89Cpc/AACAPwAAgD+amRk/AACAP0jhmj8AAIA/mpmZP6RwPT+amRk/AACAP0jhmj8AAIA/AACAPwAAgD+33C+9AAAAANfHeDwAAAAA5Ey7vAAAAADXx3g8AAAAAHsUtEHhehzBexS0QeF6HMGPwudBw/XAwI/C50HD9cDAPQqXQVyPQj49CpdBXI9CPlK45kE9CtfAw/W+QUjh+sDXo/pBFK6XQNej+kEUrpdAH4WpQUjhDsFSuNJBuB4lwQrXZ0GkcO3AH4WnQWZmpsC4HpNBuB4FwEjhxkGamRm+SOHGQZqZGb6PwudBw/XAwI/C50HD9cDAPQqXQVyPQj5SuOZBPQrXwMP1vkFI4frAw/W+QUjh+sDXo/pBFK6XQB+FqUFI4Q7BUrjSQbgeJcEK12dBpHDtwB+Fp0FmZqbAuB6TQbgeBcC4HpNBuB4FwEjhxkGamRm+j8LnQcP1wMCPwudBw/XAwD0Kl0Fcj0I+PQqXQVyPQj5SuOZBPQrXwMP1vkFI4frA16P6QRSul0DXo/pBFK6XQB+FqUFI4Q7BH4WpQUjhDsFSuNJBuB4lwQrXZ0GkcO3AH4WnQWZmpsAfhadBZmamwLgek0G4HgXAuB6TQbgeBcBI4cZBmpkZvnsUtEHhehzBXI+rQj0KZ0CuR4nB16MwQQAAAAAAAAAAW1cMvwAAAABbVwy/AAAAAFiQ4L4AAAAANfqOpAAAAAAAAIA/AACAPwAAgD8AAIA/XI9CP9ejcD9cj0I/16NwP8P1iD/2KFw/w/WIP/YoXD8Urkc/UrhePxSuRz9SuF4/AACAPwAAgD8AAIA/AACAP1yPQj/Xo3A/w/WIP/YoXD/D9Yg/9ihcPxSuRz9SuF4/FK5HP1K4Xj8AAIA/AACAPwAAgD8AAIA/FK5HP1K4Xj8Urkc/UrhePwAAgD8AAIA/AACAPwAAgD9cj0I/16NwP8P1iD/2KFw/w/WIP/YoXD8Urkc/UrhePxSuRz9SuF4/AACAPwAAgD8AAIA/AACAP1yPQj/Xo3A/XI9CP9ejcD/D9Yg/9ihcP8P1iD/2KFw/FK5HP1K4Xj8Urkc/UrhePwAAgD8AAIA/AACAPwAAgD8Urkc/UrhePxSuRz9SuF4/AACAPwAAgD8AAIA/AACAPxSuRz9SuF4/FK5HP1K4Xj8AAIA/AACAPwAAAAAAAAAA6R31vgAAAACaqjC/AAAAAOIiV78AAAAASGpEvgAAAACVSCc+AAAAAAAAAAAAAAAA/a0AvQAAAADpHfW+AAAAAJqqML8AAAAA4iJXvwAAAABIakS+AAAAAJVIJz4AAAAAAAAAAAAAAADF6JK9AAAAAMABsj0AAAAA9H5PvgAAAADF6JK9AAAAADX6jiUAAAAAglVjvQAAAADF6JK9AAAAAAAAAAAAAAAAz6wlPgAAAAACElM+AAAAAMb20z4AAAAA7omtPgAAAABKCVU+AAAAAAAAAAAAAAAA/a0APQAAAADPrCU+AAAAAAISUz4AAAAAxvbTPgAAAADuia0+AAAAAEoJVT4AAAAAAAAAAAAAAABI4TbCCtfDP+xRHMK4Hm1B7FFpwoXrsUAAAETCPQqBweF6bcLNzMy9MzMxwq5H4T0UrknChethwQAAAAAAAAAAlmAXvgAAAACWYBe+AAAAADX6DqQAAAAA9iikwVyPikB7FF7Bw/WMQR+FBMKPwgVBZma+wa5HVcEUrgjC9igsQM3MmMFxPTpAj8LJwbgeNcEAAAAAAAAAAPR+T74AAAAA9H5PvgAAAAA1+o4lAAAAAJ70yT4AAAAArkeVwRSug0H2KEDBAADuQXsU+sGF66NBH4WvwZqZmb9xPQHCrkdtQYXricHXo3BBSOG6wc3MTD8AAAAAAAAAAPR+T74AAAAA9H5PvgAAAAA1+o4lAAAAAAAAAAAAAAAAzcxAQQrXI79I4TbB9igcP0jhNsH2KBw/AAAAAAAAAAA9CgtBAAAAAD0KC0EAAAAAAAAAAAAAAAC+WHI9AAAAAPYopMFcj4pAexRewcP1jEEfhQTCj8IFQWZmvsGuR1XBFK4IwvYoLEDNzJjBcT06QI/CycG4HjXBAAAAAAAAAAD0fk++AAAAAIe1I74AAAAAm8KgvgAAAACPUwW+AAAAAI9TBb4AAAAAPPuovgAAAAD0fk++AAAAADX6jiUAAAAAeSKgPQAAAABQd1YlAAAAADaBLz4AAAAAeSKgPQAAAABQd1YlAAAAADaBLz4AAAAAeSKgPQAAAAAAAAAAAAAAABlReT4AAAAAURbnPgAAAADcMzE/AAAAAC7jTbwAAAAATL6MvgAAAAAAAAAAAAAAAP2tAD0AAAAAGVF5PgAAAABRFuc+AAAAANwzMT8AAAAALuNNvAAAAABMvoy+AAAAAAAAAAAAAAAAH4VrP2ZmZr9Xjhe9AAAAAMK4sj0AAAAAYDo6PgAAAAAn5Hw+AAAAAKnQTL4AAAAAFh0HvwAAAADCuLI9AAAAAGA6Oj4AAAAAJ+R8PgAAAACp0Ey+AAAAABYdB78AAAAAwriyPQAAAAAAAAAAAAAAAJu2KL8AAAAAUYzIvwAAAABUzee/AAAAAJ8JvL8AAAAAHRpuvwAAAAA1+o4lAAAAAP2tAL0AAAAAm7YovwAAAABRjMi/AAAAAFTN578AAAAAnwm8vwAAAAAdGm6/AAAAADX6jiUAAAAAAAAAAAAAAADXo+BA4XoUQAAAAAAAAAAAvm6ZvgAAAAAT1ba+AAAAAL5umb4AAAAANfqOJQAAAAAAAAAAAAAAAOM0S74AAAAAV46XPAAAAAAjE8M+AAAAAHxgQT8AAAAA10xQPwAAAAAAAAAAAAAAAP2tAL0AAAAA4zRLvgAAAABXjpc8AAAAACMTwz4AAAAAfGBBPwAAAADXTFA/AAAAAAAAAAAAAAAAAAAAAAAAAAA7aJA+AAAAAGuPnD0AAAAA0MQVvwAAAAACEIq/AAAAAKegbL8AAAAAAAAAAAAAAAD9rQA9AAAAADtokD4AAAAAa4+cPQAAAADQxBW/AAAAAAIQir8AAAAAp6BsvwAAAAAAAAAAAAAAAHkioD0AAAAAUHdWJQAAAAA2gS8+AAAAAHkioD0AAAAAUHdWJQAAAAA2gS8+AAAAAHkioD0AAAAAAAAAAAAAAADhlbq+AAAAAAZaoz0AAAAA3TV6PwAAAADHkJ0/AAAAAOigAz8AAAAAAAAAAAAAAAD9rQC9AAAAAOGVur4AAAAABlqjPQAAAADdNXo/AAAAAMeQnT8AAAAA6KADPwAAAAAAAAAAAAAAAAAAAAAAAAAA76GdvgAAAACFDGS+AAAAADJDDr4AAAAAAAAAAAAAAADzcA4+AAAAAPNwDj4AAAAANfqOIwAAAAAAAIA/AACAP1K4vj8AAIA/H4VrP4/CtT+kcL0/H4VrPwrXgz+F65E/AACAPwAAgD9SuL4/AACAPx+Faz+PwrU/pHC9Px+Faz8K14M/heuRPwAAgD8AAIA/Uri+PwAAgD8fhWs/j8K1P6RwvT8fhWs/CteDP4XrkT8AAIA/AACAP1K4vj8AAIA/H4VrP4/CtT+kcL0/H4VrPwrXgz+F65E/AACAPwAAgD9SuL4/AACAPx+Faz+PwrU/pHC9Px+Faz8K14M/heuRPwAAgD8AAIA/Uri+PwAAgD8fhWs/j8K1P6RwvT8fhWs/CteDP4XrkT8AAIA/AACAPx+Faz+PwrU/pHC9Px+Faz8K14M/heuRPwAAgD8AAIA/Uri+PwAAgD8fhWs/j8K1P6RwvT8fhWs/Uri+PwAAgD8fhWs/j8K1PwAAgD8AAIA/AAAAAAAAAABxPaNChetTQlzPMUMUrhxCzcwMP83MDD8fhRdBAAAAAAAA+EAAAAAAAAD4QArXh0EAAAAAAAAAAAAAAAAAAAAA2eVkPwAAAAB7FO4/exTuP/YoHD/2KBw/rkcBQK5HAUBS+CZDKVzlQSlcD0ApXA9Aj4Jmw3sUA8LXo5A/16OQP83MrD/NzKw/MzOTPzMzkz/Xo5A/16OQP9ejkD/Xo5A/zcysP83MrD8zM5M/MzOTP9ejkD/Xo5A/16OQP9ejkD/NzKw/zcysPzMzkz8zM5M/16OQP9ejkD/Xo5A/16OQP83MrD/NzKw/MzOTPzMzkz/Xo5A/16OQP9ejkD/Xo5A/zcysP83MrD8zM5M/MzOTP9ejkD/Xo5A/16OQP9ejkD/NzKw/zcysPzMzkz8zM5M/16OQP9ejkD/Xo5A/16OQP83MrD/NzKw/MzOTPzMzkz/Xo5A/16OQP9ejkD/Xo5A/zcysP83MrD8zM5M/MzOTP9ejkD/Xo5A/16OQP9ejkD/NzKw/zcysPzMzkz8zM5M/16OQP9ejkD/Xo5A/16OQP83MrD/NzKw/MzOTPzMzkz/Xo5A/16OQP9ejkD/Xo5A/zcysP83MrD8zM5M/MzOTP9ejkD/Xo5A/16OQP9ejkD/NzKw/zcysPzMzkz8zM5M/16OQP9ejkD/Xo5A/16OQP83MrD/NzKw/MzOTPzMzkz/Xo5A/16OQPwAAgD8AAIA/AACAPwAAgD+F67E/heuxPwAAgD8AAIA/16OQP9ejkD8AAIA/AACAPwAAgD8AAIA/heuxP4XrsT8AAIA/AACAPwAAAAAAAAAAAAAAAAAAAAAAAAAAexQmQQAAAAAAAAAAAAAAAHsUJkEAAIA/AACAPwAAgD8AAIA/9iicP/YonD8AAIA/AACAP/YonD/2KJw/AAAAAAAAAAAAAAAAAAAAAAAAAABxPQJCAAAAAAAAAAAAAAAAcT0CQgAAAAAAAAAAAAAAAHE9AkIAAIA/AACAPwAAgD8AAIA/9ii8P/YovD8AAIA/AACAP/YovD/2KLw/AACAPwAAgD/2KLw/9ii8P9ejkD/Xo5C/ZmZmP2ZmZj8K18M/CtfDP4/CBUCPwgVA16OQP9ejkD8AAIA/AACAPwAAgD8AAIA/heuxP4XrsT8AAIA/AACAP9ejkD/Xo5A/AACAPwAAgD8AAIA/AACAP4XrsT+F67E/AACAPwAAgD8AAIA/AACAPwAAgD8AAIA/pHCdP6RwnT8AAIA/AACAPwAAgD8AAIA/pHCdP6RwnT8AAIA/AACAPwAAgD8AAIA/pHCdP6RwnT8AAIA/AACAPwAAgD8AAIA/pHCdP6RwnT8AAIA/AACAPwAAgD8AAIA/pHCdP6RwnT8AAIA/AACAPwAAgD8AAIA/pHCdP6RwnT8AAIA/AACAPwAAgD8AAIA/pHCdP6RwnT8AAIA/AACAPwAAgD8AAIA/pHCdP6RwnT8AAIA/AACAPwAAgD8AAIA/pHCdP6RwnT8AAIA/AACAPwAAgD8AAIA/pHCdP6RwnT8AAIA/AACAPwAAgD8AAIA/pHCdP6RwnT8AAIA/AACAPwAAAAAAAAAAAAAAAAAAAAAAAAAAAADsQQAAAAAAAAAAAAAAAAAA7EEAAAAAAAAAAAAAAAAAAOxBAACAPwAAgD8AAIA/AACAPwAAgD+amVk/AACAPwAAgD8AAIA/mplZPwAAgD8AAIA/AACAP5qZWT8AAAAAAAAAAAAAAADh+pFCAAAAAAAAAAAAAAAA4fqRQgAAAAAAAAAAAAAAAOH6kUIAAAAAAAAAAAAAAADh+pFCAACAPwAAgD/D9ag/AACAPwAAgD8AAIA/w/WoPwAAgD8AAIA/AACAP8P1qD8AAIA/AACAPwAAgD/D9ag/AACAPwAAREEAAERBAABEQQAAREEAAIA/AACAPwrX479mZiRCMzP7wB+FH0KBPXO/AAAAABTzIr8AAAAAMzNTQDMzU0AUruc/FK7nP8P1GEDD9RhAPQo3QT0KZ8A9CjdBPQpnwAAAAAAAAAAA16NQwPYoLEDXo1DA9igsQAAAAAAAAAAAZmZ2QClcX8BmZnZAKVxfwAAAAAAAAAAA3TV6vQAAAADdNXq9AAAAAAAAAAAAAAAApHB9P65HgUCkcH0/rkeBQAAAAAAAAAAA1rk3PQAAAADWuTc9AAAAAJIKBiUAAAAAUrheQFK4XkD2aBbDhesxwQAAJcMKV9TC9mgWw4XrMcEAACXDClfUwvZoFsOF6zHBAAAlwwpX1ML2aBbDhesxwQAAJcMKV9TC9mgWw4XrMcEAACXDClfUwvZoFsOF6zHBAAAlwwpX1ML2aBbDhesxwQAAJcMKV9TC9mgWw4XrMcEAACXDClfUwvZoFsOF6zHBAAAlwwpX1ML2aBbDhesxwQAAJcMKV9TC9mgWw4XrMcEAACXDClfUwvZoFsOF6zHBAAAlwwpX1ML2aBbDhesxwQAAJcMKV9TC9mgWw4XrMcEAACXDClfUwvZoFsOF6zHBAAAlwwpX1ML2aBbDhesxwQAAJcMKV9TC9mgWw4XrMcEAACXDClfUwvZoFsOF6zHBPHbRPQAAAABYHjLAAAAAADx20T0AAAAAWB4ywAAAAAA8dtE9AAAAAFgeMsAAAAAAPHbRPQAAAABYHjLAAAAAADx20T0AAAAAWB4ywAAAAAA8dtE9AAAAAFgeMsAAAAAAPHbRPQAAAABYHjLAAAAAADx20T0AAAAAWB4ywAAAAAA8dtE9AAAAAFgeMsAAAAAAPHbRPQAAAABYHjLAAAAAADx20T0AAAAAWB4ywAAAAAA8dtE9AAAAAFgeMsAAAAAAPHbRPQAAAABYHjLAAAAAADx20T0AAAAAWB4ywAAAAAA8dtE9AAAAAFgeMsAAAAAAPHbRPQAAAABYHjLAAAAAADx20T0AAAAAWB4ywAAAAAA8dtE9AAAAADMzE0AzMxNACtcjQArXI0AzMxNAMzMTQArXI0AK1yNAMzMTQDMzE0AK1yNACtcjQDMzE0AzMxNACtcjQArXI0AzMxNAMzMTQArXI0AK1yNAMzMTQDMzE0AK1yNACtcjQDMzE0AzMxNACtcjQArXI0AzMxNAMzMTQArXI0AK1yNAMzMTQDMzE0AK1yNACtcjQDMzE0AzMxNACtcjQArXI0AzMxNAMzMTQArXI0AK1yNAMzMTQDMzE0AK1yNACtcjQDMzE0AzMxNACtcjQArXI0AzMxNAMzMTQArXI0AK1yNAMzMTQDMzE0AK1yNACtcjQDMzE0AzMxNACtcjQArXI0AzMxNAMzMTQArXI0AK1yNAMzMTQDMzE0BS+A7Dj0IbQwAACcNxvR9DAMATw4/CJEPNDAnDPQofQwrXDcOaWR1D9ugHw1K4KkPXYxDDM/MbQ5oZC8MULhtDwzUXwxSuHENcDxHD16MfQ8P1E8OkcCJDH8UNwykcJUMAAAnDcb0fQwDAE8OPwiRDzQwJwz0KH0MK1w3DmlkdQ/boB8NSuCpD12MQwzPzG0OaGQvDFC4bQ8M1F8MUrhxDXA8Rw9ejH0PD9RPDpHAiQx/FDcMpHCVDAAAJw3G9H0MAwBPDj8IkQ80MCcM9Ch9DCtcNw5pZHUP26AfDUrgqQ9djEMMz8xtDmhkLwxQuG0PDNRfDFK4cQ1wPEcPXox9Dw/UTw6RwIkMfxQ3DKRwlQ1L4DsOPQhtDUrizwnE9LEN7FDnDj0IvQy+MDb4AAAAAL4wNvgAAAAB8YMG9AAAAAAAAAAAAAAAAAAAAAAAAAABcj5NC7FHeQVyPk0LsUd5BAACMQhSuLUIAAIxCFK4tQh+FlkKkcK1BH4WWQqRwrUFcj5NC7FHeQQAAgD8AAIA/H4U7QB+FO0CkcP0/pHD9PwrXQ0AK10NAexTuP3sU7j8AAIA/AACAPx+FO0AfhTtApHD9P6Rw/T8K10NACtdDQAAAgD8AAIA/H4U7QB+FO0CkcP0/pHD9PwrXQ0AK10NAexTuP3sU7j8AAIA/AACAPx+FO0AfhTtApHD9P6Rw/T8K10NACtdDQHsU7j97FO4/AAAAAAAAAABSuIxBhesEQoVr3cIpXP3BZmaTQqRw/T8fhZHBAADwQQAAAAAAAAAAAAAAAAAAAAA+K4m+AAAAAKNggr4AAAAANNjvPQAAAAAAAAAAAAAAAAAAAAAAAAAAKdybQlyPzkEp3JtCXI/OQexRl0JxPTRC7FGXQnE9NEI9CqFCheuLQT0KoUKF64tBKdybQlyPzkEAAAAAAAAAAAAAAAAAAAAAL4wNvgAAAAAAAIA/AACAP1yPQj/Xo3A/w/WIP/YoXD8Urkc/UrhePwAAgD8AAIA/XI9CP9ejcD/D9Yg/9ihcPxSuRz9SuF4/AACAPwAAgD9cj0I/16NwP65HIUD2KFw/UrhOQAAAgD9cj0I/16NwP8P1iD/2KFw/FK5HP1K4Xj8Urkc/UrhePwAAgD8AAIA/XI9CP9ejcD/D9Yg/9ihcPxSuRz9SuF4/FK5HP1K4Xj8AAIA/AACAP1yPQj/Xo3A/w/WIP/YoXD8Urkc/UrhePwAAAAAAAAAA/kLiPQAAAAC5AmG+AAAAAHkSdb8AAAAALM8QvwAAAAAAAAAAAAAAAP5C4j0AAAAAuQJhvgAAAAB5EnW/AAAAACzPEL8AAAAAAAAAAAAAAAAAAAAAAAAAAClcHEIzMyRCH0UOw1K4MsGksKpDH4UYQntUb0MUrmNCAAAAAAAAAAAAAAAAAAAAAIE9c74AAAAAc573vgAAAACBPXO+AAAAAJkNaT0AAAAAYcHaPAAAAAAAAAAAAAAAAOXdCr8AAAAA5d0KvwAAAADpJyS/AAAAAFI4Br4AAAAAOLEPPgAAAAAAAAAAAAAAAOXdCr8AAAAA5d0KvwAAAADpJyS/AAAAAFI4Br4AAAAAOLEPPgAAAAAAAAAAAAAAAAAAAAAAAAAAFK6XwK5HYT+kcN3A4XqEQFyPGsFI4TpA16MUwYXrkT9Em9O9AAAAAESb070AAAAAE2YGPQAAAAD51GA+AAAAAOvI/T0AAAAAAAAAAAAAAAAPi50+AAAAAHVTLz8AAAAAR0xYPwAAAADf3rk9AAAAAJZW6L0AAAAAAAAAAAAAAAAPi50+AAAAAHVTLz8AAAAAR0xYPwAAAADf3rk9AAAAAJZW6L0AAAAAAAAAAAAAAADyWJ69AAAAAAbhwz4AAAAAimJ1vgAAAABuTBk/AAAAAJkLID8AAAAAwriyPQAAAAAAAAAAAAAAABpXdT8AAAAApx/IPwAAAABQgNA/AAAAADg1sj8AAAAAjB2pPwAAAAAAAAAAAAAAABpXdT8AAAAApx/IPwAAAABQgNA/AAAAADg1sj8AAAAAjB2pPwAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAADzcA4+AAAAAAAAgD8AAIA/PQq3PwAAgD89Crc/H4WrP4XrUT9xPao/pHC9PzMzcz8AAIA/AACAPz0Ktz8AAIA/PQq3Px+Fqz+F61E/cT2qP6RwvT8zM3M/AACAPwAAgD89Crc/AACAPz0Ktz8fhas/hetRP3E9qj+kcL0/MzNzPwAAgD8AAIA/PQq3PwAAgD89Crc/H4WrP4XrUT9xPao/pHC9PzMzcz8AAIA/AACAPz0Ktz8AAIA/PQq3Px+Fqz+F61E/cT2qP6RwvT8zM3M/AACAPwAAgD89Crc/AACAPz0Ktz8fhas/hetRP3E9qj+kcL0/MzNzPwAAgD8AAIA/AAAAAAAAAACC2rq+AAAAAHInAr8AAAAAtTcjvwAAAAAcl4A+AAAAAOd8mz4AAAAAAAAAAAAAAACC2rq+AAAAAHInAr8AAAAAtTcjvwAAAAAcl4A+AAAAAOd8mz4AAAAAAAAAAAAAAADCuLI9AAAAAMzr9TwAAAAAAAAAAAAAAAD6faC+AAAAAPp9oL4AAAAAR0bcvgAAAAAv+72+AAAAAG5GHb4AAAAAAAAAAAAAAAD6faC+AAAAAPp9oL4AAAAAR0bcvgAAAAAv+72+AAAAAG5GHb4AAAAAAAAAAAAAAACNqsW9AAAAACU3qz4AAAAAwAGyvQAAAABJcEC/AAAAAD++ob4AAAAABdMCPQAAAACNqsW9AAAAAAAAAAAAAAAAi4SUPgAAAACgHi4/AAAAACfkfD8AAAAAKPqjPgAAAAA7aJC9AAAAAAAAAAAAAAAAi4SUPgAAAACgHi4/AAAAACfkfD8AAAAAKPqjPgAAAAA7aJC9AAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAOF6SEGF60HA4XpIQYXrQcC4HnFB16OSQbgecUHXo5JBhethQfYo7MCF62FB9ijswOF6SEGF60HAAAAAAAAAAAAAAAAAAAAAAM4lBb8AAAAAAACAPwAAgD8fhTtAH4U7QKRw/T+kcP0/CtdDQArXQ0B7FO4/exTuPwAAgD8AAIA/H4U7QB+FO0CkcP0/pHD9PwrXQ0AK10NAexTuP3sU7j8AAIA/AACAPx+FO0AfhTtAH4U7QB+FO0CkcP0/pHD9PwrXQ0AK10NAexTuP3sU7j8AAIA/AACAPx+FO0AfhTtAH4U7QB+FO0CkcP0/pHD9PwrXQ0AK10NAexTuP3sU7j8AAIA/AACAPwAAAAAAAAAAM8ouPgAAAAC0qoY+AAAAABCvhb0AAAAAoKmBvgAAAADnfBs+AAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAPNwDj4AAAAAAACAPwAAgD+amRk/AACAP0jhmj8AAIA/mpmZP6RwPT/2KLw/PQqXPwAAgD8AAIA/mpkZPwAAgD9I4Zo/AACAP5qZmT+kcD0/9ii8Pz0Klz8AAIA/AACAP5qZGT8AAIA/SOGaPwAAgD+amZk/pHA9P/YovD89Cpc/AACAPwAAgD+amRk/AACAP0jhmj8AAIA/mpmZP6RwPT/2KLw/PQqXPwAAgD8AAIA/mpkZPwAAgD9I4Zo/AACAP5qZmT+kcD0/9ii8Pz0Klz8AAIA/AACAP5qZGT8AAIA/SOGaPwAAgD+amZk/pHA9P/YovD89Cpc/AACAPwAAgD+33C+9AAAAANfHeDwAAAAAAAAAAAAAAAAAAAAAAAAAAHsUtEHhehzBexS0QeF6HMHheshBuB45QeF6yEG4HjlBzczAQXsUYsHNzMBBexRiwXsUtEHhehzBAAAAAAAAAAAAAAAAAAAAANMCt7kAAAAA6IrcvgAAAADoity+AAAAAFtXDL8AAAAAAACAPwAAgD9cj0I/16NwP8P1iD/2KFw/FK5HP1K4Xj8AAIA/AACAP1yPQj/Xo3A/w/WIP/YoXD8Urkc/UrhePwAAgD8AAIA/XI9CP9ejcD/D9ThA9ihcP4/CNUBSuF4/AACAPwAAgD9cj0I/16NwP8P1iD/2KFw/w/WIP/YoXD8Urkc/UrhePwAAgD8AAIA/XI9CP9ejcD/D9Yg/9ihcP8P1iD/2KFw/FK5HP1K4Xj8AAIA/AACAPxSuRz9SuF4/AACAPwAAgD8AAAAAAAAAAOkd9b4AAAAAmqowvwAAAADiIle/AAAAAEhqRL4AAAAAlUgnPgAAAAAAAAAAAAAAAOkd9b4AAAAAmqowvwAAAADiIle/AAAAAEhqRL4AAAAAlUgnPgAAAAAAAAAAAAAAAMXokr0AAAAAoJ2JPQAAAADvoZ2+AAAAAI2eTb8AAAAA98afvgAAAAA8gAC+AAAAAMXokr0AAAAAAAAAAAAAAADPrCU+AAAAAAISUz4AAAAAxvbTPgAAAADuia0+AAAAAEoJVT4AAAAAAAAAAAAAAADPrCU+AAAAAAISUz4AAAAAxvbTPgAAAADuia0+AAAAAEoJVT4AAAAAAAAAAAAAAAAAAAAAAAAAAClcBsIK1w1CCteJwlK4KsF7FIDCcT0RwkjhNsIK18M/AAAAAAAAAAAAAAAAAAAAAPR+T74AAAAA9H5PvgAAAACWYBe+AAAAAAAAAAAAAAAAcT0GwT0KGUJI4S7CCtf7wClcG8J7FAbC9iikwVyPikAAAAAAAAAAAPR+T74AAAAAnvTJPgAAAAAAAAAAAAAAAMP10MBcj0lCpHAnwgAAiEBI4RPCPQqrwa5HlcEUroNBAAAAAAAAAAD0fk++AAAAAAAAAAAAAAAA7FFQQQAAAAD2KBBBAAAAAPYoZMEAAAAAAAAAAAAAAAC+WHI9AAAAAAAAAAAAAAAAcT0GwT0KGUJI4S7CCtf7wClcG8J7FAbC9iikwVyPikAAAAAAAAAAAPR+T74AAAAAeSKgPQAAAACrY+W+AAAAAIJVYz0AAAAA/1INPwAAAAAysj4+AAAAAK4wjb0AAAAAeSKgPQAAAAAAAAAAAAAAABlReT4AAAAAURbnPgAAAADcMzE/AAAAAC7jTbwAAAAATL6MvgAAAAAAAAAAAAAAABlReT4AAAAAURbnPgAAAADcMzE/AAAAAC7jTbwAAAAATL6MvgAAAAAAAAAAAAAAAB+Faz9mZma/V44XvQAAAADCuLI9AAAAAAAAAAAAAAAAm7YovwAAAABRjMi/AAAAAFTN578AAAAAnwm8vwAAAAAdGm6/AAAAADX6jiUAAAAAm7YovwAAAABRjMi/AAAAAFTN578AAAAAnwm8vwAAAAAdGm6/AAAAADX6jiUAAAAAAAAAAAAAAAC+bpm+AAAAAAAAAAAAAAAA4zRLvgAAAABXjpc8AAAAACMTwz4AAAAAfGBBPwAAAADXTFA/AAAAAAAAAAAAAAAA4zRLvgAAAABXjpc8AAAAACMTwz4AAAAAfGBBPwAAAADXTFA/AAAAAAAAAAAAAAAAAAAAAAAAAAA7aJA+AAAAAGuPnD0AAAAA0MQVvwAAAAACEIq/AAAAAKegbL8AAAAAAAAAAAAAAAA7aJA+AAAAAGuPnD0AAAAA0MQVvwAAAAACEIq/AAAAAKegbL8AAAAAAAAAAAAAAAB5IqA9AAAAADaD+L4AAAAAQeTSPgAAAABo1Gg/AAAAAAKLsj4AAAAAFh0HvgAAAAB5IqA9AAAAAAAAAAAAAAAA4ZW6vgAAAAAGWqM9AAAAAN01ej8AAAAAx5CdPwAAAADooAM/AAAAAAAAAAAAAAAA4ZW6vgAAAAAGWqM9AAAAAN01ej8AAAAAx5CdPwAAAADooAM/AAAAAAAAAAAAAAAAAAAAAAAAAABC7oG+AAAAADz7qL4AAAAAC8gkPgAAAABJB4w+AAAAAPYnD74AAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAA83AOPgAAAAAAAIA/AACAP1K4vj8AAIA/H4VrP4/CtT+kcL0/H4VrPwrXgz+F65E/AACAPwAAgD9SuL4/AACAPx+Faz+PwrU/pHC9Px+Faz8K14M/heuRPwAAgD8AAIA/Uri+PwAAgD8fhWs/j8K1P6RwvT8fhWs/CteDP4XrkT8AAIA/AACAP1K4vj8AAIA/H4VrP4/CtT+kcL0/H4VrPwrXgz+F65E/AACAPwAAgD9SuL4/AACAPx+Faz+PwrU/pHC9Px+Faz8K14M/heuRPwAAgD8AAIA/Uri+PwAAgD8fhWs/j8K1P6RwvT8fhWs/CteDP4XrkT8AAIA/AACAPwAAAAAAAAAAXM8xQxSuHEJczzFDFK4cQlzPMUPNzKhBXM8xQ83MqEFczzFDFK4cQgAAgD8AAIA/rkchQK5HIUDNzAw/zcwMP65HIUCuRyFArkchQK5HIUDNzAw/zcwMP65HIUCuRyFAzcwMP83MDD8AAAAAAAAAAB+FF0EAAAAAAACAPwAAgD+PwpU/j8KVP3sU7j97FO4/AAAAAAAAAAAAAAAAAAAAAFL4JkMpXOVBAACAPwAAgD9xPco/cT3KPwAA0EAAANBAZmZmP2ZmZj8pXA9AKVwPQAAAAAAAAAAAj4Jmw3sUA8IAAIA/AACAPwAAgD8AAIA/7FG4P+xRuD8AAIA/AACAPwAAgD8AAIA/cT3KP3E9yj/Xo5A/16OQPwAAgD8AAIA/AACAPwAAgD/sUbg/7FG4PwAAgD8AAIA/AACAPwAAgD9xPco/cT3KP9ejkD/Xo5A/AAAAAAAAAAAAAAAAAAAAAAAAAAB7FCZBAACAPwAAgD8AAIA/AACAP/YonD/2KJw/AAAAAAAAAAAAAAAAAAAAAAAAAABxPQJCAAAAAAAAAAAAAAAAcT0CQgAAgD8AAIA/AACAPwAAgD/2KLw/9ii8PwAAgD8AAIA/9ii8P/YovD8AAAAAAAAAAAAAAAAAAAAA16OQP9ejkL8AAIA/AACAP3E9CkBxPQpAcT0KQHE9CkBmZmY/ZmZmPwAAgD8AAIA/AACAPwAAgD/sUbg/7FG4PwAAgD8AAIA/AACAPwAAgD9xPco/cT3KP9ejkD/Xo5A/AACAPwAAgD8AAIA/AACAP3E9yj9xPco/16OQP9ejkD8AAAAAAAAAAAAAoMEAAAAAAACgwQAA7EEAAKDBAAAAAAAAoMEAAOxBAACAPwAAgD8AAIA/AACAPwAAgD+amVk/AACAPwAAgD8AAIA/mplZPwAAAAAAAAAAAACgwR+FQ0IAAAAA4fqRQgAAAAAAAAAAAACgwc3MkEIAAKDB4fqRQgAAAAAAAAAAAAAAAOH6kUIAAKDB4fqRQgAAgD8AAIA/AACAPwAAgD/D9ag/AACAPwAAgD8AAIA/AACAPwAAgD/D9ag/AACAPwAAgD8AAIA/w/WoPwAAgD8AAIA/AACAPz0K70A9Cu9AAABEQQAAREEAAAAAAAAAAArX479mZiRCAAAAAAAAAACBPXO/AAAAAAAAgD8AAIA/KVwPQClcD0AzM1NAMzNTQAAAAAAAAAAAUvgOw49CG0NmpgzDcX0uQ/ZoDsNcjxJDUvgOw49CG0MAAAAAAAAAAC+MDb4AAAAAAAAAAAAAAAD2aBbDhesxwQAAJcMKV9TC9mgWw4XrMcEAACXDClfUwvZoFsOF6zHBAAAlwwpX1ML2aBbDhesxwQAAJcMKV9TC9mgWw4XrMcEAAAAAAAAAADx20T0AAAAAWB4ywAAAAAA8dtE9AAAAAFgeMsAAAAAAPHbRPQAAAABYHjLAAAAAADx20T0AAAAAWB4ywAAAAAA8dtE9AAAAAAAAgD8AAIA/MzMTQDMzE0AK1yNACtcjQDMzE0AzMxNACtcjQArXI0AzMxNAMzMTQArXI0AK1yNAMzMTQDMzE0AK1yNACtcjQDMzE0AzMxNAAAAAAAAAAAAAAAAAAAAAAEjhekCamblA16NQwPYoLEAAAAAAAAAAAAAAAAAAAAAAXI8aQR+Fqz9mZnZAKVxfwAAAAAAAAAAA3TV6vQAAAAAAAAAAAAAAAAAAAAAAAAAAcT2KQAAAkECkcH0/rkeBQAAAAAAAAAAA1rk3PQAAAAAAAAAAAAAAAAAAAAAAAAAA4XoYQRSuJ0A9CjdBPQpnwAAAgD8AAIA/AACAPwAAgD9cj+I/XI/iP1K4XkBSuF5AAAAAAAAAGQABAAAAAAAAAAEAAwABAAYAAQAIAAEADAABAA4AAQARAAEAEwABABYAAQAYAAEAGgABAB0AAQAfAAEAIQABACMAAAAAAAIAFgA1CVwOIxIoFakXzRmlG0Udsh71HxQhEyL2Ir4jbiQIJY0l/iVdJqgm3yYDJxUAAgAEACwIJxDzF5YfGAABAB4AAgAGAPAKrxOZGukfwyMvJiMAAAAAAAIAFgA1CVwOIxIoFakXzRmlG0Udsh71HxQhEyL2Ir4jbiQIJY0l/iVdJqgm3yYDJxUAAgAKAL0DcAcZC7cOTRLXFVoZ1BxFIK8jHgACAAYA8AqvE5ka6R/DIy8mIwAAAAAAAQADAAEABQABAAgAAQALAAEADgABABAAAQATAAIABABsEqkcuCL/JRYAAQAYAAIABACKEtUc3SIPJhsAAQAeAAEAIAABACMAAAAAAAEAEQABABQAAQAWAAEAGwABAB8AAAAAAAIAFgBUCdoO5hIaFr0Y8hrXHHce3h8YISgiFCPgI5AkJyWlJQ4mYyalJtYm+CYKJxUAAgAEAG0KwhPSG1wiGAACAAcATQWKCq4PthSYGU8ezyIeAAIABgCQCD8QGRcMHfghjCUjAAAAAAACABYAVAnaDuYSGha9GPIa1xx3Ht4fGCEoIhQj4COQJCclpSUOJmMmpSbWJvgmCicVAAIACgDdBIYJ9A0mEhgWwxkhHS0g3iIuJR4AAgAGAJAIPxAZFwwd+CGMJSMAAAAAAAIAFgBUCdoO5hIaFr0Y8hrXHHce3h8YISgiFCPgI5AkJyWlJQ4mYyalJtYm+CYKJxUAAgAEAG0KwhPSG1wiGAACAAcATQWKCq4PthSYGU8ezyIeAAIABgCQCD8QGRcMHfghjCUjAAAAAAAAAAAAAgAUANYBrQOGBV8HOgkVC/EMzg6sEIkSaBRGFiYYBBriG8Adnx97IVgjNSUTAAIABQBwBuQMXhPiGXIgFwACAAYAigUdC7YQUxbtG4MhHAACAAgASwScCPQMThGsFQgaZB69IiMAAAAAAAEAEQAAABQAAQAWAAEAGQABABsAAQAfAAAAAAACABQAHwFaAq4DGgWcBjMI3gmaC2gNSA80ETITOxVQF3MZoBvYHRggYiK1JBMAAgAFADMO4heoHkQjDiYXAAAAHgACAAYAlQiAEJgXsR2MItQlIwAAAAAAAgAUAB8BWgKuAxoFnAYzCN4JmgtoDUgPNBEyEzsVUBdzGaAb2B0YIGIitSQTAAIABQAzDuIXqB5EIw4mFwAAAB4AAgAGAJUIgBCYF7EdjCLUJSMAAAAAAAEAEQABABQAAQAWAAEAGQABABsAAQAfAAAAAAACABQA4gHEA6YFhwdnCUgLKQ0ID+gQxhKkFIAWXRg3GhEc6h3BH5chayM/JRMAAgAFADMO4heoHkQjDiYXAAAAHgACAAYA8ggQETQYNh7hIvIlIwAAAAAAAAAAAAIABQBzAWwFdwtCE4ccBAACAAYA/gk2EgQZkB7jItwlCQAAAAsAAgAEAA8CnQf0D5EaDgACAAQAdw3CF4gf2SQRAAAAEwACAAQADwKdB/QPkRoWAAIABQB4C6EU8RuWIXglGgAAABwAAgAEAA8CnQf0D5EaHwACAAUAeAuhFPEbliF4JSMAAAAAAAIABQBzAWwFdwtCE4ccBAACAAYA/gk2EgQZkB7jItwlCQAAAAsAAgAEAA8CnQf0D5EaDgACAAQAdw3CF4gf2SQRAAAAEwACAAQADwKdB/QPkRoWAAIABQB4C6EU8RuWIXglGgAAABwAAgAEAA8CnQf0D5EaHwACAAUAeAuhFPEbliF4JSMAAAAAAAEAEQABABQAAQAWAAEAGQABABsAAQAfAAAAAAABAAIAAQAEAAEABgABAAgAAQAKAAEADAABAA4AAQAQAAEAEgABABQAAQAVAAEAFwABABkAAQAbAAEAHQABAB8AAQAhAAEAIwAAAAAAAgAXAB8AeQAGAcMBqwK6A+0EQAaxBz8J5wqnDH4OaRBnEngUmRbMGAsbWh23Hx8ikiQWAAIABwBQBZYKyg/gFM0ZhB72IhwAAgAIAN8B6wUHC6YQahYJHCUhMSUjAAAAAAACABQAKQCcAFIBQwJpA74EQAbpB7YJowuxDdoPHRJ4FOgWbxkIHLIebCE4JBMAAgAEAA0Q1xrSIcQlFgACAAcAUAWWCsoP4BTNGYQe9iIcAAIACADfAesFBwumEGoWCRwlITElIwAAAAAAAQARAAEAFAABABYAAQAZAAEAGwABAB8AAAAAAAAAAAAAAAAAAQARAAAAFAABABYAAQAZAAEAGwABAB8AAAAAAAIAFADfAb4DngV9B10JPAsbDfsO2RC3EpQUcRZOGCkaBRzfHbgfkCFmIzwlEwACAAQAMAg5EBMYsx8WAAIABADTCDMRERlhIBkAAgAFAC0Ivw+qFuMcYCIdAAIABwBKAh8HGA2HE/gZ8R/GJCMAAAAAAAEAEQABABQAAQAWAAEAGQABABsAAQAfAAAAAAABAAMAAQAGAAEACAABAAwAAQAOAAEAEQABABMAAQAWAAEAGAABABoAAQAdAAEAHwABACEAAQAjAAAAAAACABQAKQCcAFIBQwJpA74EQAbpB7YJowuxDdoPHRJ4FOgWbxkIHLIebCE4JBMAAgAEAOMHxA+bF2IfFgACAAQAbwiWEHEY8h8ZAAIABQC8BxQP+BVTHA8iHQACAAcASgIfBxgNhxP4GfEfxiQjAAAAAAABAAIAAQAEAAEABgABAAgAAQAKAAEADAABAA4AAQAQAAEAEgABABQAAQAVAAEAFwABABkAAQAbAAEAHQABAB8AAQAhAAEAIwAAAAAAAAAAAAIAFwCjAUYD6gSOBjEI1Al4CxsNvg5hEAMSphNIFekWihgpGsobaR0GH6MgQCLcI3clFgACAAQAXA7uGHYgQCUZAAIACwC3BFAJwQ0DEg4W1RlOHWYgCyMiJYomIwAAAAAAAQACAAEAAwABAAUAAQAGAAEACAABAAkAAQALAAEADQABAA4AAQAQAAEAEQABABMAAQAVAAEAFgABABgAAQAaAAEAGwABABwAAQAeAAEAIAABACEAAQAjAAAAAAABABEAAQAUAAEAFgABABkAAQAbAAEAHwAAAAAAAgAUAN8BvgOeBX0HXQk8CxsN+w7ZELcSlBRxFk4YKRoFHN8duB+QIWYjPCUTAAIABAAwCDkQExizHxYAAgAEANMIMxERGWEgGQACAAUALQi/D6oW4xxgIh0AAgAHAEoCHwcYDYcT+BnxH8YkIwAAAAAAAQARAAEAFAABABYAAQAZAAEAGwABAB8AAAAAAAEAAwABAAUAAQAIAAEACwABAA4AAQAQAAEAEwABABYAAQAYAAEAGwABAB4AAQAgAAEAIwAAAAAAAgAUACUAjgA1ARYCKwNwBOIFfQc+CSQLKw1QD5QR8hNqFvwYoxtiHjMhGCQTAAIABAC9DP8WCB+tJBYAAgAHAKgHmw7dFG4aOx8lI+wlHAACAAgA3wHrBQcLphBqFgkcJSExJSMAAAAAAAIAFAAlAI4ANQEWAisDcATiBX0HPgkkCysNUA+UEfITahb8GKMbYh4zIRgkEwACAAQAvQz/FggfrSQWAAIABwCoB5sO3RRuGjsfJSPsJRwAAgAIAN8B6wUHC6YQahYJHCUhMSUjAAAAAAACABQAJwCVAEQBLAJKA5cEEQazB3oJZAttDZUP2BE0FKoWNRnVG4keUSEoJBMAAgAEADQNvxe9HwglFgACAAcAOwrZEeoX2xzbIPsjKCYcAAIACADfAesFBwumEGoWCRwlITElIwAAAAAAAgAUACcAlQBEASwCSgOXBBEGswd6CWQLbQ2VD9gRNBSqFjUZ1RuJHlEhKCQTAAIABAA0Db8XvR8IJRYAAgAHADsK2RHqF9sc2yD7IygmHAACAAgA3wHrBQcLphBqFgkcJSExJSMAAAAAAAAAAAACABQAJwCVAEQBLAJKA5cEEQazB3oJZAttDZUP2BE0FKoWNRnVG4keUSEoJBMAAgAEAIgNEhjpHxIlFgACAAcAOwrZEeoX2xzbIPsjKCYcAAIACADfAesFBwumEGoWCRwlITElIwAAAAAAAgAUACcAlQBEASwCSgOXBBEGswd6CWQLbQ2VD9gRNBSqFjUZ1RuJHlEhKCQTAAIABACIDRIY6R8SJRYAAgAHADsK2RHqF9sc2yD7IygmHAACAAgA3wHrBQcLphBqFgkcJSExJSMAAAAAAAAAAAACABQAJwCVAEQBLAJKA5cEEQazB3oJZAttDZUP2BE0FKoWNRnVG4keUSEoJBMAAgAEADQP5BklIYIlFgACAAcAOwrZEeoX2xzbIPsjKCYcAAIACADfAesFBwumEGoWCRwlITElIwAAAAAAAgAUACcAlQBEASwCSgOXBBEGswd6CWQLbQ2VD9gRNBSqFjUZ1RuJHlEhKCQTAAIABAA0D+QZJSGCJRYAAgAHADsK2RHqF9sc2yD7IygmHAACAAgA3wHrBQcLphBqFgkcJSExJSMAAAAAAAIAFADfAb4DngV9B10JPAsbDfsO2RC3EpQUcRZOGCkaBRzfHbgfkCFmIzwlEwACAAQAMAg5EBMYsx8WAAIABADTCDMRERlhIBkAAgAFAC0Ivw+qFuMcYCIdAAIABwBKAh8HGA2HE/gZ8R/GJCMAAAAAAAEAEQABABQAAQAWAAEAGQABABsAAQAfAAAAAAAAAAAAAAAAAAAAAAABABEAAQAUAAEAFgABABkAAQAbAAEAHwAAAAAAAAANAAIACwAyA28GtQkBDVEQohPyFj0agx2/IO8jFwACAA0ADgQECOALnA80E58W2RnZHJIf/CEGJJ8lrSYjAAAAAAAAAA0AAgALADIDbwa1CQENURCiE/IWPRqDHb8g7yMXAAIADQAOBAQI4AucDzQTnxbZGdkckh/8IQYknyWtJiMAAAAAAAEAEQABABQAAQAWAAEAGQABABsAAQAfAAAAAAABABEAAQAUAAEAFgABABkAAQAbAAEAHwAAAAAAAgAUAN8BvgOeBX0HXQk8CxsN+w7ZELcSlBRxFk4YKRoFHN8duB+QIWYjPCUTAAIABAAwCDkQExizHxYAAgAEANMIMxERGWEgGQACAAUALQi/D6oW4xxgIh0AAgAHAEoCHwcYDYcT+BnxH8YkIwAAAAAAAQARAAEAFAABABYAAQAZAAEAGwABAB8AAAAAAAIAFAApAJwAUgFDAmkDvgRABukHtgmjC7EN2g8dEngU6BZvGQgcsh5sITgkEwACAAQA4wfED5sXYh8WAAIABABvCJYQcRjyHxkAAgAFALwHFA/4FVMcDyIdAAIABwBKAh8HGA2HE/gZ8R/GJCMAAAAAAAEAAgABAAQAAQAGAAEACAABAAoAAQAMAAEADgABABAAAQASAAEAFAABABUAAQAXAAEAGQABABsAAQAdAAEAHwABACEAAQAjAAAAAAAAABkAAAAAAAAAGQACAAkATgeyDE8RcxU/GcEc/B/tInklIQAAAAAAAAAZAAAAAAAAABkAAAAAAAAACgACAAwAQgN1BpwJtgzGD8wSxxW6GKUbih5nIT4kFQACAA8ACATXB28L1g4NEhQV7BeWGg0dUR9eIS0jtiTtJcAmIwAAAAAAAAAKAAIADABCA3UGnAm2DMYPzBLHFboYpRuKHmchPiQVAAIADwAIBNcHbwvWDg0SFBXsF5YaDR1RH14hLSO2JO0lwCYjAAAAAAAAAAIAAgANANQDegf1CkYOcRF4FFoXGRqvHCAfZiF+I2MlDgACAAQAogxCF4sfCSURAAAAEwACABEAdgPEBusJ8QzVD5gSORW7FxoaVxxvHl0gHyKuIwMlEibKJiMAAAAAAAAAAgACAA0A1AN6B/UKRg5xEXgUWhcZGq8cIB9mIX4jYyUOAAIABACiDEIXix8JJREAAAATAAIAEQB2A8QG6wnxDNUPmBI5FbsXGhpXHG8eXSAfIq4jAyUSJsomIwAAAAAAAAAZAAIACAABB4UMcBH3FTIaJR7KIf8kIAAAAAAAAAAZAAIACAABB4UMcBH3FTIaJR7KIf8kIAAAAAAAAAADAAIADABoBqMLExDoE0EXNBrSHCMfMCH/IpIk7SUOAAIABAAKDboX3R8kJREAAAASAAIAEgBbBdYJtA0VERUUwxYqGVQbRh0HH5gg/yE7I08kOSX4JYwm7CYjAAAAAAAAAAMAAgAMAGgGowsTEOgTQRc0GtIcIx8wIf8ikiTtJQ4AAgAEAAoNuhfdHyQlEQAAABIAAgASAFsF1gm0DRURFRTDFioZVBtGHQcfmCD/ITsjTyQ5JfgljCbsJiMAAAAAAAIACADwB8AOoRSyGQIeliFkJE4mBwAAAAkAAgAGAH4HLw41FKYZkx4JIw4AAgAGADwJZRF0GFMe4SLsJRMAAAAUAAIACwARBngLTBChFH8Y8Rv5HpYhxCN4JZ8mHgAAACMAAAAAAAIACADwB8AOoRSyGQIeliFkJE4mBwAAAAkAAgAGAH4HLw41FKYZkx4JIw4AAgAGADwJZRF0GFMe4SLsJRMAAAAUAAIACwARBngLTBChFH8Y8Rv5HpYhxCN4JZ8mHgAAACMAAAAAAAAAGQAAAAAAAAAZAAAAAAAAABkAAgAKACsGDwtdD0kT7hZYGoodhSA/I5wlIgAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAEQD//xIAAAAjAP//AAABAAMAAgADAIwIhxOEHgUAAAANAAIABQC2AwcLhxMJHFojEQABABIAAgAFABsFIwyHE+0a9SEWAAAAHgACAAYA3wLACNIPPhdQHjEkIwAAAAAAAAAHAP//CQAAABMA//8UAAAAHgD//wAAAgADAIwIhxOEHgIAAAAFAAIAAwAfB4cT8R8HAAEACQACAAIAIwztGgoAAAAOAAIABgDfAsAI0g8+F1AeMSQTAAEAFAACAAMAjAiHE4QeFgAAABkAAgAGAN8CwAjSDz4XUB4xJB4AAAAAAAAAIwD//wAAAQACAAIACQCUAnQGsQoUD4cT/BdfHJwgfCQKAAAAGAACAAwA+gBBA0kGyQmUDYcRiRV8GUcdxyDPIxYmIwAAAAAAAAARAP//EwAAACMA//8AAAEAAgACAAcAkAdmDpUUGhruHu0i1iUIAAAACwACAAcASgIfBxgNhxP4GfEfxiQRAAEAEwACAAYAewfuDfMTohn3HsojGAAAABsAAgAJAI4BAAVsCV0OhxOzGKQdECKCJSMAAAAAAAAAIAD//wAAAQAZAAEAHAACAAUA/wtsFb0cKCKzJSAAAAAAAAAAHQD//wAAAQAZAAAAAAAAAAAAAAAAAAAAIgD//wAAAQAZAAAAHQACAAYAdwmdEYwYSB7HItolIgAAAAAAAAAAAAAAAAAAACEA//8AAAEAGQAAABsAAgAHAFcHOA6PFEUaNx83I/wlIQAAAAAAAAAAAP//FgAAAAAAAAAAAAAACQD//wsAAAARAP//EwAAABoA//8cAAAAAAABAAQAAgAGAP4JNhIEGZAe4yLcJQkAAQALAAEADgACAAQAdw3CF4gf2SQRAAEAEwABABYAAgAFAHgLoRTxG5YheCUaAAEAHAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAACAB8ALwCrAGQBSgJWA4IExgUfB4oIBQqKCxgNrg5JEOgRhxMoFccWYhj4GYYbCx2GHvEfSiGOIrojxiSsJWUm4SYeAAIAHwAvAKsAZAFKAlYDggTGBR8HiggFCooLGA2uDkkQ6BGHEygVxxZiGPgZhhsLHYYe8R9KIY4iuiPGJKwlZSbhJjwAAAAAAAIADwBMA5MG0gkDDSQQMhMmFvwYrRszHoQgliJcJMQltSYOAAEALAACABEATQAbAU0CzwORBYkHrgn4C2IO5RCAEy4W6BixG4MeWiE0JDwAAAAAAAIAHwAvAKsAZAFKAlYDggTGBR8HiggFCooLGA2uDkkQ6BGHEygVxxZiGPgZhhsLHYYe8R9KIY4iuiPGJKwlZSbhJh4AAgAfAC8AqwBkAUoCVgOCBMYFHweKCAUKigsYDa4OSRDoEYcTKBXHFmIY+BmGGwsdhh7xH0ohjiK6I8YkrCVlJuEmPAAAAAAAAgAQABADHAYkCSIMFQ/4EcgUfxcbGpYc5x4IIfEikiTdJbwmDwABAC0AAgAQAFQAMwF+Ah8ECAYpCHoK9QyRD0gSGBX7F+4a7B30IAAkPAAAAAAAAgAQABADHAYkCSIMFQ/4EcgUfxcbGpYc5x4IIfEikiTdJbwmDwABAC0AAgAQAFQAMwF+Ah8ECAYpCHoK9QyRD0gSGBX7F+4a7B30IAAkPAAAAAAAAgAQABADHAYkCSIMFQ/4EcgUfxcbGpYc5x4IIfEikiTdJbwmDwABAC0AAgAQAFQAMwF+Ah8ECAYpCHoK9QyRD0gSGBX7F+4a7B30IAAkPAAAAAAAAgAfAC8AqwBkAUoCVgOCBMYFHweKCAUKigsYDa4OSRDoEYcTKBXHFmIY+BmGGwsdhh7xH0ohjiK6I8YkrCVlJuEmHgACAB8ALwCrAGQBSgJWA4IExgUfB4oIBQqKCxgNrg5JEOgRhxMoFccWYhj4GYYbCx2GHvEfSiGOIrojxiSsJWUm4SY8AAAAAAACAA0A7QPKB5QLQg/REjoWdhl9HEMfvCHaI4YlpSYMAAIAHwAvAKsAZAFKAlYDggTGBR8HiggFCooLGA2uDkkQ6BGHEygVxxZiGPgZhhsLHYYe8R9KIY4iuiPGJKwlZSbhJioAAgATAEUA/AAMAmED7wSrBo8IkwqwDOUOLRGDE+UVUhjEGjwdtB8sIqEkPAAAAAAAAgAPAEwDkwbSCQMNJBAyEyYW/BitGzMehCCWIlwkxCW1Jg4AAgAfAC8AqwBkAUoCVgOCBMYFHweKCAUKigsYDa4OSRDoEYcTKBXHFmIY+BmGGwsdhh7xH0ohjiK6I8YkrCVlJuEmLAABADwAAAAAAAIAHwAvAKsAZAFKAlYDggTGBR8HiggFCooLGA2uDkkQ6BGHEygVxxZiGPgZhhsLHYYe8R9KIY4iuiPGJKwlZSbhJh4AAgAfAC8AqwBkAUoCVgOCBMYFHweKCAUKigsYDa4OSRDoEYcTKBXHFmIY+BmGGwsdhh7xH0ohjiK6I8YkrCVlJuEmPAAAAAAAAgAfAC8AqwBkAUoCVgOCBMYFHweKCAUKigsYDa4OSRDoEYcTKBXHFmIY+BmGGwsdhh7xH0ohjiK6I8YkrCVlJuEmHgACAB8ALwCrAGQBSgJWA4IExgUfB4oIBQqKCxgNrg5JEOgRhxMoFccWYhj4GYYbCx2GHvEfSiGOIrojxiSsJWUm4SY8AAAAAAACAA8ATAOTBtIJAw0kEDITJhb8GK0bMx6EIJYiXCTEJbUmDgABACwAAgARAE0AGwFNAs8DkQWJB64J+AtiDuUQgBMuFugYsRuDHlohNCQ8AAAAAAACABAAEAMcBiQJIgwVD/gRyBR/FxsalhznHggh8SKSJN0lvCYPAAEALQACABAAVAAzAX4CHwQIBikIegr1DJEPSBIYFfsX7hrsHfQgACQ8AAAAAAACABAAEAMcBiQJIgwVD/gRyBR/FxsalhznHggh8SKSJN0lvCYPAAIAHwAvAKsAZAFKAlYDggTGBR8HiggFCooLGA2uDkkQ6BGHEygVxxZiGPgZhhsLHYYe8R9KIY4iuiPGJKwlZSbhJi0AAgAQAFQAMwF+Ah8ECAYpCHoK9QyRD0gSGBX7F+4a7B30IAAkPAAAAAAAAgARANACogVyCD4LBA6/EGwTBxaOGPsaSh1zH3AhNiO8JPElwiYQAAEALgACAA8AWQBIAasCbAR5BsUIRwv0DccQuRPIFuwZIx1mILcjPAAAAAAAAQALAAEADwABABMAAQAXAAEAGwABACgAAAAAAAEACwABAA8AAQATAAEAGwABACgAAAAAAAIAEAAQAxwGJAkiDBUP+BHIFH8XGxqWHOceCCHxIpIk3SW8Jg8AAQAtAAIAEABUADMBfgIfBAgGKQh6CvUMkQ9IEhgV+xfuGuwd9CAAJDwAAAAAAAIAHwAvAKsAZAFKAlYDggTGBR8HiggFCooLGA2uDkkQ6BGHEygVxxZiGPgZhhsLHYYe8R9KIY4iuiPGJKwlZSbhJh4AAgAfAC8AqwBkAUoCVgOCBMYFHweKCAUKigsYDa4OSRDoEYcTKBXHFmIY+BmGGwsdhh7xH0ohjiK6I8YkrCVlJuEmPAAAAAAAAgAfAC8AqwBkAUoCVgOCBMYFHweKCAUKigsYDa4OSRDoEYcTKBXHFmIY+BmGGwsdhh7xH0ohjiK6I8YkrCVlJuEmHgACAB8ALwCrAGQBSgJWA4IExgUfB4oIBQqKCxgNrg5JEOgRhxMoFccWYhj4GYYbCx2GHvEfSiGOIrojxiSsJWUm4SY8AAAAAAABAAUAAQAIAAEACgABAA4AAQAQAAEAFQABABgAAQAaAAEAHgABACAAAQAlAAEAKAABACoAAQAuAAEAMAABADIAAQA1AAEANwABADkAAQA8AAAAAAABAAMAAQAHAAEADAABAA8AAQASAAEAFwABABoAAQAdAAEAIQABACYAAQApAAEALAABADAAAQAzAAEANgABADkAAQA8AAAAAAACAAUAcwFsBXcLQhOHHAQAAgAGAP4JNhIEGZAe4yLcJQkAAAALAAIABAAPAp0H9A+RGg4AAgAEAHcNwheIH9kkEQAAABMAAgAEAA8CnQf0D5EaFgACAAUAeAuhFPEbliF4JRoAAAAcAAIABAAPAp0H9A+RGh8AAgAGAP4JNhIEGZAe4yLcJSQAAAAlAAIABAAPAp0H9A+RGigAAgAEAHcNwheIH9kkKwAAAC0AAgAEAA8CnQf0D5EaMAACAAUAeAuhFPEbliF4JTQAAAA1AAIABAAPAp0H9A+RGjgAAgAEAHcNwheIH9kkOwAAADwAAAAAAAIABQBzAWwFdwtCE4ccBAACAAYA/gk2EgQZkB7jItwlCQAAAAsAAgAEAA8CnQf0D5EaDgACAAQAdw3CF4gf2SQRAAAAEwACAAQADwKdB/QPkRoWAAIABQB4C6EU8RuWIXglGgAAABwAAgAEAA8CnQf0D5EaHwACAAYA/gk2EgQZkB7jItwlJAAAACUAAgAEAA8CnQf0D5EaKAACAAQAdw3CF4gf2SQrAAAALQACAAQADwKdB/QPkRowAAIABQB4C6EU8RuWIXglNAAAADUAAgAEAA8CnQf0D5EaOAACAAQAdw3CF4gf2SQ7AAAAPAAAAAAAAQADAAEABQABAAgAAQALAAEADgABABAAAQATAAEAFgABABkAAQAbAAEAHgABACEAAQAkAAEAJgABACkAAQAsAAEALwABADEAAQA0AAEANwABADkAAQA8AAAAAAACAB8ALwCrAGQBSgJWA4IExgUfB4oIBQqKCxgNrg5JEOgRhxMoFccWYhj4GYYbCx2GHvEfSiGOIrojxiSsJWUm4SYeAAIAHwAvAKsAZAFKAlYDggTGBR8HiggFCooLGA2uDkkQ6BGHEygVxxZiGPgZhhsLHYYe8R9KIY4iuiPGJKwlZSbhJjwAAAAAAAEABQABAAgAAQAKAAEADgABABAAAQAVAAEAGAABABoAAQAeAAEAIAABACUAAQAoAAEAKgABAC4AAQAwAAEAMgABADUAAQA3AAEAOQABADwAAAAAAAEAAwABAAUAAQAIAAEACwABAA4AAQAQAAEAEwABABYAAQAZAAEAGwABAB4AAQAhAAEAJAABACYAAQApAAEALAABAC8AAQAxAAEANAABADcAAQA5AAEAPAAAAAAAAQADAAEABQABAAgAAQALAAEADgABABAAAQATAAEAFgABABkAAQAbAAEAHgABACEAAQAkAAEAJgABACkAAQAsAAEALwABADEAAQA0AAEANwABADkAAQA8AAAAAAACAAsAcACmAYUD9AXgCDoM9g8IFGcYDB3xIQoAAgAVALQBdwNHBSMHBgnwCt4M0A7CELQSoxSQFnUYVBooHPIdrB9WIesiaiTNJR4AAgARAGoBAQO+BJsGlQioCs4MCA9REacTBxZuGNwaTB3AHzMioyQuAAIADwCPAw0HdwrJDQERHBQTF+EZgxzxHiMhEiOwJPElxCY8AAAAAAACAAsAcACmAYUD9AXgCDoM9g8IFGcYDB3xIQoAAgAVALQBdwNHBSMHBgnwCt4M0A7CELQSoxSQFnUYVBooHPIdrB9WIesiaiTNJR4AAgARAGoBAQO+BJsGlQioCs4MCA9REacTBxZuGNwaTB3AHzMioyQuAAIADwCPAw0HdwrJDQERHBQTF+EZgxzxHiMhEiOwJPElxCY8AAAAAAABAAIAAQAEAAEABgABAAgAAQAKAAEADAABAA4AAQAQAAEAEgABABQAAQAWAAEAGAABABoAAQAcAAEAHgABACAAAQAiAAEAJAABACYAAQAoAAEAKgABACwAAQAuAAEAMAABADIAAQA0AAEANgABADgAAQA6AAEAPAAAAAAAAQACAAEABAABAAYAAQAIAAEACgABAAwAAQAOAAEAEAABABIAAQAUAAEAFgABABgAAQAaAAEAHAABAB4AAQAgAAEAIgABACQAAQAmAAEAKAABACoAAQAsAAEALgABADAAAQAyAAEANAABADYAAQA4AAEAOgABADwAAAAAAAEAAgABAAQAAQAGAAEACAABAAoAAQAMAAEADgABABAAAQASAAEAFAABABYAAQAYAAEAGgABABwAAQAeAAEAIAABACIAAQAkAAEAJgABACgAAQAqAAEALAABAC4AAQAwAAEAMgABADQAAQA2AAEAOAABADoAAQA8AAAAAAACAAsAcACmAYUD9AXgCDoM9g8IFGcYDB3xIQoAAgAVALQBdwNHBSMHBgnwCt4M0A7CELQSoxSQFnUYVBooHPIdrB9WIesiaiTNJR4AAgARAGoBAQO+BJsGlQioCs4MCA9REacTBxZuGNwaTB3AHzMioyQuAAIADwCPAw0HdwrJDQERHBQTF+EZgxzxHiMhEiOwJPElxCY8AAAAAAACAAsAcACmAYUD9AXgCDoM9g8IFGcYDB3xIQoAAgAVALQBdwNHBSMHBgnwCt4M0A7CELQSoxSQFnUYVBooHPIdrB9WIesiaiTNJR4AAgARAGoBAQO+BJsGlQioCs4MCA9REacTBxZuGNwaTB3AHzMioyQuAAIADwCPAw0HdwrJDQERHBQTF+EZgxzxHiMhEiOwJPElxCY8AAAAAAACAAsAcACmAYUD9AXgCDoM9g8IFGcYDB3xIQoAAgAVALQBdwNHBSMHBgnwCt4M0A7CELQSoxSQFnUYVBooHPIdrB9WIesiaiTNJR4AAgARAGoBAQO+BJsGlQioCs4MCA9REacTBxZuGNwaTB3AHzMioyQuAAIADwCPAw0HdwrJDQERHBQTF+EZgxzxHiMhEiOwJPElxCY8AAAAAAACAAsAcACmAYUD9AXgCDoM9g8IFGcYDB3xIQoAAgAVALQBdwNHBSMHBgnwCt4M0A7CELQSoxSQFnUYVBooHPIdrB9WIesiaiTNJR4AAgARAGoBAQO+BJsGlQioCs4MCA9REacTBxZuGNwaTB3AHzMioyQuAAIADwCPAw0HdwrJDQERHBQTF+EZgxzxHiMhEiOwJPElxCY8AAAAAAACABQAegL1BGsH2wlGDKkOAxFQE5AVwRfdGeMb0h2jH1Ih2iI1JFslQCbYJhMAAgAfAC8AqwBkAUoCVgOCBMYFHweKCAUKigsYDa4OSRDoEYcTKBXHFmIY+BmGGwsdhh7xH0ohjiK6I8YkrCVlJuEmMQACAAwAiwD0Af0DgQZjCZEM+g+TE1AXKBsWHw8jPAAAAAAAAgASAL4CeQUwCOIKig0nELYSNxWjF/kZNBxPHkYgESKqIwUlFibMJhEAAgAfAC8AqwBkAUoCVgOCBMYFHweKCAUKigsYDa4OSRDoEYcTKBXHFmIY+BmGGwsdhh7xH0ohjiK6I8YkrCVlJuEmLwACAA4AagCCARwDHAVtBwAKygy+D9cSDRZZGbgcJCCYIzwAAAAAAAEACwABAA8AAQATAAEAFwABABsAAQAoAAAAAAABAAsAAQAPAAEAEwABABcAAQAbAAEAKAAAAAAAAQALAAEADwABABMAAQAXAAEAGwABACgAAAAAAAEACwABAA8AAQATAAEAFwABABsAAQAoAAAAAAABAAsAAQAPAAEAEwABABcAAQAbAAEAKAAAAAAAAQALAAEADwABABMAAQAXAAEAGwABACgAAAAAAAEACwAAAA8AAQATAAEAFwABABsAAQAoAAAAAAABAAsAAAAPAAEAEwABABcAAQAbAAEAKAAAAAAAAQALAAEADwABABMAAQAXAAEAGwABACgAAAAAAAEACwABAA8AAQATAAEAFwABABsAAQAoAAAAAAABAAsAAQAPAAEAEwABABcAAQAbAAEAKAAAAAAAAQALAAEADwABABMAAQAXAAEAGwABACgAAAAAAAIAEgDHAosFSAgAC6wNThDhEmEVzhcjGlwcdB5mICwivyMUJR4mzyYRAAIAHwAZAGEAzwBfAQ0C1gK0A6gErwXHBu0HIQlhCq0LAw1iDskPOBGtEioUrBUzF74YTBreG3IdCR+jID0i2CN0JS8AAgAOAMEAjgIABd8HBwtdDswRRBWzGAkcMR8QIoIkTyY8AAAAAAACAA8ATAOTBtIJAw0kEDITJhb8GK0bMx6EIJYiXCTEJbUmDgACAB8ALwCrAGQBSgJWA4IExgUfB4oIBQqKCxgNrg5JEOgRhxMoFccWYhj4GYYbCx2GHvEfSiGOIrojxiSsJWUm4SYsAAIAEQBNABsBTQLPA5EFiQeuCfgLYg7lEIATLhboGLEbgx5aITQkPAAAAAAAAgASAMcCiwVICAALrA1OEOESYRXOFyMaXBx0HmYgLCK/IxQlHibPJhEAAgAfAC8AqwBkAUoCVgOCBMYFHweKCAUKigsYDa4OSRDoEYcTKBXHFmIY+BmGGwsdhh7xH0ohjiK6I8YkrCVlJuEmLwACAA4AbQCLASwDMgWJByAK6wzhD/oSLhZ3GdAcNiCiIzwAAAAAAAIADwBMA5MG0gkDDSQQMhMmFvwYrRszHoQgliJcJMQltSYOAAIAHwAvAKsAZAFKAlYDggTGBR8HiggFCooLGA2uDkkQ6BGHEygVxxZiGPgZhhsLHYYe8R9KIY4iuiPGJKwlZSbhJiwAAgARAE0AGwFNAs8DkQWJB64J+AtiDuUQgBMuFugYsRuDHlohNCQ8AAAAAAACABEA0AKiBXIIPgsEDr8QbBMHFo4Y+xpKHXMfcCE2I7wk8SXCJhAAAQAuAAIADwBZAEgBqwJsBHkGxQhHC/QNxxC5E8gW7BkjHWYgtyM8AAAAAAACAB8ALwCrAGQBSgJWA4IExgUfB4oIBQqKCxgNrg5JEOgRhxMoFccWYhj4GYYbCx2GHvEfSiGOIrojxiSsJWUm4SYeAAIAHwAvAKsAZAFKAlYDggTGBR8HiggFCooLGA2uDkkQ6BGHEygVxxZiGPgZhhsLHYYe8R9KIY4iuiPGJKwlZSbhJjwAAAAAAAIAHwAvAKsAZAFKAlYDggTGBR8HiggFCooLGA2uDkkQ6BGHEygVxxZiGPgZhhsLHYYe8R9KIY4iuiPGJKwlZSbhJh4AAgAfAC8AqwBkAUoCVgOCBMYFHweKCAUKigsYDa4OSRDoEYcTKBXHFmIY+BmGGwsdhh7xH0ohjiK6I8YkrCVlJuEmPAAAAAAAAAADAAIAGgBTApUExAbiCPEK8QzhDsQQmBJdFBMWuxdUGd0aVxzBHRgfXSCOIaoiriOYJGYlEiaXJvAmHAAAAB4AAgAcAB8CIAQJBuAHpwlgCw4Nsg5LENsRYhPhFFgWxRcrGYga3BsnHWcenR/HIOUh8yLxI9okqiVZJtomOQAAAAAAAAADAAIAGgBTApUExAbiCPEK8QzhDsQQmBJdFBMWuxdUGd0aVxzBHRgfXSCOIaoiriOYJGYlEiaXJvAmHAAAAB4AAgAcAB8CIAQJBuAHpwlgCw4Nsg5LENsRYhPhFFgWxRcrGYga3BsnHWcenR/HIOUh8yLxI9okqiVZJtomOQAAAAAAAAAQAAIAKgCfAS8DtAQtBp0HAwlfCrEL/Aw/DnkPrRDaEf4SHBQyFUMWTBdPGEwZQhoxGxkc+hzVHakedh87IPggrSFaIgAjmyMuJLYkNCWlJQomYiaqJuAmAyc5AAAAAAAAABAAAgAqAJ8BLwO0BC0GnQcDCV8KsQv8DD8OeQ+tENoR/hIcFDIVQxZMF08YTBlCGjEbGRz6HNUdqR52Hzsg+CCtIVoiACObIy4ktiQ0JaUlCiZiJqom4CYDJzkAAAAAAAAABQACABkAAQSDB6AKbQ32D0cSaBRfFi0Y2hloG9kcLR5oH4oglSGKImgjMSTkJIAlBiZzJsYm/CYdAAAAHgACAB8AJAPEBRcILQobDOUNkg8oEaoSGBR2FcYWBxg8GWUagxuVHJ8dnR6RH3sgWyExIvwivCNvJBUlrCUxJp8m7yY8AAAAAAAAAAUAAgAZAAEEgwegCm0N9g9HEmgUXxYtGNoZaBvZHC0eaB+KIJUhiiJoIzEk5CSAJQYmcybGJvwmHQAAAB4AAgAfACQDxAUXCC0KGwzlDZIPKBGqEhgUdhXGFgcYPBllGoMblRyfHZ0ekR97IFshMSL8IrwjbyQVJawlMSafJu8mPAAAAAAAAgAMAKEFrwo7D1kTEBdnGmQdByBOIjQksCWvJgsAAAAOAAIAEQAgBPAHeAvADswRoRRCF7IZ8RsCHuQfliEWI2QkeCVOJtwmHgAAACAAAgARAPcDdAegCo8NTRDiElMVoxfWGewb5B2+H3ohESN+JLclpCYwAAAAAAACAAwAoQWvCjsPWRMQF2caZB0HIE4iNCSwJa8mCwAAAA4AAgARACAE8Ad4C8AOzBGhFEIXshnxGwIe5B+WIRYjZCR4JU4m3CYeAAAAIAACABEA9wN0B6AKjw1NEOISUxWjF9YZ7BvkHb4feiERI34ktyWkJjAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAB0A//8eAAAAPAD//wAAAQAFAAIABQAbBSMMhxPtGvUhCQAAABYAAgAIAN8B6wUHC6YQahYJHCUhMSUdAAEAHgACAAgA+gJgByMMDREDFu0asB8WJCUAAAAyAAIACwAgAbYDHwcHCzYPhxPaFwkc8R9aI/AlPAAAAAAAAAALAP//DgAAAB4A//8gAAAAMAD//wAAAgAEAHQGFA/8F5wgAwAAAAgAAgAEAAAFXQ6zGBAiCwABAA4AAgAEAHQGFA/8F5wgEQAAABcAAgAIAN8B6wUHC6YQahYJHCUhMSUeAAEAIAACAAQAdAYUD/wXnCAjAAAAKQACAAgA3wHrBQcLphBqFgkcJSExJTAAAAAAAAAAOQD//wAAAQAJAAIACADfAesFBwumEGoWCRwlITElEAABACcAAgATAHIAjgEeAwAFHwdsCdgLXQ7uEIcTIhazGDgbpB3xHxAi8iOCJZ4mOQAAAAAAAAAcAP//HgAAADkA//8AAAEAAwACAAsAIAG2Ax8HBws2D4cT2hcJHPEfWiPwJQ0AAAASAAIACwAgAbYDHwcHCzYPhxPaFwkc8R9aI/AlHAABAB4AAgAKAPcETAldDUIRAhWgGBwcbx+LIk8lJwAAACwAAgAOAMEAjgIABd8HBwtdDswRRBWzGAkcMR8QIoIkTyY5AAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAJAP//CwAAABEA//8TAAAAGgD//xwAAAAkAP//JQAAACsA//8tAAAANAD//zUAAAA7AP//PAAAAAAAAQAEAAIABgD+CTYSBBmQHuMi3CUJAAEACwABAA4AAgAEAHcNwheIH9kkEQABABMAAQAWAAIABQB4C6EU8RuWIXglGgABABwAAQAfAAIABgD+CTYSBBmQHuMi3CUkAAEAJQABACgAAgAEAHcNwheIH9kkKwABAC0AAQAwAAIABQB4C6EU8RuWIXglNAABADUAAQA4AAIABAB3DcIXiB/ZJDsAAQA8AAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAEAOgACAAMANhA0HAkkPAACAAUAuQyIFtgd9CIEJkAAAABsAAAAAAABADoAAgADADYQNBwJJDwAAgAFALkMiBbYHfQiBCZAAAAAbAAAAAAAAQAFAAEACAABAAoAAQAOAAEAEAABABUAAQAYAAEAGgABAB4AAQAgAAEAJQABACgAAQAqAAEALgABADAAAQAyAAAAOgACAAMANhA0HAkkPAACAAUAuQyIFtgd9CIEJkAAAABsAAIABwCyALoCBAZ9ChcQvxZtHnIAAgACAEwMYhlzAAEAdwABAHkAAQB+AAEAgQABAIMAAQCHAAEAiQABAIsAAQCOAAEAkAABAJIAAQCVAAAAAAACABoANAC8AIcBhwKwA/0EZQbmB3oJHgvODIkOSxAUEuATrBV3Fz4ZAhu+HG4eEyCnISojlSTkJRkAAgAeADIAtgB4AWoChAO+BBIGfAf3CIEKFQy1DVoPBBGxEl8UDBa2F1sZ+xqPHBkelB/+IFIijCOmJJglWibeJjYAAgARAIoA3wG2A+sFYggHC8wNphCHE2oWRBkJHK4eJSFaIzElhiZGAAIADwBXA6YG6wkjDUgQWBNNFiMZ0htUHqAgrSJsJMwluCZUAAIAJAAkAIMAEgHIAZ0CjQOSBKsF0wYKCEsJlgrpC0MNog4HEGwR1BI8FKQVCRduGM0ZJxt6HMUdBh89IGUhfiKDI3MkSCX+JY0m7CZ3AAIAHwAvAKsAZAFKAlYDggTGBR8HiggFCooLGA2uDkkQ6BGHEygVxxZiGPgZhhsLHYYe8R9KIY4iuiPGJKwlZSbhJpUAAAAAAAIANwANADAAZwCwAAkBbwHiAWAC5wJ4AxIEswRbBQkGvQZ2BzQI9gi8CYYKUwsjDPYMyg2iDnoPUxAvEQwS6BLHE6UUgxVgFj0XGxj1GNAZqhqCG1ccKx37HcoelR9cICAh4SGbIlEjAyStJFIl7yWEJjYAAgARAIoA3wG2A+sFYggHC8wNphCHE2oWRBkJHK4eJSFaIzElhiZGAAIAMgANARgCJQMwBDkFRAZMB1MIWgldCmILZAxkDWMOXw9ZEFERRxI7EysUGRUFFu0W0he0GJEZaxpCGxMc4BypHWweKh/jH5YgQiHnIYYiHSOsIzMksSQlJY8l7iVCJokmwibsJgcndwACAB8ALwCrAGQBSgJWA4IExgUfB4oIBQqKCxgNrg5JEOgRhxMoFccWYhj4GYYbCx2GHvEfSiGOIrojxiSsJWUm4SaVAAAAAAABADoAAgADAOIGcxAIGzwAAABrAAAAAAABAAMAAQAFAAEACAABAAsAAQAOAAEAEAABABMAAQAWAAEAGQABABsAAQAeAAEAIQABACQAAQAmAAEAKQABACwAAQAvAAEAMQAAADoAAgADAOIGcxAIGzwAAABrAAEAbQABAG8AAQByAAEAdAABAHcAAQB6AAEAfQABAH8AAQCCAAEAhQABAIgAAQCKAAEAjQABAJAAAQCSAAEAlQAAAAAAAQARAAEAFQABABkAAQAhAAEALgABADAAAQAzAAEAOAABAD0AAQBAAAEARAABAEwAAQBUAAEAWAABAF8AAQBoAAEAcQABAHQAAQB8AAEAgQABAIQAAQCHAAEAjQABAJUAAAAAAAIADgCrCVwQZhVbGYQcEx8jIc4iICQnJe0leibUJgMnDQACAAYA8wQjCo0PKRX3Gu8gEgACAAQAUwfuDskW1x4VAAIABQA3BogM+BKHGTkgGQACAAYAagXgCmMQ9RWXG0ohHgACAAUAUga2DCoTtBlVICIAAgADAP0KERViHiQAAgADAPIJvRNuHSYAAgADAPIJvRNuHSgAAgADAPsJ3xOXHSoAAgADAPoJ2xOSHSwAAgADAPUJ1xORHS4AAgADAPUJ1xORHTAAAgADAB4K+BObHTIAAgAJAOADvgefC4IPZxNOFzgbJh8ZIzoAAgADACQHiBBaGzwAAABrAAIABQAPEZ0ZGB/TImAlbwACAAQATxAHG74hgiVyAAIABQCkCRUSiRnkH8gkdgACACAA1AGiA2kFKwfnCJkKRwzrDYgPHRGpEiwUpBUUF3gY0RkfG2EclR26HtMf3CDVIbwikiNVJAMlmyUbJoMm0Cb/JpUAAAAAAAIADgCrCVwQZhVbGYQcEx8jIc4iICQnJe0leibUJgMnDQACAAYA8wQjCo0PKRX3Gu8gEgACAAQAUwfuDskW1x4VAAIACgBgA8gGOAqxDTMRvxRTGPIbnB9QIx4AAgAFAFIGtgwqE7QZVSAiAAIAEQCIAgIFbwfRCScMcQ6xEOcSERUzF0sZWxtiHWAfVyFHIy4lMgACAAkA4AO+B58Lgg9nE04XOBsmHxkjOgACAAMAJAeIEFobPAAAAGsAAgAFAA8RnRkYH9MiYCVvAAIABABPEAcbviGCJXIAAgAFAKQJFRKJGeQfyCR2AAIAIADUAaIDaQUrB+cImQpHDOsNiA8dEakSLBSkFRQXeBjRGR8bYRyVHboe0x/cINUhvCKSI1UkAyWbJRsmgybQJv8mlQAAAAAAAgA7ANkCXAWfB6sJjAtGDd8OXBC/EQsTQhRmFXoWfRdyGFsZNhoFG8obhBw2Hdwdex4TH6EfKSCqICMhlyEEImwiziIpI4Ej0yMgJGgkrCTsJCclXyWSJcEl7SUWJjomXCZ6JpUmrSbCJtQm5CbxJvsmAycJJw0nDyc6AAIAAwAkB4gQWhs8AAAAawAAAAAAAAAAAAIAEABGAo4E1wYiCXALvQ0KEFoSqBT3FkYZlBvjHTAgfCLHJA8AAgAGAIQFCwuXECkWwhtjIRQAAgBaAHwA+AB0AfABawLnAmID3gNZBNMETgXIBUMGvgY4B7EHKgikCB4JlwkPCocKAAt5C/ALaAzfDFYNzQ1DDroOLw+kDxoQjxAEEXgR7BFfEtMSRRO4EysUmxQOFX4V7hVfFs4WPResFxoYiBj2GGIZzxk7GqYaEBt7G+QbThy2HB4dhR3tHVMeuR4eH4If5h9IIKogDSFtIc4hLSKMIukiRyOjI/8jWSS0JAwlZSW8JRMmaCa8Jm0AAQBvAAEAcQABAHQAAQB3AAEAfAABAJUAAAAAAAAAHgAAAB8AAgADAI4RFx1DJCEAAAAjAAAAjQAAAJUAAAAAAAAABgACAAMAtwJ1CrgWCAAAAAkAAgADAI4RFx1DJAsAAgAEACIQThodIWElDgAAABwAAgADALcCdQq4Fh4AAAAfAAIAAwCOERcdQyQhAAAAIwAAAIYAAgADALcCdQq4FogAAACJAAIAAwAHDkoY/SCLAAAAjQAAAAAAAQARAAAAFQABABkAAQAdAAEAIQABAC4AAAAwAAEAMwABADUAAQA4AAEAPQAAAEAAAQBEAAEASAABAEwAAQBUAAEAWAABAFsAAQBfAAEAaAABAHEAAQB0AAEAeAABAHwAAQCBAAAAhAABAIcAAQCKAAEAjQABAJUAAAAAAAIADgA4ANsA4wFLAw8FKQeWCVIMWA+oEj0WFBosHn8iDQACAAQAkwdBDw0X+x4QAAIABgBPBb0KQxDfFYwbSCEVAAIABABIDxsaYiGhJRgAAgAEAMkJjxOOHL4jGwACAAQASA8bGmIhoSUeAAIABADJCY8Tjhy+IyEAAgAEAEgPGxpiIaElJAACAAQAyQmPE44cviMnAAIABABIDxsaYiGhJSoAAgAJAMIDjgdiCz0PIxMQFwUbAR8EIzIAAgADAKgJbRNAHTQAAAA2AAAAOQACAAQA3we3D4cXUR88AAAAVwACAAMA0gyzGGAiWQACABYATAKTBNgGGQlTC4YNsg/SEegT8hXsF9YZrxtyHR8fsSAlInYjoCSbJV8m4CZuAAIABQCWBicNsBMvGqUgcgACACQAqwFQA/EEjAYhCK8JOAu6DDQOqQ8VEXsS2RMuFXwWwRf8GC0aVRtyHIUdjB6IH3ggWyEwIvcisSNaJPQkfCXyJVUmpSbgJgQnlQAAAAAAAgAOADgA2wDjAUsDDwUpB5YJUgxYD6gSPRYUGiwefyINAAIABACTB0EPDRf7HhAAAgAGAE8FvQpDEN8VjBtIIRUAAgAEAEgPGxpiIaElGAACAAQAyQmPE44cviMbAAIABABIDxsaYiGhJR4AAgAEAMkJjxOOHL4jIQACAAQASA8bGmIhoSUkAAIABADJCY8Tjhy+IycAAgAEAEgPGxpiIaElKgACAAkAwgOOB2ILPQ8jExAXBRsBHwQjMgACAAMAqAltE0AdNAAAADkAAgAEAN8Htw+HF1EfPAAAAE4AAgAKAB4FFArbDmcTrhejGzIfRCK7JGsmVwACAAMA0gyzGGAiWQACABYATAKTBNgGGQlTC4YNsg/SEegT8hXsF9YZrxtyHR8fsSAlInYjoCSbJV8m4CZuAAIABQCWBicNsBMvGqUgcgACACQAqwFQA/EEjAYhCK8JOAu6DDQOqQ8VEXsS2RMuFXwWwRf8GC0aVRtyHIUdjB6IH3ggWyEwIvcisSNaJPQkfCXyJVUmpSbgJgQnlQAAAAAAAQARAAEAFQABABkAAQAdAAEAIQABAC4AAQAwAAEAMwABADUAAQA4AAEAPQABAEAAAQBEAAEASAABAEwAAQBUAAEAWAABAFsAAQBfAAEAaAABAHEAAQB0AAEAeAABAHwAAQCBAAEAhAABAIcAAQCKAAEAjQABAJUAAAAAAAIABwDYBK4JiQ5nE0gYLh0bIgYAAgAIAEwEmgjpDDoRjBXlGUIepiINAAIABAC+B38PSRciHxAAAgAGAIQFCwuXECkWwhtjIRUAAgAEAEgPGxpiIaElGAACAAQA1ArlFKYdPCQbAAIABABIDxsaYiGhJR4AAgAEANQK5RSmHTwkIQACAAQASA8bGmIhoSUkAAIABADUCuUUph08JCcAAgAEAEgPGxpiIaElKgACAAkA9QPkB88LuQ+eE4MXZhtIHysjMgACAAMAnwliEzkdNAACAAMAvwl9Ez8dNgACAAQA0QebD2YXNh85AAIABADzB88PmBdXHzwAAABOAAIACgAnBSMK7Q56E8IXsxs+H04iwSRtJlcAAgADAL8JfRM/HVkAAgAWAEwCkwTYBhkJUwuGDbIP0hHoE/IV7BfWGa8bch0fH7EgJSJ2I6AkmyVfJuAmbgACAAUAmAYvDcATRBq3IHIAAgAkAL4BeAMqBdMGeAgTCqYLMw22DjMQphEPE3AUyBUVF1oYkxnBGuUb/RwKHgof/h/lIL8hiiJII/UjlCQjJaElDiZpJrAm5SYFJ5UAAAAAAAIAFQDCAYUDSAUNB9MImgpgDCcO7w+4EYATShUSF9oYoxprHDMe+h/BIYYjTCUUAAIADgCjAkUF5AeBCh4NuQ9SEusUgxcaGrIcSB/gIXgkIQACAA4AoQJCBeQHhgomDcYPZhIEFaAXORrRHGUf9yGGJC4AAgBAAKwAVgECAq0CVwMBBKoEVAX8BaUGTAfzB5oIQgnnCYwKMgvWC3sMHg3BDWQOBg+mD0cQ6BCIEScSxRJjEwAUnRQ4FdQVbxYIF6EXOhjSGGkZ/xmUGikbvRtQHOIcdB0FHpUeIx+yHz8gyyBWIeEhaiLyInojACSFJAoljSUPJpAmbQACAAUAmAYvDcATRBq3IHEAAgAGAMIFcwsTEaYWKhyiIXYAAgAgAAcCAwT0Bd0HuQmKC1INDQ+8EF8S9hN+FfsWahjJGR0bXxyTHbgezB/OIMEhoSJvIyok0iRmJeUlTiaiJt8mAyeVAAAAAAACAAUAcwFsBXcLQhOHHAQAAgAGAP4JNhIEGZAe4yLcJQkAAAALAAIABAAPAp0H9A+RGg4AAgAEAHcNwheIH9kkEQAAABMAAgAEAA8CnQf0D5EaFgACAAUAeAuhFPEbliF4JRoAAAAcAAIABAAPAp0H9A+RGh8AAgAGAP4JNhIEGZAe4yLcJSQAAAAlAAIABAAPAp0H9A+RGigAAgAEAHcNwheIH9kkKwAAAC0AAgAEAA8CnQf0D5EaMAAAADoAAgADAKsL5hX2HjwAAABRAAEAUgACAAQADwKdB/QPkRpVAAIABAB3DcIXiB/ZJFgAAABZAAIABQBzAWwFdwtCE4ccXQACAAYA/gk2EgQZkB7jItwlYgAAAGQAAgAEAA8CnQf0D5EaZwACAAQAdw3CF4gf2SRqAAAAbAACAAQADwKdB/QPkRpvAAIABQB4C6EU8RuWIXglcwAAAHUAAgAEAA8CnQf0D5EaeAACAAYA/gk2EgQZkB7jItwlfQAAAH4AAgAEAA8CnQf0D5EagQACAAQAdw3CF4gf2SSEAAAAhgACAAQADwKdB/QPkRqJAAIABQB4C6EU8RuWIXgljQAAAI4AAgAEAA8CnQf0D5EakQACAAQAdw3CF4gf2SSUAAAAlQAAAAAAAgA9AAQADwAhADoAWgCBAK4A4gAcAVwBowHuAUACmQL1AlkDwQMuBKEEGQWVBRgGngYqB7oHTgjnCIUJJwrNCncLJwzZDJANSw4KD8wPkhBdESoS/BLQE6gUgxVkFkUXLBgVGQIa8BrjG9kc0R3NHswfzSDRIdki4iPuJP4lPAAAAFEAAQBSAAAAAAACAAUAcwFsBXcLQhOHHAQAAgAGAP4JNhIEGZAe4yLcJQkAAAALAAIABAAPAp0H9A+RGg4AAgAEAHcNwheIH9kkEQAAABMAAgAEAA8CnQf0D5EaFgACAAUAeAuhFPEbliF4JRoAAAAcAAIABAAPAp0H9A+RGh8AAgAGAP4JNhIEGZAe4yLcJSQAAAAlAAIABAAPAp0H9A+RGigAAgAEAHcNwheIH9kkKwAAAC0AAgAEAA8CnQf0D5EaMAAAADoAAgADAKsL5hX2HjwAAABRAAEAUgACAAQADwKdB/QPkRpVAAIABAB3DcIXiB/ZJFgAAABZAAIABQBzAWwFdwtCE4ccXQACAAYA/gk2EgQZkB7jItwlYgAAAGQAAgAEAA8CnQf0D5EaZwACAAQAdw3CF4gf2SRqAAAAbAACAAQADwKdB/QPkRpvAAIABQB4C6EU8RuWIXglcwAAAHUAAgAEAA8CnQf0D5EaeAACAAYA/gk2EgQZkB7jItwlfQAAAH4AAgAEAA8CnQf0D5EagQACAAQAdw3CF4gf2SSEAAAAhgACAAQADwKdB/QPkRqJAAIABQB4C6EU8RuWIXgljQAAAI4AAgAEAA8CnQf0D5EakQACAAQAdw3CF4gf2SSUAAAAlQAAAAAAAQARAAEAFQABABkAAQAdAAEAIQABAC4AAQAwAAEAMwABADUAAQA4AAEAPQABAEAAAQBEAAEASAABAEwAAQBUAAEAWAABAFsAAQBfAAEAaAABAHEAAQB0AAEAeAABAHwAAQCBAAEAhAABAIcAAQCKAAEAjQABAJUAAAAAAAIACgBCArcFhAl4DYARkBWYGYwdWSHOJAkAAQALAAEAkwABAJUAAAAAAAIABAB0BhQP/BecIAMAAQAFAAEABwABAAkAAQALAAEADQABAA8AAQARAAEAEwABABUAAQAXAAEAGQABABsAAQAdAAEAHwABACEAAQAjAAEAJQABACcAAQApAAEAKwABAC0AAQAvAAEAMQABADMAAQA1AAEANwABADkAAQA7AAEAPQABAD4AAQBAAAEAQgABAEQAAQBGAAEASAABAEoAAQBLAAEATQABAE8AAQBRAAEAUwABAFUAAQBWAAEAWAABAFoAAQBcAAEAXgABAGAAAQBiAAEAaQABAGsAAQBtAAEAbwABAHEAAQBzAAEAdQABAHcAAQB5AAEAewABAH0AAQB/AAEAgQABAIMAAgADAN8PxRm0IYUAAQCHAAEAiQABAIsAAQCNAAEAjwABAJEAAQCTAAEAlQAAAAAAAgARAC0ArgB+AZYC8QOKBV4HZwmkCxAOqRBuE1sWbhmlHPwfdyMQAAIAFQB+AQQDkQQnBsQHaQkUC8cMgA5AEAcS0xOmFX4XXRlCGywdGx8QIQsjCyUkAAIAFQCzAWgDIAXYBpQIUgoRDNMNlg9cESIT6xS2FoEYTxoeHO0dvh+RIWUjOiU4AAAAUAACACAAjgEbA6gENQbBB00J1QpcDOANYQ/cEFUSyBM2FZ4W/xdZGaoa8hsxHWMeih+kIK4hqSKRI2QkIiXHJU4mtib4Jm8AAgAEAL4Hfw9JFyIfcgACACQAbQHZAkQErgUXB30I4glFC6YMAw5dD7UQBxJWE6AU5BUkF14YkBm7Gt8b/BwOHhgfFiAKIfAhyiKVI1Ak+iSQJRImeybLJv4mlQAAAAAAAQARAAEAFQABABkAAQAdAAEAIQABAC4AAQAwAAEAMwABADUAAQA4AAEAPQABAEAAAQBEAAEASAABAEwAAQBUAAEAWAABAFsAAQBfAAEAaAABAHEAAQB0AAEAeAABAHwAAQCBAAEAhAABAIcAAQCKAAEAjQABAJUAAAAAAAAAOgACAAMAKgR6DYEZPAAAAGsAAgAIAN8B6wUHC6YQahYJHCUhMSVyAAAAAAACABUAwgGFA0gFDQfTCJoKYAwnDu8PuBGAE0oVEhfaGKMaaxwzHvofwSGGI0wlFAACAA4AowJFBeQHgQoeDbkPUhLrFIMXGhqyHEgf4CF4JCEAAgAOAKECQgXkB4YKJg3GD2YSBBWgFzka0RxlH/chhiQuAAIAQACsAFYBAgKtAlcDAQSqBFQF/AWlBkwH8weaCEIJ5wmMCjIL1gt7DB4NwQ1kDgYPpg9HEOgQiBEnEsUSYxMAFJ0UOBXUFW8WCBehFzoY0hhpGf8ZlBopG70bUBziHHQdBR6VHiMfsh8/IMsgViHhIWoi8iJ6IwAkhSQKJY0lDyaQJm0AAgAFAJgGLw3AE0QatyBxAAIABgDCBXMLExGmFiocoiF2AAIAIAAHAgME9AXdB7kJigtSDQ0PvBBfEvYTfhX7FmoYyRkdG18ckx24HswfziDBIaEibyMqJNIkZiXlJU4moibfJgMnlQAAAAAAAAAAAAEAEQAAABUAAQAZAAEAHQABACEAAQAuAAAAMAABADMAAQA1AAEAOAABAD0AAABAAAEARAABAEgAAQBMAAEAVAABAFgAAQBbAAEAXwABAGgAAQBxAAEAdAABAHgAAQB8AAEAgQAAAIQAAQCHAAEAigABAI0AAQCVAAAAAAACAAkA3wPDB6sLlQ+AE20XWRtDHysjCAACAAcA1ASqCYIOXhNBGCkdGCIOAAIABwDYBLgJnA6EE20YVB00IhQAAgAHANcEtgmZDoATaBhPHTIiGgACAAcA1ASxCZYOfBNlGE0dMiIgAAIABwDUBLEJlg58E2UYTR0yIiYAAgBIAHECngSWBmAIAwqKC/UMSg6HD7IQzxHaEtcTyBStFYcWVRccGNkYjhk6Gt8afxsWHKccMx24HTketB4qH5sfByBvINMgMyGNIeUhOiKKItciISNnI6oj6iMnJGEkmSTNJP8kLiVbJYUlrSXSJfUlFiY0JlEmayaDJpkmrSa/Js8m3SbqJvQm/SYEJwknDScPJ20AAgAEAOYHuw+HF00fcAACAAQA5ge7D4cXTR9zAAIABADvB9gPshdzH3YAAgAEAO4H1Q+vF28feQACAAUAuQZZDeITVxq6IH0AAgAGAOwFwAt6ERQXjxzjIYIAAgAUAF8DnQa3Ca8Mhg82EsAUJhdlGXwbah0uH8ggNiJ4I4skbyUkJqYm9SaVAAAAAAABABEAAQAVAAEAGQABAB0AAQAhAAEALgABADAAAQAzAAEANQABADgAAQA9AAEAQAABAEQAAQBIAAEATAABAFQAAQBYAAEAWwABAF8AAQBoAAEAcQABAHQAAQB4AAEAfAABAIEAAQCEAAEAhwABAIoAAQCNAAEAlQAAAAAAAQAFAAEACAABAAoAAQAOAAEAEAABABUAAQAYAAEAGgABAB4AAQAgAAEAJQABACgAAQAqAAEALgABADAAAQAyAAEANQABADcAAQA5AAEAPAABAEEAAQBEAAEARgABAEoAAQBNAAEATwABAFEAAQBUAAEAWQABAFwAAQBeAAEAYgABAGkAAQBuAAEAcQABAHMAAQB3AAEAeQABAH4AAQCBAAEAgwABAIcAAQCJAAEAiwABAI4AAQCQAAEAkgABAJUAAAAAAAIACQCDAPoBTARmBzQLqg+6FFcadiAIAAIABwBuBPwIqg16EmoXfxy2IQ4AAgAHAIoELAnmDboSpxevHNIhFAACAAcAqAReCSQO+RLhF9wc7CEaAAIABwCpBGYJNw4XEwcYAR0EIiAAAgAHAMIEjAlcDjUTGRgJHQUiJgACAEgAcQKeBJYGYAgDCooL9QxKDocPshDPEdoS1xPIFK0VhxZVFxwY2RiOGToa3xp/GxYcpxwzHbgdOR60Hiofmx8HIG8g0yAzIY0h5SE6Iooi1yIhI2cjqiPqIyckYSSZJM0k/yQuJVslhSWtJdIl9SUWJjQmUSZrJoMmmSatJr8mzybdJuom9Cb9JgQnCScNJw8nbQACAAQA5ge7D4cXTR9wAAIABADkB7kPgxdIH3MAAgAEAOEHtA+AF0gfdgACAAQA4Qe0D4AXSB95AAIABQC2BlMN2xNQGrYgfQACAAYA3wWiC0wR3BZXHL0hggACABQAIwMuBiIJ+gu2DlgR2hM+FoAYoRqdHHUeJiCuIQkjNyQ0JQAmlSbxJpUAAAAAAAIACgBCArcFhAl4DYARkBWYGYwdWSHOJAkAAQALAAEAkwABAJUAAAAAAAIABAB0BhQP/BecIAMAAQAFAAEABwABAAkAAQALAAEADQABAA8AAQARAAEAEwABABUAAQAXAAEAGQABABsAAQAdAAEAHwABACEAAQAjAAEAJQABACcAAQApAAEAKwABAC0AAQAvAAEAMQABADMAAQA1AAEANwABADkAAQA7AAEAPQACAAIAsQQGEj4AAQBAAAEAQgABAEQAAQBGAAEASAABAEoAAQBLAAEATQABAE8AAQBRAAEAUwABAFUAAgACALEEBhJWAAEAWAABAFoAAQBcAAEAXgABAGAAAQBiAAEAaQABAGsAAQBtAAEAbwABAHEAAQBzAAEAdQABAHcAAQB5AAEAewABAH0AAQB/AAEAgQABAIMAAgADAN8PxRm0IYUAAQCHAAEAiQABAIsAAQCNAAEAjwABAJEAAQCTAAEAlQAAAAAAAAAAAAIAEQAmAk0EdgagCMwK+AwlD1MRgBOuFdwXCxo4HGUekiC9IuckEAACABUAywGWA2EFLAf4CMMKjQxYDiIQ7BG1E30VRBcLGdEalRxYHhog2SGYI1QlJAACABcAtgFrAx4FzQZ7CCcK0Qt5DR4PwhBkEgQUoxU/F9oYdRoNHKMdOR/NIF4i8COBJToAAABSAAIAHgBwAd8CSgSyBRkHfAjcCToLlQztDUEPkxDiES0TdhS6Ff0WOxh1Ga0a4BsRHT0eZh+LIKshxyLgI/QkBCZvAAIABADDB5UPbRdDH3IAAgANACUDPAZFCUEMLg8MEt0UoBdWGv0clx8iIqAkfgACABgAwwJxBQsIjgr8DFIPkRG3E8UVuReUGVQb+RyAHusfOSFnInYjYyQwJdolXybBJvwmlQAAAAAAAQADAAEABQABAAgAAQALAAEADgABABAAAQATAAEAFgABABkAAQAbAAEAHgABACEAAQAkAAEAJgABACkAAQAsAAEALwABADEAAQA0AAEANwABADkAAQA8AAEAPwABAEEAAQBEAAEARwABAEoAAQBMAAEATwABAFEAAQBUAAEAVwABAFkAAQBcAAEAXwABAGIAAQBpAAEAbAABAG8AAQByAAEAdAABAHcAAQB6AAEAfQABAH8AAQCCAAEAhQABAIgAAQCKAAEAjQABAJAAAQCSAAEAlQAAAAAAAQARAAEAFQABABkAAQAdAAEAIQABAC4AAQAwAAEAMwABADUAAQA4AAEAPQABAEAAAQBEAAEASAABAEwAAQBUAAEAWAABAFsAAQBfAAEAaAABAHEAAQB0AAEAeAABAHwAAQCBAAEAhAABAIcAAQCKAAEAjQABAJUAAAAAAAIACQDfA8MHqwuVD4ATbRdZG0MfKyMIAAIABwDUBKoJgg5eE0EYKR0YIg4AAgAHANgEuAmcDoQTbRhUHTQiFAACAAcA1wS2CZkOgBNoGE8dMiIaAAIABwDUBLEJlg58E2UYTR0yIiAAAgAHANQEsQmWDnwTZRhNHTIiJgACAEgAcQKeBJYGYAgDCooL9QxKDocPshDPEdoS1xPIFK0VhxZVFxwY2RiOGToa3xp/GxYcpxwzHbgdOR60Hiofmx8HIG8g0yAzIY0h5SE6Iooi1yIhI2cjqiPqIyckYSSZJM0k/yQuJVslhSWtJdIl9SUWJjQmUSZrJoMmmSatJr8mzybdJuom9Cb9JgQnCScNJw8nbQACAAQA5ge7D4cXTR9wAAIABADmB7sPhxdNH3MAAgAEAO8H2A+yF3MfdgACAAQA7gfVD68Xbx95AAIABQC5BlkN4hNXGrogfQACAAYA7AXAC3oRFBePHOMhggACABQAXwOdBrcJrwyGDzYSwBQmF2UZfBtqHS4fyCA2IngjiyRvJSQmpib1JpUAAAAAAAEAEQABABUAAQAZAAEAHQABACEAAQAuAAEAMAABADMAAQA1AAEAOAABAD0AAQBAAAEARAABAEgAAQBMAAEAVAABAFgAAQBbAAEAXwABAGgAAQBxAAEAdAABAHgAAQB8AAEAgQABAIQAAQCHAAEAigABAI0AAQCVAAAAAAABAAMAAQAFAAEACAABAAsAAQAOAAEAEAABABMAAQAWAAEAGQABABsAAQAeAAEAIQABACQAAQAmAAEAKQABACwAAQAvAAEAMQABADQAAQA3AAEAOQABADwAAQA/AAEAQQABAEQAAQBHAAEASgABAEwAAQBPAAEAUQABAFQAAQBXAAEAWQABAFwAAQBfAAEAYgABAGkAAQBsAAEAbwABAHIAAQB0AAEAdwABAHoAAQB9AAEAfwABAIIAAQCFAAEAiAABAIoAAQCNAAEAkAABAJIAAQCVAAAAAAACAAwA+gBBA0kGyQmUDYcRiRV8GUcdxyDPIxYmCwABABUAAgAIAAcHgQxmEesVJRoaHsAh+yQcAAEAJAACAA8A1gbtCkIOLhHSE0MWihitGrIcmh5oIBoirSMcJVYmMgACAAMAPwPvCmUWNAACAAMAtgfqEGobNgACAAMApAgJEi0cOAACAAMA+wh2EnocOgACAAMAHgmjEpocPAACAAMAQQnRErscPgACAAMAOQnYEs4cQAACAAMASQnYEr8cQgACAAMALQmzEqEcRAACAAQA/gZRDgkWPx5HAAIAHABJAZMC3gMqBXYGxAcSCWIKsgsFDVcOqw//EFYSrRMGFWAWvBcYGXYa1hs4HZoeACBmIc0iNySjJWIAAgAJALgDeAdCCxQP8hLcFtIa2B7rImoAAgAHAHYEBAmsDXMSXhdsHKYhcAACAAQAsxHUGxwiwCVzAAEAegABAIMAAgATANkFtArQDlsScBUhGIAalRxqHgcgbyGpIrgjniRdJfklcibJJv4mlQAAAAAAAgAMAPoAQQNJBskJlA2HEYkVfBlHHccgzyMWJgsAAQAVAAIACAAHB4EMZhHrFSUaGh7AIfskHAABACQAAgAPANYG7QpCDi4R0hNDFooYrRqyHJoeaCAaIq0jHCVWJjIAAgA5AAUAFAAtAE0AdgCmAN0AGwFgAaoB+gFQAqwCDANyA90DTATBBDoFuQU7BsIGTQfdB3EICwmoCUkK7wqaC0gM+wyzDXAOMQ/2D8EQkhFmEj8THxQDFe0V3hbTF88Y0hncGuwbAx0jHkwffiC4IfwiTCSnJWoAAgAHAHYEBAmsDXMSXhdsHKYhcAACAAQAsxHUGxwiwCVzAAEAegABAIMAAgATANkFtArQDlsScBUhGIAalRxqHgcgbyGpIrgjniRdJfklcibJJv4mlQAAAAAAAgAMAPoAQQNJBskJlA2HEYkVfBlHHccgzyMWJgsAAQAVAAIACAAHB4EMZhHrFSUaGh7AIfskHAABACQAAgAPANYG7QpCDi4R0hNDFooYrRqyHJoeaCAaIq0jHCVWJjIAAgADAD8D7wplFjQAAgADALYH6hBqGzYAAgADAKQICRItHDgAAgADAPsIdhJ6HDoAAgADAB4JoxKaHDwAAgADAEEJ0RK7HD4AAgADADkJ2BLOHEAAAgADAEkJ2BK/HEIAAgADAC0JsxKhHEQAAgAEAP4GUQ4JFj8eRwACABwASQGTAt4DKgV2BsQHEgliCrILBQ1XDqsP/xBWEq0TBhVgFrwXGBl2GtYbOB2aHgAgZiHNIjckoyViAAIACQC4A3gHQgsUD/IS3BbSGtge6yJqAAIABwB2BAQJrA1zEl4XbBymIXAAAgAEALMR1BscIsAlcwABAHoAAQCDAAIAEwDZBbQK0A5bEnAVIRiAGpUcah4HIG8hqSK4I54kXSX5JXImySb+JpUAAAAAAAIADAD6AEEDSQbJCZQNhxGJFXwZRx3HIM8jFiYLAAEAFQACAAgABweBDGYR6xUlGhoewCH7JBwAAQAkAAIADwDWBu0KQg4uEdITQxaKGK0ashyaHmggGiKtIxwlViYyAAIAOQAFABQALQBNAHYApgDdABsBYAGqAfoBUAKsAgwDcgPdA0wEwQQ6BbkFOwbCBk0H3QdxCAsJqAlJCu8KmgtIDPsMsw1wDjEP9g/BEJIRZhI/Ex8UAxXtFd4W0xfPGNIZ3BrsGwMdIx5MH34guCH8IkwkpyVqAAIABwB2BAQJrA1zEl4XbBymIXAAAgAEALMR1BscIsAlcwABAHoAAQCDAAIAEwDZBbQK0A5bEnAVIRiAGpUcah4HIG8hqSK4I54kXSX5JXImySb+JpUAAAAAAAIACgCHAw0HlAodDqURMBW8GEsc3h91IwkAAgAFAHQG6wxnE+oZdiANAAIACABMBJoI6Qw6EYwV5RlCHqYiFAACABsAZwHPAjcEngUHB24I1gk9C6YMDg51D9wQQxKqExAVdhbcF0AZpRoJHG0dzx4yIJMh8yJTJLMlLgACAEAArABWAQECrAJWA/8DpwRRBfgFnwZFB+wHkQg4CdwJfwojC8cLaQwLDawNTg7vDo4PLRDNEGsRCRKlEkET3RN5FBMVrhVHFuAWeBcQGKgYPhnTGWga/RqRGyQcthxIHdodah76HokfGCClIDIhviFKItUiXyPoI3Ak+SSAJQYmiyZtAAIABQCYBi8NwBNEGrcgcQACAAQA5Ae5D4MXSB90AAIABADuB9UPrxdvH3cAAgAGAMgFgwswEcsWURy+IXwAAgAKAAME8QfLC44POhPNFkYapB3mIAskhQACABEA6AOlBzMLkg6/EbsUhBcWGnQcmB6EIDUiqCPcJM8lgCbsJpUAAAAAAAIADAD6AEEDSQbJCZQNhxGJFXwZRx3HIM8jFiYLAAEAFQACAAgABweBDGYR6xUlGhoewCH7JBwAAQAkAAIADwDWBu0KQg4uEdITQxaKGK0ashyaHmggGiKtIxwlViYyAAIAAwA/A+8KZRY0AAIAAwC2B+oQahs2AAIAAwCkCAkSLRw4AAIAAwD7CHYSehw6AAIAAwAeCaMSmhw8AAIAAwBBCdESuxw+AAIAAwA5CdgSzhxAAAIAAwBJCdgSvxxCAAIAAwAtCbMSoRxEAAIABAD+BlEOCRY/HkcAAgAcAEkBkwLeAyoFdgbEBxIJYgqyCwUNVw6rD/8QVhKtEwYVYBa8FxgZdhrWGzgdmh4AIGYhzSI3JKMlYgACAAkAuAN4B0ILFA/yEtwW0hrYHusiagACAAcAdgQECawNcxJeF2wcpiFwAAIABACzEdQbHCLAJXMAAQB6AAEAgwACABMA2QW0CtAOWxJwFSEYgBqVHGoeByBvIakiuCOeJF0l+SVyJskm/iaVAAAAAAACAAwA+gBBA0kGyQmUDYcRiRV8GUcdxyDPIxYmCwABABUAAgAIAAcHgQxmEesVJRoaHsAh+yQcAAEAJAACAA8A1gbtCkIOLhHSE0MWihitGrIcmh5oIBoirSMcJVYmMgACADkABQAUAC0ATQB2AKYA3QAbAWABqgH6AVACrAIMA3ID3QNMBMEEOgW5BTsGwgZNB90HcQgLCagJSQrvCpoLSAz7DLMNcA4xD/YPwRCSEWYSPxMfFAMV7RXeFtMXzxjSGdwa7BsDHSMeTB9+ILgh/CJMJKclagACAAcAdgQECawNcxJeF2wcpiFwAAIABACzEdQbHCLAJXMAAQB6AAEAgwACABMA2QW0CtAOWxJwFSEYgBqVHGoeByBvIakiuCOeJF0l+SVyJskm/iaVAAAAAAACAAkAcgDAAeEDywZ1CtkO7hOsGQ8gCAAAAB8AAAAAAAAAAAACAAwAxwCoAj4FSwipCzoP6hKkFlYa7R1SIWokCwACAAsAIQT/B7kLWA/gElEWqhnmHAAg6CJ5JRUAAgAIAAcHgQxmEesVJRoaHsAh+yQcAAEAJAACAA8A1gbtCkIOLhHSE0MWihitGrIcmh5oIBoirSMcJVYmMgACAAMAPwPvCmUWNAACAAMAtgfqEGobNgACAAMApAgJEi0cOAACAAMA+wh2EnocOgACAAMAHgmjEpocPAACAAMAQQnRErscPgACAAMAOQnYEs4cQAACAAMASQnYEr8cQgACAAMALQmzEqEcRAACAAQA/gZRDgkWPx5HAAIAHABJAZMC3gMqBXYGxAcSCWIKsgsFDVcOqw//EFYSrRMGFWAWvBcYGXYa1hs4HZoeACBmIc0iNySjJWIAAgAJALgDeAdCCxQP8hLcFtIa2B7rImoAAgAHAHYEBAmsDXMSXhdsHKYhcAACAAQAsxHUGxwiwCVzAAEAegABAIMAAgATANkFtArQDlsScBUhGIAalRxqHgcgbyGpIrgjniRdJfklcibJJv4mlQAAAAAAAgAMAMcAqAI+BUsIqQs6D+oSpBZWGu0dUiFqJAsAAgALACEE/we5C1gP4BJRFqoZ5hwAIOgieSUVAAIACAAHB4EMZhHrFSUaGh7AIfskHAABACQAAgAPANYG7QpCDi4R0hNDFooYrRqyHJoeaCAaIq0jHCVWJjIAAgA5AAUAFAAtAE0AdgCmAN0AGwFgAaoB+gFQAqwCDANyA90DTATBBDoFuQU7BsIGTQfdB3EICwmoCUkK7wqaC0gM+wyzDXAOMQ/2D8EQkhFmEj8THxQDFe0V3hbTF88Y0hncGuwbAx0jHkwffiC4IfwiTCSnJWoAAgAHAHYEBAmsDXMSXhdsHKYhcAACAAQAsxHUGxwiwCVzAAEAegABAIMAAgATANkFtArQDlsScBUhGIAalRxqHgcgbyGpIrgjniRdJfklcibJJv4mlQAAAAAAAAAAAAIACQDfA8MHqwuVD4ATbRdZG0MfKyMIAAIABwDUBKoJgg5eE0EYKR0YIg4AAgAHANgEuAmcDoQTbRhUHTQiFAACAAcA1wS2CZkOgBNoGE8dMiIaAAIABwDUBLEJlg58E2UYTR0yIiAAAgAHANQEsQmWDnwTZRhNHTIiJgACAEgAcQKeBJYGYAgDCooL9QxKDocPshDPEdoS1xPIFK0VhxZVFxwY2RiOGToa3xp/GxYcpxwzHbgdOR60Hiofmx8HIG8g0yAzIY0h5SE6Iooi1yIhI2cjqiPqIyckYSSZJM0k/yQuJVslhSWtJdIl9SUWJjQmUSZrJoMmmSatJr8mzybdJuom9Cb9JgQnCScNJw8nbQACAAQA5ge7D4cXTR9wAAIABADmB7sPhxdNH3MAAgAEAO8H2A+yF3MfdgACAAQA7gfVD68Xbx95AAIABQC5BlkN4hNXGrogfQACAAYA7AXAC3oRFBePHOMhggACABQAXwOdBrcJrwyGDzYSwBQmF2UZfBtqHS4fyCA2IngjiyRvJSQmpib1JpUAAAAAAAEAEQABABUAAQAZAAEAHQABACEAAQAuAAEAMAABADMAAQA1AAEAOAABAD0AAQBAAAEARAABAEgAAQBMAAEAVAABAFgAAQBbAAEAXwABAGgAAQBxAAEAdAABAHgAAQB8AAEAgQABAIQAAQCHAAEAigABAI0AAQCVAAAAAAAAAAAAAAAAAAIAFQDCAYUDSAUNB9MImgpgDCcO7w+4EYATShUSF9oYoxprHDMe+h/BIYYjTCUUAAIADgCjAkUF5AeBCh4NuQ9SEusUgxcaGrIcSB/gIXgkIQACAA4AoQJCBeQHhgomDcYPZhIEFaAXORrRHGUf9yGGJC4AAgBAAKwAVgECAq0CVwMBBKoEVAX8BaUGTAfzB5oIQgnnCYwKMgvWC3sMHg3BDWQOBg+mD0cQ6BCIEScSxRJjEwAUnRQ4FdQVbxYIF6EXOhjSGGkZ/xmUGikbvRtQHOIcdB0FHpUeIx+yHz8gyyBWIeEhaiLyInojACSFJAoljSUPJpAmbQACAAUAmAYvDcATRBq3IHEAAgAGAMIFcwsTEaYWKhyiIXYAAgAgAAcCAwT0Bd0HuQmKC1INDQ+8EF8S9hN+FfsWahjJGR0bXxyTHbgezB/OIMEhoSJvIyok0iRmJeUlTiaiJt8mAyeVAAAAAAABABEAAQAVAAEAGQABAB0AAQAhAAEALgABADAAAQAzAAEANQABADgAAQA9AAEAQAABAEQAAQBIAAEATAABAFQAAQBYAAEAWwABAF8AAQBoAAEAcQABAHQAAQB4AAEAfAABAIEAAQCEAAEAhwABAIoAAQCNAAEAlQAAAAAAAgA9AAYAFwAyAFcAhQC8APsAQgGRAeYBQgKkAg0DegPuA2cE5gRpBfAFfAYMB6IHOgjWCHUJGQq/CmkLFwzHDHoNMA7oDqMPYRAhEeQRqBJvEzgUAxXPFZ4WbxdBGBYZ7BnDGpsbdhxSHS8eDB/sH8wgryGTIncjXCRCJSgmPAACAFoAhQAMAZIBGAKfAicDrwM3BMAESQXTBVwG5AZvB/kHgggMCZcJHwqqCjQLvQtHDNAMWg3jDWwO9Q59DwYQjRAVEZsRIhKoEi4TtBM4FL0UPxXCFUUWxhZHF8cXRhjDGEEZvRk4GrMaLBujGxsckBwEHXcd6B1ZHsceMx+eHwggcCDWIDohmyH7IVgisyIMI2IjtSMGJFMkniTmJColayWoJeElFiZHJnMmmia9Jtkm8SYCJwwnlQAAAAAAAQARAAEAFQABABkAAQAdAAEAIQABAC4AAQAwAAEAMwABADUAAQA4AAEAPQABAEAAAQBEAAEASAABAEwAAQBUAAEAWAABAFsAAQBfAAEAaAABAHEAAQB0AAEAeAABAHwAAQCBAAEAhAABAIcAAQCKAAEAjQABAJUAAAAAAAEAEQABABUAAQAZAAEAHQABACEAAQAuAAEAMAABADMAAQA1AAEAOAABAD0AAQBAAAEARAABAEgAAQBMAAEAVAABAFgAAQBbAAEAXwABAGgAAQBxAAEAdAABAHgAAQB8AAEAgQABAIQAAQCHAAEAigABAI0AAQCVAAAAAAACAAkA3wPDB6sLlQ+AE20XWRtDHysjCAACAAcA1ASqCYIOXhNBGCkdGCIOAAIABwDYBLgJnA6EE20YVB00IhQAAgAHANcEtgmZDoATaBhPHTIiGgACAAcA1ASxCZYOfBNlGE0dMiIgAAIABwDUBLEJlg58E2UYTR0yIiYAAgBIAHECngSWBmAIAwqKC/UMSg6HD7IQzxHaEtcTyBStFYcWVRccGNkYjhk6Gt8afxsWHKccMx24HTketB4qH5sfByBvINMgMyGNIeUhOiKKItciISNnI6oj6iMnJGEkmSTNJP8kLiVbJYUlrSXSJfUlFiY0JlEmayaDJpkmrSa/Js8m3SbqJvQm/SYEJwknDScPJ20AAgAEAOYHuw+HF00fcAACAAQA5ge7D4cXTR9zAAIABADvB9gPshdzH3YAAgAEAO4H1Q+vF28feQACAAUAuQZZDeITVxq6IH0AAgAGAOwFwAt6ERQXjxzjIYIAAgAUAF8DnQa3Ca8Mhg82EsAUJhdlGXwbah0uH8ggNiJ4I4skbyUkJqYm9SaVAAAAAAABABEAAQAVAAEAGQABAB0AAQAhAAEALgABADAAAQAzAAEANQABADgAAQA9AAEAQAABAEQAAQBIAAEATAABAFQAAQBYAAEAWwABAF8AAQBoAAEAcQABAHQAAQB4AAEAfAABAIEAAQCEAAEAhwABAIoAAQCNAAEAlQAAAAAAAgAJAIMA+gFMBGYHNAuqD7oUVxp2IAgAAgAHAG4E/AiqDXoSahd/HLYhDgACAAcAigQsCeYNuhKnF68c0iEUAAIABwCoBF4JJA75EuEX3BzsIRoAAgAHAKkEZgk3DhcTBxgBHQQiIAACAAcAwgSMCVwONRMZGAkdBSImAAIASABxAp4ElgZgCAMKigv1DEoOhw+yEM8R2hLXE8gUrRWHFlUXHBjZGI4ZOhrfGn8bFhynHDMduB05HrQeKh+bHwcgbyDTIDMhjSHlIToiiiLXIiEjZyOqI+ojJyRhJJkkzST/JC4lWyWFJa0l0iX1JRYmNCZRJmsmgyaZJq0mvybPJt0m6ib0Jv0mBCcJJw0nDydtAAIABADmB7sPhxdNH3AAAgAEAOQHuQ+DF0gfcwACAAQA4Qe0D4AXSB92AAIABADhB7QPgBdIH3kAAgAFALYGUw3bE1AatiB9AAIABgDfBaILTBHcFlccvSGCAAIAFAAjAy4GIgn6C7YOWBHaEz4WgBihGp0cdR4mIK4hCSM3JDQlACaVJvEmlQAAAAAAAQAJAAEACwABAJMAAQCVAAAAAAABAAMAAQAFAAEABwABAAkAAQALAAEADQABAA8AAQARAAEAEwABABUAAQAXAAEAGQABABsAAQAdAAEAHwABACEAAQAjAAEAJQABACcAAQApAAEAKwABAC0AAQAvAAEAMQABADMAAQA1AAEANwABADkAAQA7AAEAPQABAD4AAQBAAAEAQgABAEQAAQBGAAEASAABAEoAAQBLAAEATQABAE8AAQBRAAEAUwABAFUAAQBWAAEAWAABAFoAAQBcAAEAXgABAGAAAQBiAAEAaQABAGsAAQBtAAEAbwABAHEAAQBzAAEAdQABAHcAAQB5AAEAewABAH0AAQB/AAEAgQABAIMAAgADAN8PxRm0IYUAAQCHAAEAiQABAIsAAQCNAAEAjwABAJEAAQCTAAEAlQAAAAAAAAAQAAIAKgCfAS8DtAQtBp0HAwlfCrEL/Aw/DnkPrRDaEf4SHBQyFUMWTBdPGEwZQhoxGxkc+hzVHakedh87IPggrSFaIgAjmyMuJLYkNCWlJQomYiaqJuAmAyc5AAAAPAABAFEAAABUAAAAaQACACoAnwEvA7QELQadBwMJXwqxC/wMPw55D60Q2hH+EhwUMhVDFkwXTxhMGUIaMRsZHPoc1R2pHnYfOyD4IK0hWiIAI5sjLiS2JDQlpSUKJmImqibgJgMnkgAAAJUAAAAAAAAAEAACACoAnwEvA7QELQadBwMJXwqxC/wMPw55D60Q2hH+EhwUMhVDFkwXTxhMGUIaMRsZHPoc1R2pHnYfOyD4IK0hWiIAI5sjLiS2JDQlpSUKJmImqibgJgMnOQAAADwAAQBRAAAAVAAAAGkAAgAqAJ8BLwO0BC0GnQcDCV8KsQv8DD8OeQ+tENoR/hIcFDIVQxZMF08YTBlCGjEbGRz6HNUdqR52Hzsg+CCtIVoiACObIy4ktiQ0JaUlCiZiJqom4CYDJ5IAAACVAAAAAAAAAAMAAgAaAFMClQTEBuII8QrxDOEOxBCYEl0UExa7F1QZ3RpXHMEdGB9dII4hqiKuI5gkZiUSJpcm8CYcAAAAHgACABwAKwJGBFEGTgg9Ch8M8w27D3YRJhPHFF0W5hdiGdEaMRyDHcYe+h8dIS0iKyMSJOIkmSUxJqcm9CY5AAAAPAAAAD8AAgATAB8DHgb9CL8LZg7zEGUTvBX6FxoaIBwGHs4fcCHtIj4kXCU+JtcmUQAAAFQAAABXAAIAHwD4AeMDwAWQB1cJEQvCDGYOARCSERcTlRQFFmwXyBgaGmEbnRzMHe4eBCALIQQi7SLFI4skOyXWJVYmuCb5JnUAAAB3AAIAHAArAkYEUQZOCD0KHwzzDbsPdhEmE8cUXRbmF2IZ0RoxHIMdxh76Hx0hLSIrIxIk4iSZJTEmpyb0JpIAAQCVAAAAAAAAAAMAAgAaAFMClQTEBuII8QrxDOEOxBCYEl0UExa7F1QZ3RpXHMEdGB9dII4hqiKuI5gkZiUSJpcm8CYcAAAAHgACABwAKwJGBFEGTgg9Ch8M8w27D3YRJhPHFF0W5hdiGdEaMRyDHcYe+h8dIS0iKyMSJOIkmSUxJqcm9CY5AAAAPAAAAD8AAgATAB8DHgb9CL8LZg7zEGUTvBX6FxoaIBwGHs4fcCHtIj4kXCU+JtcmUQAAAFQAAABXAAIAHwD4AeMDwAWQB1cJEQvCDGYOARCSERcTlRQFFmwXyBgaGmEbnRzMHe4eBCALIQQi7SLFI4skOyXWJVYmuCb5JnUAAAB3AAIAHAArAkYEUQZOCD0KHwzzDbsPdhEmE8cUXRbmF2IZ0RoxHIMdxh76Hx0hLSIrIxIk4iSZJTEmpyb0JpIAAQCVAAAAAAAAAAUAAgAZAAEEgwegCm0N9g9HEmgUXxYtGNoZaBvZHC0eaB+KIJUhiiJoIzEk5CSAJQYmcybGJvwmHQAAAB4AAABZAAIAHgBnA24GKAmmC+4NChD+EdATgBUWF5EY9hlEG3wcoR2zHrUfpSCFIVUiFCPGI2ck+SR7Je4lTyafJtsmAid2AAAAdwACAAMA1w5BGRQheQACAAcACQamC+YQ1RV9GuUeFCN/AAIACwB6BKwImgxKEMMTBhcaGgEdvh9TIsMkiQACAA0A5QR9CcYNwBFtFcsY2huWHvwgByOzJPclxiaVAAAAAAAAAAUAAgAZAAEEgwegCm0N9g9HEmgUXxYtGNoZaBvZHC0eaB+KIJUhiiJoIzEk5CSAJQYmcybGJvwmHQAAAB4AAABZAAIAHgBnA24GKAmmC+4NChD+EdATgBUWF5EY9hlEG3wcoR2zHrUfpSCFIVUiFCPGI2ck+SR7Je4lTyafJtsmAid2AAAAdwACABMAfwOwBp4JUwzXDjERZBN3FWkXQRn+GqQcMh6tHxQhaSKrI90k/yWJAAIADQDlBH0Jxg3AEW0VyxjaG5Ye/CAHI7Mk9yXGJpUAAAAAAAIADAChBa8KOw9ZExAXZxpkHQcgTiI0JLAlryYLAAAADgACABEAIATwB3gLwA7MEaEUQheyGfEbAh7kH5YhFiNkJHglTibcJh4AAAAgAAIAEQAgBPAHeAvADswRoRRCF7IZ8RsCHuQfliEWI2QkeCVOJtwmMAAAADwAAgAMAKEFrwo7D1kTEBdnGmQdByBOIjQksCWvJkcAAABKAAAAVAACAAwAoQWvCjsPWRMQF2caZB0HIE4iNCSwJa8mXwAAAGIAAgAWAEIDUQYyCeoLeQ7kEC4TVhVdF0gZFhvGHFke0B8pIWUigiN+JFclCyaVJu8mdwAAAHkAAgAHAIAHEw7iE/8YeR1TIYskfwACAAsAkwW/CocP6xPtF4cbtx53Ib4jfiWkJokAAACVAAAAAAACAAwAoQWvCjsPWRMQF2caZB0HIE4iNCSwJa8mCwAAAA4AAgARACAE8Ad4C8AOzBGhFEIXshnxGwIe5B+WIRYjZCR4JU4m3CYeAAAAIAACABEAIATwB3gLwA7MEaEUQheyGfEbAh7kH5YhFiNkJHglTibcJjAAAAA8AAIADAChBa8KOw9ZExAXZxpkHQcgTiI0JLAlryZHAAAASgAAAFQAAgAMAKEFrwo7D1kTEBdnGmQdByBOIjQksCWvJl8AAABiAAIAFgBCA1EGMgnqC3kO5BAuE1YVXRdIGRYbxhxZHtAfKSFlIoIjfiRXJQsmlSbvJncAAAB5AAIABwCABxMO4hP/GHkdUyGLJH8AAgALAJMFvwqHD+sT7ReHG7cedyG+I34lpCaJAAAAlQAAAAAAAABuAAEAcAACAA0AJAXWCSEOEBKoFe0Y4huIHt8g5SKSJOAlvSZ8AAAAAAAAAG4AAAAAAAAAbgABAHAAAgANACQF1gkhDhASqBXtGOIbiB7fIOUikiTgJb0mfAAAAAAAAAA8AAEAPgACAAMAVRVqIKklQAAAAAAAAAA8AAAAAAAAADwAAQA+AAIAAwBVFWogqSVAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAEAA//8AAAEAPAAAAD4AAgADAFUVaiCpJUAAAAAAAAAAHQD//x4AAAA8AP//QQAAAFQA//9ZAAAAdgD//3cAAACVAP//AAABAAUAAgAFABsFIwyHE+0a9SEJAAAAFgACAAgA3wHrBQcLphBqFgkcJSExJR0AAQAeAAIACAD6AmAHIwwNEQMW7RqwHxYkJQAAADIAAgALACABtgMfBwcLNg+HE9oXCRzxH1oj8CU8AAEAQQACAAUAGwUjDIcT7Rr1IUUAAQBUAAEAWQACAAUAGwUjDIcT7Rr1IV0AAABvAAIACADfAesFBwumEGoWCRwlITEldgABAHcAAgAIAPoCYAcjDA0RAxbtGrAfFiR+AAAAiwACAAsAIAG2Ax8HBws2D4cT2hcJHPEfWiPwJZUAAAAAAAAACwD//w4AAAAeAP//IAAAADAA//88AAAARwD//0oAAABfAP//YgAAAHcA//95AAAAiQD//wAAAgAEAHQGFA/8F5wgAwAAAAgAAgAEAAAFXQ6zGBAiCwABAA4AAgAEAHQGFA/8F5wgEQAAABcAAgAIAN8B6wUHC6YQahYJHCUhMSUeAAEAIAACAAQAdAYUD/wXnCAjAAAAKQACAAgA3wHrBQcLphBqFgkcJSExJTAAAQA8AAIABAB0BhQP/BecID8AAABEAAIABAAABV0OsxgQIkcAAQBUAAIABAB0BhQP/BecIFcAAABcAAIABAAABV0OsxgQIl8AAQBiAAIACQCUAnQGsQoUD4cT/BdfHJwgfCRqAAAAcAACAAgA3wHrBQcLphBqFgkcJSExJXcAAQB5AAIABAB0BhQP/BecIHwAAACCAAIACADfAesFBwumEGoWCRwlITEliQAAAAAAAAA5AP//PAAAAFEA//9UAAAAkgD//wAAAQAJAAIACADfAesFBwumEGoWCRwlITElEAABACcAAgATAHIAjgEeAwAFHwdsCdgLXQ7uEIcTIhazGDgbpB3xHxAi8iOCJZ4mOQABAF0AAgANANoA3wKXBcAINAzSD4cTPhfcGlAeeSExJDYmaQAAAIAAAgATAHIAjgEeAwAFHwdsCdgLXQ7uEIcTIhazGDgbpB3xHxAi8iOCJZ4mkgAAAAAAAAAcAP//HgAAADkA//88AAAAUQD//1QAAAB1AP//dwAAAJIA//8AAAEAAwACAAsAIAG2Ax8HBws2D4cT2hcJHPEfWiPwJQ0AAAASAAIACwAgAbYDHwcHCzYPhxPaFwkc8R9aI/AlHAABAB4AAgAKAPcETAldDUIRAhWgGBwcbx+LIk8lJwAAACwAAgAOAMEAjgIABd8HBwtdDswRRBWzGAkcMR8QIoIkTyY5AAEAPwACAAsAIAG2Ax8HBws2D4cT2hcJHPEfWiPwJUkAAQBRAAEAVwACAAsAIAG2Ax8HBws2D4cT2hcJHPEfWiPwJWEAAABrAAIACwAgAbYDHwcHCzYPhxPaFwkc8R9aI/AldQABAHcAAgAKAPcETAldDUIRAhWgGBwcbx+LIk8lgAAAAIUAAgAOAMEAjgIABd8HBwtdDswRRBWzGAkcMR8QIoIkTyaSAAAAAAAAAAAAAABAAP//bAAAAAAAAQA8AAEAQAABAGwAAgAHAJAFCwttELMVzhqrHxgkcgAAAAAAAAAAAAAAPQD//wAAAQA9AAEAawAAAAAAAAAAAAAAfAD//wAAAQBuAAAAcgACAAsAIAG2Ax8HBws2D4cT2hcJHPEfWiPwJXwAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAkAAgALAAMAHwACACEAAABwAAEAfgADAIkAAgCLAAAAAAD//28AAACDAP//AAAAAD0A//9rAAAAAAABAD0AAQBrAAEAcgAAAAAAAAAAAAAAPQD//2sAAAAAAAEAPQABAGsAAgAIAPME1gmmDmAT/Rd2HLMgiiRyAAAAAAAAAAkA//8LAAAAEQD//xMAAAAaAP//HAAAACQA//8lAAAAKwD//y0AAAA9AP//UQAAAFgA//9ZAAAAYgD//2QAAABqAP//bAAAAHMA//91AAAAfQD//34AAACEAP//hgAAAI0A//+OAAAAlAD//5UAAAAAAAEABAACAAYA/gk2EgQZkB7jItwlCQABAAsAAQAOAAIABAB3DcIXiB/ZJBEAAQATAAEAFgACAAUAeAuhFPEbliF4JRoAAQAcAAEAHwACAAYA/gk2EgQZkB7jItwlJAABACUAAQAoAAIABAB3DcIXiB/ZJCsAAQAtAAEAOgACAAMAoQqdFBAePAAAAD0AAQBLAAAAUQABAFUAAgAEAHcNwheIH9kkWAABAFkAAQBdAAIABgD+CTYSBBmQHuMi3CViAAEAZAABAGcAAgAEAHcNwheIH9kkagABAGwAAQBvAAIABQB4C6EU8RuWIXglcwABAHUAAQB4AAIABgD+CTYSBBmQHuMi3CV9AAEAfgABAIEAAgAEAHcNwheIH9kkhAABAIYAAQCJAAIABQB4C6EU8RuWIXgljQABAI4AAQCRAAIABAB3DcIXiB/ZJJQAAQCVAAAAAAAAAD0A//9rAAAAAAABAD0AAQBrAAIACADzBNYJpg5gE/0XdhyzIIokcgAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAABAAUAAQAIAAEACgABAA4AAQAQAAEAFQABABgAAQAaAAEAHgABACAAAQAlAAEAKAABACoAAQAuAAEAMAABADIAAQA1AAEANwABADkAAQA8AAAAAAABAAMAAQAHAAEADAABAA8AAQASAAEAFwABABoAAQAdAAEAIQABACYAAQApAAEALAABADAAAQAzAAEANgABADkAAQA8AAAAAAACAB8ALwCrAGQBSgJWA4IExgUfB4oIBQqKCxgNrg5JEOgRhxMoFccWYhj4GYYbCx2GHvEfSiGOIrojxiSsJWUm4SYeAAIAHwAvAKsAZAFKAlYDggTGBR8HiggFCooLGA2uDkkQ6BGHEygVxxZiGPgZhhsLHYYe8R9KIY4iuiPGJKwlZSbhJjwAAAAAAAEAAwABAAUAAQAIAAEACwABAA4AAQAQAAEAEwABABYAAQAZAAEAGwABAB4AAQAhAAEAJAABACYAAQApAAEALAABAC8AAQAxAAEANAABADcAAQA5AAEAPAAAAAAAAQALAAEADwABABMAAQAbAAEAKAAAAAAAAgAfAC8AqwBkAUoCVgOCBMYFHweKCAUKigsYDa4OSRDoEYcTKBXHFmIY+BmGGwsdhh7xH0ohjiK6I8YkrCVlJuEmHgACAB8ALwCrAGQBSgJWA4IExgUfB4oIBQqKCxgNrg5JEOgRhxMoFccWYhj4GYYbCx2GHvEfSiGOIrojxiSsJWUm4SY8AAAAAAACAB8ALwCrAGQBSgJWA4IExgUfB4oIBQqKCxgNrg5JEOgRhxMoFccWYhj4GYYbCx2GHvEfSiGOIrojxiSsJWUm4SYeAAIAHwAvAKsAZAFKAlYDggTGBR8HiggFCooLGA2uDkkQ6BGHEygVxxZiGPgZhhsLHYYe8R9KIY4iuiPGJKwlZSbhJjwAAAAAAAIADwBMA5MG0gkDDSQQMhMmFvwYrRszHoQgliJcJMQltSYOAAEALAACABEATQAbAU0CzwORBYkHrgn4C2IO5RCAEy4W6BixG4MeWiE0JDwAAAAAAAIADwBMA5MG0gkDDSQQMhMmFvwYrRszHoQgliJcJMQltSYOAAEALAACABEATQAbAU0CzwORBYkHrgn4C2IO5RCAEy4W6BixG4MeWiE0JDwAAAAAAAAAAAABAAsAAAAPAAEAEwABABcAAQAbAAEAKAAAAAAAAgANAO0DygeUC0IP0RI6FnYZfRxDH7wh2iOGJaUmDAACAB8ALwCrAGQBSgJWA4IExgUfB4oIBQqKCxgNrg5JEOgRhxMoFccWYhj4GYYbCx2GHvEfSiGOIrojxiSsJWUm4SYqAAIAEwBFAPwADAJhA+8EqwaPCJMKsAzlDi0RgxPlFVIYxBo8HbQfLCKhJDwAAAAAAAEACwABAA8AAQATAAEAFwABABsAAQAoAAAAAAACABAAEAMcBiQJIgwVD/gRyBR/FxsalhznHggh8SKSJN0lvCYPAAEALQACABAAVAAzAX4CHwQIBikIegr1DJEPSBIYFfsX7hrsHfQgACQ8AAAAAAACAB8ALwCrAGQBSgJWA4IExgUfB4oIBQqKCxgNrg5JEOgRhxMoFccWYhj4GYYbCx2GHvEfSiGOIrojxiSsJWUm4SYeAAIAHwAvAKsAZAFKAlYDggTGBR8HiggFCooLGA2uDkkQ6BGHEygVxxZiGPgZhhsLHYYe8R9KIY4iuiPGJKwlZSbhJjwAAAAAAAIAEgC+AnkFMAjiCooNJxC2EjcVoxf5GTQcTx5GIBEiqiMFJRYmzCYRAAIAHwAvAKsAZAFKAlYDggTGBR8HiggFCooLGA2uDkkQ6BGHEygVxxZiGPgZhhsLHYYe8R9KIY4iuiPGJKwlZSbhJi8AAgAOAGoAggEcAxwFbQcACsoMvg/XEg0WWRm4HCQgmCM8AAAAAAACAAUAcwFsBXcLQhOHHAQAAgAGAP4JNhIEGZAe4yLcJQkAAAALAAIABAAPAp0H9A+RGg4AAgAEAHcNwheIH9kkEQAAABMAAgAEAA8CnQf0D5EaFgACAAUAeAuhFPEbliF4JRoAAAAcAAIABAAPAp0H9A+RGh8AAgAGAP4JNhIEGZAe4yLcJSQAAAAlAAIABAAPAp0H9A+RGigAAgAEAHcNwheIH9kkKwAAAC0AAgAEAA8CnQf0D5EaMAACAAUAeAuhFPEbliF4JTQAAAA1AAIABAAPAp0H9A+RGjgAAgAEAHcNwheIH9kkOwAAADwAAAAAAAIABQBzAWwFdwtCE4ccBAACAAYA/gk2EgQZkB7jItwlCQAAAAsAAgAEAA8CnQf0D5EaDgACAAQAdw3CF4gf2SQRAAAAEwACAAQADwKdB/QPkRoWAAIABQB4C6EU8RuWIXglGgAAABwAAgAEAA8CnQf0D5EaHwACAAYA/gk2EgQZkB7jItwlJAAAACUAAgAEAA8CnQf0D5EaKAACAAQAdw3CF4gf2SQrAAAALQACAAQADwKdB/QPkRowAAIABQB4C6EU8RuWIXglNAAAADUAAgAEAA8CnQf0D5EaOAACAAQAdw3CF4gf2SQ7AAAAPAAAAAAAAQALAAEADwABABMAAQAXAAEAGwABACgAAAAAAAEAAgABAAQAAQAGAAEACAABAAoAAQAMAAEADgABABAAAQASAAEAFAABABYAAQAYAAEAGgABABwAAQAeAAEAIAABACIAAQAkAAEAJgABACgAAQAqAAEALAABAC4AAQAwAAEAMgABADQAAQA2AAEAOAABADoAAQA8AAAAAAACAB8ALwCrAGQBSgJWA4IExgUfB4oIBQqKCxgNrg5JEOgRhxMoFccWYhj4GYYbCx2GHvEfSiGOIrojxiSsJWUm4SYeAAIAHwAvAKsAZAFKAlYDggTGBR8HiggFCooLGA2uDkkQ6BGHEygVxxZiGPgZhhsLHYYe8R9KIY4iuiPGJKwlZSbhJjwAAAAAAAEACwABAA8AAQATAAEAFwABABsAAQAoAAAAAAACABQAegL1BGsH2wlGDKkOAxFQE5AVwRfdGeMb0h2jH1Ih2iI1JFslQCbYJhMAAgAfAC8AqwBkAUoCVgOCBMYFHweKCAUKigsYDa4OSRDoEYcTKBXHFmIY+BmGGwsdhh7xH0ohjiK6I8YkrCVlJuEmMQACAAwAiwD0Af0DgQZjCZEM+g+TE1AXKBsWHw8jPAAAAAAAAgARANACogVyCD4LBA6/EGwTBxaOGPsaSh1zH3AhNiO8JPElwiYQAAEALgACAA8AWQBIAasCbAR5BsUIRwv0DccQuRPIFuwZIx1mILcjPAAAAAAAAQALAAAADwABABMAAQAXAAEAGwABACgAAAAAAAIAEgDHAosFSAgAC6wNThDhEmEVzhcjGlwcdB5mICwivyMUJR4mzyYRAAIAHwAvAKsAZAFKAlYDggTGBR8HiggFCooLGA2uDkkQ6BGHEygVxxZiGPgZhhsLHYYe8R9KIY4iuiPGJKwlZSbhJi8AAgAOAG0AiwEsAzIFiQcgCusM4Q/6Ei4WdxnQHDYgoiM8AAAAAAABAAsAAQAPAAEAEwABABcAAQAbAAEAKAAAAAAAAQAFAAEACAABAAoAAQAOAAEAEAABABUAAQAYAAEAGgABAB4AAQAgAAEAJQABACgAAQAqAAEALgABADAAAQAyAAEANQABADcAAQA5AAEAPAAAAAAAAgAfAC8AqwBkAUoCVgOCBMYFHweKCAUKigsYDa4OSRDoEYcTKBXHFmIY+BmGGwsdhh7xH0ohjiK6I8YkrCVlJuEmHgACAB8ALwCrAGQBSgJWA4IExgUfB4oIBQqKCxgNrg5JEOgRhxMoFccWYhj4GYYbCx2GHvEfSiGOIrojxiSsJWUm4SY8AAAAAAABAAIAAQAEAAEABgABAAgAAQAKAAEADAABAA4AAQAQAAEAEgABABQAAQAWAAEAGAABABoAAQAcAAEAHgABACAAAQAiAAEAJAABACYAAQAoAAEAKgABACwAAQAuAAEAMAABADIAAQA0AAEANgABADgAAQA6AAEAPAAAAAAAAgAQABADHAYkCSIMFQ/4EcgUfxcbGpYc5x4IIfEikiTdJbwmDwABAC0AAgAQAFQAMwF+Ah8ECAYpCHoK9QyRD0gSGBX7F+4a7B30IAAkPAAAAAAAAgAPAEwDkwbSCQMNJBAyEyYW/BitGzMehCCWIlwkxCW1Jg4AAgAfAC8AqwBkAUoCVgOCBMYFHweKCAUKigsYDa4OSRDoEYcTKBXHFmIY+BmGGwsdhh7xH0ohjiK6I8YkrCVlJuEmLAABADwAAAAAAAEAAwABAAUAAQAIAAEACwABAA4AAQAQAAEAEwABABYAAQAZAAEAGwABAB4AAQAhAAEAJAABACYAAQApAAEALAABAC8AAQAxAAEANAABADcAAQA5AAEAPAAAAAAAAQALAAEADwABABMAAQAXAAEAGwABACgAAAAAAAIADwBMA5MG0gkDDSQQMhMmFvwYrRszHoQgliJcJMQltSYOAAIAHwAvAKsAZAFKAlYDggTGBR8HiggFCooLGA2uDkkQ6BGHEygVxxZiGPgZhhsLHYYe8R9KIY4iuiPGJKwlZSbhJiwAAgARAE0AGwFNAs8DkQWJB64J+AtiDuUQgBMuFugYsRuDHlohNCQ8AAAAAAABAAsAAQAPAAEAEwABABcAAQAbAAEAKAAAAAAAAgAfAC8AqwBkAUoCVgOCBMYFHweKCAUKigsYDa4OSRDoEYcTKBXHFmIY+BmGGwsdhh7xH0ohjiK6I8YkrCVlJuEmHgACAB8ALwCrAGQBSgJWA4IExgUfB4oIBQqKCxgNrg5JEOgRhxMoFccWYhj4GYYbCx2GHvEfSiGOIrojxiSsJWUm4SY8AAAAAAACAB8ALwCrAGQBSgJWA4IExgUfB4oIBQqKCxgNrg5JEOgRhxMoFccWYhj4GYYbCx2GHvEfSiGOIrojxiSsJWUm4SYeAAIAHwAvAKsAZAFKAlYDggTGBR8HiggFCooLGA2uDkkQ6BGHEygVxxZiGPgZhhsLHYYe8R9KIY4iuiPGJKwlZSbhJjwAAAAAAAIACwAgAbYDHwcHCzYPhxPaFwkc8R9aI/AlCgACABUAtAF3A0cFIwcGCfAK3gzQDsIQtBKjFJAWdRhUGigc8h2sH1Yh6yJqJM0lHgACABEAigDfAbYD6wViCAcLzA2mEIcTahZEGQkcrh4lIVojMSWGJi4AAgAPAI8DDQd3CskNAREcFBMX4RmDHPEeIyESI7Ak8SXEJjwAAAAAAAIACwAgAbYDHwcHCzYPhxPaFwkc8R9aI/AlCgACABUAtAF3A0cFIwcGCfAK3gzQDsIQtBKjFJAWdRhUGigc8h2sH1Yh6yJqJM0lHgACABEAigDfAbYD6wViCAcLzA2mEIcTahZEGQkcrh4lIVojMSWGJi4AAgAPAI8DDQd3CskNAREcFBMX4RmDHPEeIyESI7Ak8SXEJjwAAAAAAAIAEQDQAqIFcgg+CwQOvxBsEwcWjhj7Gkodcx9wITYjvCTxJcImEAABAC4AAgAPAFkASAGrAmwEeQbFCEcL9A3HELkTyBbsGSMdZiC3IzwAAAAAAAIACwAgAbYDHwcHCzYPhxPaFwkc8R9aI/AlCgACABUAtAF3A0cFIwcGCfAK3gzQDsIQtBKjFJAWdRhUGigc8h2sH1Yh6yJqJM0lHgACABEAigDfAbYD6wViCAcLzA2mEIcTahZEGQkcrh4lIVojMSWGJi4AAgAPAI8DDQd3CskNAREcFBMX4RmDHPEeIyESI7Ak8SXEJjwAAAAAAAIACwAgAbYDHwcHCzYPhxPaFwkc8R9aI/AlCgACABUAtAF3A0cFIwcGCfAK3gzQDsIQtBKjFJAWdRhUGigc8h2sH1Yh6yJqJM0lHgACABEAigDfAbYD6wViCAcLzA2mEIcTahZEGQkcrh4lIVojMSWGJi4AAgAPAI8DDQd3CskNAREcFBMX4RmDHPEeIyESI7Ak8SXEJjwAAAAAAAIAHwAvAKsAZAFKAlYDggTGBR8HiggFCooLGA2uDkkQ6BGHEygVxxZiGPgZhhsLHYYe8R9KIY4iuiPGJKwlZSbhJh4AAgAfAC8AqwBkAUoCVgOCBMYFHweKCAUKigsYDa4OSRDoEYcTKBXHFmIY+BmGGwsdhh7xH0ohjiK6I8YkrCVlJuEmPAAAAAAAAgAfAC8AqwBkAUoCVgOCBMYFHweKCAUKigsYDa4OSRDoEYcTKBXHFmIY+BmGGwsdhh7xH0ohjiK6I8YkrCVlJuEmHgACAB8ALwCrAGQBSgJWA4IExgUfB4oIBQqKCxgNrg5JEOgRhxMoFccWYhj4GYYbCx2GHvEfSiGOIrojxiSsJWUm4SY8AAAAAAACABAAEAMcBiQJIgwVD/gRyBR/FxsalhznHggh8SKSJN0lvCYPAAIAHwAvAKsAZAFKAlYDggTGBR8HiggFCooLGA2uDkkQ6BGHEygVxxZiGPgZhhsLHYYe8R9KIY4iuiPGJKwlZSbhJi0AAgAQAFQAMwF+Ah8ECAYpCHoK9QyRD0gSGBX7F+4a7B30IAAkPAAAAAAAAgALALsAkgIsBU4I1QufD5gTqBe8G7sfjSMKAAIAFQC0AXcDRwUjBwYJ8AreDNAOwhC0EqMUkBZ1GFQaKBzyHawfViHrImokzSUeAAIAEQB+AUkDTwWCB9kJSAzJDlgR6RN7FgQZfRviHSggRSIsJM0lLgACAA8AjwMNB3cKyQ0BERwUExfhGYMc8R4jIRIjsCTxJcQmPAAAAAAAAgALALsAkgIsBU4I1QufD5gTqBe8G7sfjSMKAAIAFQC0AXcDRwUjBwYJ8AreDNAOwhC0EqMUkBZ1GFQaKBzyHawfViHrImokzSUeAAIAEQB+AUkDTwWCB9kJSAzJDlgR6RN7FgQZfRviHSggRSIsJM0lLgACAA8AjwMNB3cKyQ0BERwUExfhGYMc8R4jIRIjsCTxJcQmPAAAAAAAAgASAMcCiwVICAALrA1OEOESYRXOFyMaXBx0HmYgLCK/IxQlHibPJhEAAgAfABkAYQDPAF8BDQLWArQDqASvBccG7QchCWEKrQsDDWIOyQ84Ea0SKhSsFTMXvhhMGt4bch0JH6MgPSLYI3QlLwACAA4AwQCOAgAF3wcHC10OzBFEFbMYCRwxHxAigiRPJjwAAAAAAAEACwABAA8AAQATAAEAFwABABsAAQAoAAAAAAACABAAEAMcBiQJIgwVD/gRyBR/FxsalhznHggh8SKSJN0lvCYPAAEALQACABAAVAAzAX4CHwQIBikIegr1DJEPSBIYFfsX7hrsHfQgACQ8AAAAAAACABAAEAMcBiQJIgwVD/gRyBR/FxsalhznHggh8SKSJN0lvCYPAAEALQACABAAVAAzAX4CHwQIBikIegr1DJEPSBIYFfsX7hrsHfQgACQ8AAAAAAACABAAEAMcBiQJIgwVD/gRyBR/FxsalhznHggh8SKSJN0lvCYPAAEALQACABAAVAAzAX4CHwQIBikIegr1DJEPSBIYFfsX7hrsHfQgACQ8AAAAAAABAAsAAQAPAAEAEwABABcAAQAbAAEAKAAAAAAAAgAfAC8AqwBkAUoCVgOCBMYFHweKCAUKigsYDa4OSRDoEYcTKBXHFmIY+BmGGwsdhh7xH0ohjiK6I8YkrCVlJuEmHgACAB8ALwCrAGQBSgJWA4IExgUfB4oIBQqKCxgNrg5JEOgRhxMoFccWYhj4GYYbCx2GHvEfSiGOIrojxiSsJWUm4SY8AAAAAAABAAsAAQAPAAEAEwABABcAAQAbAAEAKAAAAAAAAQALAAEADwABABMAAQAXAAEAGwABACgAAAAAAAIADwBMA5MG0gkDDSQQMhMmFvwYrRszHoQgliJcJMQltSYOAAIAHwAvAKsAZAFKAlYDggTGBR8HiggFCooLGA2uDkkQ6BGHEygVxxZiGPgZhhsLHYYe8R9KIY4iuiPGJKwlZSbhJiwAAgARAE0AGwFNAs8DkQWJB64J+AtiDuUQgBMuFugYsRuDHlohNCQ8AAAAAAABAAsAAQAPAAEAEwABABcAAQAbAAEAKAAAAAAAAgAfAC8AqwBkAUoCVgOCBMYFHweKCAUKigsYDa4OSRDoEYcTKBXHFmIY+BmGGwsdhh7xH0ohjiK6I8YkrCVlJuEmHgACAB8ALwCrAGQBSgJWA4IExgUfB4oIBQqKCxgNrg5JEOgRhxMoFccWYhj4GYYbCx2GHvEfSiGOIrojxiSsJWUm4SY8AAAAAAABAAIAAQAEAAEABgABAAgAAQAKAAEADAABAA4AAQAQAAEAEgABABQAAQAWAAEAGAABABoAAQAcAAEAHgABACAAAQAiAAEAJAABACYAAQAoAAEAKgABACwAAQAuAAEAMAABADIAAQA0AAEANgABADgAAQA6AAEAPAAAAAAAAAAQAAIAKgCfAS8DtAQtBp0HAwlfCrEL/Aw/DnkPrRDaEf4SHBQyFUMWTBdPGEwZQhoxGxkc+hzVHakedh87IPggrSFaIgAjmyMuJLYkNCWlJQomYiaqJuAmAyc5AAAAAAAAABAAAgAqAJ8BLwO0BC0GnQcDCV8KsQv8DD8OeQ+tENoR/hIcFDIVQxZMF08YTBlCGjEbGRz6HNUdqR52Hzsg+CCtIVoiACObIy4ktiQ0JaUlCiZiJqom4CYDJzkAAAAAAAAAAwACABoAUwKVBMQG4gjxCvEM4Q7EEJgSXRQTFrsXVBndGlccwR0YH10gjiGqIq4jmCRmJRImlybwJhwAAAAeAAIAHAAfAiAECQbgB6cJYAsODbIOSxDbEWIT4RRYFsUXKxmIGtwbJx1nHp0fxyDlIfMi8SPaJKolWSbaJjkAAAAAAAAAAwACABoAUwKVBMQG4gjxCvEM4Q7EEJgSXRQTFrsXVBndGlccwR0YH10gjiGqIq4jmCRmJRImlybwJhwAAAAeAAIAHAAfAiAECQbgB6cJYAsODbIOSxDbEWIT4RRYFsUXKxmIGtwbJx1nHp0fxyDlIfMi8SPaJKolWSbaJjkAAAAAAAAABQACABkAAQSDB6AKbQ32D0cSaBRfFi0Y2hloG9kcLR5oH4oglSGKImgjMSTkJIAlBiZzJsYm/CYdAAAAHgACAB8AJAPEBRcILQobDOUNkg8oEaoSGBR2FcYWBxg8GWUagxuVHJ8dnR6RH3sgWyExIvwivCNvJBUlrCUxJp8m7yY8AAAAAAAAAAUAAgAZAAEEgwegCm0N9g9HEmgUXxYtGNoZaBvZHC0eaB+KIJUhiiJoIzEk5CSAJQYmcybGJvwmHQAAAB4AAgAfACQDxAUXCC0KGwzlDZIPKBGqEhgUdhXGFgcYPBllGoMblRyfHZ0ekR97IFshMSL8IrwjbyQVJawlMSafJu8mPAAAAAAAAgAMAKEFrwo7D1kTEBdnGmQdByBOIjQksCWvJgsAAAAOAAIAEQAgBPAHeAvADswRoRRCF7IZ8RsCHuQfliEWI2QkeCVOJtwmHgAAACAAAgARAPcDdAegCo8NTRDiElMVoxfWGewb5B2+H3ohESN+JLclpCYwAAAAAAACAAwAoQWvCjsPWRMQF2caZB0HIE4iNCSwJa8mCwAAAA4AAgARACAE8Ad4C8AOzBGhFEIXshnxGwIe5B+WIRYjZCR4JU4m3CYeAAAAIAACABEA9wN0B6AKjw1NEOISUxWjF9YZ7BvkHb4feiERI34ktyWkJjAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAB0A//8eAAAAPAD//wAAAQAFAAIABQAbBSMMhxPtGvUhCQAAABYAAgAIAN8B6wUHC6YQahYJHCUhMSUdAAEAHgACAAgA+gJgByMMDREDFu0asB8WJCUAAAAyAAIACwAgAbYDHwcHCzYPhxPaFwkc8R9aI/AlPAAAAAAAAAALAP//DgAAAB4A//8gAAAAMAD//wAAAgAEAHQGFA/8F5wgAwAAAAgAAgAEAAAFXQ6zGBAiCwABAA4AAgAEAHQGFA/8F5wgEQAAABcAAgAIAN8B6wUHC6YQahYJHCUhMSUeAAEAIAACAAQAdAYUD/wXnCAjAAAAKQACAAgA3wHrBQcLphBqFgkcJSExJTAAAAAAAAAAOQD//wAAAQAJAAIACADfAesFBwumEGoWCRwlITElEAABACcAAgATAHIAjgEeAwAFHwdsCdgLXQ7uEIcTIhazGDgbpB3xHxAi8iOCJZ4mOQAAAAAAAAAcAP//HgAAADkA//8AAAEAAwACAAsAIAG2Ax8HBws2D4cT2hcJHPEfWiPwJQ0AAAASAAIACwAgAbYDHwcHCzYPhxPaFwkc8R9aI/AlHAABAB4AAgAKAPcETAldDUIRAhWgGBwcbx+LIk8lJwAAACwAAgAOAMEAjgIABd8HBwtdDswRRBWzGAkcMR8QIoIkTyY5AAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAJAP//CwAAABEA//8TAAAAGgD//xwAAAAkAP//JQAAACsA//8tAAAANAD//zUAAAA7AP//PAAAAAAAAQAEAAIABgD+CTYSBBmQHuMi3CUJAAEACwABAA4AAgAEAHcNwheIH9kkEQABABMAAQAWAAIABQB4C6EU8RuWIXglGgABABwAAQAfAAIABgD+CTYSBBmQHuMi3CUkAAEAJQABACgAAgAEAHcNwheIH9kkKwABAC0AAQAwAAIABQB4C6EU8RuWIXglNAABADUAAQA4AAIABAB3DcIXiB/ZJDsAAQA8AAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAABAAEAAQAAAAAAAgAGAOUMEha3HG4hmyRyJgUAAQAHAAEACQABAAsAAQANAAEADwABABEAAQATAAEAFAABABYAAQAYAAEAGgABABwAAQAeAAEAIAABACIAAQAkAAEAJgABACgAAQApAAEAKwABAC0AAQAuAAEAMAABADIAAQA0AAEANgABADgAAQA6AAEAPAABAD0AAQA/AAEAQQABAEMAAgADAHQLohXIHkUAAgACAK4NvhpGAAAARwAAAAAAAgBGAH8B7AJOBKQF7wYsCF8JiQqnC74MyQ3NDsoPvRCoEY4SaxNDFBIV2xWeFloXERjDGG4ZFBq2GlIb6Bt6HAcdjh0SHpMeDR+EH/cfZSDQIDYhmSH4IVMiqiL+Ik4jmyPlIyskbSSsJOgkISVXJYkluSXlJQ4mNCZXJncmlCauJsQm2CbpJvcmAicKJw4nRQACAAIArg2+GkYAAABHAAAAAAAAAEcAAgAIAJgJSxF9F3AcUyBGI1sloCZOAAAAAAAAAEcAAgAIAJgJSxF9F3AcUyBGI1sloCZOAAAAAAACAAQA7gycFdYc8yIDAAEABQABAAcAAQAIAAEACQABAAsAAQANAAEADgABAA8AAQAQAAEAEQABABMAAQAUAAEAFgABABgAAQAZAAEAGgABABsAAQAcAAEAHgABACAAAQAhAAEAIgABACMAAQAkAAEAJgABACgAAQApAAEAKwABACwAAQAtAAEALgABADAAAQAxAAEAMgABADQAAQA2AAEANwABADgAAQA5AAEAOgABADwAAQA9AAEAPgABAD8AAQBAAAEAQQABAEMAAgADAHQLohXIHkUAAgACAK4NvhpGAAAARwAAAAAAAgBHAGEBlQKsA60EoAWHBmMHNggBCcgJhgpBC/cLqAxXDQAOqA5LD+sPixAmEb8RVxLsEn8TEBSeFCwVuBVCFssWUhfXF1oY3BhdGd4ZXBrYGlQbzRtHHL4cNB2pHRwejx7/Hm8f3R9KILUgICGHIe8hVCK3IhkjeiPXIzMkjiTkJDkliiXXJSEmZSaiJtcm/iZGAAAARwAAAAAAAgAEAO4MnBXWHPMiAwABAAUAAQAHAAEACAABAAkAAQALAAEADQABAA4AAQAPAAEAEAABABEAAQATAAEAFAABABYAAQAYAAEAGQABABoAAQAbAAEAHAABAB4AAQAgAAEAIQABACIAAQAjAAEAJAABACYAAQAoAAEAKQABACsAAQAsAAEALQABAC4AAQAwAAEAMQABADIAAQA0AAEANgABADcAAQA4AAEAOQABADoAAQA8AAEAPQABAD4AAQA/AAEAQAABAEEAAQBDAAIAAwB0C6IVyB5FAAIAAgCuDb4aRgAAAEcAAAAAAAEAAwABAAYAAQAJAAEADwABABYAAQAlAAEAKAABACsAAQAuAAEANAABADsAAAAAAAAARwACAAgAkQkiETUXGRz7H/wiLCWOJk4AAAAAAAAARwACAAgAkQkiETUXGRz7H/wiLCWOJk4AAAAAAAAAAAAAAAAAAQADAAAABgABAAkAAQAMAAEADwABABYAAQAlAAEAKAAAACsAAQAuAAEAMQABADQAAQA7AAAAAAACABQAlgIRBXAHuAnqCwgOExAMEvQTzhWZF1YZBxusHEYe1B9ZIdQiRiSvJRMAAgAFAA4H3A1wFNEaBSEXAAIAFQD2A48H2ArbDZsQIRNxFZEXgxlLG+wcaB7CH/sgFyIWI/ojxSR4JRUmnCYrAAIABQAOB9wNcBTRGgUhLwACAAkAMggID7oUdhlbHYIgACPlJDwmNwACAAUADgfcDXAU0RoFITsAAgAEANkPpRq0IbwlPgABAEMAAQBIAAEATgAAAAAAAgADAHMMtRZyHwIAAgADACUKABSfHQQAAgADAB8K+BOZHQYAAgAFAA4H3A1wFNEaBSEKAAIABACaETwcoSIGJg0AAgADADAKDhSpHQ8AAgADACUKABSfHREAAgADAB8K+BOZHRMAAgAFAA4H3A1wFNEaBSEXAAIAAwDlEewciyMZAAIAAwAwCg4UqR0bAAIAAwAlCgAUnx0dAAIAAwAfCvgTmR0fAAIABQAOB9wNcBTRGgUhIwACAAMAxBTdH2olJQACAAMAMAoOFKkdJwACAAMAJQoAFJ8dKQACAAMAHwr4E5kdKwACAAUADgfcDXAU0RoFIS8AAgADAAISWx0FJDEAAgADADAKDhSpHTMAAgADACUKABSfHTUAAgADAB8K+BOZHTcAAgAFAA4H3A1wFNEaBSE7AAIABADZD6UatCG8JT4AAQBDAAEASAABAE4AAAAAAAEAAwABAAYAAQAJAAEADAABAA8AAQAWAAEAJQABACgAAQArAAEALgABADEAAQA0AAEAOwAAAAAAAgADADAKDhSpHQIAAgADACUKABSfHQQAAgADAB8K+BOZHQYAAgAFAA4H3A1wFNEaBSEKAAIABACaETwcoSIGJg0AAgADADAKDhSpHQ8AAgADACUKABSfHREAAgADAB8K+BOZHRMAAgAFAA4H3A1wFNEaBSEXAAIAAwDEFN0faiUZAAIAAwAwCg4UqR0bAAIAAwAlCgAUnx0dAAIAAwAfCvgTmR0fAAIABQAOB9wNcBTRGgUhIwACAAMAxBTdH2olJQACAAMAMAoOFKkdJwACAAMAJQoAFJ8dKQACAAMAHwr4E5kdKwACAAUADgfcDXAU0RoFIS8AAgADAMQU3R9qJTEAAgADADAKDhSpHTMAAgADACUKABSfHTUAAgADAB8K+BOZHTcAAgAFAA4H3A1wFNEaBSE7AAIABACaETwcoSIGJj4AAQBDAAEASAABAE4AAAAAAAEABwABAA8AAQAWAAEAHgABACYAAQAtAAEANQABADwAAQBEAAEATgAAAAAAAQADAAEABgABAAkAAQAMAAEADwABABYAAQAlAAEAKAABACsAAQAuAAEAMQABADQAAQA7AAAAAAABAEwAAQBOAAAAAAABAAIAAQAEAAEABgABAAgAAQAKAAEADAABAA4AAQAQAAEAEgABABQAAQAWAAEAGAABABoAAQAcAAEAHgABACAAAQAiAAEAJAABACYAAQAoAAEAKgABACwAAQAuAAEAMAABADIAAQA0AAEANgABADgAAQA6AAEAPAABAD0AAQA/AAEAQQABAEMAAQBEAAEARgABAEgAAQBKAAEATAABAE4AAAAAAAEACgABAEMAAAAAAAEAAwABAAYAAQAJAAEADAABAA8AAQAWAAEAJQABACgAAQArAAEALgABADEAAQA0AAEAOwAAAAAAAQAHAAEADwABABYAAQAeAAEAJgABAC0AAQA1AAEAPAABAEQAAQBOAAAAAAAAAAAAAQADAAAABgABAAkAAQAMAAEADwABABYAAQAlAAEAKAAAACsAAQAuAAEAMQABADQAAQA7AAAAAAACAAwADwQUCAgM5w+oE0IXqRrTHa8gKyMqJYomCwACABUAXwBRAacCSQQiBiYISwqGDNQOKhGHE+YVPBiKGsUc6h7uIMciaSS/JbEmHwACABQAOQDVAL8B6gJJBNYFiQdcCUwLVQ1zD6IR4RMuFoQY5RpLHbofKiKcJDIAAgAVAF8AUQGnAkkEIgYmCEsKhgzUDioRhxPmFTwYihrFHOoe7iDHImkkvyWxJkYAAgAJAOkALANVBiAKYg76EtAX0BzrIU4AAAAAAAEAAwABAAYAAQAJAAEADAABAA8AAQAWAAEAJQABACgAAQArAAEALgABADEAAQA0AAEAOwAAAAAAAgADAA4USR8vJQIAAQAFAAEABwABAAkAAQAKAAEACwABAAwAAQANAAEADwABABAAAQARAAEAEgABABMAAQAUAAEAFgABABcAAQAYAAEAGQABABoAAQAbAAEAHAABAB4AAQAgAAEAIgABACQAAQAlAAEAJgABACgAAQApAAEAKgABACsAAQAtAAEALgABADAAAQAyAAEANAABADUAAQA2AAEANwABADgAAQA5AAEAOgABADwAAgACAOAIBhY9AAEAPgABAD8AAQBAAAEAQQABAEMAAgADAHQLohXIHkUAAgACAK4NvhpGAAAARwAAAAAAAgBGAH8B7AJOBKQF7wYsCF8JiQqnC74MyQ3NDsoPvRCoEY4SaxNDFBIV2xWeFloXERjDGG4ZFBq2GlIb6Bt6HAcdjh0SHpMeDR+EH/cfZSDQIDYhmSH4IVMiqiL+Ik4jmyPlIyskbSSsJOgkISVXJYkluSXlJQ4mNCZXJncmlCauJsQm2CbpJvcmAicKJw4nRQACAAIArg2+GkYAAABHAAAAAAACAAYA5QwSFrccbiGbJHImBQABAAcAAQAJAAEACgABAAsAAQAMAAEADwABABAAAQARAAEAEgABABMAAQAUAAEAFgABABcAAQAYAAEAGQABABoAAQAbAAEAHAABAB4AAQAkAAEAJQABACYAAQAoAAEAKQABACoAAQAtAAEALgABADAAAQAyAAEANAABADUAAQA2AAEANwABADgAAQA5AAEAOgABADwAAgACAOAIBhY9AAEAPgABAD8AAQBAAAEAQQABAEMAAAAAAAIAFABoAG0B3wKfBJoGwAgHC2QN0g9LEsUUPhesGQkcUB52IHEiMSSjJagmEwACABUAXwBRAacCSQQiBiYISwqGDNQOKhGHE+YVPBiKGsUc6h7uIMciaSS/JbEmJwACABQAaABtAd8CnwSaBsAIBwtkDdIPSxLFFD4XrBkJHFAediBxIjEkoyWoJjoAAgAVAF8AUQGnAkkEIgYmCEsKhgzUDioRhxPmFTwYihrFHOoe7iDHImkkvyWxJk4AAAAAAAEATAABAE4AAAAAAAEAAgABAAQAAQAGAAEACAABAAoAAQAMAAEADgABABAAAQASAAEAFAABABYAAQAYAAEAGgABABwAAQAeAAEAIAABACIAAQAkAAEAJgABACgAAQAqAAEALAABAC4AAQAwAAEAMgABADQAAQA2AAEAOAABADoAAQA8AAIAAgCxBAYSPQABAD8AAQBBAAEAQwABAEQAAQBGAAEASAABAEoAAQBMAAEATgAAAAAAAAAAAAEACgABAEMAAAAAAAIABADsEI4bLyLcJQMAAQAFAAEABgABAAcAAQAIAAEACQABAAsAAQANAAEADgABAA8AAQARAAEAEwABABQAAQAWAAEAGAABABkAAQAaAAEAGwABABwAAQAeAAEAIAABACEAAQAiAAEAJAABACYAAQAoAAEAKQABACsAAQAsAAEALQABAC4AAQAvAAEAMAABADEAAQAyAAEANAABADYAAQA3AAEAOAABADkAAQA6AAEAPAABAD0AAQA+AAEAPwABAEAAAABBAAEAQwACAAMAdAuiFcgeRQACAAIArg2+GkYAAABHAAAAAAACAEYAfwHsAk4EpAXvBiwIXwmJCqcLvgzJDc0Oyg+9EKgRjhJrE0MUEhXbFZ4WWhcRGMMYbhkUGrYaUhvoG3ocBx2OHRIekx4NH4Qf9x9lINAgNiGZIfghUyKqIv4iTiObI+UjKyRtJKwk6CQhJVcliSW5JeUlDiY0JlcmdyaUJq4mxCbYJukm9yYCJwonDidFAAIAAgCuDb4aRgAAAEcAAAAAAAIABgDlDBIWtxxuIZskciYFAAEABgABAAcAAQAIAAEACQABAAsAAQANAAEADgABAA8AAQARAAEAEwABABQAAQAWAAEAGAABABkAAQAaAAEAGwABABwAAQAeAAEAIgABACQAAQAmAAEAKAABACkAAQArAAEALAABAC4AAQAvAAEAMAABADEAAQAyAAEANAABADYAAQA3AAEAOAABADkAAQA6AAEAPAABAD0AAQA+AAEAPwABAEAAAAAAAAEAAwABAAYAAQAJAAEADAABAA8AAQAWAAEAJQABACgAAQArAAEALgABADEAAQA0AAEAOwAAAAAAAgAKAMkEhgknDqUS7xb1GqIe3iGBJFgmCQACABQAaABtAd8CnwSaBsAIBwtkDdIPSxLFFD4XrBkJHFAediBxIjEkoyWoJhwAAgAMAI8A/wEQBJoGggmzDB0QtBNvF0MbKR8aIycAAgAKAMkEhgknDqUS7xb1GqIe3iGBJFgmMAACABQAaABtAd8CnwSaBsAIBwtkDdIPSxLFFD4XrBkJHFAediBxIjEkoyWoJkMAAgAMAI8A/wEQBJoGggmzDB0QtBNvF0MbKR8aI04AAAAAAAEAAwABAAYAAQAJAAEADAABAA8AAQAWAAEAJQABACgAAQArAAEALgABADEAAQA0AAEAOwAAAAAAAQAJAAEAFQABAB4AAQAnAAEAMwABAEMAAgAMAM4F4wpkD28TExdZGkkd5B8qIhUkmyWnJk4AAAAAAAEAQwACAAwAzgXjCmQPbxMTF1kaSR3kHyoiFSSbJacmTgAAAAAAAQAJAAEAFQABAB4AAQAnAAEAMwABAEMAAgAMAM4F4wpkD28TExdZGkkd5B8qIhUkmyWnJk4AAAAAAAEAQwACAAwAzgXjCmQPbxMTF1kaSR3kHyoiFSSbJacmTgAAAAAAAAAAAAEACQABABUAAQAeAAEAJwABADMAAQBDAAIADADOBeMKZA9vExMXWRpJHeQfKiIVJJslpyZOAAAAAAABAEMAAgAMAM4F4wpkD28TExdZGkkd5B8qIhUkmyWnJk4AAAAAAAEABgABAAkAAAApAAEAMgABADcAAABDAAEATgAAAAAAAAAAAAEACQABABUAAQAeAAEAJwABADMAAQBDAAIADADOBeMKZA9vExMXWRpJHeQfKiIVJJslpyZOAAAAAAABAAkAAQAVAAEAHgABACcAAQAzAAEAQwACAAwAzgXjCmQPbxMTF1kaSR3kHyoiFSSbJacmTgAAAAAAAgAMAA8EFAgIDOcPqBNCF6ka0x2vICsjKiWKJgsAAgAVADUAxACbAa8C9QNmBfsGrwh/CmYMYg5vEIwSthTqFikZcBu8HQ0gYyK5JB8AAgAJAI4BAAVsCV0OhxOzGKQdECKCJScAAgAMAA8EFAgIDOcPqBNCF6ka0x2vICsjKiWKJjIAAgAVADUAxACbAa8C9QNmBfsGrwh/CmYMYg5vEIwSthTqFikZcBu8HQ0gYyK5JEYAAgAJAI4BAAVsCV0OhxOzGKQdECKCJU4AAAAAAAEAAwABAAYAAQAJAAEADAABAA8AAQAWAAEAJQABACgAAQArAAEALgABADEAAQA0AAEAOwAAAAAAAAAAAAAAAAABAAcAAQAPAAEAFgABAB4AAQAmAAEALQABADUAAQA8AAEARAABAE4AAAAAAAEAAwABAAYAAQAJAAEADAABAA8AAQAWAAEAJQABACgAAQArAAEALgABADEAAQA0AAEAOwAAAAAAAQAKAAEAQwAAAAAAAQAKAAEAQwABAE4AAAAAAAEAAwABAAYAAQAJAAEADAABAA8AAQAWAAEAJQABACgAAQArAAEALgABADEAAQA0AAEAOwAAAAAAAQADAAEABgABAAkAAQAMAAEADwABABYAAQAlAAEAKAABACsAAQAuAAEAMQABADQAAQA7AAAAAAACAAoAyQSGCScOpRLvFvUaoh7eIYEkWCYJAAIAFABoAG0B3wKfBJoGwAgHC2QN0g9LEsUUPhesGQkcUB52IHEiMSSjJagmHAACAAwAjwD/ARAEmgaCCbMMHRC0E28XQxspHxojJwACAAoAyQSGCScOpRLvFvUaoh7eIYEkWCYwAAIAFABoAG0B3wKfBJoGwAgHC2QN0g9LEsUUPhesGQkcUB52IHEiMSSjJagmQwACAAwAjwD/ARAEmgaCCbMMHRC0E28XQxspHxojTgAAAAAAAQADAAEABgABAAkAAQAMAAEADwABABYAAQAlAAEAKAABACsAAQAuAAEAMQABADQAAQA7AAAAAAACABQAaABtAd8CnwSaBsAIBwtkDdIPSxLFFD4XrBkJHFAediBxIjEkoyWoJhMAAgAVAF8AUQGnAkkEIgYmCEsKhgzUDioRhxPmFTwYihrFHOoe7iDHImkkvyWxJicAAgAUAGgAbQHfAp8EmgbACAcLZA3SD0sSxRQ+F6wZCRxQHnYgcSIxJKMlqCY6AAIAFQBfAFEBpwJJBCIGJghLCoYM1A4qEYcT5hU8GIoaxRzqHu4gxyJpJL8lsSZOAAAAAAABAEwAAQBOAAAAAAABAAIAAQAEAAEABgABAAgAAQAKAAEADAABAA4AAQAQAAEAEgABABQAAQAWAAEAGAABABoAAQAcAAEAHgABACAAAQAiAAEAJAABACYAAQAoAAEAKgABACwAAQAuAAEAMAABADIAAQA0AAEANgABADgAAQA6AAEAPAABAD0AAQA/AAEAQQABAEMAAQBEAAEARgABAEgAAQBKAAEATAABAE4AAAAAAAAAAQAAAAAAAAAAAAAAAAAAAEMAAgAIACcOaRYDHP8f2CLUJB8m1yZKAAAAAAAAAEMAAgAIACcOaRYDHP8f2CLUJB8m1yZKAAAAAAAAAEMAAgAIACcOaRYDHP8f2CLUJB8m1yZKAAAAAAAAAAAAAAAAAAAAAAABAAEAAQADAAEABAAAAAUAAQAGAAEACAABAAkAAAAKAAEACwABAA0AAQAOAAAADwABABAAAQASAAEAEwAAABQAAQAVAAEAFwABABgAAAAZAAEAGgABABwAAQAdAAAAHgABAB8AAQAhAAEAIgAAACMAAQAkAAEAJgABACcAAAAoAAEAKQABACsAAQAsAAAALQABAC4AAQAwAAEAMQAAADIAAQAzAAEANQABADYAAAA3AAEAOAABADoAAQA7AAAAPAABAD0AAQA/AAEAQAABAEIAAABFAAIABACeDg4ZcyA0JUgAAABOAAAAAAAAAEMAAABFAAIABACeDg4ZcyA0JUgAAABOAAAAAAAAABAAAgAqAJ8BLwO0BC0GnQcDCV8KsQv8DD8OeQ+tENoR/hIcFDIVQxZMF08YTBlCGjEbGRz6HNUdqR52Hzsg+CCtIVoiACObIy4ktiQ0JaUlCiZiJqom4CYDJzkAAAA/AAIAEAD/A7IHJgtkDnARThT/FocZ4hsUHhgg6yGKI+skBSbGJk4AAAAAAAAAEAACACoAnwEvA7QELQadBwMJXwqxC/wMPw55D60Q2hH+EhwUMhVDFkwXTxhMGUIaMRsZHPoc1R2pHnYfOyD4IK0hWiIAI5sjLiS2JDQlpSUKJmImqibgJgMnOQAAAD8AAgAQAP8DsgcmC2QOcBFOFP8WhxniGxQeGCDrIYoj6yQFJsYmTgAAAAAAAAADAAIAGgBTApUExAbiCPEK8QzhDsQQmBJdFBMWuxdUGd0aVxzBHRgfXSCOIaoiriOYJGYlEiaXJvAmHAAAAB4AAgAcACsCRgRRBk4IPQofDPMNuw92ESYTxxRdFuYXYhnRGjEcgx3GHvofHSEtIisjEiTiJJklMSanJvQmOQAAADsAAgAUAOYClgUhCJAK5gwoD1cRdRODFYEXbhlLGxcdzx50IP8hbiO6JNclryZOAAAAAAAAAAMAAgAaAFMClQTEBuII8QrxDOEOxBCYEl0UExa7F1QZ3RpXHMEdGB9dII4hqiKuI5gkZiUSJpcm8CYcAAAAHgACABwAKwJGBFEGTgg9Ch8M8w27D3YRJhPHFF0W5hdiGdEaMRyDHcYe+h8dIS0iKyMSJOIkmSUxJqcm9CY5AAAAOwACABQA5gKWBSEIkArmDCgPVxF1E4MVgRduGUsbFx3PHnQg/yFuI7ok1yWvJk4AAAAAAAAAAAAAAEMAAgAKANUH/wxGERAVfRikG44ePSGrI8QlTAAAAAAAAABDAAAARQACAAQAng4OGXMgNCVIAAAATgAAAAAAAABDAAAARQACAAQAng4OGXMgNCVIAAAATgAAAAAAAAABAAEAAwABAAUAAAAHAAEACQABAAsAAAANAAEADwABABEAAAATAAEAFQABABcAAAAZAAEAGwABAB0AAAAfAAEAIQABACMAAAAlAAEAJwABACkAAAArAAEALQABAC8AAAAxAAEAMwABADUAAAA3AAEAOQABADsAAAA9AAEAPwABAEEAAAAAAAAABQACABkAAQSDB6AKbQ32D0cSaBRfFi0Y2hloG9kcLR5oH4oglSGKImgjMSTkJIAlBiZzJsYm/CYdAAAAHgACAB8ATgNABuoIWguXDagPlBFeEwoVmhYRGHIZvhr2GxodLR4vHyAgAiHVIZgiTiP1I40kFyWSJf4lWialJt4mAyc8AAAAPgACABEANwVGCbcMwQ+AEgMVVhd/GYMbZR0mH8cgSCKnI98k6SWzJk4AAAAAAAAABQACABkAAQSDB6AKbQ32D0cSaBRfFi0Y2hloG9kcLR5oH4oglSGKImgjMSTkJIAlBiZzJsYm/CYdAAAAHgACAB8ATgNABuoIWguXDagPlBFeEwoVmhYRGHIZvhr2GxodLR4vHyAgAiHVIZgiTiP1I40kFyWSJf4lWialJt4mAyc8AAAAPgACABEANwVGCbcMwQ+AEgMVVhd/GYMbZR0mH8cgSCKnI98k6SWzJk4AAAAAAAIADAChBa8KOw9ZExAXZxpkHQcgTiI0JLAlryYLAAAADgACABEAIATwB3gLwA7MEaEUQheyGfEbAh7kH5YhFiNkJHglTibcJh4AAAAgAAIAEQAgBPAHeAvADswRoRRCF7IZ8RsCHuQfliEWI2QkeCVOJtwmMAAAADIAAgAZANACWwW2B+sJAgz+DeMPtRF1EyQVxBZTGNYZSxuxHAoeUx+PILoh1CLbI8skoSVUJtgmSgAAAAAAAgAMAKEFrwo7D1kTEBdnGmQdByBOIjQksCWvJgsAAAAOAAIAEQAgBPAHeAvADswRoRRCF7IZ8RsCHuQfliEWI2QkeCVOJtwmHgAAACAAAgARACAE8Ad4C8AOzBGhFEIXshnxGwIe5B+WIRYjZCR4JU4m3CYwAAAAMgACABkA0AJbBbYH6wkCDP4N4w+1EXUTJBXEFlMY1hlLG7EcCh5TH48guiHUItsjyyShJVQm2CZKAAAAAAAAAEMAAgAKABQKHBF4FrIaGB7UIAQjtiT2JcMmTAAAAAAAAABDAAAAAAAAAEMAAAAAAAAAQwACAAoAoAe2DPkQwRQ0GGUbWh4VIZIjuSVMAAAAAAAAAEMAAgAEANQRPRyGIvIlRgAAAAAAAABDAAIABADUET0chiLyJUYAAAAAAAAAQwACAAQA1BE9HIYi8iVGAAAAAAAAAEMAAgAEANQRPRyGIvIlRgAAAAAAAABDAAIABADUET0chiLyJUYAAAAAAAAAQwACAAQA1BE9HIYi8iVGAAAAAAAAAAAAAAACAAAABAAAAAYAAAAIAAAACgAAAAwAAAAOAAAAEAAAABIAAAAUAAAAFgAAABgAAAAaAAAAHAAAAB4AAAAgAAAAIgAAACQAAAAmAAAAKAAAACoAAAAsAAAALgAAADAAAAAyAAAANAAAADYAAAA4AAAAOgAAADwAAAA+AAAAQAAAAEIAAABEAAAAAAAAAAIAAAAEAAAABgAAAAgAAAAKAAAADAAAAA4AAAAQAAAAEgAAABQAAAAWAAAAGAAAABoAAAAcAAAAHgAAACAAAAAiAAAAJAAAACYAAAAoAAAAKgAAACwAAAAuAAAAMAAAADIAAAA0AAAANgAAADgAAAA6AAAAPAAAAD4AAABAAAAAQgAAAEQAAAAAAAAAAgAAAAQAAAAGAAAACAAAAAoAAAAMAAAADgAAABAAAAASAAAAFAAAABYAAAAYAAAAGgAAABwAAAAeAAAAIAAAACIAAAAkAAAAJgAAACgAAAAqAAAALAAAAC4AAAAwAAAAMgAAADQAAAA2AAAAOAAAADoAAAA8AAAAPgAAAEAAAABCAAAARAAAAAAAAgAGAOUMEha3HG4hmyRyJgUAAQAHAAEACQABAAsAAQANAAEADwABABEAAQATAAEAFAABABYAAQAYAAEAGgABABwAAQAeAAEAIAABACIAAQAkAAEAJgABACgAAQApAAEAKwABAC0AAQAuAAEAMAABADIAAQA0AAEANgABADgAAQA6AAEAPAABAD0AAQA/AAEAQQABAEMAAgADABQSdh1hJEUAAgACAOMc7SRGAAAAAAACAEQAiAEBA24EzAUeB2EInQnLCvILCw0eDiYPJhAeEQ0S9hLXE68UgRVNFhEXzxeIGDsZ5xmPGjAbzBtjHPUcgh0KHo0eCx+GH/sfbSDaIEMhqCEJImYivyIVI2YjtCP+I0UkiCTHJAQlPSVyJaQl0yX/JScmTCZuJowmqCbAJtUm5yb2JgEnCScOJ0MAAgADABQSdh1hJEUAAAAAAAAABQD//wYAAAALAP//DAAAABEA//8SAAAAFwD//xgAAAAdAP//HgAAACMA//8kAAAAKQD//yoAAAAvAP//MAAAADUA//82AAAAOwD//zwAAABBAP//AAABAAEAAAADAAEABQABAAYAAQAHAAAACQABAAsAAQAMAAEADQAAAA8AAQARAAEAEgABABMAAAAVAAEAFwABABgAAQAZAAAAGwABAB0AAQAeAAEAHwAAACEAAQAjAAEAJAABACUAAAAnAAEAKQABACoAAQArAAAALQABAC8AAQAwAAEAMQAAADMAAQA1AAEANgABADcAAAA5AAEAOwABADwAAQA9AAAAPwABAEEAAAAAAP//QwAAAEoA//8AAAEAQwABAEUAAgAGAIkIGhDWFsActyFtJUoAAAAAAP//AAAAAAAA//9DAAAATAD//wAAAQBDAAEARwACAAYA7w40GGMehyIqJZ0mTAAAAAAAAAAAAAEARQACAAQAng4OGXMgNCVIAAAAAAAAAAAAAQBFAAIABACeDg4ZcyA0JUgAAAAAAAAAAAABAEUAAgAEAJ4ODhlzIDQlSAAAAAAAAQBFAAIABACeDg4ZcyA0JUgAAAAAAAAARwD//wAAAQBHAAEATgAAAAAAAAAAAAAAHQD//x4AAAA8AP//PgAAAE4A//8AAAEABQACAAUAGwUjDIcT7Rr1IQkAAAAWAAIACADfAesFBwumEGoWCRwlITElHQABAB4AAgAIAPoCYAcjDA0RAxbtGrAfFiQlAAAAMgACAAsAIAG2Ax8HBws2D4cT2hcJHPEfWiPwJTwAAQA+AAIABQAbBSMMhxPtGvUhQgAAAEkAAgAGAN8CwAjSDz4XUB4xJE4AAAAAAAAACwD//w4AAAAeAP//IAAAADAA//8yAAAASgD//wAAAgAEAHQGFA/8F5wgAwAAAAgAAgAEAAAFXQ6zGBAiCwABAA4AAgAEAHQGFA/8F5wgEQAAABcAAgAIAN8B6wUHC6YQahYJHCUhMSUeAAEAIAACAAQAdAYUD/wXnCAjAAAAKQACAAgA3wHrBQcLphBqFgkcJSExJTAAAQAyAAIABwB/A4wI+A2HExgZhB6RIzgAAABBAAIACgBRAUkEJgiGDCoR5hWKGuoexyK/JUoAAAAAAAAAOQD//z8AAABOAP//AAABAAkAAgAIAN8B6wUHC6YQahYJHCUhMSUQAAEAJwACABMAcgCOAR4DAAUfB2wJ2AtdDu4QhxMiFrMYOBukHfEfECLyI4IlniY5AAEAPAACAAQAAAVdDrMYECI/AAEARwACAAgA3wHrBQcLphBqFgkcJSExJU4AAAAAAAAAHAD//x4AAAA5AP//OwAAAE4A//8AAAEAAwACAAsAIAG2Ax8HBws2D4cT2hcJHPEfWiPwJQ0AAAASAAIACwAgAbYDHwcHCzYPhxPaFwkc8R9aI/AlHAABAB4AAgAKAPcETAldDUIRAhWgGBwcbx+LIk8lJwAAACwAAgAOAMEAjgIABd8HBwtdDswRRBWzGAkcMR8QIoIkTyY5AAEAOwACAAcAogZeDLsR1RavGzsgVCRBAAAARQACAAoAUQFJBCYIhgwqEeYVihrqHscivyVOAAAAAAAAAAAAAABMAP//AAABAEMAAABGAAIABwD4DEAVKRuJH8UiESWEJkwAAAAAAAAAAAAAAAAA//9DAAAATAD//wAAAQBGAAIABwDfCZsR2BfqHPsgGSQ3JkwAAAAAAAAAAQABAAMAAAAFAAEABwAAAAkAAQALAAAADQABAA8AAAARAAEAEwAAABUAAQAXAAAAGQABABsAAAAdAAEAHwAAACEAAQAjAAAAJQABACcAAAApAAEAKwAAAC0AAQAvAAAAMQABADMAAAA1AAEANwAAADkAAQA7AAAAPQABAD8AAABBAAEAQwAAAEUA//8AAAAAAQD//wIAAAADAP//BAAAAAUA//8GAAAABwD//wgAAAAJAP//CgAAAAsA//8MAAAADQD//w4AAAAPAP//EAAAABEA//8SAAAAEwD//xQAAAAVAP//FgAAABcA//8YAAAAGQD//xoAAAAbAP//HAAAAB0A//8eAAAAHwD//yAAAAAhAP//IgAAACMA//8kAAAAJQD//yYAAAAnAP//KAAAACkA//8qAAAAKwD//ywAAAAtAP//LgAAAC8A//8wAAAAMQD//zIAAAAzAP//NAAAADUA//82AAAANwD//zgAAAA5AP//OgAAADsA//88AAAAPQD//z4AAAA/AP//QAAAAEEA//9CAAAAQwD//wAAAQABAAEAQgABAEMAAgAEAJ4NIBYkHQ4jRgAAAAAAAQAAAAEARQACAAQAng4OGXMgNCVIAAAAAAAAAEMA//8AAP//RwAAAAAA//9HAAAAAAAAAEcA//8AAP//TgAAAAAAAQBGAAEARwAAAAAAAQBGAAEARwAAAAAAAQBGAAEARwAAAAAAAQBDAAEARgAAAAAAAQBDAAIABAA1D2UX9R1nI0YAAAAAAAEAGgABAB4AAQAjAAEAJgABAC4AAQAzAAEAOAABADwAAAAAAAEABQABAAgAAQAKAAEADgABABAAAQAVAAEAGAABABoAAQAeAAEAIwABACYAAQAoAAEALAABAC4AAQAzAAEANgABADgAAQA8AAAAAAACAAwAAQT6B+gLwA99ExYXfxqtHY8gEyMcJYUmCwACABAANQE4A4AF6wdvCv8MmQ84EtgUdxcRGqEcJR+QIdgj2yUaAAIABAAHFzUguySsJh0AAAAeAAAAAAACAAwAAQT6B+gLwA99ExYXfxqtHY8gEyMcJYUmCwACABAANQE4A4AF6wdvCv8MmQ84EtgUdxcRGqEcJR+QIdgj2yUaAAIABAAHFzUguySsJh0AAAAeAAAAAAABABsAAQAeAAEAJgABACcAAQAxAAEAMwABADkAAQA8AAAAAAABABsAAQAeAAAAAAABAAMAAQAFAAEACAABAAsAAQAOAAEAEAABABMAAQAWAAEAGQABABsAAQAeAAEAIQABACMAAQAmAAEAJwABACkAAQAsAAEALgABADEAAQAzAAEANAABADcAAQA5AAEAPAAAAAAAAQAFAAEACQABAA0AAQAVAAEAHgABACEAAQAkAAEAJwABAC0AAQA0AAAAAAACAAwA+gBBA0kGyQmUDYcRiRV8GUcdxyDPIxYmCwACABAANQE4A4AF6wdvCv8MmQ84EtgUdxcRGqEcJR+QIdgj2yUaAAIABAAHFzUguySsJh0AAAAeAAAAAAACAAwA+gBBA0kGyQmUDYcRiRV8GUcdxyDPIxYmCwACABAANQE4A4AF6wdvCv8MmQ84EtgUdxcRGqEcJR+QIdgj2yUaAAIABAAHFzUguySsJh0AAAAeAAAAAAAAAAAAAAAAAAEABQAAAAkAAQANAAEAEQABABUAAQAeAAEAIQAAACQAAQAnAAEAKgABAC0AAQA0AAAAAAACAAwA+gBBA0kGyQmUDYcRiRV8GUcdxyDPIxYmCwACAA0AsAMZB14Khw2dEJ8TjhZqGTAc3B5pIcYj1iUXAAIACAA8Dj4WshueH3wiiyTyJccmHgACAB8AHgS1B+IKuA1FEJMSqxSTFlAY5hlaG7Ac6B0FHwkg+CDPIZQiRCPkI3Mk8SRhJcIlFSZcJpYmxCbmJv4mDCc8AAAAAAACAAwA+gBBA0kGyQmUDYcRiRV8GUcdxyDPIxYmCwACAA0AsAMZB14Khw2dEJ8TjhZqGTAc3B5pIcYj1iUXAAIACAA8Dj4WshueH3wiiyTyJccmHgACAB8AHgS1B+IKuA1FEJMSqxSTFlAY5hlaG7Ac6B0FHwkg+CDPIZQiRCPkI3Mk8SRhJcIlFSZcJpYmxCbmJv4mDCc8AAAAAAABAAUAAQAJAAEADQABABEAAQAVAAEAHgABACEAAQAkAAEAJwABACoAAQAtAAEANAAAAAAAAgAMAAEE+gfoC8APfRMWF38arR2PIBMjHCWFJgsAAQAXAAIACAA8Dj4WshueH3wiiyTyJccmHgACAB8AHgS1B+IKuA1FEJMSqxSTFlAY5hlaG7Ac6B0FHwkg+CDPIZQiRCPkI3Mk8SRhJcIlFSZcJpYmxCbmJv4mDCc8AAAAAAAAAAAAAQAFAAEACQABAA0AAQARAAEAFQABAB4AAQAhAAEAJAABACcAAQAqAAEALQABADQAAAAAAAIACQCUAnQGsQoUD4cT/BdfHJwgfCQIAAEACgAAAAAAAgADAIwIhxOEHgIAAQAEAAEABgABAAgAAQAKAAEADAABAA4AAQAQAAEAEgABABQAAQAWAAEAGAABABoAAQAcAAEAHgABACAAAQAiAAEAJAABACYAAQAoAAEAKgABACwAAQAuAAEAMAABADIAAQA0AAEANgABADgAAQA6AAEAPAAAAAAAAQAFAAEACQABAA0AAQARAAEAFQABAB4AAQAhAAEAJAABACcAAQAqAAEALQABADQAAAAAAAAAAAAAAAAAAQAFAAAACQABAA0AAQARAAEAFQABAB4AAQAhAAAAJAABACcAAQAqAAEALQABADQAAAAAAAIABwDUBLAJkg55E2EYSR0uIgYAAgAFAHYG+AyAEwsakiAKAAIABgClBUEL1hBmFvQbgSEPAAIABwDvBN4JzQ65E54Yex1MIhUAAgAKAL0DbwcXC7QOSRLUFVYZzxxBIK0jHgACAB8A7wHYA7kFkgdiCSsL6wygDk0Q8RGJExYVmRYPGHkZ1RokHGUdlh64H8ggyCG1Io8jVCQEJZ0lHiaFJtEmACc8AAAAAAABAAUAAQAJAAEADQABABEAAQAVAAEAHgABACEAAQAkAAEAJwABACoAAQAtAAEANAAAAAAAAQAaAAEAHgABACUAAQAnAAEAMgABADMAAQA5AAEAPAAAAAAAAQAaAAEAHgAAAAAAAQAFAAEACAABAAoAAQAOAAEAEAABABUAAQAYAAEAGgABAB4AAQAgAAEAJQABACcAAQAoAAEAKgABAC4AAQAwAAEAMgABADMAAQA1AAEANwABADkAAQA8AAAAAAACAAcA1AAmA8EGdwsqEbkXCx8GAAIABQDUBfcLZBIRGfYfCgACAAYAHAVoCt4PehU6GxchDwACAAcAkQQ9CQMO4BLRF9Yc7CEVAAIACgB4A/UGeAoADowRGxWwGEUc3R92Ix4AAgAfAKYBTAPwBJMGMwjQCWoLAQ2UDiIQrBEvE60UIhaRF/gYVRqpG/EcLh5fH4AgkiGTIoAjWiQaJcIlTCa1JvgmPAAAAAAAAgAJAJQCdAaxChQPhxP8F18cnCB8JAgAAQAKAAAAAAACAAMAjAiHE4QeAgABAAQAAQAGAAEACAABAAoAAQAMAAEADgABABAAAQASAAEAFAABABYAAQAYAAEAGgABABwAAQAeAAEAIAABACIAAQAkAAEAJgABACgAAQAqAAEALAABAC4AAQAwAAEAMgABADQAAQA2AAEAOAABADoAAQA8AAAAAAAAAAAAAAAAAAEAGwABAB4AAQAmAAEAJwABADEAAQAzAAEAOQABADwAAAAAAAEAGQABABsAAQAeAAEAOQABADwAAAAAAAEAAwABAAUAAQAIAAEACwABAA4AAQAQAAEAEwABABYAAQAZAAEAGwABAB4AAQAhAAEAJAABACYAAQAnAAEAKQABACwAAQAvAAEAMQABADMAAQA0AAEANwABADkAAQA8AAAAAAABAAUAAQAJAAEADQABABEAAQAVAAEAHgABACEAAQAkAAEAJwABACoAAQAtAAEANAAAAAAAAgAHANQEsAmSDnkTYRhJHS4iBgACAAUAdgb4DIATCxqSIAoAAgAGAKUFQQvWEGYW9BuBIQ8AAgAHAO8E3gnNDrkTnhh7HUwiFQACAAoAvQNvBxcLtA5JEtQVVhnPHEEgrSMeAAIAHwDvAdgDuQWSB2IJKwvrDKAOTRDxEYkTFhWZFg8YeRnVGiQcZR2WHrgfyCDIIbUijyNUJAQlnSUeJoUm0SYAJzwAAAAAAAEABQABAAkAAQANAAEAEQABABUAAQAeAAEAIQABACQAAQAnAAEAKgABAC0AAQA0AAAAAAACAAsAIAG2Ax8HBws2D4cT2hcJHPEfWiPwJQoAAgAMAHkAqAFYA24F2geVCpwN7xCOFIQY2hynIRUAAgANAJoBLAQLBxIKLg1YEIcTuBbiGf4cBSDkInYlIQACABwABAUXCYgMgg8dEm4UfxZbGAgajhvvHC8eUh9cIEwhJiLrIpwjOiTIJEQlsSUOJl0mnSbPJvMmCSc8AAAAAAACAAsAIAG2Ax8HBws2D4cT2hcJHPEfWiPwJQoAAgAMAHkAqAFYA24F2geVCpwN7xCOFIQY2hynIRUAAgANAJoBLAQLBxIKLg1YEIcTuBbiGf4cBSDkInYlIQACABwABAUXCYgMgg8dEm4UfxZbGAgajhvvHC8eUh9cIEwhJiLrIpwjOiTIJEQlsSUOJl0mnSbPJvMmCSc8AAAAAAACAAsAIAG2Ax8HBws2D4cT2hcJHPEfWiPwJQoAAgAMAHkAqAFYA24F2geVCpwN7xCOFIQY2hynIRUAAgANANoA3wKXBcAINAzSD4cTPhfcGlAeeSExJDYmIQACABwABAUXCYgMgg8dEm4UfxZbGAgajhvvHC8eUh9cIEwhJiLrIpwjOiTIJEQlsSUOJl0mnSbPJvMmCSc8AAAAAAACAAsAIAG2Ax8HBws2D4cT2hcJHPEfWiPwJQoAAAAAAAAAAAACAAsAIAG2Ax8HBws2D4cT2hcJHPEfWiPwJQoAAgAMAHkAqAFYA24F2geVCpwN7xCOFIQY2hynIRUAAgANANoA3wKXBcAINAzSD4cTPhfcGlAeeSExJDYmIQACABwABAUXCYgMgg8dEm4UfxZbGAgajhvvHC8eUh9cIEwhJiLrIpwjOiTIJEQlsSUOJl0mnSbPJvMmCSc8AAAAAAACAAsAIAG2Ax8HBws2D4cT2hcJHPEfWiPwJQoAAAAAAAIAEwAtAK0AdgF/AsADNQXYBqUImAquDOUOOBGnEzAWzRiCG0seJyEUJBIAAgAMAL8CjQVqCFMLRw5HEU8UYBd3GpYduiDkIx0AAgAEAL4Hfw9JFyIfIAACAB0AwgGEA0UFAwe+CHUKKQzZDYYPLBHKEmQU9BV8F/wYcRraGzYdhR7EH/QgECIYIwgk3ySaJTQmqib1JjwAAAAAAAAAAAACAAsAIAG2Ax8HBws2D4cT2hcJHPEfWiPwJQoAAgAMAHkAqAFYA24F2geVCpwN7xCOFIQY2hynIRUAAgANANoA3wKXBcAINAzSD4cTPhfcGlAeeSExJDYmIQACABwABAUXCYgMgg8dEm4UfxZbGAgajhvvHC8eUh9cIEwhJiLrIpwjOiTIJEQlsSUOJl0mnSbPJvMmCSc8AAAAAAACAAsAIAG2Ax8HBws2D4cT2hcJHPEfWiPwJQoAAAAAAAIABwDUBLAJkg55E2EYSR0uIgYAAgAFAHYG+AyAEwsakiAKAAIABgClBUEL1hBmFvQbgSEPAAIABwDvBN4JzQ65E54Yex1MIhUAAgAKAL0DbwcXC7QOSRLUFVYZzxxBIK0jHgACAB8A7wHYA7kFkgdiCSsL6wygDk0Q8RGJExYVmRYPGHkZ1RokHGUdlh64H8ggyCG1Io8jVCQEJZ0lHiaFJtEmACc8AAAAAAABAAUAAQAJAAEADQABABEAAQAVAAEAHgABACEAAQAkAAEAJwABACoAAQAtAAEANAAAAAAAAAAAAAAAAAAAAAAAAQAFAAEACQABAA0AAQARAAEAFQABAB4AAQAhAAEAJAABACcAAQAqAAEALQABADQAAAAAAAIAHQA1AMEAjgGOArYDAAVlBt8HbAkHC6wMXQ4REMwRhxNEFf8WsxhkGgkcpB0xH6sgECJaI4IkgiVPJtsmHAAAAAAAAQAFAAEACQABAA0AAQARAAEAFQABAB4AAQAhAAEAJAABACcAAQAqAAEALQABADQAAAAAAAEABQABAAkAAQANAAEAEQABABUAAQAeAAEAIQABACQAAQAnAAEAKgABAC0AAQA0AAAAAAACAAcA1ASwCZIOeRNhGEkdLiIGAAIABQB2BvgMgBMLGpIgCgACAAYApQVBC9YQZhb0G4EhDwACAAcA7wTeCc0OuROeGHsdTCIVAAIACgC9A28HFwu0DkkS1BVWGc8cQSCtIx4AAgAfAO8B2AO5BZIHYgkrC+sMoA5NEPERiRMWFZkWDxh5GdUaJBxlHZYeuB/IIMghtSKPI1QkBCWdJR4mhSbRJgAnPAAAAAAAAQAFAAEACQABAA0AAQARAAEAFQABAB4AAQAhAAEAJAABACcAAQAqAAEALQABADQAAAAAAAIABwDUACYDwQZ3CyoRuRcLHwYAAgAFANQF9wtkEhEZ9h8KAAIABgAcBWgK3g96FTobFyEPAAIABwCRBD0JAw7gEtEX1hzsIRUAAgAKAHgD9QZ4CgAOjBEbFbAYRRzdH3YjHgACAB8ApgFMA/AEkwYzCNAJagsBDZQOIhCsES8TrRQiFpEX+BhVGqkb8RwuHl8fgCCSIZMigCNaJBolwiVMJrUm+CY8AAAAAAABAAgAAQAKAAAAAAABAAIAAQAEAAEABgABAAgAAQAKAAEADAABAA4AAQAQAAEAEgABABQAAQAWAAEAGAABABoAAQAcAAEAHgABACAAAQAiAAEAJAABACYAAQAoAAEAKgABACwAAQAuAAEAMAABADIAAQA0AAEANgABADgAAQA6AAEAPAAAAAAAAAAoAAIACACNB0ANNRKxFtMaoR4bIiMlLwACAAQASA8bGmIhoSUyAAEANgACAAcAJApdEvcYJx4TItYkfyY8AAAAAAAAACgAAgAHAFQIjA7wE8sYPR1FIcokLgAAAC8AAgAEAEgPGxpiIaElMgABADUAAAA2AAIABwAkCl0S9xgnHhMi1iR/JjwAAAAAAAAAHgAAAAAAAAAeAAIACwAZCdsPJhVpGd4csB/6IcsjMiU1JtYmKAAAAAAAAAAnAAAALAAAAAAAAAAeAAIACgBlCa8QchYIG6gefiGoIzslSSbhJicAAAAsAAIAEQCZBNQIswxDEIITeBYoGZYbxB2zH2gh4iIjJCsl+yWTJvAmPAAAAAAAAAAeAAAAAAAAACYAAQAoAAEAKwAAADgAAQA5AAEAOwAAAAAAAAAhAAEAIwABACYAAAA1AAEANgABADgAAAAAAAAAEAACACoAnwEvA7QELQadBwMJXwqxC/wMPw55D60Q2hH+EhwUMhVDFkwXTxhMGUIaMRsZHPoc1R2pHnYfOyD4IK0hWiIAI5sjLiS2JDQlpSUKJmImqibgJgMnOQAAAAAAAAAQAAIAKgCfAS8DtAQtBp0HAwlfCrEL/Aw/DnkPrRDaEf4SHBQyFUMWTBdPGEwZQhoxGxkc+hzVHakedh87IPggrSFaIgAjmyMuJLYkNCWlJQomYiaqJuAmAyc5AAAAAAAAAAMAAgAaAFMClQTEBuII8QrxDOEOxBCYEl0UExa7F1QZ3RpXHMEdGB9dII4hqiKuI5gkZiUSJpcm8CYcAAAAHgACABwAKwJGBFEGTgg9Ch8M8w27D3YRJhPHFF0W5hdiGdEaMRyDHcYe+h8dIS0iKyMSJOIkmSUxJqcm9CY5AAAAAAAAAAMAAgAaAFMClQTEBuII8QrxDOEOxBCYEl0UExa7F1QZ3RpXHMEdGB9dII4hqiKuI5gkZiUSJpcm8CYcAAAAHgACABwAKwJGBFEGTgg9Ch8M8w27D3YRJhPHFF0W5hdiGdEaMRyDHcYe+h8dIS0iKyMSJOIkmSUxJqcm9CY5AAAAAAAAAB4AAgADALQNThl8IiAAAAAAAAAAHgACAAMAtA1OGXwiIAAAACIAAAAAAAAAHwABACEAAQAkAAAAMwABADQAAQA2AAAAAAAAADAAAQAxAAEAMwAAAAAAAQAFAAIAGQABBIMHoAptDfYPRxJoFF8WLRjaGWgb2RwtHmgfiiCVIYoiaCMxJOQkgCUGJnMmxib8Jh0AAAAeAAIAHwBOA0AG6ghaC5cNqA+UEV4TChWaFhEYchm+GvYbGh0tHi8fICACIdUhmCJOI/UjjSQXJZIl/iVaJqUm3iYDJzwAAAAAAAEABQACABkAAQSDB6AKbQ32D0cSaBRfFi0Y2hloG9kcLR5oH4oglSGKImgjMSTkJIAlBiZzJsYm/CYdAAAAHgACAB8ATgNABuoIWguXDagPlBFeEwoVmhYRGHIZvhr2GxodLR4vHyAgAiHVIZgiTiP1I40kFyWSJf4lWialJt4mAyc8AAAAAAACAAYAowgLEGwW5RuDIEMkBQACAAcAJgh2D+0VhBspIMQjKiYLAAAADgACABAAQgQwCM4LKg9FEicV0hdKGo4cnx6AIC4ipiPnJOolpyYdAAIAAgAmFXEiHgAAACAAAgARACAE8Ad4C8AOzBGhFEIXshnxGwIe5B+WIRYjZCR4JU4m3CYwAAAAPAAAAAAAAgAGAKMICxBsFuUbgyBDJAUAAgAHACYIdg/tFYQbKSDEIyomCwAAAA4AAgAQAEIEMAjOCyoPRRInFdIXShqOHJ8egCAuIqYj5yTqJacmHQACAAIAJhVxIh4AAAAgAAIAEQAgBPAHeAvADswRoRRCF7IZ8RsCHuQfliEWI2QkeCVOJtwmMAAAAAAAAAAeAAIABgBBCXMRiBhpHvQi8yUjAAAAAAAAAB8AAAAAAAAAHwAAAAAAAAAfAAIACQDyCb0R3BemHFEgDiP8JDom4SYnAAAAAAAAAB4AAQAnAAEAMwABADwAAAAAAAAAHgAAAAAAAAArAAAALQAAAC8AAAAxAAAAMwAAADUAAAA3AAAAOQAAADsAAAAAAAAAKwAAAC0AAAAvAAAAMQAAADMAAAA1AAAANwAAADkAAAA7AAAAAAAAACsAAAAtAAAALwAAADEAAAAzAAAANQAAADcAAAA5AAAAOwAAAAAAAAAlAAEAJwABACoAAAAAAAAAJQABACcAAQApAAAAAAAAACUAAAAAAAAAJQABACcAAQApAAAAAAAAACUAAAAAAAAAJQABACcAAQApAAAAAAAAACUAAgAGAEgL6hOhGswfnSMaJioAAQA8AAAAAAABADwAAAAAAAAAKAD//wAAAQAeAAAAIgACAAcAgwc0DigUZxnyHcgh2yQoAAEAPAAAAAAAAAAuAP//LwAAADUA//82AAAAPAD//wAAAQAoAAEAKwABAC4AAQAvAAEAMgABADUAAQA2AAEAOQABADwAAAAAAAAAIgD//wAAAQAeAAAAIAACAAMAHweHE/EfIgABADwAAAAAAAEANgAAAAAAAQAhAAIABgDrCJ0QVRckHfQhgiUmAAAAAAABADQAAAAAAAEAHwACAAYA6widEFUXJB30IYIlJAAAAAAAAQAxAAAAAAABAB0AAgAGAOsInRBVFyQd9CGCJSIAAAAAAAEAJgACAAYA6widEFUXJB30IYIlKwAAAAAAAQAlAAIABgARCHoPPhZLHHIhVSUqAAAAAAAAAAAAAAAdAP//HgAAADwA//8AAAEABQACAAUAGwUjDIcT7Rr1IQkAAAAWAAIACADfAesFBwumEGoWCRwlITElHQABAB4AAgAIAPoCYAcjDA0RAxbtGrAfFiQlAAAAMgACAAsAIAG2Ax8HBws2D4cT2hcJHPEfWiPwJTwAAAAAAAAACwD//w4AAAAeAP//IAAAADAA//8AAAIABAB0BhQP/BecIAMAAAAIAAIABAAABV0OsxgQIgsAAQAOAAIABAB0BhQP/BecIBEAAAAXAAIACADfAesFBwumEGoWCRwlITElHgABACAAAgAEAHQGFA/8F5wgIwAAACkAAgAIAN8B6wUHC6YQahYJHCUhMSUwAAEAPAAAAAAAAAA5AP//AAABAAkAAgAIAN8B6wUHC6YQahYJHCUhMSUQAAEAJwACABMAcgCOAR4DAAUfB2wJ2AtdDu4QhxMiFrMYOBukHfEfECLyI4IlniY5AAEAPAAAAAAAAAAcAP//HgAAADkA//8AAAEAAwACAAsAIAG2Ax8HBws2D4cT2hcJHPEfWiPwJQ0AAAASAAIACwAgAbYDHwcHCzYPhxPaFwkc8R9aI/AlHAABAB4AAgAKAPcETAldDUIRAhWgGBwcbx+LIk8lJwAAACwAAgAOAMEAjgIABd8HBwtdDswRRBWzGAkcMR8QIoIkTyY5AAEAPAAAAAAAAQA8AAAAAAAAACMA//8AAAEAHgAAAB8AAgAFABoOmBdOHvwi7yUjAAAAAAABADwAAAAAAAEAPAAAAAAAAAAnAP//AAABAB8AAAAjAAIABQCDD0EZtR/fI0ImJwABADwAAAAAAAEALAAAAC0AAQAuAAAALwABADAAAAAxAAEAMgAAADMAAQA0AAAANQABADYAAAA3AAEAOAAAADkAAQA6AAAAOwABADwAAAAAAAEAKwAAAAAAAAAnAP//LAAAADAA//8xAAAAMwD//zQAAAA2AP//NwAAADgA//85AAAAOgD//zsAAAAAAAEAHgABACIAAgAGAOEJYRJ+GTAfbSMbJicAAQAsAAEAMAABADsAAQA8AAAAAAAAADkAAQAAAAEAJgACAAYA6widEFUXJB30IYIlKwAAAAAA//8UAAAAAAAAAB4A//8AAAAAHgD//wAAAQAeAAAAAAAAAB4A//8AAAEAJQAAAAAAAQAlAAAAAAABACUAAAAAAAEAJQAAAAAAAQAlAAIABgAsCoQSWxndHhUj8CUqAAAAAABkAAAAAgAAAAAAAAADAGQAAAAPAAIAAAAHAAkACwANAA8AEQATABUAFwAZABsAHQAfACEAIwBkAAAABQACAB4AJQA+AEUARwBQAGQAAAAEAAIAKABSAGsAeACBAGQAAAAOAAIAMACDAIUAhwCJAIsAjQCPAJEAmACaAKEAowClAKcAZAAAAAYAAgBMAKkAqwCtAK8AsQCzAGQAAAAFAAIAWAC1AM4A1QDfAOgAZAAAAAQAAgBiAOoAAwEQARkBZAAAAAUAAgBqABsBNAE7AUUBTgFkAAAAAQACAHQAUAFkAAAABQACAHYAUgFpAXEBegGFAWQAAAAHAAIAgACHAYkBiwGNAY8BkQGTAWQAAAAFAAIAjgCVAawBtAG2Ab8BZAAAAAUAAgCYAMEB2AHgAeIB6wFkAAAABwACAKIA7QHvAfEB8wH1AfcB+QFkAAAABQACALAA+wESAhoCHAIlAmQAAAABAAIAugAnAmQAAAAMAAIAvAApAjECOgI8AkMCSgJMAlMCWwJdAmQCbAJkAAAADAACANQAbgJ2An8CgQKIAo8CkQKYAqACogKpArECZAAAAAcAAgDsALMCtQK3ArkCuwK9Ar8CZAAAABMAAgD6AMECwwLFAscCyQLLAs0CzwLRAtMC1QLXAtkC2wLdAt8C4QLjAuUCZAAAAAQAAgAgAecCAQMLAxYDZAAAAAUAAgAoARgDLwM2A0ADSwNkAAAABwACADIBTQNPA1EDUwNVA1cDWQNkAAAAAQACAEABWwNkAAAAAQACAEIBXQNkAAAABwACAEQBXwNhA2MDZQNnA2kDawNkAAAABgACAFIBbQOEA4sDkgOaA6QDZAAAAAcAAgBeAaYDqAOqA6wDrgOwA7IDZAAAAA8AAgBsAbQDtgO4A7oDvAO+A8ADwgPEA8YDyAPKA8wDzgPQA2QAAAAGAAIAigHSA+kD8AP3A/8DCQRkAAAAEwACAJYBCwQNBA8EEQQTBBUEFwQZBBsEHQQfBCEEIwQlBCcEKQQrBC0ELwRkAAAAAQACALwBMQRkAAAABAACAL4BMwRNBFQEYgRkAAAAFwACAMYBZARmBGgEagRsBG4EcARyBHQEdgR4BHoEfAR+BIAEggSEBIYEiASKBIwEjgSQBGQAAAAHAAIA9AGSBJQElgSYBJoEnASeBGQAAAAGAAIAAgKgBLcEvgTFBM0E1wRkAAAABwACAA4C2QTbBN0E3wThBOME5QRkAAAADgACABwC5wTpBOsE7QTvBPEE8wT1BPcE+QT7BP0E/wQBBWQAAAAFAAIAOAIDBRoFIQUrBTYFZAAAAAUAAgBCAjgFTwVWBWAFawVkAAAABQACAEwCbQWEBYsFlQWgBWQAAAAFAAIAVgKiBbkFwAXKBdUFZAAAAAEAAgBgAtcFZAAAAAUAAgBiAtkF8AX3BQEGDAZkAAAABQACAGwCDgYlBiwGNgZBBmQAAAABAAIAdgJDBmQAAAAFAAIAeAJFBlwGYwZtBngGZAAAAAUAAgCCAnoGkQaYBqIGrQZkAAAABgACAIwCrwbGBs0G1AbcBuYGZAAAAAcAAgCYAugG6gbsBu4G8AbyBvQGZAAAAAEAAgCmAvYGZAAAAAEAAgCoAvgGZAAAAAEAAgCqAvoGZAAAAAcAAgCsAvwG/gYABwIHBAcGBwgHZAAAAAQAAgC6AgoHDAcaByoHZAAAAAQAAgDCAiwHLgc8B0wHZAAAAAcAAgDKAk4HUAdSB1QHVgdYB1oHZAAAAAcAAgDYAlwHXgdgB2IHZAdmB2gHZAAAAAYAAgDmAmoHgQeIB48HlwehB2QAAAAHAAIA8gKjB6UHpwepB6sHrQevB2QAAAAGAAIAAAOxB8gHzwfWB94H6AdkAAAAEwACAAwD6gfsB+4H8AfyB/QH9gf4B/oH/Af+BwAIAggECAYICAgKCAwIDghkAAAAAgACADIDEAgSCGQAAAADAAIANgMUCBYIIghkAAAAAgACADwDJAgmCGQAAAACAAIAQAMoCCoIZAAAAAQAAgBEAywILgg9CE8IZAAAAAQAAgBMA1EIUwhiCHQIZAAAAAYAAgBUA3YIeAiICI8IkQilCGQAAAAGAAIAYAOnCKkIuQjACMII1ghkAAAAAwACAGwD2AjaCOUIZAAAAAMAAgByA+cI6Qj0CGQAAAAGAAIAeAP2CPgIBwkOCRAJJQlkAAAABgACAIQDJwkpCTgJPwlBCVYJZAAAAAgAAgCQA1gJYwllCW4Jdwl5CYcJiQlkAAAACAACAKADiwmWCZgJoQmqCawJugm8CWQAAAACAAIAsAO+CcAJZAAAAAIAAgC0A8IJxAlkAAAAAwACALgDxgnICdUJZAAAAAEAAQAAANcJZAAAAAEAAQABANkJZAAAAAEAAQACANsJZAAAAAEAAQADAN0JZAAAAAEAAQAEAN8JZAAAAAEAAQAFAOEJZAAAAAEAAQAGAOMJZAAAAAEAAQAHAOUJZAAAAAEAAQAIAOcJZAAAAAEAAQAJAOkJZAAAAAQAAAAAAOsJ7QnvCfEJZAAAAAkAAQAKAPMJ9Qn7Cf0JBQoHCg8KEQoaCmQAAAAGAAAAAAAcCh4KIAoiCiQKJgpkAAAADAABABMAKAouCjAKNgo4Cj0KPwpICkoKUApSClsKZAAAAAIAAAAAAF0KXwpkAAAABQABAB8AYQpjCm8KcQqACmQAAAAEAAAAAACCCoQKhgqICmQAAAAJAAEAJACKCowKlgqYCqIKpAqtCq8KuwpkAAAAAgAAAAAAvQq/CmQAAAAEAAEALQDBCsMKxQrNCmQAAAACAAAAAADPCtEKZAAAAAIAAQAxANMK1QpkAAAAAQABADMA1wpkAAAAAQABADQA2QpkAAAAAgAAAAAA2wrdCmQAAAAEAAEANQDfCuEK4wrsCmQAAAABAAAAAADuCmQAAAABAAEAOQDwCmQAAAACAAAAAADyCvQKZAAAAAQAAQA6APYK+Ar6CgQLZAAAAAEAAQA+AAYLZAAAAAIAAAAAAAgLCgtkAAAAAQABAD8ADAtkAAAABwAAAAAADgsQCxILFAsWCxgLGgtkAAAACgABAEAAHAseCycLKQsrCzILNAs2Cz4LQAtkAAAAAQABAEoAQgtkAAAAAQABAEsARAtkAAAAAQABAEwARgtkAAAAAQABAE0ASAtkAAAAAQABAE4ASgtkAAAAAwACAAAAAAAiAEQAZAAAAAQAAgAGAEYAWABaAG4AZAAAAAMAAgAOAHAAkgC0AGQAAAAEAAIAFAC2AMkAywDeAGQAAAAEAAIAHADgAPMA9QAIAWQAAAAEAAIAJAAKAR0BHwEyAWQAAAADAAIALAA0AVYBeAFkAAAABAACADIAegGKAawBwgFkAAAABAACADoAxAHWAfgB+gFkAAAAAwACAEIA/AEeAkACZAAAAAMAAgBIAEICZAKGAmQAAAAEAAIATgCIApoCnAKwAmQAAAAEAAIAVgCyAsUCxwLaAmQAAAAEAAIAXgDcAu8CEQMkA2QAAAAEAAIAZgAmAzoDPANOA2QAAAAHAAIAbgBQA1IDVANWA1gDWgNcA2QAAAAGAAIAfABeA2ADYgNkA2YDaANkAAAABAACAIgAagN9A38DkgNkAAAAAwACAJAAlAO2A9gDZAAAAAMAAgCWANoD/AMeBGQAAAAVAAIAnAAgBCIEJAQmBCgEKgQsBC4EMAQyBDQENgQ4BDoEPAQ+BEAEQgREBEYESARkAAAAEgACAMYASgRMBE4EUARSBFQEVgRYBFoEXAReBGAEYgRkBGYEaARqBGwEZAAAABYAAgDqAG4EdgR/BIEEiASPBJEEmASgBKIEqQSyBLQEuwTCBMQEywTTBNUE3ATjBOUEZAAAABYAAgAWAecE7wT4BPoEAQUIBQoFEQUZBRsFIgUrBS0FNAU7BT0FRAVMBU4FVQVcBV4FZAAAABcAAgBCAWAFYgVkBWYFaAVqBWwFbgVwBXIFdAV2BXgFegV8BX4FgAWCBYQFhgWIBYoFjAVkAAAAAwACAHABjgWwBdIFZAAAABUAAgB2AdQF1gXYBdoF3AXeBeAF4gXkBeYF6AXqBewF7gXwBfIF9AX2BfgF+gX8BWQAAAAXAAIAoAH+BQAGAgYEBgYGCAYKBgwGDgYQBhIGFAYWBhgGGgYcBh4GIAYiBiQGJgYoBioGZAAAABcAAgDOASwGLgYwBjIGNAY2BjgGOgY8Bj4GQAZCBkQGRgZIBkoGTAZOBlAGUgZUBlYGWAZkAAAABQACAPwBWgZoBoAGlAamBmQAAAAFAAIABgKoBrYGzgbiBvQGZAAAAB8AAgAQAvYG+Ab6BvwG/gYABwIHBAcGBwgHCgcMBw4HEAcSBxQHFgcYBxoHHAceByAHIgckByYHKAcqBywHLgcwBzIHZAAAAB8AAgBOAjQHNgc4BzoHPAc+B0AHQgdEB0YHSAdKB0wHTgdQB1IHVAdWB1gHWgdcB14HYAdiB2QHZgdoB2oHbAduB3AHZAAAAB8AAgCMAnIHdAd2B3gHegd8B34HgAeCB4QHhgeIB4oHjAeOB5AHkgeUB5YHmAeaB5wHngegB6IHpAemB6gHqgesB64HZAAAAAUAAgDKArAHvgfWB+oH/AdkAAAABQACANQC/gcMCCQIOAhKCGQAAAAFAAIA3gJMCFoIcgiGCJgIZAAAAAUAAgDoApoIqAjACNQI5ghkAAAABAACAPIC6Aj/CCEJMAlkAAAABAACAPoCMglHCWkJeglkAAAABwACAAIDfAl+CYAJggmECYYJiAlkAAAABwACABADigmMCY4JkAmSCZQJlglkAAAABwACAB4DmAmaCZwJngmgCaIJpAlkAAAABwACACwDpgmoCaoJrAmuCbAJsglkAAAABwACADoDtAm2CbgJugm8Cb4JwAlkAAAABwACAEgDwgnECcYJyAnKCcwJzglkAAAABwACAFYD0AnSCdQJ1gnYCdoJ3AlkAAAABwACAGQD3gngCeIJ5AnmCegJ6glkAAAABwACAHID7AnuCfAJ8gn0CfYJ+AlkAAAABwACAIAD+gn8Cf4JAAoCCgQKBgpkAAAABwACAI4DCAoKCgwKDgoQChIKFApkAAAABwACAJwDFgoYChoKHAoeCiAKIgpkAAAABAACAKoDJAo5ClsKbApkAAAABAACALIDbgqACqIKtgpkAAAABAACALoDuArNCu8KAAtkAAAABAACAMIDAgsUCzYLSgtkAAAABAACAMoDTAtgC2ILdAtkAAAAAwACANIDdguYC7oLZAAAAAMAAgDYA7wL3gsADGQAAAAFAAIA3gMCDAQMIQwjDEIMZAAAAAUAAgDoA0QMRgxjDGUMhAxkAAAAAwACAPIDhgyIDLUMZAAAAAMAAgD4A7cMuQzmDGQAAAAFAAIA/gPoDOoMBg0IDSoNZAAAAAUAAgAIBCwNLg1KDUwNbg1kAAAABgACABIEcA1/DYENlQ2XDasNZAAAAAYAAgAeBK0NvA2+DdIN1A3oDWQAAAABAAEAAADqDWQAAAABAAEAAQDsDWQAAAABAAEAAgDuDWQAAAABAAEAAwDwDWQAAAABAAAAAADyDWQAAAABAAEABAD0DWQAAAABAAAAAAD2DWQAAAABAAEABQD4DWQAAAABAAAAAAD6DWQAAAABAAEABgD8DWQAAAABAAEABwD+DWQAAAABAAEACAAADmQAAAABAAEACQACDmQAAAAEAAAAAAAEDgYOCA4KDmQAAAAJAAEACgAMDg4OFg4YDiMOJQ4wDjIOQA5kAAAABgAAAAAAQg5EDkYOSA5KDkwOZAAAAAwAAQATAE4OVQ5XDl4OYA5nDmkOdA52Dn0Ofw6KDmQAAAACAAAAAACMDo4OZAAAAAUAAQAfAJAOkg6dDp8OtQ5kAAAABAAAAAAAtw65DrsOvQ5kAAAACQABACQAvw7BDs8O0Q7fDuEO7g7wDgEPZAAAAAEAAQAtAAMPZAAAAAEAAQAuAAUPZAAAAAEAAQAvAAcPZAAAAAEAAQAwAAkPZAAAAAEAAQAxAAsPZAAAAAEAAAAAAA0PZAAAAAEAAQAyAA8PZAAAAAEAAQAzABEPZAAAAAEAAQA0ABMPZAAAAAEAAQA1ABUPZAAAAA8AAAAAABcPGQ8bDx0PHw8hDyMPJQ8nDykPKw8tDy8PMQ8zD2QAAAAWAAEANgA1DzcPQA9CD0QPSw9ND08PVw9ZD1sPZA9mD2gPbw9xD3MPew99D38Phg+ID2QAAAABAAEATACKD2QAAAABAAEATQCMD2QAAAABAAEATgCOD2QAAAABAAEATwCQD2QAAAABAAEAUACSD2QAAAAFAAIAAAAAAAIACAAQABIAZAAAAAUAAgAKABQAFgAcACQAJgBkAAAAIwACABQAKAAqACwALgAwADIANAA2ADgAOgA8AD4AQABCAEQARgBIAEoAUABYAFoAZABpAGsAbQBvAHEAcwB1AHcAeQB7AH0AfwCBAGQAAAAHAAIAWgCDAKAAwQDVAOcADgEwAWQAAAAFAAIAaAAyAWwBgAG1AdcBZAAAAAQAAgByANkB2wHhAeMBZAAAACYAAgB6AOUB5wHpAesB7QHvAfEB8wH1AfcB+QH7Af0B/wEBAgMCBQIHAgkCCwIRAhMCFQIXAhkCGwIdAh8CIQIjAiUCJwIpAisCLQIvAjECMwJkAAAAGQACAMYANQI3AjkCOwI9Aj8CQQJDAkUCRwJJAksCTQJPAlECUwJVAlcCWQJbAl0CXwJhAmMCZQJkAAAAFgACAPgAZwJ4AoECiAKQApkCoQKnAq0CswK5Ar8CxQLLAtEC3QLjAuUC7QL0AvwCHwNkAAAADgACACQBIQMyAzsDQgNPA1cDawN3A30DfwOHA44DlgO5A2QAAAAEAAIAQAG7A/kD/wMBBGQAAAABAAIASAEDBGQAAAAKAAIASgEFBBgEIQR+BIAEggSEBIYEiASKBGQAAAAHAAIAXgGMBI4EkASWBJgEmgScBGQAAAAQAAIAbAGeBKAEpgSoBK4EtQS3BL0EvwTFBMcEyQTPBNEE1wTZBGQAAAAfAAIAjAHbBN0E3wThBOME5QTnBOkE6wTtBO8E8QTzBPUE9wT5BPsE/QT/BAEFAwUFBQcFCQULBQ0FDwURBRMFFQUXBWQAAAAVAAIAygEZBSoFMQU6BUEFSAVPBVYFXQVkBWsFdwV9BX8FgQWIBYoFkAWpBbEF2AVkAAAAFQACAPQB2gXrBfIF+wUCBgkGEAYXBh4GJQYsBjgGPgZABkcGSQZWBlwGdQZ9BqQGZAAAAB8AAgAeAqYGqAaqBqwGrgawBrIGtAa2BrgGuga8Br4GwAbCBsQGxgbIBsoGzAbOBtAG0gbUBtYG2AbaBtwG3gbgBuIGZAAAABcAAgBcAuQG7gb5BgAHCQcQBxcHHgclBywHMwc6B0YHTAdSB1kHYAdiB28HdQeOB5YHvQdkAAAACAACAIoCvwfXB+gH+Qc8CEQITQhwCGQAAAAtAAIAmgJyCHoIgwiFCIwIkwiVCJwIpAimCK0Itgi4CL8IxgjICM8I0QjXCNkI2wjiCOkI6wjzCPwI/ggFCQwJDgkVCR0JHwkmCS8JMQk4CT8JQQlICVAJUglZCWAJYglkAAAABAACAPQCZAmkCaYJqAlkAAAALQACAPwCqgmyCbsJvQnECcsJzQnUCdwJ3gnlCe4J8An3Cf4JAAoHCgkKDwoRChMKGgohCiMKKwo0CjYKPQpECkYKTQpVClcKXgpnCmkKcAp3CnkKgAqICooKkQqYCpoKZAAAAB8AAgBWA5wKngqgCqIKpAqmCqgKqgqsCq4KsAqyCrQKtgq4CroKvAq+CsAKwgrECsYKyArKCswKzgrQCtIK1ArWCtgKZAAAAAUAAgCUA9oK5wrpCusK7QpkAAAASgACAJ4D7wr2CvgK+gr8Cv4KAAsCCwQLBgsICwoLDAsOCxALEgsUCxYLGAsaCxwLHgsgCyILJAsmCygLKgssCy4LMAsyCzQLNgs4CzoLPAs+C0ALQgtEC0YLSAtKC0wLTgtQC1ILVAtWC1gLWgtcC14LYAtiC2QLZgtoC2oLbAtuC3ALcgt0C3oLfAt+C4ALgguEC4YLiAuKC2QAAAAIAAIAMgSMC6ALuAvQC9IL9Qv8CyMMZAAAAB8AAgBCBCUMJwwpDCsMLQwvDDEMMww1DDcMOQw7DD0MPwxBDEMMRQxHDEkMSwxNDE8MUQxTDFUMVwxZDFsMXQxfDGEMZAAAAAUAAgCABGMMZQxrDG0MeAxkAAAACAACAIoEegySDKMMtAz3DP8MCA0rDWQAAAABAAIAmgQtDWQAAAAfAAIAnAQvDTENMw01DTcNOQ07DT0NPw1BDUMNRQ1HDUkNSw1NDU8NUQ1TDVUNVw1ZDVsNXQ1fDWENYw1lDWcNaQ1rDWQAAAAPAAIA2gRtDXkNgw2NDZcNoQ2rDfYN/Q0EDgsOEg4aDiMOOg5kAAAAHwACAPgEPA4+DkAOQg5EDkYOSA5KDkwOTg5QDlIOVA5WDlgOWg5cDl4OYA5iDmQOZg5oDmoObA5uDnAOcg50DnYOeA5kAAAAMQACADYFeg58Dn4OgA6CDoQOhg6IDooOjA6ODpAOkg6UDpYOmA6aDpwOng6gDqIOpA6mDqgOqg6sDq4OsA6yDrQOtg64DroOvA6+DsAOwg7EDsYOyA7KDswOzg7QDtIO1A7WDtgO2g5kAAAADwACAJgF3A7oDvIO/A4GDxAPGg9lD2wPcw96D4EPiQ+SD6kPZAAAAAUAAgC2BasPuA+6D7wPvg9kAAAASgACAMAFwA/HD8kPyw/ND88P0Q/TD9UP1w/ZD9sP3Q/fD+EP4w/lD+cP6Q/rD+0P7w/xD/MP9Q/3D/kP+w/9D/8PARAGEAgQChAMEA4QEBASEBQQFhAYEBoQHBAeECMQJRAnECkQKxAtEC8QMRAzEDUQNxA5EDsQPRA/EEEQQxBFEEcQSRBLEFEQUxBVEFcQWRBbEF0QXxBhEGQAAAABAAIAVAZjEGQAAAAJAAIAVgZlEHkQkRCrEK0QzhDVEOUQABFkAAAANgACAGgGAhEEEQYRCBEKEQwRDhEQERIRFBEWERgRGhEcER4RIBEiESQRJhEoESoRLBEuETARMhE0ETYROBE6ETwRPhFAEUIRRBFGEUgRShFMEU4RUBFSEVQRVhFYEVoRXBFeEWARYhFkEWYRaBFqEWwRZAAAAB8AAgDUBm4RcBFyEXQRdhF4EXoRfBF+EYARghGEEYYRiBGKEYwRjhGQEZIRlBGWEZgRmhGcEZ4RoBGiEaQRphGoEaoRZAAAAA8AAgASB6wRuBHCEcwR1hHgEeoRNRI8EkMSShJRElkSYhJ5EmQAAAAfAAIAMAd7En0SfxKBEoMShRKHEokSixKNEo8SkRKTEpUSlxKZEpsSnRKfEqESoxKlEqcSqRKrEq0SrxKxErMStRK3EmQAAAA2AAIAbge5ErsSvRK/EsESwxLFEscSyRLLEs0SzxLREtMS1RLXEtkS2xLdEt8S4RLjEuUS5xLpEusS7RLvEvES8xL1EvcS+RL7Ev0S/xIBEwMTBRMHEwkTCxMNEw8TERMTExUTFxMZExsTHRMfEyETIxNkAAAAFwACANoHJRM0EzYTQRNDE1UTWxNhE2cTbRNzE3kTfxOFE4sTkhOxE70TxxPOE9AT0hPoE2QAAAAMAAIACAjqE/kT+xMGFAgUGhRWFGAUZxRpFGsUgRRkAAAAFwACACAIgxSSFJQUnxShFLMUuRS/FMUUyxTRFNcU3RTjFOkU8BQPFRsVJRUsFS4VMBVGFWQAAAAMAAIATghIFVcVWRVkFWYVeBW0Fb4VxRXHFckV3xVkAAAADAACAGYI4RXuFfYVARYfFmIWahZxFngWgRaOFqIWZAAAABcAAgB+CKQWsxa1FsAWwhbUFtoW4BbmFuwW8hb4Fv4WBBcKFxEXMBc8F0YXTRdPF1EXZxdkAAAADAACAKwIaRd4F3oXhReHF5kX1RffF+YX6BfqFwAYZAAAAAMAAgDECAIYDhgQGGQAAAABAAIAyggSGGQAAAAXAAIAzAgUGCMYMRg8GD4YUBhWGFwYYhhoGG4YdBh6GIAYhhiNGKwYuBjCGMkYyxjNGOMYZAAAAAwAAgD6COUY9BgCGQ0ZDxkhGV0ZZxluGXAZchmIGWQAAAABAAIAEgmKGWQAAAAPAAIAFAmMGZgZohmsGbYZwBnKGRUaHBojGioaMRo5GkIaWRpkAAAAHwACADIJWxpdGl8aYRpjGmUaZxppGmsabRpvGnEacxp1GncaeRp7Gn0afxqBGoMahRqHGokaixqNGo8akRqTGpUalxpkAAAAAQACAHAJmRpkAAAAAQACAHIJmxpkAAAACAACAHQJnRq1GsYa1xoaGyIbKxtOG2QAAAAfAAIAhAlQG1IbVBtWG1gbWhtcG14bYBtiG2QbZhtoG2obbBtuG3Abcht0G3YbeBt6G3wbfhuAG4IbhBuGG4gbihuMG2QAAAADAAIAwgmOG84bKxxkAAAAHwACAMgJLRwvHDEcMxw1HDccORw7HD0cPxxBHEMcRRxHHEkcSxxNHE8cURxTHFUcVxxZHFscXRxfHGEcYxxlHGccaRxkAAAAHwACAAYKaxxtHG8ccRxzHHUcdxx5HHscfRx/HIEcgxyFHIcciRyLHI0cjxyRHJMclRyXHJkcmxydHJ8coRyjHKUcpxxkAAAADwACAEQKqRy1HL8cyRzTHN0c5xwyHTkdQB1HHU4dVh1fHXYdZAAAAB8AAgBiCngdeh18HX4dgB2CHYQdhh2IHYodjB2OHZAdkh2UHZYdmB2aHZwdnh2gHaIdpB2mHagdqh2sHa4dsB2yHbQdZAAAAA8AAgCgCrYdwh3MHdYd4B3qHfQdPx5GHk0eVB5bHmMebB6DHmQAAAAFAAIAvgqFHoceiR6LHo0eZAAAAEoAAgDICo8ekR6THpUelx6ZHpsenR6fHqEeox6lHqceqR6rHq0erx6xHrMetR63Hrkeux69Hr8ewR7DHsUexx7JHssezR7PHtEe0x7VHtce2R7bHt0e3x7hHuMe5R7nHuke6x7tHu8e8R7zHvUe9x75Hvse/R7/HgEfAx8FHwcfCR8LHw0fDx8VHxcfGR8bHx0fHx8hHyMfJR9kAAAACQACAFwLJx8pH1YfWB9aH1wfXh+LH40fZAAAAAkAAgBuC48fkR++H8Afwh/EH8Yf8x/1H2QAAAAOAAIAgAv3H/kfFiAYIDcgOSA7IFEgUyBVIHcgeSCYIJogZAAAAA4AAgCcC5wgniC7IL0g3CDeIOAg9iD4IPogHCEeIT0hPyFkAAAACwACALgLQSFDIV8hYSFjIYQhhiGMIZYhpCG0IWQAAAAJAAIAzgu2Ibgh1CHWIdgh+SH7IREiISJkAAAAEQACAOALIyIyIjQiSCJKIl4iYCJvInEicyKCIoQinSKfIqkityK5ImQAAAARAAIAAgy7IsoizCLgIuIi9iL4IgcjCSMLIxojHCM1IzcjQSNPI1EjZAAAAAQAAgAkDFMjVSNXI2cjZAAAAAIAAgAsDGkjayNkAAAABAACADAMbSNvI3EjgSNkAAAABAACADgMgyOFI4cjjSNkAAAAAgACAEAMjyORI2QAAAAEAAIARAyTI5UjlyOdI2QAAAABAAEAAACfI2QAAAABAAEAAQChI2QAAAABAAEAAgCjI2QAAAABAAEAAwClI2QAAAABAAEABACnI2QAAAABAAEABQCpI2QAAAABAAEABgCrI2QAAAABAAEABwCtI2QAAAABAAEACACvI2QAAAACAAAAAACxI7MjZAAAAAQAAQAJALUjtyO5I78jZAAAAAoAAAAAAMEjwyPFI8cjySPLI80jzyPRI9MjZAAAABQAAQANANUj1yPfI+Ej7CPuI/kj+yMJJAskEyQVJBckHyQhJCwkLiQ5JDskSSRkAAAADgAAAAAASyRNJE8kUSRTJFUkVyRZJFskXSRfJGEkYyRlJGQAAAAcAAEAIQBnJG4kcCR3JHkkgCSCJI0kjySWJJgkoySlJKwkriS1JLckviTAJMckySTVJNck4iTkJOsk7ST4JGQAAAAGAAAAAAD6JPwk/iQAJQIlBCVkAAAACQABAD0ABiUIJRMlFSUrJS0lPSU/JVUlZAAAAAoAAAAAAFclWSVbJV0lXyVhJWMlZSVnJWklZAAAABQAAQBGAGslbSV7JX0liyWNJZolnCWtJa8lvSW/JcElzyXRJd8l4SXuJfAlASZkAAAAAQABAFoAAyZkAAAAAwAAAAAABSYHJgkmZAAAAAUAAQBbAAsmDSYPJhEmGyZkAAAAAQABAGAAHSZkAAAAAgAAAAAAHyYhJmQAAAADAAEAYQAjJiUmJyZkAAAAAQABAGQAKSZkAAAAAgAAAAAAKyYtJmQAAAAEAAEAZQAvJjEmMyZBJmQAAAABAAAAAABDJmQAAAABAAEAaQBFJmQAAAABAAEAagBHJmQAAAABAAEAawBJJmQAAAAJAAAAAABLJk0mTyZRJlMmVSZXJlkmWyZkAAAAAwAAAAAAXSZfJmEmZAAAAAMAAAAAAGMmZSZnJmQAAAAEAAEAbABpJmsmbSZvJmQAAAABAAEAcABxJmQAAAADAAAAAABzJnUmdyZkAAAABAABAHEAeSZ7Jn0miCZkAAAAHQAAAAAAiiaMJo4mkCaSJpQmliaYJpomnCaeJqAmoiakJqYmqCaqJqwmriawJrImtCa2Jrgmuia8Jr4mwCbCJmQAAAAtAAEAdQDEJsYmzybRJtMm2ibcJt4m5iboJuom8yb1Jvcm/iYAJwInCCcKJwwnDicQJxcnGScbJyQnJicoJy8nMSczJzsnPSc/J0gnSidMJ1MnVSdXJ18nYSdjJ2onbCdkAAAAAwAAAAAAbidwJ3InZAAAAAQAAQCiAHQndid4J4MnZAAAAAEAAQCmAIUnZAAAAAEAAQCnAIcnZAAAAAEAAQCoAIknZAAAAAEAAQCpAIsnZAAAAAEAAQCqAI0nZAAAABUAAgAAAAAAAgAEAAYACAAKAAwADgAQABIAFAAWABgAGgAcAB4AIAAiACQAJgAoAGQAAAASAAIAKgAqACwALgAwADIANAA2ADgAOgA8AD4AQABCAEQARgBIAEoATABkAAAAAwACAE4ATgBwAJIAZAAAABcAAgBUAJQAlgCYAJoAnACeAKAAogCkAKYAqACqAKwArgCwALIAtAC2ALgAugC8AL4AwABkAAAABgACAIIAwgDEAMYAyADKAMwAZAAAAAMAAgCOAM4A8AASAWQAAAADAAIAlAAUATYBWAFkAAAABAACAJoAWgFsAW4BggFkAAAABAACAKIAhAGWAZgBrAFkAAAAAQACAKoArgFkAAAABwACAKwAsAGyAbQBtgG4AboBvAFkAAAABAACALoAvgHOAfABBgJkAAAABwACAMIACAIKAgwCDgIQAhICFAJkAAAABAACANAAFgIpAisCPgJkAAAAAwACANgAQAJiAoQCZAAAAAQAAgDeAIYCmwK9As4CZAAAABYAAgDmANAC2ALhAuMC6gLxAvMC+gICAwQDCwMUAxYDHQMkAyYDLQM1AzcDPgNFA0cDZAAAABYAAgASAUkDUQNaA1wDYwNqA2wDcwN7A30DhAONA48DlgOdA58DpgOuA7ADtwO+A8ADZAAAAAcAAgA+AcIDxAPGA8gDygPMA84DZAAAAB8AAgBMAdAD0gPUA9YD2APaA9wD3gPgA+ID5APmA+gD6gPsA+4D8APyA/QD9gP4A/oD/AP+AwAEAgQEBAYECAQKBAwEZAAAAAMAAgCKAQ4EMARSBGQAAAAHAAIAkAFUBFYEWARaBFwEXgRgBGQAAAAEAAIAngFiBHkEmwSqBGQAAAAEAAIApgGsBMAEwgTUBGQAAAAHAAIArgHWBNgE2gTcBN4E4ATiBGQAAAAEAAIAvAHkBPkEGwUsBWQAAAAHAAIAxAEuBTAFMgU0BTYFOAU6BWQAAAAVAAIA0gE8BT4FQAVCBUQFRgVIBUoFTAVOBVAFUgVUBVYFWAVaBVwFXgVgBWIFZAVkAAAAAwACAPwBZgWIBaoFZAAAAB8AAgACAqwFrgWwBbIFtAW2BbgFugW8Bb4FwAXCBcQFxgXIBcoFzAXOBdAF0gXUBdYF2AXaBdwF3gXgBeIF5AXmBegFZAAAAAQAAgBAAuoF/QX/BRIGZAAAAAQAAgBIAhQGJgZIBkoGZAAAABcAAgBQAkwGTgZQBlIGVAZWBlgGWgZcBl4GYAZiBmQGZgZoBmoGbAZuBnAGcgZ0BnYGeAZkAAAABwACAH4CegZ8Bn4GgAaCBoQGhgZkAAAABAACAIwCiAaaBrwG0AZkAAAABwACAJQC0gbUBtYG2AbaBtwG3gZkAAAAAwACAKIC4AYCByQHZAAAAAMAAgCoAiYHSAdqB2QAAAAFAAIArgJsB3oHkgemB7gHZAAAAAUAAgC4AroHyAfgB/QHBghkAAAABAACAMICCAgcCB4IMAhkAAAABQACAMoCMghACFgIbAh+CGQAAAAFAAIA1AKACI4Ipgi6CMwIZAAAAAMAAgDeAs4I8AgSCWQAAAADAAIA5AIUCTYJWAlkAAAABAACAOoCWgltCY8JoglkAAAABQACAPICpAmyCcoJ3gnwCWQAAAAFAAIA/ALyCQAKGAosCj4KZAAAAAQAAgAGA0AKVQp3CogKZAAAAAcAAgAOA4oKjAqOCpAKkgqUCpYKZAAAAAQAAgAcA5gKqwqtCsAKZAAAAAQAAgAkA8IK1QrXCuoKZAAAAAQAAgAsA+wK/woBCxQLZAAAAAcAAgA0AxYLGAsaCxwLHgsgCyILZAAAAAMAAgBCAyQLRgtoC2QAAAAHAAIASANqC2wLbgtwC3ILdAt2C2QAAAAHAAIAVgN4C3oLfAt+C4ALgguEC2QAAAAEAAIAZAOGC5gLugvOC2QAAAAHAAIAbAPQC9IL1AvWC9gL2gvcC2QAAAADAAIAegPeCwAMIgxkAAAAHwACAIADJAwmDCgMKgwsDC4MMAwyDDQMNgw4DDoMPAw+DEAMQgxEDEYMSAxKDEwMTgxQDFIMVAxWDFgMWgxcDF4MYAxkAAAAAwACAL4DYgxkDJEMZAAAAAMAAgDEA5MMlQzCDGQAAAAFAAIAygPEDMYM4wzlDAQNZAAAAAUAAgDUAwYNCA0lDScNRg1kAAAABQACAN4DSA1KDWYNaA2KDWQAAAAFAAIA6AOMDY4Nqg2sDc4NZAAAAAYAAgDyA9AN3w3hDfUN9w0LDmQAAAAGAAIA/gMNDhwOHg4yDjQOSA5kAAAAAQABAAAASg5kAAAAAQABAAEATA5kAAAAAQABAAIATg5kAAAAAQABAAMAUA5kAAAAAQAAAAAAUg5kAAAAAQABAAQAVA5kAAAAAQAAAAAAVg5kAAAAAQABAAUAWA5kAAAAAQAAAAAAWg5kAAAAAQABAAYAXA5kAAAAAQABAAcAXg5kAAAAAQABAAgAYA5kAAAAAQABAAkAYg5kAAAABAAAAAAAZA5mDmgOag5kAAAACQABAAoAbA5uDnYOeA6DDoUOkA6SDqAOZAAAAAYAAAAAAKIOpA6mDqgOqg6sDmQAAAAMAAEAEwCuDrUOtw6+DsAOxw7JDtQO1g7dDt8O6g5kAAAAAgAAAAAA7A7uDmQAAAAFAAEAHwDwDvIO/Q7/DhUPZAAAAAQAAAAAABcPGQ8bDx0PZAAAAAkAAQAkAB8PIQ8vDzEPPw9BD04PUA9hD2QAAAABAAEALQBjD2QAAAABAAEALgBlD2QAAAABAAEALwBnD2QAAAABAAEAMABpD2QAAAABAAEAMQBrD2QAAAABAAAAAABtD2QAAAABAAEAMgBvD2QAAAABAAEAMwBxD2QAAAABAAEANABzD2QAAAABAAEANQB1D2QAAAAPAAAAAAB3D3kPew99D38PgQ+DD4UPhw+JD4sPjQ+PD5EPkw9kAAAAFgABADYAlQ+XD6APog+kD6sPrQ+vD7cPuQ+7D8QPxg/ID88P0Q/TD9sP3Q/fD+YP6A9kAAAAAQABAEwA6g9kAAAAAQABAE0A7A9kAAAAAQABAE4A7g9kAAAAAQABAE8A8A9kAAAAAQABAFAA8g9kAAAAAgAAAAAAAAADAGQAAAAmAAIAAAAHABAAEgAUABYAGAAaABwAHgAgACIAJAAmACgAKgAsAC4AMAAyADQANgA4ADoAPAA+AEAAQgBEAEYASABKAEwATgBQAFIAWABdAF8AZAAAAAQAAgBMAGEAqgCvALEAZAAAAAMAAgBUALMAtQDAAGQAAAADAAIAWgDCAMQAzwBkAAAANAACAGAA0QDYANoA3ADeAOAA4gDkAOYA6ADqAOwA7gDwAPIA9AD2APgA+gD8AP4AAAECAQQBBgEIAQoBDAEOARABEgEUARYBGAEaARwBHgEgASIBJAEmASgBKgEsAS4BMAEyATQBNgE8AUEBQwFkAAAAAwACAMgARQGPAZEBZAAAADQAAgDOAJMBmgGcAZ4BoAGiAaQBpgGoAaoBrAGuAbABsgG0AbYBuAG6AbwBvgHAAcIBxAHGAcgBygHMAc4B0AHSAdQB1gHYAdoB3AHeAeAB4gHkAeYB6AHqAewB7gHwAfIB9AH2AfgB/gEDAgUCZAAAAAwAAgA2AQcCCQILAg0CDwIRAhMCFQIXAhkCGwIdAmQAAAADAAIATgEfAiECLAJkAAAAAwACAFQBLgIwAjsCZAAAAAEAAgBaAT0CZAAAAAEAAgBcAT8CZAAAAA4AAgBeAUECQwJFAkcCSQJLAk0CTwJRAlMCVQJXAlkCWwJkAAAACwACAHoBXQJ0AnwClAKcAqgCsAK3ArkCuwK9AmQAAAAdAAIAkAG/AsUCywLRAtkC4ALmAuwC8gL6AgADBgMMAxIDGgMgAyYDLAMyAzoDQANGA0wDUgNaA2EDYwNlA2cDZAAAAA4AAgDKAWkDawNtA28DcQNzA3UDdwN5A3sDfQN/A4EDgwNkAAAAHQACAOYBhQOLA5EDlwOfA6YDrAOyA7gDwAPGA8wD0gPYA+AD5gPsA/ID+AMABAYEDAQSBBgEIAQnBCkEKwQtBGQAAAALAAIAIAIvBDEEMwQ1BDcEOQQ7BD0EPwRBBEMEZAAAAA4AAgA2AkUERwRJBEsETQRPBFEEUwRVBFcEWQRbBF0EXwRkAAAAAwACAFICYQRjBGUEZAAAACkAAgBYAmcEaQRrBG0EbwRxBHMEdQR3BHkEewR9BH8EgQSDBIUEhwSJBIsEjQSPBJEEkwSVBJcEmQSbBJ0EnwShBKMEpQSnBKkEqwStBK8EsQSzBLUEtwRkAAAAAwACAKoCuQS7BL0EZAAAAA4AAgCwAr8EwQTDBMUExwTJBMsEzQTPBNEE0wTVBNcE2QRkAAAACwACAMwC2wTdBN8E4QTjBOUE5wTpBOsE7QTvBGQAAAABAAIA4gLxBGQAAAAOAAIA5ALzBPUE9wT5BPsE/QT/BAEFAwUFBQcFCQULBQ0FZAAAAAYAAgAAAw8FHgU2BU0FZQVxBWQAAAAOAAIADANzBXUFdwV5BXsFfQV/BYEFgwWFBYcFiQWLBY0FZAAAADUAAgAoA48FlQWXBZkFmwWdBZ8FoQWjBaUFpwWpBasFrQWvBbEFswW1BbcFuQW7Bb0FvwXBBcMFxQXHBckFywXNBc8F0QXTBdUF1wXZBdsF3QXfBeEF4wXlBecF6QXuBfAF8gX0BfYF+AX+BQMGBQZkAAAABAACAJIDBwZQBlUGVwZkAAAALQACAJoDWQZiBmQGZgZoBmoGbAZuBnAGcgZ0BnYGeAZ6BnwGfgaABoIGhAaGBogGigaMBo4GkAaSBpQGlgaYBpoGnAaeBqAGogakBqYGqAaqBqwGsQazBrUGtwa5BrsGZAAAAAUAAgD0A70G1AbsBgMHGwdkAAAAAwACAP4DHQcfByEHZAAAACkAAgAEBCMHJQcnBykHKwctBy8HMQczBzUHNwc5BzsHPQc/B0EHQwdFB0cHSQdLB00HTwdRB1MHVQdXB1kHWwddB18HZAdmB2gHagdsB24HcAdyB3QHdgdkAAAAAQACAFYEeAdkAAAAAwACAFgEegd8B34HZAAAADQAAgBeBIAHhweJB4sHjQePB5EHkweVB5cHmQebB50HnwehB6MHpQenB6kHqwetB68HsQezB7UHtwe5B7sHvQe/B8EHwwfFB8cHyQfLB80HzwfRB9MH1QfXB9kH2wfdB98H4QfjB+UH6wfwB/IHZAAAAAQAAgDGBPQHPQhCCEQIZAAAACsAAgDOBEYITwhRCFMIVQhXCFkIWwhdCF8IYQhjCGUIZwhpCGsIbQhvCHEIcwh1CHcIeQh7CH0IfwiBCIMIhQiHCIkIiwiNCI8IkQiTCJUIlwiZCJsInQifCKEIZAAAAA4AAgAkBaMIpQinCKkIqwitCK8IsQizCLUItwi5CLsIvQhkAAAABwACAEAFvwjMCOMI8gj/CBYJJQlkAAAADgACAE4FJwkpCSsJLQkvCTEJMwk1CTcJOQk7CT0JPwlBCWQAAAAIAAIAagVDCUUJRwlJCUsJTQlPCV4JZAAAAAMAAgB6BWAJYglxCWQAAAAIAAIAgAVzCXUJdwl5CXsJfQl/CY4JZAAAAAMAAgCQBZAJkgmhCWQAAAABAAIAlgWjCWQAAAAIAAIAmAWlCacJqQmrCa0JrwmxCcAJZAAAAAMAAgCoBcIJxAnTCWQAAAAIAAIArgXVCdcJ2QnbCd0J3wnhCeMJZAAAAAEAAgC+BeUJZAAAAAgAAgDABecJ6QnrCe0J7wnxCfMJAgpkAAAACAACANAFBAoGCggKCgoMCg4KEAofCmQAAAAHAAIA4AUhCjAKSApUCmMKewqHCmQAAAAOAAIA7gWJCosKjQqPCpEKkwqVCpcKmQqbCp0KnwqhCqMKZAAAAAEAAgAKBqUKZAAAAAEAAgAMBqcKZAAAAAsAAgAOBqkKqwqtCq8KsQqzCrUKtwq5CrsKvQpkAAAADgACACQGvwrBCsMKxQrHCskKywrNCs8K0QrTCtUK1wrZCmQAAAADAAIAQAbbCt0K3wpkAAAABAACAEYG4QrjCuUK5wpkAAAADgACAE4G6QrrCu0K7wrxCvMK9Qr3CvkK+wr9Cv8KAQsDC2QAAAAOAAIAagYFCwcLCQsLCw0LDwsRCxMLFQsXCxkLGwsdCx8LZAAAAAcAAgCGBiELLgtFC1QLYQt4C4cLZAAAAA4AAgCUBokLiwuNC48LkQuTC5ULlwuZC5sLnQufC6ELowtkAAAABQACALAGpQu8C9QL6wsDDGQAAAADAAIAugYFDAcMCQxkAAAAKQACAMAGCwwNDA8MEQwTDBUMFwwZDBsMHQwfDCEMIwwlDCcMKQwrDC0MLwwxDDMMNQw3DDkMOww9DD8MQQxDDEUMRwxJDEsMTQxPDFEMUwxVDFcMWQxbDGQAAAACAAIAEgddDF8MZAAAAAEAAgAWB2EMZAAAAAEAAgAYB2MMZAAAAAMAAgAaB2UMZwxyDGQAAAADAAIAIAd0DHYMgQxkAAAAAwACACYHgwyFDJAMZAAAAAEAAgAsB5IMZAAAAAEAAgAuB5QMZAAAAAEAAgAwB5YMZAAAADgAAgAyB5gMmgycDJ4MoAyiDKQMpgyoDKoMrAyuDLAMsgy0DLYMuAy6DLwMvgzADMIMxAzGDMgMygzMDM4M0AzSDNQM1gzYDNoM3AzeDOAM4gzkDOYM6AzqDOwM7gzwDPIM9Az2DPgM+gz8DP4MAA0CDQkNCw1kAAAABQACAKIHDQ0PDRENGA0aDWQAAAAFAAIArAccDR4NSw1NDWANZAAAAAUAAgC2B2INZA2RDZMNpg1kAAAABwACAMAHqA2qDccNyQ3oDeoNAQ5kAAAABwACAM4HAw4FDiIOJA5DDkUOXA5kAAAAAQACANwHXg5kAAAAAwACAN4HYA5iDm8OZAAAAAUAAgDkB3EOcw51DnwOfg5kAAAABQACAO4HgA6CDoQOiw6NDmQAAAAiAAIA+AePDpEOkw6VDpcOmQ6bDp0Onw6hDqMOpQ6nDqkOqw6tDq8OsQ6zDrUOtw65DrsOvQ6/DsEOww7FDscOyQ7LDs0Ozw7RDmQAAAAHAAIAPAjTDtUO8Q7zDhUPFw8rD2QAAAAHAAIASggtDy8PSw9ND28PcQ+FD2QAAAAIAAIAWAiHD5YPmA+sD64Pwg/ED+APZAAAAAgAAgBoCOIP8Q/zDwcQCRAdEB8QOxBkAAAAAwACAHgIPRA/EEwQZAAAAAIAAgB+CE4QUBBkAAAAAgACAIIIUhBUEGQAAAADAAIAhghWEFgQZRBkAAAAAwACAIwIZxBpEHAQZAAAAAMAAgCSCHIQdBB7EGQAAAADAAIAmAh9EH8QhhBkAAAAAwACAJ4IiBCKEJEQZAAAAAMAAgCkCJMQlRCcEGQAAAADAAIAqgieEKAQpxBkAAAAAQACALAIqRBkAAAAIwACALIIqxCtEK8QsRCzELUQtxC5ELsQvRC/EMEQwxDFEMcQyRDLEM0QzxDRENMQ1RDXENkQ2xDdEN8Q4RDjEOUQ5xDpEOsQ7RDvEGQAAAAjAAIA+AjxEPMQ9RD3EPkQ+xD9EP8QAREDEQURBxEJEQsRDREPERERExEVERcRGREbER0RHxEhESMRJREnESkRKxEtES8RMREzETURZAAAACMAAgA+CTcRORE7ET0RPxFBEUMRRRFHEUkRSxFNEU8RURFTEVURVxFZEVsRXRFfEWERYxFlEWcRaRFrEW0RbxFxEXMRdRF3EXkRexFkAAAAJQACAIQJfRGGEYgRihGMEY4RkBGSEZQRlhGYEZoRnBGeEaARohGkEaYRqBGqEawRrhGwEbIRtBG2EbgRuhG8Eb4RwBHCEcQRxhHIEc4R0xFkAAAAAwACAM4J1REcEiISZAAAABYAAAAAACQSJhIoEioSLBIuEjASMhI0EjYSOBI6EjwSPhJAEkISRBJGEkgSShJMEk4SZAAAACwAAQAAAFASUhJUElYSWBJaElwSXhJgEmISZBJmEmgSahJsEm4ScBJyEnQSdhJ4EnoSfBJ+EoASghKEEoYSiBKKEowSjhKQEpISlBKWEpgSmhKcEp4SoBKiEqQSphJkAAAAAwAAAAAAqBKqEqwSZAAAAAQAAQAsAK4SsBKyErsSZAAAAAEAAAAAAL0SZAAAAAEAAQAwAL8SZAAAAAMAAAAAAMESwxLFEmQAAAAEAAEAMQDHEskSyxLUEmQAAAABAAAAAADWEmQAAAADAAEANQDYEtoS4RJkAAAAAQAAAAAA4xJkAAAAAwABADgA5RLnEu4SZAAAAAEAAAAAAPASZAAAAAMAAQA7APIS9BL7EmQAAAADAAEAPgD9Ev8SBhNkAAAAAgAAAAAACBMKE2QAAAADAAEAQQAMEw4TEBNkAAAAAQABAEQAEhNkAAAABgAAAAAAFBMWExgTGhMcEx4TZAAAAA0AAQBFACATIhMqEywTNxM5E0QTRhNUE1YTXhNgE2kTZAAAAAgAAAAAAGsTbRNvE3ETcxN1E3cTeRNkAAAAEAABAFIAexOCE4QTixONE5QTlhOhE6MTqhOsE7cTuRPDE8UT0hNkAAAABAAAAAAA1BPWE9gT2hNkAAAACQABAGIA3BPeE+kT6xMBFAMUChQMFBcUZAAAAAYAAAAAABkUGxQdFB8UIRQjFGQAAAANAAEAawAlFCcUNRQ3FEUURxRUFFYUZxRpFHMUdRSCFGQAAAABAAEAeACEFGQAAAACAAAAAACGFIgUZAAAAAQAAQB5AIoUjBSOFJgUZAAAAAEAAQB9AJoUZAAAAAEAAQB+AJwUZAAAAAMAAAAAAJ4UoBSiFGQAAAADAAEAfwCkFKYUsBRkAAAAJAAAAAAAshS0FLYUuBS6FLwUvhTAFMIUxBTGFMgUyhTMFM4U0BTSFNQU1hTYFNoU3BTeFOAU4hTkFOYU6BTqFOwU7hTwFPIU9BT2FPgUZAAAAEQAAAAAAPoU/BT+FAAVAhUEFQYVCBUKFQwVDhUQFRIVFBUWFRgVGhUcFR4VIBUiFSQVJhUoFSoVLBUuFTAVMhU0FTYVOBU6FTwVPhVAFUIVRBVGFUgVShVMFU4VUBVSFVQVVhVYFVoVXBVeFWAVYhVkFWYVaBVqFWwVbhVwFXIVdBV2FXgVehV8FX4VgBVkAAAABQABAIIAghWEFYYViBWPFWQAAAABAAAAAACRFWQAAAADAAEAhwCTFZUVnBVkAAAAAgAAAAAAnhWgFWQAAAACAAAAAACiFaQVZAAAAAIAAAAAAKYVqBVkAAAAAgAAAAAAqhWsFWQAAAACAAAAAACuFbAVZAAAAAMAAQCKALIVtBW2FWQAAAADAAEAjQC4FboVvBVkAAAAAwABAJAAvhXAFcIVZAAAAAMAAQCTAMQVxhXIFWQAAAADAAEAlgDKFcwV0xVkAAAACQACAAAAAAACAAQABgAIAAoADAAOABAAZAAAABMAAgASABIAFAAWABgAGgAcAB4AIAAiACQAJgAoACoALAAuADAAMgA0ADYAZAAAAAUAAgA4ADgARwBaAGEAYwBkAAAABQACAEIAZQB0AIcAjgCQAGQAAAAJAAIATACSAJQAlgCYAJoAnACeAKAAogBkAAAAAwACAF4ApACmAKgAZAAAABkAAgBkAKoArACuALAAsgC0ALYAuAC6ALwAvgDAAMIAxADGAMgAygDMAM4A0ADSANQA1gDYANoAZAAAAAsAAgCWANwA3gDgAOIA5ADmAOgA6gDsAO4A8ABkAAAABQACAKwA8gABARQBGwEdAWQAAAAFAAIAtgAfAS4BQQFIAUoBZAAAAAEAAgDAAEwBZAAAAAEAAgDCAE4BZAAAAA0AAgDEAFABUgFUAVYBWAFaAVwBXgFgAWIBZAFmAWgBZAAAAAUAAgDeAGoBeQGJAZQBtgFkAAAABQACAOgAuAHHAdcB4gEEAmQAAAANAAIA8gAGAggCCgIMAg4CEAISAhQCFgIYAhoCHAIeAmQAAAAFAAIADAEgAi8CMQI8Al4CZAAAAAEAAgAWAWACZAAAAA0AAgAYAWICZAJmAmgCagJsAm4CcAJyAnQCdgJ4AnoCZAAAAAMAAgAyAXwCiAKKAmQAAAAfAAIAOAGMApIClAKWApgCmgKcAp4CoAKiAqQCpgKoAqoCrAKuArACsgK0ArYCuAK6ArwCvgLAAsICxALGAsgCygLMAmQAAAANAAIAdgHOAtAC0gLUAtYC2ALaAtwC3gLgAuIC5ALmAmQAAAABAAIAkAHoAmQAAAABAAIAkgHqAmQAAAANAAIAlAHsAu4C8ALyAvQC9gL4AvoC/AL+AgADAgMEA2QAAAAHAAIArgEGAxADGAMhAysDOANaA2QAAAANAAIAvAFcA14DYANiA2QDZgNoA2oDbANuA3ADcgN0A2QAAAAJAAIA1gF2A3gDegN8A34DgAOCA4QDhgNkAAAAAwACAOgBiAOKA4wDZAAAABcAAgDuAY4DkAOSA5QDlgOYA5oDnAOeA6ADogOkA6YDqAOqA6wDrgOwA7IDtAO2A7gDugNkAAAABwACABwCvAPGA84D1wPhA+4DEARkAAAAAwACACoCEgQeBCAEZAAAAB8AAgAwAiIEKAQqBCwELgQwBDIENAQ2BDgEOgQ8BD4EQARCBEQERgRIBEoETAROBFAEUgRUBFYEWARaBFwEXgRgBGIEZAAAAAEAAgBuAmQEZAAAAAEAAgBwAmYEZAAAAAkAAgByAmgEagRsBG4EcARyBHQEdgR4BGQAAAAGAAIAhAJ6BHwEfgSABIIEhARkAAAAGQACAJAChgSIBIoEjASOBJAEkgSUBJYEmASaBJwEngSgBKIEpASmBKgEqgSsBK4EsASyBLQEtgRkAAAADQACAMICuAS6BLwEvgTABMIExATGBMgEygTMBM4E0ARkAAAABwACANwC0gTcBOQE7QT3BAQFJgVkAAAADQACAOoCKAUqBSwFLgUwBTIFNAU2BTgFOgU8BT4FQAVkAAAABQACAAQDQgVQBV8FbwWOBWQAAAAFAAIADgOQBZ4FrQW9BdwFZAAAAAUAAgAYA94F7AX7BQsGKgZkAAAAAgACACIDLAY6BmQAAAABAAIAJgM8BmQAAAAFAAIAKAM+BkwGWwZrBooGZAAAAAIAAgAyA4wGmgZkAAAABQACADYDnAayBsEGyAboBmQAAAABAAIAQAPqBmQAAAAFAAIAQgPsBvoGCQcZBzgHZAAAAAIAAgBMAzoHSAdkAAAABwACAFADSgdUB1wHZQdvB3wHngdkAAAADQACAF4DoAeiB6QHpgeoB6oHrAeuB7AHsge0B7YHuAdkAAAAAQACAHgDugdkAAAAAQACAHoDvAdkAAAAAQACAHwDvgdkAAAADQACAH4DwAfCB8QHxgfIB8oHzAfOB9AH0gfUB9YH2AdkAAAAAgACAJgD2gf6B2QAAAANAAIAnAP8B/4HAAgCCAQIBggICAoIDAgOCBAIEggUCGQAAAANAAIAtgMWCBgIGggcCB4IIAgiCCQIJggoCCoILAguCGQAAAAHAAIA0AMwCDoIQghLCFUIYgiECGQAAAANAAIA3gOGCIgIigiMCI4IkAiSCJQIlgiYCJoInAieCGQAAAAHAAIA+AOgCKoIsgi7CMUI0gj0CGQAAAADAAIABgT2CPgI+ghkAAAAHwACAAwE/Aj+CAAJAgkECQYJCAkKCQwJDgkQCRIJFAkWCRgJGgkcCR4JIAkiCSQJJgkoCSoJLAkuCTAJMgk0CTYJOAlkAAAABgACAEoEOgk8CUcJTglQCVoJZAAAAAgAAgBWBFwJXgloCWoJcQlzCXUJfwlkAAAAAgACAGYEgQmDCWQAAAADAAIAagSFCYcJlQlkAAAAAwACAHAElwmZCZsJZAAAAAUAAgB2BJ0JnwmsCa4JwglkAAAAAgACAIAExAnGCWQAAAAHAAIAhATICcoJzAnOCdAJ0gnUCWQAAAAHAAIAkgTWCdgJ2gncCd4J4AniCWQAAAADAAIAoATkCeYJEwpkAAAAAwACAKYEFQoXCkQKZAAAAAUAAgCsBEYKSAplCmcKhgpkAAAABQACALYEiAqKCqcKqQrICmQAAAADAAIAwATKCswK0gpkAAAABAACAMYE1ArWCtwK3gpkAAAABwACAM4E4AriCuQK5groCuoK7ApkAAAABAACANwE7grwCvIK9ApkAAAABQACAOQE9gr4ChQLFgs4C2QAAAAFAAIA7gQ6CzwLWAtaC3wLZAAAAAkAAgD4BH4LhwuRC5MLpgurC60LwQvDC2QAAAAIAAIACgXFC84L2AvaC+0L8gv0CwgMZAAAAAMAAgAaBQoMDAwVDGQAAAACAAIAIAUXDBkMZAAAAAIAAgAkBRsMHQxkAAAAAwACACgFHwwhDC0MZAAAAAUAAgAuBS8MMQwzDDUMNwxkAAAAAgACADgFOQw7DGQAAAAKAAIAPAU9DD8MQQxDDEUMRwxJDEsMTQxPDGQAAAAKAAIAUAVRDFMMVQxXDFkMWwxdDF8MYQxjDGQAAAAKAAIAZAVlDGcMaQxrDG0MbwxxDHMMdQx3DGQAAAAEAAIAeAV5DHsMfQx/DGQAAAAEAAIAgAWBDIMMhQyHDGQAAAACAAIAiAWJDIsMZAAAAAQAAgCMBY0MjwyRDJMMZAAAAAIAAgCUBZUMlwxkAAAABAACAJgFmQybDJ0MnwxkAAAABAACAKAFoQyjDKwMrgxkAAAAAgABAAAAsAyyDGQAAAACAAAAAAC0DLYMZAAAAAUAAQACALgMugy8DMYMyAxkAAAABgAAAAAAygzMDM4M0AzSDNQMZAAAAAoAAQAHANYM2AzaDNwM3gzgDOIM5AzmDOgMZAAAAAIAAAAAAOoM7AxkAAAABQABABEA7gzwDPIM+Az6DGQAAAACAAAAAAD8DP4MZAAAAAMAAQAWAAANAg0LDWQAAAACAAAAAAANDQ8NZAAAAAMAAQAZABENEw0cDWQAAAACAAAAAAAeDSANZAAAAAMAAQAcACINJA0tDWQAAAADAAEAHwAvDTENOg1kAAAAAwABACIAPA0+DUcNZAAAAAEAAQAlAEkNZAAAAAQAAAAAAEsNTQ1PDVENZAAAAAkAAQAmAFMNVQ1dDV8Nag1sDXcNeQ2HDWQAAAAGAAAAAACJDYsNjQ2PDZENkw1kAAAADQABAC8AlQ2cDZ4NpQ2nDa4NsA27Db0NxA3GDdEN0w1kAAAAAgAAAAAA1Q3XDWQAAAAGAAEAPADZDdsN5g3oDf4NAA5kAAAABAAAAAAAAg4EDgYOCA5kAAAACgABAEIACg4MDhoOHA4qDiwOOQ47DkwOTg5kAAAAAgABAEwAUA5SDmQAAAACAAAAAABUDlYOZAAAAAQAAQBOAFgOWg5cDmQOZAAAAAIAAQBSAGYOaA5kAAAAAgABAFQAag5sDmQAAAACAAAAAABuDnAOZAAAAAUAAQBWAHIOdA52Dn4OgA5kAAAAEgAAAAAAgg6EDoYOiA6KDowOjg6QDpIOlA6WDpgOmg6cDp4OoA6iDqQOZAAAAAIAAQBbAKYOqA5kAAAADQAAAAAAqg6sDq4OsA6yDrQOtg64DroOvA6+DsAOwg5kAAAACAABAF0AxA7GDsgO0Q7TDtUO1w7ZDmQAAAACAAAAAADbDt0OZAAAAAMAAQBlAN8O4Q7qDmQAAAACAAAAAADsDu4OZAAAAAIAAAAAAPAO8g5kAAAAAgAAAAAA9A72DmQAAAACAAEAaAD4DvoOZAAAAAIAAAAAAPwO/g5kAAAAAgABAGoAAA8CD2QAAAACAAEAbAAEDwYPZAAAAAIAAQBuAAgPCg9kAAAAAgABAHAADA8OD2QAAAADAAEAcgAQDxIPGw8AAA==","textureAtlases":["iVBORw0KGgoAAAANSUhEUgAABAAAAAQACAYAAAB/HSuDAAWbTElEQVR4Aez9bcxt0XbXh5koStCFxCtFaazbYEs3mISQWsL5QConSowdVXnBwWmK8sFWiflAXC6qiEDGVXodBFUlDEmj5BInjoQsjKkMsQxCflGQGwdScRuCcIhl17QhvTZCSImu1LQgEszp/O3z/Pb9P+OMufba+3k5z3POnNI8/zHGHHPOMcccc6011t7PPl/yJassDywPLA8sDywPLA8sDywPLA8sDywPLA8sDywPLA8sDywPLA8sDywPLA98QB74xN1aZkizbR/QstdSlgeexQOencfCZzF6TbI8sOeBX/ALfsGbVT9eH+zFxl7bJz/5yV/6lZ/6im/8lm/4+t/x5Z/65Nft6a625YHlgeWB5YHlgeWB2zxg0kFv6YrXjmz/a/st/eWBD9UDeSakxb01H9Gp/bNP0lVv8csDT+aBlfx/vMk/e39LYP3yf+SXfxWJ/3f867/xh7/rs9/+F0BeBtwy1uqzPLA8sDywPLA8sDzwMA+YRFzCh82yei8PfHweOHKmLunUdryorHo05UlXvcUvDzzIA+sFwHoBcCSAvvZrv/bXkPST8P/YD/++N12l7df++l/yTUfGWzrLA8sDywPLA8sDywO9B/LBX/oo9iPOE46Z/pIvD3wMHvBcsdak99aunph9U7Y3hm3qi8oXLg88qQfWC4D1AmAWYKdP+r/lG/7DLun/oR/8ztNLgA75RsD6s4CZV5d8eWB5YHlgeWB54OEeIGEwaUhUnjJnqzJ52xcuD3wMHjgS9+rMUD/VduRVdol3rET7KEs+adsXLg9c5YH1AmC9AOgChgS++5TfhJ+2pNVFZv2W8fJgjL2uU52Dl2x5YHlgeWB5YHmgeCBvmNIddjKGUr5HlykXuzzwUXugOzMpS+coB620pzz5pNVBVku2JV31Fr888Gge+FheAHzpl37p6ccOb8UP1U9dIPHJvwl9h13i3+kh+6N/+N94s/4soPPyki0PLA8sDywPLA+864EuAVAGJk1vZRW7NmWJlYZfZXngQ/OA5+aaddlnhow1a0Num3PKV8xx1E1UP2XSe23qLFweeMcDH1Ji2yX3yDo5665te3rqf0j+Yi3vBMQQkLTPEvpb5XffBti6+ZZseWB5YHlgeWB54GP3QH2Ql+8wZdBZ8aO8dCL0KssDH7IHPB+zNdZ2+Yr0R1blt/KOB1ocq/JVTnvKkrbvwuWBwx547QltTdpN1KvcZP9W7Matc7xGX9ZA4e/395L8P/0nP/vGqh48dEXbRV4srN8GqB5f/PLA8sDywPLAx+yB7kFeGWjFR53c9hl2/aoMfpXlgY/NA56nbt22PSY6FvNBV37Pjq6tyhxPrO2LXx44e+C1Ja016U7+1uT+1n6+FOjwtfj1HAiD+Kqv+qpfbbJe0aTfJN/2yld5187/JpDzLnp5YHlgeWB5YHngY/eAD+0V8Quyh1THSITO4rwpW/TywIfkgb0Yt01k3dJ7uNc2G8M+2Q6dJXU6ebYn3emm7Fo6x0762nGW/gvzwGtJVDPRN+G+NXGv/b7sy77sTZVdy2tT4mvwbYTjJ7pf+7+U+HcJvrJZX14S8E2DMfe6lsQGLHJ5YHlgeWB5YHkAD3hzBCut7FrcG5e2VZYHPkYPeL5Yu3SHKYO+hp+N7RhdeydL/WyHfuxS58rxsy3p1Fn0C/fAS05SScIzoU7+UoJOUv9Y9dJctb2z+aX62fD8yk99xTf66X2iybyyyiNH9l/86e958xN/5vve/OSf/f43P/3nfuCdipx29ByDFw5860AbFi4PLA8sDywPLA98bB7wAXoPaXusin+d62Pz9Vrvh+mBLp5T1tEpS68o7/CSjPbUmdHMl205v7Tt8om1Tb6ifZR3/F7bEf1OR9nCF+yBl5iYmujXRLom2pV/rIT/mnGqDZWva3hp/jY0+aV+k3yTenkSdpN22z73Y999SuZJ7H/mz//xN/+v/+JH3vyln/yPTxV6Vnk5wIsAxvsTP/C7Tv9LwC/6Rb/of6odC5cHlgeWB5YHlgc+Vg/4MA5eqtudTsVZv6F+HrOjlYGrLA98DB7I88Z6kz9Ke95qf/nZOLaDlNR7K/niv0favqj9Rcp+X5RcR2X/pBlFXnTk5JO2feEL8cBLS0hJoE2aazJd+WsS9X/gU//A6RsBR/HI2NijXrWt413XS/K5Ycgn8d1/75eJP0l/TfhN9HkJ0FXbRXT8NgDjMSffBBh2rOuEm7FweWB5YHlgeeCj8IA3vkTojleeuA3drLTBp06lR/O98eFXWR74GDzAWaCIb7kv8soTobua43TtdQz1Uz6bX91EdVPmWJ1sr21P335i6lYaPkv2SfmiX6AHXlIyStJsktwl0MhMuPcwk3zox6x789o2s125a3wJvjck+RQ+fwMgP/WHJmnPT/hnyT5ykv0Z2lZfAtz9JoDmLFweWB5YHlgeWB746DzgAzQ4q9tou1RnfVM+hjknQshXWR74ED2wF9vZJp2YNL5JHjprbZevfZSL2Y6Mouwt90VeuVh1U27fh2CO19HKROeSF5WDnSzbF/1MHnjfSShJsQmxCXKHJtcdPmaCvzcWc2d7Z0vKunUoc83v2/8ZZv4XgPVTf5J2kn+Td5N/eVH5XvKPrvq+BGA+/hzgW77lG/7DtGfRywPLA8sDywPLAx+iB3wITqw0fK3bkB2t9EW3jgFPEd9y69/lgdflgS5+U5a0K1MmIpfeQ9pqrX1re443o2djKHfM5CstD1Jyrj1+r80x1JEXlYNZsv2SfKab/Rb9hB54nwkoyXAmwibHiZlQV9pkHLl0h7/yH/6Vp3bwmspY9u3GrbJqn3yup9K5/vexFxla/BBgJv/8YF8m7LPE3sTfxF5M/dRxTH4PgJcA/jDg6SXA+i8Cc0sWvTywPLA8sDzwEXjAh2FwVrfRdm2djZXyMew7SQOyVZYHPnQPcA4s0nk2pNGRvgWzv3SHR2XYoG5H3zVPwT5ThdGgTocpg7YyXm1DZrFNfg9Td0bv9V9tFzzwPpJOkmAT35oQy5s8V6xJd+WvSfBv0a3zVb7am7xr61B/PPd+lPD4hD/8R1Ken/qb1FfskvxM9m3Pfkl3LwG+/FOf/Lpi12KXB5YHlgeWB5YHPigP+FAL7tVttL9T+bu9Wju9IZuNPZrObdCrLA98aB7IM8baKq8s5Ulne8qhs1a9bEu66lUeXWViJ7PtpDz+USflymY400V/1mcmz7EqfYRHZ5Vn9sBzJ5wkv5ns1mQ4E+aka6ItfymJ/+qv/uo3D62X5tCWiml/0nXN8umX59qXGm78GQC/0m8Sn5iJu4m97XttnW7q+z8D5DcBPvnJT/7SatvilweWB5YHlgeWBz40D+RDtQ/fidtY8Lma9COTrpj6d3SOl/RofudhH9kqywOv1QPE917JdukOkVkZTzqxyuUrZp9K7+naRh/pitkmXXVOncc/e+3Z1vW3HbSqV9uqHN6ibuWVi7UdPtuSVnfhFR54rkQzk1sT3oqZJEvXpFp+lpQfSfa/5mu+5vRSoOKRvujM5ta2iq4lsa4dPn30XPtSQ4XEm4SdpNyaCXwm7jX5l0+s+vKOKZ8vAfgWwt3/DFDNW/zywPLA8sDywPLAq/aAD65gpZWJ29A515ro7/HZ7452zIqjeZXlgQ/aA8R8Fs8AMtsSK5187ZNt0E9RnbOOrbyiNlW5vO0dOkfqKpth6kqL9pEHjxT6Zam8bTO57QsnHniuRDMT3Jr8ZmIsXZNo+S753kvcSfIfo87m6OxBpr2Jri2x+sKXAPrrqfenCwuSb/423xcAoEm9CXtFE/oO9/o6Djq+BPC/B1w/CtjtzpItDywPLA8sD3xIHvABueI2Fnmue8l+15Z97+g6fvJD5ZwIQa+yPPAaPEAMZ7mVt1+eCWnGl37fqC0i9nS0sorqnzqNf5KX7hDZLbXOfw2PLkV73nJf5Kvc9oUHPfDUCaYJrVgT3kyGoTNhlu6S7C4hvybR/6e//uvPLwaSPjpGN39np2sQ63rhq09M/sWn3KMuTL7qq77qV/MCwOqLABN5MZP3pG0XL7VlO3PyJwi8BOBHAX/5P/LLv6qzccmWB5YHlgeWB5YHXqMHfHD1gZo1SIvbkJ1ql9wr4yt70KJy0TECHT9xNL/zkI1sleWBl+QBYvbWUvvKJybNPHs8bS+5VvtzLWm3eil7DHo2bsqhKWlb8klXHdostsEnbfvCiQeeMrk0ge0S3C4RNklOrEl1TbwvJewk9w+tl+aoNlWbcz3S3fo7P/ni5Kn2aRIWX+JvAZCMz74NQIKfyXvyyi+hLwnsy8sG5vP3ANafAsx2aMmXB5YHlgeWB167B3hgrXUbslM1ka9Iwt/VqgfvWHdY55IfzacCv8rywGvzQMbtJdr2Pcw26Nde2c9ck/xzrKubK2XSHSKrpa6jtsOr07Ut2Z0HniqxdNwuqa3Jr0lxYk2ia5I9S8qvSfa/4df+2vPLgaQvjTGbu9pY15Drg65+gO/8pS+fAmcHgWcLknBeAPgSIF8EmLCbwJvoyx9F+yX6pwDMz+8BrD8FmO3Ski8PLA8sDywPvCYP+GDqgze2S4vbkJ1qTei7pL/Kap/yEsA5OhzTrrI88FF5gHNA6XAm687O+5a5hs6OvbZO/6ll2iPmfMgsyCkz7NpOHdY/xzzwFEklSSzjdslsl/RmYlyT5ppUd8n3XsJOYv/Qujd+Z0+1ua4p19u9COj8pj8fe7/2ouQrP/UV38hX8X0RwAuA+hJg9iIgE/rUqfL6osB2XwL4pwA84+zZutqWB5YHlgeWB5YHXosH8qE2H4C3sYBTrYl8TfT3+NrXMe8w50s7RvP5YRt6leWB9+UB4/Ix5nesWzD7QK/69vqEH7Yn8scY9uznjlYG1pL7ZZuyGa/8o8PHTigdr0tia/JfE+FMlGsSXRPtWVJ+Kdn/l3/9rz+9EJjhpf60z+auNtY15Prq2qtvOv/p28fESwHPS4A//Sc/e34J4LcBZr8LUBP6S7wJv5gvC3jZwHzMz58kXLJ1tS8PLA8sDywPLA+8RA/4EJoInXUb/KnWBH4v2Z+11TEce2DOKT3EqywPvFcPEItHSqeXsqRn41UdedBKX+mnxK3MIz/Dp7RlNja2zCp9aOtwNt4l+Rju7PuOVtYhMgpzZLnEp+5HQT9mMknSynhd8loT3JoAZ3KciXNNqrvkey9pJ9F/jDqbo7On2pzryXVWH1QfdX7Uv4+1b0eC/Fu+4et/B0l4/TZA9xLARP4o1hcE9lPOSwD/FICXEUfsXTrLA8sDywPLA8sDL9UDPojWh+BtGLzVxL0m+J/61P/sK5GB1qoDX8dh7Kh17rRpqK2yPPAiPGBc3mJM9pUWGU96D2l7aN0OjqEeaM25lYFVnvxj0M6RCH20pg2OkbJr6TF1u1+MQxEr3fHIasn+te2D5R8rkXScLmmtiW1NfDMpzmS5JtI12e6S8kvJ/r/yG37D6YXAJdwbp5u32lZtz3Xleqsvqq86f+rrx8Cjgb33EsBk/VrMZD9pxoGn5p8CfO8f+LY3R+1dessDywPLA8sDywMvzQM+aIJZt8GfaibuXWJv0t8h/21O9smxHP8Oc+60aTSvsjzw3jxgLFYDZvKq1/G1r/we0pbt8g/BbYxJrWNUGXxX6Yfc/lWna1d3D/fGrHNcy1eb9uw42vYlo6BLSZRO+Ukp/lFHjKYzudd2VvoQiMdIIh2DZBU6k9aa0GbCm4lwJsg1ea7JdZeAzxJ2Ev3HqLPxqy3V1rqWXGeuP/1SfZb+TFq/PwSviWF+jG/2TYAu+Tepn+FeH18CgL4EOP0g4Pg2wjU2L93lgeWB5YHlgeWBl+CBfLCEzroN/t6n/5nIS3dJv7Kv/dqv/TVUdcErXgCkbS/BV8uG5YFLMZntHZ0yvJl8RyNTnqj8Ibjdje0Y8uBjVcZmLHFvXHXE7Jeye2Pk9UR6zHdP5wDv+InQ19Sh3u5VlTtmyqEptFEqvpV+BP8+JHm0byalSddENpPcTH4zKc6EuSbTNdnukvJLyf5v/s3/29MLgcSkL/WnvZu32lZtz3XletMP6Z/qu/QrfofX/w/Ba0Ocv8W/5iVAl+Rncm+7LwnkReX8KYA/CBjn9Vrzl/7ywPLA8sDywPLAs3sgHzJ9KBW3Yc295J+H60zkoU30O+ST/09/+tO/9au+6qt+de3ngzrIPHfVucUhPj8IQ6+yPPC+PEBM7pVL7dlXXZE2aTBp21KmzmPgdjcfaGVc6ReFed3Yo7G/XFtuXcdDfDzMeGcvL8lo/6jLQ5LHmohmkloT2ExuM+nNZDiT5Eyga3JdE/BZ0p6JPfQtlbEdp5un2lJtzXXk+nLd6Y/0U/Vh+tcXAOKt+3hD8H/iuz777X/BlwD53wR2vwlQE3n5PTTpR0d6fQvghp1aXZYHlgeWB5YHXpQHeMil5MPuNvh7LwAyie8SfmQk/bb98//8P//rPvOZz3wHfPaFzod35rmrOb/0aDoVbZRfuDzwHB6Yxd1MnjalTtKpA921KUusNPytdbvrCz6ommiLjJe043cy2y4hfR+zXpqvtF/r49H9vC/SomPBU+RBiniUPnX6kP65NXHMfjUxrYlrJrWZ7GYSnMlxJs01oc6Eu0vIjyT5v/23/7a/id4M98bo5kSWdlWbcz25zlx/+iX9VX1ZfZ37cAt9SyzzTPFDP/idp1/n51P5o/8zgMn8XvLftdGPyksAXjzwAuIWu1ef5YHlgeWB5YHlgef0gA+ZidDWbdDT5J+brUm+SOJvRQb9Xd/1+/8Q3wBQH7Tmwzxz3VXnF4f43gMx/CrLAy/ZA8TuXrG9In2qrOORpVz+KG6j/+Fq0p7ndSarOpW/dl770096hlxXaBOrnmOItl9hE/7dRj3q55neGOLeGPIdIqMw1kdTbkkas09NSOEzac1kNpPcTH4zKc5kORPpTLC7JHwvaSfRf0idjd3ZkXam/bmuXG/6If2Tfkt/dv5GlntyDX1roPOL/Le8BMhP9btkP2XdCwNeNjAv155bbV/9lgeWB5YHlgeWB57bAz5c5gPrNoy499Bt4g6a9Ism/iLyb/7mb/4NP/QjP/KjfP1fPTDHaR7C04akn9sna77lATzg2dAblVe+h9f2UT8R2spc0pdwu9NNhL5Y69mUvwWZr+tX5drV6aYsryF7dPY5SmuDSD/pgvh+G/XSHmT7UD/rz2j0LUl3sq5dvVeL1ySLqWvSWRPSTFahM5E1wc2k12Q4E+RMnKEzqa5Jd5ecX0r2f+fv/J2nT/9nuNe/m6/alPbWteQ6XXv6Qx+l36pPq89zX66lHxK4/CggP8zHp/L8V31HvwmQSf5R2m8B8FsAzMf/SvAQ21ff5YHlgeWB5YHlgefwgA+mzCUt3ntgz4fsTOahTfor8uk/ternWD6Uj/m3u+r84hCfCvwqywMv2QMZo0lrs7KKtFdZ8kmri+yaug39d6rJrYiOtGfzfaPXC+yQPorZ5zHW0flwyK7Zh0u6Y7h748mDH025NmFM/ZqI1kQ1k1gT20x2TYAzKc6EORPpmmR3ifgscSfRv6Uyni8JurGrDdXGtD/XlevVB+kXfZX+g07/Vt/D594cpR8a6Hwd/ylfAuS3AKT5swN+jPChtq/+ywPLA8sDywPLA0/pAR5ELfWhdBsNh14A1KRfnr/9/6mf+um/yLcAHvgCQNu0deHywHN5IM/IU83pHKLzZNxLH8FtDIAe2FYSYdoemhBnEp6JNnL5W+fIMXKex6C1zTmutXHm1yI/sleXdMaQp73sMGXQFMb7IMrRRDH1TD6RSYOZoGbyakKbSa6JbybDmSRn8pyJdU26u8T8lmT/SJ9urmoPfNqb68j15br1RfpHn6Uf07/pd2j3IvfpCP3QIOaZ40/8wO9685QvAfJbArwE4JsGf/QP/xtvHmr76r88sDywPLA8sDzw1B7wAZR5pMGN6oNxPnRnMm+yXxEdPvn/sR//8T9fv/5PW47nHM45MO2AXmV54H174NY4zH4zOtemTmKl4ffqNtrb6lm7BT2z9JXucNau/Mjc3bhVltehbFOeskv0EZuqzszHd3L2hz3Y26dLbaP7qX8idFcY64MqR5LEmU4moZmcZtJqIgua4JrwgibCmRxn0pzJdE22a0K+l8T/nt/ze97cUmdj1rmrbWl3rifX6drTH/oo/Zb+TD+n/30JMNurmfwxgpmv4/sSgE/nuz8H4Af8MpG/lvbTf9A/A+B56DHsX2MsDywPLA8sDywPPLYHfGBM9IF0G5Odk38f3HmI9uEarEl/8l/7tV/7a37285//ue/8vd/576Wu/fOB3Adr5ryr2lFxNJ8fiKFXWR54KR7wHF1rj/0Sk2Y8+KN1G7rvVM/YNcgZVb/SeX5vpRn7mnG9dtyC19jomhPTzpRDd/5uZEf3b6Y3hjzHgHQi9AdVZonhTF6TTvhMSqFNWDOJNbHNZNcEOJPiTJYzic4EuybfXZJ+Kdn/7O//7OmFQMVZv24OZNWWtDPtz3XlevVB+kVfpf/0afV13Y/Zvs3kjxXM/ClAvgSovwfw0BcAvjDgBYD/GwAvHu6uDY+1jDXO8sDywPLA8sDywKN6oHvg3MYM5xcA+fCcD9+Z8EPzST8Vmv/276/+1b/y83z9P/Xsn2P6QM2cd7XaNMSrLA88qweIQUvSe7JZW/aXFukj3SGyS3UbOu9Uz9U1WM9l8ns053qv/dY2rxePhdgxsxU/dXYqT6w+7fw/kV3ay9o+hnknPpDVQj9L0speHc4Sw06enzJn4plJqYkqaAJrQptJrolvJsOZJGfynEl1TbhrYj5L4En0b6ndeHXO+iIg7c115Ppy3foi/aPP9GH6Nf2d++D+iN0eVtljBSznnRcA/s8AT/EtAF4C/KWf/I9P3yTgmwb8GcD6McDH2sE1zvLAMQ/kjW9GHxtpaS0PfNge8HwkQm/UfMD1oTgfwjOpr8k/LwE+97nP/Yxf/09dx3BM0LmceyB21DpE5wdh6FWWB167Bzx73Tpq/Ce/jQ7wYFs9U0fQM5hn8hrahDox6WvGUtfrREWuJcjESlf9S7zzXYszv7If2dbsj/uW+3mJHsOcr33oUiqm7KTw2v+pCeElviacmYxmkmriaiILmuCa8IImwpkcmzRnIg2dyX9Nwmuifkuyf6lPnaPakPZV211TrtO1pz/0UfpNX6Z/0+91Ty7tYbY/ZvzyvwL4LYCn/p8BeMHADwHyLcjHXMMaa3ngY/aANzx8IF1R/yhPXdsWLg8sD7z1gOcEtG6DPj/E5oOxD9OZ0EP7yb+f/n/605/+rW9G4ev/VdcxQMf2gZl576q2iEO8yvLAs3uA+HtIsf8MGbtrSxl0rduQ7VbPVEXOHLJEz+G1mGc4z3XSjqkMPvvZnqhuxe5aogxd6MRKO542wOe8t9DVv5W/sE91X4/wY8hzzEBb6Jul8tn2KuhMBvdoP1WuyWYmopmgmrSayJrYZrJrApxJsYlyJtCZWENn4l2T8r0k/g98z/e8OVIZA73ZWHXOtCdtzTVAu7Zcrz5Iv+grfacv07/p97on7tXeftr2yEG6ff/3ffsbXwL4ewD8zT5f27f6df5b0R8CXMn/I+/eGm554IIHvOGJVV25SHvSVX/xywMfqgeMe7DWbcjeeQHgw7MP1T54Z/Iv/UM/8iM/+oUvfOGdr//7gO5YPnD70My8d7XalPYOlVWWB16EB4zLNKaTZbt01YNXJp24jXYqMvBe9QxdQs/cNWii3KFn+QgyZ9XTjiqX9zpzFO0H1utNtkk7v7Ylf4S+5G/b634NPvf2Gnp0vRcnyUN/MMVE8AjWRDOT0ExOTVhNYE1oQRNdE1/QhNgEGczkOZPqTLYzEe+S9SPJ/hGdbmxkOX/alfbmOnJ9rjn9oG/SX/pQn6af0/+5N+zl0ZcAjx3IXA++57t/y72XAI/9ewD+EOCXf+qTX/fY9q/xlgc+Ng9wY8wiP0N1L7Wrt3B54GP2QJ4T6I3qQ2s+APvAXB/ETfpF/us//va/+/p/fSB3fOdz/oHYknWwqywPPKkHPAuPPYnjVmSelFUavtZtyNrqGdpDz9tR5MxXXa8DtsmjJ/2YmNcbxu145WK9zlyyR9tdK/qVTpltiXt+Z8+yvdnDus8dP7qd40EazEI/iviWe6X/Hkn8M6HMRDMTUBNTE1XQ5NWE1gQ3k14T4UyOM2nOZNokOxNv6Jqgz5L6P/JH/sjpk33wUp2NUeeqtmgjqO25nlyna09/6CN9pg/Tr/o6/Z/7cjT5Z1+fKGw3vp6/93sAt376bz++TbC+AfBEu7eG/Wg9cOmmljdNnCSvw+xfUV31Fi4PfAwe8HwkbmPh54dVH3DzATofwE36Rdr42n9+/Z+27JNjOb4Px8x9V9Om7rwOtVWWB57EA8abgyeftO3gTJ46lbYPeKRuQ+9e5dwg8/xU5Hwh85wdwZro5nl9LtoEPq8bR2lsVFd7HU/+MbD6svq+43Ov6l4GfyQWauyM7m0Mqkf7qyvXvADIJDOTTxNS0ETVxNVEFjS5NeE1Ac6kOJNlE2jQxDoT7pqMd0n7pUT/UjtjolPHrnOnXdqa9ue6cr36QJ/oo/SbvtS36e/ch9yfoy8BnjJg+U2AH/vh3/eGPwV47G8B8CJg2L49pf1r7OWBD9kD9caVvDSYVX9kOzJ1bFcmr778wuWBD9UDxnqi5wO8l0z4kOsDsw/WoEl/Im+9+fG//Pr/7AWAY4M+LDP/XU2btHU0rbI88KI9kLGaNEbLiy4Efla30fZO5bwg99zsYZ6zGc35zjZ5zz1tVWbbY2BN0OXzenMtjV2O8xg2dmOkz6DZh062tz+0lT2exYLyod7GEu2Uim+lr/DfIy8ATCYzwczE04TUBBU0aTWRNbE10QVNfk2IM0nO5NmEOpPsmoDXBH0vsf+hH/rhU1IPWtFXPutb56g2pH3aDLqWXJ9r1gfpF32l7/Rl+lef5z7k/uS3Nvb2+KlDll/pf4ofBPy23/avfedT277GXx74GDzgzYy1Vlo+ETpr9pvJ0bE4lvzC5YEP1QN5HqA3qg+r+SDrw28+hGfiL+2P//H1f14GKM9+jpXjO6c2DKy2DdG98w+/yvLAa/FAva/I1zhPfhuLO9cmUTy1eXbAPFNHac6jutKe0afELjlXlteLa2lsto90h4+1Nn3XYd2T3Cvp3OM7mhhgbzMWZvRQO+tJgx9E2UsOsy2Ty0w6oU1GTVBNWE1gTWhBE10TXxPhTI5NmEET6UyuM/GuSXmXvJvkX4vdWMjqnGlP2qntuZ5cp2vXF/om/aUP9ak+1ud1L3Kfcv9m9HMEcb4E4AcB80cB/Ur/Nfhdn/32v/Acdq85lgc+Rg94I2Tt0JSZLNtSV3mHyFZZHviQPVDPi/w2Fv3OCwAflH2oBk3sK37v9/7BP+bX/7Mt+zpePjA3D8PaJH7I+7HW9no9QHxSZpht0qlrfCdud+OB96rnZIZ5pq6lOZf0yfMp/ZTItYHxRefKa8Yebd/UuUaW82U/5Xuoj9GRvoSzvUNe93vwGRdJj6ZzGzSFdsoM37a+on9niWHKM6mEzqTTRBQ0OTVZNXk1oTXBNeE1AQZNjDNZNoHOpDqT7ZqI14T9UsL/4//pf3r+BkDSXb86dp077Up7XUOuy7Xm+vWJPtJn+lCf6uP0e+5H3Sv43MtKP1eo8qzCiwCSd/4c4Jb/EYA+K/l/rh1b83zoHti7iWVbpeH3Kn7LPsknrQ6yVZYHPgQP1Jiu52Qbi7z5BQA//vezn//8z/EDgN/8zd/8Gx7pBQB+107oVZYHnsID9WwwR5Uln3S1x7YOZzLk1m3Q9+pe0mjbpcSza8/EVXov4Z21mbyL6EnP0LFst488+FTVucScc2aX8g71LW3Sl9B9S6z7Pnhj4ggO9XNB/9WXmhBW3gQyE8tMOE1ETUxNVE1cTWRBk1uTXRNgE2LQRNnEGTShziQ7E/CanHcJPDKS/KN1NkadK+1I+7Q51+Hacr36QJ/oo/SbvtS3+lrf537kPtW97Pj3EcCcR55leCHA7xmR1P/oj/yh0zcDZt8E4HcE1tf+38durTk/Fg/kDZA1yyet7CjaNxF6leWBD9kD3fnYxoLfSf55iPWB14fxTOyh/ar/Zz7zme/g03/+C0Bl6trXB+18UG4egKt9H/JerLW9bg8Qq5SKyqo8eeiubkN+r3JGkOVZ4WzCzxLNPGOpU+XJQx+pnmMx+9SzLo+OdOJMnjpPTWs/80hrl3y2JW174p6/sy33M/e47v/guzhRNprP7dIgBR2K+JZ7Jf92SWGVZVKZyaYJKGhSapJq0moia2JromviC5oQmyCDJs4m0plcZ9JdE/IucT+a9M/06ph1zrQn7dR215Lrc83pB32jr/SdvtS3+jr9n/uS+wVd9zP5lxCmnEvOOy8F+GCDFwNUEn5pnnNegq3LhuWBD8EDebPqaGXgrRU/2bejlYGrLA98KB7w7LAe4x/cqD6Q+pDqQy03QKtJfUUS/+7r/+jZF3RM53BObRiYdkkP8UkOrrI88JweIAazVD7boG3fQ9q6ug35uXo2OvT8VPR8gbYlrQxMefab0Xl+65ne44+2pd5T0PVadM0c+AT9mW9Snj6ufq5t3d5mDATdxcssxka3cxxCv8qSyWClayIJn4mmCagJKUiSasIKmsSa1JrkmviaCIMmyCbMJtCgiXUm25mI1yR9lsz/3//z//zn9+qsXx0fPudPu7Q17XdNrjHXrS/0jb7Sd+lP/Jv+dg9yX+q+1X1N/lUG7TJ6eWB54FE84M2NwaRnN8Fb5XXsRzF8DbI88II90J2Vbdh79QsAP+nnzTi//O+v/9eXA/mg7YOyD8I+ADP/Xa32DfEqywPv3QPEZRb5xKTR7Xhks7qNtnP1bFT07CR6rhJph1dPWh3b5Y+iiXCe65ms6lzLm7SL9pcXlSdmm7SYepXGD8jE2p68OtV36XPa9LXyxLq/8BkHd/QsZmYxNrqdSm1X/uIxk8EZnQllJpomnyakfkJtwmoCa0ILkuSa8IImwibGJsqgCbQJNWiinck3dCboNYnfS/gvtdWxcp7ZS4C01zXkulyra09/4J/0lz7Up/pYn7sHuS+5X+wp/GxvX3yALgOXB5YHHtUD3qxy0LzxIU/+MekcWzoRepXlgdfuAc9Ynp13kn8fWH3A5aGXh+eu8rdyfPpff/1f3frA7AMxc/jwO5y63dW0K2197X5f9n8YHjAmXc2MVw5eqtvQuVc9Fx1m8pjntCahyR/Vyz6cW/lK55l+bDqvG9CMr0ysc3ZyZHt9ba9j3crrq8Tq97p38N0e13i44y/F0VA7v3SqNPyrKrPE0MQxk8lMMk08QZNRk1OTVZNXE1o/4TbhNQEGTYpNlE2cM5k2+Qd9AVAT8pqw1wT/v/zJ//Jv7dWqD1/HzDm1A0z70m7X4tpca65fn+gjfaYP9ak+1ue5D7k/uW97e/xMwfoJrgNf+amv+MZf8St+2W/8ZX/vL/w2zv8zzb2mWR5YHmg8kA9PNCe/dxPc7nRnOOs7up0f0qBXWR740DwwO0PbWOg7LwDyIdYHYh+yRb4BQP3c5z73M7Ov/9eHbMf1QdiHX2y4q3lGh+h89qFXWR54Cg94Nhw7+T3aNtDKGJ3c9hluo9+peiYqemZEz9Ieokt718e2WX/PPYhO8pfoPPdJ20+ZiBxaPrHS8vYRlYNHqrY8Bs582Mn1u3sC1r2GNx7ucBY3GWtD9RyHVW4b+CrKXnJYXwJkgpmJp8koyamJKmjyajJrcmuyawJsQmyCDJo0m0hncp1JdybjmajXRH4v6Z+11TFy/Jw37Uk7td215Ppcsz7QJ/pIn+nD9Ct+1ue5D7k/+QLgfX0DgPNF0v/JX/KL/+2/b/u7/+invmz7c//LL/8H3/zL//O/480//qt+6Y9yJl/FIVlGLg98oB7wBsby9m5+tm1D71JVd4ZjiPNc0uAqywMfigeIfYpnYBv09AVAPhx3D9Wf/vSnf+tf++t/40336//qO0Y+DPvw64MvNoyqTYlDfJKDqywPvG8PeH60w1iFt03ZEdzu+oHnc+i5ED0viXmeLtH2u6RHu+cVrHy2SXPOocWZvLannm2g1THlE+0rZtslOvtIH0XGnuke8a067keiey0SD6UeiafR5V4cJg/9asrsBUBNIOEzwTTxNBH1k2kTVRNXE1kTWxNdE1/QZNgE2YTZBBo0sc5kO5PwTM4zce+S+//nf/3/eNNVdJHXPjlezpPzp13amva7JtfomtMP+kZf6Tt9qW/1tb53L3J/cv9me4z8KQL1yz/1ya8j4f81n/rb3lBJ+Knf+r/Y3vy7//QvPFdkfBvgKWxYYy4PLA/se8AHKbSk925+29A7WhkH3dl4o+k8Z6XhV1keeI0emJ2jbSzmnHj4QOqDaj7s5oO1f///vd/7B//Y3tf/84HZMZ0DLA+79Uy+Rj8vmz8sD+S5cWUZp8jkk1Y2w+2uH3iunoeKeWY8RxU5q1UmT3/pPXSMPPcz2rO9h3nNYJyjutmv9nGcqjPj/aZStueaHD9lt9L4lr57PqYt9zPpuu/wGR+D7uJpiM/PLLanrNLwL77sJYe0ZSKZCaZJp0moSalJqkmrSaxJrUmuia+JMGhybLJsAm1CDZpoZ/KdSXkm65nIdwn/JVn2z3FzvrRD29Je1+CaXCPo2vWFvtFX+k5f6lt9re/di9yf3Dfpbq8fM0A543zKnwn/7/hn/7Y3f+CbPvXmd/+6Lz/hD3/rP/iG+oP/60+cXgTwUoBvCHCetYU/E+AbAnx7QNnC5YHlgcfzADcwizezPdyG8rV1bzznV0dbQNtStujlgdfiAePX2AY3qg+ePoz6AOuDcD48S/Nf4/zs5z//c0/09X9txLfaDb3K8sBzeKCLuZRJg9fU7U4fvFc9gxU9k4meT/FI0qnuDB3DM1/RRDnRa8ERZDz7Sl/qd1RvbxxfVs506jrl01Zl2pP8jJ75WXnuJ3Tdd/kaJ4O/FG9D5XzNVBfZqypdUlgTfxNIE0wTTtAk1KTUJNWk1STWpNYk16TXJNjE2ETZxBk0oTbBBjPxNiHPJD2T90z0f+5nP//zezV1oXOcHN850460T5tzHa7Ntbp2faFv9JW+05f6Vl/r+9wP98g9A2d7jPyxgpVP8knmTfhN+kn2/2/f9lWnpD+Tf14A+CKAPvQl6af6AoFvD8BzjXgsO9c4ywPLA1/0ADcuSqI3s8Rt6Nxac5xKj2HvzQ2/yvLAa/UA8U2pcX5O/nng9KHUh1QfbruHZ3/878jX/xnHMZ2jecBN295au/5dHnheD3hOnFVeRC4NVlpZxe1OFzn0O9Xz0KFnBvQcVcwzVtsu8fb1vIsmwd35PyJjnKqnTKztHa+u2Okgq8m+n/5XObqMZU3esW0TU0dZRfyMLHHm+9zTpOv+l1ipcSU/1O7FYvLQr67sJYf5IsDEEsyE0ySUpNQEFTRpNYklqTXBBU16TYJNik2STZxNpEET7Ey6TcRBE/RM2jOh30v8a1v2y/GcI+dNe7Qx7XYtrs21unZ9kf7BX/pOX6Z/8be+z/3IfcqXALMXAY8RsHzdnwSepJ7En2riT/JvNeFHz5ovBXwRwFhZeSHAtwIew9Y1xvLAx+wBbmSUDr3JVdyG/r1ab57JV907vo4pP5rPtlQafpXlgdfoAeMb3KiekXwI9aHVB1wfikUeqPnV/2u//s+4zuO8d3akXdKj6d4ZhF9leeA5PEAM1mJcirRL7+F2pwe+U/McSCd6Xjw7nk3RhBPe8yqtzh7aJ9Fk1/OePHop7+hOR1nOI92Nocx+8h3WBL8m/rXdMSsydsqgK5/z2z7DPb+7r4m570lH3BBnxNBevNFGqfhW+kr+nb0AqMljJpYmnCagfiJtgmrCagLrJ9omuCa8oEmwSbFJskmzibSJNZgJt4m4iXkm65nEZ4LPy/RZTT1ox8hxncu50560U9tdi2tzra49/aGP9Jk+1Kf6WJ+7B+5J7lPu4WyfHxqmfmJPIk+iTuJuwl8xXwAkzQsDXwjwGwG8CLAynt8IGLZuD7V39V8eWB74ogfy5tXd7Laheq/mDbPS6CKrfe74bvycf6idi/KzYBHLAy/cA8ZsjfNt2P3OC4B8aPXBNh96ob/5m7/5N3zhC1/4+Yd+/T/OZLUNl2o39CrLA0/pgVmsKRexQRo8Ureh906t96iOz+QQOs9m0pzT5KE7Wep4tjus5/05+ZqsX5pb/Uz6O3o2Trf+lNEPPlE69SrtHiBPvydd91e+i4USQ0fibnR5vWWWGOan/ySSmViabJp8moyanJqsmryazJrcmvCaAJsQmyCDJs0m0SbWmWybgJuQgybqJu6gSX1N+rm3WmubfXIcx875tCHt0lZtdy25PtesD/SJPtJn+lCf6mN97h64J7lP+QIAutvrGyL3E/zI37d8w9f/jn/2X/1n/ptf9Q/94jf/1f/xV58+8Tf5h8/kn2RfHtpK4u8n/bwAIPmX75CXDTfYu7osDywPFA/Uhyuau5vdNuSn2t0sL8nsG9jNkbKhen7wg15leeC1eaCerW0s4KYXAN/1Xb//D5H885DCywAeiGvNB2IfeusDLvPf1Txr2jma1pnDCas8mweMvYoYUGP0CL+Nfu9U70+0SSdyTuA9L4mepUTPmrK9pDN17JdocpvnmfbkH0I/xlgm/dhRk/1Olvppu+tGpl17mG32TcS3yUvr8w5zbyudMQEdsbQXe0Pt9V83u6SwJo7P/QLAhNkEGjSpzkTb5NuE3AQ9k3YT+UzwTfo7TD37go7pHM6pDWmXtqb9rsmXAK/tBQA/yPcv/Iu/7kd+3+/+7W9+6Ae/881v+D/87/5HXjr87H/wT5wSen7k7//7o1974nkBkC8BfAEg8jKA5N9vDGTyr6x7AUAbZ52Dt8rywPLAbR7woYve0t2Nbhvt51pvkkf5HOOO7uYaTWdboCna9pZb/y4PvHwPGLMZ49sw+5yA+PDpQ6oPr2A+NOeP//FnAJcerunvmM7hGWX+u5p2pa2j+YMprosFSR/FD8YJL3Ah7sHMNNrVSVQ+w230a6vxfwk9L2KeI2nPl1jl8iJ6s5rnXHp2vi+1M4c6j43aBB6tMxtmvkj7U4dx5JNWBuJrUb936L7OMOOjiaVZ3Bmjo8vrLd0LAGX5IiA/WfbTZj999tNoP53202o/vfbTbD/d9tNuP/02GTY5NlnOBNqk2kTbxBs0GTc5N1k3gTep7xJ+/nvdTm4fx3BM53DOtEPbtDXtd02u0TXrA32ij/SZPtSn+lifuwfuSe5T7h97Cu/eihcid/uaf+pr/s1v/c3f+pdJ/L/nu3/Lmz/xA7/rzR/9w//GG+b/4c/+Y6eknx/r+w++/R/9W74A4KUAlUTfpF9ExssCknm+5u9X/0n495J/XwisbwFc2LHVvDxw0APewGY3uG2Mc6p5g0yaGyq8mG1JO07gbM60aaivsjzwKjxg3GJsje1tyK56AcBD7Wc+85nv4NN/Cj8E2D1Y14dhHn7zIdczyPyjVrvS5tH8QZVubVVWeRygTEzZB+Wg97wY/ZtYafi9ukU79KkS85X2HMwwz4x0l0heK8vzCd2d4ZcmM+nXLhN/eOlLaF/QdSdWvyRvH2WVR84+2C6dONsn9pY291jMuDB27pD420bt4nCIz3LoV1lMBBMzcZTOxNJk0+TTZNTk1GTV5NVk1uTWZNfk12TY5Nhk2QTahBo0yTbxNhEHTc5N1k3eTeYz0SfxrzXb7eMYjukcOa+2aFva6xpck2t0zfpAn+gjfaYP9ak+1ufugXuS++TeibnH0rOg5Wv+Jv7f+we+7c33f9+3n+qf/pOffYNtX/+P/T2nhN9P82vy758FkPhn8k/SzwsDvu5v8o+M5P/ICwB0hs3bzO4lXx5YHtj3ADczSmK9wW2j/VzzBgntjbPDqpt8jjnoOmfaM5pPRZn8wuWBl+wB4zVjexsGX/UCgIdef/yPh5L19f92y9PXKMirLJ8Ibc0+6tg321K26Id7oPpavu6L/B5uw5zdmvefju7uYchmSaQJ6F67OiapIud6Vk28xdTrZNne0df2UT8R+tra2eL6r0HGuaTPHqgz2w/luad1z2tclJjai7+h+rqLiWCHJo5gJpYmmyafJqMmpyarJq8msya3JrsmvybDJscmyybPJtQm2KBJt4m4ibmJuom7iXwm9zXxTz717OtYju1czq0taZ82uwbX5Bpdsz7QJ/pIn+lDfaqP9bl74J7kPuX+QXd73EUvZw97vvuzv/v0ib/JP5/8f9/3/VunT///L7/7H/hbfMpPQk6y76f+iZn8Q/spP98AMPn37/6PJP9+C4D/crCze8mWB5YHjnvAGxs9pMVtyE613hzh6w2042s/xkPmuHfofImj6WwPNIX2VZYHXoMHMpahz8l/nh0fTH2ABX3oJeHnQYRP/z/3uc/9DPJas59jgZ5Fzx/z39W0a4g+yDPldSIxadZNqTL4KjsphhxeHdsWHvdA5ztliZWGv1S3ofNO9Qx0yDlR7plJ9Czl2TpK59n0XHu26zmGN+m+tq3qO06iCXzq2t7Nrf4tWMerfngMnj1gnKN7gR77qn7uMbQxULHEUxd/Q+V8PTBmkb2q0iWFNXHMFwAmmqDJp8moyanJqskryayJrYkuaPJrMmxybLJs8mwynQm2SbdJuEm5SbpJu0m8iX0m+9CUKlPXvo7l2M7l3NqS9mmza3BNrtE164P0i77Cb/pQn+pjfe4euC+zFwDsc/cSoAtWPvnnU/8f++Hfd/q6v98A+OM/8O+8+T/9pv/9KennE3/+jp9P8zPpT9rfASD57772z0sAP/03uT+C688Aul1bsuWByx7wRpXY3dy2MdS9xMUbZL2BXuLtJzJu1G5ubRtqp1J55QuXB16KB4zRRGjqvXPkefGBNB+KeYCG98f/eDjh6//IaMua/RzLscFy3rQl8aX47ho7sJ/SYcqSVh9ZrbaJXT/aVrnNA/ozeyvbQ9ou1e1OJxH6XuUcIPM8JOZ5qbRn6hr0TNJHWsyz29GZcGf7XrKeetDqdmNVWdW1f+pdQ9s/bWLt8PrgoahfO8x9Yi/lKy2f+50xIV3jaPCzeBxNr7d0LwCU5YuATCxNNk0+TUZNTk1WTV67FwAmvqDJsMmxybLJs8l0Jtgm3SbhJuUm6SbtJPEm9GAm+9xfLSlPffo7lmM7l3NrS9qnza7BNblG16wfnvoFQJf8s881cr/6V3/1t//7/+5vOiX//L2/yT/fAuAFAHtJ0k5yz6f3/AlAJv2VRo9vC/ACgOQ+v/rPC4AjCX/VufszAO8fdQmLXx5YHjjgAQ9Qd2PbRv93HprypnmE5maKnjdVkbGjdvOnbKiusjzwKjyQcQu9UY17zwNnwgfU+lDMQ/fPfv7zP8eDCQ8lfBvAB2kfrrOP44CeSedz/oFp12BPPEih7TWUzk7Xhf0draxi6meb8kRoCnqrPK4H9Gli7seM3oYZtCVC36ucA2Sehw49M4mepTxbR+k8m55b0fMrdkk4bZl4q5tov9RN2vYcJ+nUTTp1oPkhUmVJK6vIWFn1BTLpDvFtJ6+yTi/3xT1ElrQ6yirWuKhxdMfPYnE0n68N6LyqYrKfmIm/tC8ATP5f0zcAMqHPRN/k33utban/kb0A2PixPxJ/fumfr/zXFwDf9M/9ynPiTyLOp/sm/ST71ORPPwQ4fizQFwB+9R/06/81wT/C8xsFr+qgLWOXB16IB7xJJebNbRt2nmreGLlp5o3Vm6gyUXnFHAvaOQbm3NJDfL6pJq3NyFZZHnhpHjA+jWPwnIDkmfChtD7kkvD7YPJTP/XTf5GH7Hyorg/TjpPnz7PG3Hc17dHG0fTii7aKGJxrqXy2HaUdQ3SuirRTlL/l1r9HPJA+k+4wZdB7dYt26Heq56DDPItJ53m6ha7nGb6eX3jPtUm0MuXyYienzXZRvW5cZVUn5dIm/KA0bUmrCzq/NoGuvfOJMnwsvYepd2Rf2FP06t4mL93FB/GEPOKKWCTGakwO0estmfhX2uQf9AUA6EuA1/4NABJ+i8k/+CG+AGBv2ce6xxm5/OK/X/331/59AcDLAH4TwKSfxP8f/Xt+0fkFAIk/yT7VFwHo5AuAx/j035cDd78DsKX9i14eWB64zgP1ZuZNbhvDnBMXb5De6OvNtd6QvbFWdByROe5qZ8doOt9soVdZHnjJHiCGKRnL2+DP5yjPg2emPvTm1/+/93v/4B+jvT5UZx/HybHL+Up7tC8R+rWU9DE259oei3Zcsc6JfJV9D+izqpXyjkZ2pG6hB91Wz0GHeV6gTRbzPFWZbR1yJpHn2ZTO85u091MTadqkL7XV9o7PsaSdo6LtoEm/qEydvZcAuT7WD68fOt42fTdD9Lo2ZFndS2TucdLKErv4mMRUF5tD9RSz4KsrNSE0UczkP18AmPy/pm8A5J8BZKI/o30BQL+P5RsAnIH89L9+AwCe9nwBwG8AmPCb/CfyKT+f/Pvpf74AeMin/7wE+OQv+cX/NteWV3fglsHLA+/ZAz54dTczZBu13hS9sfIJpTfUvPFWWv280ULnuM51h509o+l8c9VuZKssD7wkDxibNYa3YeT5LOVZyPPiQzDIj/75qUT9+n/q+UDsOI7dnK9q00vyW2dL+pL25F2LcvmnQucBs2hTyha974H0mbT7Rk/pa3Ebfac1zwO052SGnKdsq+dLvkPPZD2nmRSbRO8h+rYnjUxeTJl9jmKOkX1M8GeIrm3Zz/FAK76Arj5JHl8mD50yfZ06KZPeQ/aU9kRoY6LGSfIlvmbxOdTO1yroV1G6FwDK8iXAQ78BUH8HwL99f47fAMgXACT3s8S/+/T/uV8A5A8APuaPAHaf/rPPBil/+0+CT6LPp/9U/u7fbwDUFwAk/yTxmfBXmm8AkKzzXwaC+fV/P8m/FfkhwF/xK37Zb9T+hcsDywPXeYAbGaXe0LYhOyct3gi9WXLjJzHxRnrppoteVscTmStqtSVtHGrnG6xyZKu8Xw+4FzN8v9Y93+y5fmjqRjXW8xzkufHBlodp//7fr//Tlg/T6mb/HNe5nHugtohDdD5H0K+hVNvl93AbC9ure31po8zwbev694gH9KG6yUsnQs/qVtrkwXeqZ6HDPDNJd0mi7XnmOtqzmejZTcykOWl0kr+Wfmh/58vkHtpKe7apn5jrhE5fHKHxa9VTVn2OnrKklVV0H2fYxQlxhXwgMWmMzeJzqLyuYrKfmIm/9GO/ALjlfwHgh/X8oT1/eM8f4gP9cT5/rM8f7/OTfD/Z714CZBu0fRzDMZ0j59UWbfMHAMFrfwTwqV4AsL/dSwCj9ev+ma/7g3zFn1/+n70A8H8AINEncefbAJn0k/BbkZPwo8cLAL4F4AuA2af//Ljg0RcC/9JXf+lPrf8O0N1buDxw3APcvCizm9g22s5JCze/esP89Kc//Vt5EEBeb7KVVyfHqDda5rurM5tG8/lhHNriWuQXPq4H0r/SFS/NeK3+pfFeUrtrwyZp0LoNuj1LeU58eOXFGp9CUPhTAOSzh+js79nKc8W8o2qHOEQvsmAfJVGbZ7Jsh95uqParYyU/hj3bBW1BZ5XjHkh/6V96S1+DW/SDfqfeJW33zp73MtFz092jbOOc2V7pPIOc1a5mQpyJ8oxGnzax6l0rr/2Tr2OZ3JvwJ2Y/aHWVOxZYa+eXKsOXKZNPrDT8TGabWPdTvmJeQ6W7+LqTdTE7ml5PycS/0ib/4Pt8AUASbVJtkm3SDZqMm5ybrJu8m8zXJH+Pt49jOKZzOGfaoW3aavIPHv1fAJ7qBUCX/LPfRuq/8C/+uh/h0/7ZNwD4HwC+41v/V+c/AfAbACb8FfMFAC8K8uv//knA0WS/01svANy5hcsDt3mAmxel3sS2Ibv34FRvktzgP/OZz3wH6A12D2t/eG+uIPNFrfbID5Xzg7i2I1vl6T1Q/Z289CXUSvXgk7b9NaLrALNug2/PUp4XHnzh+S//SP75FgAP2PlAnHT2zbPlmWLOu5q2SI+mF+93bLVo9wy3ofjQOhsbG7SlIm2rzD2gv6pGyqUToY/U7U4PvFc9B3uY56ajOWPKpfPcdXSeUemaDJswzxB92sSZ3lH5teNkYt/RKUsbnAfMih/g0x/SFfEpMn1ru7yoTqK0OjN0T2fYxQzxhbzG2R3fxepoOhXjGibpt60v4N+a9MNn4i/90l4AkGybfJuMm5ybrIMm8Cb04JHEHz375njO4ZzaYPIP1hcAJv/gpf8G8KleAHT7nC8A+AFAfujvyAsAP8kHTfyTRsYLAJDkv74AuOaT/i75R7ZeALyAi8cy4VV6wBtRd+NCtlHzRtjdLPm0kpcA9Ua7dyOu4+QcznuHnW2j6WXeRDHsAykZGyxJXtp9ST5p9aueOiBFvbfcu7zyl4hpe6Vdt7iNBUzPUp4dzs2P/fiP//n89B9ZrdkHOs+U54k576p2iEP8Ygo2URLTTukZbqPvtOoLcU93tDEHY83mGk2nQvsqt3mg+k5+5vM9+TZMoB08V/Ya3j2fIWeGtjw70PU82a68nj35ekblMxHOZPkSTb9bdbq+yirO5jDJr4h+J3Mcxq9VX9yC+Df7yaffpW1DP2UdPdvrWbwgzzgrdBenQ+V1lFliWF8EPOcLAJJkk2Y/RTepzkTb5NtkHDRBz6TdRD5fAnQvArLdPjmOY+d82pB2aau2uxaTf/B3/s7fear+FgJ/EkF9qhcAvsip+22Udi8A8r8B9BsAJN8k9iTxVGhfCHQ0+vkCYPb1/1miP5OvFwDu3MLlgds9wM2LkjexbfD3HqJ8EBK9qfKJJS8C5L35isoTHUPMmy7zRk2bpEfzydYOka1ymweMg663vlfnIWhf56m88peIe7baBmbdBj89S3kueLDmAYQXAJ6pfPiVzj6eIXByjtKWtPGl+bfaVu1O/uRT/Fpr9YEP7ilXVvsOPueY0UPtVGiniG+59W/ngc5HysBKKxO3Ox2w0srunbG638nnmZnRnDHa8qxdor3neU5FE2KSZBNwE+YO1anY6SpTV15EPmtTp6IJ/lF51XPOxOoL2pQl4uPkoZWJyup+zORVD36278SJbRkz0nfxd4654I3VikPlVJBnqXy2PStdE0J5EsZ8CfAULwAe+jsAJN0m4CblJulgJu8m9GAm+pVOveyf4zqXc3fJPy8BZi8AZsn/U74AcF8rGmy8AOBv//MbAHsvAEjMeQFg8l/RlwG+APA3ANYLAD2+cHng/XjAm0+9Wclvw6x7D1TeFEVvqtz8+a/KQGTevG3vbsqOIXpzFZn7rmpPh0NllSfwAL6m7GG3H5dke2OeJnxl/3T+qT7YxppO1dgGjXvQcwLN72qQ/PPjf3sPyNnHsXJ85xxY7Rmi91o6n2FQyqvNld+G/r2aa7+WrmMNvs6Xto3ms63Qq1zvgZk/O78r28Y0F+ulvfesHEHOGHqJ0so9h6D3vYqZBEPXZLnj1RM7nT3ZrB9yK/1neo7tiwBROdjJckznAatPHspXv+/x2ea+7e3/XgwdiEHjNXF0u1doe1GlJoTJ+6kx2L0AqP8V4Nd8zde8sf7TX//1b6jf8Gt/7anm/wLAp9x+4u0n4CbFfkrup+Ym0aCfrGfCbRIOmphnsp5JfCb30rwAkK5o3xzPOXLetEcb027X4tpcq2vXF376D+79DwD4+Ku/+qvf/Mp/+Feeav7XjLlPuX++0Mn9hTYY+V8ALr0A4EcASehN7jPp5zcBkpdGnx8B9GXBegGgxxcuD7xfD3gzyhsW9EbNm2G9aeaNlcSFHyxDVm/uqZd0HS/ncv47rLZVm4fa+aHcNmSrXOeB9J00aGU06a4926RnfZSDlhxT2UtBbcOejlYGZt0Gf6oZ3xn7nglkvgDghVo9S+ol5jg5vnMOTFvSxtH0rMW5u0nTRtqTr/Q22u/VXPe1NGPRp445+DovPGWGb1vXv9d6IP3Z+RzZdrQe2f88M0l7rpAlXXnbOqz3PvhMhKEzSc6EOmn1qm7K1a+y5KXBSss7ziU04Rerfo7nfKJ+SOx8dUmGz2c67gft0uDeHmdbpfdi6UI8dnE8upyvHdAUY/8t9x7/rQmhvAljJpEml5lwmoSSkFL3XgDkSwCTXpNgk2KTZJNm0GTa5BrMpNtk3OQczKTdRF6siX7y6og5To7vnGlH2qfNuQ7X5lpdu77wBQB+2nsBoK/1fe6He5T75l66t4mG3ld+6iu+sf4GgP8VIP8dIG38N4F+kk+Cnz/sZ8IP+gOB6qCn7mO+AFj/DaC7t3B54LgHvPkk5o1rG0NNXwDkDRaamy4vAEhg5L0Re8OufeDzpltvuMwfNW2THs0v5yaKMa+wuP9purJEff4YyFw5dvJpx0uktTttVtb5ZhuKp5rxnXEP7dngoZo/qeEhu54jdcQcI8d2voHVniF676XzFUZVWyu/DZ17Ndc8o/ERbeJMD3kZv84vP9TOsQu9yjEP4L8s1Z/yHW6j49V1ttd5bqQ9UzPc06v3Oe93IkkwtMkwWJNnedvUrXJ5UN2UdXSOJX2kr4m+2I3dyRw750pavzw2sneM2e0h+4fcfbyER64Zk5gkfonVGsdDdK/Qbkl6T2bbo2Mmg5WuSaTJJWjSaRJqUnrrCwCSYRNjE2WTZ5Np0CQ7E2+TcTCT9EzeoU3qj2L2z3FzvrRD29Je1+CaXKPJP/hYLwByf3Lv2NfZSwADinNx6QXA933fv/Xm9/6Tv+Zvmez7qb683wLwBUAm/uo81guAf/xX/dIf/fJPffLrtH/h8sDywHUe8OZTb1jbGGb6AsAbat5seVCY/SmAN2Yx++XNuD60YcNdrfbJj+bzzVY6EXqVfQ9kDKCZfKX1+0OxzqOFzif/PjFtuUTbDmbdBn+qGdsZ8/UsdWckz0v3IJtjO9/AtGOwZ14afI6SvmG+jk9bK72NPvdqrrfS1bcdX/vA1zkGX+1IfjSf1wG9yjEP4MMs8on6eRuK0OA7NfdM2n1VXx6scZBnqp7BbMvzVuXynNlaSXqVmQCTMCfdJdBVB31l6iuTT8w2aTBrHS/7d7QvASpW3dl8zo0/oPWLqExU/hB0b3L/3OcaCx2fsTOjjbMGjWFxqJyvF8i6MpN3uo8qq0l/8plEQmeC+VgvAEh+TYZNjk2WTZ5Bk2qTbDCT70zKM1nPJF569gLA9oo5Xs6T86dd2pr2uybX6JpN/sGHfgMg96fuXe5r0hlM3/XZb/8L+RsA9RsA/9EP/vun/wowP82XNvk36a+JvnpVzp8IXFv5UcFf9vf+wm8btm9p/6KXB5YHjnnAG443qcRtDHHVCwButPyPAHyCCT27eeeNud6cuRHXmy12RE0bpUfz+eYKvcrtHsCnFH37lOg8pwnv5pR+SahPsElavyiTr7gNhVPNuO4eOOu5mPG1b47rXAOrHfDPWZxPdG558Ejdht655lqTrj45wmd/6Zxr0J19Q3yOgUrDr3LZAxkDaHd+Ttk2dN6puWfSoLopy3jIe87sjFW5/e2bqG53vyOh7WqXgKOXcvulrNLwXa1j2c8xbe/6psyEP2WVdqwceyZTB19BJ1a68+clHfYCHfekovt4BDN+Oto4azBjN+mheirIKOJb7j3+m8lgR2cimQmmLwDA/BaA3wAAu98BOPJnACTJJswm0SbVYCbbmYRncp5JO3RN6o/wdYwcP+dNe9JObXctJv9gfQFwNPnHr3zbQp/nPuT+5L51+6osQ+9bvuUb/kOSfirfBqDy9X//BIBvAPCigiSe3wEAM7GvNH8uUP8bQHSuTfirPmPeXe/T/EUvDywPXPBAvfHIg1m3wU9fAuTN1ZsuyJ8C7P2CubrZv96Q84aLDVHTvqSHyvmGinyVyx7QT4n6lN7SM9zudMCs6MPP+qV8qJ31oLOg9z5LnT956UTorNvgTzXjGbrGO3yehxld++W4znWHaccQnexKhH6ukj5iTm1LWpm4jcZ7NdeadPXJNXyOA13nHLz2JA7x2Z/Qq1z2AP6rRVli+ll6Gx1P1T2q+7bH78UD54z22XlTXseY9ePeljWTXJNf0UQaPml59RLVS1Q/ZdAplxZre+0LfyT5z36ODe5V/EO7fkpd25SpI9pPVN6he+deuc8d5v4SS/B7MWWbcdmgsVtxqJ4KckvSyCqv3pOhiWCHJJHITSYzwczE02T01j8DuPZbAPkSIBNx6EzSoWsST+K/90Kg6sPXMeucvgDokn9eAtQXADX5f4xP/9mP3B/3zD3s9hdZBhZnyWTfxD+RFwCshYQ8/74/aV8KgPyJgMm7LwfQVXYLxqf/afqilweWB67wgDeaRGjrNuhDLwC4yXLhAHlw4CXA7CadutDWvAnXGzB2RNW+GQ7VU6F9leMe0F8zvyrfxpBHq332EAtpp4hvuffzb7VBHrRimXSH22g/Vx8YxRrr8p6FDtURHUvM+QZdbRqiJy/MSamoTJsqr1zchsK96hor6os9xJd77XXMMrc2dThU27UiX6X3AH6k7GH6ehu651r36gg/2/vujD1EVpNQ73/gXq3JeNXt2qssE/FsYyzbklZ2BPNFQNLZ17Gr7Q/h9SdjQIuVVg9k/8S6l8SBsllMpJzYgr8UYxmfd7TxS9xKG+9DNC1Vp/LTjg9tmCWGyjORhM4k05cAR18A8D8C5DcA+NSb5Ld7AdB9C4Bk2iTbpBusCXlN2Luk/qisjlXnSju0zU/+u+R/79N//JE//oe//BaF36zwJYs+dw9yX3LP2Ed497NijZ//zb/yTf+p3wDoXgbwZwDf9M/9yvNLAJJ4k34+8ZcGaUPGi4B8AYDsluSfPrwAqDYvfnlgeeB2D+SNSnobw131AsCbLz8GyJ8D5M250t6Mxbz5SufNF1uiamPiaH7nwTJl0Kt80Uf4Av9ROkzfSm9D95Zq/w7HkOf5oSnove+SNkgnQnd1G/JzzRhO2hgXOQfQngfR9oo5Vs436M6mIX4vPk1btCFlld6G0r2a65SuvpBPHyKTr7T6oGMmhg3VPniK+JZb/z7EA52PU7aNwc819+kSnftcaWPDc7aH9N1rr/e25B+SBGffTLihaUustPrqdXxtU+co2j+x0vC31vQjNONUWfLsEXzdq9w/4wAd6URiqvJ7cZaxWeiM4aSH2vn6gfy9l5oQJm/imAllJpomnyajIAmqyeo1fwbQvQTwk3PQpNokG8zkuybm8DV5hz+S+Hf96vg5N3Tapa1pv1//f8in//Xr//jbPch9yf1yD3Nfk64BSLx/z3f/lnt/ApB/CsC3AFjDr/nU26S+Jvwm+yDJOsk+vw9A8u4PAd76LQDGW7/8X3ds8csD13nAG483JnpLi9uQXf0CwBu1v2aeN+hKdzfqvZsv9txVbaw4ms8310rDr/JFD+A7S/Vjx29D+dbKePTtxkVGqfhW+nz/dvNrr/bJz3AbivcqN1Nk9SEy4/xauo5V5qy2jeZnK8xN6bDaVflt9LtX6zrh93xVryeVp2/34F/nCTuqjfJD5Z01IlvlsgfwIWXmS+XiNnTPlb2Cr3s247t4MQZqfFTevlXe8fXe5n3wUvJLso2OmHTKcpxLCfpsjEv9sn32aX/qOA+ytO8hdPVb8vqY8aUrdnuDzL2cXQOyHZp4qtjFWMZmoY1fcTSfSuURIrMkjazy6j0aZjI4ozOhzETT5BP0JYCfUPsSwE+w+TTbbwBc+hYACaYJs0m0STWYyXZNxGuiPnsR0CX5M1kds86Z9qSd2u5aTP5Bv/ng3/776X9+A0Df6Ut9q6/T/7kvuV+zPVXeBRJJNv/lH4l/fhvAPwfgJQDfAiAh95N+Evz8yn9+ws8LAL8d4EsA+tE/9S7R/9JXf+lPdfYu2fLA8sBtHvAGA2bdBn+q3vjqTbLebL0ZI+cBgm8B7N2s0a9j1DmcW9SmO0x7pUfTeR3Qq8w9gM8s0voxcRtKD605njRzQ1PEt9z7/VdbEisNn3Ub/L1qzFasMS7vg2pF28E6Vpkz7Ul6qD2pf5mrFudHbruyitvQOde6Rvn0Q9L1GnKEz/7Vr2nLoKut8qNplSs8gN8sldanFbfR4V41Fo5g3ePk84ztxQt99tqzzftfxS4hNmlOnNH2pz11kO/xVT91bbsVc+5Ka+9DEB/aP/2JLHlo9iBROvdG2v1MzLiAJrZSNos1YtO2Gqd3fI1n+dF8vq5AdwXdWjpZ1bmaNxGcoZ8gZ1KZyaZJqEmpSapJq0ksOHsJYDLcfQuA5NlEOpPrTLprQl4TdvlZgl/lvjSwX2KdK+1I+7TZ5B/0BUCu1xcAJP5d8o/f9KW+1df6Pvcj9yn3bra/s4D56l/91d/OS4Dv/uzvPr8IyBcAtPEtAJJ2Enno2QuA/BZA/inATL97EcAcnLeZvUu+PLA8cL0HvKl4c0rcxnDnm1y9MXpTFeuNmR8D5M8Bqrzy9hfz5usNeXKjTVuTxgvwlIpvpR/vv/pDD6TfOnobiu9U92OGXZ8h68ZXNprf+15hi0Va+/ZwG53u1ZlfkBvTNc4v8XXMMmdn31B51pI+Y+LOpirbht651jXqr843Xi9uQcajX46bc6dNg642D9F7j1VseI3FGMF26cTq623onWvu0SWavX2q+MmYq/cz+Jq8mrgqF03A4Y/Q6on0SbqOYZtY2+VvRcbNyjjJ79FHdDtfdv5Wxr5A5/4k3Z37vAZ09KU4y/gMusbxjB9d3jkHyJ6tzBLDlNekMhNOk1DQxNRE1cTVlwCzFwAkwSbFJsmgybPJNJhJdibf0DU5z8S90iT9ypJWVrGOXedOu9Je15Drcq0m/0/16b8vAHIvK70XaJylr/mnvubf/Nbf/K1/2ZcB/HnA9/6Bb3vDtwCQmfzXpB25lTZeApjw+y2Ao38KwDhcS/ZsXW3LA8sDxz3gQxc9pOtNahttN78A4MDyAoBvA3iD7jBv0NL1Rpw3YWyKWm2WHyrndUGv8kUP5H4jTV7/idtoP1f3AZl0Ysqz3x3tmBVH89kGaAt676M4r3Zig3TFbbSda/qi0sQ0shrbe7z6daycc9DVpuRHc+tb5A8tzGOR7jDtSXobnc+1rtG1d/7xOpHog/8MUxe6jpvzp12DTpuTHk2r3OgB/EhJf3b0NnTONffoCF33OPkaD7fw3f0sZdwD5Y8kw10iTr+UO44JdG1Lvuo4lrinW9v2xtKmGdrXeWd6KcdvyUPryw7ZP+WX9pI4QCfjYY/ei7WMz4buYlrZUN8t6FHEt9wj/1sTwhmfLwHyBQC0LwEuvQC49lsAj/ESgMS9JvNH+Zr0y2fyn4k/9NHkn5cAvgB4rE//2Yvcp9lepvyKcNo4M1/+qU9+Hd8O4L8MpPKjgXz6b7K/h7wI4CVAfgsg/4Rg9hLhl/29v/DbrrBzqS4PLA8c9IA3F29KidsY416ilzfJepPl5ovMmzDIjZ+XAEdu3jleziOdN2Hsipo2Jz1UzjdP5Ku86wH9kn6T3ob6uab/L9H0Qyf739GOXXE0v7e9whaKNiWtrMNtKJ7rJZ8YxyC6ye/R3bg576A724b47E/opyzMb5HubErZNjqca7fGzid5jUg6rzl7dPaBrnOkHWFf2p3rGyrP5mPmes2l+s21pLz6GX7LmvuTNPuYfNJ1j+Hd+xoPt/J7MWcSi450Yk20aVMmXdGEuuod4R3rkq56YuorA5NGR1lF++/p1D7w+i2x+pt9U3ZpD3P/K93FSsbSjM4YvaO7WE7ZUDsVZBSx0qfGp/wnk8EZ7SfJmVzmS4D6AoAXAZe+BdD9HoCfjIP5ibmfomdyXRPvTMq7bwOYvPtCQMyXAcpSN+k6R7Uh7dPmXEeub5b84xe/MeE3KPSlL1hAfZ77kPvDXrpvs31F/hixdTpzX7b9uV/1D/3i6YsAXhL4oiBfBPACwG8G5AsAXiR88pf84n972Jdn4zHMXWMsDywPDA94sBKhrdugTzVvfHmTzJutN+CKfAOAPweo8o7P8aBzLui0Q9vuUJsrjubzOqEp6HzMxfUnVr9tw0Hnmn6/ls5xBl3nqfxQORVtk39OdO5qm/w2jDnXPX8Ys8YxutIzVGc2bs49aG1KHOJzjCN/ruJciWmX9DYMOtdunZ1v6rUBvruGHJHlWDlX2pI2DlrbE4d4lRs9gB8t0unbpLeheKq5P3s0e0p77m1HZxw8hL4Uc11ii8xkODETZWl1O942UZ2KtHcVvZTL1/6Vzz5HacdGf0Y7Fj6VBjsf5zVA+tp97OJC2V6MEZO0JxqnA4nf7Q4zlqVH0/kaDU2h7dnLXnKYbZlcQmfiaTIKmqSatJrEgia2R/4U4DFeAlx6EZDJ/YyuSb/8YyT/R776j9/0pb5Nf+c+1D3K/ZvRjxlwX/mpr/jGT40XASTys28C+BLAdnmTf+Rf/4/9PX+LsR7TtjXW8sDyQO8Bb0oVt6F+qnkj9OYI1pttd5NGxguAx/5TAG++2jiw2i8/ms43V2Qfa8m1S+ujittw0qnm3t9KO9Yd1rnSlqFy3ivo5yg5f2dbyrZh0Lle8keelWvo2bg59x2dtiU9mp+8MB+lw7Ql6W3on2u3zuqneo3xQX92rUE+SxiyT46bc6ZNYWuuoa53qK1y0AP6DnXpROhatyE719yfSrOPVQaf+yud+9/RxIqx1rUrS72ML5NXZNKiyW9NqjuePp28jlH1kpcG92qdx37ONeMds+opt5+YeqnT0enTGe1edEifTo6MWKhofCR2MVVlGaNB11iWHyqnAk8R33Jv/+1k2f4o9CwxnMkzyczk06TUJBU0cfUlQH0B0H0LgKQ4PynPT9D9VD0/aYeuybhJekWSfGSzZF957Zd8navaoo2gtud6/OS/S/4f69N/9mi2f1X+KEFUBuFM8T8J8Ak+LwRI8sG/b/u7/yhf5ye5508JOO+ph87d1/2fJfaL2YtdHvioPJCHTBrMug3+8J8BcPC7mzQHnZcA3Phph+/0lDGONW/E0BduvGm7NJsKvcpbD+iLRH0lbkP1VKu/5d2LirYnOtYdOkfF0fzOPqHzHMV5Eqt92zDkXHN90jVWr+UZR386pphz39HVvrR9qLzjS2RPXdKGat82Jj9X15VY/eU1QPT60CHXlL3a9WFc5KBzpz1hb13LaDr71zUjW6X3QPWRfCJ0V7chf6fmPlXaM9Sh+wwaV0lnTNhujMgn2tbF11482mYyDB6t9FU3aWWJtidC71X6p343njrqqdONq27VUd71wZ/KO98q6/Yr9+cIbUygK12xxph8F5sh6+I5ZUP1XqHtWUtNCGd8Jv7S3QuAa78FcOklgEm0mAl2Jt81MYfPxP0hdDd2zg2ddmkr+JDk/6k//WevnzjYNhJ8knqQ89XNx1nirPNSoGtfsuWB5YGn8YA3nLwpJb2NaacvALoHJ2/MFbnZ8xKAg25b0sq6G/almzE23tW0vaOH2kf94I5PKInVT9toP1UfchLrXlQ+dZN2zDusc8qP5lPRPvmnROdK1B5xGwaca64LuvrgIXwdGz7nvqO1q+JoPhXkT1kcP7Hakvw2jDnXusbqr+4a4PUh0QThKGZfrkVUZHV+7Qubcy3So3mVGzyA/7LIJ+pjcRsdoMFTdY+OYN3f5LtYQ0ZcJM70lGdsQc9i0iT4MZA5cpzKZ1tHVxurjuOJtEt3iMyautK1TR6sOrZVvyZ/aX/Q3dMhDmjPeOhoYgz5LNaMyQkawx2OLud7MXQt9HnSMkv4Z3KTf/HalwB+CwCsfwrAj+H5CXkmztCZVGeyXRNx+C5h5wXAtS8FunGQ1TnTnrSzrsG1+aN/t/63f7xkSb+7FyJ7Bz3bw5Q/aXCtwZcHlgdepAfqjUW+3qS2Yf2DXwBwM+dmzJ8B+KcAysS8sUv7cNXdpOvNGDuj1nXk+obaR1dcfy688xGyzVp97INQ95CUsq6fY95hN/doOj0MdbbS9pTFOTu7tjHxuda15bofQuvbOj58zj/ozsYhPsuhKa7pLfd0/zpPYrVxG9Ofal1f9VmeeWivBYkmBzOcJRPIP/OZz3zHD/3Ij/woyJg5n7akjdo9sK4p1zuaV7nCA9V3nW872TbmuFdzr/Zo9zYx976jjbmuLWXqgbOYRG5cJkJbuTdCe5+Utv0xsLNDmx1fHXlReUXbRdvhoeX3UL1E/Zn+7ejcC2h0Emt75YkJZBkble5ii1hUXuPyju9iuMb+UD0V5TBJv219on8zGbxEm1SaaIKZiPpnAN23APhzgPqnANe8BMjEGjqTbuialJuoz5L4a+V1fPhqQ9r4WMk/fvPPKtK/6ffcD/fo0l7a/kRhtYZdHlgeeAUe8AaFqdKJ25Cfb3Lc7OqNMW+m9ebMzRxZ3tTrnwKkTu2fY3c3aG++Irbe1VxDRw+157vJMtkLKfiCklj9s432U9WvYt37Pd4+omPeYZ1TfjQ/a0k/MLF2JG5DfqquRezWb5xewq6v4yY6d2DalvRQubev8E9ZmJuSmPZIb0PnVHNd0NUH9bzX60FeR5I28ZghCdV3/t7v/Pd+9vOf/7mf+qmf/ot+8u/4zqs9aae2D3Q94hCd1w69yr4H8FtXlCfq4w63Mci55l7NaPa1izf32/0XiQtpsZPRZgwlZmxCz+Iy5TX5l0dHWrTf0bHVr5j9k1ZPmYj8Et21K0uEzurYKYNOvyat792fxNSDzrZKEwPKjIcZzuIr43FCd3Gc8T66nYoyeVCZmG0Ppk0Er8GacGYymkmqiWv9LQBeBPhNAL8FkH8KkN8E4FPzTKYzyT7yIsDE/dqE3xcI9k/cS/yxKe31U3+w++SfdesLX5A8x1f/3e9bAohzwNm8pe/qszywPPAyPJA3FGkw6zb4m18AcPOtN3Ru9L4EqG31xi3vDRqsN+e8KWNr1FxHrm+onG+qlYb/GEr1jfw2Fn+q6Vfo6vcjfB3Dse/QOcUhPseeNPhcRTsStzH5qda15PqNy4zTSqd+pfVvzsG88M5/h2lb0qP5XkzDP1Vh3izagUxa3IbsVHNtrjf9kP7y3CfWawW8icoMuc587/f+wT/2V//qX/n5N6N0yT9zOHfao73aP9A1JQ7xs/mduT6Egv8o4lvui7zy9HOlt9HpXN2rGbKvl2LOGBCNC1F5xYxR6YxVE9tZjConuc+KXF6d94muSRu689fJUt8xRNqkO9SfM6x7Aa+udKezJyNWaM9rQaW7OMt4bOgav/JD9VyQWZJWlnipPXV3aRPBo+gnzPkSIF8AQPsSwBcA3Q8CPuVLgO4bAZnAQ5vgV6x6ydfEH76+kHiK5B//6dPq69yH3Juj+7kbHPNGn03mGqtleWB54MV5oN444JVJi9toO9W84eXNsN5IvfmK3NSh682dBxsezqtcffsn5lxpA3TaB63dA11LxdF0Xjc0BZ0Pubi+xOqXbTjg3gsf/Fn9fZTf2RfmqXNr12h6tpI2MGny0Js111LXn7EpjQ60qDxldZycA9q5A6t98BTl0ifhE/+TczuvdoCbta4r151+gc4z3107uEaYVMyQawtf8zfxJ/mn8LX/vOY4V9qgbdrsGgbm2lz7EK9yowf0YYcpg651G7J7NfdLOtF9Tcx9n9HESNdm7HSYMWaSO4vVTPJnNH1pm41xrfzIGWJM9cSUJZ3tKU8anay22TfbpPEtdPWx+4EcOrHS2dd+lzBjpKMzrpKuMXnHE7vEao1heIpY6SM8Og8qRxPF1MtE0wQ0E1OTVfCpXgKQaNfku/tGwJGXAZnkV7pL+i8l/tj2WJ/8Z/KPP9PP+l7MPTpKPyh4VuflgeWBV+kBbzqJ0Fm3wZ9q3uTyhpg30rzRSnsj75CH9NlLgO6m743dOdMO6LRRu+8w1yQ9ms43XmQfU6k+kAc3avoSuvoann3osOrmWI5/hzlvpYfKeX+gn7IwN6XasA3ZqeYa6vqMx2uxjgOf80A7/x1W+yo/1O4V13VP+EiMYydWe7Yx16nmunLd1WdeN8R63SBp2Kuf/vSnfyuJ/xe+8IXTJ/5v0/63//L1/3q9cZ68tmifNruGgXV98qPp2WKVuV57MWb21lF9K5+4jQHuVc+Me5fovlbM61iNxyN8xhB0xuxerNJmUm/i3/HKUv/SuE/Rzrpy3Mpnm7Q6ovKKtGdNP1b/yrs38NCJ6nRovw6JDeSJNV7kM7aMuxqPwWfcVnqotdcP9CxJK3sUPJooVj2TzsRMTruXAP4pwKXfAzj65wCzlwCzFwFdMk/C38mrzDHrS4f8xF/6muSfr//71f/0jy9O0o/p3/Q7NPsj1r3a4x8liNYgywPLA6/CA3kjkQa7ug35bjKYN9F6s/WGjly6Ig/sPOBUuXwdEz7n9GYs5k0Z26N261M21E4F/kMuri9RH4jbcMC9Pde3og9I8Ht7oT442RfnTMT/8M9ZnC/tgN6oaTt0rivXfy2t/3K8Opc23GG1L+0eKqeiTP6xMcfv7FG2jYlPNdeUa63+qmfda4BYk4bk6yf+f+2v/4031Czf9V2//w/Rx/FE59UebUy779bi2sQhXuUBHsCPlA5Tpr873O76g6ea+5Y0+wrv/oq579KJ9Z5DmzJjRzSmEjNOK21ynwidPH3k7V955U+NrIs5xEvzpZ4+yf7KZqhfK+b+JF31Znz2mdEZH9KJGVtJG4cNdvFrnA/18zOYNEipOm+lj/TvXnJ4pC0T0UxQoTN5NaHNJNfE17+BB4/8JgAJtsl2Yk3Ok68J/VE+x6h0zg2diT/0pb/5vzX5x7fp91sSf/f2kcJoDbM8sDzwwj3Q3UhmN6VtrOVU8+aWN0DovHl2N9vZjT0fAngJID/Tr2PnvNWmtNc13GG31tF07wYL/zGUzhfbWPippg+rf+u+515I1z45nnMM7GwY4vN+0P7UxTk6W7Yx+b0XALku15qYcYocPtsrneNBT/yEHZ19aftQOfsN+qlLN3fauA0DDvsu/dZdA7g+dNXEn0/8Sfj5lJ9vAJDsU/mbfypf/c/+OYdzuzfuyWQvco3VB0/t8w95fH2Za6y+nvHb6HSuuW9Ju68V3fdr0HNt7IAZU9IZc5U2iU+8lmbM7FPn2OPtlzqdLNuhWVtibb/E1/76KlF/pn9nNPtGmzjTS/k1e13jBT7jKumMwwlNDBOrGcuDvXftpo0ivuXe/fdS+7s9GomJ4LVo0lkT0cd+CbD3bYBbXgSYxPMCQPoarEn/NYl//uDfS0j+2fMmJJZoeWB54APxQHeTUAZWWtk22u49wHOjy5thvYnmDRY6b+jSPjjIgzzE+4Ce8krX8XP+tKveoFnHXXVtMxxqZ39Af0il7jNrq37Yhuzenle/wqffO7rrs/OQVG3QTux7rtLZsI3JTzVtz7Xl2jM2kScPrSz7QOd40DmX899hZ6OyoXKvPJUP67jy2iFuw5rdOEo/pK/qme+SCZMUrhk/97Of/3mS/h/78R//8/zKP9cS2mut4+Q8zq9NuSfuB+u5q64xcTStcoUH8F2W5KX1L3rSM9yGzqm6Xx3mvkq757eisQNmTEHXmEveGEYmXWNWXp3kUyYNWh1TPnVqW+WzzyX60jrpr45YZchnNf2bNPsFXzF19ujsd2nviRV0jJnELs6UGZOBxi+xKi0O0TvPHrRRZvi29YH/Xpv4p/6RlwDdtwD4NkD3TYD8YcBrvg0wexFAcn5Nct/pOsaRxP/aT/1Zb/rBb0mA6bd8qVJfuOQe5N4cpR8YPqv78sDywCvwQN5EKg2fdRv8qXozE/PmV2+c9YY7u6nng4APA3wLgLrXh7Y6R9qQtmmv6HoG5jqlh/h8k02a9g+1uHZxGws9VX0Gpk+h09+XaPeKfjkmtHMNdH5xiM4yafCpCvNSnF/chmyaxObaXWeH6FV59oVOH6efmD+qdlUcKufYpa2WTlZ1ruEdLxE66zb4q31Xz/4s+SBh4VpB0s+n/NDILtU6nvO5P7kv7on7wXruaq5ziM6+h17lOg8YQ/aSF5Gnvyu9jfZ71f0S89rjnoKeu9zza2hjJtF4qljjrvIm4ImV3uMZL9tzfOUpk65t8qJ6FVnfJdmejm3VT8njV/n0MXu0x2fbjJ6NMdv/jJtKG2cdEpvIa4wOvsbxjB+qp0L7XrnUvtf3S44mint6NSnNhBU6k9lMcjP59c8B9l4CXPo2wN6LABN4kvxM6jPpT7n6FZmjq7Ov+88+9b8l+ceX6eu9PTnathscz9f4Cc77l/3G//O/c3dmnm/mNdPywAfmAW8Ie0hbV7chP9V6U6s3v7xh1putN+9EHhrgfXhIGpmf4GWfjq5zpR1pY9rvmu6wW3fKhtoHWVgjJdcqvQ35qabf0p/Q6euOZr/4FJa9JDFjrxwjx3Wugc6fOMTPUpiTkgi9WdNm15F+yFgkhpOvNP5CVv2W4+Z82nCH6Z+kR/OpuAaYpN+2Pv6/aUPS25jqSZJ/EhMq8XVN0t8lNHldyX1yb9wT94M13dVcq34Wh8oqN3ig859+ZjjblYnbaLtX3a9E9zLRfb4FPcMZN9AZU9De52ZoXBrX6EnvYepVOudyfHU6TFn2PULXNcqLjpF8RyPravVv8uxb8tfS9u9wFhPED20ZRxlnM7rG6B1vDCeOpnOsz2j0a9ud6AzqnAV7xNFEcabnJ9C0Z3L6XC8BSLy7hNyXAWJN5I/y9p/NkYk/NAl/Vr7JYM2XHPnyI1+K5MuS6sP0r34XZ/tzSb4XG8/dxnWAc7Qz7zbarorvnbFW0/LAR+MBD00idNZt8Odab2h54/Nm6M2y3oC7GzoyHgpEHxBEHlj4P7tBdbpx6lzw2rF3g861DTrXLT3E54sLMor4lnu9/+Y6pEHrNuhTzX3PPU8fS7M/7Bdfx+Zvr/0qNrKDe+H84jDj7HNkz1GcW9zGpKeqL2Z+yFg0blM2o/XfQR9hi7YlDvFZLg1a0LUkrewWdJxEaOpmvcZv9Yx7PRDxKzQ4+4o/bXvV/o4J5rzuk/vifrsO1zXQtSYO8akgW+V2D+g/fctI0jPchs6puleJ7qPo/t6CxIj9jJfEjCfpjLeONrZp62hj2nb5RNs6RDarOZ9967izvilnrfCibclXGr6r+LPK08cPpdm/bgzlub/SicaRSKxBZ8xV2vgsOIvnlI8u5/iXPoLoHC6XEsQj7TUxla8JbCa3mfRmMpxJsomzmIk1dE2+914GmMCT+JvUJ61MvT3s5q22abOY68r1ph/SP9V3+lRkX6CP7M+ezuFAeQGKnC2uUZzJF2DOMmF54EV5gJsHZQ/zBlPpbfQ91XoT84Yn5k0Rut5UuYkjy5u5DwYzRJdEkpcAqZNjJJ1zpj3aKOZaXN8d1vVXvw21c7HtLHiFhGvo1r2N9Zxq+ksfgu4zF2AT/s997nM/w99g8/+ts28kaOhlP+kc17kGdrZo52h+0uLcTCINbtS01zXoB31hDBKXrB1MmXTFjNf0V86pHXeY9iU9ms/nPWl0LEkruwbt3yEy6zboq/2WZzrPvTTxds2n/pnEJO14Ys7r/rgv7rf7wbruqmsVh/ie/+FXeZgH8C0lUX9X3IbeubpfoHuY6P4m5plOOTRxIRojFY0j5NKgcXYJiVF1Ml6voelfx3FMcdauPFHavkfQNYv2Sb7S8F3Vl9XX1/Du2wwZy7Y6LvJZzXiCzliTzjiUzji9o2ssZ7wPlXfiH5lFXfmbcS85vKXNBFWsiWwmuZn8ZlKcyTK0SbRYk+3Zy4AjLwT2Ev1sO5L0Y4c2inUtuc5cf/ql+kxfJt6yN12fmwPn8TseimnO05d942/6Vzmzj2/CGnF54MPygIcqEbrWbcjO1ZuWWG969eZYb6DdTd2bv+gDQkUSSf/LrmyrY9Y506Zqr+sAY53VB5UfquebMPSHUFgjpa51G7JT1VfpQ3zL1/pN+P0v1kA++SdBYz8eYQ+GGWefayuypyytL/QDqC9yfRl/xClfS88YpV0+daVzLMfPOceCt6jVxuTxjTy0BVkWeZG2pFP3Ek2/WrchO78AcE1grtX1p3/wU551aJKQS5W4UydpZaLj5RzuDahN2qnt7gfrilrXPZpu9iN9V3nrgYxF6cTqd/jN6l4luo81Bivvvu+hMVIx40iaOIPOeEuauJSXFpEbt5cwdSstD2at86Se86mfusr2MNdcaXlwVr0mJFZ/X+LZQ3WSRiYvqlfbbAdrzZiSJuagM/aSJkbhjdU77OJ5Jhtd7l1vk5fuEBmFcdvSJYW3ykhQ6ZuJKnRNaDPZhc5EOBPkmjybVIvXvAgwgSep98WAWGXqzrCbV5vEanuuK9dbfVF9VX15697M+rVB8X6FxqrYWfMJzmXXsGTLAx+zBzw0HSLr6jbkp5o3LWlvcol5U8ybqHS9wfPQ4APA3gMEbTzI+193ZZ86JrzziWlX2utaRNd7h51PRtO9m6b+RP7airYn1jVvY1Gnqo/SfzwI8il//r/qvAzoEn/3IPs7puhcA6sd2jianrw4NxNJgxtVW0HX4tpAYw7ED3wrYhajR2M159SOO0z7kh7N5zhVnrJKw99SGJtS55DfRtupugZ9Buq39Fn6Kq8JmYR0tLLETP6TTp2cAzrn1y7t1HbXArq+ga45cYhPBdkqD/OAPkz/zuhtTHWuuV/uYaL7exSJC3SNjxlmLEHXWLvEE6foZLxeQ2dfaeesY9uuvOrZnqhOh7P1KhfpCy0vXREfI0tfVz7bjtC539fqZ1/pjCnpjL0ZnbE66FlMz+Sjy6nQThHfcv2/F3VmieGtchJW+tbEtSa2NfHNpDiT5ZpIm2Andgm5slkSf1TOOOg6XsW0Q7ranOvJdVYfVB9VH6Zvb92f2q8Pm2eX7sXpXtuzG7omXB54aR6oB0Q+Ebqr25Cfa71xeXNL9CYodjfUelOH9wGge4hIGbp82sxXy/1U1fZu3Dq/doFpd64t1zzozi/pu6FyLsrPgldK1DVvYx2nmn7Sfzws8l+u8QIAJNnF7+nrpO0n5pjOM7DaoG+VD5VnKc4HblZtdg2ga6wxhz+IWeRdjCqr/Rwv53BeUFvuMO2s9FA5PxDSRlFHeg+zDdriWJV3bHEbCodfmugPkfNtwuNZl9/DTPaTnvVxbNH53Ze9/WB9d9U1i0N89n2l4Ve5zQP4l6KfO9xG+7nm2YHOc+XeHkViAt2MDekOjaVE42yGxGltm8XuUTnjqSvdzdG1pT1J1/6XeHxQdZSlfy7R+Bmdzt9HZbmHR/qkfhcrGVMdXWOw8hGvXTzPZKPb+RxI7yFth0pNCB+Dz0Q1k9ia4NYEOJPjTJqha1Jtsl2xJugz3qS+IvrKZn3rnPLVxrqGXF9de/VN+k1/sjdJP8ZeGSScjS/5Uz/2p/h6vbKFywPLA6/HA9w8LNKzGwryLWu9UXU3t+6GWG+q3U2dhwHk9aFgj+fPAPiUmQeR7NuNnzakjXUNucZc+6BnfhpN54d7fYrstRVtd53YLw1u1vSR/sOn7Adf92fP0seVpg8y+4I5pvMMzPmTHk3ngvypinMyvvQ26FPV5lyHa814g8Y3R14AELvZ1/FyDucFtSVQO2c4VN+JV3Vpo8BfKlVHPhHaug36/AIg1+Mac915hjNZ8XqgrEMT/YrqKpcHGVd0jrQhbdNe1+B+sL6orrviUDkX2ijiW279u+cBfaVf0ZWe4TZ0TtW9Et1DkH0V3eNrMGMkac90xpMxdhSNzYzZW+iM8zqmtlS582TfTlfZHuKDbJfXN7RJ34L4nX6JuRczmn2etXVy44K2jjaOMr6SNv5maLwOnMX0Jfnoeu4rDVLoSxErfWr0n8dIIrsxTFTBrDXRhc9kOJNk6JpE1yQb3gS8w1kSf428G1dZZ0+1ua4p19v5I/2VdOfnh8qMg4Fv/yu+53sBkPGJGclLi2HmIpcHlgdmHvDAgJVWJm5D51S7G1Xe0LgJetPzhgh2N8/ZjT0fDI7S/Kq8SSfj2q/OUe1IG3MddZ2uf6A+6XA0n30JTUHvtZW0ua5zG4s51fRR+i4fhtK/lc4+0jmm8wysNgzR2a9pK/KnLGnHNiY6J7LY7RpcZ8aacej/fiA/Q/rSlmM4rvOkr6CxJ2raWumh9o5P1ck26Q6RXSqOKW6jw67PWKNr1jecZZMRz7Uy5SYnl9CkX+z0HTvn0hZtA/f2g3XeVdeeOJru+R/egh5lhm9b17/VA52/9Pk2lKHBc83z45kS3ds9NAY6zDhJ2jiqmLF2lO5i9xqZcT7rox3Zbp8O1T+K+CB1k6/+ucTj49SRT8x9eAzaa5UxwpjSicQUvLHVYcai13IxY3bQxvQlHKq71xD6X1UemkDu9Sd5pT2TWOgu6c2kGLomzTWp7hLvSy8DTNpJ/i/Rtnc4m7vaWNdQ19j5ofpqz7+P0XZVsCzl5YHlgRfngXrRl9+7mWxjFedab1TdzSxvftDdzZabNfK8aUPzQCDmw4E0DyPSiTzQ86cA9X8GQKfOUe1Je3M9da3hh85fo/l8w600/Gsr3RqRbdb0T/pNOv1aaXUSczznuMPOltH0bKWbfxuzn5PZXIdrNc6MP2KXGOUbAMqM9eSTdgzQcXOuHZ9hX2d3lQ21c9zaVmXwtaCbRT7R8cRtdDj7DNtdi2tzvfrF85tnXdprQSYo0ib4YFbas039is4hdnuiza4BnOyH66+I/zoZcgpttXSyqvOx8PoiEXpWt9F2qrlPGYfuZe5tRytL9IwawxUzhqSNr6NInKKbWGP3Gr6OVXnnSTm0NduVXYOe80R981hY9+FaHjtqH/YdWaKxoFxeNLYqGn81JuGN1wZnMZ7y0e18FqAptGdJfkaf9B8jidwbg4SW9prYdskvspok1yS6JtmzZNyXAWKXyB+R2X9vnmpTtbmuCb5bf/VR+m7Pxw9py6B5YjrjsE6VbUlXvcUvDywP7HjAw5MInXUb/Kl2N6d6I4P3ZpdYb57y3Q2ehwfkRx4i6sMHiRW/Nu+PrDlGN4821Jt1XVOuW1/cYfpJejTdu8Eif81F+12fuI1F3Uvk8FP6jv2Xz1hQ1uGVvk7bntLHzsMcrh/cqNqc63G9xpgPkPxOBfHpCwDjs+JevDp2zqcNoHYFps3X0GOIcyzbL2XQFNpqUWY/cRuKF33Wrb/6aC/JMcFHp6OVVaxj1jm1y33Na4f7sbMX+qBD/Iecku3yiZWGX+WtBzofpj+hN2ruk7R7mOh520PjIOOio40fkfiCrnFW+Xqfk6/xajwjT7rqyTMPdEXbEzudtNNxUnYLrW8eG7v9eCwZscFYiXvxkvFVaWOxonEbWOM6+aHWXkfQscxo29/BhySPR/tmIluT3C4RrglzTajha9INv5ek1zaSf2VJK9vDbm5knZ11Ld16q0/0F/5N+qi/r9F7JyBejiBj+eVYtSxZHnhBHvCQiJgmDda6Ddm51htSvXHBdze97iY7u7nzwHDLA5EPGjyE8BVrfoX+0o8CVrvS9lxbXXf6ZNDVZ/Kj6ezbSsO/1IL9lETXlLgNnVNN/6TfpPGrNCgv2pbjQDv+wJxXeojPNkJTaHuq4ryJ95II12EcZXwZ7/z9Pz+O2L0AMO4TpY1lHzIv+a74bxtOSbtvofGr/aTBLLRTEu0DbtTc5+oz1qXf9Jk+8IyDJhuZoFSaBMgkSFpEN9tqX/icx7nTJu10v10LmGt03XeY/tijh/o7/kY/i7yYbR8T7fo7RGbdBn2v5j7l/s1o93oPjYuKGTtJG1vXYhezt8iM89q3k2ujuuoonyH6na5nOzF9c5TG11W3yuTrviSf15+UV1o9Mdv3YiPbZjGWMVnpEr/ENfFsfHc4mu9dj+XR3Stt+zXJ4mPodslulxQjq8lzl2DPXgaYpO8l8te0OV7FmU3VdvhunZ0/8PNTJ/7u5V7APFNbxmXSs+mP6Mz6LvnywAftAQ8H2NVtyE+13oi6m1fe3JLOm6M0N2voetOG9yEiaWU+SMh3DxU82PPr8/z3gOg7TjeX9ohpd64x169P7rDz22h656aL7DWWWYxsYzGnmr5Jn1Ua31YZPP1Fx3LsO+x8rF1D5exr6Kcsacc2JtpNZo0p445Y5TcqZi8AMqal6cvLAqrjgcZp+lPfJWJjqbmGW+gx3D1/uw+i7d3Y22g8+yxtdz25Rv0G6g/QawBYayb1le54ZCmv4zmX86dN2qrtNb5zH6BZe9TOP5dko/u96zS8Jf2v7GPFPT9uwynnWvcIPuMyafc397vSxkSHGTvSGVfSlzBjssarsVzlR3jmdeyqr03KU7fS6u7JUydp/fIU2O1JlbGfyMTaPuPVF9WDn1Vii7aMMeguJpVl7A56L85r21A/X7fzWiFdEf13iongU6MJbSJ01i5B7hJpZLPEuyboHU/ir3xG297hbO7O1m5NyHLd0s+Z+Lvf7wTE4wiMvYeO9ljjPNSO1X954MV6wEMCVloZuGX1BiTWm1Z3k/MmWHHv5s7DAO35UNDR+aDStZMwkWj5o4DqdHOnfbmOukbXDqZvBp1+kx7is38rDf/SC+ugJLo2cRvt54RO/1S/HeHtKzJuVOdLHM1n26CfqjAnJeeG3qjam2s0howrY46Y5e//fQFgTM6QfvThf7fgGwCOBzoHmHNrT6K2Nug66to6fnQ/+6CjO1mOsw2FU9U27c61uEZ9Blb/mIRUNPlJhJ5V+qduHQ+euUXt0DZtvWY/9EFg+miPHl3O8Y4epWLKTgof2T/6L/2gLHEbCqdqLILG4x4aq+hIixkPSRsvFY2nI1hj0Fg1PuVnaJzP2nMc6cRKdzyyWXXeWTtyz3pipasPk8fnyUtXuXzu0WPSxAPjGRd7aBx1MZexmbSxe4cZ1x091N65biOjoH9VMRF8TiThNdk1+RVnCTPyLsGeJePKuwT+WpljzbCzC9lsLa41UX885z4w11XBcrtyF5cpS5pZKn/7zKvn8sAH6oHZIVEOZt0Gf6p585k9KHU3ue6myk0ZuTfnxO4hYO+BobbxkKEMmj8FINmqPwqYc0JXO3MteWNOP+ibO0y/JT2a37k40f6aivbmuqS3sZBzEqx/0mdHaPslMm5U5xNH0z2/In/K4vjOD95bt+s0doypjDX//p+Y5E8BiFVjVjR+Qfqix0sDeccFncu5xfRj0th8oOYaL9FjuHvXjMpn/200HvIZa0u/pU/0E2jN5GaW7F8jd9zEtCFtu2U/8ENT01eX6NH9HP/oUsSkO9lJ+QP7J9fp0pDN6jbaTjXPh7TnKJGzBu+Z28OMCemMGc8ysoyrjiYGkYsdnXFa6Twbtc0xU+742aasw5TNaMeivavpB2n9hb70EcxrR6VzL6RF9hNaVH4N2jex0vC1ZpwlbTxWNHYDZ3Ge8qF+vkYgzyIvZts9+rkTTucj+YXOJDjpWfI8exFgEj5L0h9T7lwd7tmd60taP+ib58R7wfD+mYvx+v5NXBYsD7wsD3howL26jfZ7D+zeiPIm1T0U7d00L93EuweElOXDhLSYetAkXPwpAAlX/s11Z0PavHeD1gcg/om658uhdr75Qr+WkrGCzXWN25CdavpFusZJ5dWr6Jh3WOeUH83P4tP0gXNv2JZ2uzZjx3jKWPPv/4lHX0oZuxWJXx7eiV9eZOU4ju1coPMnpn1JY/vB6nofiqf50oa003W4rlxrnml8NKvXJPgzXcY2YRKdL+2AThu123V0+5Frh97xP77GX0d9PlTvnQP67ZVL7Xt9X0ObfsNW6Q630d6e4YzNpHN/O9o4SMw4qbRxVGNrxhOLtCUan4+JOcdD6VyLdqdMeuablKObfNL4PHlp9wJenUTbK7K/VbbHV335Lk5SRnzBZ5xJc52ArteO5vrRxXfKPAughfa90rY/Z7JZ5yIJVpYJcdJ7CfWllwEm6A9N/h1nD/fszPVU2vW/L9wLmANtNaY+QXxzrg70RaX2r92yPemqt/jlgY/KA/UwyCdCW7dBn2q9+XhzEvNmlnR3s/Sm3KE390QfDo5i94Bh0vWFL3zh3o8CVhuqvbkW1yqmT/TTQH1XcTSdL1y0UcS33Mv/t64p+W2Yf6r6BT9Jg/qtYuok7Xh3mHNJj6Z3fEjbUxXnFbcx0Tl5cF0ZM8aTcUYM81V+kn9KvgDoHt7RN3Z9eeVYoOPnnNqRmH7do1nPTnXdt+B5XOdP+7Tf9YCuszv3na9M6GmTfih28yBLm7QzbXc9YK7TtVfc8Tl+u+TvoXI+B+oio8BTKqbspPAB/eNaXaM8mHUb/KnW/ZDPvUs697fSGQfSnlVjRSSOoDOeKm28ibRLg5VWdis6fh13zy7n6vpWWR2n4/VJ9ZP8JfT6IaLvXihLXpq9lD6Ksz7KO0TW1YyxShuTicbvHWZsz+iheu8MwFPQtySt7B6+r8Qz5yUphq/JcfJ7CbYvAsS9RP0x2pznkk1pf9KuVR/QJv3ceC8YHof5BOfhyqEyTpPeG+ao3t4Yq2154FV7IA+BNFjrNmTnBMcbT70xdTey7ubpTZs26UQeBOATu4cDZfmAgky+tttm4pU/CpjzS1fbc325dv0h4quo1Zfp56H2Kkq1Ofm6vm2s6FT1RyJ+gxezraMd6w7rXMkPlVPRNvnHQMd0PsaUBu+dDWPDeDGOjCuQhJT/meJt+v/F36bwATqRuEXf3wvwfwBA7pjOATqvqD0VO3/PZKyxqemDI/R5jJxHu7QXdD2uD/Q8e47TR9BHk3z8h+4MZ+PU+dKe3Ats1f66H65VTD9IN34++220neLtDvd8PlTuxSi8hX61KDuKtf9L53Nd0LVuQ3bvHLsfonsGZqzu0RkHSde4rvFdY2vGE5O0ZWxWPtuO0nUMeVDaueUTk96bE72u6o/E9NklGl9XHf2P3HZlHeZ1qGvvxpj12YuRWVvGm7Sx2CHxG7XGd8cP9dM5ACnoWJJWJp7bnjvhnM2XSXAmyx19KfHOBP05E37t6mxWxvqhZ354brkBsXB5YHng9XrACzpY6zZkp5o3HW9IYncT626aefOtN2h5HgiguweDa2T5gJL9PvOZz3wH3wAg+eLr1M7n/GK1v67RtYPpG/11h9WflR9q5xsvba+haGddC/yWNf1Saf0m1vYc546u8w3xe/Fd2rFhm7ZnTBgvxpFxBRKDf+2v/403VAo/Trn3oMw3BNDzpZXxnGM6D+jciWlb0tp+CVnnTk2fJE0fePBUc560Q1tzHa7P9YrVVyTtyGbJu/JZ0l/l6os5dp1bm0DtzTW4LjHXDJ3+qLQ+azB9XOmh/s65QIciJp2ylENTZu0pT/ptr5f1r/YlQlO3WnMf6n7VfZSvmDFAXMgbI4nGTqJxRbxJi1UmX2PzWp7xs0/yde6cUz0xx5DONsdSlrw0/pEG019H6D1/2/bUaEwwD3RF2zuscSefsQlN7IoRx8Z2h0PtfKZpp4hvufv/TtueO+G8NJ/JcSJ0V0243zd2tlWZ60Yu/RLwfpg8KTeLwSqv/JMatQZ/OR5w42/Fl7OSp7dkz0e0Zd0Gf6p54/FmJNYbWHdj3btpe4NPzJv/jN57CLGPOvKg//0aSRXJ1cy2uo5cp2sX0z/67A7Tn0mP5vbGi85LLNqVmOuR3obxp5o+uZZ2jDt07A6HyrnQ/pjF8bp5kW1U12YsGCfGT8YX8cfX+IlBKp/s8yLKB+WK+cIK/Yxj6Bzb+UTtSNTGS+iaOnTdDaafTr5JnTqWNqR92u666nqrf0jSkZmsVyS5t9ImfRTrePDaUG3TZtB1gLk+aNedWH0jn/4rdPp6Ro8u5+t50uhnyf7IO1557bfHZ9tLoHNdld6GgeezrP9zj+o+XuIzBjI2pD2/NY5mPHFnmzEoIpdWL/lr6Bwr6b0xUk9avNQPva7iJ+SJ+m6G+HyvzT1BR11liext8h3tGLbZx7hArkzatkuYcZe0cZlI3JZaY7vjR5dToc2StLIpvoQkdM8GE+aaUHf8tS8C+HaAfZJWdgk7G1LGuuAT99b6PtqmgfH8DTVuK//8Fn1EM+rsS4hL1HmoexxHfOzxHLfiQ+d5af1zfdC1bkN276Eob0bQ9UbmzTBxdkNOefcAMJPxQFHbqiz5pOnHQ7xfqeYlQPd31dqW66g38eqLnZty9as88SANvpairWm79DYWca7pk0s0/dDJ/ne0Y1cczWf/QT9mYS6LdM6/jcbz2chY8EwYO8aSMZtJJIkof99PjNaKHp/6E6MUXgY4hujYonOK2lIx7d2jZ3vG2q+pdZycU9u0GXQ9rhOs/pHHT13Ft8hrso8f8Tkv/3ipwgsY/jQIX1O5NtRKO3r0YzznBtNG7QZzPa5RzPVLVx8lP/F1xuOMHl3P913jWFn2QUZR5yhmn9MAL/yfXDP0Nqp4Ps/63r0R3b89ZN9pz/3PuKg08YMs4+gausZi8kdp5jOW7aMs5Z2s01eWfZU5RiJ0V6uvjvJ5Den62J57VOncw6SP6GV8oG//lF+ijbmKxqZ4F8PEcdYa58kP1fN9Ezml4lvpzr/vI+m8NGdNmpOHPlIvJe/Xth+ZUx3WB31pnS+hfSc0rm0y9q7td1T/qcc/aser1EvnSVc8sjD7qFv5Tq5ORXVB2h5aHQe0OKc8qEzMtpdOa/Me0mbdBn2q3mjAejOqN7F6c+xuvsryho8s+SN0PlygX/mU1fH8UTUSq/xRQG0T63rqetMf6Sdo/XeH+rXiaH4nrtB5KUVbOqxrkd+G8eda/TLjs0/QjllxqJz9Vmn4WwpzUBIrrR3b0DsnDMZBxoexYyxlDPowDJKkJi+NnKSTGOU3A1Ivx3J80Xkrpm2Vxn5krqPibM+aOD/5Bd9Ya98cO+3QXtcB5jr1i4g/ZtWk32SfRJ8knsQeX/rnF/j22kJ/Xh64H2lj2u56xFzrzNfVV8nrz4LG4yUc3c7X9ozpmTzHS52kHQcZpfJvpS/jX9ejnfLiNhpONX0+i9W6l5V3z8GMiUpn7ByliX90RWnPxWOiY1d0DuXyR9F+YFfxE/LOX1V2De9+5P5cot3bS3q2p770tZhxV+mMT2jjNtCY7nConc8p7TeXl5CEXmuDybUJ90tA1pB25ZqUp+yl0DcHzsM61pi9xD9sttX75IF0ctI0yl9CXale17fT6WSMYe3GcY5bsI5bx6j21PbKq/9S0fVW3IbBp5o3nLwZ1ZuaN8DE2c3Zm3t38z8i40EDPdE+yc9odHl4z09XSQyQdfbmeqBz3ekP6PRVc3OuPk6e+IC3SFe0/X2idmODdMVttJ2rvuj8Y1vqB13HTX6o3fMZ/GMV5qHkfNLbkJ+Tf+w3DoyNjBljKmOU2KzVhFKk3b//J4Gt+o4nOo+YNiStjXvoeirW/ZPHH7XalljH04a0T/tdF1jXDo+faiXxJ+nHbyb8D0n2914O8HKG+dNOaO0Hc13Qrles/pBPnyVdfXzHG5cdDpVzDEuLqd/J9trRp1QdZYnQL6WkvUlvw8BT1d/uheieHcHc94wHaeOkwxpPe3yeC/T2+GyTzj4drayi/cVL7VUPPvtAdxV/Kdd3D0X2xjFynyrNPiNzv2t75dW3j5j9pY+gcZdobIrGbCAxTRxnbM/ooXbS6xDZbnkpiehRO2oyLQ8+Z8Ve5tPupJW9BtwNjoc1Eq9Hy0mXM8KZONpp6c09oPNFNeXBrLTXtipLHppin7fc23+rTD4xacdB9lg1x5zR2kA7pfJvpW//3WtLveegtQW0Mq904jbkbZLjDSlvYvVm6A22ojfzW7B7aPDBQmRc9SpdeRKFTA54oEen2lzXVm/s+kP05izix6jp40oPtfNeQHeFPu+r5NzSdQ3w2169u1Dv6tz178bOeYfauSg/Cw4S9kusNHzWbfDns+G+g54JY8ZYIq6sxmqiSX9F/jyFJBRM/Yxxx3WuitrSofbOMNcmbVzfgo6RvmJubUvbXRdY194l/nyrh6Q//4eFvQSeNs5/XgMu6dd2XjSkndC5BmjXJlZfp0+S3vMv8Rc1Y/MaegxxL66P9s1+0iCFMV56ma1zG4afzzX+z/2o+zbj3efEGhPGDHLpo+jZT8zzwTjJz+iZXpVf4mfj78kdE6y0MlHfwesvZaJt8jNkT2jLvdmj89qUtH2UiSlHZkUufQQz7pLurgnEbKmz+FY+1N85p1ef29eQpHY2ZsKdNLryidC31tmY2uU88q8JCaIXULYv+8bf9K9+yZ/6sT91whdg0Gs1obsAKJtdOLKdde/xta3T72S1H/z7qtU+7ajy5CsN/9xFH+a8ylxD4jYUTzVvOHkjypuYN73E2Q2YhwI/pSMBJ7HhITr/FpeHeJJxZLShg25+2ubDBTd+aB8WpLt221LXr1jzDQC+EcB8ne25NtZeb+jpG+j0G7T+DEx/V3qo3YtxeZCC/vsszl/trvw2jLy11rGSZ+3wFPEt9y6v/Ag6B7rSiduQn6r7m/venQljyZgzXo1PsCb9Jre0EffEZv27c/vnuEk7b8WM447ONSSd65TWB0fQPmKOnXZob67FtSbqI/zCmcVHNZE3uQd5KcD5zusK/XhpYIW3ej3qxs2XALTndUm7XQeY62Pd8Ll+aP3SYedf4zAw4/S56WHG+bxId4jspZTqo20Ydqrp79yPumcd797mnmcsSBMn0MbLEST+Oz3PBW3SM9zTyTZp0JrzSyfO5pzJHbdDfSOqo/9miN6sLeW5P3s0e5zt8mK2QSsHH1KJO/pn/GVcQhOvorF7hzW2O36o3juz8uCh8pqS1Uu2ZiIu/VBkTse4NP9rbD8UJI+jRPyu8kwe0Nl72F1QUoap8tIdHpGlHXVM+T3cxiS0V9zrc7RtDPvOOulrSRpZ5dV7LnT+ROhatyG790kIN5q8GeXNrd4E80bLDZkHZBIZHqp5COdv7uvDej5UdzT645e5fp4xGGvvoSIfSnxwEG2T1y4TLHhqrgG6rtGbffoh/QPd3bDxa9Tq9+SH2jlekFtmtO1Pgc4pMod0InSt25BdW+sYyY/hznNDX1sYi5Lo+MrlK25D4d65cM8zDjJWjCPjDexilzOC3MRWmrgk5m3v+ubY0swL7fwdpp2VzvVIu9aKNc47vvZxzJw3bXQdYF0zvsAvJO4k4F4vuEZwbeEag898cch5Rv/WSn/GYkxeIDC+LwZAxk17oXMt0LlOaX0gVh8l3/mUWIxKrMLXmH1Ofkx/PlfQL6XgA0pi9cs22k81fZ17AO1e7aH7m1jjAd6YSVrZHnIeaBeTVlbPzIy3b7YrS4S2pu6tdI41mwd55zf9lW17uqnnniCTrsjeIss9rjrJq1f7XJLbDhpbxpsyeTFjU9q4DTS2iWfpxCE+n4VKwx8qrzFpfSybTewrOr7yGa/8NeOhIHkZSsT+KhMP6JzESsM/pDJ1jinvmPCU5Dta2Qy3uzHAWyrj0m82/hH56H6vvzyYhbGeo8zmUd6taRuGtYmON6q8eeXNEJqbKw8GPDTzaT4P5T6kPxbyEO6DN3P5EJH0TIbc6gOMPLabYEDXWteafuhu2t6kRfxaauf/KhtdzjElDVJyH5M/NT7BP87nXNXWjt+G8pHa9a0y591D2ij0tSSdMuV1nuS30eFU3UfQh7I8ExkfGTvGF2jMiSb3idLEOAkovNV+FXOOjk57Kp12J30pvvVB+iVp2xNzzJxLm9L2ukZ8wHWF8+9LRF4Mkpib8N+a6NOP8UX9PcPcG+xMu6Fdj5hrhU4/JJ2+Sjr9Cm1MBmbMPgZNzB8ZZ6id9ZKmr3ziW+n7+VebtCfXtw3h9L7HXuQ+zejcZ/e+orGCXPoW9HzQ1xhUdgs6jn0rn3PYJtrnGqTvXk3/SIv2g7cik54h+2Nb7hX76blMuXTd75Tbr+pc4jOmpPPMS3Peoes1YHIdII4zrpMeTef7onJkFPjD5TUnr0dtz0Q+6aP9P2S9w4GyFF+sB+qBl/fC0PHZdguNM3Jc+U6WbXtzbUPxqerevHtt2r6HtD1XSf9Wuq5jG0ZNH4TqTc0bITdVHor5pOzS3+Hy8O4ndujySZqVh3s/ZVPGQz56+e0B+vMpYD5w8AAgL51YafhaWQdj8ODvg4LoWhPTH96wEw/etOseVJ44qfuG7H2VtAUbqr0dvw29WlOPtuSTHk3nNui9Qr8syUsnQnd1G/JzzX3M/c39z7gwZjK+jE2RGDPW9hJN29S1v3gkrrVDu2aYa4DO9Unn+iuNn6pM3v6ic6Ut2umaXKPXFq4BVF4ukvRnwg4t32Ft73TwtXL9XlGbEtNu6FyTtOsV9UNF/VUxYxA64/OOJo6J2S6ej8joO6tH+qNDEd9yL+vf2Tq2Yebh+17uWT0n7q/o/ovGhzGDXLpD4ky5dGLG4Z686iXP+PI5163jOVaH3VzOCVY/zfyj3lFkP9R1byqyr8hyf6XV3dNR96iO+px16Hrm5evZn5x/YngW38qHyvl8ek5F2g6VDzm5XWv7BecfKZz54lCQPI3S1bH6NGa87lHTidBZWVnyj0HXMeVneGnObXREB5zW7qKZsr2+O22XbLN9DPHOhRbZcxXsyJK8tLaK2+hwquknb0LepLxpeZPjAZnE30/lQJJ2EniSef/2Fh3/9tav5ubDdfewYDsP5fQh6c+v485eAviQsYf50JE0DwnYwtw+MIg+BIjpi2tu4Po50D04gqPb+YxKd5gy6FsLNlkqLT+zexsdZ23IL7Xn+EP9nTNV29GhKH/L7duAbtZt8Od65CwYD6CxAmZcGYsZ58SYsSYa8x2qk2PM6Dp35dPOpHMt0DXGuzjHR3mdSFr9HCfnyLnTRtfFuec6wktAzn79VkT1kwk8aEWnyqus4+vYe/5P26FzXdC55qTTL9Lpv6QzFqEzTu/ojOMjNHGOHni0Xhp3DHU+T9Lg+y7YTUl0LduQn18ApM+l3Rsxz0buZ9I1BuCNk6SVXYvEI30SPTfX4qVxbL923Jn+kbXqI7HrQ9teZT9sr3TulTT7C+0+JyoXs+0amphCP9E4q1jPvDzxWqqxfARH1/M5gLZ4NuRbnCWGS345ef4QfNQGxRK+WA94qEUM9SIhLSqf4XbXV5zpdfKcY0bTL9u6cbah8E71wlgR3Sq7xHfjF1lnVycb3aa+pu2xi/5z3OQ7+1K2jU6nmv7JG1Le5Lix80DuJ/V8KpcP6LR3N+yZTP3ZA0Mn96G+a2OeHHM2b8p5UIAH6cv4PjyAPiRUTL94Y0+/QadPpfV3YO5HRw/V843b9pRBW2h/zJLjSSdCX6rbAR3HwPZKI9sr6Fvsqywx26S30fFc3SMx9zP3u8ZCxoux1cUnySXymmQe4bvxlDGnNKgNM8Re2tLuGuu5Xun0xyXaPmL6zHmrfdjuV/65rnjWO//Y9lDsxq6y9K10tb3zp+vMtUPrk4qdT41FMeP1jiaWiWFjeg/Re0jdG3sMfb5OQVPQf1/FuWc2b8Owe88J+r/uS+Xdw0T32D1PNDa6mKkyz69oe/LS4C2VMe3X0SlT76HomInQVv0lDyKrvDL195A9sV3afRLZW+gO675f4h2n6hFXyoyxGXrOaZcGidWmzmJb+ehyPoN5HlIOfbF8CEnsWsPtLysuBsjzKxjPzz/zC55x5pR6QZDvcBvrQw4eqd0YM9kY8jS27ZVXnviODXlhfCp6GPbOvHeytK2jh9o7F11kz1mwi5LY2boNnXsPQfiz3py4ifIpHA/lfALPQ7c3aG+wiXnTrjQPEsqk9/DIgwfjqSct1rGdu6L28/DPWmlXBvrAIHpDT6x+k+9iFL+X2u1PlY0u5/PT0cgsuffKbkXHsr98IvRjVebJsfd42zr9PXu20fFc6x65d2LuszEAZozUmDImRRNLeOlb0PGOYrXL2BZzDbk26Fw3tP7Yw9onx8y50i7WQvLPt4c4f67tkn98AYCe9FHMPrN5sMM2bUrMNUjnGqFz/UlXP838W2Mz4/aOnsU58U1bIvRD6mwu5BTb33Iv499qG/xm7e55xHe3P3kmci+l697DGxcPReLOMYxBeOlLeI3upbGynfOR/Ix2ftdQ8aiv9DH9pSvW/ZDfw739pl/XPpN18bN3zcwYrOcd3lht0PN2CUfX8z0VmuK5qPSpcf2zPLA88Do94MH2osAqpGe4DZ1bK2PSdzb2rfJ37Okujsr2LrDZpv4RvFvXO3ZcWOtoPl9cWTtFfMs9/N8cT1rM+ZSBWbfBn2r6If3EzY2buQ/k9eZZb7rw3pTrzb3yjIsscfbgcFTueDlmzqs8ZdqMzPXwQEMykrK69r0HgvShdPpYWv8XzD26RI+u57hClyK+5R73X8dOhH5IxcIcr+NTlrTzKstxbKu4DeVzdS8S3TMxH/IyDowXMeOqxqwPySaTtyBj5jh1jo7HJuSJaae0awBzjbl2afwCrX+SV0fMsaBzHucGucbwctH1udYjfjLhT90qu8Rn30p3ftWnuQboXF/S1Q/w+qhi+hU6YxM64zdo4py4TjT2kbe1jl35ST/HrTjUz2e50vDPVbDLUm2E37K65vQ7e2Jc1/3p9rLGNnufsVH5bMtYSlqdlEHLSz8EmeMh/a/p63pmqI/EqofcNukO617M9ku5+wsPLSq/hLM4yXi6ljYmxYzXoI1t4llaHKLzWURmSXpPZtvC5YHlgQd6wEN3FK+Zbm/MbIPu6jbkj1G7sZWNKe7NXXn1wO1OFzxXL4QdenGlTfpa7MZNWdoSdNpd6aF2vgBDZ0H3KYvjV5uS34YBp5rr1G/c9Li55s3QG2ZidwPmxo283sA7ngcI5B1e83ChrmN143XzK9Ne10MScOQlQPonHxT0Y2L6OWn3oWDu1R49up3jDD3KJXyrtf+vY3TjdTL1wSPVMVJXWcU6tu0pT1mOmfQ2lM419wA690o69zTjHtpYMXaMpYxB4xIkpsSaZMrXRFX5EXTsnDNp7ap2wuda6jrTB9Lpn6RtF3OsnCN9xtpYd9oqTRt0t/7OV1V2ie/GVea8idoFdv7Ut3Wt8OmLpPVVoj4Va6xmHAedsQ59jvVK1/Eu8bX/4Otc8qPpfP2Bft8FuyjaB27UXLN+Tsz9kM59k3Zvuz03Hq7BWWwpz7hTBj5l9RzeOoc2p73X+CR108/Ik0+a/YF3n2bI3tLmHifO5LM4STk0Y1XZHp8xmbQx22DGdaWH+vks0pal8tm26OWB1+SBGvfPFts5kfQMr3HobIyZPMfudJB1dRvyd2peeGZ01+9O1s1zreyeTTMb9i6kD2mbzYe8Wffe2ob69AJM2y2F+bLI72Fn4zYGOdVcb/VbvRnmTTRvttLekPOGnXQ+AFT61oeLrh9z5vjJpz2VZh3IQJIHPpWUR5brTzr9JF19KZ/+lnYvGuz2biYb3R893hizlr1YQ1f7LtG2PxSdb4bbmOBc9Xmie5PoPoK519DEQtaMoy4efYA2ubyENXGd6TNXtsl3NqQMe+mHTNtzPXW96YujdB0jx3dOMO1KWvtyfTP6qL+y/9E+2KQtaR90rkOadULneqWrT+SrT4lDZMZjxip0xvO1tP3rmJf4Zp7ZeUNOEd9yz/Ovc3aIjLpRc736Waz7IZ/7JQ26v4k1HuQ7nMWSurYnQs8q/WZtyo/oqCvOzoHte+h8idDXVPyLfvr5CO0e5Z5Ju7cgssRsk65ns/LoGUcdEnedXFnGpbQxG2gsz3Covpfzx7yrLA88lweM/21MaFUGPnnpJtmT2XYJrzF8byzaat2G7F71QnMt1nHu+DrfNfwhu7xYVvTim9hduG2v/ZOf+aJZ85H1jW6ngu5jlL1xbEuEzroN/lRznbl+aH0netMUu5uvN3Rv1vId8sCAPHHvIeJSm2OlnrJE6Fq1N9dEksD/ZIAua7bN9VfUT4nVp/Dp86Tdkwnm/s3o0fV841enyuCPFsbIUnnblNc5j8gZI/Uu8c5xCbcx0L2avpbu9if3r+6xMSDWOILP+POhOZPPjjYhnWHX54gsbZHmK/fMU213TWBdd/pEenaNoL32z7HrvNVn2un64KWfC50zUbsqdutBlmtOOn2jr/SpWOPSeAVrXB/lc4yO3rs2qR9zzc7fUDmf50rDP3epdm7DgFN1TdXXR+M6z0nur/QsLjo5MYW8YsqSzhhUnrIj9DX9OHdHxjyi47ygFZ9JzzB19PEecs5oTzxy9jyDIn2kE40T44c26SNo/IHoJw9NnCozZu+wxnTyQ+X8rCcNrrI88No8UONa+5WfzkeeNc/NUETn0YqDVWSClFUavpPZr2u37Sjm+PZx3IrbUDhXLy4PwRzvjmZO5qhzH+Hpd6qdTbnRSedF+RY6x6p0Z4c2Bs7WNlTOfoC2oH9N2dO3rUNkXd2G/FRzfXXt1Zd58/SmWm/A3LyRdTdxHg6QH3lIeIiOc3TY2VVluSaSJV4CpAy6+kK++gy++lU+fZ+0e9Ngt5cz2eh+vvZUGv7awjwWaRG59FMgYx6t29C9V9O30u5Bxdw/91SsMQCfsTOLWR+eZ8nrLOmfyR3HdvkZahftfKuFP29BlrZD1/W5bjF9s0ern5hj57zaVhFbkc3WdK38qK/quNpQ7YNnHWKuSV8qy7VDp1+kO39mbBq3Yo3xS7z9KuYcla668M08s3M5VM/XBOjnKl5/mE86bdyG/FRdX103fO6He9Rh3Vt491/aOJjhLIZSDm1lHNuUdahe13arzHN5a//sN/NHJ9eXnb+PyLq9Q5b7nPReW8ZL9kn5Hk3c2W4M7qHxWjBjuqOH+r34h19leeA1eIB43jgjni/Ox5BlnJ/bPf+e2Tvd7U5/wO2FCfdKGoSe+kdwT2fWlnMknfrQXd2G/Fz3LjhenCrO+uS4d3Q3/yXZ2TbGqHNVW+QNkMdCx02stsCXNe+tbai+ExfIbinMY5nRtO/ZQ9tmzbXlmqGrT+tN1INXsbuBK+MBADoxHwo6Oh86ku50O1mdT1s6ZC3KXRdJE1U+sfpEvvoOvvoXPv1fafdogpf22PhQbwxzKilX9lB0zKPjqL+HtF1Tt6H/Tq0+he/2oe6X+yjmnksbJ4k1/oxXcK+aoCYeoRkz9WZzoMOv7BPHaWPaDu3aQNeeWP2UPHrwqQ+dY0LXOeHTpqRZD3zibI1PJc/50zZobe/WhM95gVjXD199JJ/+rHFaY7mL9yqrfZKv48/47ANd5ujO6FA53/Ogn6N4LXEu+c6+bSidnzHqunMPunh2r7rYzr3uYuKIzLjK2FJW4++p+Tx3OZfylB2lXZf6R3yCTl470s8z2v1JzL2Trvs944mTbKu8bTWeKl/P04w3RsFSu5hWNlTPZy/PQMorDb/K8sBL8MAnOA+c6V/763/JN/2W3/ILfzv1yz/1ya9Dxpn1nMEjR4+qDu139ynj/8HrcqBEaQaHrrWTpyxp+yqboXPO9JVX3MaA59pdcOpFqvL0Udb1z/HvaGxgzmrLjEf3VLvxnTvRQOjQQJlh10dZzpF0tUt777Bb12h652KcMuhZYbxZ6dpyfvoln/Q22k61rifXqi9Eb5Zid9OtN+l6Y+eGj8wb/x7WB4zkk94bI+eSrjZ1PGtTLk3ixAM9669r1ycd6r/E9LN03YvKu2cFc19n9OhyjgXoWuh3S+n6KXsI0jf7y3e4Dd22Vv/J6+/E3Bvouo91v42NxFkcEqt7NZN36IdU5nG8nJNP/H/285//Of4rz87OXEdda/WF/qk+U1714euYOR90ZxMy1iDmep6Dznmlwa7W9cCT+P/Vv/pXfr779hD+qH7Sf9WvGafGsDiL/ZSjC28fMcc9QttPzDkG3Z3NIb53juGfo3jtYC7ptG8b8nv+qOuve5B75d4ldvGNjDgQuxhBRjzZlnS2KU+Ezqp+ymb0Nbp1DM9kld/Cawd4qepHfY2+dEWvOblvHZ37THvyezTx0rUbR7RJd+gZ6pDY3KnEMe0Zz3v0UD2fAehZYYxVlgdeggc2zjNJ//d8z9/1R/7Mf/alP/FDf2L7T37P7/27/l1fBpjwi8pBZPTn3I3FbKM+KLZnnZWDSQ/28OG0b/ZX5jhH0X4z3MZA9256efHpLlKXZNlfmjlKndmjHH1o8FQdS5zZ0V2AkXUX+kuy2Vjd3Nolavcduq6Ko/mdOElZpeGzMB5FfMt9kVeeCJ11u+PBU3UNYq63+qTzYb3xws9u5Dwg0JY4e2jIhwzpSzgbS3mde2Znyl0PyDjY0K1ZWecjZNWX8OnrpN2LDt23BnOfZ/Todo4HafAxCnPOim0ietKJlYaf1W20tbXzG7L0cdJ1b+oeurci8QGdcSJtrCVm3ELXasKe+JCXALUvSf9f++t/4w2f/mtL2iftGlyf663+MJ730D6MAe1YYs7F/PDa0aF2d1j9+Zg8tjiedGefMtfFy8IvfOELP/9mFPxffaofQH0l1njMWO1ie3YOkHf6OV6l965L6OZ4Zd56Tkfz+YxDP0fx+sFclU77ttF+zzfph+p/ePdGzP2b0cbCrUhM0bfDmSzlSddxaLPaJj9Dz96s/Va584PX1JnfU+5+XUL3HD3pisTIJVnG0R6d5wiaeLxQM36P0mPI8zmwT5XBr7I8sOeBjU/WOf/f9tv+te/kwwQqNDLOxF7nK9s+wbkhiSf5/+n/avtv/vv/99/x83/581/630L7MoC2fCEALU9f7L2zaxvzE/sPLg5SD1KV234rYqh9pS/hng3b6Hyu9cKzd5HCgbSLnW4dL+e6o7GN+V1Th7Sfax2zzos9Xb10kZ+1M5Zt3bh1/mpf2j7obn3KRvO9YETelSqvPH1SJp0I3dVtyM8111LXWX2hj8S80UpzA4ee3cgvPST4kJEInTxjVH5vXGyxXVr7kEsfRdfnmivqn4rVn/DV5/K5Lx2de1jobs9TNtTPcQFNof0xi+OJOba2ILNd2RHcRr+2dn5Spl8Tu/2oe1b31r2vsWJ8VTR2Z/hUST/jcpP+qZ/66b9IEgo6l7akrXU9dd3VL/D4r5NXWR2rzgXvOUybpOtZ134RPemnQufQpoquifl94YLfKXzzAnn1A3z1lXzGZsYstDEtXnse6njweS2SFqu+84Ix997ZHWrvrXTXmG1YM30BoD/cA/dEdB/hpRONhSNIHNX47/p1ejUGk3dMZTO+ytXfQ2KZ9op7fY60devuZOnrjnafLiH7i477fA3WGKlnBJ7zoVw6z47nRyQmJ3XvbHVtY5h793jPgHJwleWBXQ9wtkjy/4s//T1vfubP//Hd+hN/5vve8LzBOSfmdwfeb/wE55BP8vnUn+T/f/jv/vY3/+Pf/DvfQP/3P/H3v6H+5f/rJ97QzouArPkSgLN9d7Yy/vdnj1Y7iTRByycqfwrMeW+ZcxsDnGq9+HhxSsT58N3FMPWSruM6X+DML9hFG3iqdaycR7qz7dLF/tr2Oodzi9VO7b/Dut4hfid23EvaKJW/JFPfudSX73AbSqda7XddYq7fm2T1YXfz7W7YXBSOPGjUBwr4lMknMnbq7D1oaENiZ+9MxnppS+x8oKz6Sz59C63PO6z7VHn3s8Fu/1M2utyLSXmQgm4tnazqVN4+Iu3S4JG6Db22Vn9UvvMpsroH8O6P6D4mdrGxF98Zmxm3SZuYg7Pqr/bTLj1DdEhC/QSaT//5RDrnlK7nJdeX69YnFfWbWNtzjKRzHulqS+WxGVmHuR7pp8Ccv9qH3z/3uc/9DP6uBf/n+itd/ZY8vs04rjEOX89Hp4Msx/EciMzT1dqnjh1z51ke4nvnPHnoxy5eUxhXOjFt24ZO+wJAX1c/5H7Uvas88YzMuL6ExFHqJN/Rxh19Kp2yWVuno+5zo7aIzA8tL11R/1bfJ597ljR7m7x03fOMhXoGruHreUmeONypGbOX6DFMG/fKPQvwFPkZvtVa/36UHiCZv5T0z9p/8s9+/+llwA2OIxbPX//n036Sf18AvPmvf8GbNz/xPzlXXwLwIsDqNwP8MwDO2hjTGL/BpLddHCAR+qkrsztH0kft2EanU82LDnR3AesugJ2s9q1jO2dBbMYW1yMiO9c6Vp2r2uPFuyI3AmR5Q6i07bWvfJ2r2pK25hoG7doqjqZTW4fIKPSpRdkeOhd9pRO3IT/XtB26rq2uXZ+I1Zfw3KTFesP2xt49YOw90HcP8YzR9enGrjLsQqZ9SSu7Bl1v5w9l+iyx+he+7kHl654ln3tb6IyBSg/Vc6xAW9C7pWS/pBkr504+6dSR3obCvZrr3qOr/+Q73+feQLt34iwmjJ8aZ/AZo10ckzAiB60k9VmVg13C38lIQjMB7T7917a0u67RtYvVR5d4+lVf1jngtSFpZaL2JkJb0ZN+bHTsRO0SeWDik37+5h9/8+cWvISh+tsh2IW+63RP6YsOld8LsB9jUNlj/Gj8zmLec2I7vDRo/8TuLHSy7AOd4zrvQM9sxdH07AUbKNWWbcju+aXzTfWBsd7FtOcD7OL7qMzY2NNXx7hLNK4qpo501ZG3/bnR+cFKK6uYfpf2euN+XcLcZ3STl87YR5b8JTrPSUcTi5Na4/YWfgx9iv8Oka2yPHDPA8ToD/xH3/9nZ8n9tfJ7g+8zp/hmfr6+zyf5fOXfFwBgJv/QfBPAPwvgZYF/HkDfh7wAwBBLRys7GTwUXzJuw75TzYtPd9HyYncU6xg5PrTzBlY/YRcy8FxznDpHtW12cfdmIKLX0crEbrw6Z7Up7c11DLquV340vXNRThk0BX1KxU6WOs6TuI1O55o2Q9c11TV3ftFnifUGLc/DBPTeQ4UPx7c+vDN2jrE3V9qjjdcga0795NMfSXc+RFZ9DV/3o/J1/5LPfS50xkOlh+o5XqFrQf/Wkn2l6/wdv40J79Vc54yuvpLXr52/697kvknnfktnHNV4y1isMW1ST+JHwkeSR9JIAvlzP/v5n+eTeyoyksJM8qFnFV36Z/IPTUKJDcxbbdFO7XdtousXq6/2ePt06PiJ2rCH2tthyioN/xgV2xxbGv/6A4v4GHmuSxo/0G6Cz95TTf4TiY2sjGEs19jnnFRZx9tf7M7Cnsx+YI5fzmme5dHU3r+QP1XJawxzJK9t25Df81murfqgxngXz8hyn6Uv4SxWqjx5abDSnQwblFd97cv256a1T9RGbetQf3d7Ufer8uwvMvc5aWUicQGd8ZH0Xht6nBPRM0PsGX/SO2jM7uHofi/OOz5lSXs+kK3yEXuAs/Qf/eC//+Yv/eR/fKrXJvsz/YMuJQ5P/61ffQFQE//k+RYALwGsfBPgoS8Aqr0ePOQeFmUz3O50j+JsnCofw55sUF555cx7rl54vBjVC5gXuw4vXRxzrJwn5y90ayM62b/aWm2rF3X47mZwrawbt849WzM2T9bqmsWhdt5H6Q6RZan9aVPW4Tba79U9H7OuutbOH51Pu5u0N3SxPlg8xgN5jsH4+XBe5/PBQtSume3XyvELfTr/IOt8iaz63H3IOOvoupeVr3s/+C5GlI3mU3uHyGaF/lnkRdrqHPIdbkP/Xq3rqnznm05W/dztR927WQwYQ12MKcvYJGmvyT6fFufXxU36eSGALgngLNmvcpLKHCtfApBY+tKhvgTQVjHXW32xF8PpS/W6/jm+dM4tneiZFmmT1sfK5B8THTsRmv3h2xa+YHE9M9QftsuL6cN6Xch4rvEvz7mBFpWD2V+6ngf5Ordy0L5gjh9ntjvTo/lJCnNZOrqzZRsddp81WFuuOfeFvYJ3zyqyt8gS3W+R2JEWlYnKZ5h6lYa31v5Vl3ZlifZ/Dkwb9ui6Fvm6B/DuUe5dpXOPZ7TxXmNf+RHMcwJt/IGT2sXtTDaGON9fPQMdKlMfXGV54OQBku4f++Hf9+aHfvA73/zpP/nZN/7dPy8DZon9UflBF5/+6z/OaP4AYP3afyb/fguAlwD5I4H+DgDXgbvzlrF/0Jz+YZiB9up21w4erYyH7t64o3m3vfZlvFOtF596waoXPjYA2ZGLZR2rzqUNRzH717E7O9PG7iaQMm4W8BVTJ+kcW59oQ7Ut7S5rrftS+aF+2tdEaAq6lD2s4yW/jb7nmjZK13W4PrH6AD59JJ0+9aYMHnmgqA/yj/HgzryO2z3AaFvapyztfwiNb+ivjxI7v+rzRPYHvu5T5d3PGWYc3NEZJ5UeKueYO0pXPXiL48NLd7iN9nfqbE3Iqx8qr+/Sp9LdHuQe5f5lHGTMZGwZtyTYJucm/H6yXxN0eNpMIk34M1l3PNGxRZJ7xsiEP2nmYNwcU1vFXIfryzVXv8DP/De7RjiGZyLHl652XOI9467jORCb8CVJPy9qoLXTdXSY8aQvxOpLY1SscV3PBOemyipfx3BsERugr7El5yhnN8/3aDqfe+jnKMxPSdSmbcjv+av6Rl7fVL+4bxW7fX9KGXGX4yff0crE7AuN3CovKr+E1+rnePYFk0ZH2R7W/YD3elTjWt49hpcGiYHKGxfXYJ4RaeLvQDVej+IY8t45y9inrSszHeVdnyX7wDzwLd/w9b+D5N/6J37gd72hwvMi4Kf/3A+cvxEAfTTxV++Au04xzvngHPoCgKT+0gsAXgL8t//Z33HvBQC/A8CPCHL+GXPMf1U8V2X5ROiubkN+S3Us+ko/BM82eNEB64UrL3DQXhQTq7z2qWPmfHfOP9sy1ibN2qRPWPvluHXOtA+6u/Bzo0DuDSPprq0bo86TdqR9aXtZ12wPh9o5KNGxSIvIHUNaVN7hNpTONe2TTvuhc23Qde3y1U/Vl/obzJt70kcf1Hm4RneG3TjMgzzn62jtS3uTpk/yt9DGXPUZvP5MrHsg7/7UPau8ezvDjIlBd3GjbDSf26EptFlmNO22dWMpq7iNfuc6s195XfeM138V0+fS3R7N9px4JKkmwTcR5Ov6fP2ehLsm+jUhJ2EneSR5J5FnvK6a5Hfop885dkdjy943AOpZqWvu/KLPZmh8d33r+PL1jHq28QvrZ72sI33OixMqvrcqq4i/2Sv67/nc+ZwTfSrzUxmD/UNWbXYtFfEDsuqPmf9qvGZ8ewY65Ax18uwPXceH72xRXvVzPOfL8zvoer6H6Fxoe6pSx652wG9U7RZzTaxXP1W/uIfIpcHcX+kaB0/F13uVfEXmV5a2KEusNPw1Nefa6zfTS/uktUledB/gpTuse2l8I68xnjGQsXEtbXyJxt8OdjE7k41hpvfbbEuasWZlr23WZ8lfqQeI8e/67Lf/BRP/inwbwBcBn/ux7z4l/rd+I+CCi07xzdni3F77AuD0vwLEfxP40BcA2OpBSDwZedeW9HYnAx9ac9xb6Xs2eOEB8+JVL3heBOtFsuNr3xw354M+6pPsl+NB53zVnnqh9ybgzeFarOPV+dKWtDPtL2u+tI9D/fzAJA1S6EtJrHQ3/jb6vPOQg41ps3SuCbquWb76Bn7mX2/W3c3fpMOH/A55EEeeCC2fbV1/ZMwtdnZge9qZfLeua3Rr/853+jWx7kXHu297mPGYNHFRahc/yobqvdiUBynGYtJdX2UVt9HxXk1bK723XtvwF3TnN2Tpa+lub+r+5d6TBHbJ9p6MRJwklcQxY9jYNbYrmqyCJqUks3svGaodzpljO6+Y56OufY+3n+MwR9pq4pzJuy9NWIeJugk8SIJN5YUKfybBn0aw3mvWXH0gzxiMm/M4Xzen/URsYS2uW8RH0NVXXiNrjBl7FWvcGtdiPRPwnKFOrsy+oucAm5xfmXzFtMtxQOfQjrvzXM+5/Gh+lpLzSYObNe2GzjVJu2Z9Ufew4+v+P4RnfPpXdEzjraLtl9B+6EknQlvV6dptq2jfS1j7ydtPHtyr3X4ocw87dJ8TiQH5jAfpo1jjTJ44hDYeG8y4PUKPIc73Y/Qt0mKVyy/8iDxAkm1yT+JPsp+YLwPyRQD/3Z8vAa75NsAF157imzPFeeXTe5L4o98AOP3XgOO/CPQHAR/zNwA8NIknY8eCErfBP1ZlXMbK8a+hz3Z4sQHzguWFTewuipdk9gVzbOic98JF7mSrOvbL8XIe6LTLi3vi3g3iUhvjoJPjQeecaU/aqe2uZeyf+zDbu6HSXrCV009aTFk37jYUzzVtgk57pXM91b+uu/pDvvNn94DgjRwkURBNGkSSB+jETFqq3H4dOkfOLY3dla5roV29RPUu9VcvUb8l6uPEuicznj2kzb3ssMaAfMbJHd3Fk7Khcr4eXaKzfS9et6F4rtrVYbeulOmDmZ+Qp3+Tzr2Qzj1L2j0ncTUhvIQknCS5JMJdnO7Fe03+SeRJXi/NWduxN89RtcN1JfqywWT+KJrwJ17qqy7ro/KC4FJlTVnxcb5EqDTtjMlc+AK6+ukIT7/0U8ZHpYknZMZVYsagdBe/GefQ3fmo5wg+9eoYzoNtxAKoDXtoPzDHdK6ww+uGOJpOxeuB/GNjju/cHW5j4nd8xDpyXawz/cH+wec+Ste9v8QTQzMdxqxtnazqVN45Zoi+bUkr28Nsk3Z+eGWJyvdQO+znmGInT9+4HxVzH6Xd34xraeKg0hkbl2jPxB4Sg03t4nUmG93vPUOiR6n4Vvr2X9uUVV75wg/QA8Tjd/zrv/GH/Zo/yb3Jf30BkHLb6JffBjj6EuCAK08/AMi5vfYFwOm3AJoXAJzzMe826lUxrnIi9KwywWPX2VwzOfPTds+OvPjkBcsLG+jFsEM2A7mYOjkGdI6f80JXuypf9XOsnCfn1y5ss3qTeAx0TDHnTpvS1lxHrHG2Zykf6vfiS15EN+nsm/Q2lE41bYFOO6FzDdC5vqRdf8WZj71B15s8D5rIavKRfE3wM2m5ROc40s5XbZFnDdAdduuruthEcqM8x+n6K6u+TH9Luyd1nzre/ax7XPkaE8ZKYMZSpYdaG6PoUar+jN+G7rlWm5Kv9iePH+A7f6QMf8Lr18S6D/DuUUX3mNgiuSRZ9JNkP032k2oTST5RJuE0Hi/hLMYZgwT21k/A+RTdxNc5qi2sz1rXXv2UPpzR9KGt9pWvc3S89lyLdW3wdYxbXgCwv553x8Nu6M5+11qx81nGrHTGO3SeDek8S9DKE+s4jg9iOy9diA/ozjZl2S/HdK5iS3f+h8qTFK9BDp58tWMbSqeq3WKuKdfq+sG6l/C595XPtmtp56Kf44qONYs9249iHUcerJUxU5Zz7PXLPh1dx1VHufM4hzyoXxKhs+Y+Vjr3u6MzNo7SxtUMjcMdrLErP7rcu9/KJ0JTPAviW+n696PzgD/0RwLPD/2Z1PsJvwm/6LcAKu83B/gbf78N4N/7z/CCs4nNd14A8Il+99//tT8EePcnAPm/AHDGGffC3LvNHhpwVpngnTo79Mq7PiE7OWTwszln8rMdzgPmBSsvbvUiCJ8XzKQ7XS/QjJlz5NzQsa6zfSlL/Rxnz9a0DdqbAQ97PnQr84ahvSLttqmbWOdIH6Rt2pzryPUNerZfyClHcG8M2jZr2gGtfWLaDp3rkq5rl0//VFpf6t+K3YM5MpOSW5Cv4/JQPhsbG2irtsizBuhci/we2kaskQAac8rFHDdp/Snq9w7do7pvM559ps39TqyxAW/cBF6KtVvaz/HpPJ0tXbym/bM1d3J8ibzzqX5PzP2RZh+tyIg1EnE/VbfNODYeSDAz7qTBrhL7yOsZIDnjRYIvFW5FxvCs5Bxpi2tx7WD6Rxp/Qs/8qlz9GeY8lcYWZB1q50OQfSKhv8af+BB/OW+1GZ61inXd+qViF7vdGe7Oi2cpsepdOj/EA76gEiPYX22U19YcM+cLO+o1YjQ9S2FeSp0/+W20n2ranmtynSLrr/sp736Dj1UZ27FmtO0dem66NmS1Xb7GdvKp47i2i3Xs2if5rk+25xx1XNs61F/uT0VjOdF9nmF3HjNeOjpjq6ONwQuYcbtHj2HOz5GVhrcwRi2drOos/hV74Nt+27/2nT/5Z7//9IN+fGpPhecr/fzQny8ESO5N+MXuRUB9CdB9E8B5wAOue7QXAHyDgJcdnOUx73Zg7pOKhyARuuOVM/i9Wg867cgqqlf7B+8cl3AbfdABz9Xxwbw45QUuL4B7NzgvoOrD8wDFwyl0jg+dc0unbUnbLuZY19jKjYCHcx+W+cSMhzVvHPXG4s2nYr2huHZRH4Dalza7DjDWeWkPaad0mLLZONvoe6o5f9olrc1irgfadXaIb5BXH+ljsfrUh+ZMNqAz6ZHP5GSPZq/ZYx7geWitY8tjC3S1KXntToROHv3KOwbzkxQSe5wJ7FbfcRL1YfVx3QtjLFHa/buE7nvFjBNpYyhwFm9H5cQkuuC5Ol/FaqM8a4S+tFba9Q84q9Xv7kfuUaXZT+KImPPa4v5XvBRvtoO1GvNcX3nJcOun/l1iyzcBeFmF/cQq1fUwn+vItVdfzXy6J69jVD7n26Oxj/Y9dA1HkGsI6+b88sIGf8++zYE/actxZ7bW9cl3PsqYzfg29sV6VvI8VbrqOkZ3hrQJHxgzxATrtC2xszHnC1vqNWI0ne9v0E9dmJ9S7Thfj9Lu6qP0Va7fvQRn+9/J8Wcnr7K9cW0Ta99b+WqbfIcpS9q5Uwa9V+mz155jqduhcyfqI9DKPkLnfkLPzmDGetIZKx1NXKU84yzpEZvbpJ5jdBK/GdND5XyukFNm+Lb17b/qpGzRH5gHiHd+6I9k30/nTcy7FwK8DCDhzxcBvgCoqA7j+U2AnIf5nOuCW4nFR3kB4A8A8gKAMzjGvTnO7QjO6obhVg83vPQeqmf/Bpl3G3U2v3J0zrXO6cUoL2L1IuhFcg/pwwMrDwg8MKGbYzoPWG1I+5KuejlGjp32po1c9HmQ4+GtfqLDA5vJ2N6N5tJNJedLO9I+7c715DoH7V51OJrP7TO666dsG51ONefXJjHtzXVI5zql86ba0fpVH8qLR5Idk54O2VvkiSTZmRi5zzWZkscW7dAuMG2Wdo22pzz72q7MB2jsItHijJBcMK9jVtTHie7FDNlD26RzX2e0MVAx40XaWCporB3FUzyWMdrrYrUp+dl6qhyfIKu+kRfT19LsC3TdH/cWZB+9xhCL2XYLbTyCVsYljpiHGDIheypkDubK9VQf6CNRPx5F+qFr/4rpe9rq/Ed59iB15RMv7RP74DUIn1C51nB94Vz7AiDnSbquTX7mqxrD8hn/0p5NsZ6r5NGBV9cxQOcQtQ1buWYZa7OXAPYDc1znCjvqdWI0PXlhTkqH2rON9lPV5lyHdK4zfeSeguy9WOmMi2vpbsyUOV4ns+0IejbQlRarTDloTZ2kbRdtkxerPPmk1RdtA7uqX8Ba3cuK7Dey3PdKZ2xIi+hKi8bXDI3DHTRmZzi6vvPciGxWPBez9iX/gDxAEszX/WtS7osAkSTdlwEm8rMXAfmtAF4AfP/3ffvphYFjMR/fKpB/zhcAf+Y/+9Kf8AUA555zOLbz6pi3QyJ0rduQnevskB+V51iFrvPKMzc0eK/mnF6MwLyg1QtgvVBWngstD6c8NHbJf70Apg3Q1Ub5qtfZm7ZiFzcCHtR8ONt7WNZeH7i9icxwdnNJf6Q9+jTtzjW5zjt072Y41M4Bq44y+YrbUDjVnDftuXXv8QXr7m6yyvCjPpv51AQnkf3LB24fvEUevqETiT+/4eGDqkhMOmbOIz2zLe13HUexjulLAG0iacBebGMd2OJ8+i/jKumMsT2a+LNd2pjssMaFfMaOtHH1UHS8is6diM3wne0pY83wrv0Ipn+Na9H9qMh+sXckf+yriVHd+1t44wFkDmKFmKE+ZeFFqYm/Nmh/rr/664iPj+jUceWZO+m05SE0a7O/dKJrnyE+8hsZ0I6VqN0VZ/7IWE46z4J0PTeXzmPVd5zuXGkfNrC2fInOdYs1qiNqb47rnGFbvU/JD5VnK85ZcRsWtC9IZj6q+yqfMfAYNOMyjjgb81L7rN818mvOSOoyh2dJeobZr9KOkfIcB7rjkbk/HRrHovEMIkt+RmfsdzTnQblno0PisKk1Xi/xY4jpc2O2QXeF8Vf5gDzwLd/w9b+DZJwE3GT8GqwvAjLx95sAyHgJQOVPCOjDi4Qf/ZE/dG/eAy8BTvHNeeG8+iOA1/4GQH0BwHkbW3o4tlNR+mTY3SCV3ob8VLuDfavMMQsyN3MlSiM/1zqvFyHQi5kXPrC7QFYZiZWfDvAgzAXWMRwTzLmqHWlj0lXPIPDCji3OBSLnQYVkC5v2kv98iObhOr+enTeXjmaeWrEFGQ/rPBzRr1t/rinXOugaQ8mP5t321JXeRp9zzXlzL9LG9CV03WvXWNeefN6QO98hY49m1UQdzIpf4ROhefg2Acs9rTRJjWPn3Nozs5W10ZaYdLbNxlBOjFW74H0ZwDpYk37u/O8e0SZ9K+beJ53xIZ3xU+mMs6N0HUPe+TpMGztaP9DW0coSOx8ry7hOmv0kltjPvMbAGxvuuTiT294hcYrcubiuECOZiHXxdKuM6yDXzno+tC19oI9mcegezDD3QNqxEnOejsYm5GnbQ2nWm2PIV1QHuXulDOzsVeaaE7uYVtadB2SeG/HI+VMXzHGdyz1L26DrS0z4quMYOa7zhW3eo8TR9OSFuSgdage4UbX5qI/cV9E4gDcWlF2LdQx5x3FO5YlJ32pHjfvkk2Z8+Fo7uTJQuvab8anf0crASisD02/QxLKYce15MLb30LhHR7pixtaMNg4bNEYzZis9urVxjnyvMM4qH7AH+JV/PsG/JuGf6ZLUk8D7ZwEm/xV5CcALB8Zh7vzWwcEXAA/+EwBeAPhfAHK2OXdjm6+K91SWBmvdhuxUZ4f7Wjnj3Rl8Hts5Btb54Tu9B9/UuDh64eTizAOAD8A8lPKgWi+cXizzIljXf8Re+jiGczi2PIiN2ok9PDQf+e+xSMJYC4ki66KvD8KzG5FydOnjwzljkchpX70Z5PrL2ru9TNlQPwdtyjt6c+ycTx+CaV/6MP2oP/Vp3kArjT+Q6ZcZ+rCsfxPxZVe7xJ+9uuYTURPsnC9tmdnrmjrsZHt+mL0EMGkjjtLX6f9K5z7V/buWz1iQzlhJOuPpMemcw/gUtalD10qb9BHEn+hVv8Kzr7Wyr8Qme0iy7J6JvIwyHjIGqky+4iz+Ml6Zn7OADbzkfKyXAd3ZSHuw1Vr9lb7OPdjbq+wzo+s8j8Gzhtn+ur6HouN39s7W2vlKWT0X8vXseb2/hNnPsUTnBKut+MWX/cQ891ViM/Xs73hgzndnW3e/Gk3nexv0UxXmpnQ2INuoaXOuxfWJufa638aR8SB/C9Yx5EXGhJZP2rYOb7HFPnmN81pBW0crE9WbIXpH51HXsSs6TqL+qZj72dGei0RjQcx42aMzxjraWNzBWQx38jHM+XzRTqn4Vvr2X9tStuhX6gHiPP/e/9ZP/+vLAL8NcOQlAF//Z17/pICxDr4A+ARnizW88w2A//oXvKm//J/8fz/+C8C/PP4XgMf8HwC6w5WybcTIqXKooevh9qY4w6qfvGPfgjlOXpi8cNULXr04cgFFxkMoDwKZfPFASluO4bhgzpd2QM/WUvVyjBw750ybveDzkIJ9R14E8GDDuniw5iGfJJOXCPQnObPC+4kcOjz84xcf1rkJYVfaqf25rrJ24mgbNePpVppxTjXn0wYwbZv5EH/qx4r1xkt7vfkmn76RFvFdV2viD4/fb0182Ftil/1ybjDtlM71SFdEV5n9LiGxQ5x1hbb0ecazNHslnag8Mff1CJ0xIZ0xk3TGVUcTf508ZTlepZ2/wyNr6XTwF/L0W9LsZVb2kvggXoi7LvFnH4krYnMWC8qPYo2hjFVozwp2zWzq4quTcf3Ka1d3HtIn6a/q426vkKFX25TVMTo+53wKOtd3K41d9O3s69akrPpFvp6H5PMMSXu9P4L2AXNc5wa1L5E4qff9bM/+jptz3dlW72lDfE5GoJ+jYAOl2rIN2fm65RpE1gftOl17t+fKjIlr4yrjKceYyR3fecXsW+mOd5wOuS4hT6y01y715PdQ3Yp7fWpb7Zs8dFZ9UzH3UxqcnQfjoEPjxNhJzDMxo4nDSa0xO+NH9/O5ynhPOXQW9VK26FfsAb7yn5/6P1bybwJ/5CWAfyZQXwA4xo57iceN88VZvfoFwE/8/W/4c4F8AcBYjLkzZ9vkwUiEzsqg51oPNhcAZHkhqLTttS/jIsvxg8aGbVQR+l6t4+W8XrzyglcvjPBccEmA/dTfh0keILm40h89x3FcMOdLW6qdlU/dHCPHdj7nT9vzos+DLQnW0RcBrm+G+AF/4BfmyXm1Ke1M+11XXe/gM55upTfHdR4w50+7tPWS/9KXrrnehGe8SQXYVRMQE5tEEisqvn5osuNe8hBr4oPN2lftZ83IEmd06tVxKk8yqS2JnqX0NXTGlrT7NWtXr6L9ct8rnfEhnfHT0Rlre3TXN2XO12HaSXvySbNmeenqhxnPXmXCf+RlE/FEzLIXudfy4JFKX/vkOND13HhGOBt8gp9xdJT2DNSxc+60O32mf0X3o9u3IzLHOYq5r/RJ2x6LzrXPaOaibTbnbD17PsnzUOnubHm9b7B9Jsgxcvy0qbObNea1i+sxsUI/9LO/4+ZcYV+9t42mJy3MRxHfcu/eb7fRcKra7TrAXJ9r1k91/zMmpGcxlPKMp5TnGJ3ObP6uXx33KM9ep6681wvaqix526u+vJh60mKOV2n7i/SZ1eovefYT2n2tWPe9xkTyGTuVNr5maBw2WM/OEX4Mc479PANJo7PKh+OBja/8+5V7P20X/TT/oS8E6J8vAUz2658CIPdbAGkD9I7LT7HN2eFM/tpf/0u+iR/z4yv9P/f/+cq/9j/8d3/7+RsAf+sv/UMnWuSbAHz6zwsAfwDw1v8BIA+J9MmwYXjiNvhT7Q51XgBoh6+oTsrrWM5xDeYYzgHmxSovdF4MRR4266f+PGTyAMnFVj3QcXJs50w7oC+tIfUdQ3R85xPTlu7iz8MuySQPzflpxtGHZvRICkgScvycV1tA7dRuMNfV+CBj6hZ6c8ycx/m1B0w7037oXBu0N9WjaFJdk4vKm8gkktTAg/j51gTn0p4yLuNr62xtrr8i+sqybyez3TbOTrXPB2p0rHVfKo8e9lc5e4usYqeXcZB0xkrSxtJjYY5d6bTnEp3r7da5187++JKJl3vsBdc8K7GCnGtGd90gVt1b48I9VJ78Hm1/Ywas5wbeM8PcxFNnV40xedZl/zp2zpt26tO6D3XPruEZK/Xr2I/Bu++MJe1angpndudaK33pPOX1XNprfcHuvrF7X2DutGdmPzGTcUbs0Q/97O9atBMMG9O+IT4nJ9CPVZijK93cyrbR4fwNAGx2HdU/rjn91MUS5we550hatL3yl/Szn33BrI6hbvKdzHGqntcj5V4fKq9cpF06sfZTb4b0rW05XtJVD76r6aeOzn09QmfsQxsvicZSnomOJgYnNeNUuuLoei8vkU88SqNHYY5VXokHvvJTX/GNf/wH/p3z3/qbcCf6AuAxkHH9TQAS/dlLAH4QsNoAv+NW4u78GwC8AOBv+X0B8D/+zb/z/AKAhD+Tf2j+BCBfAHAd4AyOMW+KZzuBXd0wlloPdR586Q7zhlPHkHeOa9C+OT7z50UrL3JeEHEYD8Xdp+Y8DPPgqC6YYzh2rjPtgL60hqqfYzk+mPOmPdDdxd8bhg/ORz7l88EZ5JsE3pRy/Jxbm7Qzba/ravzQxZeyoT6NP3Q2a87j/NqTfku7O5+5Vv12CYkLdEwsklYG8jApmoyI7A2fNuXDZu7BY9HsPfNgR10Xe6tMOjFp9OTtI3Zy5utebLDu3APpukfJ4zPmStkttDFbMWOm0sbVNcgY6Nexkq82dDxrRN6tVbnY6SDDb37iDxqT7l2isWpscl00PrkmsM/udaLyazHnlsaGrJ4X8Oh5Ie5Yg31zPOcB0970X+5F7llHX9pn+zCmtKgs53tMmjU5Xq7vIbTjVXRNM9w7P3kdr7TX+kDvE9wHvB+IyE7VcXLealtdAzy+yZeXxL162d9xnQd07oHaKA7RSQY+ZWG+LM6feO/5zXWIuUbXvRcvniF0pCvaJtq+x2cb9Kwylrqi49+CeV2o1wrbEiudfWob9tietLKKl3RsB7s68xlyY909niHxYFvGhrRxU5HzgCzPR6VHoG6TmvF6DU3sqw+9ygfkAeKHT/35pN1P5TPhln6MpL8bgzmZe/YCgG8F+BsA2nLgBcAnOCecye4FgEk/aPVlAN8SeOj/AEB4cGAoiR4icRvtp1oPMXw9/Ef5biznOYp1jJzbi5QXMBFn81C496kSD5v1Amp/0LFB56y2XFoD+ujYz3HAHD/nhU676oW/3nTgeRDmQebIiwA+GcQ3dVz4nFeb0s603zW5xuIL4mob1fg6ivQ51Rw/59Ue7UuboXNd9Ybb8fgCeU0iku9ofI7cJEQkMeGlEy+YHivJvzQOSZxJUbdGfIK8+ibl9lMmn2ib47B+4int41zZDtb96XjmwGdg136tzNjo0Ph5CuzmqzLWgqyuqZNVneTxrYk8sZc+P0Lja/aPMbhO8ok6/JG+R3WYA13Q+UTmsnp2wEsvAfz2kn0cA3QeMe3Ud7kfsxjI602lZ32ukWMD+mnLY9Gsk7Fc7xHcm9t1oSOdWP1T+byOV9prfaD3Ce4B0onITzXHyjnTttm6iHmvWcR9tzbHzHmce2DaBP3Upc7h/MwrLZ6fN7DddYBHfNPFi+eINujEpGubvDryoLRtiUmr26F6XdslGdcIdbxedIiOutmuXJm82PVR91JbtjPeXsUHl+rsHNDPNmKjOwfIjZ2MpTwXlR4xuTXV+LwWx1CnGE+EpjCWJWllC1+JB4hFfuiPxNxP4zPJlu4S98eUMTef9PPr//XPAOD5HwHyJQBz77iYmNz9BkD3AsAXAb4A8H8AwEectTHmzbFOx65uGEqthzkP/S10He9uAef5nLfDrm/a4A3NixjIxZJPwmpi4g1fRKdeOHMcx8750p7O3k6WfXIsaOcAc+5qV70B5I0kaR5s9tZNosi67VPHzXnTHu1M+3Nd0M3auzibybbRnzbwVHN859WOtC1trutxnYkmCiYOtHW0sookHshMQBLxbfepuDH31Oi3AbAp1wyNb45g6lQaPitj4gseol0bNjA/++J+5B7NaJNZxq86jON4HVb95DNWKm08PRTruJXHHmTVruSvofGvSXv6K/2k7yui38mM6a5dfWyE3rNV3UTGzFrPlLxniZcAxlNF2tSzn5hz5Pxpb+5N3fe8znh97lA9sY7zlHzafy2NH67ps7cO1z7DvH53tNf5QK//3T2Ce4Lt0PeeU9KGtHm2VuLE+yTXa/yS/XK8tJ1572pn42h6lMLYlqSRdXy1ZRt6Z//kWnKNnW/ynEB71hM9V7ZnW8rUS7S9ojrIsyoXZ/1sP4LsferlNcM2ZehJiynr6JTZJ/FSu7rqgV1NX6TPpNlfaTD3u/LZBp1xIp1xJJ1nI2nir6nEKfIar3v8UD/HPHqUim+l699X6QH+rp1P/Um6+bE/PoG/9Hf/j5nw17F4AcD8s28BYCftvgS44PRTbHNeOHOzbwCY8Itvxv8OAF1fAHA2x3zbqJ6BC9N/UfFkyJ22dCKDnmoeZGgP+63oGHVc59tD+tCefdMOL05ewLh47n3q78MkibBJyuwi6dg5X9oxsRufbrVmvxzPOUTXAaZd3Q2AtXqT8KYBmhz41V7XDPrVf/XruDln2qJ9oPbnmqDrmu/4jLFL9D2/Ob7zgdqhbWlvrsX1JWaSIH0N4lf0TT4S/RS183n6/7loHm75RB178YFxkqi/unb9pn7VUZ5j8PLDP7XhDNIn9+cSzVgkd7xMqH1po7/z7fGzeYyZS2iMVaQfskv9bU87kCV/K81+4iOSFvytH3I8Zemrju72tNNjbMfMeTq5et04zJe1nr16voihel6Ia85a7ZvjSmtD2uzegHV/vb7k9WaPpv+sTx37oXxnL2Mqz3U9lL5k655PaPO6PcPJfYJr/6X7g+2n+0SOnzZV+2f+4F5IfBFTxEr2y/FynrBdW8TR9KSFebLkvNLiNhTbZ6ZcI3T6Js9JpfMsSYteBzo+26Q7RFYr46nr2I+JXCccT7rDmQy5lXFST3nKci7b7Sef+knbt0N9VP03491z2qXFGh/yeR6SzrORNPFXqrF5CUe3c3JTdbMN2oKeJWllC1+gB4gtEn8+VSeppvLpupUXATU5f2qebxkwBy8BsGP2LQBfVGDjAde23wDgB/74DQCT/oq08QLgMf4HgLSxHir5bSidah7kPOyVZgORibU9+RyTeeCdr0Pbs590jusFigsYD4bczEnC+BTSCm/1gRKeB868SHoRBB031+b8YmO3vgS3rPYB037onCttSNugu4t/3jiS5gG5/kkASQPy1OvGzHm1J21M+3Nd0LnmOzp9MqPx1T2f5bg5n3Zol7bmOnJ9Sdek4Ro+kxP6mfwTcyRkxJqx9RRo/HY4mw9dE0X8kD6CTpl0h8is9lOvjolfSOCZG7/gK3Tcp0uIPmfYWEW/zrHHq39pHuPnKTDnZvzkb6XxK/7EN77E2xtLH6EjfQvaP3Fv3tpW5zSOxL0z6PU845u1z/o4Zo1Nbcq99joC5vXlofSR8dRJGx6TznVeS2MHfTp7jvgmr9sd3dwfvPbP7g2dnD6n6hzVtrS/8wHtnCli6xFfAGDrc5ScRzr9tA0jTrXzz55vPCuJnGF5zzO88iqTT6z6jpe4p0+bY6TeETqvB0nbdyZD3lX62cd2ZSlXlvN07Y4xQ/t3qE/SjzOac2BbdyZSljHC2YKvZ0zeGAOJO9EYLJhxeoQe3e+9EOh4ZLV4Lqp88e/ZA8QH/7VfJv4k/37dPl8EkGiTlJOQP3XyX8dnXmzqvgnAywFsAy+4kzh85wUAST0vAEjw/+b/759oXwIgRwdd/vtAvinBORzjXRXbKoOVVrZhJDUPM7SHPLG7GHSy7ANdx3bOPaRPtSvHZV4qFzYfkEE+/eQTsqzI1CFh4wFzdlF03FxX2t/YnL5Meqv2V7/mXNB5IfaCLXY3gbyp1JsI6zc5NXFQh7Hs67jOI6Yt2pn+T59I7/hGv8zw5KvqL+dzfm3SRlD7XZNrnCULMzkPhbQlVhqeij8f8+/8GYvENyvJNDFLZT5i2ApPpY1PS+3HAy17ThJOARmHeK/7rb9mqH7F1IfOiq4vRrAPf+ZeXaKJWey+9SVA2gJ9aT7ajalr8cjYMx1t6xCZfmRvjQ3ibjYecsdSRz4R+lKt/eWvxToPa6q1O4ueubx+4QPiqurX8XLOtNe99ToCcm0Rvc48BV47h/rg0cr6qq6yGVb9jr/kD6/7e9jcE7zWcy+Ant0TZvJT/5wz7azrcO8TiRO+scT1kjjJPjlWznFna7V3iB+1sGaKWOnkp/5Ju10Pa4R2rekP6DwvSeMr+ETPWSefyS6NaT/Hzvm6ttS7huaakfryIm3SidBZ1asyx86+6or2mfHKE6Fr1S+J0LNa97zyxkai8ZOY8ZX0CM5tUmexqty47njbEqEp6K/y8j3wCRN/Emc/9Tf5F30RgI7VPwmoSfpT8rx0IMnvvgWArVe8APgE54bz6J8AkNTz6/75AoCEPytt6OQLAMYZ2/ygePdwJW5j0FPNg5yHPW8Oly4Y2S/pHBvaOfew9oHPMfMi5YVxduFD7sXUJC51c12Om3OlLcXm9CX0NqoIfarZP8eFdj4xbUkbXYNrFfNG441F5CHah2fXb5v9E3O+tEPbwLQ/1yXtmgOrj+TxzSFfOb82aWfa7rrEmizAm1wYA8o6vrahQwLOQyNJ6mMVEnaSZRIcqrYkdmtxnYnoMQbjkfj7QoA5SCZpQz/9lrRtiY6PnvLss0e7T0eRsXipgW95CYAP9sa/tu2oHY+hh22Ms4fZxt6w9tw3v02B34/a5JiprywR2trZmf0r7TmsWPUc13lA4ymxi29kxgKxW3WyP3TOkXZoo9cQMa9jlfZa1iG6yGufh/L12tqNp45r6JD1dvIq29Pr5k5Z55cqi+s/1/lavQdcg4xxvl/kfGkbdLdW40D0xWn1Q47lHMX+zuah8iyFuS3S1Z7dD3PSN/oCzDMjzZmC3kPPnXqpm7Ttjt1hjpX6yh+C9RpRecbuZFWuDijd6diuTvKVtn/qIrMql6/Y+fKSLPeemKjnIOMkz4S0Z0McQblNao3PGU9c15iuMniKem+5d3nlC9+zB0h8SaQzkSeBrkm/yb9I+/t8CcALhu5bANrFjxZecO0pzjkvnMXZC4BM/KV5AfCf/Nw/+Ve+53v+rj/CNwA474wz5qtxf8GEL3Y4GXM3QNLbkJ2qB1lkQh7AfSglqfCB3IuFF4M9dLxE57yE9EHHvjlPXqDyYgZ96eKX7dn3/8/e38ba92R3nRiMRjPmPxbeYCE8lsBS21bikIni5gVEzQQbN4omYAcnxEKKLfxANDHueQHqVmOBbLXGEZEb8CDGPI6EHBtr4saWQaN+0BA0NijIYCHTgJqHGWK1bSEHafxikkEzYP9Sn/M7n/3/3nWr9tnn3HOfq6S631WrqlZVrapdtdfae5+bMrMt27c/0W90ubSYOpWGf4hZHzplQ2e72Z86lrrxm/aAqAcLaY3KzLNeYuoEOvuR/at9r2M7U0fq75aesh3bT31k33Ns1VAgrTGdtDxwxCdPw8xv3K9l+CuH64s2nKfsl32rY8rxnqLtPwY1DgHbo5467NHJo1xNWzfRNQRPumLOoXlZnrHqZAHRQbYBbV8q1nKZpq1e2j7cFZGdbSSd7UrbHuPF6Hc9iDjucOBZ7hK0T9Y1PULLVcy9YA9d6ztmkDmrER3Aq+ucuWcN4HjL/Fo/5Wfb2Vf3EDD3Fum6j8F3r06s5Wq6V882LsVRn+Xn2O5Cn+pfHWtNe96dQPd8z8lz8dZZQT+y7z0d1LXAtYUTIMumjBxbjKf2tWUdAvz7ClV2pmt/ltaJQ8z+q58ca+ojr5kRPdoz8tqrNLLkVbk9eZbtYcrq5SeP/SHTPXqrjHmJ0soyLVY+6cyTToTOqIxaN/lJq1N46ifR/MSc90qzPuDlOslrQrquLdOuvUDXJ2tSeg+24l1jh7oZajrzJv1IGmCd8MT/B3/wew6v8fee1vOa/SlHgMY25dKB0JN3bR5vAYz+LSD9+vAH/+BHd6j3HXTB9acDAKOef++Hge9bABr+Inn+C0DqUZ9rrLW3e73XgqbBjEtLH6IXscjNGMYCByWbFJuCG0DFXh5yKKc8kLZE2z2FWR8623ajqhtZbnhbdK2nvGwj2y99TT0mvbRypME1ppyUD227Yvar1/88BJLeOlw8aChvuawLnW1lH6DtG1j7n2OTzrE3Wn2oJ/QiD/oQrQvahu3aH/uYfXdsYBoRGtDguVHD2c8oNMz2Ik9vfRV/VAfDT+NfrP3M8UA7xhwz9Na8mods3w7oOQJSp9LKNt1D5kS+89ND5rDHh0d989CFuss3WChjf3pYefZpC23bMqZHaLm9qJxeeQzb3vrS8UHdXtzSY698j0d/evzkec1dgikHuo6fuerFXOPQnD+sh15Z5ztl22722T2kt3exz+S+cwl9rgzLJ0JfEuuYcqx76a129+jD/fsEuvdfA4fnhWPpjd01QR57IWsry1kXzHHHuEZ9b0WuHmgrQ6alE6GNS6NvPTjJsUKrD9DrpmJvn8jrLWnqWl5+8pKu5Wr5Ub7lLsXenrElq5avaepWHumMlklej85y0onQo1jnbSvtfOf817VBOq+HSuf1Ic2a60TX5AhblcO6rWj55ENvBerM8EgaYB3w4348ufdH9U4Z5hjZGNQ++e8h8vY4AWqb56bpa61D33q/BfCl7/mirz2h5sP65brhWsSQ52k+DoC/9He/4u+PHAA+/aeM/wKQ67S1tbR49vq2wqEzRwFJI/QQvYhBO93bBOSJdWPIdMqUtr29aD0x5dMHY25m0qc2QcuByqnjsl2w9Bk9Li2mPitN/iGmHOgcB3S2D519q+MYHQIcKnlg5CFT+VUGbcDLtrIP2b/a9xwbedRz3AWH+qFclZN6sS/2z/7nGKuxrDGNAYGxBcobIWV4MqQBOjLe4VOGNwN4uk4djGoiRjZxJId61fjv9aeOh7FqIOW4c27VyxZSl3HaX2h41kla3gh768Y5Epk76S2kDfJB5kvdYyTriCQvxy6d/B4N7ylExscconvHl8i6YExbeiJPnY7wVP2tfK+1Lcz9oO5X1qttVP07d1voNdArU+Vle/Yh+7m1b+Xec22adpWZtLyKlkmE3oqMcyv/krzar5oue/vSSdf9fivdqq83OFvlyFuI2Z/e+HLuK83aYU0lP2WkbNtrWPvVWA8e6AMhsfaL9KqfHFeOF5rrJK8bafQjDZreg5QZlUuZI7nWfyhkHdCW2Gu35tW0dZIvPcJTbZ7K7+mv6neUdn8UXQu5Plg3pHP95HWRNOutE3vrcovXRNxY16QzUNeQtLyJj6QBnvhjzPPk/Nwf7uPpPkb+liOAvJ4ToBrspxwOo/wqh7Tj6H0KsMMBwEy8wzXCNXauA4Dv/3UAcA02WQsCLw1eLL2Lb2lC18PCizov+hFdNwfLIQNaWSLtXBKtr1zbyc0K2s2sIpsgPLHmk05Zys8xlH739Fh5jBUeuEu/2Yfax95G7qFTsXfgVF6tQ7q2kX3IvkGnjlJP1EEWc+XY96LznLJtF7n2z74zJqOGgohBrZHLU2SMyDTONdJBjM0tgz0NNIx3ntBi3FPPJ5S0lRE+5bIutP3IstLVCeBYRMeaiC5Iq5NzEdn0Fd2ApPfKYD4o67xUdM5yHUnXsqaVx5jy1Xj0zhw51tTBHhq5lpMGHzLSPmumrgvWBI4kxkd/1EXF1Cd5qctenmWqnFFaeSP0WjyFtX6219O387IHqU+5Ksc2su3sZ+4puV+55zw27u1THcdWmvGTP8Je3VN6OLGXj87Ayt+Tbk3dMAayzmI/sr91PDn/lWadJC/rpkzbOWL2Qbplrf2EvmagDUPSybMfiUsrsN5zOLYcL3ReK14/W+jeVK+9TGf9LT7lUp7p5GX9c+je/pC8EZ1tZJnkV9pyovk1nXzyzD+F1hNTT5VnHlhpeWDOe6VzjbhuKub1kTRrLqLrEZ50xZa1XjvkEcS3qbd/e7zMn/QjaYD7RQz///Yf/1ebxn81sKshTj5ytj4L0AmwR1bKr+VrelSWcqNPAfhl/hMqP6x1rg+usZ4DgLcAfO3/v/mX/5v/ERrk6f//7RP/6//yLv8BgL550SQeOnXMk15a+hDzYoauF/456SqLtO2ci1VW9iM3rLqZ7U2njJSd7ZY+q7s9eNAt9VOedLYHnX2p/c9NXNpDoIejw6VXFnnwlQvW9rNvtd+kGRNlpEkXvakL9CZ9QPUBKtv27Id9s/8epKBGMoghjTGFUYXheK2APA1ljfbEdAbgIKjtauRlHen7Mv5zXp3fxNQlfdFJQn9cP5bJes7FCJ2zHlqHPGkw24FmLtNYZi7pH/yc+3No5Fo+6R4v85O27BZanr6yLnBmMBacUURo3hxxPVGOOqmPSlddkn+Kl2WkT8lNmV6D52LKgM42GWcvbunTvFov5ULbbvbX/UTMvSbpuiedk0YO5XuYbVxK556qDHmO6y6ozB6e0EPvDFxanR6/8lqx7n1K5dd6pBdi7W/VQa6DEV3rpEzbOWLtR2Ov/Ye+r0C7BunE2i/Sq25yfFUHXi/1Ohql3aN6mLykL5WFjL2R/WFP2VE5+WJP1lae5bOM9AhrnVrO/BGi18wznTjSvfOeWNcG6wZerh/ovD6gWWuD2FuXldeqrtcQeYSKb7l9vmUtM/EBNMC64d7lX/93P/fmX/5/fmp9Wl6N65pOY7tHU543AkZvA8DHUVDrnttOrd9LI1O5vKHgfwXgkwCugx1qXt8AwGGAQc9TfT8BwAGAwZ8RHvn/0Z//zX+R8ly/x7butM6tDNa4NN4h1gu7Xvin0tSnTJVj2nYC6Qtti9C3ovXF7EfdtHJD20Nn/ZRbx1H6VXW4lb4xHscg1jazP9B1DKMNPQ8CaA+Tyt9K92TX9rN/te+mHRtY9HZDF5mXdZRjW/aB/tl/xmfEeCJq+KfRWI3wS9IYnhhwaeBruPcQ50N1PGD88/S3Vx7epQ4A9ZGonvZgLYMc+uMnDdDwshz0VmS+yHfeRjiSkWOh/apLDGf4zv81kDaVk7Q80bwtZC3SPw5I+qqh7/xvOVeqTqou9+i16jvrJF3L1bT7j9dhD+u1WsukzDo2dHgqovdRmZSX7UDbD/sH5h6TdO5DD0W7NyZmn+5C55i36FNtbOgiz7ullcv0Ft2KrmWlTyHyLJOyl8Y8xBxHb7yuhR7W8ikL2jYaZttJt6wHD6kTGs/+QC9Gx5PjrHrIayevqRHt9Uj+Fr1V3zzr3wfWvaOmaTP39exDr+wo37Jir1zNMy1mHegeP/Wd5ZMvrX5HmHMuXddFrhlp15PoOgusa3Er3aod1u4WZh70DI+oAead+2Duo6vxX41ojefK35vmbYDebwLgBNjzo4C1/a105kmDtCPSLsY/sU3BsmMaDg4Arqt0APB0XydAGv/QOAAOT/+bA+DSHwDMfnHxERLrBbm0/EP0ok70wt+LWTdp2yg47Espt3qzlZn9qRuXN4BubCOs9VKm7YClL7XPe9JLykjZ0NkudO1X7X/d1PMwqLQHidg7XLYOjdp27VvtO+k6vhx7j67llWlb9MExOz7GQ9Twx9jC8K/G4iUGf9ZBHrIx6PZENsfqgOCJr8ZflVENf9I6NEDHmagOKqaOpE8hMiiTqFyNWPpxSg75da3sSVtP+badiEMl5wRah0rqaESn7h6Szv7Qbo6p0o6/h3v0eM0yXnc99Nrcwlov+9YbX9XFqXSVkfKz7drHus/09qKnwqOv9CWx9r+XZsw9/jm8DR3sOet6ZZrI1Ujt0fB6AVmEnkx4C7GOrc676Vwb0PBFy6Qs5R+x9qGxD8E+mr4WKncPZt+W1oFDzLE4PsecusjrB7peX6a5LqVB02LyLJd5mQ/fvB4t7xpY917TIm2M6HPbV45ofdNg0jXf9Baqx1EZ852DxJzfOu+5JrwuRNZNridp19oRXYesP+ketuw1XzoxaeobkpY38YE0wP0gnyty/8VTf4zj3tP4vQb+nnLI770NAE9DPeX0eJl/Dq3hzziNOCR2/AtAZ4T1unAN6QDgyf6WA8DX//8Pf/h//h04AKiLjBbvvPYR0IsIX6MXdmIeHj2asqMNQjnZxpE+KKfRifZv7Y/1lCPWfqCoGtng4OVGZ7qWTXm2IdqHY1/t415kLI4R+tYNC+1k+9C1fzkG6NzUkx4dCnv4yKFcyoOubde+1b6TVnci4x5Fy1Q9OFc5XvrHAYqhjFHNk2oMbDalaweMf4xPjXbahBblJ+IsyH5sGf/WQ15GDMeM3jSIvbkczV2dy3PTvfVQZdT10UvnXNb8Ko90jpFx9z6pYH54MwM9UkaDO3FEZ/ktmrxrRNdtjkva8fb0UHV1n+l6XZvuXd97eNbvzX1vrOpjhL06qY9sr/Yv9xjo0V7U4dd9friPdereW9k6nmukB/2v499KNxHrPYb0HtwqU/Oy/aVlHmIdf53/PekqQ9lHzHaTbtlXC8g9J2Q/pJcm4BBzPHX8ea3kNdS7xpLHtZnppM0Tzatp+SB55ktfC9m3U5ZpkTzpitaTb7qHWSbplJ80ZWpUbq0vv4epP/PlpY6hmWN5Od/Q7s+5Jup6MZ1rCtq11pD1x7pzHY6wFTmU6SG8cwJtzHDPGmBt5f0X3/v/nU9+z8EwxxDnST3Gsj+ad46Rvacsxjev4Ne3AWh3T/29TgHLgUSN/kT6wQ8e7lT54ZrguuLaw6DHsNcBgLGfbwDk6/+Uw2lA3dbWsrO9W8W8QBKha6SBQ6wXuGk2AOgRZp51QOV2sPaBNH2QD30jplzbc2MCcwM7h04Zjs+2Sh/sW8VWbO13zTO9OZY946kbtxt6IhcraQ+EvWidlAVd2/TAqPqtOqx6HOjzljNEOcrP9jHm2Ih4pRrD+j6e9ivzEuMfh4QeUpwAp4z/NPqlGaNxdJOQc1rn66HSOS8jmjms66VXtvY5xyeNTvJHAdPJ4m8rUAadpf626D1lrV/RuonQo8g4yHM8FasOSPd0pT5Fr5MeWiYRusZeXXhei6ewt3dZp8qubffGvYdX5WQ7ti2694hlT3dfdp/uIWXgi70ye3nIuHpkbMh1jHtxoy97x0M5guWlE6G3gjIsk2npRGjj0ujuuJ3/iqO1nTpDZkTbSmzZDxZol5BY6ewb9EJ0TD0d5DWT19Op64+9K8vUdOZJ1zLuf+RLW8Z0zZO/hb09dsSTD2ZEvnlbbWVeLZ9pZafczE85p+jUJ2VNp66kM08651k610FeG0mzflxLoGvLddawrr896VZtXdNJU7eXTt7bEvPvvWmAOa9vX1bjHweA8T7fBsAI730SAL/nBNCYP5XXK6cDoDoBGB994Lo4Q+kLeuT60wEwegugvv7P9U3d1pbXwxnNvlvUyonQGZeWPsS8yKHrhV/z95RRdqBt0ya02OOTt8Zsn75lrBsZaTY5+UnLy/p1rNluo+3bXXAdB7JzLNK1P/ZTdNMW3dgrnjpIevnIqIeKcm0v0T6Jte+O6RxUhjJtj35waGL8p/F3LRrDPY33fO0f45ynzGKlfZKfBmp1IFimooY/2DMyvXno3TBszVfOG7R6FOUlWqeH1LOsMnrIvMF3/kZY69Y2e+sTHdXPK5x/9E0eTpiqx2ulmQNkico1nQidkfGQ7o2rjh3djHRd9amuxb36r3Jq2uuwh6eu516dlF/n3nTVQy9t2cSUXdvOvpb9nL247uU9Xi0zSmfdHp28kYwRn7oPFUd9SH7rzkF3PYSXgXqEEb7NfTffdA+zD9JLK7jGnG/ouh5G6VovZTbatnrYstexQT9EoB+ExOzb0vIOMcdVx57XTV5P0L1rL3mj+4QeP3m5//XkZb405ZQh7xT29lp5iUmnTPnJg05+0qNyWQY6Y8qznFjlkVYP0jWddVK30M5pnedcA6wP0nWdkM51xNoi7RprmGvvHLpVvbGGMw09wyNpgPtUH4Z5j8Vr//67Po1+0afz5GN038fbABjk1Qlgez1D/xyejoA0/nUAYPgbz3j9n5k7XAtcK1x3PNHnyX51APw//9Xv/yWf/vN2gK//c90erzPk3DkopHeBLk36GvNil3YTGKHlElNm0LZPe9JbSLk1pnzo3maVm9oWXetW2dluo0d9bFk3NjHKEUbll5a3xtpmb0x1DHUTd3Ovm34eCCOaOh4oYpVDutdm7RfpUzplfIw/UR1kXWXbrn3CwKsbkxvUpYjhyFNk6/taOZugRn/Fasjz7X86EHBU1DKZRl6NGpQamfVmIedQffRQnVUczWPypUVkJF1lZto5O4XUoUzWhaadjDledYEOU8/OmcjaQPfMR+rzvmn657yJ9llkPNA5LsZLOscNXXWjTtWd6UtwS0Zeg0l7jZ6DWR+69rWO0bTjVyfyK1Z5tb3sa+65R9r9mb1Y+rEx+yIt9vpG3jViT3aP15pbdQXdC9QjiG9T5/+1fg/hZVxa+hBzzpOua8N0lpFW1hGzHemWdefxIWMr0JZBWoQvDfbi0vg3HjI4ZjCvnXpdmfb6uwu6t7nnpSzz5GUZ8+Sdg7nHSldUXuWbJj9pyyf28ivPNGhM2ean3KTRjWnp1Jf0HnRexVwD0Lk+kva6EFlXEXtr7xSvVT8EyvVCj9/j9epO3h00wDrK1/29r+IH/zDqfRKv4Z94304AjfPqBNj75oFG/pZjQKNfZLwa/7R7xuv/zsKNHwIcvQWQT/91AHCdcs01QRet/awkDY7i0vIO0Qv9UkTOseOrzKNs2oY36oN8yyRC3zjQaCM3Kg82eXWDy7RlEnO8tBXRfiW27O44Rvysu7RCa8x2pbNf0Nl3aDfxxNEhwAFCngfJFlpuJCvbk659q313TKcw6ymTNuwL/ebAxHDmCf1dv/33qXE+VcYRgPGowY/BKZ0IbZoy9dv//O2ANPyrPOVUA9WbBTHnTH0kOhcPjc7TJVj7muOBzjE79+ijOls8pBIfyxHgPDpvFeuYSNdxV72gW3iX6Hhvnbz2kj51zeY+Bt0rn/Kga5/qeE+la33S2UbtQ+lj7sPPkebc2NtvymbcW6+Wa2IObe5Bytx3qP0jvRjr/Nc0a6XyTCsjsNcWPIL4NnX9vz358sBeXI588Mb1mNdI7xqq113dl06lcy8b0XtkWBe8ZmQvRl7uyaZtJ8vI66HlzBulsy3LyLMuaF7ykj6lt1P5ObfMPeneGsg1krTXB8i6Osbe+ttan63ajTVLmpB13nLe/Wveu5xJ3YcGFh6u5T2UdP6bP4xnjGOMYox/jH6dANLilqF9lzzbrw6HKpNylWe6lwcvYxr/jBcHANfEGcr3+jj5GYA//sfbAX7/zzV6vN6ucg0oxE71cGmDO8S84C+hlVOw1+Ye3qFPyqr9yY3qUrrKtK0jjvrYsm9tXpY1z3TFpRW4EWsfemPJTTs3del6EHCIwLsUUx5tkLYtMfskXftex9ZLZx3l2KZjYBweoBjPbFo88d37VoCGIQY7Rnr9pAB+GvYa6InViCedr//rRKiGv+mUJa3h2Ht6fOpGwHl4CGReaMf56aUzjzklLWaedbPfud5y3DnvzP/eN0GYb+Ym3whA5+i5h8kb0TlXPZp61nWtjm7wcry9a6vquuovdauOxV7ZLC9N+Rp71ye8umdtpauM2saof7keku6VrzJrm6V/dQ8epVu19UZVei8i07KX0KM+7eUvrfFTZfeUcQyJ0I8RtvToWJfWsRuxroU96SJD2RVbsRvB/t1gXpjoyUqedCJ0xqWlDzHHXK8V0vWayustafemul9dkmYvp15i0uYlr9KkT0X3XJHye+i9cqu8mrYtUHpUptfmJbrdqpPzCV3nnnRvjeQacl0dMdfcKbpVWdcoNIE6BPFt6nZa/sR70ABrs94H94x/jWONaAxknQAa/Znm9fz7+hSAvuSbAPTFfp2DyKG8Y0MONEj06T945uv/ztThuuAa4prjM4B8CwDD35j//q/8AGC9PpS9C7Oy9KFTrba4HGlwjXnh76GpS7mUETRtLS3a5l60DrjG2p/exiXPjU2UL1ZZ2U6jR/1sWWuedMVR3eQvrdIaa1/sY2LduOvGPjoEeoeMvDx04Y1kwK/tma79yj5D17FlOssqR7n2xb56oGp8YWzpCHDj6iFP+jHwMQaJ9VUn8qtxj2x5GnaifDA30PyEgLyMPXmOQ3R8edPQmxP1s4Xoknx1KspLPCXHuqcw57JH1/q1XecbdM7F1A0OnHMcPzoCmAN07TyKPV4tm2WcL5F51qkEws/+SjuWPXNadWW6p9e9PGRQVqz18rqUzj2qQ191P3OMW1j7TNq+iqWf2cce3Yof9nORMtJ7cU+dLDOiT7VHvfuMtm//SBNMi2+5D/93a+xL684aXQt7MOsd6a12WpFVH9D3EaqeMz3q29I6st6H5bjrNdO7vupenOnclyvd28vuUkZ57pW9s8C8PZhn6RadecjN9IgetW95scob1YPveKsOL03nPDLvpOv81/VxhT21rlGuEdewCM/Q45k38foaeIf74N69Mq/855N/DeQ0rjHu4ach7lN5kbxrOwFoU6Mdh8PHf/Sjhz5k35K2fPKSdmyJ1fhnHBjuF07Byc8ANP59/f+aDgD67IWVCF3j0ng3Yh4ge+haP9K1rUvSJ/vW28RGvN54or+0Nepjy7qlU3gE6hASR3KWYzlwjbVfvf7XzTs3eOg8KDxQ4OWhY1q0XMWUJV3bM1371es744Mv1jLKUKZt2ncOVKKGlwYcBhgGfu8bcQx0nARseJarxiNGG7LIV+YepHw6AOgDvBp7shyD6NjypsFxqwdQ3VRUdyOk/CjvLvw6h7008uXXtnIcOU7HLqZ+0Blz1jvARjzfAGEd9ObjXB5zTB9wLuBQYo0hg75lX3vzyZhyrKmD0Tyl/qBTp+ZdinXfIZ37UtCj/Sz5w/1sdN07nro2TI/GVfsd/bQP2a+kW9Eb+zTphw70pxfkJyZNnUxXmvSeWOVkGpqg7Lepx/trPxJ7Y1xaF2/EukYyXcse0z252W4rtgb5K+PKRMq3XzQhnbg0/iHmGJOu15HXV8W6H5nOPeu+aPd75EtfA92HRzhqw/Lkj+isaxnQaH7myavouLf0y3z08uWLlHHuxDrX7r11beS6gXZtHZF1x1rL9QdNqDzTb3Pf3VOyvHmieaYnXkkDrMH89DXvl3rGfxrMlcbA5wm5Rn++BQCPvPtyAmCo0wZtnjL0s9+WrUY/aY1/jH76Dv7VH/lTb5rqL12P1Nv8DKA6ALhmuRapd4d2b3WYjjgI6Yo02I1uACMc1Wv82sYlafpEPfAQ6+aU6bqR1XSWlVbuEUd9bNnreKAJlCWIb1M3y43kJX9pFddov8Q6hrqJu7mLvcMBnoYphw7pxKQzbyTLthJrv2q/T6Wtr0zb9pD0QNVoTqNNgyyNezY6DD6Nf4y06iTw6T/1kSem7C063yaonxEoS1QO/Yd2HNVodLzOiXpQL4nq7KHw1Bzuya99zfE4VjD1AO38g+gMAzznOw+zEU155lxnjXOSWOeLPHisH+rh9GEd+e8ecx7rXNrnHEuOETrHD131s0enl5Rxf0nMfSjo3Kv20sP9jPYu6a91sr/S0Vfa3epjy+7u18mnfi/d443KnuK/beHdvlhe/hZa9tqYbSo7eU+Btl/gKC4trxtZL6O8xh/JyzZbsVvrB941g+0hs0f3+rm0smv0ukj0+hHrPkPa/afuSabr3mW6nlXwe7xR+SzrXqkM8+Sfg+y/vfLJlxYpn3TW38O3jLglL2WrmxEyB+SN5kL+Kcx5dy1UzHWT6+pI99afvFZkvY6kxVzL8GZ4QA1wDzO6L8L451/9abBrKKfx3KOrE0CjXMSo7tW7C8++YaDraDglzzqUg66RfuoAwPjXAfCdf+RbPnGHKTpcE1xbXLf5CQCGv9Hv/8mnHOVbm0uLd75eFJB46NRReNI0eO2Y8u9K3+hbblB3oTtj7vWzFbuxqZkGDdQjbGFPtryl1V1jHVPdoHMT9+DOjZ+FVCOHjcYMhxP5HkBJw7Nu0vLEbE+69qv2e5TOesqyHfpAf40aXNVoY4PDQMPIw0DDQNQBAPY8nxqCPaMv5Y9ojEKNUNpTv1vy7L/ouEDno+pdnYipr/umR3N2F3722TGJOe+pj9QTNPq7xAngIci8YcRj0OPIqZGn++SxbijnPFOfNGvKORTtV/Y1x3DOvJ6jX/YLytd945x07j9H2r3pUlz3M+SN+rJnnKO6O/vciq37MjSBMT1mGLWffOmKvX7XMqfSVUYtn/nmJe+haNvuIbxRXFreOXEkp7bbxN5LsJ2RcPMToTMuLb3Ges3U64w9GF7uxdDuwyN0fx5h3eNG5eRneWnw3Ii8UR32Y/LEUbnKt7xY82s6y0mLtWwvrU4SmQfT0qO5qfnUs2ydZ9eD68B0XTe5phqd6+0culVd91zqEcS3qfn3XjTA/HMv431Pok/9LzH+NbpxAmA8Y4zXeO4TemVuocY7Zfi9ARwBaeDvqasMMI3/fPoP/aXv+aKvvcOkHK4PrivmwH8HyOv+/ktAjf/8AUDKtza9tu7Q/M2qKVC64tKqXCNWuXdN0ydk3Ohb3ajOSVdZR/m9frasG5NBmQw1XfOUCV96C5dW7hDreNygE3NTd6NP9OBI5EDCeMFY5RAi7xRm/aSzLensUz1csu9JZx3l2C8PSvpN1NhKoxyDm8i4MAo1/uXlk3o3QAw6X91OWZWmPXhizfczAB0ANb+m7b/ouEDHuqXj1FWlU6cPRdd12kv3+pJ9d87BHLv6EFNXroW7OAFcC+cgziXWjfNXsfYx55Vx5Phy3KkP6J7O5PV03ONRvsdPnvtNwa09KvNatZP72pKys+1L6ZR3pLNPPboVOwTyMtR05j1l2n6L5/bVeuK59R+zPH2239IjXFrZrTiql/wm4kZ7pB8i0AeCKJ19S3ppBdZYry33jop13yGd+1Klc/+6Nu3+2EPPgB7Sjx6/x3M/FimTdC/dk7PFq/K2ZNr3LV3WOTg33Ztj1kE9Z3LN5Fo60rnWkm7Z6xqFTzBf+sDc+GO9jSIz6xwNML/ce/bubfjOH6P/5//B/+MQe0ZzGsmVruXrmwD5OcA5BnqVO0rTH/J8am86y8sTyYPOuGX8//CP/jle/79rOPwOANdr/SFAjH8dADz9J59yXIOt0TtdD1lZOhF6FJeWd5eIXOqP5MMnJG6VrXlLq3sj5qa1h671W7q2UdOtyK1AmRrkieRL9xDeKC4t7xDrmE4d4PVw6B0sHEgYxxgyHFZ5COXBlvyeHHm1zXrg9A4bx1HLKkvZHp70k6jBlYa1DgARRwCR9MhA9PX/lJN0tgNNnpjl0CGbLG8TJL/Sykt0TGDVO+NXF2LVlTpM9FAXzRulk5+09SrW9XhOusqiPaNjBJ17MPWS+pJGn8wBhnnvsLs2D2eSc5tzCU2fRPuX/c9x5Xih1cNoDs7R856y7i8FR/uR/Fb8xp4Gn5Bo2cSllbkR9/SxlqkyjulsJ+mWvfar0qRfUmDcBulTaPnngo6H/konQo/i0vIyjsolv1VZ5UE/VKAPvSA/+1jppVVcY14/de/NtHtP7kN1fzKde1il2esqbyud5aVzv9xDI99ySctjH+7R8DKvl7beOZgykx7J2NIPeer9UmRuqescJ+YayLUCHeuorrE96Vb9xrVDHYL4NjX/XlMD7zDPPLX+5m/+mv8M4xZD36f80Br+Gs686q4RDKZxfIpOYxsaJwDGfn0LYO9r+lXeqTT9o4y4p3yOKcfta/+++s847vDjfzmn3R8C9C0Af/zP1/+5NlvlpcWrXycKTIQ22ihp6Euisi7B1uQ66FP1u31z0xphk9+rt9VWq3KjT5mG3grI7QXbI096hEsrc4h1c86NGzo3dejeYdE7aDBkMGgwlj2gPETFHr8nq7ZZ+5Rp+yyapwzl2zYHqTGNLg0xDf+KjKv36j9GIU/uKa+MRNognW0lbZ51/DE40xVH8hxT3ig4dlB9gOpIVHfgfca69u6arn11PKDjTR24BsTUGXolDW7N9bWcALz6n2sm14R09i/n1f47Nsda57bqh/RenbNfULaH7iUbONqH5Leqt/ZDeIRaxnQPl1b+RtwaXy0b6Z5sea3Y2lfoGfZrAB0+1ZB9k3bOz8GlDXBUnrGn7K00efcVen1IXvZ/aZ0wDX2IeV25j9T9JfffpHN/StpzyX3sEmQvzHo1TV7ul9L3hXWfNi3eV7vITT1Io2/o1PsltGdqzmvSuRZyrbh+jui6GmErtq496S0kb4Y7aIC1cDD0v+b9f4jv1PlXdf4qPsarxi0Gr0/5odPQTdryiZQnnQht7Bnc1QngmwAgsnp17otHP5FtfxNzXKkHdEf8wR/8nqs8/W9TzDWz/hBgvgWQxr9P/7keKX+s1+BugcYJPRxdzMuxPLgnphzKZ7rSLbvbF/m1/FZ6aZXuErdk2x/wroF2COLb1Ltp+Vv9WVqlQ8xNGjo3cOjc3HsHhgdMIoaL3ztjRNVDj7IegNJZP+naZvZnD219ZdoufTJqaKWRXQ1/0oxl9O0TBmE+yVWWsvcgdSgH0p6/J6AssSfLsYiOM28I1AVYdVfnvZd2fVyCdZ3tTbtOxVG97G+OLcfsGgBTP+osUR0zDyOHzzWcAHXN2K6YfYLOfufcMqYca+ogdQM90iF89XxH3Np76v7UmlqDeSujEcqCJz3CpZW5JI7kwSeY/zb17l5reuLz10DOcZ1383q4tKH3+CPeU9IUfSQk1n4vLX+Nvb0j95fcd5J2b4InLea+fIqmzqky5uf+6L5JnrT5pmue/D3o3lxxT91rlnHsW6jeE3vzIk+kPHQv5hoYnTGxjuoa66Vb8fW6kk6EnuECDTA/GIjfHMY+BrWR7+D9Fj6NbAxe0ufENJJP0VuGO/2pbwLA26pzrTz6rSxpx5KGP3TP+McBwPV4wVSNqhweynAdIlcnAE/9ceKQhk/+8Z7O/X0k7058L16ESN8VlxOyttrKPOmKW/1bWuFz45a82nYvDe/SQNuGHj3q29IqHWI91Otmnht+HhrSvcOGgxDjhu/ifTJeDzrqyZPuybKdxOzTFm0d5doe/TNqbIEa2Rrh6QgYvfqvIdh7ZV+Z2cYWTbvWse3sk3k9GY4HdJyOWz2Aqa8616brmrjvtGvxHKx9su9gjjHHrj5AdQSm7qTVMfPg7zI419dCPjXI+XX+bRu0P2L22/HkGHPsqZOqL9Pn6PxE2dFeI79Vv2FskCbkvpXp5Esr6xQuTdBWPFU/26NPBHlvU/PvSAPPTU/ZX+kewjs3oqOerORD32ewfdqQFuWRHsWl5Q1/dJN9JPeZ3H+Szj2q0u5j10D2x5STafdO8qUrbuVlWfbjTFfafLHmXzudY6501fdWmjkz3/kjLV9eRdeA50pF1tAxjtZZj9+qrGsW2kDZGU5r4B3WQhr7GKQYqhr6og4AUT7ltwxf8npOgTSSNZQtm2g5jewR0o/qBGAco/LX5tvPio69Z/zDu+Mv/9cZ9ho5vAXAdcn8YvRr+Hutcv21ykuLV7tWFNRDOzZCO7IXR3KS38a2Dg4+oYdZ51x6aTIznlO/VV37A32fwXHThnRir99LK7vG3LDdzMW62XtAiPXAIc0Bh/GEYYwjAAN66zC0Tk+W7STWPmU6y0Er00OXfhg1ttIQ0/hO3DIC6/f/yrwLZn+25DgO0TGCjlt9pI6cWzHn/77pXHd3oWs/HQuYY3X8vbWgvtSfmDpnLlzH1zL+7/r6v3ML5vgcd+oCuupqp957+8ZdeK3ZdX9K2r0KXg3m9fAufRnVpX3zal9m+nVoINeaa+EcREuWl35szTkm+1H7Z7ri0irccABkuu4z7j+JuT9V2v0r97Nr0u7vI6StUd4ePueF5aRF+feNjqHqzfOu6pz0aH7kW6bWNT8x10A9ZzLNujnGusYau3suwCdQniC+Tc2/tzTAXHC/wv22xj6GKIYqRjGv1RMxZMnX0Nfwr2i+9asBbFpDWBzxyTcvkb6ZrsY7/YVHX9IJQF+pU8tfO22/Eh0n2DP+1e09rNnDtcN1xVxzHXqNQsMjr7W73EPbTeTbkBeidOKhk63ofSA9yLYuTW/1bTm20SuzlWd5+1TT8sG9ARl3Cda3LxWXJvwQc7N2gbm554afi87FVw8f0xyGGs+8Qt/7LKAekNZNtJ0e7u2b7dAnYzX0NLzT+Mf4Gxl+P/sznz38CzfrIQ865ULTnphty6/lM92TZ76yRMeo7lJf6sk5Feu831fadXYC6/rM9GGdZv3aV8cEOt5cr+oFVFeiOkxUz8wBT+wx3Edr4Rw+TiPXjGhbidkX+wnmOJzjHG/qoeoo9Vfo1LU0Oj9Fm9/DVn24X5OXgfqngm1QTnoLl53llJeY9J6+UX6G56OBnFNpkVFI9xBeL1qv1pHfQ3gPGewbbfbGkLyllbnhAMj9JPeZuue6H7E/5R7sfgXmPnaKPrf8SJ77Z+6nWzR7sPlJywMr33TFrHMNmjEiZzTW1DV0nQfTzlVF61R+pusayPUB7foBjzHXV2PduM56a5MyMww0wBxxD/EjP/xDP+mP82nkYwxr9PcMYwxYjdVq/Gca45uyyKiGMOk0iKF7vCyTMuxX8pI2H6xOAIzvzL82nf2QznFAjxwAV/rhv96sc40sRK4vrz+vu2Oe11hL3k/wQk200WsjI8h2Mr01ul6d5N1XP21jq2/3mWf7PeyNeWmdOUQXkeji6h3u9XAZHUIYNPktNca1B1cegsmTrjJrmxxElZfprG9bHMrGNLY0xEAdAFs/Bue/cMt6KU+atqBtM1G+ZSsimz6AmZcypB1f3hCoCw/snE/nuIeuh0TKkd6LWXeDHq3H5C+tfqah4R1i9j/Hl2tWPYC9NYHO1KPYmxvWhQ6tcwz+WhZn2J51Y1/ArfllXHvmWJ0FVr1eK92aWOdMGsxAW6OQedKJSSOD9CUx60IblG964uvRQM69dA/38NCa5Z6CBrMv0mAvLo1/iLnHJj3ab92LEt2jRntx3Ztzn6703rJ5FiIj99At2v1WrGXli+QnnenKr7IybR8rUqbyMg2dMXVcaeYEXs6NtGVNn8I6/7k2knYdHbG31lrWjeDavMGciVUDC/cPfGqbv8zPv+PzibmGv+mRcYxhqyGrgZ3Gv3Q6ASivQWz9NIzNq+XkJ9Iv09Ji8u2/feRtAGjKmHdNtO1Ex+NYR8Y/n12sM3VdwuvCa2hp4jPKt9x1W2/SUnCPlgfeNdJ5ZUgnJp3tJh+akPlJm2c7l6AyEpO2PXiPGezHaIxL69wtb39u8vVA8MAQ8xBKGsNJI4gnqeTlwTeiU4a0bSXSr0xLWyfb40A2plGdBpn06Om/nzVYDkxZ0razF62XmD+qWNtJuerQMauDnLOcyzygoZn7B4p1/dFu5W2lLQ8eYo4lx5hjVx+gOsp1gf5Sn9I5F9CsZdbFXd4GqA6AOq+0Y/ui8wvaf8eU48zxp17U1RG39HuXvCb+xl67lSbvGsH+IguakDiia7lMQ8/wujTgOnHUozR880aIDPOSTh78hwrZbo+G14tL4x9i7iXSuddA5z7Uo92vRPexczHrJz2S457Zw9xXRzR7MHlilkue9CnM+tL0Pek6FvNAy9YyptEJtLpJ7M3LFo+6vfw696RdF4mun8C6zlrWeq3k2oQ/Q2gAvXL/wb0H96A+8Qc19HuGv3kjAxkjF6MWgxajGqMfA1vjX9Tg1ijWIDZ9Cmt5+5P14GVa2rKgTgD6hczMu4SmDeol2q5o30HiyPjnvyjElN0nWa8j0/fS5ujClJ+YHZE+FxmEdSptGiRQrhfki5Yx3cPkjWjk9PKqfNOPidlP+pFp6IxLSx9ibuB1o6+HQR4uHkBiHlYa0xg/HpB5qFUaGdZXnkib0Nl2pS0LpmzaNqZxl8Y8NBttvrmgAwNkLFk+5fSMN9vbQuspi7K0YR944wDaSB+Ul+Nz3OrD+cp5zPmFdt7vGXOtQbPWKu/cNDIOMceUY3X8oDpRR3VtoEd1KtZ5Ic28+J8hOIjPDdUB4JyLti325pe+Ox7HmONOfaijI+7VcSt+Y7/Ym1Y+5U8Fyu4Nlq1I/cojnbwRXdvOcim3lpvpl6MB59wRbaXNS5TeU98yD4G1X9kmeeZLj3BpZQ8x9xTo3G+g3Ye20D1LzL3YPS1RmvLQo7R5W+g+ShnpHrLvwk+UTr51R3nwM8/yFe2PSL50YqVJZ0ydSlf0HHSOyJfei8475aXFukZIu34a9tZYY6/BNQkj6bXAayTQM/cb3mvkU/+f++lPrwZwNf5PGf7VWNa45bOAkROAPI1ljWNRI9k02OOZb/uZlk7MctL2D0Nc3jUw24W2/+oGPGH8v4p12xukvEToXlp+zeP6Nk+6h8mDJqSst5x3/47ykr+XplyWtRV5o7T8x0b76TgSl9a5Q6wbuRs8mAdFPWDyQEqag1AnAJtZPQRPpVOWdG3btPliyvZQBjW4xDTqeVOhZ9id+vdtyMo2pOkDdEXze4gTwk2/1xf6mGNzvKC6cK6cvzqvzvcRcy1s0Yc1Uuomb6vutfPWdnNsjjfXqzoBU1epQ+cn58P1UZH1whzwWcDWPNW5o3yutSq3rqHsn/3OsdQ5ZszqoszRKd234jf2tlPlzbceaYP0CC13V1R+ypE3QsvWfPkTpwbQgOuj0pekqfNYYTQO+KO4HPPAQ3RPEXOPlXYvGmHuW3Uf7u1t8LKcdMVaTlkg+6dpafdU801X9MyGL10x86RrmZqu7Zi2P/b3HEQnp6LzQjlpscczr6LzXdG1Ibp2jthbay3rxnVGeoamAXRb70PT+NfAv6vhn4azRi9GrkY2mFGjuxrLmdZwPsWjbcqIWT5p+2hZ0vTJtxLMvxSzraTT8N8y/j/+ox9906ZseYSFm3v7vTdfGzN9Dm6VHeXVgVmu8jO9VSbzpPditgFtvUpvlat5D5Hu9RNejUvjHaKbOFg3+jwQ6qFTDy0PNxADmleYMICS7wGZPOm7HIrWVRbtGNPwSoMMmqe0PcMNo9yyWb8abbZhuyO0XA/r5l/7g9GZ/2FBvTsfzpFzl/PpHAfmOmD+e+nKzzKVtqxY8zPdmluvI/iEHmadpJdW/hBzjI4bVBfqBlRfdY0wV3U+6lybdi3g1HJtn3IG8BYH9ZRRsbada8c+Ow7HlWNNHaiXhqmvpFtWV9fJP0Ujz5C0vGtjrw154qhN88VRucl/nRrorYvkJY2GMi0tqsFTacvdN2Y/oEdxOeaBh5h7CnTuN0m7H22he5d7sGn2th4tT8xylWee+2Qi+yjpxNxbK80+DC8xacvLsyxpo2Uuwez7KVo9bKFzQhnpvZhzvEXXdULaNdRwtN5a1nod5RqFbxjxzX9J+E59+MM9hca/T/3T8E9nwKVGsPUwgDV283V7HQLV6E6DuUf3nAG9ciOe/RIpB40jovbFMltofcrYZtLyqvGvTmiXNyHyBxT5V3wvaQGeGsupi9H8ROhM08aIV9uv9Ub5lV/TyoGfdC23lbaeuFX2KebZ70TojEtLH2Ju6Lnx14MjD57eYeUByMGIoUSUJ+ZBKq+HPfm03+PX+h7MYjW+MMzYfPmF/zS4MdrS+O8ZcMoUa9un0tYTe06I7BM0BwN9Q5/0KefBOXLeci6d34Y57w9Nt+bX9qX3Yu3r0ioeYo7TsYPqI3WUa6bOj/OQWNeLaXTv2sEZwNsuzEvPGcDnHKwl6p6zjrKvjsEx5Tgdv/poWHVlumUd8noIj0BZQ6VrupYzXzT/HDxVd5Qvv2KvbcuQl3Sv7OS9Dg2cWgeZn/RT1w59NdJX6YrLMQ+89dtA7jG577jHiu5NiexbpN2/TiF73jllco8c0ezz5tU9v5d2/ydPOrHyUwblzE/+KZr+UcZ+jvCUbsxX5zkXPTrnzrm1nHmJlnE9JLJuSqxrjDRB/tvUK/7L/QD3DfU+T+M/DX0dAFvG7qV5GMEavNUJgCPATwGUn0azdA/PcQZolNuGqFzSGOPINO8cTDnSIPJqpB1jNf7v8Uf/LrkSvKYuqXt2HRurWAXVfNOWG6Ur3/LgVl6WO0UrZy9WedZLfo+X+Q9N9/oDbysuLf/Wwe+G7yHg4eBBI+aBVQ87DkWeXGMEkechmXTysv7eg9FyWReZGTXeRI0xDLjcgOsv/lteTJmjftuPXr9646YvtEs/NPAxKok4BqphSRnaVv/Oi/O1cTBvrYH7yGPtI5egfOkDc/BnVEcZ4GLM8aoDdQKqJ5A5MTpPYp1b5hyec5/InGVkfbOWevPF+s+60rU9+wHaR9D+OybHmONWFw1TR9KNvc4DdA2Uy5DppCmT6aSzfi1X866V3mr/ofpwrbFMOU9PA6fWlz3eW87y943ZH2kw43JMgzdi7itJu++I7kcgvExLu3edg7nnjerl/niKdj9NzL0Wmr1YXt2Xa16vfOUpay9ujUEd7NGLZUXmAdr5qFjnMufRvB7muoCua6ilc60l3bJuBPJeVWBN8K/88r5Tesv41yFwyvDFsB2V0fit+RrDGL4+/QeN1fBWzrWQ/iir1zd5lJHeg8q0Xqar4U9aw1/MJ//f+Ue+5ROvaqHuGKwXb8VeVcuYV9Py74LXlnlteXcZ2yV1s//SYI1L4x1ibux148/DwwMG7B1eefBxgGIceZB6wFImeVlnRI/agl/r2I6o4ZWIcebmC2J0a9hlOWjliLU90r3+yeuVh8fr/zoeerLRnQ4C+kj51L/z4nw5h85pwzrfNd2KHMpUrOVOpa1POWlR3tuct3/lVbSOZcnvxaXxbziu1AGoXsDUl/OxZ80wH3Ud9NKuGZA1lZ59fweg1nOuxVwf9tF+O5Yc35nznLqE3qPzUR35orJMT5waeKoaOLVWt/IzL+mnPlb7Cvbi0viH6J5SMfcdafekPeg+dldkX1RGpd0zt9AzOvfapHMvhiZPHNHWyXIpcw9NnymXfWecph3zKdwzF70y9bw0nei8g3V9kHYNHbG3zlrWuv6gX01A59wbYPhj5I+Cv/LvE39xy9jVuN0qk3lb5cnrOQG2Xr9Po/oSmr5t9Sn7vpc+1Y9Txr9P/nWAPOAv/r+IayIPHAZkuje4mlfTvTqTd54G1GkidMalpQ8xN/fc9PPgqAeRBxXYO/AwYjFcyfOgHGGvfsqVrpj18lCGrsaXaV6ndzMeGWqUrfKyLWj6sjfWuujFNyRqnmmdABiX8NS/c+I85dw5nw1znqUbe70u4RH2YJapdE2nzKQtB68XMl86Edq4NPrRnAAc6qyPRGjmk7XF2xtE5tg1d856uuM8o9vUG+lrhJFM+bWNEb+Wu0v6VBun8u/S9qw7NfAUNDBa4/LBXlwa/xDz/JDW4POMET17ttD9K5HymebczPS5tOcu9aRH6Hnaw3o/Usv08pMnXettpe0nZaRFx6M+4Ev3MPWac0LZTO+lneeKrotE188Re2tMXivyegLzWh8yeb9ZEeMfA1ejvz7xTyM56ZFRvKfMqC4GcP33gPBG5W0LrJE68qRHci7hZ9vKt72KPcO/PvnPp/44APjRP9b661m1b0fKBdsLIz5lt/KUtaeMZSderoGRnuWDNS6Nd8OYYuHnAZCHRx5CHlpiPfQwgDCENHQ5LGukjoeoWOXsTVfZptMIg8boZyPmxwoxsmv+KWPN8SamXqAzT9px0C/aMN1D6sC3XMp3PpwjD2Xm8RjrHOf8tyK3gvlkSPcweUlnPYWbb1oc8Uf5lO/FpfFvrFv1AaojMHXnXKjf1L3rpYe9NdLj4QhgTbHGeCNAJwFle3JtP/tlfx2D43KejwfTYfwD3TT2rTDSe/KlR3hL6AMx7M8DNTebmRp4Vhrw+thC8ojLEaVv7KG5x0C791R0b9pC9rG6/7q3jXCrPHtk1st07p9Js7+Sdp8dIXszeWItl3xpMOlah7Rti5WXfc2xbdFVR1tzsDcvz8w616TrujiuI9aS0fWV2LLXs1safJEBHe01/Ln/PGX8nzKMNYL3lKtla1oZ6QTQGYCxbH7Fnhx4RsrXMplOusoepa2TCF3jyPCXz1sPjJfoU3/eevgvfuQ/fsP19yIX6RzUq9AAmzChh7lBSy+t7I0bgTwE8hCpB1MeYPUAxAHARqch5IE5Qup7oFZZW2nrVLkjA81XtXn1v1emysm2c7zQVR81XcuTTnmV7pXPdpwL5ycPZubwGJ3Xii37EOATxLep22n5ouVF+aJ8sfJN70FkKEc6cWn5h5g6UC+gugJzXlLHVf917klrvPfWyoiH4c/NgJ+XVLm1XfuU/bT/jslxOu6GqQ/pxr6hN9IZKHfXcA0Zd+1Dr/5T7Vevr5P3dDXwEtYRY9iKS8tfo3tLRfeeHro/gXW/rXuuaTH3uR69t1zWdQ/tIfst/Lrvsi9XXqZrvmmRsklb17YSe/2SV8eR6aSrXkyD14i9ea5rgnSunSO9tdZakfVMgn5xgTXw3/7j/4rb3ZPBb/41cPOpv0ateXux1qtp5VS+aZFy9UcBMZAzX1mieaL8ilv5W3kpx3LgVtTI72HvW38dALz2zzXw4hbolQf0Eg7IK6vkyYtzznKjXlqvSYOHmJt9HgZ5uOSB5AEmegCCPPl3N8ToJs1GmdEDVJ7pROg9URk9xFDDKMMpQV90SlQDrtbNdh0jmDrYQ2fdc+mU7zw4N86X89cw51e6sQ+BdC9UvumKte6p/Fr+VFp5tZx8sMal8c52XuUc5BxL13VgmvUCXdfNKO0bAaAyQNsR7Y9zXeeZ+d4x1+hNXUFvBcuJlO3RPV7KPZWfZSc9NTA1cL8a8HrsITzj0ug1urckesb00P0JJD/TSbOfkXZfuw9k71Su+yjI3ipW2n1X7O3J5p2Dtb3sz4jOvkuPUN2ab/qaWOc71wRrhnSunUa7pvZgK/6yAr8Sj5GMsYkTgCf7W5EyGLW+9p8GbqU1eOEnXctdI618EIPYNwCgMZq32rBu7Wfyt+qfykPOntgz+JOXT/1xdGj4M9bjN//Ly1qdczSvVQNsxoTErQ16aWXPNqQ4iPJgy8MSo8in7TgCfOU+DaEtGllbB7N5WzLSYOOJLL/YTp9wBFBPw60nI8eSY/TwFUeHr/mJKecUnfWgsx0PaQ9n5u4YR3Pcsu8cci31hJlPXtK9sqd41k+ErnFpvENUF6D6qTenqdOq/5xv115vXbhuKuZact1ZBgcADjAdAdlW9sP+OdeOI8fmeBtWXairlnVD/8kn7xrhPmReo19TxtTA1MC717/XKZhxaWkiPPDG2Z/7jXtQD+s+Zdp9zHPLNPnJM21+D/eUoV7uoz2aPRd+7r33Qffa7vHsc2/M8Oq4ScuT7qXh1XMvy4/o3vzCy7UA7Xo5omuKNSQtNtZ6DsF7UQHd8CvxGpHi3/nk9xyeomNgEk1f0xjWYK4yT6V79bKONIYyRrERB4d1K1LHejVvK71VJ/NSvnTFNPIr7RP/avynA2Aa/y/q0pyD6WjADTgRemlRhL5xI5CHQh4ceWjl4VYPVD8D8E0AfhNg9Fp0z9hCnnzpxKQt10OML5/880NtGmJpqGU95BpzfDnu1McWnXWgU96IrnVSvnOSBzPzdozMZY2NtQbyrhnuIu+cupYFa1wa7xBTJ+oJTP2lbqv+nfOKuTYqXddQTWd51p0/jgnqFACJ1KV/9tcxOC7H2bDqoLEOvETovUH9Uj5p6/d45k2cGpgaeBoayOtUGhzF9Ymue0wP3YdE9qfcV5Pv3iW6n4nyK+a+bNnK20qzl5Nf93TT7OnSYN3jR+m9ZS2XbZyie+NBLz0+PHWWtLycD3ngiF/LOIeJvbUAr62nJeJobclvRbtnCvxnGX79e77wq3xCnoakToAeYoBuGcTkpeF7qux95Gf7GP06ABhj5mXbI/6oTK/8iCe/h/CI1eAnnUa/NOMhOl8gefPX/p/lJTg7PdAAm65BuoduzolLq3jDAcBmnweCh0YeUPWQy4MU4yd/dV9HAMY4T+Q1xDWSesYT8sivaB35pivSBk/+fQsBQ6uWyXT2P8fmmNVBYk9HmQ9t/XMx5WQ7Hs7M2THmXPbmvBU7Oyjn7IpXqpDtS4M1Lo13iOpltHZ7c5HznPMvzfo4tc5yDfXolMU6Zx3iDOMHA9s3Kb/Iv32EJo8+njnX6qap4WqhJ7PHu1qDU9DUwNTA2RroXZPyeggv49LSa8z9M+ncj7boPK/yrJMPb4u2DmUsK28P5l7eo9mH4bsfj9AyKSPL9vKzbNL0m3RiHUuOV5oylSYtT7qHOUe9fHmUg87y0Dn3lc710uhcS0m3rDVPGnzW4au/7vO/Pg18DcrkJW3+6Cm6xm0azNKZl7T5Ys2r6VE5+YlZl77r6MCwtlyWkVdxT5lah7T1egiPSF/E6gDQ4E+sxr9zwb9ofNaLcXZ+auAMDbg5U0U6cWn8Q8wNPw8GDw0wD7A87PKQhMag8Zf3dQCAvA2A4YNxjjOASDmejPYMqOQhl7SYeUnTtg4I2qONzK909j3H5Fhz/L1DM3UFXcsrZy/W+infOXLOGuZcQhPEt6nn+TfHIA3WuDTeIaobMHVW9ZnzkPMNnWuh0nXdnErX+qapxxr1zQAcAjgGcm3lWBxfwzr2xlrnOnUEfxQsl/l7eVln0lMDUwNPRwOjaxj+KC4t7xBzv5FmD5UGc0+tdO6x7q/JO4emfpZX3hbWfdy9vKJ78AirHMpV3p70Vl8dn+hYL6ljXeeDNLQobblE6yTmfCftOgkcralW5NaZBO/Zhi99zxd9rQY9Rn7SafRXmnJEjdqe4SvvWmXSmFa2mG0kXfPJYyw4ATCozR9hT9aoLHzL70HKVGM/02nwJ63x75xQ52/97b/25mj89/bKZ7s+Z8enBqoGXOCJow0b/kLMDb8e+HlweFDlQdg7UDFy8vcA0hGgMwADneBT0GpUIbfyTPfyMKTS8YBxRT+sk1j7nONxjDnuPChP0VlPWpkjtFxitpPz45w17M1rY7+sQ7iMp455afmHmDpK3UGnXnMOct6l69rINGuot/bkZdmklQ3W9knTP/uc43BsDeu4TbesGaYGpgZeuQbYDwhb6J4hLq38GnPfkc49STox99Wk3dOSdw7tHmkd04m5p56icy+Gpry8U3X35Ge/TtE5Jmmw1pMnkp/lk2ZOSCc6T1nOMuaBzvUIc4002rVTsWWtedLgsw3oQyPyXNRRgGGav/q/ZRzvydNwtmxNn+KbXxE5yqLPOAB8ai7fOjUtv2KWS5pypsFKy0tjv9Jp8Cedxr/9x/j/4R/9c2/aQlye7WKcHZ8auFADbNSExLp5Ly3/hhMgD4g8QPKQyoPRwxTUSOIpJz8EeLDyN/7gCDjnLYA05KX57QHeLqAZ5N238e9hmXqqdOotaXWYvEpXWbbHPEWs89iy1nmGfu7BNcs4pOuYSS9G9QRWHaaOnQMx17J0rum70MoTbRO0T9lXx+CYGvbG3NiHoF5MJ27lZblL6PuUfUl/Zp2pgdekgVPXn/ngKC4t70Z07+lh7lFJu4ddG3N/dM+kDelE99Y96F5OWeg9dWoZ2oZnH5KW18NTOurVkefYUwbzYDrnRNo80LLmJfbmG15ZH6N1VPmt2npeQz+7gM75VlxDHgdA0nscApQnbhnG5mkEp3FcacteC7NN25KXfZe31e6eMrYhWgesEYMf3l7DXyeA/abeT/29v/Hmx//mXz18889af3aLcHZ4auBMDbARG3p03ahNL63SIeZBkAdEHiQeSHkoeqiKOgF4Ks+3zhv2/yGL1/Y15s/FdDTgcPAX/1OO/aqYY3BcOdbUAXTqp9K1LOmUdQ6dsrId56mhc1exZR0C/JcSHEtiHTfphZj6gk5d1jlwzsVcD9J1zexJW7ei7YDZF/uYfXc8DXtjVRct+xBqWv5evGv9ve3MclMDUwP3p4F6HZsGa1wa71ZkD4Kfe1HdR92vcg97CDr3T+i6v55Ks3efKjOSm20jI9OVvkQXVQbpPXKcC5E60BXNr1jnuabLGqlrqKZb8dX4J+9ZBv7V33/xI//x4XV4jMo9Bn91EljPJ9E9A1ojuJe3xRvV28MfldEwBzGo6T9ljbU/e+SkTMsrr4ca/uTtNf596k9/6Tdt8tT/4x//xBv+a0NbgM92HT7Li2d2+sloIBe+NNiLS+MfYh4AeVh4GOVBlYdpNYx0AvB0/5QTgKf3o9f105CvNHX4zh/Dn98WwOFQy9Av+5J9zL7nmBxnjh069TKiax3SytuDvfrZlnPUsDeHjf1iNjvXK2PKIL83fniLMfVW9ZpzkXMvnWsjaW8gcx1VOstLK1fM9rNv2WfH0bCOtbHWeVYf8M4J59Y7t/w5fZllpwamBq6vAa9ZcBSXlrdG9h/SuQ8lnXtV0rmfXYtmr1RWpd1HQfbYiu6756Ayah3bsh3TI6x9ppy8HtZ80yJ1ku7JYC7gJ+b8jOic2x6da6PRozXU47fi6xkF/awCc+2//NOQ3+sEyHLWxZi9y6cAGs97jfBR+Vq/Z6BbBsM6DXL5PbQ9sZaBvxWzHcrtMf41/EH0TB2f+vPKP/+54VktutnZqYF70gAbNCGxbtpLyz/EPAjy4MiDhwOJmIdlNYTSEOepvN/8j94G2PMZQMqExgFAPQz/6kCgPz3DH37227HkIZvjhk6dnKJr3UynDpPOMklnW87PEev8NfY6v9AvLbh2GZd01YHppZU5xNRf6hU69Q+d60A618mltLLE2q79yr7a/yM6rsSWda+BtmaYGpgaeH4ayGu30rmHJL20Ya4x96JKu19VrPsaacuYR1r6UnQfPYXs15QZ7dtZ3zLJS1pZyYPeGsOpfOvWcjVtuR6mPtX1FjKX5Oec1rR5uR6OdK6XPXSr9nzDe3/Te7/94z/60YNxqSGfxv0WXcuTrsax6RFiRJtXDeqa3lNubxnL+Vo9aXl72rWs9Uao0d9DHQD2oYca/iBt5FN/1vDzXXmz51MDd9MAm7MhaXimexv40vIP0UMAzAMlDyEOKqKHJ7jlBOBJ/ZYTwM8ANOTFavSfSm8Z/tX4z4M9x5ZjTl0cN5bDE5KerrJsyriETlm2e2yzN3c5r63YOs/QLyU4RsYjPdLF0socYtVjnYucd2jXdcVc53voWp90bSv7kv207w1742vsG+PPNPQMUwNTA1MDaqC3hyRvaQVNQ9+IuS9Js29B5/41otnzyBOle+m6P47Svb0VXp7nWUa+aB7pyjNvhPSJvB5u9beXZxspa4vuyUhenQPn61ysa+CYdo30sBV5WWcSOvtz/+l/ePhBPAz4atRvOQDMyzrQ1YDeSmtIU2ZE762f5VJW8ns0ZY29fHmWuRTTCbBl/Pee+mP4Ez/1yb/0hn/ZyEKcYWpgauCmBti0DdK9jXxphQ4xD408WDxwPLw8RMEtBwCGO06A0RsAfCbQe4X/lMFv/inDf8v490BnbDnW1AG0uulhLUs6ZZ1DV1mlvd68tSLrAQz9GsLWOiZvyZg67c2F61p0fY8w1/2em0jlitmH7Fv2udG9uc5xtyIzTA1MDUwN3NCAe4TM0T5S+UurcIjsSdC5N1U69zBp9jdoUf6IJ9998RR6Vo/25crv7c3yxFqnlz7Vr1P5yKxlajs1fyut3lK/la7zNUo75yewrhXTrdqNc8o0SKDcswzo/4d+8NsPvwHgE2eM+zTsNfb3oE6A+jkAhnMa00lXozrzpMWUs8UzD+zVyfxK1/5spdOwp5zppDX4wdGTfvhp/ENTHsPfH/rjWnqWi2x2emrgnjRQN95MS4M1Lo134+DPgyUPJQ8wDlJjdQJomGuo8wv9IycAeZbzDQBR/hbaVq8P9k+076BjynHWwxKdnIq1jumUe4q2TmJpt85XzmUr+nwPXDq/IzheiqqLpOWBS8bUKXSdC9dBxVwre2lk5NpKmbXd7Ff2t9E5FunGXucY3gxTA1MDUwN1LzBd9w3TW7g0da4x9yf3TbHuZaM0+1/m1bR5uU+O6L17cC3H2Q9PrPmmaVdaHPXlGnzayDbPkaneKtY5yzRzW9Mx37kuXAPJ69Gt+q0zyXLkPdvA3PzAX/zwLSfAHoO/VwYnAMZrNaxrGiMZXg8rb1RXfi1P2phtWF60zDnI2CgvWjfT0qCxZ/z3DH94PvX/kR/+oZ+cT/2f7aU1O/5IGmBjJiS6WYtLy79xSOQB4wHl4QhyqBKr8V0Ndgx6XvfvOQH4RODctwDS6Ket2j5p+yZmvx0L6BjzcIRGF3tjrZtp5JMeYZaVLu06P4mtyDqX0K8toAtC6qTSS8s/RPWa6Lwn5rqodK6fHk15+LUe6WzDdZB9sZ8N6xhynC17hqmBqYGpgd0ayP2jt7fIW5rEWzH3qErXPe2ctHuiaF3TYI3urb29Vx5nfY+WV9E2kg/PtPlPAdER/VBXFev8mO7Na/Ccf5D5z/SIbsVulZMHEqj7rAO6xgnAfwbAgOcJNMb9njcBRmV8iq2xnajRDA9a3KIzr8qyfkXbuQb2jHrkypfW4Bf3GP7qXMOf1/35Tw3PelHNzk8NPIIG6mZsum7wS+vbIXp4gHnQeBB6QGpcgz0jPB0BOAH41f6eE+Azn/lH/zSf+iedMpJOJ0BtO/uVNwX02zHUwzTHrB7OxZRxKV3arHNkuhVbD9mcT/gvJTiuHE/ypBOha1wa7xB7c5LrO+lcJ5fSKS/p7Id9O2Lte46tFbk15/BmmBqYGpgaUANbe0Zvf4G39CL7FPzcr5JmTyOde9uIV8ucSueem+e29x4V6zlf80dp26n58h8L0Q9tJ/Z0pv5zXpKOec15Hq2DS/itie65hKxnHVhTf/Z7v/3v80nAX//EHz84AUbGfe/J/4iHIwAjGAM5DfdqrJ+b1qiv9WzH/EtRA15EDnRF83vYM/7Rh1HDn9f8fd3/wx/8gx9l7T/rxTQ7PzXwyBrIDXm00S+tj4eYh4gHj4dhHpZpbKchnsa69Ac+8IE/MHIC8F8DLHcKLzX+6bdjcExgjhVaHQT29HXQU5Q5pKusc9JVVkv32pXXsmdoGlAfW7i0cmvszUmuh0q7ZvZirZ/p2nb0a6v/rdgMUwNTA1MDXQ2wd4yC+wr50hWXlncjsk/Bq/vVKD3a45J/Lp37rfcc8KQvQeunbGnlmQbpc6avQZ8r0/Ij/fXmJOazzvV9pVuTqyMA+kUEdKsTwLcB7uoEwJng2wQ6AzCWdQakgS5PNK8a+aM05c2rdC+tfDANePnwal6WSxpjn3TP6Jen4Q+iVw1/jH/0jn3xIhbSHMTUwANqgE2+F5IvXQ+EpVU8RA+WPHg8AD0sQZ0A6QBIIz0NepwAPPGvbwL87M989hfJo+w13wDIftp3MMfkOEHHHqh+0Am0KE36VkyZe+iODNtNbMXWQxY+QXybej1/c9zSidA1Lo23xt685LoY0bmO6loa1em1lX1pdO2r6Za1zjG8GaYGpgamBnoayP2h0qbBUVxa3hrZs0y7f5GWPgfZF7O86dF+6b6ae22e5XehU2bSykzetWnGq0xpdSBfrHzTYupT2vlx3hqO5vpSfhN5Q2amoQnIfknhHYxR/kUgTgCN99ET/srf6zDACNbA1uCuqCOgIuV6hr68iinXNtN4H9HUG+VtGfzU0egXNf6r4f+xj31s/rr/S7p65lienAbcoBPzQFhaj28c9B46oAeUB6YOALDnBEgHADSG/s989rM/W50Ae94CSMdCbSv7AW3/QPsM5lg8OEXGXSJ6gZf6qTzyhxHZ5FfcqFPbynSr9uIOWMa0J6CHUTAvddWjlyZgjc57D3Od3IXuyc4+NLrXzxxPK/Jq55yxzzA1MDVwvgbcV6jZo+UtLX8z9vawa/FO7a15dueZfgmdsqC9NxBr/rXTjBWZjll6hJbrYU//ZR6d3/vA1lR3TcF/kYFX0fkWPR0AGK97Dfy95TCMNaY11EdGN3yNcssmmm+ZLTnmnVPWforK6KXhGRkjT/vrE//jd/7Li1xAc1BTA09QA6PDYWl97ToBPBTzAE7juxrmGu3pCOCH/6oTgM8D7vL0P/twZQfASEfw0ZMIfde41VYTf8MQpOxrD1UHphOha1wa70bs3VDJ692A7eFZv2Jpu/atplvxQ4A/w9TA1MDUQNVA7g1JUy7T0KO4tLxu7O1flXdpemsf9V4jUWPd+w/ypBPlW9d6pvfipfVG8h0v+dJ7EP1SbqRn5o68mMPRPO/lN1HrWpEWkSGdmLRlDgVfwh8MVA1XjFmNerE+/b9LGpnpDNC4BquBPeJlnT30XuN/q33zQGn7p+40/HmzAp1yjb2E9THHMDXwlDWQG7J0IrRxafQheuDkIeXhlgduGuDpBMDwHzkBePXfNwH4jwAf/WMf/TPpKKi0clI+dLa91/ivh6njDVQX5+BBZyFjb/pUG03krRs5eDO81QD6y6A+4Un3cGn5t6JrfoSunYqj8snvtNfrVys25xslzDA1MDVwkQbYVwzuMaSlR7i0Mjci+5c897Katoz552LeXySd9xrQec/Ro2sZ01WO6YfEHFfS9CHTPfqUPp2PI47m9lx+E7eul6SVIw8kwH/R4de/5wu/in9HhxGLYYuRrqGP0X6OM8CyonISyaONnjNAA1vU0DYtVuNfvljzTWe+tGhbPYSXzoQ0/KF92/dFL5Q5uKmBZ6IBN203dXFp/e++BcAB5cHpIVyN8DTSt5wAP//z/3x1AtT/CFAdAKZTtnS2b59A+1kP2XqgMtYS0QM89TFCy4hZDt4oZrktuolYD1bKzbCtgaoj01s6Jm+psa6RrTTXxCgfueRV+S19qk+tyDr30DNMDUwNTA1sacD9zjKZPrXfLK3SjTjYtw5l6n5HXXnSoNG8HvaM3jy7k/Zcr+e86Sy7h877mVF52xzl9/jK7Y3tFA8dWaanL3jqteCpOT4nv4lezx/ryatp+DVQ5iWGd3hyzRNsfrAOoxgDfcuQT6N+RGd9adCoIyCdAT2DXAO+Z5xnecslT7pilWW+MkCMfg3/avST/s4/8i2fwIHyEhfEHNPUwHPRgJuySL/dzCsuLW891PNQ8sDz0AXTCNcwT9SAT+Sp/y/8wi+sToAf+IHv/yuZL40c6JQnne1CZ5/sp4epmIcqY+zEqou9aWRRVjxVb6tcE7MewNAE5BmSlvdaserCdA/hjeLS8m7FXC/n0j15R96oDy37xjz30vBmmBqYGpga6GnAfY8895mk5SUurcDuyD5Yyycv6Sw32j89m0XP7kQN8Tzj5WW5vbRtibXeXWQrC9nQtrEXR3pKfuq10TmXl9BNxHruWL/HG+VlWegXHzBoeaLtv63TUMZIHxn6l/J1BIA6AzTA0yCXFi2TaJ5oXk3Dh9fjWwej3/Fj6H/8459Yv/E/PPGfv+j/4q+DOcDnqQE2ckKim7u4tPzVCZCHlwdcHsZpjGugV9SoF9MJgDOA3wgwr2KVRTrbzL7Yv97hu3GIHsZ71Ik6eAxsXVgPdGlwhm0NMFe94BySJ72FSyvXjbl2RjR1yRvIGLXbit+4FjMNPcPUwNTA1MBeDbDP1CBvtAfBX+4rjvZL+HlvAZ3nd4/2rM+8vQZ7ttW7P0iZd6GznT30ln4yj/khXeZpa057ea36rbMwedIiMqR7+Db3Ff7lHpQfCuRX7DGGifz6PkYyxjpG+6WGf62nLB0BGuhbRnqWkdaA18gXzRezHLTjq0/5+ZFEeTzt5y2J+cT/FV4Mc8jPUgO5uedhsbTRrA6AelB7OHoYg2mQV4Mdgx5eNexxAvA7AITeDwJap8rLtqCzH/YNzMM3D9LOIXoYbxszOoBOXdw33Zq7ZQCOePBnGGuAuSKIb1PvpuXvmdOlVb5mpE3kbbXdsm8F+3wrYzKmBqYGpgYGGnDf6OHWHkTeUmKPRxn5FWv9NV3P4by3yLN7RGvsi6Nyyc/7APiZTjrr7KXtB3K2ZOc4KdvTwx5e0/mqy0aj9z2xFbtVTt4IkWte0kf2CuZZds14RcQ7X/qeL/paDGB+K+Cn/t7feEP8f//D/3KNGNbVqL9GGoeATgHfEBgZ8fIrYuD7Kr9P9jX4QQ38RAx/oj/qx5p+RfM9hzo18Kw14KadCJ1xaemuEyAPxzS+0zCvRnsa8+kI4FUqnQC9TwF6crKdSx0AHLaMrxNTB/dBtyZXPUsnVpo0gb7McL4Gqt6cUyRJn8Kllb1LHMlvYtd5pQyh4lvu/Ds1MDUwNbCtAfeOWko+uBWXjXzyakRW5ZG+wc+zdmTkpiGedN5r3IVOmVt0tkG5TJ+it+SSx9gtM9LDKX7oe2seySNs4VaedWuZg9COXPkTmwa4Jz38XkC7t/30P/z0L/HD1/zuFfHnfvrTh7cE9r4h8Nc/8ccPjgOw0vJ6mM6FdBBg7POWglFnhZiGf8/4/+Ef/XOr0c+9/5zwqYGpgeetgdzkoY1Low/RQ8nDC8zDUCdANcx7xnvvbQCdADgC+BQgnQU9GdmObYPZp+wrtGNIdHwFGT/jVg97sVXZPHDNR16Plvc2d/69qwbUs3IyLZ0IfSourczeeEqW+U3kum6gZ5gamBqYGriGBthjCD10/xnhcqw3yt/iU7cb8/xNup7Xmc5zfS9tfcpLn4N726nlRm0wVvJyzJfQR71u6X4rr1VfzzhpcU89y4IZqDtDRwPMOc4A3gzAGYATgE9eudcFdQr4tgCGuT+ql0/qfbq/F63rq/zIxcinD//1P/vHb4jQxGr8+6TfJ/x85sAYuBdvQ1w6w5ysqYGpgWemgdy0peshsLQxdd8CYGPz8EsjPI1z6J4Bnwa+bwPgBOBTgJ/57Gd/9hu+4Ru+McukjCo/27Y/YD2IR4ct4+vEqoetdKu+HqqpR/lbSF4NypBf0/InXqaBqk/S8qSvhctRdk8evc92e2l4M0wNTA1MDZyrAfcW65l2L4IvvReXYx0x68nrIbw1js7iemZnup7tmfa8F703yfrS2ba8ROX2eOaNMOtUOttNGr1kuken7o506n1Et6Kb5wv1CIk9WVnmUKHUkdcrl3mvnvYzAQxsnq5jfPN2gA4B7n9xDGQkrxd1IPTyKo820uivBr9P+nm6n9/xsxZf/aRNBUwNvHANnDoAljb+G4dUHm4ehmmIVyM9DfikfRtAY59PANgE//qP/dhPZV7WqbKzXfsCZh+hewerPMZXIjqB1zsQe7xW9MZBSvpUSL1T1rT1alr+xOtooOrXdCL0KC7HvBGO6lX5TcwhyDcN9niZP+mpgamBqYG9GnA/AZOmvrxr4dJk3opHo+LG/YTnMOhZ7fntmW5alJ9o3ghTvvSoLPyUvUUrgzLSiY4PnrSIjqR7WHS4Z25alRtzaVrcO++W7yG8DMpM3qQHGmCd4Azgqfo3f/PX/GcY3XxLzy/p+4Q+3xTgnjhDdRBQllgNfZ/u+1o/jgee6vM2Au0djP3W/ld/3ed/PffVrbtzHgdzNtlTA69BA24AYMalpW8cVB5weTCmMV4N9TTik05DH/rjn/zkp9jseCMgy0lXudlm9sX+iaPDFT5j68Qc/4hu1dZNkzIZTI8wy076cTRQ54ZewEu+6WujbSVWmvQMUwNTA1MDl2og9zJk9NLX3tuQtxxj0od7CPi981ieZ7bouZ5p6UTKZVo65UqLlgFrfdsVs2yvfOYjn3SibSaqp+RByw88Z45atRvzTF1CD7fk9uqMePBnuJsG3mGtrc4BHAQt8gq+kR/O5t4YI17DPtHX9zX2fX2fX+ZHduvecrcuztpTA1MDL0EDvcOAcfUOhKXxD9GDKg87D0gwDfJqrGvEb6FOAF5j4vcAkGH5Ki/bgs5+ZP/OOYgd5xHRBePu6SR5rcitwxXeVqD+DA+ngT36zjLSidCXRkaasjINTTD/bWr+nRqYGpgauI4GentL5ZG+dlyazDV6/7AH6xnO+b6Hl2VOtZNlK217IvnSYq2TaduGJ52oXpIHLf+I585Hq7bOofRedD2I1KthK6+Wnen708DC/XB1FhzeKjg6Dsi/v+an5KmBqYGXpgE3d7DGpfFueO7zsONANKZhXo120hr0I9QJ4O8B9GTAy3ZsW8y+SdeDtpdmjCVWPdR0Kz4NN5TwQgLza5DewroeahpZyTNtG7105k16amBqYGrgGhpwH0IWtEE60bLXwKU1tOvpv2eyZ7bIuS69hdQ3X1nyMl1p6/Rwb9tZt8qvafRhzDx5R0T3S4uXzkGrus4zMgg97PFGZZMPnUE5yZv01MDUwNTA1MAT14CbdyK0cWn0IeaBlYeexjeYxnnPgB8Z//J1Avh7AFVGyofOtrcObPpOn3MMSTvGgupghK34rYMVHoE6e8LecntkzTL7NbBX75ZLTJoWSfd45iVWupeGN8PUwNTA1MB9acD9qsp3L6tIucobpZdjWfAQOWuh88zt0XlfcQndk7mHV9vaupeoZWu61556aIjOlo040ukefhO7zpH0KURultmi35Z8+9d6yZv01MDUwNTA1MAz0EBvA5cH1rg03o0DPA++NMSrkV6NeNIY/KLGvzydAPw4YK1bZWe70tmvHt07oOExvk6sejDdih50BM7wvDXAnGYwLZrXm/u9PGT05ClbrGXkT5wamBqYGrirBkb7i3yRdqBrHPFrOdJLRs9deaYr9s7sLV7Wp1ymz6W32ql558g+jrnqKPWjvixDXuWZtxebiPXMoQ6h4oiX/KStD2+GqYGpgamBqYFnroHc1KXBjEtLH2IefHkoaoCD1VCvhnymNfxF8nQC8HsAyIJXZZLONqGzP5Wm38nLcSTtOANTD5VuxdZDFXqGl6cB5vySkPVG9CVyZ52pgamBqYE9Gsh9p5Y3T8x8eXuQMr24NH43ct6Sl+dupfOslqYMdC17jbRybauH2Y7l5dW0/NBB6ij1kvxr0a3Z9b4EmQTxbep2OstYVrTOxKmBqYGpgamBF6gBN3uwF5fGP0QPNzAPyjTIq8GeRv8eGicAbwF84AMf+ANVlulsTweAmP0a0TmOpB1nYNVHy7p1oMKb4eVowOvBEZnei9SzrDImTg1MDUwNPEUNuFdVpK+VRzp5pisurdxmzHNXWmNaTH7lmXdNzPuFKvec9jtj7+kHHjpKrOX2pJuIG3NySZo6NdD2DFMDUwNTA1MDL0wDo81dfj14ljb+Q8yDMQ/MapRrrIt7jH+f+OME4N+fgNYXazumsy976RyLtOM8YtVD6qcVWQ9e6BmmBqoGXC+VP9NTA1MDUwOPrYHR/nSKbz7Yi0vjb0bOW8p47vZwy+hWfspJXvJ7sivPe4bKPzedY7I/DXs6uk9ea/JGoK0akiddMeuYl7xJTw1MDUwNTA08Yw24sSdC17g03iHmoejBCWqMixrt4rlOAP4PKp8IWB9Udg/tQ/bpFJ1jkXacR6x6MN2yZ3jlGmAtGJKWN8Jzyo5kTP7UwNTA1MC5GtjaezKvR8sDt+JyzAfXyPlK2nO2Imd15fXSykjZlbaeZU2DPV7mn6JrfdOibZA+xi1d3SWviT/MQ2LSyDZIi/CTtlziqfws+2Rp5uNLfs3nfLh18EmOh7594ed/7p98qv17shN73Y49ybVx3SFOaVMD2xrwIkiENi6NvnWAp5FdDfM03ivtE3+x5vMGAL8HQH6Vm2nbh1dpeYnSlgXroc84Izp+sWXdOEzgz/A6NDDn+nXM8xzl1MBr0cDWnmZeIvRWXI75YDfW83ZPeiRrxEemeSlfXsVaxjTlKp11yct0odHT0uKWvu6a18Sv8qEJyCSIb1Pv/k2+tPhuqedPLd/5R77lE9/7p7/3zW/58l/3qV//ni/8qqc2JIz/X/7Lf/mb93zB8ne5N31q/XtB/cn1Db0nOvysK2/i1MCL0EBvcY8ujqWN+BA9FME0pqHZyDJW435Pmvo4Afw9gJS3RduXPWUsC+Z4Ood61QcT39Mb/BmmBqYGpgamBqYGnpsG8kxLmnFkGnpPXFq5W9HztZ65Nd2rGzzbRz40eFbMfvTqmt/LO8GrfTN9LWzNr/OBTIPyTYuWEeW/WOQeE+P/537602/+9X/3c2/AD33og//61y6/8i+T94QG/s7yOf/mT+ME+LzP+7w3X/qeL/raJ9S3594V17vXBbgQ615T05ZrmHVbcoapgZepgbxYGGGm8yJYWt4h5kWTxjR0NcD3GP21DDJwAvApQJVn2rZE+RXJRz586BpzLNCO8Yg5fumWNcPUwNTA1MDUwNTAk9WA5/hdOpgypD0H9+DSGr8Ve2du5+y9Va/JGrWZZSmTaege75IyW7JGfdvit64N77dG9Xp14BmoRxDfpt5Nyxd7Za3zrJC3Rj/1yb/05sf/5l9988M/+ufeQOsIIP3b3//+J2Vo82YCDgDj/CTgzsuNNZ1xNfjzvr/aCKazjHtUk7cUmS05w9TAy9ZAXkRJL23Yh+gFAuaFA+0FVbEa+jVdy/uZQOX30qfatU7tK+kcC7RjPGKOH5pQ8S13/p0amBqYGpgamBp4uhrw7KKHSffSlWf5ROg9cWnlzo3IpY7yk655lpFvWdBoGdM9zPo13/pZJnlb9C9rwfyk5YEjvmXM38KDkPij3GANyXPKDoU8Vgb3i7/3m77+xzH8/9bf/mtvPvaxj735wR/8njc/9ff+xo23AZ6Soe2nADoBeCvgy77sS77lsXT4DNt1zXqN3DD6ve+vtsaptPXSPmi6WVq0nWeoqtnlqYG+BvIiokSmXfDi0vIPsRrO1bj2IroLcqH26tOW/KTlbaHls791LI6xoeNObOwZpgamBqYGpgamBl6kBjjvMmQ6z8Jz6KUJpDy4FZVJGelTuLes7W7JS1m98pm/JaeX98tagE/Ygz0Ztd5baTf/WkauaVH+i0MM6A/94Q/+M5wAvA3AbwHgDPj5n//nv8hnATgI+G0A7hGfwODf4XcAdACI8I6fBbz4+brjHKAf4i3DXyMfx1BG3rzoxSwDbX3WCbaCNgJtHducc9MUMcPL1ICL2wsscWlDPkQvCjGNag3tLWN8ZOCP6uyRaV1li/LF2lfHADq+hjnulrx1aCcPeoapgamBqYGpgamBp6QBz3P7VNPyK1ouMWnKkz4Vl1KGtDzpTKc8+cnbS2fdpK3f45l3bfxlLfRknuKbfw5SlkB7vZD8pHtlnx2Pe7z3fcX7/gSv/uME4E0A4qf/4ad/CScAbwV867d96889haft3G/6ewA6AER+H4DfL+C/Bhx/zPCcuXqHe99nN3mnO6wOwHe8b9c2YMwa8xr6X/C1/+H/hci/Gv/4Jz/5qb/+Yz/2Uz/xEz/xT4jQ8Mj78Af/4EcpZz3laEPQhu3R9jGe7vEsMTXwxDWQFxVdzcUtnbi0MofoBSFWw9oLU8P7Grglk4u1xl6bvX46BtDxNcxxSzf2DFMDUwNTA1MDUwPPXgOca+cEy+d5KP2YuLRB7G3/nLIjmejMvKTlVbTMXqR+r+yRPWFLA9wH/sgP/9BP8jYAT/55GwDkbQB+HwAHwf/uf/+7Psn94ZacB8hbem8C6AgQdQjguDjeo65dYwzw+axAh8Lxc4e1zAsiuC4OT/21BZhrDXYMeAz5H/iB7/8rn/nMP/qnv/ALv/CL//2//B/eEEfBfMpSB4eAzgDl0gZ6ps2wEbxGX5B651CmBt5qwMUN1rg03iGm4QzdM67l9YxxeV7Mp9DyI/RCTZTOOvZJzHE4toZ13I114CVCzzA1MDUwNTA1MDXw0jSQ9wGOTR5pz0hpUf594xJ9uM+2HNcIaXuUdy5/JGtLzqHx4x/ry6tp+S8aMQZ5CyA/CcAR4A8Ewv/IRz7y5im8DUAfNN41+rcQh8AoH4dCm9hrzvk1ZV265ugDcTX+ua8nYqQz1zzF56k+hvwpY1+jv1eOPGQgC5nIpg3bw2aYToBLp3HWe8oa8EJPrDRp4mJM41law/pSxFinbhrtIx58L86kK68ny/7Z77iwGZ9jTWzsG4G8GaYGpgamBqYGpgaeqgb2nFOnymQ+tOnESlvuuaLz6bhI92h5e3FLrjIsU9tM/jXpXrvXlP/gst77m9777TgBjDz5/wvf+12HtP8uEKcAT8y5F3zwDt5s8J1zHQHVCYAToYlcboq9PGV/HvnfFbIuiQfj33t8DX+e1vNKfzX8NeR5qu/r/rwZwBN+IrSfBeTbAukU0BGQbwRgV9CHsBXs3+WKnjWnBp6gBjwQXOAVl9bnQ0wDWlrj+lzk4qKOaH3SW1GDP7118rxos75yRfsdFzZjyzG35Hr4qxt4M0wNTA1MDUwNTA28Bg30zj55p85L89WT9Uj3aMuPcDnWG+Vfws++UL8XevzKMy0qx7QIP+lMJ1+6YpVremLTQHUC4AzA6Cf6nwKe0m8DMGk8deY3AKqBv5XmyT/3stecdPphm4/0WQFr/fC9P2Pj/p17eY1/DPlP/4t/lTb74ek9DoF8lZ9xnIoY+dTpORNwBJCHDO0L+nLU90Ifr6n3KWtq4LE00FvI8g4XY+tYxaXx1l/jTEMaWgP7EvQi03B3EzANppEP/ZVf+ZW/zYu05mU96OxT9pvxHGMda2PPix0lzDA1MDUwNTA18CI14JnP4JLOwco/F6tM6qeMSpv/0Lg11l5ejssxnOL18rNutnMt+r7lX6ufV5PD9/5+CuDbAPwmwB//rg+9+Yvf933rfwqA5j8FHB8CXa39OwhaeAqPM4Cn+7z6nxEeeff5hD4/TaAt7ps3xnPNtYUs4uJ9v8Y/4+WpPk/5DfVpvQY/tsCeaHkQZ0D9nIC24JGnfaENQR+PfW0ww9TAy9BAXszSXpQVlzbkQ0xDutJpcF9CVwM+0xr7v/N3/s7f5QUqLzHreAHbF/vrWBrWcaqHlnXjpoX0DFMDUwNTA1MDUwMvWQO9M7CO13NTvnVE+NJij2feHqTM3nhOW5TNYF+SB135mZYWrVvTPb5lKlq2ouUq/9Wmuf/j1/81/hN5E+C7v/u7188CeBvg//R7v+HTGN6vVmExcPTgWwBicQS8g9EM70pvCbh+wVuv/WOA88q+hj+GOWm/16cvGvxb9/3aAVnGejoDkIlsHQ22VZ0AR4fR0vpr30ODk5waeF4aqIvYNFhpeUvLW6OG9B7E+KacRngPNdS9aBPzAoa+hgOgXNCOMcfehjvD1MDUwNTA1MDUwIvXgGffaKCZP6Ktm/nywORLi5kvLxF6b1SW5U33EN65wX5Zb5ROvrRo3S08p+yWnFeRh3GHE6C+CYAzgLcB+G0AIg4A/lsAvxfA2wDca74KBW0McvSfCuqPEV7JAUBPWNu7jH++48cgr4a/NoL2xMgWMd/y2BDpCEA2begEwPGAU2A6ATYWzMx6ERqoB4xpcBSXlrfG0UWnwV/zvRhH6EWamA4ALtwPfOADfwBMfqWzfraV/Ylx9Mbasm/csJCeYWpgamBqYGpgauClasB7AMeX6VN05lsfTL50onSWTV6Pb34PKy/rQxssRzpp8xN7+clLOuv16CybdK/s5J2hAe71vvOPfMsn8g2ApD/2sY/d+CwAZ8CH/vAH/xm/I9CaebVzgd7yUwDfBKh4pbcm0PP63b8GOQY33+f75D+/y9f4pyz39vTXe/kmaznOHXKhMx7agmd56iLDdn0b4KN/7KN/hjZtvzoBbLPJUmYjZ5gaeP4aYEFnMO1Cr7i0wmv0wtqLXkhgxjTak07jHsP/O77jO74zHQBJWzbrQ2c79jPGUMfXsm4E9XGDORNTA1MDUwNTA1MDL1ADdznzrCuqHtMVya+8mq4y9tZJOdLKEkd888/BlJX0pTLOqTfLvtXA4df2/+z3fvvf58l/OgCkf/AHv+fwNgC/CfChD33wX/PvAnEccP/4WpXIffKWE+D47wevoZ6DMc49eRrhfH+v8Y0hjkGuce49PnXi/p3ry0i/Dk6FyF+O+Ye8I72Wqe3TFj8EqBOANwLoUzofbD/kInuGqYEXoYE8sKS9wCoubcS3ohffKeRC6sVquJPWqHezwAHADwGazvykU1a2Zd+i/3VsOfZWbIapgamBqYGpgamBqYGmAc9HlDGiU1GWETMvZdR806ewJ8M6mWe7mSfvHOzV7/GqzCyTdC0309fRwOEH9n7vN339j/O6v8Z/Ir8N8G3f9vsPvxHA5wGkX/nbAO/wmn999R/HAPfNV5gW1v2NV/81vH0FHxz9Iv+xD8joXT/vcP/PG8J8Jgwd5bPrh/rkYRdoY+BkoC84Hnp9QR5ljzKXQR+ynUlPDTw7DXhh9fBw4bQRJS4tfSt6kYCjmEZ50mm4e3Fq2HORVgeA3kHLiCkn5duf6HeOp467FZthamBqYGpgamBqYGpgoAHPTbKlxVpFvph1tuiaV9Mpr+btSVOGUOW85Y755ouj+uZPfGANcE/I6+s85a9vBeAcIPI2AE4AfjTwtb8N0Kbn8MN/X/JrPufDx9f+lytN2a2n/7z677/6w/Dme3wMcSLzttfo5r6eB4O8uk/kB/5Ic+/PeDr9h3fLGUG7+ZsA/F5E/h4A8mhrILPTzGRNDTx9DYwuEHpO3lZcWv5m1OiumIa5dBru1QHAhoADQA8fxv/IAeDmoTzlZx+O/e6NrWWtm0ZPN+TPMDUwNTA1MDUwNfAaNHDqHOzlJy/p1NcefpaRHiGyzat0tlvzsk4tN9MvRAPcF37z17z/D/GJAG8D4BDgk4Ck/c8BV/rm/YVo7s7D4PpaDW7u2zG289V/v7uHT/5e45+ecV+PXYAMPiXgVX7eJICHHNpu0Ws88VafMPiVg6z8FOCcPrX2ZpgaeHYa8OKw46bBrbi0/M2Yxje0RnmiBrvIhp2RV3R4zQcem4TRtGWtL2Yb9iP62xtXy55hamBqYGpgamBq4NVqwPM/FdDjZf4WnXV7dI+3JS/zsm7yobfyatk95Xvy9vKyvV6dzJ/0/WjgHf7f/Dd/89f8Z7z6jxPA/yDA2wA4AXgjgE8IuIe8ny68Kqm3fviPp/S+bo/B7r/6456e+3ju2ZuGlhZPXiOUxXD/mc9+9mcx2g0Y7z7B576/IwvZC/W1IXBA0Bd/D8C+Zb8GspqoGaYGXoYG8qKTBk/FpZXpRg3vxDTMpTXaQQ168Qd+4Pv/Ck4AL9Z0AFhGTDnKBm0/+pljaux1w3Hc8GaYGpgamBqYGpgamBrYp4HR+TniK7WXL0+krLRo/a28Xtmsdw36Idq4Rj+njKYB7gd52u9bATgCeDNAJwAOgj1vA3BviVPhGkrlvvYacp6IDK6HgwOAe3LGVp/+51N27t+9T6fenjFQvucAwBGAU+DEJwG3nBNb/WMMrJm9fdvT/1lmauApasCLr4eHi7p1eguXln8janyLXLgZ02iH1pgXcQDwjQ5pjX/RMonKyzZsO/pWx9CybgTHf4M5E1MDUwNTA1MDUwNTAwcN3OWcHNW9Fn/vFPXa6/H2ypvlnokGuC/E0Oc3APzhQFBHAG8LUGY0nK/6D77q+4mj/HP49OGc8k+8LNfPjafsGOv5hJ00Rjff7XM/z3079+zeq48QueRxzz9yAOAEoC1sh/JJQKrtloOi10f6Rlv0jbZbnHtDanHSL0IDvUUtDzwVl04ZeIdYL+Y0zqE12nsOAH4DAI9e/R2AkRMgZdmO7dufhlvjadkzTA1MDUwNTA1MDUwNXKgB7x9q9RH/0nK13kxPDZytAe4b0xnAJwI4Aj70hz/4z0ZP+X/Ll/+6T/2er/u6N9xfnt1gVOA+9WMf+9ibYD13cjWuMZ4x9DHGff3/J37iJ/4JPCK6xfAmco+/Nx7qfMt/8qfqJwAY/xkGnwQc7v+ZN3RPH7En6A99oz59pc/wyGd9HOd57/713Odw9v+VaqAucNOJ0KO4RB70IWqEixrnYBrtXGwZv+EbvuEb8ebhCPBC1fgHsyx0yrIN2zxewPSn9r2xZpgamBqYGpgamBqYGnhADXhfsdXknjJb9e+a99jt37X/s/4ZGsARgOGPA4DPAeLfBd6Qwv3nN33jN7751m/71p/DULyRuTNBvR/54R/6SdrbWeU5FLvxQ3sY+f7IHoa1//YPPjRG+rkRQ53oWwVp9FcaJwGfEZf/EnCwAbAJsBl0ANAfHRX0mfkhbzoAnsOym328lgY88ETkHi6YYwPSp3Bp5Q8xjXBojfNTDgD/1QcXu68LcUEar+QAyHEwRNIzTA1MDUwNTA1MDUwNPJwG9py9e8rcZ48fu/37HNuU/VYDh3+Nx48CfuQjH3mDod/7XQAMRIz3j3/8E4e3Bd77m9777fAwGJuYpUXWinGBT/77vuJ9f4LfIKAenxpwH9zKvZRw6/V//r0ehjkGO0/v0QH4f/8H/79f1OCuhvs10z7R903i48PAW28q0CedCr1/CdgmaHkpkzTHMTWwRwMedj10Y9vCpTVyiOkESAfAKScAXjk2g95bAHscAMi3bfvSMPvcktPoRwkzTA1MDUwNTA1MDTxBDXgP8gS7Nrv0UjXAPSbf+i+f82/+9OhzAPgY8jzN53V+jHscAzgQjKTh+2kB5XmQ9cL0xjV6wwHAf/HSyPep+kM7AHQm5CcB2gUgc8xc0K98W4EfE4RPPuUYW4tzH2pKmOH1aKAueNLyEuUnLq3sIWqEi1xQRjyjxmrU8xkAGwgXph48LkovzFpeOcoGbdO+NMw+Sjf2Oi7oGaYGpgamBqYGpgamBqYGpgZesQa4r/ySX/M5H37FKtgz9Fu/sJ+v1WOAY2Q/lgMAR4CfBNAHbAfmFcSegEcfKYfNQd+1M7QjmhKwF2aYGnjRGugtcnlbSF4vLo1/+DZIYzwNdI12L8Y06rkA+U8AXJQg6YxZ1gsaOSnfNunDMdY+NvaN4BhvMGdiamBqYGpgamBqYGrgYg3Ms/Vi1c2KUwNPWgO3Xqv33p37d39Y7zEdAPTDTwJ45T8/LaZf9JEyBPqejgLsiKb9uX896SU4O3dNDeRiTzrbgG9eonxwIWqIi2mk6wSoBj3pfI2IH/S4BwdA9rt1dYapgamBqYGpgamBqYGpgamBqYGpgR0auOUAyCfqT8UB8Na8f/OG3xbzNwkw9HUA+MmCbyz4YHE6AHasgFnkxWugZywnD7oXl8a/4QToOQBOvQXAxakToOcs0JGQsnU40P4x9vrXsmaYGpgamBqYGpgamBqYGpgamBqYGjhDA6sDgId0GNT5TT2v1GtoP+SPAGrwV8SW+PS/+FdvvqD9S0H7lZ8s4CCAPx0AZ6yAWfTFakAjvw6w8k1XI3tpFQ9RgzyNdA33ngOAC5Dv/3Mz4fUcfxMgHQHKSdm2Z/sNa98a69ZbDPBmmBqYGpgamBp4vhpYuInjV7yJ/GCXN3sg58XzHdrs+dTA1MAVNOA9K6K8N1Rs5smb2NfA0AGA8f3U3gCYDoD+JE7u1MApDbgpipSvNOkal8Y7+RZAGvRJ8ymA/6aDDYUf9MBjxw8F4nG0LDd1ZzoA7Gfr3gxTA1MDUwNTAy9BA5wLf+tv/7U3f+F7v+vNt33b7z/8S6/f83Vf98b429///je/dvmVf3n0C98vQQdzDFMDUwO3NOD9amLeB1YaAVl2T/pWoy+cccsB4CcAT9EBMD8BeOGrcQ7vThpwsztHiHUSoY1Low/Rp/JpqPv0HtSYr8i/A/T/irKp4MX72Z/57C/ydgAXNPkXOgBa19YNHnqGqYGpgamBqYHnrYF3cBz/1N/7G29+/G/+1Td/8fu+7813f/d3v/nQhz74r438n+/3ve990xHwvOd59v71aMD7S0bco+WdQjV2qpz5e9urck2/dFwdANy384bVc/sRwOzv/BHAl75c5/iuoYHcHFMe/BqXxjtEHQBgzwlQDf9M88QfYx8HgAFHAK8Y8cQn5UHblm03rP1qrBsHCekZpgamBqYGpgZegAY4A3AEcG783E9/+g1vBfA/uT/ykY+szoB0BHDz+gKGPYcwNfCSNLB1r3nJOL0PpK6y5WXa/B7PvB7Ce03hlgOA3+vi3pygQc3e+li/ATD/DeBrWo5zrNfUgJvfKZmWS4Q2Lo0+RA3zNNj3vAWAMwBDH0cAGwwRGr71U6bt2G5D+yI21noAVJr0DFMDUwNTA1MDz18D7/Cvn/h0DEcAbwb4JoCYjoD5acDzn/A5gmevAe7TMpgWzTO9B7MM9KlIG1lnK03eawzoZ+He23v0/A9evKWL8f9YDgA+R8Dx4ENC7ILsK/3K3xmzLGOhHGN7jZM6xzw1cKkGcsPMDXZpAk/+FsDWpwBclEaNfrFn/HOx0+YxZl+kW9YMUwNTA1MDUwOvQQOcF+/7ivf9ife+972H3wfQASDyOwF8GvBbvvzXfWo6Al7DiphjfCIayPvG7JL8Hq+X1ysnz/KJ0DVSPsvUdC+v8qjzWsINBwBGtL/bBZJ+aAeAbwf7o+FHW+DW2wq9vuIsmA6A17J05zivpQE3QORB17g03i4HwCkngEZ/4h0cANnv1sUZpgamBqYGpgZesAbeec8XLH+XHwPU8K/oGwE4ArghfMG6mEObGngoDeS9lrRIH6QrbuXVsnvSlNkba9u9epR5reGgDwxs7sfZK3Gc5lN1/xUgfGieyp8b+YyLqGPBz4B76Cv/vPV1fIq/zln2E6cE/fFzBd9WYAyMRafBa53YOe6pgUs0wMVGWC+6oJdG73YCaOCPnvqbn8Y/NBfu8eI9tEebLdb+NNZ64EDPMDUwNTA1MDXwCjTATd4Xv+eL33zNV3/1wQnAfwuoTgDS0xHwChbDHOJjayDvGemL6aTl9bDHG9XNstB3jbajHNKvLdx6so5hrXGO4Y6xTcQJwFN3Ik/n98ZDnW/5T/4Uxr1ye5iv/IcBf5gb0tgH2BPs//SHvilHRwX50wHw2pbwHO9dNcBFVoObori0Aoeoke5FqRGvUd9DL8yaZ900/o8Xv+3ZfsXWnUOAP8PUwNTA1MDUwCvRADeAP/iD33P4ccD8LwE9ZwCfBvDGwBd+/uf+Sc6fV6KiOcypgbtqwHurS/CcOueWpfyeyPhPlbMM+BoD+tn1GQBP5X3CXu/XvWfvIff+OAFGDgDeDOAHwXEoHPfnpUzE6qTQ+EeebxT4qQJ5tEXfGFOLjG2GqYGpgZ0a8IIZbZpLkzN8C4ALrxr4W2nKZ2TzMNLOMda+NPZ6YdtfeDNMDUwNTA1MDbwSDXDDxw/K8uSo/qcAHAHVGeBvBHzJr/mcD09HwCtZJHOYl2hgz32V92XIr3SPZ5mKWfacvCy7RB+Sfw5NP15ruGVgs6f6dB0ah2sa2EdDH/2eDNzjjxwAOAU+/ME/+NHyyn/KPPQNGRj39IG+jPrHvn5O37KhSU8NTA281YAXdt1Al5Z9iBrqYBrx0FtGP3m1POmUd7yAbav2oXVhdQBAzzA1MDUwNTA18Io1wI0hv2DNt6A6A3hDgE8BRo4A3gjg7HnFaptDnxrY0kDeB1Iu78VqOvPuSlfZNa38pWXUaN5eVDb4WsMtIxujPJ+wk65OgKaspUX0vBnYY3sOAIx4+Ozdx3v+Kov0jbcT6EPtG/s+Mnz6P5C12ceZOTUwNXDzYvZiBI1Low8xDfaeQQ+v5wiQX+ukPNs4om0ntqwbGw95M0wNTA1MDUwNvGINcI7wL2Z5pRRHwKf/4ad/6VOf/Etv8jMBfy+A3xDgvwbwRsDxpvEVa24OfWpg1UDvfkpeD+E9dFxam6N4SV+auFcb0NfhzV7u2X3Knt/Y41jFWNcJQLnjnrm0utQfBsrxer8/LohjgW/2yyv/KcP5u9Un+qAc3lDwNwro8zl9GnZ2ZkwNvHINeCF6EVZcmn4OkQvbWA16LsbKG6WVISq/YW07+9aytzceCswwNTA1MDUwNfD6NMB5w9OhH/nhH/pJHAE/9ff+xhveCvjIRz5y+DwABwCRHwvkNwK+7Mu+5Ften5bmiKcGDhrw3irVIa+H8B4zLq39rUjfyLePWVae2Iq9+nDrLQCM7Z//+X/+ixja/Nr+xz/5yU/hACDytH2vwc19Pa/4Y7gTT7zyz0Qc5o56tEFbtksf/OV/+uYbBPPp/6tfv1MBV9YAFyHBTTJxafxD1GgHRwb+ljMg60Mr94jZZtIte4apgamBqYGpgamB0xrgbOGJE84A3gz48b/5V1dHgG8E4AjgXwfya9enJc4SUwMvVgPcaxnqfVemK720ShnNhyct9njmncK1De8ZxdbOmnekkVV5prOdVuzVBvWwPnHX6M5/tYfh7a/t+8q99/ZH/SunKvId5OGMZQ+GjvJZ9lCfPGwJjX/fSBj1BXmUjTWAnBmmBqYG7qgBLyQvbHFpcg+Riy7jyAkw4mfduICVb3tia/ZwkCRCzzA1MDUwNTA1MDVwUgM8jeIpFN+g4gzgE4G/8L3ftf5eAD8W+GuXX/mXufE8KWwWmBp4ORrgPssgneh9WA+XVvGusSc3ebfkn7h/vFW+9DFlt6xXH269BcCT9/zBPV7f54dXfSKvI4D7e+eiabHq9SA38pdjGRS+ljUfWRj1Gv60RZv+JgFvJNAn+LX9kIvsGaYGpgbO0AAXI6GH64V6zF8aHqIXrjgy9pNv2UTlHbG2Z7plzzA1MDUwNTA1MDVwNw3gDODmkm9J+UTgh3/0z73549/1ofWzAH4foLXgeXi3xmbtqYGnr4Fc69J57yUtLm1IDx7zvrHSo/5QruQ5BnCGozGOntIIr9/d+w1/dQLk2wCha3W8NAVnXPnOH23Wp/60wZP/NP75jGDj1f85l3MlTw1cSQNeTF6sievF7AU8Qi5s8sRarvX18OoRGDHbkm7Z680YPIL4NjX/Tg1MDUwNTA1MDZyngXd4mqQz4G/97b92+L0APgt4zxcsf3d+FnCeMmfpZ6WBeg81ut+Sn7i0ka6x3ttlulcueR2adpYWRehDTLk9elRO/hFzHI01Q9PAQdfoNI3x6gTwNwHg+yTep/HU0xkwuudHPnlEy/vU3yf/yM5v/nnyX41/6iKr9Xs59r3BDFMDUwN31QAbASExN8zDRtHyF2JvE966+Gt55QTWtky3IjNMDUwNTA1MDUwN3IsGFr5VxRnAq6Z8IsDvBPBvA7nhvJcWp9CpgcfXAPdYhETvuyourdyNWO/pzk1XeaN0ytWIPOdek/ohO8fV2K8+qI8bvweAUd5zAvijfvk2gI4ADHq/z9fITzS/Gv7I4hMtZPuDfxj/vKVFH5Q/jf9Xv1anAh5QA24MFZfWhzXm5ryXzvpHurZhumXfOJxIzzA1MDUwNTA1MDVwHxo4OAN4DRVHwLd+27f+3Hwb4D7UPGU+gga4rxoF87z3qri0imus93oa5vDPNc6pk7KlR23YlljL9dLKbOi4GjlDaAC9LOgUQ1sjHQMcp2ga5ryeD488HQH5VgAGu0a7cuSBWUf5+co/bSlfOfSJvtHHFunrDFMDUwNX0oAXVA/h1bg03hp7G+6Il/WOdJVtumXPCx0lzDA1MDUwNTA18LAa4IbTX7F+2JZna1MDD6IB7rUIid5/JS6tzBrz3k4jfAspT37W26Jpq+anfI3B5GX5XlvRf8fVWDMcNeD8H/SO/tIJgMGOQ/TT/+Jf8WB+DRjtPKUnrzoD0sivNGWpQ900/BFMG+RRpxr/zHHrr32dkzc1MDVwTxrITVI6cWnt3ojHi/PWxp38WueYTrlJt+z1Yoc/w9TA1MDUwNTA1MDUwNTA1MA+DdR7p5pWinww49LSa6yGtka4RrkofwtT1hadMpCfMfNGtLKP43CcLTlD0YDzfutzAAxyn9bn2wAY7aQx5HmFnyf3P/AD3/9XiBjyRNPkUYayPRk+9a/GP/PX+rm0aP9Kt2dyamBq4FoacIPMi006cWkN3jWmvKQZC+kZpgamBqYGpgamBqYGpgamBq6nAe+vEvMeDHrJqCEtanCnQd6jLQeSn2lpZfbQMj3ZI3nWAZV5HItjbMl5j4kSOmFpvPVtAL/d9/V9/6Vqz5DHIUDAwM/4lnvzr44DDH9kpuFPm84dfWnRddrIGaYGpgbuQwN5kUm7YY5waR05N45kJZ/xkSZUfMudf6cGpgamBqYGpgamBqYGpgZSA94zwRvRljcfzLi09Bo1pEEN7DTKNRTB5I9oZST22iA/ZfTkpwzKWgdU5nEsjq8l1+D4V8Y9EtnWiL7H5k+Ktk/g6gRAp+gdJ4COAF/l56n+z//8Pz881a9P9tPk1yFAWerwZoCfDijXuXXe6EOL9qmRM0wNTA08lAa88BKha1wab2+kLmWrDNMta17wKGGGqYGpgamBqYGpgamBqYELNMA9lSFpeKZ7CI+4GDWi0/jXyNY4x3jrRfNHiJxT0bopX94WKpd+H8fi2Bx3Y3fDqfxupZ3MlJ201Xs88x4K6cMhOvfON3OgwZ7OAJ7i88o//8qPp/p840+EhkfeBz7wgT+g0e8Tf2Qgk3mkDduz/Yca8GxnauC1ayA3nkqvG0JT0ha9tPxe3KpjXqs6PJjIm2FqYGpgamBqYGpgamBqYGrgtga4lxoF80TLmQYzLi19iBploEa1hnca5WkYathlfqWVISpblA9m3ZSdZXq0RuVxLI6vJdd7zaTVBTxCTb/lnvdXGWKVK188T/r9lqZPxPX3vdBnzkedcwz7XqzlnE9kOUesL9o6tqk+xMaeYWpgauAhNeDFlwhd49LhXVLGsdme6YlTA1MDUwNTA1MDUwNTA1MD2xrw/qmitSo/09DEhdgz/jUCNbgx5qqBl2nzNfoqKkdjMNPQlk+Z0PKzDLysr3F5HI9ja8lDcNymwR4v8/fSKUcarLRp5WY6afMfA+kHcV0PuQach73o/Dg3A8P/McY525wamBpoGnDjEVGKm0DS8nq4RJ1evjzlJW7R5M0wNTA1MDUwNTA1MDUwNTA18O49W9WF91mJlCFNSMwyS8u7YfBhsKXhl4a3xvlXfuVX/raM8nuYBqNGYQ8td0qG5URkaWQylhZzfC15CDl+eeCIn2W26Fo/00krQ94oLf8x0L6BxpNrI+fSteN8dIx+23iM8c02pwamBgYa8MJMrDTpSyJNZj3T4AxTA1MDUwNTA1MDUwNTA1MD+zWQ92fUMp20PO+/zDO9NMamkaehDWKcp+EPzavg8nrGu7yUk0YjtHmWrWh+DzccADlW6AzqJXnSmZe0+aJ54FakfM2XBxJS1lvO4/+tfV5al9a1km+NJE2ZY8z6jTXD1MDUwFPSgJuOfcq0dF7El9DITlm2lWh+8iY9NTA1MDUwNTA1MDUwNTA18K4G8n5JOhG6RmpXnumDUZdPbzXQ0+DWKNfY/52/83f+LmN1BFhGtG7Kq7RlrCPK7yEyNhwAjI/gOKUPzCM/eZY3v6L5yjsHR+0oc9RW5T9m2r6eGrd9tLzpiVMDUwNPVAN5sUpvIXmjyBCzrnTlk55hamBqYGpgamBqYGpgamBqYJ8GRvdU8sE9cWnl1qe6OgGqAyCNbwxznvpr/Fc0PxE6ZZwy/s95q+CEA0AdoNWqG3hbwfJZRp5yz0Hk1PrKTr68iVMDUwNTAw+mATeh2qB80EiZypeXfHmJ0Bksn7xJTw1MDUwNTA1MDUwNTA1MDbx7v6Uu6r2Y6XNwacJuOACq8Y+xrvGOIU/U6P+Gb/iGbzTK66EGvXLAlCu/yjcNWqaibwHE9+aMKXXQksO0eT2EZ1AeaWlxaTyjvFPYqtyQQzoD9WeYGpgamBp4cA24+Yh0QHoLM0+61/mtvF75yZsamBqYGpgamBqYGpgamBp4VwPeSyVC741LK3vDAcBbADgBfEqfBrcGuUa+xn+ieRWtOzLmzc96Og7MS7RfOxwA6gKtpZ620qM8ZS2twKlo2RGO2oA/w9TA1MDUwL1qwM3wVCNb5cwTU5a8ipaRb3ri1MDUwNTA1MDUwNTA1MDUQF8D9b6J9CguLS8j5UiLax5P0PMTgOoA0PjWQE+j/5u/5v1/KNPQX/qeL/paedZRBqgBD8offVqQjoCkqUs/6Xd5A8AxjvQiv6lidQpAG8gnWE5cGm+NtilmXtDW3YOt2tofys8wNTA1MDXw4BrobT7yRkgnzXvwDs8GpwamBqYGpgamBqYGpgZegQa810qEzri09MmIAUusDoCeka4xr3H/gQ984A9k7DkDKGs9MI34nvGv86BXJ+vrAOCNBcdwHG/q4Fy6iVjvY6276tB2enhs27LUlQaV1cOWfaNN0gTKEsS3qfl3amBqYGrggTSwZ/OpZTKd9AN1eTYzNTA1MDUwNTA1MDUwNfCiNeD9FWhcGr07pjGbnwDoANBIT4O8OgA+/ME/+NFzHAHI1BHQk6v8zEuauukAuPAtgKam1bju6RHeQY+po1O0dQKV4/z0sBW/1Rd4zzUszBHOHCI0EWfNcx3Q7PfUwNTAWw2wgfXCiN8rO3lTA1MDUwNTA1MDUwNTA1MD52kg77WkQePS6EMcGazkZ97oDYDqANA41+DH+M8oH+SNANF6achX2jKJtYxp+oUTAKNSBwDjcdyB6uQcvKU79ZOY+qt0tH+QFelT/WhFu84A6j31sGDwf8mv+ZwP/77f+iu+73e/9/M+Q/wtX/7rPkWER/5TH8Ts39TA1MD9aOA5bGL3M/IpdWpgamBqYGpgamBqYGrgOhrwfqpnVN4w8KuBWtMatv4I4OgNAI1zDf00/pM2X7QeqBEvZp6fEYjkYTTWemc4AJamamJPRz3eDb2hF50MoLT6Eqs+a/rYB/pB7LULj2De29S7zgDTTw6ZHwz8b/1fLW/+09/+OW9+9P/4ziF+4lv/J2+Mf/Hr3/OG+F2/69cfIk6C41if3Hhmh6YGpgamBqYGpgamBqYGpgamBqYGpgaeqgaq4Uh6MWqIaqiKyYeWrwOAH9jDCYChraEOaqxj2KfB/9E/9tE/k+mkdQKkUa+clAnPsqBlKlKnOgDov2Ny7APUwO7hwfhXF6BGfw+znLR9qNjpS699eISKyTsUeOw/rA+e6Gv0g8Q/9L/9Nw5OAA1/8P/14f/Fm3/wf/1NNyJ8yh8dAY89nNn+1MDUwNTA1MDUwNTA1MDUwNTA1MDUwLPRQBqMGpa3nmRrpG6hhm7PAZCGeM8BgBPAmA4A6FOGvZ8LWM50timdDgD6SZ8Z0w6je2kzSkRH4Bqtq26QiWyjafWTaJ0eKhfM9o60c1WxZXedAMmHfoywfOHnf+6f1NgHear/e/69f+tg0INEnvbrBKCMvJ/58//+m//vp77yEKEpx9sD6PMxBjPbnBp4SA1woRukTyHlLWPdiVMDUwNTA1MDz0ADv/yX//I3M04dzDXwOtfAA21R3CNmXFp6dQKkcZrGqzT50hq99Q0ADXAwHQAa/eCf/bN/+i+Zrk6AdAQgI98I0PBXruksIz1yADCGNLiTRhejaLmRDtSHqJ56mHru9afTh5yzHt2qHAJ59xrQgz/Y57f8GPv5lJ5v+jHoib/tPf/GwbDnqT8GPo4APgFI4x8nAGmdAKR5GwAnwP/43/yOQ+QNAWRkO/c60Cl8auABNJAXbNI0fSpt9/aWs/zEqYGpgamBqYEnpIFp+L1Ow2/O+5x31sADbkXcLxqXRh9iz8DtGa/Jw9gdOQB8Oq+Br+GP8W/UCZBoeY17UFmg+WKWg04HBE4A+kc/7bfGt+OtqD7AzKuGP3J7UQdAom1XtC/VCZB9CNo5S2zZ61xCXz182Zd9ybe87yve9yd4lf+PftOv/snv+dYv+SWMeAx2IjQGO+iP+Wn8a9Bj8GP8j7799/V/nvZDEylLW+kEyLcB2kDRwwxTAy9KAy7qETLYmqcC5JueODUwNTA1MDXwDDQwDcFpCM418HrXwANvUdwrGpdGr8ZuGroYrGnI9uiRA0DDXENdB8AP/MD3/xWjjoB8I4By1gGVI2Ze0uTrKIDGEdBzADCmkeGdBr+0ZdWFRj+/L2CUJ6In6J6+Rk4A2xOZkxKdrx62orfsAsrdKfC0/et/x29YX9P/89/+G3/pP/+uL/4ljXS/2ccwJ+oISAcAP/bHk3t40DoBKKscscoznU4AaBwPOBvuNLhZeWrgETWQF2fS2SX5iUlTtqatL9/0xKmBqYGpgamBJ6qBafy9XuNvzv2c+wfalrwvBI1Lo284AHQCaMCOjFkN3vwRQF/9xwhPAz0dAD/ywz/0k8QtR0DW7dE9RwHldBToAPCHABmLxrdGfaKGN5h8DX+Neo3+HqqPEarPUV+yD8xJJzpnia3YagdAXyXQl/e9731vdABg/BOr4Y6RXg14ymCkgxj8fAYAGnEEkKcsZYA6E0CMfWJ1BOgEmJ8DXGWqp5BH1AAXskH6UkSOdatM0xOnBqYGpgamBp6YBqYROI3AuQZe7xp4pO2I+0Xi6gDQANZY1vAdGbXwqwNAJ0Aa7j0HQDoCeAsAh4BvBVQDX1nwM8pPzDcAeg4Ax5aGfqUt4/g1+HmrICPfw5MnWq6nr3QA7HECMBfMTYnOWcVWbL3/J+9Owaf/vuI/cgBo/Isa6xrz8HEGaPyDOAAsL1qv5wDQCXDoy/f+5sNvAugEQO93GuisPDXwgBrwwhRpWhqstLxE62RZeSDBvLep+XdqYGpgamBq4MlqYBp/r9f4m3M/5/6BNybvD72vXFr7qxMAY7gawBq01cA1rVGs8Z9vAGiwa+Rr+Cf6NoCYnwVo3KecXr7leg4A+q8B7ti2UMO/OjgcZ0UMUXjpDNApoO7E2o90PuRbANLMTYnOm9iyu/f8zjP5ZwV+df/9v/lX/RKv72Ok87S+vgGg0Q5WQz7zMOrJTycA8rIM+aR1AGDgG30bgDL0hzQ/DgiSbgO7eJxnKWUWnhq4sgZy4UqDRpqTrmheD5MHPcPUwNTA1MDUwBPVwDQCpxE418DrXQOPuC15X7m0PhycABqkGMjVENbg17jV4NUg7jkAMMwx3qsD4K//2I/9FDEdAdA9J0A1/pGVTgDzaSsdABrl6QCoBng6AszT8Gd8yGBcGeXxS/iOvYfqCxw5AGxfvYtnOACYQ0LFt9wL/uIA4PV/vt336T+ooQ9ixPN0X0NeI950RQx26vgWADSReuTpAMDwJ10jfMpQB1onAD9QeMEQZ5WpgQfXQL1A3XyTX+ksM6IZiHnSDk55pidODUwNTA1MDTwhDUzj7/Uaf3Pu59w/wFZU7wNNe98I3ngLAEM0nQBpzPaMXY1inQA+kdf4TweAxr9YnQA6AjTyNfiVUT8XSAdAdQKk8d1zBKTRXw3/HBPj4ocG0xEgrSOAtLrJtwJGfdD4BzX8RR0AIHMTMecs6VbkOoEf2cMBwGv3/Bo/hj6YkV/2/42/6t85lKnGfi+tQZ9OAD4H8JMA6vSM/8rTCaETgB8mZN6uM/IpZWrg+hrgIq1BXmJezHtoZGY507WtmZ4amBqYGpgaeKIamEbgNALnGni9a+ARt6V6/3nDCaADwDcBMGQ1cHuoQewnABrmGvAY7hj3GP4/8RM/8U+MOgLAdAakoZ/Gf74loGyQ9noOgGqAYzDWSJkcH2NhHDU6xpEzIJ0A6Ei52Z5OBzCdAOkIOMMBwPLJecz02UsLZwY/3MfTfxwAH/w//y9/kQhNhI/h/8X/7r/9xj2LV/Ex4H2S33MAmE8ZDX8Qh4Bp8qrBr+OA+r5lQB3/TSDl538FOHuaZ4VH0MDoIk0j/hKaoYxkZ94jDHk2OTUwNTA1MDWwpQFvpCa+XiNwzv3rnfutveHKed4nIlY67zmXxl8/BdA4TQdANZI1iEX/HR+GeO/pf3UA/NiP//ibLUeAxr645SDoOQDSCKfvaYhrnPfGlIa/Y6rImJOnDnwjgLbzc4lsG1pHgHpOBwBvAgycADlfSTOndwkLfcKY5ul+Roz+jOTpEPAX/zXUwZEDQCcAqPHvE30dAVkm5VCOMjoBaJc+4ACAT9/vMvhZd2rgoTTQ23jzQr6Upv/KrvRDjW22MzUwNTA1MDVwhgam8fd6jb8593Puz9gqrlG0d4+Y95y73gLQ2K2o4bzHAfC3/87f+cWM1RmQxv6I1jHQewOAvvmmQhr7SZvvOOg/fe9F8xIdL6iMbFf5tplOAB0A9U2A+hlAm/QlYs6VNOvCeRXhnQw4KPjV/1+7/Mq/zJN9nv5r/GP083SfKI2x7ZN6jG9jOgBGtAY9+Rr+8kDfBNDIh2c5kLbTCcDvCdifL/z8z/2TJwc7C0wNPLAGvBgToffE5Viu4lbdVmXdCKBnmBqYGpgamBp4whqYRuA0AucaeL1r4AG2Ju8/syl59X5yaYW6TgCM11NPyzWONaB9RR9D3af/fgKA8f/pf/jpXyJC8yaACF0/Ccj6mZdOANrVKO8Z4n6br2Gu0W4d+30O9t4CUL44ehNAJ4BvAWj85xsAzEfEOl8taw3O6crYIugThj/RH/3zSb9P+HUAaGhr8IM9Qz8N+pqfeSOadnAEpOGfNPlE6+MEgP6j3/Srf3JrrDNvauApaMALNLFe0KSXQeyV7fEYK3yC+DY1/04NTA1MDUwNPBkNTOPv9Rp/c+7n3D/gRpT3gtKJ0MRbDgAMVJ9e6wSoxrNGdDoB/AzglANAJ4BvBNTPAqrxnw4A8pCPs0HDnT7YP4zw6gwwzz5bj/7WSJ6fF1guURnZpvJ1AIC+BQCqSzDfANABsPP1f5aOc+Y8wiPU9Ftu/OWp+Xu+YPm7/uAfRr8/9Mcr9kYMbgx+fnm/Z/hrjG+hzoCtMuZp5KfhL02eNDL9HIG66DGGN8mpgSehAS/EvFC36KX1eiuO6jLYbIv0DFMDUwNTA1MDT1gD0wicRuBcA693Ddzz1uQ9oc2YToTOuLT0LScABhYGqw4ADWsN4DSKNZp1AGCkpxHv0/7/+p/94zdG3wZIZ0B1BJgGcQKkI6B+BtAzyDHMfWJPvn22n76xYBrsReuJ6qC2mb8HgL56bwJsOQCYh4g5R9Ite73vrzTpbsDRgPHPE/80/HUAgOkAwNjW+NdQvwsiz/oa9KC8PU4AytJ33lJAHp8ydAc7mVMDj6wBLlZCohdw4tLK7IlZp9JNxI12SM8wNTA1MDUwNfAENTCNv9dr/M25n3P/QFsS94kZTCd6L7m0grccAKfeAtAYFjWiffqvA0Ajnqf9GP8/+zOf/UWjzgBQR4DlQX8nQEwnAO3Qpu2nUV5py9hHDH/fItAJMEIdAsoQbQMHg28AiPVNgL1vADAPEZ2fHrZi630/9GbAEeGv/VejnzSGdToA0jjXSD8XlSFav6bhw/OHAn3qX5EyRPjUmZ8BbE75zHxgDbix2mzvok3e0gqeE7NupW0TJG+GqYGpgamBqYEnqIFpBE4jcK6B17sGHnhL8l6RZqUrLi3vEHkV3dfScQBsvQWgIayBrHGNYa0TAINdgx4DXwfAz//8P/9FYjoCfCPA3wXw8wBROb4FoAFPu/ZFoxyUB9pHDX/7aD8zLa1DwLopDzrbgk5HgA4APwPQAYA+6xsAO1//d87aVN26xydvM/jv/nz6j7Gv4a9DAJ5Gd89I14AfoXVEDftaXiM+y1GGtrN9yyUPmt8BII/+osvNgc/MqYEH1IAXYr1YTYtL69Ot6EbQyzvyrN/DVuTWxgBvhqmBqYGpgamBJ6KBafy9XuNvzv2c+3vYhrgfNEiLyZcHZlxa+hBHDoD8FICn3Bq/GsUa/xrY+QkAhjtGfHUA/MIv/MLBCaAjwLcB0hFgvXQCbDkA7I+o8V77Zf9AnQCVB596ygCVm6guwPoGQM8BUH8A0Pt+0HlomPMj3djrPT48gvg2NfjL/PEJgA6AavyTvqsDoBr6o3Qa9llm5ACgPJGy9JHfAbAsjo3BkCd7auDRNOBF6YVbcWk9W2NuAElnmSNd5Zhu2fs2AgrOMDUwNTA1MDXwOBqYRuA0AucaeL1r4AF3He4PCYneM4pLy18j95/5BsA5bwFoZKdB7RsAGvL5BgAOgFNOAJ0BYM8JQJvVSE+D3T6lcU+fdCLATzrL6QDoyU8HALROgC0HQO/pP7reuOd3jnrYpm2dV+iTgR8B1AGAIa3Rn28ApBMgjfOkNcbhSYtZ7hRdn+xr1CNrFCnDbwBY9su+7Eu+5eTAZ4GpgQfQABcpIbF34S6tzBrz4u/RWfZI92Rmm63Y2gfoGaYGpgamBqYGnogGpvH3eo2/a879533e571BnnhN2VPW/a3Re9yG6n2gTXnPSFpaXBrvEL3/3HIA+IOAGroYvhjAGN0jY7u+AcATfwz///5f/g9vdAKI+UmAbwSIOgOQp9FejXSN9doXjX7rmq5YHQApX9k6GNIJ0HMA5NP/kfGfDgDnIdA5ElvWem8PL0NNZ96BxljGAaATQMNfxPjf4wAYGfbnOgEorxNAg950OgB0NCSPcvxmwHQA3JrmyXgCGvCC7eHS+neIbrhbaNnAnkx5rdgMUwNTA1MDUwNPVQPTuLo/4+q16PbaRv+15b2WebhknGfuS9zbEU7h21Lv/s3ylSZtXBq9/gAg96IjB0B+BpD/EUBDeMvo5um9hjxGvgY/TgAjvPrbANUh4JsAGPIY6xjoRtsnrSGvgU95oj8mWNFy1hNTNvLTCeC4e8Y/+sEBkN/+++o/qI5POACYG+dJbKx1LVSa9DDQ7m/58l/3KZ0AiTxVJw3iBEhjPg3vNP6zTPL30tRPw79n/Gfb0pYD3/ub3vvtwwHPjKmBB9QAFygh0YtWXFr+IW4Z/TXPOoHKE1vWjXZJzzA1MDVwmQa4rggjzLxDwflnamCvBi4xGmad6TRgDaShLi3ONfI81sjOfcKzJ4vL6yG8XqR+jw9vMeY9p8apBqtPr0cOgNFbABjVGt4Y7vX1fw3/RB0D/i5AOgR0ICALucjXUK+oQU85Px3ooY4A5Vkv5VUnQP0tAMbvGxHn/Pifelb3zsUR65w19jqP0uA54R3+GwCfAvzu937eZzD4+beARr6t998EapjjDKCcP7y317jvlasOA9L5xoGGvYY+MqQTrUP5+a8Az5n+WfYhNFAvXNNLa3yNXvR7MOsdaWUmtqzVYIGeYWpgamCsAa4dg7Qof+LUwNU1MA2152GoPdV5wuDX6Befal9nv26v9cGG4tkjUkx6C8kzWifLm5e4tIJrzHtQjVIwHQA+yfYTAN8AwPA95QDA8N5yALw5hpEjQCeAToF8C6Aa7KR1OmjwUz7jZz7zj/4paZAylj/lBMg3ALae/uer/+hNB4r6BFPP6j/n5EjnnOWctuxDkEci6be5g7+0R5/4UUCMfp766wTA2PcNAIxuPg+Q1zPqK486ldcz5OHpZKBO0mns92j7Nx0Agwme7EfRgBdgIrRxafQhesEnsiGQFjMP2rqByhVb1v5NgMIzTA28Mg1wrdSwxTNvhMoy3/TEqYGhBqZRdNsomjo5rZNq+F/L+L+WnDmHp+cQHQ03hnczPE8Soc+JS5SHvhXrPWYapRqrGq97HAAYxTwd9xV8jXEN8d4bABr/iToCfBtA1BHAZwHKTKMdWr4Gv28NVDTf8j0nQH0LYPT6/6mn/zoB1Gk6AHIOyhzVuW7Z6/296wLeRYF2f9t73hr+GPhGn65rlJvuGfU9w75nsCsLg9186JTdK2PZROtZfr4BcNH0z0r3qIF64ZJeMuZFL52bb88JkPWPdK+dlrVuEtAzTA1MDfQ1UA9R0xX7ted1NtLL5J/QwDSU9hlKU0/v6kkjXSeAiI7Mm/p6V19PWReD7aGeO1tp8mpcGm8Yuc8033vOxLz/1FCtxj+GrE+3e28A6ADAUNZ41gmAwb3XAYAzACeAmA6BfAsAmWn0Y8zbjga/vyEg2gew5wTwk4B8swCHxujpfzX+/fa/fv9/eOLenvyrW/XtHDg3R6xza7pl3wjwLwp8CoDR7w8A+qQfHq/7a5xjaG8Z/+alkZ50Gv3y4dEObVD/Z/78v39A+L3y1hMtA85/A3jR9M9K96ABL8ZEL9yltXeIXvCJbgYVswy0Mo6obLGxp/GPEmaYGtjQgNenRTItnQhtpI55W/XNmzg1cEsDT9k4mX17ekakxn4PrzFf04HwsHN+a0O4zfCM8dzp4dKqdaP3ivX+sabr/abGKajxD+bT/9EnAOd8BoARz1N9jfyDpb/xx3Ig9aoTII1+DX3QNwbEzNNB0HMC+FaBTgwdAPntP+PNb/9xBJz7/b/zUeaxN9etyCG4LkxfjMxpdQBgkO81/DXGK2rEi5nvGwO04b/yO9f4R54OgD/6Tb/6J5sClouVMCtODdyDBnoX8NLaOUQverFuwpm2TKJyGvbacYMQW7EZpgZevQZ610PyoE2fQpRZy7x6BU8F7NfANYy2KeNhjbbH0rfGec/4T94l/VP2JXVnncvXX9kp6lnSS8PLuLT0jZj3iNJ5L5k0Bj7pNPile4Z/ffKfT//9DYB0AGAo+xaAbwD4dF7D/BwHgL6B+iaAjgANe9LIHcXqCEgnQP0UYI/xnw4AjX+erPuWBHpTn+rXeXCOyjzmHLsOWpHrB/qBA0AngLjlANCY17jXEM+0tGUrkm+7Gv/V8VDrmMaBQF3eUICer/9ff11MiZdpwIs10Yt5aSLX6IUPuhlsYZaHTlmNto1st7FnmBqYGigaqNdIppOm2la65tmMfNMTpwa6GpjG0+XG02vTXRr50F/wBV+wRvPuqpPpCHjY9djdFG4yOUt6cWn8W7HeI/buJzVAEzVOE33aL2rM5pP/dAD4JLznAOj9FgBGt4a6T/Y18PdivglQjX2dBIlZpucEyLcA8ul/Pvm/5Om/elXnzEvOVcxlznVjr/cflSZ9tfD7fuuv+D6N8fwEQMMeI9uoYa+DINMa8DXPMsoDbQ/jn0gdeKCGPmgdefSDMvxugXno82rKmIKmBq6gAY2AvKCXJvcQ8+KH7m3U8EYbBnWUdcRsJ9tu2TNMDUwNDDRQr5VM12vKNKKynKLljdLyJ04NHDRwV4Nt1n9Yg+0x9a2RX41/HAGZB31uPy+pc24bs/zttdrZBj1D6lljGlxqHN1Pcv+Y95HeT2qQihr5FdPor4b/lvHvbwD4Q4DVAeCr+tdwAKSBnzROBNJi5ukIoH3fGvC3AHgDoBr/6QDwV/9BnR71+3/1hj7VsbpnPpyvMo85x9AE8W3qnv7y/TzGdxr/Guga2RrjGN/nROrXqGyM+TT+qwMg204HgP+pgPrH1//vSTNT7NTA+Rrwoq0X9NJEHaIbgDhyALCRsIFQLjcO6ymvYW0r+9CyZ5gaePUaqNdEL927jno8lJn1pZP/6hU+FbCtgWkU3TaKpk5u66Qa+D79/+L3fHH3LYBLDPpL6sy5uj1X5+hkY3fwPOmdPUurd4jeB4reR2psihqh4ilDn/tOXmH3dfZEjV1RI9gn/xrIvv7PJwDVAYCRjcGN8Y0xrqF+sNbv8U91AuRbADgl0vjnkwVe/9f4Zxz59L86ANRRNf6dA+fGuXIOG9Y5bqwb9xakCa6Jt6mb6Zpnmb248C1+zwmAsZ8G/DnGv2WzPm1gwCtXZ4DGv/yR8Q+f+uazTvcOcpabGrhvDXghJkITF6IbgOjGUJEN5Tu+4zu+M/nWEZXZ0DbExpphamBqYKABrhNCYqW9lrYwZVS6l4Y3w9TAQQPnGAuz7N2Mreesv3QApPHfcwBY9pLxTifAw66xsg3m+UPW6NxZWt4heh8I5n2iRifYM/o1UkWN14oa+RW/+Wve/4dGhj+GMYayDgCNf4zp3u8APKQDIN8GoF0cAD75xwHAk/98+r/lAGD86kW9oU+dK+jdeXBunC/n74ijec71kHSrtt63QGewXPJ20V/2ZV/yLToBQOlqxJtO1MBPXtLkk8Zw/z3/3r+1vv6v8W9ZnQDK86k/yNN+kPp8+w/Npwu7BjcLTQ08ggbqhb20PuxyALBx6Hl08wDdQETkHWNty41AbMVmmBp4tRrwOuhh8qDPjSjVOipYmaYnTg3c0sAlRtqs87BG2mPrW4NerA4AnQDmi4/d79n+6XV6a0N4l5HniTS4ZPQ+EPQ+UaPzlPGv0ZqoQVsxjX1pn/QnVsM/jf+eA8An8A/9BoDGP28g6AAYPf33Pjyf/p9j/DMPzk3OV87jkc55TrplrwY//Aymxcw7m8ag9vV6DG1pDXMMdWmMdIxyogZ+Neg17EHlWSYx5VoHmekAgOa7/9/4q/6dA59y6PPsQc4KUwP3qAEvRLDGpfF2OQDYlH/ms5/9WTaa3NxzAzku/oPMTlv2o2XNMDUwNXDUgNckSa8ReeeiMlKOPHCGqYFNDUwj6bSR9Jp1pDGf3/mnA+A3/M9+wxsdAFnGeuAe/VlO3FNnlrn72i2bQ+8c6Z1JS6t3iHk/qJFZHQA+kQZ7T/yrsX/q6b5P+MU0+nlN3lf+0/jnyX8+/cfY9tv7h3wDAEcD7RGvbfyPnv6PHADl/n2d0za3vTkf8Vrx6wXeWvDJP6gDQMRoT8Mfo1zjvRr0GvLIwfjvOQAs00Pa0QkA0geMf8qSft9XvO9PXG/kU9LUwPU0kBu5F+7SxB9ibtrQbtwiG8bHP/nJT33mM//on7JpywdrXWU2tJ3Exl6NHOgZpgZOaSDXLmUvTWfdU23eZ/5W//NauQZdx1zbvs9xTtnPUAPTiLq7EfWUdKgB3UN4vUj/4SdKw9fgr4jhjwNgywmgHHBvtC97y89y+3VbdbWxZXkeUURaXBpvjd4Tep9YHQAYdToBTjkAfLoP5pP9PcY+Bn8a/Tzxz6f+vFqP4e8PAGKA8waA3+Xf46f/B9HV+Kf9/O5/9Op/ffI/evpfHQD5CUA6AXr38cxhzumRdr4TW9Z6TyZNvnTiW+6Zf3/3ez/vM2nM6wjQ+OdH+0aGf9bDYMfo56k9MZ0IPYPfuhr4OgBI6zyQR9kzhzWLTw08mAbygvTiXVrrh+iGDbppi/DYYNix2Hjki1kXWpkNbUdsrBsbBelrBceHPOlTmGWv1Y8p5zoacO62pFmmInXkWf9U2nIPjfYrEboXlyO/Yq9sldeq3tIJvBmmBm5ooBoEM325MfUYusNYvs9YjX7TGP8jBwBlap/QDbxTOtpT5pSMmb9/Dd/YDN49M+p5Us+cpdU7xHo/6H2iTgCM0J4DAGPVV//zDYB8+p8OgPqUX2N/ZPD7tB+j+sd+/MffaPhX49+n/w/xCYAOAL/77736r9OCcdUf/dM5kvpSh6DOFZ0toPp3PkTnCaxz6NwG1vnPdCu23mu4buBdHPgtAIx1DXLQtwKgNd4zH1oDP43+9//mX/VLyoJPRJYyeqiRTx5yeepPPfnUR28XD3BWnBp4AA3kRQq9GPOCz40Amg2DTZONkU2l5mddaGU2rO1dZTNoci8Jte1Mj+hL2pl17qaBnAskmQZrrPmme3XII5hX6UPmA/+xL3VcvfTS+jaKvfLJY1ikCeLb1Pw7NVA0MI2l/cbSY+tK4xi8RtRQF5WpkQ9q6Pd4Pv1/73vfe+stgCpT2SMdkk/eqXKj+pN/2Tou24FJzxPS0olL4x9i3g96r6iRCWqAVidA/YX/NGo1dE85ADSWfcqfRr9P+6vhj9Htd/+PYfznq//0hf755J/+MxadGzoAtt4AQG89J0C+DTByBDhfYs5lubdf57vNe66DpFvWer8B/06BtwAwujXq0wEADV/UsPdJP4jhr/FvWR0GVWY6ATDySVvGPmj8/0fv/2Vv+JeFdxrcrDw1cI8a8OLLixN6MeaF7sUPwudX/3n6zycAbOCZb5msr8yGtb3GWjcE6GsEx4Ys6RFmmUr30vBmuH8NOF+2ZBpMepRvOZFytV4vT3kPib1+2V/7WHFpBU7FWqemacNA3gxTA10NTMPpMsPpofSmQXwK00A/RWPU7ynjE36dAIlp/OMAIJqfsrf6PdIhdUZ5k3/d9Vo2Bc+KxHq2kF6IeR8InfeKOgF0APhU2qfUd3kDQANZBwCGcxr/GNVp+OdTf167xwh/aON/z9N/HQA6Afw9g3QA6BTRSZKOk5EzQN2nI4B5cY7qfX7Oq3NdsLcmWpH1PqzSpM8KrKXf8uW/7lMa4mnEQ2OYY+i/5wuWv4uhn8b/F/+7//bBAaBjQCNeB4CIHOqRD49f9ofHE39kkOev/eMUoBxvJ5w1kFl4auARNZAX6tL6cYh5geemzabAd/84ANhgMk8660Irs2G2Jd3YNzYF0ncNyB4F82r7yaeu6aSTN5I/+dfTQOpbOhH6LpGeprytNHkPEbbGs7QOnBNHshhHHTe8GaYGbmlgGlTXNajuqs8tg9m8NLCT1gC/FP2WP4176Yoa/eD73ve+N7/9/e+/4QSgD/bNfovoCHqEWe6u+pz1t9f3rQ3hXUbvfFla9hrzXtD7QzANy3zyjwGqAyDfAKhGLPeeGroiRrAG8R4HAEb/yPDX+Oc+96FCOgB6P/639RZA700A9dJzBIzeCMi3AnTM5FylIyDnNuf8SPfWRt5zSLfidwuHdfX5n/sndQDwBB76S37N53z4aH/QwDsY5rw1gDPg63/Hb3jz5f/Tzz3sMRjxlE+jX1nweIsAw97X/KGtg9HPk3+cAPBZs3cbzaw9NXC/GvDC612gS2v6EPPiduOGx2bChshmxAZhXmLWPV6Ayq1ttuauFhxXCpSX7ZJf+ZWnDMuZnni/GlDfIq1Bm5YWM1/eJagc8DFC9pn2My29NP6t6LXWyzvyrD/CVmyGqYGxBqaBtG0gPZR+NHpHqDGdWA39aqSTxkCXn0b7Fo1Bb+yVM0/E+CeStj37lv0djQ0dkydmuYfS/2ttp+wMo3Mk+Uurc4ieT6D3iGlQamT6BFrjPw1UaB0Ae77/r8a/r/9zz0rMJ/+8Yk98jKf+6VjQ+MfxwOcHexwAvt3AeHV8jBwBPSfAOW8D5Jw5jzm30M75EXM9SLes9V6u0qTvFOgXRv+vXX7lX2Y9DYS981X/wVd9v28EpFGvEwDEmAeJOBR0AOTbABj/vhHwhc0B0dpbBm1O9tTAk9WAFye4GOvFzcUFj9f+2bj4DMCNoGLWVd4Rs63GWg0d6GsG2iFsYeYlbT14Pb754Az3pwF1TwvSidB3jcruyTUvEfrawbaROxrP0vJuxLzGkq7lWrons7G7OoU/w9TADQ28VsPnscY9MnTT6IVOwxlag1rUqBeroa5xfgo13sWv+eqvfvN7vu7r3oBE+aJ8ynzTN37jjbLw0glA3+hvHUsd61b6sebptbR7YzN4N+G5Vc+XpRVZo2dT3iNqTGr8g9UBMHr6ryHr021w9ON/Gsj5+n999V/j/zG++a8OAJwA9iMdALylQL/zDYD6KUA6AdRH6ki9gTpT0smCvnW+OBegc+Sc5Tw6t2LMe10TmW7F1nsS6EcJjA2jXSM/n+pj5OsYyHxpnQDU4RMEdPQog5iNTg1cqIGTm7cXdSIXPxsNm8/hAmrp3BCgszx0698SMTcC+3DhELrVUqZ0D+FtRYTXer0GLdPLm7z9GlCPPUwe9N64HMuKe+q1Kuu8Qz9UsG+0Jy0ujbfGen310ln+SCurYsueYWpgWwOvxdB57HFi5NKHLWO3Gsoa+6CGPpjGvga+BjqYRjo0hnkvYsBn/LZv+/1vMtY8DX5lkf7Qhz74r4mWJY8++CaAToBzHAHqIXX12PP3Utsvu4NnCGzpxKXxDzHPprxP1JgE0/jnnlIjNI1TDdZ8+o8hq4GrwetT8PoGQM8BgEGdT/+fyhsAPv1PB4BOi3QA6NxwrI5dXagbUONfPYrqeK/xz3w5jzm30M75EXM9SLesR7m3ot2t8A4/2Pe+r3jfn/ij3/Srf7JGPhkgwv99v/VXfB+RdXh81Z+xzTA18Gw14MWZuLTRDH+8xU3DjaDimRsDirvGRVRlmE6EviTaR+uaBme4Xw3snb+ldYOy4FZ0DrewibixTkwnQl8jOD5k9fq0NP4a67W1lc56R7on3/bFVnSGqYGbGniphs1TGVcasZXW0E3sGf0a/NXYT+MeA1zjXaP8Ix/5yJuM3/3d372mpUHi9/7p712jPBEZyO45AOCTb1naxglA33pvA/QcAYw/dZP6kP9U5vOl9SN2A88QWNIVl5Z3iHk+5X1idQCkE0AHQL4BwD2nRqvGbDoAMHI1fDGENYo1kkGcAKNPADC2Mbzzh//y6fxD0H4CMHIA2HedGY6Nsd7F+Ee36hwHjJE5yXnK+ct5da4D63ogTRjh29xH/sv4cATwOwG9SB5rEp08cldn81MDd9aAFymCpMWl8YYOgNwIenRuDtDIOkbli429bgrQ1wjINkgn2vYeRI7lpJUtKtv0xMs1oC576Dz0cGlNnhuRQ52ePHgE8W3q/v7aB9s0vTTGGut1tSed9Rut3B627GcdGBPhFL4tNf+epYGXZtA8lfFguNIXDVgxjVvoNPihfdKfRr9P9zX4NfbT0E8j/i9+3/e9MX7sYx978/GPf2IY+R/p/p90aZA61CUiCweBzgTbsg2ROtDk6wig7yNHwMgZkHqBVnfgU5nfl9KPsln09tg8U5ZWfo15TuX9osYlhmY6AEZvAWCA6QQAfRsgn3RvOQE0nDGkeaJefwBQBwCGOPEhg23m9/84Jeyjr/+fegPA8adOdJik7nyIt2X8Oy/OU85dzmnOdaNzHUg39sqHzuBaSt6kpwamBh5QA16o4tLaPsS80KFzE+jRtbxyjqj8xJa13rRDXyvQBiHbuitd5R0amH/urAHnKgXlXMHPtPRy5IOXRmVtYRO/rlHKXSsoKzH7sbSGDrFeV6NrsVdOGUdM+dluy17HCP3UQ+37nv726sjbU//VlnkphsxTGkcarNJbhv/I6O8Z/D5t94k9Bnca+RrzGkIYGz4FxRDSGMonommkwNdAQVYa9L4F4Ov+pDH0Mfgx/v3VdevRV8rm2wC9TwPSCZLGfzoI1ON0Alz3Rys7Gx/75lZcWv4a81zK+0aNS3DkBDj1JkAau74J0HsLYMsBkOv9oY1/HA20WY1/Pk/w2/9zHQA4AtTLKQcA+uUNAJ/8g1c0/nONtCWx3mPMcxdtzDA18Ega8ALMC1R6aX06xNy4R0ZHbui1vHKOqHyxsa8SkEdITNo8270LKgsk2M7b1Px7Fw2oy8StuVpaY9eIW20wnuwP6WuHXvtLa+QQ6zV16jrslVfWEWt7jb2OEfqphap/0/bTdB1X8i0rmjdKy5/YNPCUDOfn3pc0UqXT8E9Dt2f086QcY7ln+OdTdw1+jX1/7ExDX+M+USNfg8S0ZTCUNEyQSxs+9ffVf/rl2wig/cQRoBOAPiAbAwfnAU4AHQf5NoBvOKiH1I00eSMngPp97mvmsftfNkH3zkToGpfGW6PnUt4vVgeAhqfGqK+m5xPrfJKtcaux6xNwHQC+Jp+fAOj00hGV14Pr/bGe/tMXry/6R6yv/uPIyHH5ucO5nwGoU3Wszu/gAGCu6xrINdKyD0Ge6YlTA1MDj6QBL8a8cJfWlzW6cYu5gSdtPkh98Sgr5Sfdsq9ufPTGlG1CL8d2R1jLZ7pVXTc6aAL5M5yvgZHe5Kfek15aU7dirsER3avXeCl7RLdih0D+XYMybAt50uBCrGPI622LrvWUd8RsB5pQ8S338f/ar9qTHAN5pi1nvcSkaznTEzsaeGwD5CW0rzGauMfwz2/6Nabz9X6Nfg1+nrJj5GBI5JPNNOLha2xocFAnIwZ+jb6+j9FPuxrufs+v8W6fRfiU0QmAXA0vZCKLtwR8ayDfCECGjoB8M0CngLwtJ8BLWD+POYbYEtxDZZEexaXlrbGeSZ5fOgE0/vNNAI3TfAtAB4CfAPhbAGn8VwcARrOGtA4A1n29RnQAgA8VaItrM69JDH/6aZ99eyENf+hq/DNu9aBTBNRRAqo/HQC9zwCcC+cGdL5yHnN+Gz1aB64Z81vRQ5BveuLUwNTAA2nAiy/RCxRcjHnBS7MZQIvyE61/xJSdbbbsq4Qqs7bXSy+t5VHslU8enTYNbYA3w/kaUG+pU+mKSxN/I+a626KpR36tf0zXdkgTKr7lXudvyrb9pYm+2PjvHdSdMdtW4nVGdHcp6iQlybO/5CXPtPmifNE6pkFD5smb2DTwmMbHc28bg58x7DX8NXYxfPMJOkYxRnK+3u+r/RjUGA0a1dXYTyMfg5uIw4D6Rj8XEDHKjRr8afTTHw1/n/pr8OcY6jgYA/LsM4YOffFTAGQadQToWBCr/J4TAOdK6lz6ua+nx+h/2QTdJxOhe3Fp/DV6NntGiRqaafzzJFoHQBqrGrAatRq6Gr57jH+uFa6Jer08BQcAfSOm8Z+GfzX6HbeoPkT1JKo/UL36GQD69k2A6gRwrkDn8Yz7CtdKWw6HUNPyJ04NTA08sAZ2b9x54UvXDaGzKSxtPL02HOa1NgPl2BbypROXxt8bs16PbqLWNqBnuFwD6NfQ07W8pRVao+vwEkw5R9o2Krbswzz3EN4lgTYIta2l8W44APLwlfamSYSfnvoT12Vt034kQj9mSP3QD/uctLy9mHWhCbbzNjX/3tLAYxgdL6VNDU8wn/hD52vsadRq+PeMfoxnn/ZjPKchk0/1yavGfjXkMboxyPdEX9FPw1+DXMN/C3NMtJvjoJ84IuhHOhVwLNCejgDSOhuQZ6TddAJsvQ3APLyUtfVQ47i1Ibxl5J4LJ9PSS+OvMc/oeo5pcKYToDoANF41ZjVyNX57xr9P/7keiBrYXCvVAaDjDExnQNLXfjPANwDsz8j43zL81UNF9QTyxoT6E3UA9N4C8FMA7y/y3iLnMef3SDv3iS1rPWfhP2TIfuyhH7Jvs62pgUfRgBdhYl4cS+vVGvOCl+4ZGOZl3UanXOnGXjcE6LuGHAeybKfi0vIuiVWO6Sbuxjjgz7BPAz1dVb2aFpcmeo2ut7tgymu07fSwZV8lIJvQa2Np/BvGP2PzZknMQ7nSlhFTN8iO2Gu/ZT9KSJ3QgUzbT/mmz0Xri7ZBmlDTb7nz73wDoD3BP9fYSsO/Gv9bhj8GsIY/T9wxlIn5tF+jHyRiNPBEXYPfp/o+wffJvYY+xrxRAzvRJ/D2hTx5GuAa+xrevpKfaB5oeerTNn1xfDoEtpwAOiBA+qIzQEwnQP1dgN7bAMzndAbsW9dlC3SfTITuxeXIB2+ca55Pnl86AHwC7RsAGqkarRq1GrvV+MdQ9om5r877NF0HgNeNRjev3/u5jJjOAGkdAddyAigP+fTFa5l+0mf671hwboxe8UcX6kVUXxXVZ2LvDQAdAMyLc+ScgWfeV+TaaEvhEFw/pq+F2dbShK7rLvuftGOh7DGmjMaaYWrgZWogF3qllzbkNXqRnMKsc6SrXNMt+8433cjKYNo2Ki6t8I1Yx1PzI11lmW5F7jwOZLzmgC4Jieo3cWllDrHOW6Y9oCpmGWhkicptmO1VumWvfYS+a6jylyZwPbDoWx5UHsQ99AYqy0vnuJF/jNl2Y63jgk8Q36Ye/q/9sy+mr4HKTHSEjz1u+/Fk8Fzj9zWX16gEifnUPw1/jFQNY55ka2ynYexTcl+X13DxaWa+yk9ZDX0Map/ua+hrQKcx3zOkNah7SD815Om7Br7jGmGOFbk6G+gT47WP9BknAAhPp4O6cUzmKwdErk6A2q+cA+dFfM1rde/YNzYi98rE3J+XVneNnkOeS3mOeX5p+PP0XyM1jVgN3JEDQIMZ9Ol/dQDgMPNaEnUGJKZjoDoBNN7v4gxQBrJpi7bzDQDHglMjHQCOvRr+qSdpdZiowS/mq/86YJyPnCNo5865FGOec/6lW/Yh5DqRdy20rXfsE321/46nh5ZxfNZvHVtaVO61+jnlTA08uga8EOmItAtdXFreGr0otjDLH2llJbastU3oawTkE7KdSi8tf429cZAvP8sGXWXWdCt69bEh8yUHdGiQrnolvRido4oeTiOs5TOt7Ia9trNfrcid5ngkf2ly1/VH33IceUhJc5hJe4ibzrqDcdJery+NfSM49hvMKySU28PkQV8z0vWUn2noGYoG9hoKr7kcBiXj17AENTw1jH06fsrwxwjGuMfQ10CB9im/3+9j9GMMaxhrSKdhnEZ0Nfh9hX4LdQRo/Kfh75N2x+d4RfmgTgDk2Cf6WQ190oyHsaVzAD5p+EYdHvB1AmQ/1bf9sF85R9Kvee2eGnvZDkZ7Z2+PXlrdQ8wzyLPJs0qjrGf8Y7hqzI6Mf94C8PX/0RsAXDs6zjCyoUEj1xm015uIUd5zBGC0a8Bf6gSgfhr/tknfcFpUBwDj7Bn/6kfU2MfAh05D3/sEDf1E50F0fkTnDcz5hHaej9hbC3XdtKLrOQx9abCtw70TfaO/jsHxoYNRtAxoPWQ4ztaxpUXbubSfs97UwJPTQF6ULvDEpfV4jfWir+kse6RTlnTLWi98eNcKVb5pcWkNHWLt96m09Y6ovMSWtY6p0qRnuK0B9JfBdOo16aUVPsTefOXhdIru1Vf2EbPdSrcidw7IJKTspaVXB0Adg4dwHm4eViAHPZjlUkaOmXaOMdvPPrXsG+uZ9H0H+0I70iNcjmXAURzVTX6rfmOc5M1QNHDKQJj5Nw3/kfGfhr9PwjFeNXj9th9DBMNDo0TDH8M3jd40kDX6Na6rsU97W4b+qbz6dD2Nfw3rHmp8pwNAp4I6yL5B03cMfsaLM8Rxm/ZTh+oI0ZmgE8A+j/qq8S/Oddz/JKBsByRzn3Q/lW8aXIx5/nAueU55hmmEYaASNWI1aqvxryG89QlA7y0A3wZI/Mxn/tE/TedAOgU0ytMRIH0XJ4DOg+oAoG0dAH4CkG8AOG6f/qsf9SWqx57Br84rOieJeQ8hnXPp/Abm/Fe6FVvXDnl3Ccq+ZfizljT2v/Q9X/S1RH4DwagOTYOWs57OAHTBuBlz6+zSou3epe+z7tTAk9GAF6ILu+LSerrGvPiTzjJHusrJdCtylYBMQmK2I720MoeYfT6Htv4RlZvYstZ+QM+wTwPokJC6rPTS8g+xN2ceTOdgT45tNKztZx9b9sXznHKyjaXJXI1/+pZjyQO5HtqkOeS5QcpyHlwpxzHT1jFmH6Rb1oOEqgsatQ8jXFqZcyJyKD+SB58gvk3dTst/lTgNo75hpOEopgFcDV+MfwxTjV6MVb+Bx5D1NX9fBcbwgEeeBjAGv0Z/NfiRm9G25FUDH+M4DWXSvZhlGEN9qs44c9yVrnqgP9kX09k2+fB1BOAg0TmioaZhRhqHQH46cJe3AeZav73WB5ueeyrZ0hWXltc91zyrOL9Gxj/GrAauDgBQA07jf/QGgA4AfwugIk6A/EzAtSWOHAE4AIwY8EaMeoLG/ejNAPOtl9e8bdo3xoADgOh4Nf7RhfrR8MeA1fhXr717BvVfMe8XkvbeoSLz24l1HZAmiG9Tl/89yPc+iTG4jhi/Bj964s0QdKjD52c++9mfRd8gjp/UM2Wpo0MAWQNHgOO7fASz5tTAE9CAF6QLOnFp/SMN3opcfD3+kZdyKt2KrBsBedcKyqrtkV6IdfNyAxHd8Hrl4CnniL12WtZ6GEqDM+zTwGgOl1b9EOvcOGeXYJVlG0fsza/9a0XWNQx9TlBGyl+agHV95ljygO4d5PC8EfAgzDopK8dLe8eY/ZBuWev4sr/wrxGUiSzpROgal8a7JFY5mW4i1/YrTXqGpoFpFN00ijT4wTR409j1ibeGdjVo82k2N/2+Zoxhq1Gr4e8r/ltGfxrVp+g0tvfSlxj/6ka96ARRJxr6YK8f5uMIwPGBwwRHAPrBANOAgoZHHmUo23MCOAb7Y/9yPqHner+53mMTZO8kiEnnvgq9EPPM8SzyfMrzDENLw1VjNh0AGLo6AXQAiDoAep8BYPyNYjoENBAT0xEArXGu80knANcua1HDHqzpdAZYLtevMmnDdtM49S0Axuq4PffRjTpTh9X4V+eic9HDnLMe7dx2sK6BUbpVvbGGSO8Nh7VFvxhLz/BHV+iO+XFfTYNfvTrXOAKcS8rBR8bIEUDbrbNLi/RlhqmBZ6eBunBNg724NP7e2Ksvr4m5l4sG+QTbSVwa/xB7m1lugOTXdK2jrCNmO9It61Ygb4abGlAnPVSX4tKq3riZqHOV88bBQLpilpHemF/bTmQEpC8J1kt50Asx+2HfPKw96PKGSZqDnhsfbgDkgVlXeaDt2G7D2p/GuniM1N0K6oAytpu0vMSlFbgVHUfFXtkjL2X26FZshp4GpkH0rkGUxqIGpAalRj+GpkYuhj/GKE/8MeQxUP3GPw1/bkBJ+8N+GP8a/tRFRn2t/66Gvv0EpXuGODzy81V6xuz4TyFlqduTrfFvHxJTh74NoBOAtyPQWRpTGFHw820AdZbt5Diy7zm30xHw7prv7QmN19tD5S0t/xDdn/MM8mzyvNJY1XjlyasGrU+4QQwyjF4NYNCn4pyB6QDAgOvF6gxIJ4A0BiDrKA1xaD8VALlWNdo1NDXodQhUJ4BrVQcB+ZTV+ETeyAFAvxnflgNA/alP9au+QefBeanIvMmTdi430HnvYat2436CMgTxber0X2UvjIGxML584s98MzfqVUOedcLa2YqUoT5rIN8SQO/VEaAeW5eXFu3X6RHMElMDT1ADXogu5BEure9740gGw8/2SN81KA85vXaXxl83NTc3N8I9aB0ReRF7bdonsRWf4YQGRnpcWr1DVP9inTs3ZrAXa3nTygNtq+GoP/JbkXUtQ58TlAEuRPtgn0DH4EEu5gHPjREHFzzzQeuCKdN2doyV8dA/gvg2dZ2/ykyENi6NvhGz70lTLtNlbClD2Ymt+jo++ATxbeqV/50OgPO/8cfw1PD36TVGfX2CreGPweGr7Bi5W8b/yPDvGdgjXhraPdp65mE0jwxnjWiMZmkxnSPKTEzD3LYSKUsZHSnqUicKRlMaWhhUGGun3gbI8dhXMJ0Ac92/dQKU7S/3Rmkw49LSh+i+7BmU55LnleeZBiyoAwDUCeAbAFtOgOoQIK1zQOS8rI4A0+kE8Akx16a0yBqrTgAdAT51FlmfuUZNm0+9avwjn7bsD/2j3+kEGL0BoD7zPkD9g86J6FztxJznLbqJW9dEpUmfE2xnNf4ZI8Y/xjk6wfBHnyB60ujncwDK7Yn56QAycATgrAFpg7aQQ9veV7VBLC3av3PGNMtODTy6Bli4hEQXcw+XVnYr9urIa1XXdqCvGWobpsGF6GYH5ma4l8760Mo9YrYHTaj4ljv/pgaqjqoeSS/GnIPRvOUNBmVMS/fqpVzbOmKvPy3rotCTdRhftm//7Lc3SaKHOwjPmxpoeZZVBqhc0PbaKJZjrH1jgPKgrxWQSUi0ncSllVmj/T0XU8aRzjaSbtlrn6BnCA28ZkPIJ8FpGGow+mQbg7Uaqjy1x1jNp/4YEmkkcNMPD2MVgzaf+lO39+S/Gv9pTJ+i07A+l95j/Ksj9QPucQDYF41y06K69S0A9dpzqPh0Fd3iUKGMuvRtAOQpuzcuxyG+5vXP2GMrSDL3z0ovreAh5p7tGZTnkmeV55pOAAwtnQCnHAAYe73o0/LqFMC4q7HnAND4TtQBAKYTgOu6FzXyNfoTydP4rw4A27Ft+1cdADoB1BX6U5foVl2r+5wP5yiwzuNd0030eq4iyyAtyh8h5Q7Gv/c5rA8McvSCHjHSmdN8Wq/Rn/pwvSWaD1pHZwAynVfaSicAMtArfWtx71ha0RmmBp6eBljALmLpHi6tXI29cpXXqt2Qn2nouwTaItQ2l8Y7xNz43AxFDaSK5ospA1rZR6xtm27Zh2AfTb9mrLpIXUmDi7Hq3jkRPej2ovXElG+bDbMvSbesdS1DnxNSztIqrs4p+5JjGB1UHFYc9twocBNAOQ+yrKMsZYOOlbYjZr+gCSN8m3veX2Upt7ZnemkF1mhfL8WUdaRtJ7Fl3RorvBmaBl6jAaTxl1gNW4xHDEkMSr/xzyf/Gv8Y+Dwt9EZSw98n/hipvaf+vEFQX/1PB0DP4New3YuOYat8z0hOXaAj0uoq8045ADTGaaNG+5T6VSc6WPKTCvSKgeWr1ugbB0t+EkB95irfPOiNz7GIr/EacMxlE2TfJCTmXgq9GHPfzjPIcynPKs80zjUN2nwDAEcAZ12Nafyblzzo3psAGNM6AjSwQYzuxKQ1yEEdAPVNANZhjazFdAacY/zbH/pBf6sTQAcJukJ3RHSJbtWzunc+nJ8j1vnrpVvRW3Neeb00PANyzw2H9UT/vcfBOGdOuffhegdJf/XXff7Xa8A7fnXg+EeonmxDOchENnPAnNkWfbANZLZBLS1eMr5z9THLTw3cWQMu1B7COzcuG3XorPKgrx1yDLYjLq2x1cBi8+ttAF78FSkLr9ZxEwWRf4y2mdiybm0K5M/wVgPqIjH1t7Rih5g6r/PhPNX5G6V79VO+bTbMvkg39q05hbcVNsdn2/bLfnMYGTlsavyO7/iO78Tz7YFvvnVAZYHKtz2wdXo5RseXuDWmvXmO3fKms52kl1bwELOfSTuOilkmaeUdMdtKumWvAf4MRw1oCLwW1OgTewatxqmvp+sAwMDEOMX4x/DESNAYwFDAIN0y/H3qXw1/5Gu4aryKOgLokwa1/dvCanCT7pXvGcipk9QTdObpALBv9jWRvF5f7A9lHb+onntvA3CjrhMAAwG97/kkwL7af8eV+FqugRxnZyN0f0zMvRR6MeZe7J6d55LnleeXRqxOAA3cRJ7EkhbN0wEAYrgZfQtA9M25kRMAY3srYhBiDHJ96wjwOgd1CojwdAIkWodyykIu8jX8xZEDgLEy/lMOgJwH5+aIde5yXluRQ5BnWpQvygflib285FWaejde+0/jn+scneRTf9aQ9z2sNcaMjIjIzLjmUZY6rE1kIAtHgG8D0BZt8pkB60ongPdWxzZ6Y21ZM0wNPH0NuHjzAunRSxsKfLFXpvJa8c0NgfxLA20Rss2lpQ8xNz4PIC/0PIhGdNaRTpm20zDbl27slQ89Q18D6itxaUUPMfXtHIi9efMQ6OXJsz6Y8m3ziNkf6Za1rmXoPcG6iatzyr7YN7DeGHmDBHKTxI3Bxz/5yU8lX9q6qQfbyPG2ji/HmP2CJsiTPjAv/FNlKjtxabIPMedDOvu/RVs+UblHzDYr3YrMkBpIY+Cl0mnkJa0xCGIgplGahqmvp2P480QfQ19DgJv7fNWfp9b1ib+GP3J8VV1jV8TgN6YBDd0z3Ee8kbHt2MQ0zKtxrF5SV9DyRXVW+5vpUX/sv2MW1cfobQt0jZFVnQD5ScDeNwEYRx3jS70GRuOKvYC90lD3zZpeWsFDzH04923POs8qzy4dABhfOgFEjC6NXY3+ihiEOgJ0AIAY/6arI4An62nw+2ZAYuZroFcngIa82HMOsDaN7hFp/FcHQLZrf069BYAu69nvPDgvR6zz1tg37m1yzjOv8skzjPJGfOslUvYd+sw6YTysB+YPAxz9oQvm2qf1jpc11uoux3iQ0+hTwXKHezJkeA+mfNqizXwTgDz6Rln62hpRzqn2Zv7UwJPQAAuW0EMX8yXYk3lo6Ep/TvV3ae0cohtf7/DxENqDWV+Zom017Omqsddgv1fGKyTUQWJPb0vTzWoko+ucAzfp0dx5IIi9cinPuQRp9xh7/bLfrch63UCPguVT1tIKr2OzH/aRPhM5XDL6tJ+bHp5ucSNDvvwsqwxlgrazc6yMx75XmvTeoIzE1AX0Ysy+Qdvnc7DKUPYRa9vZr1bkxphJv+owMgxeAh/jznGkoacBC2r8ahhrvGqIYkzyJBqj3tf9MQB6hj8OAqLfpWv49574a/CKtAtt+xU1mPfgyOh2jMqwnDpIvWgc99ByOgDoNzJ7fbaNilk+xw2t7tMJ4ByMfiAQowHnQH4SoLPF/tmH3nhzfbhuRNfQS8TO5tfbL3NPXVqdNeZe7B6eZ5LnVJ5dOgFEDC2dAD7pzjR0OgJ6DgCNf5Gz0zcBNKxBeYmZr0GOEwBjPZ0AlTbtfuATf1E+DgBl6VywHTDbt1/p0Dj1FgB6dx5ybhqd8ybd2DfOQOcb/kOFW8Y/Bjg6wgBHHxr/rBvWkGNsHVxavEufqbs6ArwPYw2mEwBHRPaBNY2O79h2qz7D1MDjaaC3Ccjbi/SesoQRvs293t/at6WJXg0sLsw8fNg08hCC5kJPrPmkleFmc8amav+uN+LnL6m3NtTTYf5Gc4j+6/zk/EH3Yq1z4XyiefsOvSc4LnFdm/bBvmW/ezdF8LgJ4AkXNz2kvVHK8ilH2bbluj0eWEsbANG+9bBlXyX0ZMNbiNkvaPvbQ8bU48ursmyjYa8PjX32nFLnxYeXaNTkmNKw03AVNWA1iDXCMUAxHuvr/tzQ+zQPZ0B+379l+GuIIhdjNGM1mjNtvypiyMJL1Ljdg9albM8YVj+pO2j5oPWQkX1OOtuxrexflpVWNyMngG9h8MSf+Rj9LgAOG5wGo7cB7A/jyHFB13GznuDlunopdGxw7Js1yOvtqUsrfGNPd28GPZPAPKvyDPNsk+c5l5jOAZ0AGGY6ASqmAyCdABrWonkifA1xjHINdYxSHEsa8L20e4IGf2LP+Ee2DgDbtP3sn04AHQCMXwcJOkOv6tnzkDk5xjpnjX3jDHRuK5/0fQbaXX/0T8MbfeRr//AZo/cB1GnRMTXyTkE5Nz5ByL6wr9AnnQDomnXdWl1aTN3dqSOz8tTAfWjABbqFXgTnIH21vPR99D9l217i0gp0Dx82DL6fdvOoB1AeRm6eiXmIuamCtHeM2Q/plrVuCvBmeKsBdaGexKVlH2LqOHWfcyLtgeccwk+e5RJTpm3Z9hHtU2LLOhkoT0iEXoi2Zfv2yb570wPmDQ8HPN5nvv/3sM/8rKcsZYO2Z/v2p2GOT7qxb/Sf9N5Qx91Lw1uM9gm0n4n2v45HfpZNWdC2cUTHl9iyLh4rdV9keCmGTG8c1ZDT0EvjFSM1jU8MT4xGjP986s9TPW7mfcrce82/PvFPwz+Nf9s7hfYNzJhG9F1pdaFuNIBFdCidZaxnH3tj2erbVj1k9RwB6BejvjoBMBxGnwTomPEtDOQiX33aR8eTY3TcdR311tpz5XU2tdE+nnsp9GLMvdg9Ovdwac8rMc8yaPjJ89zjHCTqABB1BIgYyiMHAMa0kTLSogY4Bnl1AGj843SC1jkgwtMJAPYcAJbV8BfTAVCNf/rmeHQCeE+gntCZ56Pz4Lw0rHOWc9uyu8Ey3cwrMG88/eezD8bNGzzoSIOb8Tmu1ubS4n30C5ldJwBzyr5C3/L3AI73GvfRl9aVGaYG7l8DLt4ewhtFelbr2Fv5pq+Jys5+La2B1cjiovTggXZTZwPxsNlCDyhRWaCb6vHCP7Tb2s6+SDf2qp9Kk35toTdv6mppyjhE9Zs6h3YuxK35yzzLiynXtmz7iPZJbOx1Hh0DvFGwnri0goe1adv2xX56eIPe5Igc9G9a4Pt/eYlZV3mgbdjmBWN1fHvGbNlEx5+4tAKHaH9A+5ho/7cwy0OnTGjbaph9SLplzZAaeK6Gy6jfPqlNoy2NOgw9jD4N0DQ086l/fuuv8e8P/PWMfwxMjcyR4a/xWY1l+6JRKqahKg+0/xqv8kyLjlWUL46M3pHhW/VI/ToW07VPtmXb5GfZTMN3XkCcJ+hUHVcnAEbXyAnAJwHMJY4AHTTOT7Zvv+wnmOPN9eQaG63B58TPvWBAs38Sch+VXhp/jefu7Xlu5VnmGee5pwOg5wTQGQD2HADeC2pI99AyGuAa5xrtI8xyOgl0BuDE1ykADxmWT8QBYLv2I9H+6gBgnOkEUId5HsacOE85hy37EOSRSPpt7v38pZ1bT/952IEDgLFibPMknnExJsq3eJ/9u9Un+kBf6Fd+CvCAfWpDnmFq4Doa8OIRkSqdOKItb769Mi3KvxYqF6xxabzVAVANAzZINl0QgyIPlxFdDY+UmYYG7R5j7VP2txV51aHqoupqadpZ56/eOORcaCQzl8Y89OFxo0A55jbrQt9hHvdMYI7TMa7jsm375NqrNzje6IDcEOAA4CZAvmM0bX3HnOO2TdB1i66P0T4mMk7HAb03WEdZ1JMWl8Zb9VHn2b6qnz1oHdExgrR1jLaf2LLWccKfoWngORkre/tajTUNOYw6DD2NTYxLDct8uozR6I/NYVjyRE/jX2MSI1SDUsPf19YTNWQ1NhPpxyVRY/UUasyOypmvftAbdGLSlgPVZY4nacZV27UOfOcgx5/1odWd+mSuiDlXzAefYzhf+SaAvwuQ/yWAujoAkG/79El9gI4xxwyNPmrcuy6fYrmyCbov9jD3Uuml1V9j7sXuzxXzTO7t970z0nNfxECTznuBdABgwHGGakCfQo1ujHHfAsBQ1/jXaB8Z8vCrEyDT1vOJfyJt2v6oz4xNJ0DeD3gPoF6dg+O8OE9iY69nIPRDh1tP/9Err9ujD//VH2uAddM6t7RI3+870MYNxwR9oU/s/+B8C+C+p2DKfygN5AUlnZg0fRqle/21bC9vLy9lSIPGpdFDo8KNkE2Vp6geKHsxD6U8vNxYp6GxOY3Ol4VMO3ficA7RP4YuhxwHHvPI4Ykn1pgHKzzyOTi5GeBAvOMc0vfst2MZoWMCF6JrxfVDf1x/abxr0Iv0H68zN7GMXT3kgW9Z5SgXdNy2az/sV8Psa9It6xDgnRusk/KgF6P9AO0baH/PxZQBrXzbO2Ltj+mWPYMaeIpGyaV9qoZZGm8adxqe+VQZo5AnxL7yz5M7bkqJGJGk/eY/nyTvMfw1Yqtxq+GZqGGcvKSrQV3TGtiJSffKp45GBq56tay6RJ7jop/SIGnbs7x9gZ/jqnTKUX/pBEDv6QRw3nAC4Kxh3thDQW7g/WzDuUsHQO0rfcv+MmbSjl1UJyDrVbx07T5WPfeBDWTfJCS6l4JLRvfiHrpX1/2bdJ4BnGWcb551IE+FNfoTMcw4NzWQe4Y+efAtk5jluYeoDgAN/x5qxJvHfQgx70+k4VPOOrSTUQdA9qfS9FuHh/cE6Kme/eg+5iTnKuewFTkEeabvCw9rhbmmv35vz/0Osb76fxzDQ/WNMd9wTtg/7zntH31nDK38Qp0WZ5gaePIacKGKdLhHy6voAHt8eZa5BioTrHFpvNXIYqPIA8WDhEODjYXfA4DnoaLh5MYJv0ZlgCnbQ432I9b+Zd9bsVcZqg6qjpamlVtz6DwxdxxwHHbMHxEafs6f5cjnoGW+OWCp6xz25u/EAWnftybOMsNx2a79cI3Zf/pu9DBnHDz9ZxzwMlpWVE6uY9uy7c56rf3NcWyNt+bVej25S6t0a47tG2h/E9ET6YpZJmVAO86d81r7Xsf2qtKPZXjcV7tpmGmsaXhqpGJUYlBqSPaMfwxIjMeR8a8RqWEKaqxWTINWg7MavRrLIvmVTp55oONLhO5Fy5unjkB1l7Q8MMtSX33mmByr/bMdUX6OH16mlSGqz9Q1+nf+eBsDJ4BvAzBnfLbB/OHAIfoWB2XqWwDZf/tnfyumDlI397We71vuYLOre2Smh3s9+32NuTf3aPdy9/etc9KzD+MM2vNRozgN+x6dvxWQ+RraOgB6TgDuKzT0NeQtp1EPXyeAyJtDGv9Zz7Y0/EH7kZj9hGYMjNexowfvAdShej7ORZ2vxn6UcMPAxnGD3vIJO/PK/LMmWg+XFl13D9Fh2rrxFoB9xJFIX+dbAA8xDbON+9ZAvahq2vaTn7T594G1HdOgcWl017BwAxTZoDWm2FjcKMEaPXhEZYAeUm6sIH2IaN8SW/a6gcF/rSF1Ir00ZRyiOlXHYOoe2jnZQuaTAxKPLc4ADsiUCW1bZf7sk8g8JU26FyhDsCy4rkvbdiz23XXnzUzeyPDGCg4A0AM+Met48CNP2bZl22eO17GA54SuHpqAhZh9sF+gfU10HD3MctApC9p2bPeIOTfSLWu9LitN+lWF+zYwHkp+GmNprGLAaWBi6Gn8a0BqPPKEH8ORG1KfHqfR6NPj+tRf41TZpkX5oDGNXQ3OS7EaqOekR8Zs1WXq0zq0owMgxyPNeHp9cZxZrvKUq77UoTrVEeAc1rcB/FeBPPlnTokYYswx0c85dAQg17Z6/eqNQz2krh5qrV+znTM2u94+754KLi2aht6M7tege7l7PPu/52QPPQc9G9MBkEa+xrJoOTHLanRrmGvwa9xXzKf3OgLSQdBzBlQHwJbx3zP85dl/xq8uvA/wbFS/x3lwXhJb1o1zkPR9hoMDgLn9/7P3/6G2fd15Hya5tix/K0WrFsKOqK3w5hVY0EKkEpxitxJ6DcWkVuzUuJAoEZIcjBrcPxobWZVbt9Tg0qhxncrFTWMSofxoI8eUJkg2aYkkCJRGFVhumpo4ahuihoILpaEtteX32/nZd3/2++xxxlxr7X32OWefe/eCeZ8xf4055phzzTWfudY+17frvrTB96TRB+zH9mEItr72dXZIgU3YxjMBW5kvHlK8oY2v7ZNHex+BB7qbqaYZF+n2Hvm57sk2sk3Su7CM9JZY+AARWSA5AIBQdQ8S03zgVOKhHtCHlAvrcQE42DKxcySf+a+Lk/YxXo5pYo7lMjp9CPpT/4rpe+Q6Nl2ccjwQPX1HVh9oWzvHznGxD8YTs0/Ip3lpu2m7882HNpibGB40HACwMTC9YtZVn75In9m+fca2Y6g2r/VvVGkv6ySm3mXUOvkCG7QHTDvTP/ZjhrVe6rSfZWyxI+1KeWQ9uT9J+6SuW5KJt9AFAaPdJGKSM4gb5FJCmQQS8ggBhNjnb/4l/7w1zk/HOShI8q+uJI+ZZroowQQlmaDk9xq0fx1BJQ0/JNZy+gnfIacPO9ny6q19qf2q7RG3n13fs376Szn9Ww8B8msAv+hgXDPw9p8vBQzmMbZ+wWFbaYs2i/ZLf6SvnItvcS9c02ZZ7HI9J6uLZ1qup1vyMvSdBdfsfCbM1n7Sfd6B9dkpKYYkK1f05wKZLqnuDgAk/Un2STOeBN5DAPLrQUDGs65tVtQmDyhmBxjuDfAFPsFHPiPxqf49+t3xGdH2clzbzBsknr1dp8/szdmrJbHG7tHWcoP2rlVxZie2Qf55HmCzBwB3YOe1/XvUe3jgiQfqzZ/xlJ9UHAmX5Fu2InozrcrECYvBxY0b0eDi50OEOIs0pIrPq+tDJB8oytYV1WkboG2D2jNQGxNH8ikd+VO70hcpL8MRh5C+TB/rd9Hx2ELKM5Yc+jD2qTPbsv2BaRcyl2kfYuf/Zpksu4zIifTSbrXdOZYk3oe48xQCwgbA9IpZV32gfrFN+22fse0Y7Js4ks/6a/9I33OpJ3EZFU++wAbtSb9gq3bvRfsnpl77CtJ+hLRNeWQf+r0HKfNRXteQhnurkwRMUiZJg8hJ6iCQEL1K/nkj7G/H+dxT8s/bYsgiBNG3xRJPyai6K3bEnzJrxBKCqd0z3FNGgl59UdPNT/+tyZbHNuygP6B9UgYJXR/Mm6G6xM6v+t6xcExnXwRwIFADY0ognYMBfxqArhw77RC1m77pD1C/3du9sWXPBYsa66aXcoeurx0uQ8EpzJ4L+Sxwnc80nnezA4Ak98g8PyH++RytBwESbok4z2IJfRJ200lDJnR1PDhI4u/bfw8Qsq46sANZe8DanxqnX+4J3AfgM5+L5VmYY8JYOn7IL3nRzoJd2Ij/8SHrLP4gTjr5R3tfy66uz2dfKmAbNvJyBpvTVvo0wlva2tn/SHt4YNUDOWFTXq10zNxTflampmcc2Xii6eIyym0Si3xYsDhy0uhPAVhotkLWR/Yh5KIKslAZsOkYtDNxZJ0u0j/2yz52qF+W4YRD0Idg+lefJzoW3fiYZ3nGnQWbsVZvtmX7A7UpcSRvXlke+TQvbU9bsM0558MazE0JJ+EcVDFP3bhkvnLWR1avPrFNbWj6XO0mfullnUT1LkPZIdi2toDaB2pzh/SrSyctdSCnftsEteOI2ldxZJ/WnioT57KfH2If0b9bBOHe8yVeYBKyJKmQSEidhJG3xZA/yD0k3z8ex4aUwCfjlfzn239JYhLFjqjWNOISSVAyKWpzR5z3puEDyiYqqyP9lP7bkrMeNnd9yL6kHbYNWmaG6aPOhx4AiI6rmAcBHNx0wQOAPATgiwDKqkf9ouOH3fZHn1Tf3ft9o307lrJc+1K2qmmggTzlisvIOz0rWadz/a5re8Z9HvBsqM9PiBnPTdBnZcqk8fbWPDDJtOQbAt4RfQl/osRdzHoeAoizA4Ak+/nGf0b+u37SF/cC+XzErz4P8fkx5HiMpFe5zj6tpw/4g70OvmNcGFPGelizjICNb3XR9umwAtuwkQMAbMZ2bT3uMd7S1rfy0aPdj8wDOYlTvqSbtZ5xEV3KiSlbhrQuLCN98+Hhg0JkYYZc8VbYhZKb2AeJcqJ1RR9E+bBycT0uBAfbJnbbl5H9yV32veIyPDEdS/yszztkXEh3fIxblvo+7B2zC8eLgcJmr07OPp36Yntpn3OL+WfQPh72fv7v7/89BBAt68NeHerVD9l/7Ligz/Qz+2i/1zD7r7yMCidf0L7+ALVPeyvan8Raxji+QE79k/4ebBp2aWPFkXXKS5lyxo/ixT6y3l2iROA9IqQLu0GJGCjJlDxK4CB2Sf4hfHkAwFcA+bt/yCGEsJJ/9KjTNvai5LaSXwnlNWifE9Mfa3IlrrN46tC/tQ8Zz35oV6ZVOesi6yew863+71AC70GA4wcaPBTwAIAvAZwPpFE39Tjm2IJ92q9f0m/v6V5aWZRc+2ZFunzTOiSNsBByna7PiFzPu2cGzwaff/lcrLJlIHEpW04yzTO2HgAk0UeGBGaapF8Cb5wyvHjI4CEASLr6qGP9itiUn/5rK7bXPYH985nJM5HnrH7Ev/p9oOOQOJJf9Do7AKBfvPDg7zUhY7/P8WHF8qKW7FN++BkA/sQ2bOSwwr8DQDr2Hv2KHx/XwwMPD4QH6k3hYkMR8xLNX8Nl1D2EfHi4yHUPCm5SAos/iw2HAPwUIB8gPhhMAw3WByUuubDSprZo2xFrP0byk36T9rFeObb0sfqD+GLQh2COZ46p/ncsRNNnyFiqM9ux7YHVtpF0GivketXyp76k/drjHHJOOd/chIBsCpibXMg+5OuD3jrqANUL2pZt136PjizH0PWBtD2X5RJT3zKUnG3wtEO7QG0Vsx8z2bL4hYMSNk3OEdsAc5yRsSdC2jqTR/HTHMh+ku5luvF3ie+JrFRbk3RJxCBmEkiJIyQRAgepg9zx5p9PviF8fP7vH4sD83f/kETqJBmUFEoI0W07iTVdIpvEVtIrmawocbZvGadsF78kLf23R9YO2qYfEmGx2q+N2tTlZ5r+ANNP+i79O5PzQMAxzzEzjYMAxrfOB8efdA8JnAeOqXZm/+hj+rDO1XuNX7Fo1XWvxlMleTUsI+0Q6jpt3DU81/R8ZvB88BkIQeO5KAkWzc9niWmg9XzWSsCTyCdRNz3ROqJ5HhTkIUDK5lOeujzP1kKSf/uaiGzf7K/PWn1YnoM5JmM4Xvw6+6weQg2ZvvcDAPYbzBPs9Y9LNwcWa/P/xR37aODhgZf2wNYEz/xONi0RuQb6UdMyvoz8Q/BBAbrAgS56EgWQBRHM/2KNxZZ0F81EF1AxdakfzHa1R/sGpt0pj6zTRfqncNnP9APyYtB/dTxzTNP3yowNsmi6aH0w27DdI1a70t5R5DCWYL2y3onwOi+0AducSznPeGgbeBhC/vn9P/OU9LohsKyoLnWDzlXb1hb7PjqwHEPaXvtLP01D3rqqrmVUeOIPxwLbtFPMPqzJ+ATiz9cSbKLsp2h/QfssYlOEavNafFQ7+SPLkc5FGpf4IfZO/r1XYrLHLglXElNImYQxySAkHiLHm14OAHzbywFADRwOQAB9c5xkP3VKLE2bkVLTk9RKIsEkwcqS5uybcmKS0JSzzEzWf3tRPbQzszvtt/wMLZuYfkFOnzmu+nMNGRPHRzSNuVAPAPgShHnAzz88BGCeEJwL6KFNbcTu7Fv6cc/8vYcyN16mXAM7JI2wZHB9nqFrumv87Hnq8xBce4aQZ1mfpT5rIeOS+D2Y5H12CCDZBzkEMK7+1KEdFbUTzIMLDzvE7Dt+0mf5PAzfOx51rEaRm1+fYQM2vRNC/cTelQML/Xdzpz0UPjxwrx7oJn2mKXdI2qVhGXVOIR8WLCwGFzyJRX1YSLT8KYAPgoo+JHyQpD7bAG0X1Kawc9bHUeR9kgUMv+DaGvtl6DoEfSemX5HT55fIqUfdoO0esY7TSG7HJ/tT6zwhvNjpvHEeOc/ygc4GgD88xgGAv//PDUCWVVaPqH7b00f2375Hv6v92Tf6v3V19U1bRuUn/shx1E5Q29cQf3DP4icChyTqsK+g/RXtt4hdJWjzJThUnNYv5Hqh691c90BCrrEhyZYkDEIGOZMYSswhbhC++rZX4g/5kwCStvcAQEKJftuy7cRKYiWQYJJfZfuzF5OIpjyrj+/ISx8iMw6mpWwaSD3t7NA299iRZauu9JH+w6fKHgYkKut7xySRscoDAA+EGH/Iv38HgkMA0nIueABAO46dfQDTT9fM6beoc6OFarbmzdbVZbTbBp/Prtmu5d3zdO2Z4fOhonV8dvJM9XlbSXyS9Jpn3LqgadYTJf2J5lFHHT7fRd78K0v8tXuG9o9++2zEh/oz/F7HZmS92PUZNmAT/aDvvFH3fwDAZvIoMyyYzaUXM65RfLIX23jrj635NwvuzN6mC4+khwdexwP1hjWeiHxpWI51wFNwIRNZNAwueNychlwQWWx5y8rFaexsETXdui5Q6rQd0La1Bwx7a59H1tkCp49I/1gv+1h9QXwxpP/0aWL6fI+cdZFTv20esbNrZJ3GSftJ4zJuvWWknRFe7XO+OI+cVz7UQebhYUKOf3jIuBnoMOupC1S/7dl++sD+Y+sxaH/iyDr1D7m77D95yupYRtrJF7SpDdqkjaK2d4gPfOOPj3gAcw9bV1Q3aHt1zJv+H2zF3mOwD3txVDv0P31A2ru63oJ03KLNJFuSMEiZJFDSJ+Hr3v5L/PkawC8CSMu3vvn5vzor0gaBdMlnJavYJXFMcpvE1368Bqb/9sraVW2+hOyro2LqVE4/6b+9mOPgeDlO9QDAn4L89V/+a59zwMgegYMADgEuOQCgT/ryFnP8NXS80GLlmoj62Xq6jLxpcL32GeIaz5rPs0L0ueGzIJE6Gc86Pj99pvKs6Qi8aSBEMOM+o9GhbL4EP9EDgEyjPHW1A5TsZ5rp2u1zX9QPov3OZ6I+Db93YzOyb359xvMYm7oDANLIo8xoOefOzQ3ZqfDJTxYeBwA7Pfco9tF7IG/QKhsHnxOWY33wLLiIiSwahnxIuAC6IIoQCsgED3oW31xQO9l6oDpB2+oWWGwLu2d+GEU+yivngB2c+YD0heB4io5pYvp8Tc46yuotY0Pb1baR1D6Esl9ZBx0H+21L25gnzp+cW/lg96sU5iSHAW4kErO8cuqzjW5+apP9x9ZjyD7Yt5G1+7JO6llG7dNY2jaYPtFO7a5I35P44xveGNB3faoOUN1gtqls3xOxcyVkn7bkoeY0h5TBd3G9Bsl4iTYkWhJJSCOEEeIH4ZPsgfn2X6Lv23/JfyKkjzfD1COoSyLZoWWSeEpWPZhIQoss0RXpC7J9einUd4mMEfGKWQY5bdyytdY1vtYvfSFWn+nLPEzRz4k5Ds4Jx42x8hCAcWa8mQ+Q/noAwLzgQKj7OwDamP2xjy8x519C540XKZ8JqHXdTNm0GS6j8CmwXruG5xqfa3/KWaaTLevzxmcozxWft0nglSvxJ5006vg8FkmzXhL9mUxZ20YHZBi7Zkie9s/QfoL6AT/6/Asf13EYWYeL9Ften9E+9tAvfHfnv6l/Yu/jJwC3nA4PXe/dA3WBcCGhX8p7cDmWB3cFFzGRhcXgYge6CNZFksXWv7jOIkTcB8EMU4d6c3GlPW3QLjD6lL4YySeCSTqX+CH28fxrvxKRCUvgiTTqP/0ppo9znFO2bEV1ljGxfe1JHKadxoR0L+Use7LddrHJeeLccW65UQB5+LPhhOD6+383Ax1mXWR12oZoevpMH4yOLMeQfVCmn/YRubvMt07iMio88Qd+cZz0C6i9In3mLyWzEccnXhwG0F/LgakHWf3ZZ8cDtP8VsXdHyD7O5KHm4DvyuSp+SL2zf1+CVLyGTokWKCmFHEr2kuRB3iBxED3e8Ev+/cTbQwEPASgLMfQPwXEI4JcAkkjR9oyDkk8JaUdiJY9iksgq28eKtVyNz8qTfm2gDWyubWV8r+6so179kdj5r0vT34mOheg4eQDAGDsv+B8g2Buw/uT/BuFcYB44vrSBDdUX9v017oFbtPFCy5FrH+qVwT1hGeUOgbXaNTzX972yzx2Rej43eIb4nOTZ4vNW8i6anihp93mMHmV1WR+E/It5EGAZdFtfm2aYz0Bl+9ShvtKP+FT/DpyNx8i66XX6XwA8AIBQEzgMIA3bsXG0uty05euUHf4XAGzS3js/sLiul49aDw/s8IALeC1qeuJsQTF9GUqeFeoG3oUtF/m60LtQivnZteTCRXzPwpsLbV1gsUMbo6/2v+Io8klc9Jur9p/4YtBvYo6tMv5WrjjLUx9oW0fs7BlZp00LMtfM/mXknRFe54NzxDnnvPJBD0J2Jbl+3p4bDWU3FVkXWZ20gcyGgvmMXtLSP/oAe4+h9n0kn/qJvHV1PllGpTN/YIM+AatfsFNfVOLPoQh9oW/6MVFdYLaBnH1X1gdriP0rofqsxkfVi3xI+Te9bkEi3kKHREsSCRGDkEH0Kvn3La/kn0+7OQSQ8CdCBgl5COBBgIcA6JdISghpt6ZJRDuymgS3kkj7RB+R7esMLWO9tfhMB2NInmPZlUv9ndzV2ZPW6ar+yXj1p37eQsco50ceADAvJP7OD+aC4+/XIOiZHQDoe/1473ijxcdnQaozzTWSvC3Z/GWUffIcqc+SPWu+a3/W5Xnhc4Rni89Vn7dJzE0TffNPPJ/B6FGXZdVT0QMB09WV+rRvDfP5l3L1Sz4Pffbh32PQ5+JIPj3DSLvFdToAoD/40E/q7/kAAFs9AGB/5oEF6fgbXw7n3MpHt/DzQ8fDAy/mASe6SEPIe8Myyj4ruHgldgs8C54LYi6gEgkWWk70JF/8NsvF24dBLsYu7tZ3AbANF9y0RRujz9VPI+vkO2XwY7qcK4nVD8QXgj5LTJ9W2QebWPOJpy5k2xrY2ZF2jiKHMiBX5ln3ZLNtOxeYG869nD/OLx76PFCcg8huHGZoXVG9xCHKEGYOAGhXO7RLP4x+LMdgHxJH1ubV+UEdJ3/Qnm1ri/eLvtFuHq76QeTLCO5Lfdhh6kO2HdC2O9QXe3B4Y2mC/e0QB5qunIh8N9e9E5TOviSVkkcIYh4AQNYgbgTIvOTfv/JOnDAj/x4AcHhg4EuC7msACGEGDwUkpBLWJLEp24dE+iiZrHLtv3HLi6av1ce/5Otn5URkQ9qYsvmXoramLuX0USfrV1BCrs8rOj6MjQcAjCfzwwMiDgCYD4y9h0DIOe4cAqHD9rBLe0V8oD/vHV9gIWLtm13m1fXRuLgMBadnSbeGr6XVdT3L8mzw+cMzhWeoz1Ofu0nySfO/4TMftE7uCfN5bFl1QfaRJf3GLafO1Ofz7dJnXz4HlfWBvsG/EfR74si+2XV2AIA//+K/+q/8Agf+HIZAsukjto4WlxGw460u2l6wBZuwDRuxFZuxXVvx5Sj7lra+lY8e7X7iHnChwA3eAKZVXEaZZ4fjzXZ6KLiQubCJLngunnWxd4H1vwWEcPDZHwsyeS7sImk1uCBnG7arHaA2Rv+rb0bWyX/IH8vlnLA/xmv/jS+j4CHos8T06aVy6rGNI9p24sh6Mh7mm2d8GQmn+ahdzAPnhfPE+eOcApl/fv7PHIS452agytRxk6Ae9JLmQQKn6qQ5F0Ht0g/YfAz2QxzJp76T1l2mJ1p/GRWe+IP2tUe/YCNf4XTEH1/wsOV+xH/6Tl8mqk+0nUTb1w8d6pstpH8l2PeKo9jJl8h56btMezP53gnKzD6JpqQLIuYBACRNcif5h9xB/gm83fUAQIT45dt/6hEk/2J9GyzZl2CKkkSJIrZVEovtHYEk3f7txVrHuIielInj24r6O9ORCdSvwbwOq/6uTKZV3RmvvnO8K/k3vnUAwEEOgXnC2HoQ5Ph6MGCcOWVwbHNM01b6pB/vHV944XGtE7M510zSlBNPzxLW5W7dNm1r3c76Pht4ZuTzxWdqPndNq5jPYZ5P+UxCtnzqStmDANJ4znX6fKatoX3pEN+Qro/E9NXw+3IM6feRdBoPZfA5F/pPpBoSzfOf5zwvLu6MVD85rMBGOAI2p630aQT69rgeHvhoPeAET6wy8RqWkfYk5AJ0K9nFzUWPhS8XThdoyYQI6YJwcPn3AFy8K1pHVCdoWy7E2pP9C19UP42s0yKiX0n7GK7sj3LtP/ElQ/pNWZ/uReslZhtD7uyY2TiKPym/jLTDJkWbHH/ng3PEOZNziofKh5n34V/educmoZOzPjKbB0k0hwC0Y9vaom36AZuPYa3/o8jZpV8ysdZfRuZp02a72gFqW+17+oH+0Hd8p98S9amoTjHbS1l79qL+6pB+llB9ob9MH8VP9zjy3Vz3TlA6+zrSKCGEgPv2HwIPsYPw82k3wQMA0jwIkPxL+hMl/hUhjr4Nps1KOImbnkSxEtkkjsrZv0tldOyt0/mWNOqbp6zOvTamntRhuvpE7VZ/Ij4znv7Drxm6MXAcGAuIO2//mR/5FYAHAI4p4+oc8pCANOuA3dhqo/3Vh/eMN16IXPdmas0XKacMGpYhH0K3/m6lUbcrw9rvM4Hnhc8Qni8+W33uGgd5C2wcAqhMPXT47FFnp0+9M1zTqc0i7ShXXHu+VZ/o44H6PXEkn8YG+bnX2e/qeavOs56XFhyI4GP6hf2joeW5jT2j/pmd2ObPFfxa4U7sfEYXH1UfHlj3AAtBd5meC0WVl1HxSaiLTxenHukVu7KZloueCyI3qcGFHkwywWLMKaQEhBvdhbiii3rWV6/tgLavTdoZPqn+0qejyOnq0k6Z71CwP4nIGZYRPwR9VlGfrmGtY1zdR8x2Ux7Zp4ce6VyJWfa0ydAex5554NzI+eKcYt7lT1D4EoAvAmabA9KpKyJTXvIvaX7mPKx9zTgyV/Y/5WXknfyBz6tP9A3+yL5774EcYtC39Bmy960+rZj9znvQNitiG2nauIXOoUT6W0L6Q3kUOc0f5Lu77pmczGxL0gjpkvxD9iB5kDZIHW/0Jf/8F28cAPAlAKGS//zkux4A8Ba4CxJJyWBHQMmTpEpeJYod0jfS7eNLIH5Fb4edz9OGNdtSX9XTtZd6q9z5xjT9qF/Fmf+T/EvkJfOMK2PvWDJ/PCjgQIB0QtabHQBgl/6p/b/X+AsuSKyBW5dlXC8Tl1H57JmS628nU76GLOc6z9pfn9E+mxMl/jyDlM33GcWzqD5/fF5ZNp/b3TN+7VChPrtmcftWMfufcvFT+j3lUexmz6/Dm3V8hS8h1jzv2btIrPEb/cPOG7ZLH/Ze9P30pQJ2elCBrXlQ8YY27u3Lo9zDAzfxADcFV2IuEikvo9xZyEXnGhl9W/Vy0csF0oU5CYMLt5h/EBASQtyFu0Prieq2LRAb0ibtD9+kz5RH9snHyB/DRd+87OcMl1HwFPTZDPEveTOs9VL3kGc2aK/5o2hbdhnph3npODvvnAfOC+dJziXIO7/X94IQ+ylgt0EwTR355p/DA+K2Z/vao33pD2w/BvspjuR2DqZfLGMdcCFkG7arHdqFP7oDAL7GoX/6aw3ta6L6K9r+XtTuDrN/yvb9iOmTKo8iJ9+SdxfXvRKTmV1JFJMQQgIhepAzSB0kns/7eePPIS8HAMiSfw4A6pt/Dg2S/CtL/iGEyCIy5DAPACSjoqRU0ipJ1PbE7NuWjH+2yqzlz/yb6dTPdiS3e/RaN/WlrpRn+tI3yulHfQzq50TGpZL/JPiMHWMMkm556/glgMjc8uCAMrRF22mTPqr9vtf4Gy1Cdf0z7pq5DLvawLo7y1tLd71mXfdZwLOCZ4jPGp+vIgTQPNC4SF2fN6kz9aqrIqQ/DwbIr3rVCXbPo1k6Ze3vDIuv9HviKPLkeeU4kXfpNf203p8B0H98h/1D+TLCc9q72D7apG1swBbGyM//tZExx+/Hefia9l3an0f5hweu9oATOxF5FpaRdwqzRaem71moap0ujh5DLpouzty0hlzQWXRZhDndk4z5NrYu2DWeetRte9qgTdocPpr5cRT5KC7njZ0xntj5YBkVTkG/JV4zZ1LnUe7armmjaDvfF3Rok2PsmDMHnA+g8yTnT/70hHnHlyeS/BlaH7KfBJoDq2xvNgfTb9h/DLXPNT6Knfmgxim/GKpPaDP9om21/8T10xrqz+xvyuqfIbaQp01b6NhWtJ+i/T9i9SFxLvFD7E7+vVdiMrMrySJkC/IlAYTESeog95B9iD8HAH7+7wEAhwO8+fXTfsi8ssQfNE3ij34OADJACiWDSUqVzZMoSmY7zP6ljD+Mz2TzZ2g9fUs5ZXGWNtNpeVE9W2j5Nb3mVT/pR/3r+Ev+JfJJ9hmjjDN+jC3kXjJvfdBDAMabuqIHAB4YpA3Yha3aveWDe8h/42XINbFbM5dh2yWh00HaQYdrdX0m+fzguQPp8zmbzyGfO5mGTHr3PCEt66TelG1LJK/TW58/a3H7OUP90WDnv1HsZtdhLLAd/9BX3qjzBQDBt+v4jecy9o+WqfNa19kBhfax1yJoH7bTh2HUMsJr2vdafni08wl7YDahTQdrWEbaKcwWHtLXFi7y1uqu5VW9buy5WV2MWVhyUWahdeGtb2RZkCBa5EvILJuYDwT126Y2aJv2h6+qH0fWaUHR36R9bJd9q/03vowOn4J+uwbRQ73UN2TbuRZXyX/Ot5wfzhvmE/PLAycQEu8820IOC6yL7IZha/7l/bXhj5F9Ng/xE9fMX8vIe+IT2vMe8J4Qud/oA19B0Pf005ac97B9rmg7l6C2ztD7WKzzER9E6Hw1sk8+VE5EfvXrHkjIXhskVqCk0AMACBvkDKKen/53b/8l/xJ86hgghXkAUMtABOshACSyknyIobZJUCWu2p6YfZvJ+Mk85RlaDrRMyqTtCVlnptMya/qyjHIichfSR8r6Mcm3Pq7kn7HpyD/jDYl33FKXBwHoYqzRYfAwwAOAWh8b7ceaP+4l79UXnKcN+nwhp1s3l5E+C135mnaom+t1fTblMyWfP/W50uX5vPC5YJxnT6fXAwDRfQFx9VOP+upCd9qf8lqefqO8coP4axmh+m0kndKUQS7KXnOdkWzesPOX9f3vfn/PH/jG78UP9J1+jQaWEa5t6xL7Dj6gTdrGBmx5vP2/xIWPsh+TB7zpwLWwjPxDyEWpytxYa4Hy5itXHWtx64ounNzMBBZUg4ss6OILJrGCnPhWljxJWZZHTl3qB2lTG7Qp7T/6rPPryPqorpxHdKzrc01bRrmzkL67VK66Rpz20F/bNT6ypnnUe0J2Hes635wfOW/4Y3/MLy8efhBi59gM0cEDyXr8VVrK2obzTxvW5iB9iGC/r8GDnhwT5ztY/YJN2InN9NmfLtiHS9D+rqHtpU/2ytpeMfuHnH3f4dNR5HDh63p1abXMzeP3QkT22CGxAiFaEmxIGISMt7oQ9vz0v779J4+vA5LYUy8PAOohAHHz882/MuQQsgiJlJxWlGCSLpEV7U/2Txm/ICemr8zL/Kyb6VnvUlmdtmf8Uj21fOpR7lBfOe6OvX5N0s5c8E19Jf+MI+PmeFm/IvooI/EHPQwA0Uu+7YLowD7tr329x/jNF5R9Cutat/fZswz1e8tmudMzm/W6Ppt8huTzx7Q15FnC88FngrrV7/Mn9VY5iT95tqdu9edzZo88/ISv9oT0U5WHioO/wVtc6D/7zD6/AuD39hwKvPIhwBObsMHf/j/e/t9i2B863osHuBm8XAyIK4vLSDuF2YLkwngtzvR26dmGm/bc7Luw5gKcxAxCAqmSYIEQro6QZT1kddqG7WqHtml3+E5/Jo7smy666Luni75yJWb/kZdZ0IdbOKs/0mtbe+MHm2zXMXWMHXPngHMCzPlSD5r82qSbZ6ZRv87P+ubcdrUD1DZt1Xaw+GevD7LcwR/oUa/tgLYNpk3amf65hazevZg2bcnZF+TsJ7L9L35NX1V5uO1s/hPPi/JcezHLHiru/eceSUlnk6QKlAxKAiVqkDvf/vvpf/3tv+SfA4BK6o1D+PMQwLjkUeIPSgollJX4ZxyCSFz7E7N/VcYfpOmXlC9J6+pZf4bWAQ2zsnvTUyd1Uq9yYvoJWZ9K2iXrjEGSf+SMM46Ml2RdPYmpk3K+8fcAgPqOObrzECDHV/v3+uStyu1dJ55ZznWsU5N5yuAtwzL0PXlO5bOpe27kc6HL97mQzwCfDVu60Vefe7Zhu51+nzX0J/tkenkGHcpY9oj4lfQt/44i0+cPeddeT74CYC/DQS17Iz+1xxf0H3+OhpYRsPfW18EXtEFbtMnhAzbws2B+DoxtHAhoz9G/L2HLrfv20PfwwEUeyEmtDNawjLRTyIVH2UVwht7Ys3z0mKes7hlaHnThdCEFuYEJLrpJypTrb5P9RFkiJlpeVCdoO7adfdX28F/17ch6kYUOvW955XzCjoxXHxhfRrlpwJfkV1yrc8xD/zKC7exByp82ELTpfKtzzfF3TjhHQN5481DJQyYeNM6rNcy/U4GMPtvo5h3zT9u0FWzm4KFvF/jD8gdUX/pk6x6sPsp+INe+1fyMe08nqv8a9L7tUH/mPZ0+xQfDj/qnm1cj+zT3kb0oyyV+iH34t6bV+Kxe6pjKb0U8Lm1XQgVKAiFckDSIGKTMt//83t9P//O3//npv2Q/yTyy6ZBFZMm/WA8BaNe3wUkAtVGUZNYy5GffUsZHxK/xVda5RkfWTzvUJWZerbM3rq5E5Az4yZC+ZPwJSf7rW3/GiHFjnuB/x0A9FS3j3PKgJ5EDAfR5CJAHQDmme33wVuWmC8PrZ7iugZcGrM36xtWzjITT89vnoes5a319VnTrf5ZDzudA9xxc01/b45lmmm13+unHlUFf7MHRxMmfyLe8aP/JVwD8FIAXcODGIQD1n3vpg4Md+BnfS/47WxgT5s1oeBnhFjY8tw+P+i/gAQf2UnwBU95MpTdHh8uw6hRy0asEwEVWdDFzUazpxjus7WSc8rVt23AhBV1ckzxIziBeErT6+2wWpdkn2tZPwmI7tq0t9kvbw4/VzyPrdDkPTwnvTJjZb5/pjvIMl1HmVmHWxiz91K7jlnPNsXWsHfucY8jOk/r5PwcBHDqtEX/yqMdhFBcHCBwk1DZsW1tA7XPuea/Yl4lfZ74g/eQPZPWkT2jDdsG0RxtB7BdrXzLuvSVmXpXV1yFpl4a0XTn7tsOvnS+H687mPHEuynplPdJmcfOyXieb9gTfinhc0m5HBCFtEDWIF2QMgr71h/98+y/Jr+TfeOYri5aRDNK2BwASSYlqRfPBzMv+VVk/ka782viSbas7ETlD+kofMvZ7yL/jlQRdHZ1e8mYHAMwB9Xnwk4cA2OPYav9rj9Wl7T1ZEF4/oVv3sMI1L2XTRPNALnWZn7iM/MMzK9ft+ozKdR7ZfDHzSavPVJ+JtlHrWR+cPY8so37bwP4LA/2nTvphrzyqneopg1zoeM519hWAxJsXG+y3+fI2DwHwR/HBc9qn7mkeOA7aQNscHmNL2sBYMLaj7nPafo7PHnVv4AEHb4bXNqG+a+u/VT3t7pC0DMuIH4KLXKILXkVunK1AnVzsqg7itCVmu8pZJ9tzMXWxlTRIykRJWP7O+sC4xj/8DgjSZRnRuqK6bcu2s2/aqy8Hpo+VR/JHt9DQN67EKtt/cTmWB28R0IueRNtKfNKW49bNM8fZcXcegM4NsH7+z/yC3DufZphv/5mf6sx2bBvUnrwPtNt+iEd/POnv0Uf66Um+9UX1g9mutoBpY9quTL/0WWLNN74HabMrZ3pi2pdy9gE5+5f91hfFpzmvlEeR1fug5l8Sz7LIq9elhOEtykumJGySNN/QQsb49J83/Pn2P//bP/L4QqB++k9dybzyLJ7pEH/Jv2+BJX/a2aG21zz7mIivib+Fz9+iTfuaPkDWV/hO/3kAkG/+JeMghzIQdsaUeUJ566sv0byqH13Oi3oIRBv5tUF3AGCf3sKfe9pcXRxeN5O10Ut5tl5SLvOMz+pTdiG4Rrtus5a7prvO5/peZcuajh50qn/Whu3YxhaqH+zaOLZ36le0b5r+2YOj+tnzKOPIt74ONuE3+sezFgLO7+7Za0PA8xCAPP1efGHftuyz3DIKnt76oxPdSf55wYIN/j0CbMPG4xirZ6u9R/6deYCB80qZNOMO7iVY63dx0t7DtdbvZXTgEFxARRfSirmAXSJXPcZtryL5pFkOzPZcaN3QSwYkUWASL4h+/QoAogZ52zoEULdt2bb2aKN9OPo0/T6STvMR+WO/7Dv9VF7DZZR7bqj60UdaIvIpOF45zxxTx9gxB50HdY45r3ybz4Oum1M5H/n6xPLUJ0+9tgNm+9qkjaBzD8z+IGdf98i1fupGzna1BUwb00/ZD2X6iLyFlt+LW+2ip9ppPPuSfbT/6ZfwY51vGR/FTvc76VyZP0vLdOskIntZ1vgZ7iEJb1kmyaCEDZIG2Zq9/ed3//XT/9nbf8kdWIMkX4TsSfolftiQb5e1cQ0lmVkm+5nyW/retl+KxKo3MfuOnD6SpG+Rf8YIss4YJfGnfuqrcurPNtSHTn8a4uGC84GDAg8AbMe+6Md7xLPF4G0idX0yvoVr1mZdZMJCyDU6n1Wu7d26nmkpU1996hdNzzayLrJtJtYy9dmi/oH269Y4VLfPpExHfu51GBP9wzPWP77nlwD+HMA/DEgZfIWP9P0wYolQfXHKYzxsCx3ogvijmzf9tMV+rCP/1Du2gf7HdececJAqYnamIWe85u+Nq4Py3bWV39V56bS0Cdm4cuIy8g/BRU3kxqihLmCXxr1Jq17i3sS2L9ay2aaLKzc8QaIgiQKTcCF3XwFwCEB6LZuETLKSJMIFy0XLfmC7fh2Y/lYeyadxQX6vF/3xUl5D+78Xl6F8T0h9lCe+Ws/5JTrP9swv5kDOMYg+p8uQeA6TwNl8yjmWf5eCrwVSp3M55xtz3Dnfzb2cf/arzMWpT7J8yvoF7HyDHd5/Ytqu7P1zLarnVqitiXt9W+ZWzr2XkkeTp/WCNnZd90hK0iZJlGQNciU5g3TxVr6+/Yf8/9zP//znhJ/+6Z85fBlAGd/+U8e3+aLkH0JngEBmoD0JvwjpI0g0tROsBDbzJJuZZl/F6oeMf4wy/aZf9j99o78ce/zPeOSYIDOOkPM8lJGQp76Uzc82bAedeQDAHPLvQdBWzpVsE/32A7zX8dq1SLxOodmaZbqINcoztAz5hmXIh+Czy+dWPrNyn2a+mOVMK8/Os7bIs1zW3StbFyzt0A/bugZH9V0+pNxLXth++nsAPGc9BICIs1/iMIC38f4XgZB2yvkcXhsv/ae/3Yf41h+d6PbAwbawwTbQgY0jYOvjumMPrA2QNwnmd7Jp12DqtL5p4D1f2Oul7RWXUeDs5DQXtnqTebOJ3HTIM7Rcojo7tO2KWTZ1uVC4iZccJJFKwoUMWWMBgvTnxZvY2Sfb6lO/7dk+NmkjthPw6zGkz0fSJ7HYdHPPvqc/ZvJy9FOXb14i8u7gGImOHej8cmwda9Dxdz6I/DVZHjBbb/xzLlLWrwbq23/02haYNmgXqK1pv32aYfXTrBzpqTd9Q7tpR9qXfso+INuvNdSne8uvlavtd/Fqu/3St6B+SF+FH7s5esu00dRpzUAvV8UPqeXfeyUmSQQhUBI2iRlkC/JVf/vv2/8Z+Ycc5gGAJE5MQif5T6KZhB9bCBJHiaS2SgIzrmwd45ZN0njPxPHW88a+Zv/1jb7KsU/iz1wgeJiDbB11bKHlwdoO88C3/xwkMec4CLA95g5lsMn5UMfz1v66lb6yHLxW1LWpa888Mct0aZmfsmVBwzLks72s67ZrufEZdms9OkewDZD4qZ2qK9tS7tB6PlPUOzDbukQeVU91lRORudDJVfFD6m3/pY2zQwA/yfeP8fmyhDf1fg0giffZ7DO5ovmgdXzrzwsYdOcfH3yQ/9sO7q211QnZxUmrATtq2q3jtrGG5N3LRf+59EPKpi0j8bSQuRC5MInd4sWNSHq9IWu8q2ua+juc2UJZ62dbLgRu8CURYCVdxCFsSf6V+Uyo+6OAqc82aFMbtMm+YD++PQb9LY7kV1l8aee1Lvrm1cmmJSLvCcuxnJh1SDM90fQzdF4lOmbd3HJegY47mPMBmTf53bzJuZcydSjPKThzj4dV6sy2kNMO5xzovAOzH/SPePYT+aua+72WMZ760je0lTYgp33VV/aF/uk7Mfus3OXVtIx3cqbVdsmrIe3Pvunf9IX+wZcRck6+pDyaPK0dyF60+eS6FZF4CT2SQcmb5AyCB+GCgEHIeMvvb/9nb//9dPsS8i/xT7Lp236JnsRRG0VtTzRPtD/GwSyPjF/Fl/DxPei0f2AG/aKf8Dljn+NBnAAJJ+S4WF9Etz42LdGxRAfjbFvONUg/882Qh0kcHGEX9dCjXvtzD37ubHiyILxNQrs2HU1Zy+ustXwiMmExuEbnup3yVj5lLXPUaRvioS3LgKm/k31Gi5ZRh7YPtI3EkXxa9003jXgnH5NPeRnvZPV0edemaevpt/k8az0EYB/OyzhIugcBvLXvDgMk+B1K+qnLXkqdIG3UP/iH70eHlhG079r+Peq9sAeclGvoIF6Cy7Cb8uIldUe1082IfE8X/fBSrn1bRoFDcPERXZREN8CJdYOccWXKK4NZP2XbuQStn/rdwLuxl0yASbyQefMK+eq+AoCMkd69yVWnbdhm9s9+6E/9PLCOwUg6m0OOVU0n/h6v7E/arx9Is4xpe3A51ktEXg2OR0XHC3Regc4txxh03EHnAshc2fO5f85D6jEH/f0/cupEzvbSDm3LeYfN2Rfk2tc9cetVXcQ7/2hL2pd2V9l+2Vd9KZo+w73lrJ/lq0y8Bvthv9LH+iT9WObdnvn7nDKjubN7JuPIT66OFNxLmuQJMiU5g2BBtGZv//MP/3Ew4BvbJGuSRXQg+9YfhOz5Npd2JJu0S4AcGrQpCR+2pt3KoHmSw+yXaVke+V7G4qXtqP3WH/hWf0PIHQeRNA51GDPK1bFAD7rV12GOo22h3wMA5gVteADA35NwXuWBEjZQJ+3Ifr20D6/R/2RBeNsE1j6vlNfSzOuwW0uXUfDspZbrtpjrd8rmg6aja4SuHdLIW20rdVaZNpq20FnbG0ln6z75XJZTrpjlyOPq0j7kvNy/2vnkEEDiLmlnP8RhAF9TkuZhAAR+FiT9/vSS+uzhqZ8HCTzb3SeNri4jaNfL9fyheeqBOhG7+CzNgduDy7Dg0rCmlw51dpHOZd6H2Nv9qx1dX5Zh1tnC5WKUi1Ru+JFzU3yJbN2qz3i2uSVbR53a4cbdDb0EIEmX5B/CJmmD8HdX90cB1QnSjm1qAzZpf3mA4O9uHEby2XxxzEjnqvEPqe/rX/sgZr9MA6ts2houox6BMuBZcAw6dJzEbl45vqDzCsx5gAx5l8DX+TaLU485yBcAPPSQU2+2l3MNW5xvYNptXxK9rzsfdGlZN+VsBzltSD9VX9kP+tb5Lvv8mrK2aJ+YfbGP9j39oe/KnFubqzWPuVrnrfFatouP6tvXNaThNepInCRsEkEIFkQL4gUJ8+1//fSf9BlRq6TfAwD0EpL40x5hL/mXcGp/RfuTWElrrfMa/n6rNugrbWef9Y3EXLJfkXFhLBmzJN3WB1MvsmlZBtm2ZgcAtMNXJMw55xUyB0sE7cCmakva8FZ+nrW7vULcRQnWt0suyye6Ri5D0SG4Rj8Hj7rU3eHutnx+dPZoc9PeSDrbG+2JU8ZLHxFP2fzXRNo/8A73EDxveaOfBwGQfz/d98sACD3p7MsJyKRRjq92LefBQSX+7pXwPTaM8Na+GCY8Lj2Qg4FsXPkSXEb9W4Y9bY8mTzYjv9WVfsOGzvZlpB9CLkQuTqAbXtGNcIfcwKanbFqH6k3M9tfkrKPu3LS7kU8ykSRM8g9C2lhAugMA0ur/4Z46bce2sUXbsF/f6uuBdSxG0mnOmEcal+OYsmkVDxXu7B9t7MyqecRN62TTZriM+k+C/u+wzi/HDXROgY6tYy3mPEDmEzPmU86zvTJzjAca5VOvbYnaAqaNaXvtV413viDN+VrLG882qo/ST2mjdifSP+KJ2ee3ktNGZPvR+VmfpC/L/JvNU9KZpyLyWljTM6oe9FCGq+KH1PHvjBi8ZXoSpiRnEMB8+89/7ccbf8g/of7hv/zL//mmtjsAqOTfN/+3JP/2q5JP4pDGTLcs+JZj8RptZ1/1QSXkEnORuSDprgco6EidyKapP7G25UEDY+98oy2IPnOKeechQP60hIMkylM/bdKW1/DlpW2cFoKPT8g1r66Vy+juIeQ6rWweaFqHUa7qr/FpW53emhbtHPSMeOof0dP6jrx1UZdL/BDr/91Tpq95feqhb/iAZ6n7CZ65eRDAW332VfydgEr42bPngQBlKOvXAhwmoMu9Em3QFm0Osw/tX2/+o+Y1HsiJptxhpiF3cdPFZZRbDfWGW4uv6LK9iqPKyc4qE3+LCxu5qq3LSDuE9IGbWm/I3PDnJljZG8uNsigZSLSOuKbbGzXtUc56yuq0/dzISyaSiCX5V+YzodkBAG9myU8d6rUt28YW7dJmfazPB9bxMD6yTnnIXI7hh9iHf2tajWfZe5OrrbM46eYpz3AZZc+CPu/QcUl0zEDnE+i4go416PiLzCMePjlHtmTqUkZUVme2h5y2IKedOe/oQ/btFnL6R7m2n/ZV243TN2T7eAmmf5QTkbcC7Vmna1s7weyPfbXv+jTnV5mDzFXm5O45W+pT1zDTQTqX+CHW/HspYXiN8hImSRpkCuIHIYOod2//OQjgrb8BksYbWj7bnn3+n5/855v/Sv4hdBJPyWISPO3U7r1oPdA+ZlrqeQ2/v0Ub2Udk+68/9Hsi8wBCzjjVcaj6Mq7uROobbIPxlvwzL/wJAPOIOcXc8hCA+eUhgAcSzhdtSxvewsdrbTZLwseU5PrXrZPL6OghuFYbn6HlwChTdY+sdm1frJN6Uia/i1svcNbmKHJa87PvmY6cl+Uy7a1l+3fwB89Unq88a3n2+ht/iLxfBvj5PyRfom+a5ayHDvdF6I7xtN237v8n036dfDWuI0zPAVKe4TIqtyFvsufIjf6ZLaPoaVFAfosL27gS095l5B1C+sQNrTehG11vSDfAYm6Olb1xjSdaTyTPTTZp2R6ydqRdyllWfaDt5SbeTX4lBhJ/cesrAA4B8n8GUK9t2bb22Ads1s/6fWCOR8oj68m4mbZWjjJclOGa4Yfcl/vXdi9twXoi9ZXBKpu2HPPAU9DfFZ0/Fbfmk3PVsQYdf5G5sffzf+o4H5XVUzHbRHaegc41MftR+5hx/EK8YpZJOfUq22Zi2qZc7ad/+k+sfTYuUe8w01Km7lqcvJpve2LabD+yn/gg/ZPzLOfhUXauiqd52pRdy7N+h0PV2T1C/OxaIwdvkZdkCaIGiYKYQap8GwvhgoD59t8//Ccxk5xB1pKcQdAI9ZP/W5B/bE3b98hJRO2rpLHqe4uxeOk28RFt6Cv9ISGv6DzoyL86OtSXibWtSv7zAID2OHTiAADCz/zioMl5xhwjUIa5RV30OZZp00v79FL9Z4vB/URYy557qSMx18hlNHCLkDq1+Vlt8tyY2JZtZRu2u4Vbdczf0vNa+fb3yUEAz12fwaDkvmKW8Vntczr8bDuv1a+Pqp2cNJ1s2gxxhnkpk2Yw3fgMl1GwDbkZ25JzE4e8Vb60ObNtFDv1kzKveWV7M/uWYdDZCWT6wQ2+6M0k5o12qczG2g04sjptq0NsI12sZdQBao8beDf0kgLblvSLEDfk/L/Yu68B+H0RZSUQ6rc92tcebc55hd+PYTY2mT6KtvPIMbas5UwnzlXjmWbeFh4UvcE/nV2kdWEZ6acwu4dzjiuvzaWcT4yrYww67iLzgbnDHHKObaFzUh0Vsz1l57foXBNrf+zntVj1Zdw2RW0StTmRPhKvfe3i3mMdkua9C3JP1pD5s3GhXfVXG9Ju+2Rf9YN+zTmXc/FSGT0bdbr5P6q09zrpp+tSwvDS5SVLSdAgU5Cqtbf/lfz7+X89ALgF+ZeYaqPEUtsvwdSBXHWnrpf2/Wvrz77pB0mzfkjkEEiCbfnUsSZbPjF1e7gg8eewiflGyAMA5lM9AMivALCPunkAQJtp22v7ea2900Lw9oLP9ltZ4pqIPuWKy8jrAuVIt3xXxjTLgFyJmYe8HPPBa0LVl20NlWdtE+eyzIfY+/zXfp/4Cc9Yn7c+f2doOer4TB5uWEZQ7/v0yh1ZXSdZje8xNesoJyKvhWXkPwkO+AzdrF2Cna7S9pqdo+ibXTN/LsOi081F/9If3kBgd5O5Eb4U2Vy7QUfudJOW7e+Rqx7tcvNeN/Vs9g2VIBDnLS5/SKQj/6bxm6NKGmyP9rVJ+3Mxwt/4/xjW5s6evKHmtOh3421+6iLtkiv1Uq/GM+0SvVlWnaZlXDkR2bAM+RS6+zXnd8qOj+i4ic4l0PEF65wiztzx9/vOrz1I3TqXSLOdbFc57dJW0b4k0mfi2fct2fKpJ2XbS0y7lLW5YvYRuYb0iX7Ex6wh/MwCX+cf/eEPKNbgHwPifqU8P+FxDUKXesVqQ9psf+yvvtCPdd7lnNySa92MT+o69xNH0fbeJP1wrZGDt8iTKEGaJGh+kg258nfYvv33t/++jRX9/N83s7yd7d7+Q9YMkD8C7REgcQZtAZNEVnKn/SD+6zDLIFd99r3qfovxeKk20wdd/zMNnzMekHHGx7zUsSbrR+uBjqfj69gn8fewqB4AcLjkT03AnGuURYfzx/mS9r2UT6/R6zrwkSNrIleujcrLSDeY1qFlEmu5oersIp+rlsv4UvKJ15DlUx5FT+s78sd+Zd+X0dkTZ/GZW9HnJmWPIXWMpI/jolNeypci9a0zk82vWNvO+rXsLG6dLj/TkGtYRtpZcOA7rJPkOfGqv9hR7RzZJx/bJ9Je6rIN7aAdZXEZaacbif6kP9zUgm50RTfAFdkkk1bRNDbXbNh5O8rmm3R1VrR90pXX0HLqSdvcvOem3o0+CAHIIDEAt74C4CCAMqnb9rRB27BfHzt/GINjcFxujUP9aeyVxUvbot4lF/rr1aXVMsSznHaabrziMgocgv5N1PeJ3ZxyDomOI+jYijnuypDLvQcA1gGZixlP2fbEtElZe8WubzkHlffgTJdtJWqPqM0V7R/pyjP0fuU+5WCOe46/7Otf/YXYGzgM8EDA/03BAzuRn/AQOBigngcCeRhQbUn77Zv91ofOrZx3zsktpA5lsm6VGx31Hsj4KN5f15CGl6qTJEmSBkGDTEGqIFe8bYV08dk/5N/f/kv8IWf+gTbK1t//S+p8uyv5B68h/5LKtD1lfLUWzzx1ifdOHq+dB9lnZfvcoeQfJN86e9DyqRe/JvHPOZCHRMgEDo/8CQAHShB+5iB/dBJ0vnnYxNx6HAD0680rpLLucXWYa+I18nLUK6aOkXW4bDfjWW6vvAwFe8rSTm2zS+vKUO49X3v8k2Xec19b23NQU24Lj8RZmUyfyTOdpFunYpfXpVHPUPNN73AZhc9C3Shl3E1Zh27cZhtc87u62QZysanaPbKf+Iu017iqLcQXgn3I/qUv3OCKbnwrsjkmLTfJprGRhviz0WbjzmY+66u7w7Slk6lDeq2r/rQnN/QSCjEPAJAh/5INSILEoUOIBOXVb5vaoI3YqZ/1u+NwxG6cXjptNP1kXtImV4fVnlm5g4Ib/bPHjmW0dQj6NlG/J87mU84lx1B0bEHHO5H5BPmEUJLu/NqDqUfZdrLdlLVLTNtz3nV9TV9UuStf02pbxrWlYtqdsn3tEL+Rvsd/Wcb7mfvSQ0cOZViD+KqHezYv4hwWMHasUdSzbe1Km+2bfdY3+jHnHrJzs8Nadhan7kRXvSfzfkl5qPhwXUviXqKehE6yJlGDmEOqIGGQL4hX/uX/GfmHkOUBAORf4g8m8fMNsMRNgogNBu1K1OY1TF9RjvisfOpWzrKp6z3Ks/7TV/Lss8g4ME7XkH/9pi7GET0Ex94DoUr2Jf0Sf5E55d8B8H+dYP4xLwnMN3Qyn7CdNm1fe+5p3FwHPgHM9a9bJ5+ThvvUX+WMP6eNrFt1dnHS9l5p+946j3Jv5IFusEzbQkyelVnrzqxOpqdsO3vTbDvLI6+FZeSfhdmGyc1Yh27YLsWqq7YdtnV9GNlnl/0+S3xGRH2JnR3LaONE/umD/Up/uLkF3fAm5oa4ypQjjY00m25INBtx0lKHcrbVyWmXcleu2pp2uZGvhEKyIGIzMkiAOCRZ6GTKqN82a9+wWz/nvGEsjqEbq3tLG6aerSXaR3q9yPNKmTTjYpdGnvnKHS6j3CGkX3Ne63fROSR2c8nxEx1XkLEWHXeQOc78AIknKU3ZvKw7k7NdZW1K7Ppg/26JtIO+rr20R1mbE+kr8VmfM10inv57jsw9zQENXw9A+CH+9Z4mjXWLcWQt0B77YN/0gf51ftV56PysWMvtjRc93T3hfTOKPr3uiYxIkCBMkm7JGqQqP//n8IavAHwDm2/+IWL5u2zf4s4OAJL8015H/pPIVUKn3Yn4lbj+TTnzsk6VbQfMPHW+R8x+pFz7SB4+l0hn2b2y/mM8GVd0eQC0RvyZZxk8SCINmfnFfGPu+QVKfgXAfPPQIg8BtPuexu3pivBRpbj2reFszbwkfea0l2yXNtU/a/+R/hF5oA628TUkL/NTxjX3FNfWtCnTUl6G7WdhtmFyI1bRjdpzMfVWG8LGtL3Ko9iLXrTHVdtdRtpNyD+bYDfEFdmgQ4r9zJbPdinjxnmGbqgTZ2SjS6960y438WAlEJJ/UfJPHBLQkYQkDd1XANpiX7DXeZNzhvEooY6ZccohJyIbap71XhqHCU/mGWlctH3tZd3E2pdlKD+E9Cmyvk7s7nvHJ9GxE3MeIedcUmZOQRqZF8z3bp7lvMt8dVS0rWwfm4hrm5j2K3uPdP2+NA2d6lO/iA3I2lIx7U+Z/hKv/c44PiPeYfpzJnMPk9eh9zcHAXk/K3Nfk8cagI603T7rF3yTc63OR+epWPNrHF01jTj1RXUNrPfFSDrde94/pB2ueyEjkiMQ4gb5k7hBpiBV3ef/vv33DWySf4mbb3fzAMA3wDPyL3HzIEIyKaa9KeNP4/qWeCdbVrReh7RrurreE2r7XpT8g1knfTWTnT+S/iT+HABI/kXnh2/5Jf/Mny7UAwAOAZyHzFH0rB0A0J97GTvXgU8IXQPrOmkcV2yVqWUtv+ZGy1j3OZg2VnnNhrvJ45n5Hb/9O37kS7/7Sz/5D3/fP/JLP/SP/9CvcK9xH+VPa/Jgl8N691PH595b9Kcbtxezw0ljA8bTCPIyfSt+SdktXVv52mm5bDtl80XrdbiMQmeh2xzlBizltc2um9g17Oqn/rSl2Fn7MrJPl744JTxDUJftoUpZXEZaS/7pi31MP9SNPPHcBHcyN6sbahAyneU6nbRJerbdydjYpVs/dWeblVAkWYAEZMBe4h4CgLwtlBTM0K8Ast3sE7Y7Z1bmy2GMZmPH+N04MDfQ2aHzZi8ONWdrEvW8lPeg7VFXucNl5B9C+hNZP4vO7cRr5hFjy1wSc17xoHJuMGdyjlU5CW3qSNk2cj4p5zxXnvUn+3ytjG7q2kbKpmlHovZWpJ+kJWbflfEbcmL15Z4497PllEXSWbO2DvlYA6hjX+ynvsEnzjewzskuzvzN9Kyv7HzOcsjO/SN29wdp7XUvRCRJngQOEi55g1RBvNgc8vbfP/7nm1eIVwaJG/UIkLx6ACD5By9985+EPG2XlCZu+VhCmHq25C2d95Sf/dMva/2D9DMeSf6zXsrqyTkj8feQZ4Z+DeChAHPE+eLbfudRzi0PACArkP/8EoU86qKTeeVBEvblnLmX8WkXhY8r0bVvDTNvTSavBr1lPeOJmaecWOW1OHozf9ZOpitbz/hr4/Jt3/bFH4Twe5+BHrhxj/lVjYcAHgiw5vP1MAGZcj/8R/4b/yTP3hfoROcn0ggLwWfwMW7eiN7+0hiRFpQTkbeCdbOcabfCTjdp6q9ylt+Sl6HkLDgQiW6YKs42vW5cL8XUl22lLWHvWt9GsWdf+lVFxmu7yyhwCNqZttun9IUbXNGN7wzZSPP7Wd6acUH+c8NMPXRZX70zTFu25KrDNkQJhSgZELHTUA8ASE9yJ8nrkDeFtglil7brY/3uODgu7wDrnNqKjy6d1ibkrUt9lFOe4TLKHIJ+FPWvqN8THZPEOoeI51gqO4cSmTNJIGcHANRxzimnnirbZqJ2dfZmf5TpN3L2f69sPXXNsLMl09J+ZfqKXPs8i3d+M22G3LvmKc9wz0992IQwttht//SJPnXeOR9F5qvyDKlLnjoSuzreAwPrfTKSDmmJyIfrXohIEjmIUn3779shyBabwGsPAJIMegBwCflPEqfNFff4lDpdOdOrzox39e45bW+fKOfYQ/7T1/Yv/aBMOQ8NHFMPdRxbMIPlnA/5NYCkpJJ/yL3BN5MQFeZkfgVAPQ8AaBPbZv2xX2+FrgMfIbIOzi7z1nAtD701f9aW6Zbv6pp3KXa6Tct2Mu1NZJ6Rlfh7n4Ee0HofiuRxCMDzln2V674HBBwE/MD3/K4/doNOfZbP26FvGYHxyLDwHPb5DvqcjnJDfP7lRKiaNIZ0y5jWoeX25Fn2Uqy6rV/Tu/glZam/ZOg2QrlRUs4BS9kN23Mw9dmek0L7wubqg5F1Gkfk517o50qsbS4j/7QBTZvtS/rDza3opr2im3g21X7+PCP/WVe9HWKH6cppW6ZZrmK2pY0SCwmBiO011EMA4n7V0BF/01is0GX72KXt+lnfO09AxubSkPWvkS9tr5Sv86vGR/HV+VjLE+fq0jNtGWVOofZb34r6XHQsKtb5Q9wxTHQOJTLekBPnADg7AHDOUR859aScbaasXZ29tU8Zp//EL8VOR6YhY4uYdqXdM9k+k6+cqI8S9eElyBhRfobkcXiXYziTGWvG177qD+eYcw+s85M487dLz3ozudbLe2HIeZ+kPLLOr7ciHrXdjsxBztgI8oYIwsWmD5+7EWTzx+aQPN/QStpA3yyxiUQPpEzClwRRkujb2iRskMsM2tmhfSJPGazxzOvkLK8sduXvOU27wQzYTDxtJ47vGYck/5YDCRJ+D4kcS+KOoWVy7BxX2/BAwMMA5gfBnwQ4f5xbkn+QOcfcYw5yACAxIY3yzDfmmnOLNrs+Zf/fQj5fDT7qGOtgXsYrZhnkmk+8ptU6GbesacYrmi+aTzxl89fSs8ybyzyr+MSf+0nS773FvZb3iPdo3svI3Jfca0n8iRueeQjwGc9Z9h6/5w984/cSeKaTls9Z90zk/dYvfPOXQJ75lBtOXkaYjdOzxkClYJVNew5iXNY3XrFruyuTuvbK6unKLyOTdPAUcmCUGYga3IxVdLNW0c3cGtY6qTvb1y4wbO/6OLLPxpb4JRc6vTr9pi2j0NmmU3vtQ/YtfdBt3Nmgu2EH2QwnAeo+++/00A7p2Z4y9ihfirWtJBTKlTxADGqgX6SBfAGw5wAA0sBBCO1ot77V1/p+Mk8OY8V41ZDlr5XReU3dakvEnWNrOIo/meeU50pc07GMsqfQ9UG/ivpbdBwqOk6JdQ4Rz3nvPAK7N8fMmTrHjFMHOXXM5M4O0tLWlGvfiNN/0/VFRfMrZt2aR7ukZfudXPtAX9f8WX2hrzrUpzOshJ9yNc04PwPw66UZ+TednwPQh/SJPnX+gd087dKyzppc6+Y9MeTu/hnJp3sM+XC9BemwTcmcZI2NHmRM4s9mETIFqWLjx1sgxsUDANI8AICUUXbrAMBDAEmjm0+JoxvQJI6VuElERfqTsv17CaSdl9D7Ejq1dYbZJmWcB7MxMJ2xquPmGInoM5CWQT0gupx3eRAAgWf+EZhTzC0PAHz7nwcAzE1/CkA5iA3zGJ3OrWpb9v+tZNeBjxTdU9g946LpFc0XyVeuaF3TjXc4K2P6DNG1lte1dTdpv+O7fsc/JeFP5N7y/st7Upk87nOC9yr3HqSfey8D99yVHf6M5yyE/n/wY1//4z/xE1//UwRkDgJIl+yzp0H2kMB8nv3oGO0vIzhOV5mTlTuZNNOVb4UYXHV1aS/Vfm0748sw5BTq5od4t1lyI5aYG7WUuw3rVlrWR7adtEVbw/7sV/pyFNl1WYfCVTYO1rCMtDPSp53anf3JvteNe7dpr7+dvYb8ozfbncnYOcvrbDUtCUVHFCAANST5h9DvJQYSBH4KYb/0r/7W/84RkXHqQuYrvyV2No60Ou9uGT/zS+27/kzU16JjkHjJXErSmvOJedLNjdkBAHWZg6mjyswb0py/4sxe0u1XyqaJ+EK5onliza9x25nZ5NzX9g7tY+1/xvVVYncP70mT6M9wNpbe04mQUdpMvzjXch7WudrFs/weueqI+7HecyPrybOCtK96C+Ih2UtSpsxGD9IEUc8DAD6xxtfcY5At4mwEK/F3g0ldZNDPSyVkl5L/StwkliI+RE5f1njmfYrylj/Ix89u/hMl0KZtjQe6anB+ieoCJSGSDeaJh1DMHeZQHgLUAwDmInOSwKEU+dRhDjvXaMe2te0e5sFhEfg0/2GN5Jrhh9wP/1om05Bn6bVcjVtPzPy9aVt1Mv9N5X/gH/y9f8l1OQ9ouUe497gv8n5Unh0AJPH3MIB77spOLuxd/vAf/to/+r/9t77hr/zKf/ANf4OA/NP/+vKzHgaQD+EHM3gIwDOf5/GwoRu/K037ijKUqlj5JRGDU79xMfNeUl6OdoCHUDc9xLvNkpuwxNykKc82rqTn5nVWTj2i7aVN2mwfBnY+G8mnMV6Ta55xdKacbSwjY5X8Y7d9yL7WDXtuypXrGzM/jTUfRI9YdRq3XeLKe9E6ieoF05aUK2GoBwDEIQR7/vhfEoOU8Y++BesccX6IjFUN5q1hzrlbymttkldtHfGce7eQz/zR2VP7q48TcwyUZ/Mr506Vc/4gM4dmX4Uw9nWOZdz6VadztrZtHLuRZ/bbvzX0nhfXytY82iVt1n6ma3NF+mxa7X8Xx2+k67+UTasoySe9k00TKceY5f27JkNIqZv+cc7lnOzmbE3L8sjoSaz5tX7ch909N7LPni/EX/UAQOIjEQJNS5SUQcIgYLx99QsAyT+bQNKT5FNWss8bXEO+9ZeQ1TfIbjrTNuW0LWUIHPEkcjWeeZ+arC/Erf5Tbha6uuqd1anpjmei4+4hgKSDecL8Y+44r5hrzDnIhiQEAuIBAAdUfAVAHkRn62cAXZ9eO+2wCHw6/7Au7rmyXCdnGvpqvGtjVsZ0MevuTcs6dyfz1hyyb/AwgDj3Fmux96T3o0g6Mvchh70Sfu6xlP/EH//Bn7mi45/xTIXEQ/Qh/n/z//FrPyf8x//Xr/nbh8OAf/Ozz/+9n/mazzkM4KsAQz0Y4PnP83jY0I3ZRaapoEPS7iXQqdewZRntnELd9NRNEXE3YGJuzlLOTaqyG1KQtIwrWzYx9dqutqXN0ZfOdyP7cJG3dVkmsdO5DEWvRv7ZEPMb2m4Dr/+2UL8npkz9Gp/p7OyYEQc28jXQlxm5S2JAvwmU5bCAN/8EfjKADoiFc2RtfuRc2SM7x14L12xinpXQzce9aVXX2RxOO2rf9a+o3xOZP124dB4xlxjnnAspey8kMXX+zeam6diCXG3KuV/7QB9JS8x+P0dOvbZrO8YTsZt4Yu1L7avxRHxHPDH9eamcZL+T9/yhT+51Lg47aT/96rzLeZnztcpZbiajs8tLXTvuvVHk/HotwgEZc5OXWEma5dj0QcIgUZApNnwQLT/7J40NJPkSfAibxE2ZuME3vJI9N5li2qXc2UcafhOr/Fo+/ZTb0fdglU3r0HFNdPxB5wZzxXnjQQBzjTnH3PMQgPkI6edgijWBQwDSOCiA3DgP0Yt+2tXeexi/89Xgk4rlvnnWccuQn3IXn+m4Jr22dY2Ou6rDzwA8AOC+UAbrgUDN415z7Yf01/Dn/uyP/FWejxd2GB9/Rj3e6EPwIf2Q/7/1q7/+cAjw+V/5jZ8bPASA+FM2vw7gAIF9Ds9ndF5ox2pxlSUeDD82pLwc43vRehWHmhOpT7mWe+l49gP5EHKzo1w3RW6+EnNztnfDWjeqs3hueG0n29Y+7bUvA6sPR9IpDZmLMlx7sOojvhhsX3tA7dTu7Ev2NzfjKfNmnAeehIcHIJvnLKOMPuTEbAO5IwumzfKrjhrPNrVFnBEHSAF94zfdbvTtYyJ5EH4IIG8Nk0zYrvbQD/2s3x0Lx0ZkzJRnaN0tpC3H+hLc0kt+Z5vzrWA3N2dpS6l7iHdtdTbqW1GfJ+Y8T9mx6tDxdO6IeQ8wH+p88X7o5ho6SFdXIjYQr7Z4P6TdnUx/Sc9+XyOrI7HKxGvAbtKq/RnP/mXf12T9SBnla9H7VUQPcv4R07zfU3asuffpU/rWuZfzs5u/mZZl855Vl5jllFNP3Dt5f43kJ88Q0l7lCwAITxKuKidRMw+yBAnzAEDCBUquKvGX4HcosROT9EnMbBtMm1KW7JOmfA9E7lOxQb/X/pqeY1VlxzXHOeWcE84T55IHS8w5DwKYhx5MeQDAusAfBOy+AnCeaWvtw1vED4vAx/0P6+Al11b5ml/jz2lrTdda3iVtvlnZb/3Ct/y+/J8AIP4cpvFm3zf6HKb5nOVegvhL/jlYy0Ad/itAnn9XdAp/nn3+zwEA5J/w+S9/9Yn8cwjwN/6tr/mcnwVk8KsADhDY6/A8HjrRe9VYWalDla7hQod2BHRQbk1X5o2iu8tmvefK2HgWcqOD7AZIdJMk5qZMuW5UtzapuWGtsnVTp+1oA6h92h/9qj4aWSdfI3cXdbgSqx7ii8F2tQPUPu3NPmQ/Z5txNsr1zTiEmU30rA7pqXuvrJ/3lrd9yisnzggDfSJA2niguxBV5K0fG3/IH+VTX7ajvfpWX+t7x8Pxqcj41TTi1utQ3bfGri3SOvucdwW7OZppSyl/iHf6Z7bUPutv0XGo6DjNkDHt5hLjzpyHMDJneNtPIM0/huk90c0R0nK+KNvWzB7vh9qPGqffpNn/PWh5UR3ETVOeIXaTlzjri31ew/QdMvcc9x6HbgbiXSCfMeF+5cscAmNCnMC4eR+jl7R6iNPd/+ikPHbrB3yVczDnqfdtnc9ZJuXUg0yeaVkOOXXGPZT3lvLIPr9emnRAdpJkVbnLhyhBwCBdHgCwSST45l/yTxlImoRtDZPgKXf2VOKYcfxF/KX99tD/1Zs+dhwSq0y8C3XciTsnxJxL9SDAQwC/BoCYsOazdvBSpP4UgHmKXtrBnnsZ3/PV4JONsT5eel1T59I21sq/dftrtq3mcRDwpd/9pZ/kfwbwYJe3+txDue9GTsKPTDmevfzVf559qw3NMw/PQ+rz8wQ+64fY8/b/nPh/1dkhwK+MnwP8n/4Py/+F4N8IoC4HAOg52nPzcVHhwejRp8TlGAcvDeihTuq7tXyNfuuAp5CbHDdTONzg5iixbnjdqCWubUzJy42p8a5O6rRdbdFG0H5E3zqfj+zVcdnKX0aBQ7C9tEG7tDNtz75l31NmE17fkhF3Q5xlU9Z/pClne8+Vq95sO2WJVyUWEAEIQt3wG+fAw40/fa31s43si/5NgpDj4RjtwayXsmP6GpjtKlfbnX8TzDl/mKe1XNVn3PYSuz47t0XHoGKOUyfnmFZZ8lnnAXHmEvcEIfPRYbzqyzi2EK82YT9ptR/G6S9yYpX1iWh5y6nrOVjtznj2E19wL+Ev/Akhh4RD0gncj/qR+4/ARptNNpttA3ECeRnYRFAfneiv961t1/bTBm0hzQMDx0Yf6cucizlHnb8ieSln2dTRyVk29aAv7qO8x5C5Kr7YFwCSLomW5Mf4DJN85QEAb1shW7w1gnz5aXUl/9bfwq59ba74IP3bZPxeCG2OVR3HGu/mQDdv6kEA89KfBfA5s4cAkH7XofrfAlLOQwDsuBd/fVgWHv/u8MCTtXNHna6Ierq8Ty3tM56bHAhA6Hmbz/6aZyyB5zVp5LFP4Fl7fMY910+MwcKz1QMASD1fAPjJf4d8BVAPAfhJwC0PAJwc4N6w0Jkrw942LimHLZQXU8601Gl6IvIpuFkS6yYoN0puxhLdqCXmplTZzSnxTnbjJ1oPTN22rV3aq/3HiWz/0hcpDxc82bRlfier8/T22LZB7dG+tDn7Yt8TJS5shCXFIJtsNtCUpUxi1lfWt9netTI6U59tdJi22ReRhQfikP1Spn8sSJCFSiCsX9uzP/pXf+v/HJOcE2ty1klZnR3a7nOw00ta2oDc2T7m72k+7pE7HaTVtoxX27p+OgaJjk+HOafquDLekkbkzDcuck9AWClPOdLNy3op51zubCONfojZp5mcPqGMcctrmyTYeW6ceyMfzNwLrAFbQeIske/IfEfove8uRQ8DuF9pE5tn96tjsQdzfJQdG32oT52Pzk/ROZzz27yK6ljDWke9cY91z4aRfX69BBGRaEGwIFRJtIhDqHyjKpJmnvkQJoiTn4qCxHn7T16S/4641bbTjpS1t2KSyfTTPRG4tOshPz2ocKzq2GY854JynU/1EIC5xxxkLuYhAJ8rQ/79AqB+tYIebbqH8TpfDT6JGOvi3uuSsnt17i33lm3vtfG9lvuM5yXPbP8AIAcAa2//PRA4HAKMPxboVwAeALAf4Jk8HHLTcVMZ2IVlpN8idLovTcMO68zkmp/lMo/0U3BzI9bNT90ouRkT3aQluoFLZHNH3E3eXkwdtmHboPZpt/3IPg7Z/l+Lrb9sE9QObdNWMPvQ9duNMpv/3Jiz6WajbT51kTsdpunjDtOOlKlrXDlR3VuobdoLyZm99edAAJKTJCJldajTtrUT1Mf63DHIcXE+rGGWdyxFdSbanvMv49fKqV+52tX1oczz0zzN9K4eaVW/cdtP7Pql/xNzfGYyYypxZY4QZ56TRtyxTnQegAbePlOPcqZZLuumjE3Eq23ep9mXTsYPpHdoGvMYu5jfvmHvkHvjFkHd3FOsGVwS9g59wy92ZUyjDAcJ9KV7y59+3ys7Xjkuyjku+t+553x0noo5v0kzbr5ofdHxyjlBnuVF9YFxX+WzZCSfnjHIh+uWJGSNVEnuIU28PfUNqr+pTlLvoQBlJFd++u/b/xn5l8BtYdpa5c4n90TaOvseaR/I/2ycTK9jbXw2X2YHAR4A1EMAf8/M58r8RpkvV/ijZsxb5zht3ct4uQ488OGBT8gDn/Hc5Nk6PwD4yh8AlPyD//Ff+U9/nv9VoAcA7APQOXzIM/eqy4qzh3amIy83DOqrbVwa32NTp3O1Xm5u3PAkulkC3YiJbtDE3Lyl7ObuUsyNmfpsSxvAummzT2UMO9/sSTv5T72ifup8pJ3abV/SB7lhZnPNpjsvNt1ZBpn6YupCto1E25/lZ3qViW8FbREhP5A4yFz2RZk+SvSosxa6tu2P/nUe5Bg4LqBjtYZZHjl1KdvOFmrXDLfq255Ybev6Ueb5dL5at+o0bpuJnb1d3xyXDnNeQYz9GoS5ALkkQGKZO3XMnVekK4vMI4J1TDeeiF3EO/tMo1/IXf9qmvpo0znPvCcQJz3tsY2KW21a3nLGK9I32uZAoa4j3nt70XFh/UGnfbE/FWm7ps3iWRbZUPujv3P+OS+dr2DOaWUwyyijk/5w0Mq8Yc75lQR9Js46TDnrZBvojXutPjtG1vl1CyIiiQIlUvn2nbeeSfwl7xJ9DwHy7b4HBJAnP/3PfHVI0Gy3Q+1KO6uMH0hLf9R45j3kp2/b35NP6vgbZ/4gd/PIuQb6RYAHAf5NAL5SgfTz22YCc9d568HXPX0FcL4aPGIPD3z0HuCZuPDM5Bl6zQGA/0UgfwfglgcA6XmM5KoPcOPLyHsScnPRyV2dY5p6r0VsoW4icgbzM21Trv3ITQ+yGy4wN2LKbtJANnCimzk2d8hu8mbIpgxi0BEA66jTdmhLO7Qz7bdvjZ/2jsOZ/9Qn2pZtawuIbZ0v7AvIBtlA/9mI5gZdQmSZROunvipXvxtPP1In06uOrTg2UUbs+pF9oo9ssLMvnZw604a0XR/rd8fBcQEdqzXM8sjqSbSNGWpLYs6DTO/kTm+2X21c689WXtVlPNtT7uzq7GdcSM/xSZkxZG4wp3M+KOfPXHK8O9m5Rh5zibpr60bVgV2kpX0pW552JPasTQb6oQ3US390/qpplCctMXVcKqftyNjvIQsHLbOA3zJwb3J44DpsH/XHGtayGZ/Jnb7si37Qf85J56tY5zvppJkvksZ4OufWkHKpI9uI50k+R0byaT+BfLieS9qSOFXSBFGSICVhz3KSKQ4IIEq+LYVQEYdAzd7+S8hSH7IETtvWkP6Tn36o8cx7yO+X+HfjStpaqHPLOee8ZV4T/FqFOeshgJ//51cr3gfovYe55DpwCfKbbda6S+o8yrYecH1uMx+JL+aB0wEAv9+HxD/9CcD8CwAOAPwJAH8E0P8GkGfwsJgxveiyQodOkIrLaOEU6sP/aMjhN+CUq/lZN2TaWEaoba3FszzyJSHbm9ZL25HdLIFuuEQ3YqIbNDE3b8rdJo80N4UgG04+M2VDJunt6qlTtF3t0c7sQ/av+G/m9ye+Sh3K2Ybtaod2aSdY+0O/DWw2KzHCHzOinP6remtcG0jv7OjSqo6M57iRnnHGcfbmkXTeuNFX+z3D1Jtt2xdQH+tz0HHIsXG8ZphlldUjZhspa8Mapq2W69LMS/3ZJ2zRPrHrE3O8SyfNehXtZ2K1w7h2JtofsAuM+dpbaeY6pDrHupOdazk/SIO48ka3q2MadiFX+9SFHuxkDjNPsRdEr7ZRN/utT/Yg9SgnWsf4GpLXhWpP7dvs/pql66vXxmp37Ze+cn7W+bs233PeI7OmrhF/8xjzWtd24jlSnyEj6/y6loRImpIgQYqIV3JkunVE65JP4BDAN/6if/yPuJ9QS6LUqx717kX6TtlrffCo9z4PA+qYGwe74PxKdM7yNp/56E8B6pcAfgFAPmWpJ9ruW86j89VgO8YfTfvCb15+8Tctf8df+LZv++IPjhrLdq1HiYkHWJ+5xA+xx78v6QF83R4AbP0RQH8C4AGA/w0gBwDsAXj+Dt3PHksVJCIbFjpg8KG/hZS3jHUbzDaUwWWEDi1D/s2D9op1Y+WGC3QTJtYNabeJc8PdbSjZhLLJ6oiBn7139dS5d5No38RL/Wg9ceajzi/6pPajbsDprxtPUR/UshlHL/GqXx9lOrZkuvEssyXbViJyd4BhP0AIHkSKsrNA2+rt7NCXYM49/e5crePjuFWkHGm1vHpE9Sdm+51cbc14J1cd2RaytoDVXvtR+1fjtZ66Urdybd94tdN41yfTmBt+7p9zIuUt8t7Nh0zjXtn6CgB7qCNiF2QQks8BAnMUHcQl/PavYvoDmXzT9uJWHfMTkbcC/aOM/p9h+u8tZccj7cw+6k/nZp3HdZ57T4tZnjTGfXZI6VrFfMKeWte24hni8xnkMv4hNv69lHwkQZoRIgiOJIcyWafK6pAYQfIh/bw99TNq4rxZ5S1rkv88AKh6uzh9Jd0+z2TzH/g+Cf414+ZcAGfBuSrWQwB/tuIhgF+vMHc9AKCu9ZBp6xp7b1XntBDsFCD9/9lv+T1fzhCHATu1PIodPTBbl01/OOplPNAeABz+G8DxO//8zX+V/RsAfAGQBwA8/4epy3PMddATkWugkVPwoX8Npp6Qsz3ayXjK5L1oqH3KDQ+ymy7QjRiYGzTl3MAhd5tKCB6bazb8vPFm051EIGUJcKcn27L9tE+7sz+1r1u+reWJp770j21rC5g2Zh8qAeaNY/YbGUKCn2rZjKOTeOru5NlYdGVrmvptl3xlkbHc2lDnlwzqqG3N4ulHZf2s38E9Y37JmNY5b1u2nahdz8XUiWyb2T/sqvOQeNc307ry+isx20u52mV81l/GkjzmSP2ypc51DgApNxv/PencK+iFvHe6sEWbkPOeY+5yv5FGGfvWoT4hT/mWONNreiLyLDgu5Csnpi9INw6+dMj20ibl7FP61nmac9n5PUPvi6yDzvoMYvxZozgcwI7uHss24tmRz2vkJ9clRCKJkSQoCc0a6acdyU6nR1IEUYI48f898xfVQQ4AIFXk5QFA2pA6O7m2f0m/H2U/3oMA52SdH90cIi3nXJ37zE8OsAj+FKB+AWB9D6+y/beYZ08WhJWEw7rzjV/3Z5L8p/zNI2+l+iPrqQdck12nawnzSU+5lnvE93sAPx7+C0Ce5fkTgGsOAPwvALk30LvfjPWSToiKNHAK+dC/VEYPdVJfkbNt2jw4LpC0Fwu1P7lJQnbDBeZGDDk3achu3kA24Gyk2GSxqWJjDZmHCLDR4m3gGmFMguDbOHTVjWm2qT3ambZnv2qf98ZTx5pvtCNtq3bjHwN+wifZZ3yDz/RjovUS0U+8tvOcuPo6tG3Gttqe/UDmgIdyaYs699idfkTWv6BjDTredZy2xreWV08357t5jx3aVW2tcfpLmljzM77VT+yrthOv/e3KZB9TTn8qpx1Vxl77n7Yr00/u+zonMs5c596mjn4BLw3MKediPThM3cqUpW0OH2y/9o+4Y64/7gnTvs520uiviLwW9L9lMq4sWuYa3NKRfdHfOU9zTtf53sWzPHLqoi3tyXTkWk/d5Zmcz/CRdTrMRz5ce0hHkiEJTJIfyQxpWVbdps1IljrRA8GHPPFX1PnihUOAaw8AuvbSpsw3/YEfL9lfG1vmqPOhys5f57fzVWTecvjF3PUrgD0HAN43trdm30vluQ6sIevQ7/z23/KXPdyQ9BP/3r//w88a/vw/8dWf/63/9a/9/A9+52/4iTVdn3AeazGXqJxrdOYdCj/+eREPPPsAIP8AIPsMnsfD0qvHz4pOBnqtnLiM9EPwgf9cVN8EafvQXoNrebM6u9LpE+1l3+qGJzdEbsTA3KC5gYLkQdYh+Wwq/KNTEMC9ZD+JgTJ1CWzq2ajV4AY0bdLWtD/7ln3eI2dd5NRrW+kXbQLTXolzYkeQICUcDBAoK2Y9ZHSL2c61sroSkWvAHsbaMZohcyDJv3q37Ev/pZxjjKzvczzqWK2Nby27NrY5vtqRtlWZPpK21Vfza33itpN9xY61/nZ9yrSsq6wfE7PtKne2Zpp9Z+y37v21+1o9ifqrQ+4b56J6scv62uhaxTwmrfYv4/qENOUZ4k/y9uJMz1Z6Z0va3Mn2Ux+sYfVXjVO3pq3Fa96s7Wp3+sG5mnN57d6ueVkPWX1rmHVSXzync9+gPLLPrzViIfERJTwVzd9CCVa2aR10SqR428+bf+5P/k91fg7w3C8AaMf2ldOOT03W74mfmg+6/jo30i+dnPcA89a561cAzFf+GKBfAHAwkF/IZH31d/a8dNr5anAe44/9dcT/T//QF7/8V37qa8an0l/1Of93+v/9X/t1n/P/o4OE//mf/Lu/zNp1ru0RazzguiyXyjjFiXOJH2JP46Y/cNsDB18zP/l7Ftd+AZAHAOwNeAaPpus4bVtTSqgA7MIy0g8hH/rKbAqQZ2g5EV3I6gyk7SWCcTHzWnlHG0/qaYt1E3PDUzdGuRljA8fm2c/4L3mj7wb9UmRzz0ayksjcTOYGUnuzH9k/5ex/yuZXTH3ItpNtaxP2ZqhEGiJSfwLhG3P8a6Aecq1vvPNLtrtHRlfqqbqN82VCtbkbSw6Cuq82ZrbgM/L0XcX0L7J+Bx2TOlY5njM566gnx9V2avvVvozbj1lf19JTD3K2qy3ZZ2zNPqzJ2b+uj+rPNqusTdVO4vYbmbFnXejmhmnMI+Z11lVHh7M001mP1A2x4f5CdwbKMpczrfaRePpCeYbpS+X0NfWMqyPLmZ9ouS1MWy3b9aemZf/vQa722RdQ34E5v2f3dKZTnnjWQ06dnVzLp87yzK57iJF9vkmZEQxJSaKkJdMulWmPOqL18wCAN4v8H+rcgxwA8LcA/B31pT8BsJ3ElNMW0j+FUH2O703THx+7H+xnYpWJd8H7QMwDAL8C4ADAP2QJzg4AqJv+f22/syBwQYa++E1f+8OQfpDf9fOmH7t94/9H/rG/528n8ecAgLf+IMSfvH/vZ77mcBgAfsdv/44fGaoX9D+uMw+wLnPl+rxE3DwwL+tl2kO+zAP48PAFAHuL5xwA+D8AsA/gGTz0XjU+VkpErmHBcEI+8FOuGwPjliGunKjeW6B6Ozv36Kd+V9e+gLkpYnPGphnyBxHn89k9JNDN+C0QQikJZROfITewbiT3bCCzv1ty+gM59dsmmLakjdouQnzoU/UNb9Yl/iJ1kK2bKKHJti6R0ZU6UnfKM3ur/cT9gmHLDnxFmfRZldO3yun7HJccQ++RLcw6jqtoO7YrVhvtx1Z/9+ZX/bYLahM463v2STnL1v6pM9upcrVpLb5F/v0qoHtLX+fDLG66iD0QfucjbXAgkPkpU7720bj+WEN9WP2a8TpGNd6VtUyHpG0F+kAZ+1Kx9ts4eElAr+WVtzDLV7syXvuon5zL4NZ9XfOzrrJ6K5JPmuXA1BfP2Lp/GFlPNygd4ehIT02TtIjkp1zL13i2a13q85aUAwBIP1/r/dK/80tf5jDA/wXg0gOA2m6NYwdp2pOyaR8T0j/8TPCttQTW9I/dB3U87S+4N+gr/agvmZ98BeBPAPj5igcA5En4rZ++t+1q30vGWRS4uj/uJ/HH7p/753/94W0/ZP//97/4NQfiD/nPkIcAh68DRtmf/NO/9nMOFT608sn9K6ej48qiaaeXsKzjx3K1jGXBvLJcpj/kuQfw2fUHAMf/AvDWfwBQczHOQVUWFwwn5ANfuW4I3BjUdMtXVPdzEJ2dfbM025rV08bsA5sfNmRsmCWBEEA22BwCsLEmIBuIs6H3ZwAcEvhTAA4L3PS7Qb8UeZuYJBjbMri5BN1M5kay2+RlnzvZTWCtm3pzs502pG3pR/2Jr6oP6CPkiX5moE72XR2guhNr27N4Vz91KzO2e8eP8Vdv1y4+Ij191cmOYWL1e45Ljp9zeg0pT37WU5/22F7aYF5F+9T12TT9WdH8itmGNmgTqL2JtT/EMx85dSirP5H2iacdazL2d1+1MM9ZAzjwYt5Txq9DZvrQNcubpXOPeE8xZ7ty9if7mbL+6FDfVX+upW+VpZ2uTKZlGeXOvppGv0jL/nUyfsp042LmKa/lWeYarH3QDzmvZ/d1Puu6MqlDWf2i6RVTn+0MdN+QOJLPryQXSUCUXwq7diFFHADw1pHP/vk7AAQOA/JTaolUJVPUn9kr4RJn5UjHNjHtfO+yfcYH+JCAr7s/rvgx9j/HVV9cis4x5xEoiffvAOQBAPOYnwJwqOW8zbrWNy3teY355moASZfwJ/Ibfz7v51P/JPtb8uEAYNShHl8D/Knv/42/cDwIYD361C99AB74HGs86zjxEeqaneVH9okjIj+uyzxw8Dn+bn8CwJyd/E8A/A8A+V8A+gcAeR4PExyjy6w5lrZyInKGZcQ3yX/dHBhnciEnTjYOh3Zo65Lg5E2dVUZflkv9NT3r2gfRDZGYG7O6sWMzmEEiA9FhU85mn4MCNv+8HYYIbH0e7EY+EeIgebINMdtP+9Ju+1LRPos1P+OpDznbShu0C9RmEX9AiLJvyN3bf4m/qI7EbGtLpp42VUydyNjpH1artnZxxlb9MzvSR52c/ky5+j3HxHEDc07vkbNu6qQfzDdsTDuqzbN+6gdwb6i6alvakb5Im5Xtk/HErKus3kT7XW2Yxekj93ceFCFzr3PvM3+zf6mHdOJi5m3JWQcbuK+Yh5meOrKPVdYfifiOePpwllbLPDde2824ciJyDfSRtMTa7z1xfLin3DVlqs3G03/O6e4ez2eccnfvpw5k9O9JS13qP2LuHXJfMbK/ckkykvAlCXlJOdumHUhQHgDw5p8A+YdEEXibyufVECoCBNYA8apBoguiuwbIG2mSuLciYvriJVEf01f8gf/wpz7Fd/gCH1D2JW15Td30xeD4Ot51PuRcsExFdYjmUxe/Mh/5AoB5y+EVXwHga/1LeeuC1s907a14a7+5EnRfAGAbb/D3kH/f+PMVwH/9B77282//bV/3+b/wo5Cpr/r88NfVjwcIfEnAHwqEPPH/p7POacNHjt0aTNrhv6RzvWc9H2l17bYuLkqZ+OO6zAMHn+PvegDwt37Vr1y+8l8Bfvn//NvODgR+5T/4hr/BfwH4Ez/x9T91ywOA7EI3+MsocAj5wEeum4S98arnOPFO7djeXuz03TIt+8XgZXBTJtaNXm6yU2YjXgMbdcglG/UkDB2pzDQIRpKpqjfbTfu0Wcx+7ZWtm5htZNtpV9qrDNHPfiFDXCCcEKVZsL5IO1U2LW3YSlNHIr6uNq7FOSioJE8b8A1y+qjK6cuU09/IdbxyziLvvR8sm/XVbTv4gznqvMOutNs+2U+Resjpz0tk9Yi2OfOLdm9h9WXqS9n29iA2Mm/zoIi5zBznHrcPIjqRE/e0s6cMejlwoN06Vtm/Tq6+wZem6VfnhfF7Qm3dQvpOmc4H16Sp6xqc2Vr9mvdovb/Xnp21LPHUhUxbiTW/6oj26h5iZJ02jmcbyCQUkA3iHSYRsU4tZ3qHWVZdWY40yRAESvIEgYL4Q6iS9EOmJPUSKEmV+i9BbMny6hLJS3vfm4z9+leSio/5wsL/aQH/koc/9cV76af22k/HLUk1aVluj6we0bkm2cdfGZiXHqzw9p8/Zln/iGW1SZ2ibYmdnXW+XjtOLAxcvJ2nffrlFwAQeX7XD6nnKwBCffPPzwEk/5TXDmxH3+/6+/5TXyadgwS/JOBAwTro//3f8Q3/Lv+FIGvuB2s+mn/P1trRK+O5Ph8OAHzesMaPcsuxrOVG9FQ3ZfWR9rj2eQCfHX4CUA8AOKjK/wowyb8yBwAv8QcAHUgHvOKC0YT60K+bgj3xqsO4bVyCWVd5D9qXGVYdtV+5EfPmEbvNYt2k50ZfAgAmQfLLADbuEIc1kkmZJFKp07bShrRRuxOzfzM5yyunXuRss9qU9iJDTrp+zt7+Q6qrjhpPn2b7lMu45axf46RXMrc2HuZxiEO92lbG00fK1Y/G9XPFOkZ1vtb5TDzvsy4/dag/28UnjBc/Z2Gu0iftz/4p69trET3UVR9oe6A+AtNObV/DLI+cupCznS0Zu5jL3JMe4oHOY+0W1VfjpneoTRW7sqShu45R7WONV58YX/Njl8c8Iv1a7HTuScPeLGfcfswQP5inXH1j3HIvjdkP5bw/kfMeznu7k73/sw5y1bkWr3Wjnbp/cH8xipxfbthFyEaVM828a7GSGfWQLmmARPFWGuKUn1BzMCDx78hS1b0Wp13ybX8N1YN9ynvrrul9rTxslUxC8PAhX1FwAMDfWOCLRw5a8Dl5lLGvr2XjVjvpd/tSMcvM9DluHWb9Ts72JMuQf/3JIZVfVOBbyD+HK/iWPOYv5fEv9dXnXO7QMmJn1ywNH5A38wXpuRpwCPCF37z8Inb43/rx+b6HABwEEPIQACJPPm/80YedHiAkopO+85MCDwTQfTgMGAcCHBD8V//LX/M5pCxt+ojkXIOVP2MN53nC84x9AjJpo9/LCN06fqr7EfnmVbuiz+sBwH/4//rW/48HABJ+MGUPAPwDgIzbcbwcl4v6kpUcbBQoi8tIuwn5zw0FhtdAO5eGqsM23CixOXNi17LEu77VcupMVD9YN4BuEBPr5twNP5ihI0gQiq2vAiCaWTd12pY2pF3I1f5L41UfcdsCqy1pp3L3Zh3i5GfSs7f/pqtHpE1k2065ppmXiExAf/dlgiR/DRkzddomqE/SR8qdL2fjkXMQOeencp3Ls/urlrM+aDtpB3Y6ZowThHd22KEP9GmiBzkg8xwdIMG8LK8u/anfQH2XdiJrf4e1rDpE9WY7nYw92JzEn7lBnPTZuJve6cw07CHeobZWzPL4zXgtV+PVJ/hty4/61vmS8+cSGT17dGQ5296D9qP28R7js/5Uf+a9O7u/a3rWUa56Z3HLi0W3+4aKo9jZm6SvkhxUolDjlrsFotugPuKQB4kCRIpPpwmQKT+hTgJFWYkRqM4Z0hZ5iVXWnjVc079Wr+alLVVnLfvcuPrxk4cA+JivK/AvCEF9a/KvneDa2D7HH+imfiLynpA2Mf/wF3MS3/nmnzkL+edwhcP5/COWHrDk3EVWF/oMpovZdsprdm/5iQWhXvwcAEJOgNxD1A15CAD5J/53/52//uBP7E7SvybTJw4NOGjwywDa4ucB1Z53HmcN9nI9Jn6QXb959rEHAFnzSbdMoPVArqr7Q+rj3zUPnA5dugMAfgZwIPzjUKpDDgDyDwAyXqOxZYQci7X22zwrHybFUVnKy0jbdQCQm7LZ5sF0J18i7ewNx0l69rv+1LUmz9pInbW+dot1c1Y3kHVTTTw39MoSmcRKeIhDhiBHEIqOdJKe9VKfsm3OiEDtw1a862PXT9sH00Zl+tW9/efzaYkg/a/B+jO0Pdun3FZaluEPpnV2df7v0maEGBtyLC4djzr3vO+cm2Cdv87tvXM/ddlenQ/4KudjHgToR/1NPIPkXuSgR1+jh82LPzNgHDwISr3Vjzkfq632ASRPzHJZ33ks1vEibvv0oR7Q0RfstkzWN03MvJRtu9q1J44ey6nTeIfph05O/3Wy84U85GtRPeJMT7aRZTvb1tK6vj4nba2t5+bZz8S8z2f39izdNSF1pO5OzrLKoT/3Dcoju7+2CMJL5Uta1E8cUgMxgFB5ACA55Y015GntAID66t1C2qWM7d8Sq17jFW/Z5h5dtI+PJK2+uYa8Eojjf/24R+dzymCPgTZt17Tn6N5bl7Yom2j7M9RWUHLuIYC//ecAgOcPAdlDLPycczh1oEvyL6q/ovXSFuTO5uxf9Uu/KhxSF8j4j//Yr1k9BOBggM/8sY9+daS/pudBweF/FxgHCXxVwGECb1ZXbHqvWazDXImuzYefALAfcC/Cs8/nwrGOZRMPCkOn8Qeue2DXAYBv/hP5OsADgPI3LJb1JvfldpODNJQfgg97sNsY1DQ2O6SJNZ946oxJd2rTttew6liLoyfbURZtp9PR2Z8bum7T2G203YwncvN1IQmTMoQYstERTgiH5SpRUn+2i9zZSFrXH9NmdUiv+m03MW2UPHX94Q0z+XtC6qwybXf+MC0RGeKev93GNkjp3ouy/j4++61cfdT5U18n5nxT7uZlN3+d22uY9VKvbYHao82MTfUVGw8OBpiP5OPTDKY5rszpqmPma/QyPo4ZPk1/aheorXsw63lfpN6UbRPkYKLODQ+usg6y9Wp6F8ce0hPTxlvK+Ad9nZ9y7Du5zpOMv6aMbbW9zl7T6KuyaFrnh5pmndfA2i/iea8qT+5tN25Ll2/dile2aVsVR9OnDSjy4aqE4LXiSVQkKKRJJCRSHgB0n1BTNglQ6qyybSRmXymf8Y9VTn9BxHwjjSzJvIUv1FHHocbvwc9pK/ZUG41LsNOH+kxf8hUAX1N4AMAhOn9ngZ+ycKjllyzpb3WI5HXB/IppjzZqszjzs+vADGeHABB/fw7AJ/3YBNE3cBBQiX89HPjTP/TFL//rP/7rPyegiy8KPtIDANzLesxV1+WzAwD2J+wDWPtH2aUpn/VH9uFSt/EHzj2Ar9q/AcBPAPwCIIm/Mnl5AMAXBMdxepb/rZyIbFgwmJAbBDcHbIqYMN3mMTdGlq+YOpFt61K0btXXxffq7nRW+7OPyHWTmP7RT2Dd8HPjZUiy1MkzwgQRkRxZL/XWdo2nbdfI6qmYbSNrUyIksSN79kWS2GHqqbLtJaZMeeKmEcev+UZbuyrBMz2RMgTI3+zNf/UP8ervbg7VeUa8zkXiz5nv9R5Hl21k+9qXduO7md98kw9Rxr91HEnfS/71N37OP6aXfk27tFX0HhVNzzrIqa/KzBfS6HN3EIdd5NV6e+LVjrU4tpMvrpWtefZ7DXPMq+y8AMnL+FvL2iNqT+3Da8bTT9o1Q+1dwx33uc/vDpf6DKz6aNu0mWx+0dW1N4qcNqDIp2tGDF46XWIC2hYyRALykwcAECfiSZ4kUJX8zAhQbc92RW34FFBf4Cv8mD4071PwA33M8bfvW5j+kozjRw5T8gDgr//yXzv9N5b5xyzzKwDnsXpE0teC5cS0qdq/NpanhWBFqIcAfKpv4M09f+2f9tdIfx4G/DM/8p/7MvUg/CCHCfzcgIMA/rvAYQpr2Mdw2Y/Euj6f/gig+2D2KewLWN+HE5YRap2qT1+ZbvxeMO1SrvhatrZfAPCH/fIAgLf9En+R/PwfABgnns3DcPvy7D6gqIZlpB2CD3wRAyBvfqbLxt7J4+bm0k1MTLpTu7a/hdbVvkTqmr+lx/ysr9z1p24ku0113YATx1c1SEgTIRNdgGR2xBQyxVhYJ3Up13aNd3aupVlvhraXqF3g7CADogehlDCKlTxmPPUq0y6y7SuL5qO/I7ASzjWE4PK2P220vYrVT9W3de7UuTW7r5yfFZ3LBaf3OOVSh/M97dDGtJ1+4dO1v5XAVwHMTfyc4Zr/9pLxQJc+x8/p27RNe9cwyyOnLuVsg3uvs5v1MMtZdwttM7HaZHytH3vz0NWVZZxJT8yxR2ZOiM6PPci82lPu1mU6W2ufbhW/te1VX96byuXeXkac+3sPUuYQ1JVI2xnvZOsfsa4rxLkqfkgd/66Rg5fOS6IiGYNIQHwgUrz9J3gAwM8A/FQ9iVOSH2V0I2cbVbZ/pCt/KqgvOh99Kj6wn/qCuHKHzq1ECDhzEYLrTyr8GwC8+Zf481UA6WDOY+qtEX3zZuW2DgDsk32teFoINgTe8vumXvIP8vt90vk7ANjqW/4k/KZx7x7e9Mf/AuAfEfyTP/rhjwDSDuvehjnvMTvX4LN1mv6yH2Df4r6Y+NEPy+jsWfmI6wd1G38rTDtS3mOPfdxT9jllaOfJFwD1AADS/6v/7//C6RAAmQMA/wcA/gtLxohn8tB3aV/P7LdyIrJhGfIh5AaADRNv7tjwMmnYNDJhaug2X5ZJfceOnNqyzUtRPRUv1WP51INM0H6x2zx2m2sGrIYkBhIH0OANCdYA+Z2RVsbGG1od6hSz7U7GVtIrdmUzTf0Vq/3E1wgjcysJfid3OmsadpCWqPwc4g8Bxc/YZZu1z8bTP8p1LtQ5U+eV862i8zLR+VvQexpcRqhx0toDANrUHu1M++0TfvAPA64dmtwij7nvuOpnUFu0T3tnaDnR+h2iv+sfB3HMha7OLI32yEvUhooz2/emo29PWce4wzrvtuKulTkvbyXTdurP+Jpd9KvL7/q7ltbpeKm0NZ9xv5aQ9/SaXOud3fdrbZpX2kXfrL2R1V+VELx2XAJKu5Au4hCJ2QEA6fkGtSNAEjT1dWQu0+wzacqfCnZ++FT6Tj9zzNMXM9m5JeYBAPOSwyo+9+cP/xEk/JB+vmIhvx5oeajFAQLBwwTjIul5ENDN/Wr31lj2q8LT1O/47d/xI5B0SD9v7D0EgNAj8wf9sKcSf23/se/87i9D9vO/AOT3/xB+/oaA/10g8dE669jHctmXxFynD+s+ewP2Uu6x2Zfw/GOtH45YRsg6VcZX6kfmqvEPqR/+zTzlill+S7ZuV868imtlu7xbpWFHewDA5/2QfMg+gU/+lfMAwP8BgDFD1y0Nw7gaaOAQfPCDNM6msm563GCJNZ849cXUaTu3QnTfQlfaqFz71W0Wuw133dgTrwQhyQyyJAesAZLckak9XwHYTm3/mrg2Ule9FavtEKbuCwb6k293WZR80+sC1WHVr00VsQt93efbnS8zDXshnpX423btM3F9kn6t8yDnSp1Lda51947zcjLf6z1d48uoRxp4RgSybe1KW+1H9o0+My9nY5v+vEbmSwLevvupvT5PG7RLTJtTNl9MHVVmjLsDK+xhPtXyszhtmWe7M0xbX0JmTNHr2M6QeUBezocqMwdJcy4mZnrKXZ21/JqXbShbBtwKW33aqr+Vr023Ru/VgvW+nsW5z0/3e+rYYyflKZf1jvq69kbWaTNI/tm1RRBeOr8SFg8AIEWQp/wbAJAoAocAEAvfjnZESIIG1jaMJwEk7aX7+tD/1XfpY+fDDJ1DOaeQnXfMQ+Yjc5M5ywEAb/5B/3YF85l56xwmnWCcvAyUN0iiJf+2C1absg975tvZYrAe+Yz/pq9+BeDfAoDAY4tfAWAbv/FPws/XAr/yb352OEDwjb/En58Z8FaV9XyY8WSdWjft7nPtT7c+nw4A2Ee510ZmXxDrfFeXjqfujOuUWb76LFfRejXdeJdv2gypm3nIhsxDfqmL9s4OACD0/GX/n/0Pv/M/ygOASv7Jz/8BgL0Lup5raDoEXTokkUbOiAETY2vzs5ZfNxrov1WISXvQWeOXtmP9tLnrW7d57jbt3WZfQiBKasQksZJNEOIBAemIFCSM+pZXVyLtEbfda5D6LBypN2XbT8RuPp3v7CaNt6ySfMoqV0ydVcYG07SH+ui+lJxSngMDPv1Gh3pBdXfY+beOf86ROofqPMs5mPJkTuc9vEc+3C/oSt3akLZps33JeaMfOCTpPpOfjflWOvMcAo5e54RtgWmDdonam0geccuAqUMZ3Yw7h1LVxr3kX93Z1pqcdq7JOSad3NXtyq2lOf4zzLny1jI2djaYPuvDLdK7dm+ZNrnHuWf33NuzMtQ/C3tsrnVGvNM/kg/pYHvtIQkvWQbCIolRhjxAenhTmj8DSLIEOfIQIAlRR4rUDyZBSjn7SHrGH/J9EvfnjItjnJjzQTnnTsrOOQgvxBzy7nzlU3/IP4cBzlPKMF9FZAm+xN+45ShLoA3bSxuqrM32aY9/2kXhaeJnX/jNyy/ymT/EHSLvFwAcABD/3r//w9+SwFbsgtj/4s/8ugPZP7z5P/7en9/8++afAwWIP8/Ip01+NCmsy1yJZ2s16z3Pf/Y77KvcW7E/4bk46i7H+mf1is4RPbWBvHWpi3JpW1fP/CxrOfPELENal24Z8y0jqvslkDYOBwD4m7/mf+kBAHX4A4CM2dB1M5tVBNawYHTdGFy7aap6iKP/nkNnc9f/biPdbcJJqwRAwiEmuVFO4okMGe2ICUQFgp1kVR1bmO0rJ1KfeOrZIsJpNzatvX2HVEm0XYyosxZSfydTF+I/OyypxM74jPjTd/sspj+U02/IdcxzbtS5U+dXNwcn90y9f/fEuf8oB57d69qR9ml39if7av8Zv9n81Md7kHHzJyF1fG0LTBvSNmRtTswyWRdd2M6BA/dRd2BUyX9tP/UhZ1szOW3r5ByD58jo3qrvuHdY5yJlatpbx7ds6vp1Sdpz++d91iFpO8Ke+3qtDG2c7vnaHv0jrWItd9Qxa2dknzYplDm79pCEly4DYUkyA9mBBPGG1AMAyFS+NYU0QZgqQVojSkmQOpl+kv7S/X3ov48DBce6mws5H6vsHAMhvM5Vv1jhAIDAfJXMU25vSP217S6e9l86t84Wg0mE9efwif84AOATfQi/PwPwAID7kN/600fwj/xjf8/fJu+f//Mf/rgfBwb+rwEcAvzET3z9T43mlkmTH1vybG0+pONfnnvsUdjzuOcmzh7huP6v6cBfubYrd7hXj3VnY5H5yurWnppu/hrO2rtVOm23XwDw+/7ZVwB8GfAv/uJ3/VXmLQcA7B8Zs6HLPl5tnwoSkTMsI34ITIYMt9owqb9B7KDtGZL3nFD1TnVlv5W7/ncb624zT1olAkkaktikXAnQGpmG9Gb51JMy7RIXq9yVzbROznZTxqY10scn9i5Ckv4aJx2dYupPmYME/HMp8ac85I92Ux/9JN71N9NyHJXrWOecyDlT55RzLXEy5/OevVY+zX/bS3u0U9uzT/Yz5xA+wYfPPQRgLJwLOeYzn6ddyNrrPSdmOexmbDlowN6O9DtvyWNuZZ+rjG7Sso2ZnPZ1sn5/acyxnsk5L5S3kPlKmZfGLTvMp2/KHW7ld3Vq2uQePd1fV+Zfe19v1bvWrpne0b3tzcmlhOElykNgIDYQHxFCwRt/DwDypwC8aSWPQ4AkWEmclDvCRFqSJmX6hmwfUzbtgfdB3p8zDo4rWIPzhXTlis4tyC7zlIMo5iQHAJJ/3/5fckBV28m490ampe3X+oNFYs/lFwC82YfYQ+ZF3vDX/wnAP/YH2eerAQ4CfvzHfs3hr/1T7+f+l/+Jj/WP/aU7WZu9lLv1+vA/AbBXYW/FvoY9G3sr9hs814aSrl6m0Y5xZbGmGweXETJunT04K5P6Ul5GhdM+BHmEzEfmEj/Ebvsvug8HAOwF8wsACD4HAP/+//e/9DcJ/gQAmXTy/f0/dWNcbmahHQczLBhNqJuc2SYx06njhkpMPeqeYNpRZWwiDbw2VJ1TfWlzytlXbhjis416t7lPUlBJBPEkOSlLTPkkWmJSUaJCPcsrp64tec2OWleCnGjb2LpFxvMAoCP+lQgmIaQd6nDIsEXiqq+IU4e66NBm+2d/jM+wG8McY+ScBzlXci5dcK90c3iWNm6Vs3u7K3e4l7o5nrbaB/uW/a6+YYwY187nW2nO4TrudXxoM23QLv0tYrcy6HzBvq25qa3MY9uq7ZKOXhF5FvThDNPfa3KdN8bX6pBnuT2Y82FLHnOsPmgPc4r0lw7YRhtbNmY+/c+48izd/Io37lt3b26lDRNOGxjKciWu1V9G2UvCmq5sc6g92YB8uq4lDreuB5nJN6QQJwg+RIrPqSFWHAJItDwEyAMA6kvOEpM0pZwEKmX6RvzWfXzou4/DA8c2xxw550aVcz4hS/59+898ZH56AODb/5yTVWfG05ZMR6a9TMuyz51Tp4VgQ+D5+ZuWv+Mv8CUA5J3f8kPuIfp8EcAhAH8fgAMC0vhv1CD6fDFA4ADAQ4C/+FNfffgZADo3mv1YsnMt7tbsw7MSf7DH4gCAwP6KNJ5xwxFdvZqGv0ybyeQvhqNu4tZLHMlPnhvkc2W5PfIy6hwOOtzrNG2j9zWugx18xs/fnYDU//d/5r/4b+QBAOTfQwAPACjjAQD7xWHoMoL+uMpuKyd2zqShQ6gbHuI6dA27eqapu6B20C7yDM0j/5Kwpb/Vq82Js37PNt/dZp8bzSCxECuZkohKgLbIFaSWMuixTtX53HjaZDuibUK01n73L7mChEGwkvDN5NQNcb+ExEEsaYtAPRY92rEvl/iEsaK8Y5bouIo5/jlH6jzKOYbczG/n8BqOaqdFwnJdmnngYtCGtE2b7Yf9Au139R0+xbdrX6s4/hWZv8wd54BjXsfJtsG0CVlbRfOJo2fPvNQuvhDItjpZ/R1qwwz17xrmeHQydbv0Lm2rrHNgC50z94reQ1v92Jt/ZT/zPtsrL6OtrbKjyFkZ46L1a9x0cRkF9gTKU856iSP5tOYgT6/nEohb1ZeAQagk9XkA4B9V84sADgYgWf4MwDetHiJUwlZJlIQqyVTK9It4YpVv1feHntc7GMgxzfF2PiQ6ZxKRnWMeUnkoJflnjvKFCvmUt37qzrZTzjJVznK3mjPThWGS8W3f9sUf/FPf/xt/ARKfn/V7CHD4o3/jv/njd/78xp8DAb4e4DmsSp67yp8Qsj5z5TqtfDgAYB/Avo29lnth/OZzc1JXHeKsDfM/8/nKXiR0L6E/daSsDtNE0ztcRqFD/2jPPZU2jLxaB50vedHe4QAA384OACD9GTgc4ADgv/Kj/5n/dvz+f3kJQzGQqzpmGWmHoPMSHcwtzDrI6ix4cNJIqzZ0cWyyPPJW6HR0aehp9dY+EKffs+Ckq1gJABPC0JGKSqqIS4a4aSGykpSKEC8Jk3WyvnLXhmnWz7JruswDIW8QuWrXLJ5v4iV+FekzZIy+rf2xOfxCPjoh+pTnk3Lq5mmn/bwUGSvqdGPmeIo55jkfcu7U+dXM6W6+1rRR7TB/t7DWO5vz2pL2aXf2xf6lD9KPzgXGcOsnIHVOMF517NUH2k62rT2JaS+yechrX9FoDwdGW2/+sUG9FWv7XVzfzjDH4TVkx3+Gzdxc3mMa/cPuLbygb9195b1lHr5SvhaHiul9PsvbamsZFdfCVn3yuSp+SI1/b0UkbqEHwiOpgthzAAC54gsA/1u1PAjwAMADgz2HAJeQMfsE8VJ+4OuR9Vv6WvKMTmWwkmzjEveKSf59+89hVL79R2buegCgzmy3ky1X0bK39Ie6Yim4SOTZyRt9DgJ408/XAP6xP8g/xJ/wzd/4dX/mIsXvu3BdbzOOPA0899hzsH/xAAAkzj5j1F1W6o+sue7IOzxfbYsxRLfP3CjX2WkbYlfGtGUUOgTbom/ut9w3Hdu1Dnq9SHvJ6+wAAFKfXwDkzwB8+88BwB/+Z/6+f+7Wv/+3k3ZYZ3S4jMKHgONuFdQZWNumTdJm2JWnbA2WW9NjnmXFqus0kdMPTqwOZxt6J6WYpCEJDbJEJ1ECBG4RK/IlTujIulvxLLsmq78iJE4idQlC2CFdBOyHuKMLMg+ph5TVizQJP+Wpy2IGidT29OE1suNRx8h4jiOy4yvmfMj5kvMJ+avO57HzcYaj+Pamm0LjQgdXYupdRt7ZPE87td/+ZH/1QfVrzgkOX7qxq2NJvB4ApJ5sw3bBtKfzv2mWQ8/aARXzicOibKPK6upQP3WoL2eYfn9puc6/Ls68uCLk3Hpp+Rr7blGn9gudNe058aHu7H7NOHJetJOX8cRrbVmG4lld2rQN5LyepEsE7gEhOhAuyBPkngC54s3qT//0z3z+v/u3/+2//XM///OHwwDSOBygLIcFlxwCVIJlXKJVEd+Q1uE9+O1hw/xQwnFz7HJsHXexkv2MS/xBiD3zzQMqyT8HVfnX/ymLDvRnu52sDYmWe8nxzcXhUplnE18DcBDgzwL+/D/x1Sfy/8Vv+tofvlTnOy3/ZF0t/TAfnIXDXo+9C/tk9ssE9kXsS0a9ZaXuTOdZOuPF/gV97INA4qTfQn/Yh60Hku2eyj0Z7TZtjuKHC3tf+jr4BBuwiS8AOACA3OchQL7950DAt/+Up97RZze3V4UHI4cnEpcRPwQar0GnzjDLo+fYgZPOo27bI115D1pe7Oqs5XXlTbMeeBayTynjg1lwQiZWUuBkBSvJIJ6kB1lSC0KYOxJlWh4CVCJlXJ3GwS4t89dkCLjtdwgRNPApNkTMt/W+sQdNpwxv9SuBJI1ykEsWL22q/ro2ru+7Mcm0HD/kOr459jlPcg4194fzseKYlqcNN3ndZXpFy1adxpdR4HQIkLbah+yb/U5fVF87JiDzAmLdzYlMe4kDAO3WZuKzecq846GY/ZrJ6hNtp0N9OMP0dyfX+bInjp495WoZ5wG4Izh/EqlHvGKmZfk1WR21bqZv1afstWFN96V5w4zTs66TTRPRr3wUz+Lmm5dxZbDKpiUux3IVs4zyKHqms4uTdna9JLm4VLeEB4IF+YdY+fYf4s9aReAggC8BOBzwjwGuHQJIxCR0kCyJWRIuZG3osOsP5br0R9qclL+mbxyfOp513J0bYhL+lCX/zDfnKIdRkn8PpjggcN5tzau0Je18DT+dLQZXRngrypcAHATwe3/e/H/E5J/11itl0ownVpl4Fw77PPYi7Nl8YYZM2qizTOp1umoadQ/62X+wF2J/BKKbvQb5I9R6l8bRcWoH3e7D2K/ZpnugaG+IJ98hv/R1+BkE/YfQM39nBwD+8T/yOSigPPWGgcsI+Ocml4oSO+cvo7VDqBvEa+LqCqRN9Hdt702z/hbu1Zfl0HkWZv3uNuyZxuTMwKBmcOKClWxUUkUcQgVCVCAsSaCq7CGA9ZKUpbyVn2VnMgtJR/Ig75B1bIGw+5behYd+zAJlCNShvjpISzuw/5KAnynfYabV8TCeY6acY4qcY57zIedRmWM5/1IexU73CXJelOMSP8Se/qs+yxoXl5FxOgDARm3OfthH+5xzNv2fY6PMmDEP6hzNuATc+WBdMPU7DmDaon0Vaxn01Z/RYBvpqbuTU5dybc94+q6T9fEMc67sldHVlZ2l17LMg5XgfEmkfMbfWn4Jey7VOVxyuifxB5d+UV5D8uqlnq10yyXa9q2x2jKNvwbJ2NuG5AcSBsHy83/e/v/Sv/NLX+Y5xnOLA2jSfNs6OwSArCV5k9yJSbxS1o41pE/k7+3bo9zrHQg4LonIhhxrZOeDmHMGmXlkgNgzN3n779cpzEMOpAgcAJDnAQD6bbdDbcm815wr04Xhwgyeo3wNQOA30hdWf2/FXcOxW7nDS9b1Zeg6vDVnf8Oeh/0WyL6F/cCxrUt0Uvagl/rsNdDF/sh9G225BzmWvUp/tsNcoA100477N9LIO/YFu7KtET35ssrEb3kdDgCwxT8E2B0A/G/+1n/ty779Jx/yX37/j/03v3QKipXFZaSdQt0k7olTPwbgpGuk28Y9IfZpjzJ4Ftb6zeReC0yCDJIEbxQmrZO5Eg9voorcuJDiSmaSVEFs+KSZm+OlAuSuO4zgjW6SdYndFmKni9Kazd701S817gLRYfX1VtxxEnMckXOM63zI+VPmlnOv4ih2mpfKichbFzq9lGs7yyhwCNqYttun7Kv9T39Vv+fYMZ7MBX6qkfMzZeYxZZwfWT91Z5vaAaZ9nWxZ6jM3bRub0J96O9n6iV07+muG6duZ7Di8NDLutOH4N9jNlZr23uLMdW1O2bQtHNVP9ZX3YJZB7i7a5qr4IXX+r+WzhGkdknZNQH+nL9t9Ir8m2dhqSxIEKYJ41UOAv/7Lf+3wpRrrEXIeAvA21p8DUA8CJmlLQifJEyWAEjFRWzqkH6R3uNXHR/7rHAR040aa4ys6D8CcJ84dkfmU5N+3/5B+/j4Fc9GvUvIAAL22BVYbtPOt5sWTBeEZCZCjb/3Ct/y+Z6i4h6quodiiXNG8TK8y8T1hOZYDD8989jHse9hvgexljnuBPfosc9CHTgL7GfY97J/QyR7OvRTpzV5DPWt4aoP6toH96HafSHuk0Q/KHG1KvSPpVS/aPv1XgBD77mcAvv2vn/8f+6D9NzEcZVyJNpC4jDJnAcdfGqqOEacN9GZbt5BfQqe2ovsUtnzAoM1CJQRJHpJUOLG9cZjY3lDI3lgipAmiXz+Vl+CwkSHfN+hgEnNvoEQJ+Awty+EC5J/gG37089beupbNuPIMrdOhPlhD/ZWoPy/FOjbGc/yQc3zrHMh5k/NpyN38H8mnexT5mgu9eRlPzLaXUfhmXwE4N3P8GGsC82M2V5lDWUc5xzrHz7EA63hkvJbzZwAcBKCb/NSrbHrWV079dfxzLiDX+dDFmSOk51xJmfGZBco5fntwpifSc24gLyPUtK34qHKqo3xrxAZ1VnnLvkvybUPMtg4G7PjHOupI3FH9UCR1dHW6fNPAawLtpI6u3dW0tyIeXbuSIYiSb14hU3wJALni03+emaxR/hQA8sUbWH4uQLn8GmB2EJCkrxK0JGsSNu3qkH6Qbn9SNu2Br0f6czy68crxzXnQkX9Jv8TfN/+Qf97+M+8g/v5tCuZo/l0KDw/UbXs5r956bqwuDp92putq9cI163RXZxmKSQdPgf0C+xL2Oe7V2MMc9xGdni7tpE/d7F/Qg05f5rCHY89Ee+5TLF+wtnGmn7rq1273lLRBGm27hxq6qz7iXBU/pN7+X9p58ocA61cAHgDk5//4i36ErTe3Lp2AXMMy0s4CA7AWKH/hANc27ylO37EHfBLW/GAeA9iFJAdMWIPEQpSEiEmCqswNAHmC6PvbeQ8ARDY0Bgh7PQSYkXFvMpG2kCFREKgk+1mGcpZVrnHKz9KyTsouWNUHxl0c9NuliP+p4zhUdLwSc0xzzJ0LYsylrbk+ih4uynGJH2LP+7drexkq2wMA+mP/ss/6Jf3rGIg5bo6zc6f7yUg3L6mnPtD2bB9Mu9ZkyzL3aR9bSFOn414x21JHtqN/KuZc6GTnxQwZk1cO3dzYkzbMPM1R5+pb4J42s8xMnvXH8uTnZXpFypiW5au8p0ytsxVPncp7cKsM7dYyq7a8NQHJ9iVsECTIEsQJ0gWph+BDtnjzzyEAawQ/C/DNqz8HgID5NQCHB76NhcRByCRjoIQMTGKorD1bmKQz+/OQX4f4p59nY+WYijn2zgkJOyj5Z/5J/JmHkn8+9WfuMQeZkyAHAB5E5TykPm3QNvalvW8try4OH3em6yS9VK5oHumGLm0ZiQbLJZq3C9mPuPdhX8V+hn3IaCN1dnKrn7roQBf7Kl4OegjAfoq90VF/W3+0O02nHvaiH13sCdGtfuL0pbRRbR9NnMYA+aWvQ/v6xZ8B5FcAkn/e/nsAQLkyFjezE4O4OqzOIr7U4ADOsJaPuPq6dt5D2hNf0Df8sBW6jX8SBQbbUIkGkz1DEqEqcxMQuPk4DIBMSf479K29NxH19gRu7Nlbfm14CbS/6FZOTD9dI7sY1jHIuOOUmGOZY13nRbkXujk/ipzuzSoTv+aiHa4Oqw3LKHc2p7M/9jP7rm/S3zkm3Txwjvn1SJ2bfJKf9VJftmPbYNq0JlsW/bSfOtBNXMy8lFO/PqmYfqtynRddnHF4xVDnwVZ8mDadT5mH/BZXN9exI9NTrnkZR65XrVvz3zqufdqRceVEZAN1qqwe8zK+S35rAlLbhyBBlDwAgIhB4nnjCsGCaHEAQED2fwUgD1JGOckXhI0gibvmEEDCOCOWXTp9Ir327RF/2QMBfd6NiePo3PIAoJL/NeLPvPLNP1+e1LnoYRSHABwUMO84TKAtbbu3ObBrkdgu9Bl/9I/n73bRuy/Rrb8Y7dpbcRl5Z3sz4hcE9FFePOhi3+LeBr+yFzmWqe1nHD1ngXrsc9DF3gpOAQdhj8V+jz0V+Uf9Z3WLrpN9pqsb+9Cjfg8AiJNOX0J/2qs8VB4u4q91HfqDbd0BAP/tH2HjAODF7FUxmGE5xsFbhdT/3mR8gM2rvmDyrYVKBCppSGLhTQkyuWtIUtTJ3BTceJCp2efWEC/yOAigHDcsb/O5aWsgnXzLoZs2XivQR9rq+koa/qlYfWZcn6aPt+QcG+U6fjm+dR7E3JnN/VHkMMfAl75mNiyj4bOHTPYp+6sP0m/6t47RbI4wh1jE8/f4HgYw16yX+mwDzLa1B8TOxMxDph710Zs69sipK/2hnP6qcp0TNY7vN8Js3Ex/bn31dDhMO81P8rkqfkj9yr81v8ZTx3PkTu9XrPggWaamr8WtUzHrmJdprynvbb8rR1qmK1ekP6bZt6245Q54T4RE4iZZg5xBoCBSECrfuvolXT0A8KcAeQjg1wCzQwCJIGi7FbGLNO3rED+Sfk/+/BRs0efdmJhWx9Mxl/w7z3zz71zh4Mm3/pB/iH1+9s9XKOzTwPo/U3CQgF7b1s57G5OzxeD6yGe/89t/y1/+wm9efvGd/Q0A18pE5C5uunjYj42yB5ztKci3jPIWsv9An3sikLRRz7ZnuKRu9zHoYl/Fno4XhAQPANhbkW/ZrL8mp43s19wzopd2iNMm+y/0H3V1do+sk7+RuSj30hdtrP4MIMn/a/wBQDudWGXihoUOPCOo5y1wmH0aZNrnStQm041v4TIqrAYneodM1AySBzAJRhISJnkGbgbiSY6QkyRLoNZ+cy3hEv2JAA8bNkAgb0FI5+cF3nQeAIi2dUvM/mS/ap/1Q/qnyunLvXKORco5Xi48OZ51zGOudPNqZJ/NSeIvddE+V2K1aRn5m4cA6Q/9mT6vYzSbF8wfQp2jzDcOnaoe27BNMG2pcr2nzM/6e2TrJeY8yPFPuc6FGsfXG6GOD3HqmJ6yaWt4SfnRzNlcIb520e49XGlHythmfAvvoR/PtcE+ph7TRPNq3HTQPDHzdsn3RkiStEHUJGUQMYi9b155/vHpNcSLN6/+LQC/AqAs5J9AXcgcxM43vJI/yWCipK1D7dtC/EqZxL2+tt7e8p96Of0F1lDH0HF2/Cv5Z34wTyr5Z17xlQlzjTnnT1HYgyGT3r35p/206d7GatcisV3os+/+h77rZ7nn8N03f+PX/ZlR5eo1abu5Z5VIu5AvDcuocwi5Z8g9hzL7jSxTZfV0SNmqZ5Rbs/VgU+qyPfZG7PPYt+UBAGnkVTtTRyejlzrUZR/IPtEXk/IQ0tUdOqr9I+s0T8h7zetgC/1gn8nBVf4EAPJfDwAox5gMI5cRbmbvTJHpB0OPDVYZQ64N6KJu1ZnxkX3qKOlca5h1r5VrG9neJTqXoWg1eIMkMiEyeBOCTGhDkhPJj8jkR64kybikGeSNKg8Rif4lSD3qS9ZAdFYkbS1g11q+eZZLtE+J9l1/VMR3pOnDlE3rUN9XzDFSzjFEzjEu82JtTo2iZ5dz8SzxGZGqz3hn0zLaOYTsi/203zlP04c5BjlWjqVjXJG5xBxjw+3crIcAqTvb3DNOtUzW35Jr3fQBsr5JTN91sj5eQceGsVB+DRzNPVl7SfPCBi6xyofMO/wn7b1D897MpPSLcsVnG3dPhCSJEsQJsgZBg5RByHgLyxtYPvv3EDwPAPwZAERs7QCAQ4UkgJJC0HYrcTSOjchpa8r407hy9TH5piknKlvmgU9/OqCPEpEzOGZijrPjz1zwkKl78888Yj4l+efLE79CAX37z/xknvr23/mUNt3bWD57Afmg4HAAwH6Ugzh8wBcBPJ9vpP/WalhHDehWnuEyypyF3Dvknsu9rHsT9yFZvspVt/G6bxnpM/tIXzLYBjrYR7GPg/zzpTABws7eDzstm5i6UqYMOqlHffSiyy+UiauXcpSP+p39I/tsz0L8Na6DLdhHX/wZAL/3948BdgcA9GkYt4xA/ZteKuzwYOxorcNlpF8SOh01bahs26rlanxWz/S9qF7Lz+KmV1xGxS6N9CchJ74yA21IYuGNDVaCkkRImZthFiRb3EBJsCRaM4SA8fMA6nHDZVDnGmIP+R1ekjbrF+n2vyI+I636rsbTz2tyjo2LreMmOqZgGf86R4hziVU+ZL7AP117nW3LaHvzKwD8oM/SrzkWdezW5gt5zDW+NHFO5iFA6s32tAGs46SNYpZFTj0p13LGq37HXsw5UGV8uhG6sXiNtGHWaS7mHFlLJ+9xvR8P1HF9VcvvjZBIliBtECjf0ELO8mcAvHXlmQkZ8wsASBoHBH4F4BcAEBKJGeRs7QBA0iZKHhO1cQ3xK/liyvrc+lkm0yz3wPUDAH2WmOOlzJg6p5xXkv98889cYe7U3/xz8ATZ9wDAr1CYf8w56jBPnV/OobTr3sbyRovN6QCA/QH+wXf8JODbvu2LP3ijNm6lxvW2Pr+X0YCBPGTR9LO9F/sI9hfuYdynsB9yD0yae5O1vcixvVM7xt2rHOPV5oyf1bUebWKPn/+zh+MAgDjp2EYZy4u2n0geZdlzUfcG5F/7RzOnfU6Vib/U9Rl9oj8eAORXAP7xPz//pxz9H8ak3Te3DeVe2ZCyuIxCKRNfC1lWueJQcdJJHtclqL5az/TEWubaeOq8VF5Go6fg5BcZbIM3sSjxAL3xQW6MLlTCRTxJOASL02QJ1hpykuenNkn+ldGLvEbqavvap001Pku3XGLXf9LST52cPl2THYNExynRcRRzrIfczZWR/GS+k/YaF/ZwaVfKpi0j8RDsE5h91ifpP31dxyXHTHltzjCneHhA/r04+VWv7YDZvrK2dWiZa7DqS38gp6+U9eME9beIz5VvjUP1SbfyHqTM4/q4PMDces51cf17IySSpSRtkjSIGW9kIfqSMA4C8g8B5gEAJARSlgcA6JKg+RZYYphI+xI4bUnETuLau4b42PyUTRNT372Ny73Yg6/0oaj/EnOsclwdc+cBxH+N/NdP/5l3Hj759p+33nwl4B+cdH45f9Kue/Gjdjxnscm6/AQgv2RFxnf49g5/EuA6CS4jHNC9Qd0zUMa8RPcZ7D/Yt7APch/FXgnZfS/5lLNObQO9R1uwpwvYaBjiSTbtrI520iZ2sE/jbzpxAAB/wD72aZ0dM1tIRx99oj6cZeebf2zTzsSRfEgH3+I6HADQpzwA8BAAJHgAQLmjb+zDi9lMA1yJNlpxOZar6TW+t9xQ96TdmrYVz7ZnZSkzyztmPbEj9Wb9KtdyW/FlNHgK3jxi3rRMAkOSlSQ/EiLRhcDFIVHCRRqkfut/COAG5ubrArpIV2dF2iAt208581LOMmty7a9xMP1T5fTjTNbnHeb47FjQZnOBOec8Qn7rS1uqvcsw7BCcn2D6QB+lL/V5jglyHU/HPVGZssj5kwAe9Mw59YvZtvZsYdbZK1ed6Ycdc+Hky6NPO1/XtC4+qp/mDvlc12Ct80HT49+HB17IAxKBe0IJEyQOEuXb2vwKANIPESPMfgbAAUD3+38JmmQQTJKobPtJJpW1cQ3x6Vq+eZ1O697TuLylLfjK9pX1X0X9meiYOubMgY78M1988++n/xB83/4z3yD+vv0nnUMn6viVCbptDxvSPvtwLxjLSvdc251WDwB8QcDXEfjljn4SUPu0DB8c/hhc7qPYV8z2D7nHcP/BfoW9j3sk9vK+pGPPxF6LMupVR+7hkLElgraSpryGp7rqpU33bBwA+N+Dk0berI9hw0En+rCdPlKXvnEAQGD/R7/VV+se42t2jyJP9kukvfSFTYv94u8AQPYl/kn+6Te+ovwI1HuRq1NsGrgWlmP+DNfq1jaGqlMnM+/a9C0d6K2XdWo6cfPAmWw5y+zBZVQ6BW8i0BsW9KYHmfQGJkmGSrY6wiUB46byxlo7BCCvI/+moQNZfYkuTh1qx3Ox63P6pMr6rsP0cyfnmCjnmCHneA55NgdG1tk8yjjya105l2lzZu8y8g4h+6sPco6mX/V9HaPZmDN3Znk8APxfAjhRRqf6s81u3LbSsv5M7nRk/9Mvyvqs4MzHe9KHqidjVNMyrlzRcSc9L9MrZpmH/PDA1R64FyKSdkiYIE8QqTwAgKDxFQCkDOIPGeOtbP0ZAOStOwCAnHUHANceAlSCp+0d0seaniQ189IfH4tM/7IvNZ55nax/yFOumP50/kjGk/x7AND97p95w/yB2DPPmFvMtST/+fMTP//3AMC5pC3a2PXprdNcOHhLD0m/NvClTX4B4AEA6E8COHB5w58E+Ayly8rg4S0we4TcN7GXce+R+4oquw+hLHXYL7H/zrfj7JXYS7FHohx1Uo/7E3DYs0Q42IeNEYZ4bn/kLUM+BfTRHvawR2O/5tfD2KId2X5jw+HrB+xFF/2Q/Ge/1JXtFzn7oDyKnPqmDL7WhR2Hwx/6xlcAHgJwEOCbf8aV/h19k7a/mJ00wpWN1TTznotdO9mW+YnIXltla771xJpvfG8+5ayTmHItk3nINSwj7RDy5siblglhYPIYmCwZKtkiXklVknRvsPy9dS6mLLKeukn6ReoiV33Ga7u3itunrq/4gvT0CbL+qqhPZ5hjkHKOU7eINWPsmI+s0/xBvpcr5yg2aa+4jLRDsO/pj/SfPs4xqGN16VygPvOKucgXAdTvxjXtUMZO5YrYSlqici2b8ey7/hD1U0H9eA0OVafxUBbRp9zhh9yn/87qPS35SHl44EYeeGsC0rUvYZJAeQgAgYBkQdAgZ/kVADJkjZA/A/AnABA96ncHAOqXKHaoLYnaeQ2mHuROR+eb95RGn7C365tp5s/6lTosa91EfVj96lh25J/5wLxgTnGwxFxhbnHAlJ/+M7fy03/If/38n7ro8nCJdrUl7Zz1863SXUa8P/TJJUhZ/Dc7AGD/Sl75ScBi22+E+dw/kED2EOxh3Buxp3HvurUHId+67osg2wb37OhT12zPMvyBbwhp44iexTNPmTqnYH88AMAW9mrYhw3ku0cSs74yeey1sB1dEH/JP30mjzKWn6A2djiqHPoGclGGq+KH1Nv9e7DF/uETDgEy0D99NZpdRtCm21lx1FQVZ/xg6LHxl5IxwzbFo2lPwHzxSYFjQs03XrHW38q3vOWMV8x85UTkWVhG3iF4c4B50yYBYZIYmDQZXFASK+HipiQNJHCj+YY1DwCQuZHJnwV1VFR/bfvaOP2xbvYt5fSDsn5KTF92cvo95RwbZcctsBvjkX0ae2Qu58aH2Nv829nQ2U/aQrDfl87PHKeUHdMZZlnlbmzrOOa4pVzLXRJPPcjpC2R9FDjz5Vr6qH42VyjLNcMPuf2/19TpNT1SHx54pgfeinhstStpgkRBpiBwkCuICmSDN7S8ma0/AyDN/w0AIkdZCJ4EpzsAkBz65lbSKGqDhC4RO4lr7xZm3RlJRMeWf95D/pYvtvLpo77YKkt++hbZ8QMdY8YfwirBZW4Qkvzn2/8k/3767+f/zLXu83/nUZ0X9zhmLh/cJ/4RTfp0aeDgLf82UN2zGsdn+PsNfxKQz19kwtlb7rrvYR/NPif3OLlHcR9LPuUoD0GGbPM3k3zzvnYIkPsW7DkG7UscWWf7jsw79OVY9/R/3MMT+K0+9mAX/cP+bHOyVzr5hb7RLzkHMmnuuWxzA6utXXyoeNXr4DP6j08YS/pFQCaNPg6LlhG098UNpCEv5UQNeQ6iP3VmPOW1MpTjWitT8z7UOP/XMuep57EskzKljFdUg+k1bjo4C8vIu5hk5URiMkmUEruFhhvLwM3WfQnQ/R0Ab07rVqxtdXFs69LX0qyT/UL2JqroYpmYi2nKldxlvC5ekwVsNqbMA/OQuYjf06U9idqcuAyjL56fOS517BjvHFfHv5ar47w2pjl2KbvAkpZjvyWnDuWcE/ikhPTZmjyqneYC5bgSU868Q8FSNvOtZ7mKW/m1/CP+8MCzPXCPpETiJ6mTwEneIBD+MUB/BsBBAOSC4FcAeQAg6fMAAJQUdpjkEbmSy4xfSk7VrY6uvj641/HZa5djmNj117Tst2l7UF+K+hh0fB37jvx7AAD5z7f/3af/+fb/ks//6cdev71WORcQvnx4reuNfhKQz1dl8BAkgOyL2Mewt3FPzT7c/bR7I8vlngeZdOpKuiH//GyXPTuHARBxdFnfvQvo/mXYtBzDyb4R59LulLMM8mJAp/3It/bYOWnvVBcd2kN5+q0f0Jk6bE+knnKD1d6Mj+IfxgNhXOS99GX7p8OOOibDgGUEy72GTac+18aMJyJfGmjAOsogl7qrfMgs/6yVzbxS7dRGV6ZLq/X3xquuGk895oE1LCPtdEMwwXOSJFnhxsjAjZ6BmyeD5CrRxcYFqB4C8DkVNzQ3ZAbLZ31l9CNnO8rYU2XTRPKVOySthuy3C176Bjl9h5x+7WQXpYqMTwl1DI2PYqfxRX4vF/Zz2Y/EZaRfPD9zfOrY7Yln/RzXS8eUcXbsa90a7+YEaTkf8EUJ6atOHsXP1iTLmF7jpoNc5HOJH2L9v3vK9DUfqQ8P3NgDr0U0Lm1H0peEDiIneYOw8ZYSwp9fAfDGljTeZkLmKMeBgV8AUF8iuHYIkARSWVsSsdO4NmeaeWLVZR3ylcFL/XVv5bMv9r1ilrlWrjqJ62OwI//OIeYFb74l//npP4dIvv33zT/7Lt/+k8cc85DJ+UV7tKtd2a97GyPscTl5zQMADhrwJfcvfjv+LwGLtrww+vxNRD7sn9hvsK9h/8N+mbf2BP/aPbL7aMrUfW3WZY/O17ocADBvQA4E1OH+1z2NexhsiYBtGUb0LJ55yssoc/oCAHvlC9hMH2mLMmuBMthGn9z/29/OVtP26B7tamuHI/u0lyKfS/wQu+2/2rAMtV0w/7atNtqyk51sWhpU08zLdJrKeMqaYVoXz7yULZuY+TM5y7+FPLOL9FlYRt7FJIubnJsmQ5IribfIzVoDNy8LSJ7QsrBQzgMA5VqXOLpF2xGxBVlM2TRxTx5lCdlf5CSILnx7yV0leBsLzWz8mGfmIXuRdm9X2qSciFzDMtIunp91nBy/Nax1cmwvGVMffM/FK+dD9SdzINPW4uRxWf5D7MO/pomzclnnIT888CYeuEdSok2SJ0kd5ArSDmmAuEG+IGr5FUAeAOTbWQlaPQDwMECimJhEUlliVxFbM63GrZ/k0PL2M1EfvGfM/tDXru9rPsj6VaaeaeoQ09eOp+Ms+XcOVfLPnGFOcYjk23/2XhBWQn37D3HmIMF5RXvZT22813F00XntAwD3svgZ//GTAPYV2vNKyDPacNg7sRdxz85+l703hJ39Nm/wQT+lZ+9NmbofIs7+iT03dSH9zCEPAdCDXuq6F6573GHXcgzaJ47ks8v0iof+oJ923P/vJf+jhUN9ymf/rF9Jfu7BqoyulVDtzvio9mpXtjuTX82Y2hAGeWkccWXRNNF00fTENZm82YVOr5RNe2+YfVAGMywjvotkcaMkMcqbqJIrbtAauGEzsOi4aII8jFhEKJOHAFkHOW/+2oZx7EHWLuW9aD0x+4qcfnDBwz+GNQJYFxPjjEMJOU6dPIqfETbKvLdLm7v+kbYQ9BGYvtXfa3Ozjp1jCta8OrapP9tNOW2r9mU5dBEXM0+56rL/R5z5KH04ip7mhOmkdZf5FSnbpXU6HmkPD9yVB+6VmEicwCR2ECzIFqQB0sJbREi/XwHweTFxfwYgQYPw3eIQAFuS4GmbmPaaRvlKDM0Ds6/I9zoml9iVfbKvScxN6zDrrsld3WyjI/8eAPj2n/nBQdLs0/8k/8jOr7W3/86PtP0S371mWRejtzoAYC/LvUv7jM0r/S8BPK/zmW38sHdif8E+lT0Pe2j22f6en69xIfSQeA8CKFP3R8TZP7M3pxz1nEt8CcBBAnnsodzj5H5m2Lccg7alvSPrzH7jWfb0f9zTBvbQJ/pGO0fdS8Gsf/rr+O7ZqVvKH+qn3VtyV3+kZbszeRQ7XOTf8ur0pQ23bOtiXdW4jCsnIhtozLwqE+fK/A8p838vKTvXcv859hOsYRlph5ATXUICJglC5uYxJIHihszAYpGhEnkWCxYdFkwv4pQjL7HWTb0pu0hpB3nKs7xaJssju9hkX+2/C0n6KH2nnL6tsv4vWMcp46Pok3lO/uxay5vVecn0ao9xsAvLSL/4EICxyTHbknNM67g6jol1HImTb3qW3ZKtk0ifI3R+Sb+Nok/mRKZtlTU/6yDXK8vVPOJb+V2dR9rDAzfzwGuSjWvakkRB9iTS+RUAxA2yDzFjgw2Z4M2tPwPwE20IXx4A+MbWN8OipFFMQqncEc8uzfKXkH/7i6+Qr/HZPdSxH2D6pvNr5qdsXXWRZ1qWU9bfoO2AjC3j3ZF/iCdziIMkSD1ziQMk5lN++v8xvv1nnriQvOUBAPtZ/MvXFy98AFCft8QznPZN7EHcE7Gf5hDArwAg8/6unzTe8rMHd2/s3sk9tHX9KQDrFDr8ewDunyb7mbRP+zus5Q4HAPRDHoJMG6PPS4Qn9fAJ5XIfFuWz7slfafseWX2NPejHJjHtG8mf7oUjvFLu0mp+xpXFPfUtcyusbd9K7y31aCOYYRnxQ8iJnjeLN51EN8mSiwNYyXOSc+Uk8ywkLCIeAPBXV0nLMlVGD2nqE12cErWHMspd/izNOtnH7LsLnX6pPkt/VlmfF8xx6eRR/IxkUea9XtV2412/l9HJQ0g/pr8dAx8OdZxyDFOu5bbGlDbThj2ydSrO6trXI3b+GFmneaDfZmmkc2W5jNf0zEPm6sp8yHn8+/DAHXngHsjizAaJn6RPYiehq18BQNgIHAL4FUD9OwCvdQigrWvkX0Kb/VSe+eQ9pNMH7LQvEnQQv3jYgpwhyymjo8qZZl7qQfYAwLYq+a+f/lfyzxzyja3kn0MBDpY4LPBgyflEOznW9h285zFzKXrrAwBeZrHP0J4XRp/PYIZlxE+k1j2S+12JvH/Yj704gThv+WeHAOy/revhAfU4PCAd/bTlfod9DnYcQ9o3kp5c2Rcys/yhL+gljLyl5GfZKp/8UOqh4xRme7LnpkcbaddI/vgvOpzXWtw8kXozuebZRpY37VNFfdEhaYZlyIeQE90bTXQBqSQrCZWk2UVGgg5K3JPUc2qY/90Ki0/mVzn1pWx7tf09cfRkOeXsF3Ili+kPfSSmH1PWzwUdhw5H0bN7oIuT9l4v+szVYfpjGWUOIf2pv8EcjzpH69jN4qkjdStn27eW7V9g9l95ZJ98heyl/2p8lk65zEu56jD+wIcH7toD90xOtC0Jn+QOwgX5gsjx5hBiBmmrZI08yE397wB9IwxKEkXJo1jJpXHIJ3JFbUxCKFFNlCSSplxRH7w3zH7YZ/0G4mt8n2nKlk9EX8arbF3QcXM8k/xzaJTk37f/+ea/kn+/LOFQiYOCPFRy/tSxzv4j3+v4uTi95QEAb9CHHYu2vDLyHDdgwyG4V2Efw96H/Sx7awg7ZN9DAA4c8xCAfPfH7ofZH5PmIYB1OfRgP08ebdCW7WrHQG1LHMntXiTLHGT1gRNdT+ocyy0DCTXf9AOm/i3ZPaHo3pF4yuoZbdNGtj+ih4u0F7t+6xe++Us/8D2/64/9qe//jb/ws7/t7/2bhJ/7mm/6nPBP/6a/61f/4Hf+hp/44jd97Q9j84sZcYXidErKqKrxK9R/slX0HVjDMtJOJ2VMXCe36MQGk0S5OIASaJEFIUMl9Zwc+hUAyAJayxBHh5j6XJBsbwupu1XGfmS/sr/pB30jesNXxLclVP9nfBQ9zXPSucQPsY/33/RDysvo8iGkb/W7mGNT52mOYcq1jrrEbK/K2gTWvD3xrB9y9rvKo9hpLpDnlbJpoOkVs4yyZYw/8OGBd+OBeyUm2pVECtInwZNA1q8AfGvLxpyfAvi2FtJHWYJvbSFvBsmiKIkUk2Aia0uVtU9CmPmVtHZx+5v9V35PaD/A7Cf+0Ef6fs3HWbeT1Seqy3GkDcbbsU/yz+GQb/45QGK+bH36z3zyQMl5ZJvYgI3Z93sfMxeqtzgAgDizP9WGV0Kf12CViS8E9yHuZ9jvsLdlL8ybfog7BD7f6PslAESffrFndj+MTF0PEKjrAQD6KEdbtKsNR9RObR3JJ7urnPGsd0t5GY2cgn4S9VeH7hlzH6l/QNIpo65jO9o+oi97fesXvuX3Sfol/FvIYQC2v6xlc+05KealHjnXeCB96yTscBnKTwsGk7dOfic+OJv8SbCTrCuzoBhYMFh4PARAJs38ROtXdEHKdp8r15vZvmb/q2+82UV8OQmd72vaqLr7ou57vbS9w+qTZXTyEPTx1hzN8dojb40p7WnDGqZ9VV6pV/trfFQ5e1ASf87V+brTZ7nM69Iy/yE/PPAmHrh3goJ9EioJoAQSkudXALyVza8A+BIAMseb3e4rAMmbJBSUNIoSO1CCuYZdeW2+BO0v+JLj8xr6aSP7rv/0FeOAv413vs76KaOLeNWJjhxXyT9fgUB0+XyfOQGZZ34wb/zdP2//OTzKg6T66b+HSc4Zbda2HL+X9vFz54eLzmsfAEB+2R/a/hui+wVxGba0+3n2Quxx2Sezx5bMQ/zZg4NJ6tlzUzb3xaR5gMCXBAT0UI59VNkraVNi5yryucQPsa/Es75ylrdeouUqLqPiIdQ9GvG6F8Rn8gB9p1/os7yEPMpRvvihto/dt76WP/HHf/Bn8k3///HXftPnBg4B/sLX/51ngTTzQb4IuLVRD31v74G8IbCmTkbii6HeEHkzJJHyhgBzceCGMHhjVJTcs2jwkPIQgIXEPLHWJe5NZzu3QNvJvmQfs+/pk+ov/dhg5/dMG1VOix/pXGKVD5kf4T/2N/2S8jL6fPZgmy3YOV5rco6lch1T4rT7AiH7VuXRXDv+lKtXpimLlE251jW+p4xlH/jwwN144LkE4jXqJ6GS8EG6II6QMAgeBAZCB5GTvIG81eUtL6QP4pY/Bdg6BKCNDBLNDrUHNF9bEyWJImWVE7PP904iuzlQ7bdv+ka/MoaM39YhgH6yfkX975xwXqCbMWfsmQMEP/tnXkj+ffvv5//MHQJx/55EHiQ5d2hPW+hj9rvzy72luRC91gEAP189fvL/1s9M2wczLCN+CO5l3NuA7Ifct7PvhczTH/9AIAcAsz8MaD323OzRqcs+HkQXust+Ke3S3mHe6mW5Pah+FGb5KlsOXAz6R6x+oj9wAjlH9pl+J0+hHP7RB+GHbHs0fbi0z/jVSHt/6g/9Nz+fkX/I/doBwH/0Vd/4uYGvAa42ZGfFm3V8Z3uPYl/xgL7PCam8jGKH4M0gdjcFky4JssS5knGJtcgNg+yNw2dIHgBwau1CYr71KtoO6cqXInW9ibGDNl3gsm/01ZC+QNZHcbOf/Kg/B+rjGY4ip8UL+VO78IuX8sxXyyj45BAA/9exIe64JXbl6lg6rrT1AmHWN9NHk6f5oD9Iy2uWnmWqnHVSruUe8YcH3o0H7o2QzOyRWCWRlPRBxiB5kDve6ELa+ALAvwcAyYO8eQjgG2FJXL4thtBlkKiuoeUpIxlM1ObEzEfOPGT7K+IX5Jl/rk1/SZ3aDmb/6K/+xHeS9fSj+dVPxs23jnoYU0m/xN/P/iH+vvnPT/99+8+b/jwAQOZgwK9ImD8eIGEzbTrm9s8+v9R4XTvOs3ouVF/63V/6Sd9IX4PsP92LzvCNPvm3ix3mcxzZsAz5bJ/kvse9kHtd9s3shT0IYC+s/yT3lJHgujcmTj339JRBd9kLa08i/SDulfIsrZap8a4eZbqwjPRDcJ+X+8f0T/oGX3BQYtA39D/9U3yQ7Y9mz/pN/FkXY/pzv/8f/bLkH7IvmU+kDF8AHMptlH+NQ4BndfpR+WIP5M2inBNTeRmaDyFvjLw5mHDeIKCLgYsJiwI3QwYWiQwuGCAh/x4AcuZnPWVvymzjGpkbmNNOFjvaRYcHGdkv++sCClb/6LeC+nWGo/hpQaAMV8UPqR//v/ZbHxgHa1hG2iHUccgxukSuetTfYLXllvHR3KmvyJde2FKvLu2aMrXOI/7wwF14YEYM7i1dYiWZlAhK/CB99SsA3jZyCOBPASCAlJHEUWfrEECiOUMJqERQu0BIYYdZxvwsW8mkfWdMkG85NrfWp23aLNon+0m/8Zn+k7gbB9d8noc2HugwrpX0M96+9Z+Rfw4A6hcAkP/89J+5k5/+036OOf2yr6K+uGeMRehZz2L2gjPiTzp7RPaF0d69iF2/l2HcIbi3yf2Qe1r3ue7b2WP7Vp/9sSSXdPbHlu/qo4N02rHtgWnbiD7rci8jokxZ7NLIy7CM+NnhCD7Cbuynj/SVPtN/CL8cQSRN38hXsv/6nHZGsO0h3vT67Pu+/3t/fov8+7dkOAD4f/6hHz1M8X//f/+X2oMCDg0ePwe46Ri9mbK8ITTCtEQnp7iMwqfgRPYGcRFxAfCG4abhBjBUQi5575AbiN8eMTP9bwG7cqR5Y1b9l8SxEV35uycWPW13kQOzn/YdTL8gp8+OcvpTeYajyuEi/3F98IC+SEz/LaPYKdTxyLFak2u9yVjSTraN3KVluvlirV/jQ+XpYbYmk7d1oXt2reVlnb3lss5Dfnjg1T1wz+Sk2iaxkkwmiYSQQf4ge7zdhbxB/nkm8ik3JC//IKCHABDPegiQJFQ5yapp+RY4yWBH8GuacQmxfapon0V8gpxY/XRJXF2X1Nkqq07QkP2y7xJ8/IkvJfL6lXTLJGbZJPy+6Yf0EyDtvvVP8l/f/jM3/AqADX+Sf8pS14Mj54q20Rf7Zl/BLR/dS/6tFpy/+K/+K79wYEflnzv65L92tXtGk2ZYhnxGdN0L5b7W/a77X/fY7MsN7r0pU/fF6kI3cuyhtEPEfuS8Lo1n3SpXXeTbduIy0p/4BdvlBn4NwaEPB0NwBQJxAl9J5AEAPqOu/T/6INvUtorYeNXFb/Yl/3zin2/8U4b0E/w6wHiWqTL6GOerDHtUehceyIlYJ+oyenAKSZJcQLzZvfnrIsLNUEn5jNSTzg3H51WsvfwxEk/VujpV7zVxTvLcWHEzewPbj7rIZb/TH7HYnfw1fIc/iVe/ZnxknxZD0r1SNu1Tw+qD9FuVl+GcQ6jjck1cXQVrm7eKj2aezAF0v8Q10ztLfwkbHjofHri5B+6FiOyxIwkWpCuJJKQQcgYJhLDx2T9kjucUBwGQOtL2HAJI8GdIW5JUiam2VKx2Uj7LSB4Tyc84cvY9CWbKe3xYyzy3/kxftbf2Rx/gD/ysT7tDgBwHx5lyjHUl/RwAGfIAgHEnSP7943/MCYJfAHBwROBA4JpP/2/tz+rfW8dvtKAc3qZynyX/Z0/KHvRGbbyUGp/hYIZlxA/BvVDuY927g7nvRe7276QRcm+sPvWLx3bTlrRxZD/7Ut9MkfnVBuILAVu1Hx/AAfz6AZLvC0L4iH8gUfLPFwCUZW7IHdCBPvQe26htj+TbXLST5F9yX4n8tXH0/c5v/y1/+TbWPrS8tQe8GbCjk+tENb6M8ofgjZ03DZOwW0RcKLpFpCP0pnGixmaHC4JuuphEn7SMK9um6M2ZCOG3HW5odGlzLoTZNxcKb3D9oX8K6r9LcKg4Gxvin/qF/7gSO58uo8wpODaXYuo4yl1bt0gb6k8PauXEKhO/5tJvte4svZZ7xB8euHsP3JpQvLQ+iaWEEiKZJBJiyNtayB4kDlLiIQDETlJHGcijhNM3uxJRCX4lnzXfAwBRYluxy6cPlLMvFWuefU98jr/V8xwds7rqTsz+6R/94iEA48Bbfccj/V/LVPLPmEr+QQ8A/ArAQwAPAjwM4ADALwCYIxwGeFhEXeeJY4/N2m+fsp/IM7/cW/qNFqjPvvsf+q6f5UsbDwDYG7IHvJH+l1bjM73uT5bR8JO33bO9e+5/leve2H1xtyemrWNIO0bSaQ+HfO1lH7v6Nc94IvJikMvQTzgA/MNP/CH8HP5U8k++b/7lINTHJ3KDo37aMgzx1H/tIe3q6zt++3f8CG/pCbcm/xwaoJOfDLyj+X+1Lz/FijkJlZ2sFZfhoENIQpU3vwsCWBeNJOKSdJCbpwvcYCzALMScsHVlU8+WnO3THvpvRf7xh74J1H/4THmGo8h0YaDOp3Lt6atlZr4kfcmQ83VNzjohr7Vj3ij+ZPzI47oUP9Ta/le9lqxx0xP3lMnyD/nhgXfjgXsjJFv2JNGSfEHGIGUQRL8CgABC9iF0HgLkTwEgdn7WvXYIIOkD0Z3EVPIqSgoTzRPN0/aK5Ne0Gk8fSDbFLf9l/jV1sn6Vq101XvuhL/CN5F4/Q7r1NWk130//GUOJf8oeBHgIwFch/gxArAcAEH/JP3k5R7QFO7A3xyn7WX1y7/EbLVSHAwDvM0je0Psen5vYnGEZ8dMBQO7bkbu9u3v4DrO8unJvRVvHkDboR3EUeTXfVjsO9mEz9sMP4AWSfz73l/SLfvov+ffrZOpW8o/enf3HB1dfP/ad3/3lWx0A8JOA/FIA8u8BwOO/Brx6iN5VRW/MerMYX0ZvDiFvdheA2ULCDWKoRJ2briP3pPvHWEDihqqjxmmLtA65adXLAYO6tS8Xu26Rs6/Zf31SEJ/hK303w1HkVAaZi7KP64MH0hfKichdWEb6NMQCPS0z6nd6M20U2SyT5ZG5xA+x83/X8s5LvlzsHmx4ud49NH+UHrh3gtLZl4QLUplEErLoVwDX/hRAsgfWIBmVCErsO6xltFPyKFZibJ86zLLph85PW2nW3yq3Jx9dllOviM3Iabt9wwf6TpKPzxnDegiA7wnmS/wl+/UAwHwPAcA8COBLAH8KwBcABN78Q/4ph958++945rjZR1EfvBe80aJ2OACA7LHfvJHO11CTz+wqE//MPat72Nzf5r53Tc46yOoC1T/aWiIc2qb9CEN8lav6gUZPdmAvdtNf+AIvGiH3fPEBL2AOEJD95J8DAok/daibfij7ylNb2e6tek7bvJ3f8/ZfMp+YZL+TLUsbj58B3GrU7ktPd4NgoendBF5G/iF4w3sjuRjkIuFiIsGWlFfSzmJLWpJ8bjT/HgC/tbGOZY2voe3Zvl8W8PZ/7bN/b2z7Yt9yobP/+mOC+BB/db7MtFHkVAaZi/zHte4BfZS+THkZ1a8JqWNNxjryvfbIlLVcRfVkmUzbI6tzT9lHmYcHPgoPvBeiUu2UcEkqJZKSSAgkBM6fAvD2f+2nAPWPAkoy8+sA0vIAQEIogU0kz2A6Nhq0+xJM4mk9/QDiI7H6q4tb17xL6lpHtK46K2pvor4A8ZH+ws/630MAfe8hAOPCmEnyPQQQM125HgT4UwBIv4EDAdK7t//YqM32I/upL94T3mgR+4zPqtn/3UjfW6phH2A4vf1n38q+lj66P3bvnXtp98yg+3j3w6L7YvfC4GhzOQbbFkfy6SLttS7bTzz4Qx/AKSD3/CyYAE8gIPs7f/gI/tEf+MD+ywtGh5YI2V7tb41f7Itv/cK3/D7JP2S9I/GmkZ9fCmyVp551OAD4/d/xDf/uxQY+KrxLDzgxE5FrWEba2aKSN4MLBOjikQsKci42ypJ7kZuSz7H4I0jegJatqM4OSaM+J3ocKnigQLpBO8G0P/vlje6Chw92BvxH2erHjI/sJ8SQtMf1FQ/gL67EKqdPU15Gva2Q5WfyUHPWPnEuynvtkS37Vpg2vpUNj3YfHriJB94TWUlbk3hJxpJIQhghjxA53ujWnwLwqXd+5k1ZDwEk/cRNSwIqUU2U5CeRJd90iaOIzcjavoa1XI2nL9JHW3LWQ7Z8yqatoeWrPuL0y/Suj/pDP+Ez3/Ljc/yfhwCkGRgnyL0EH/LPeIOZ5qGASBl/BuAXAKJzgrK266EPNqbv7Re45p97zrvJIvLxKPHZDhoO+3X2sO7L3Suz32Z/zFvwDKS5F899MvVzX+x+eMcBgHa9ladPvsB+DwDgEvQz+46c/ZcfyA0qF9jou/0Wn91/PsvfcwAAkTd0hwD10/96aMABwH/v1/0nP3+2wQ8Fd+2B2cQ0HaxhGWk3PwSoxB6ynp/r1/wu7mKVyM3sJzyZjuzNfQn5d9HDBztD9V8XH6rOiCTxx7XtAXzJ1fn0lmm20WGmrcnkcWnzh9jj34cHHh642gP3TE62bEsCBrmUTEoiJYgQPgiehwAejvPJt4RPIulBQJJ/9HgAkKR/JksYyZfYalsSyI4Q701LPemHS8ho1sPX1q24Ng5ZFrmGtf6kT5DxlT7F3x7EOCaOgwcAIOMk2WecPQAQzXN8Ifbk5QEAc4D5AfrpP+XR7bhL/vV77eeaj+457+qF4+OumHufJwcASfzzDThfx/oWnP03eRBiDwNyn1yJ8HDncgzZ9lvsdWwzUZsWDzDc/yePkB/Uflqn9rmQf/pvO+JIuu1+7w9+52/4Cci55B6UvIuZp7z30IBy6P+nf9Pf9auPAwCG79O58oah1xl3QovLyL/oEICbyhsMzBuvk1l0WJA4BPDNfVdOXYldO5mGLTV4wldPOXfc9Adf4I+VgN/I138djuyTz5Ef11MP4DcuMeXOpzVtOdYVa36Nq5905aN4AvNOCY2wp0xT7VlJb9Hmswx+VH544FIP3DM52WObREyimURSggjp47NuPvPmqzgOAAj5XwMmeYT8QTor8fTz8yT4Elawy+8OACSRoraL9Em5YtZJWT8k4j/iMz9mWeWtOupKvdatqO2kK1ekDwZ9pS8ZPw8BJOT1EIC4XwlQxnGEyCv75l/y7wEAhD9D/fQf3Y61Nmp/9lWfvEe8dL0Y5Q8kkH2ee9Lf+oVv/hKBOPs9yozw3p6f1V7ihhPxpY/soz0EgORL+vlSNv/4nb+DZ//tQQD76Nwjb5DgYcLJj9U+8l76ss2TH3yBxzjnnj/7RF4G61Qcxi8RbKNi9lF7Mu0ieesAQMIvJvE3zYOCRPMeBwAXDcdHX9gJWyc18cXgjZE3Td5cSbaTiCN3pN40Fik/3+dNfi1vPLHKxA0u+MTTprQ1+6Bs/xLt+4XY+dG0oepNF0vaf28XvuPqUL9ei53eQ2PHf2wz066Rb6XnmrYfdR4eeNceeI+kJW1OIiY5g6xBJiFvkEiIPOQPssdb//r3ADgYgPxJGinrIYBvgX0TLMmXpIqmi6QT8s2xJBJMW5UrbhFnyqeu9EX6SJl85ER0EM9Qy1i/YtZJ2X6QplxRu9MneQCgXyX4vulnLEkjMCYG4uR5CMBYOp4Q/jwEME/yz9gjU85xV3+OoX3IvlafvLf41uLFb6b5ff8/8A/+3r/0fd//vT//R3/0j/zy//BP/tHP18J/97/1e/9vP/SP/9CvUJ561GfPONp6D89qbQQNZ18B0Bf21gSIfR4A8FNZAmsMAZlDAV7G5UEA+2f2x+yJRztLBNvUjpH1ppd2pF1nLy9zX79XHj1aIqRuZTtt+8afhd/2bV/8Qd7Od8ReEr+FSfyVqSP59wuAH/rPL4+fADxrtN5fZSerSA+UwRqWkXYI3jiSZjCJdRJuCXmipD+RfBYoFiFOI80jXRk0nvpmctqBnDYip/0ucPaton0Xt/KP5aoPMz6KPK6dHsBveRnXn+QpX4JZTxnkyjY+pHz413TTatz0Bz488PDADT3w3ghLZ28SMkiapDJJpMQQoudPAfyjgPw9AD8Bz7fAkk1JZj0EkOyDljFN4iip1aaK2iu5BNeIc5ab1U1/4C/i1W+WsT3jYq2njg6tk1jtzDg+0Pb0h74CHTv8CRnnAKA7BJCogwQPeyDzjGUe7JBG4ABA0p9lOCSgPu2gi7axRRvtQ/ZTf1T/vpf42lLyO77rd/xTa0T/0jwOBb70u7/0k5Aw9o5rbb9xnvsP0HB2CID97J15scYeG3LPQYAv3PJLIw8CyKOMXwO4f2bfO9pZoi3bHEmnPRPya176gDa1J3EZ6adQ9+6zeNYJOfWmPIrc9mLMfva3/b1/E5LuIQCYYesAgHyJP2h5DwA4YCA8/gjgbcfuPWpjMnMl5gRHXgh5wySJToLNgpFhRtIrueczJRYhFqkk+x35Ny110ybxbFs57Uu7lbNfKdc+k9elmU5ehOrDjI9iJ38jP65tD+A/L2V9SnqmGc+0lM3vkLTH9fDAwwN34oH3QlS27JSUSdIgbRJJyLnkEfIH2efzfw4ACDwbPQSAEOabYMlgJfgSfdA80PR6AJBEUkIpanOH9KtLt65oGf0g6jfiKZtPPWWRcsqg9UTTsgyyNswwbVVOxEcG/OchAH6FkDMWjqOHMxL/LEOeBwAc+CTJT/KfeY55jrdjiI32KfusP94zzpYh3trvIfj/o3/y+86+BtiKp04OA477u5kZr5Ve9y+0S1qG0x6dva37XvbF+XMA/gI+b/v9L/G6nwRwCMCenHrso9F39EO219n0Wv7IdtKOat8yCp4F+jELtewxXnXa3sg+7TurTPyqC9t+7vf/o1+GoHsIkOS/ypL7xBn5zwMAfv//zd/4dX/mKiMflT5KDzixuwm/jB4fQt48kmgXG1DiLSZRR5bAi6axMPElAKePpmWZqqeL26aYdiFrb2L2p5Ppd5de0/RPYOfHkX1aNPQ3aY/rKx5Y80vmKSci1ziaa/pXWvuKZD1Tatz0Bz488PDAK3ngPZOXtD2JmWQN4gahhJTn22EIIT8F4C2dhwDI/lFASGJ9G0z9JPozOQ8AJJCSWjAJbydr+x7M+pZPP1QZf5EmIlMPnIUsm/KsvHZUxFbT0u4q66s8APCQxQOA2SGAhwHmM46Q/CT6jH1Ny/F2nGkTG7Sv+glffAyhW2b4PX8SdeUk9ymbn9jld2n8pIAvAjo7Ximt7kPcy1Rchj2H4N6UfW7uydlPexjAPhuSz0s3AvtvAmkEvwJgn40edB7113ZH8qtf1ScYYFq1bxl514aqq7YxVJ/aRb7J9Sf++A/+jF8B7DkE8FAgDwGqnOSfwwUOAPj5zE0Mfih59x5wYtMR5Tr5l5H3hAxLpivZloSDHVknLQk+MqeSBBaprk6WN1/92Z5y2qSdiS6Ut0L8U0L1ofFR7HHt9IDz0eI1bjpo3hZ2ZVPPQ3544OGBO/DAx0Bi7EOSUggb5A1CCZGbHQLw9t9DgPpHAfMQwDfDksyKHgjUA4DuEKA7CEhyrDxD+mX/JKimkZ5+QMY/NY24+rs80rLeTE496hO1KW1ckyX/YncIoN8l+fVLANLNg9jztQd/48GfeED+lf0ygLf/qYexZBwdJ/uTfnLOvXesSxD7t/yd///0x//Q2Rv+JPkpr5Uz73/2Z//k5134l/6lP/35D/zA9/yz1ZYXiK/tW8hbC8vIP4S6n809bx4IuHdmX90F8ik/If+judOl3aeEVxSy7V3+GbYtO8OaPrpY2ybt2RcHXPw3fnkIwEGAQcI/wz3k//j5f9r/bLsfCt6/B5wQTnx6pAwuhK0FRuItERcl7TPk90p8ksRJZJbpiH/mI9uGqA1iLoLI9iFl02Y405Hl9VFg+g+ZS/wQe/x7jQf0YcUtXZbvyq3ldeUfaQ8PPDzwgh547wSm2i9Jk7RBOCFykEmIHQQy/x7A2h8FhBhyCOAfhpNcSkIrShx9eyyBrYcA2jQjw9hOnn2oaF6tn+X0QyK+yrjlM+1SWR2JM/uqvRmX9Cem/zxYSZ9L9BkfxwaEzDvGkH3G2EMA0a8Auk//Hb88AEi/6Mc6995jvC4tEPGOpJsGmVf2AIA4suniv/DP/fCTNPL+wr/83/kc0i8iHw4Bvud3/bFqzw3i7jkSkbu46RWXUf4Ucj+qXPeuXZy9ck2n/lF3bXMkn2xEfusr/YUt1V7jy8jbEyzf4VBx0q+cWGXiF138bwD8FGB2CFC/DKjxejjg7/558094469aLvLFo/DLeYDJ3V2md5N/GRUOwcUFzIVD0g1KyMVK3GucT484BOAzJPLWyD86KaPuxLQhbUs57Z/JlK/9Sx3mZ339c8TOh6aNIo/rxh7IuYvqGs/mzMu0h/zwwMMDd+KB90ha1mxOoiYphWhC5iB2kHSJI+QeIsjv//2vAevfA/DzcAilBwEQTAlnEtK1A4B6CCDRTRKcMrYTT0w5yyInWbXf6YtOthzY5e9JSx3I1a4ubt8T7YNp+qseAniIg//xfY4l4yL5Z6z8AoDxJXAQ4GEA484XAH7lgS50O4bVn+mLtfn33vJyGeLNqGQcoj4j8BL8RMuK6kmshN+8/9Vf/B9/TiDOfjNtukJ2zyGiAtm48h5cRr0nIfeiVa57127/Sp2it7NlFHnzS59piPHO3rW0ZSggrJXp8kaVUx1kLsrlVeOZN5WZZz/2nd/95a1DAL8K2MI8AHi8/Z+6/ZPO6CaqaWCGZcQPIReYXFySgCcxl7QzwWeB3yTxF0lnPwWo9ar+bBs57aoLXo1nf5Br3Vm81tM/R0zf6dOR9WSxIO1xrXsg/WfJLs28ipeUrXUf8YcHHh54RQ+8N8Ky114JW5JSSF0eAkAWeQPMW2L+ZwDIP8G/B0A6JBEiWb8G6A4BJI++rU7yKqGV4EowxY4om2YfRNOTNGca5Qj6YIbq21O202E7iWlHytlv+1zTarz6T7/mIYAHMRB+yLxfbDBejBtv/BlbQx4AkE89DxMcP8cK++1b7f/eeXjv5WKpWf7cn/2RvyoprwixJ22GtfyM7FNOwt8hNoRNl4q590DeG5ZRdneoe9Fr4qW9zs5R5LR/zX6R/pZX2qLc2U/aMkLNM02s+V18qDnpQeaiXF41nnmtzG/0Ie58BbD2JcAa+U/iz5t/yD/zoW3wkfjwwNEDOVm7CU/aYsgFJglyEvFK0tcOAnjrz18i5a+Vzr4AsH6nN9tNe5C1NWXTRPNqXePdoYJ11AHqnyN2fhxZj+uGHsh5e0O1D1UPDzw88BYeuHeCco19SdYkcJA5CCbkzkMA3vrWQwDIP4G/BwBZ3HMI4FcAEkiJaiWwEstKdJMoVxn7TUvZtNRlmn0G0xdVVt9WuVqPeLahHtuvmDZuyfpI31FeGdS3HgIwfgbIP8Rf8s9bfsaQ8eRghzHlSwAOBdbe/msD/bCf6YNr5uS91nHN+YHx+X0Scol6JfZrcd/ip55LZfRr0050TyJSzb1gyqaByzWh7j0z3sndnrXZt2JL2qY8ku/mwqa8jKetyjNchoIub5belcUG0m92ffGbvvaHIfFrJN88yyXmAQAyX9HczLiHoo/eA07mxJz4y/DA2d8EkCSLScY7sl7f5hvn7T8HAP7XgKYndvqyvY6odwthTdP2ilX3Hv345xjSb/pzZD2uF/TAw88v6NyH6ocHXtoD90pMbmGXpE0SB6GTUHaHABBG3hR7CIBcDwF8w+zPAXwDXT8hl6iCSWAllzMiXMnzVrzqsbx9BvVDovmUzzLKInWUE5ENtiliE3K1zbg+WMPqM+P61QMA/M8BgF8AQP4h94ylb//9eQfjyniSR7m9b//tN75gXoq3mKNvrcP1hTfvl5L1lyh/xQGAXQDrHrDGl1FmGuo+tYtTv0vfmzZpv9rpvkoc1e7uStu0HyOVZ7gcy4izcnvSh6onBwLUu+ji9/oSecn+Flpe5M0/3Omihh+FHx4ID8wm/DLKnC06a8S5I+2kJbFX5o8C8r8C8HcBZmWqviTp1Y61RZCy5Nc6xlMvMu2aZhmxtoN/jqH6cCQ/WSBIe1wPDzw88PDAJ++BtyYgL9k+RM2QZBUiCqGcHQLwltivADgEIF6/BHjOAYBkVkJcUfIsoZ5hrUfcsvZX1A+gaSDlM17zyevSrGN7YmeTafb7WpT8O24cAngA4Nt/Puuv5J//5YFDAP+XB8pQnoOD+vUGtulH+6gP8APhJefsa+t2AbzkAACSnuS/xjPvUnnnAUCSPOUO3Q8uo59PQt1HrsWpn/nGxcybyZSdBO0UR7HTvtV+kfbWV2eLadq+F5fRmRr21MUH2WbGka+64Bu/89t/y1+W0HcHAOSRbhmRrwhGo9p0VfuPSp+WB3KyKCciZ1hG/GwBkgyLkmXJcxJ3CT9pyiBxyL//NWDmZ33lbAPZtsHZolfTs45y1asdmW5ZMfXim2NIn+nPkfW4Hh54eODhgYcHqgdem3C8RXsSNwkdZBWSB9mTTPpzAIghBJI3xRBGgl8C8EaZPAkkhwB5EJBkcs/PASTCEuQ1TIKt/Zaveixrf2doObCWwWc1rcazvrZ0qH3PxXoAgL89AGAcGBfe/nNY46f//heP9e0/5J+66HCssE/7q0+cQ4nMZeJvMadv1abrwSUHAJeS+kvK7zwA0Ozc49W9n/FlFD6F3DdeI6Or1uvSapmMpz1HWVs7HEXezYX9XF0/TFtG/p5g+Q6HilMbyFyUe/bF3wXIgwBJPshv/DPO/yQAV3l2ow8FDw8cPeAkrpN+GfmHkAuJZBhMsowsaa+YBwDK/I8A/E0ADwXErFv1Z9vIaddMrnU6u2mHv0vATxQuaVP/DKy+G0m3WRxQ9LgeHnh44OGBj8UDtyIS96pHgiZxk8RC8CB7kL7uEAAiCeHPQwB/P84hAPl8Ru5PApJQSiollklc10iw5HMvdrqsWwms/cYPykngTduLWdc2EzvbMg2fEO8w/dXJ+JWQBwCMgwcAjhtv/TkA8H92YNy2Pv2nD/YtfeH8EZnvyM77mWz+vaLr2J/44z/4M5cQ9Zcqe8EfAXSvTBfqns/4MvJOYbYvNX3vPtby6FYGazzzMj9tClmbxZF1uIjf25U2KScid2EZ6ZeGTo9pQ92TvT15z76YCxwG8Gk//1tAhn/4+/6RXxoNLM9u5KHg4YHhASdsh050cDHkwpKkuhLmJPApS/AT/9yf+5/8i/w9gCyXctWd7aY9a3LWUU69tEecnyZ4AGCa5awn2p6+GZg+06cj+XE9PPDwwMMDDw+kB+6VmNzaLokbKLGD6EH4JKKSSn9TDqH0d+T1SwDeMtevAfYeAkh6kxB3chLqKnflTZuRWPudaNlMm8n4izwJsv5L27ShQ/vdkfpMo27GlSX+jlO+/fe3/4yLP+Hwt//+hIPx5EuBrTf/9q/6IeeQhN805qtpt567L6nPteAHfuB7/tmXIvWX6P09f+Abv1ebJlj3dMbrvm8Z9U/BfWKie8g1rOUzrkw7ynsxbTvK1X7jI/tw2U/j94DapK3gQtAP+FYZrPHMU1ZHYOrv5FH0xKOQuSj37Auyz7qe4XgA8GzdDwUPD8w80E1y0haDN4s3lYuYRFlMEp+y5N80/2cA/x6A6aC6RNvaczPP7KSu+sBsjy8SsCfTsuys/aNvqu9G8m0WAxQ9rocHHh54eOBj8cBLkot70i1REyV3klhJZ5JLyCLEEqIPiZwdAuTXAB4CSDLXvgaQ2HZkuaYlyUbOfPWApEvqZ0Q2Sbxl9UdFdGR5deq3tCtt+v+z9zfA1nVXXSf6vjFAfAWzLymuMbeVqiT0FblY7WtZ0PWqEBKKG0ggIB0pTG5IkII0xIuSGCICbTUFtkE+ygT50NLcBJHPUkASBLkJCoKk6XxIBUOLIYBW+qpUF2IKSd5z128/+7fzP+OZc62199nnec7HXFXzjDHHHHPMOceaa535H2uutZPP/q3hOQfoJeCX96m/4J8n/wn+fXXDn3Ss4N/zYT/0l35wvNUPzptKmePInOvyUuVXlXof42nnIUD9MnQJQtifFVSAV9d759bJk509GHUtmuvHXFfKu+aVuj61XJp24LW/ltK3klpjmVSuzPpVn9MnD/u8mQQbfaLPxBnQmlrre+tXH2J7l2xPOon3/mn1j/Jjj4cyAMD/A9IIABzrzlFvyQM5geWd6NLNZGSb8iLxwoF6g5LmhTbH89SdVwF6T9+xl+3AZx+W+Kxr36T2i5sEuxHmAgDZj2xTv0xUX+nDSTSO4YHhgeGB4YH0wFUFJpfVL4CZSZAnmAUMCjwFmgB6QKavBPA9gPwmgDsBKOcJs1vMayBAACu4FYBWah8SQC/xaUPdBLSCWmkCegG8vrCsUurWZF3brDT7Vfn0xxzPeTAJ+vEtC/Hc9k+QBvDPuSFQwzv/gH+3/VMnwT99tf85rvSDvPNljjJfKb+seXtZdr0XsKa6DFC/1uZu6//cei3L5JPCm7qgv7XeZM3JetPE+pfETlR3o0qRC2RZs+Za9ND18NTfTUn2XzoV78Et/FU56B9H0odci+MTfJQ+5MFiK6WP0eccUFff6l9tT21udu3qI+kk3h72yfxF6D4A4L1nBAAu4s5Rt+eBOmnNO7kr3UyGtskLAzoHsLmQBNlzlIvQXQDUyZT2Wzc7+wTNfsln/bSb/eEGwM8TQlMOn3XSlvaj/eqv9OekNo7hgeGB4YHhgcsCFlfZbgI5QR4gEEAIMASsAkozCMDCD4DvbgCDAAQADAJQbhAAcEodAwGCWEFogt4KjjNfQbV5dOxr6ivvgdsEu45Zmb6AIpNanlT79kda+2I+x9vj00f63oU3fiThV5JP/Qm8CP4B/AYA/GAjuoJ/+0Jf7X+OKccvz1yBzzkjzxyHT3qV532rb3kHvF8fAqRd1nbZlxnetRwqdZ23mWT7tadrRGy7lhTsC04Fpew65RVYEg+gMiGjnIS+dVtAtbUudn3aovS3pDomxyud1O/Jke3JS+mAPHSbHB/+1s8AfHym/1o+VqYO+gYGakAg/Tu1u7HtHZ3I/rB/e8ERzDYAwH2c+w33du4nYwfAEZ4cVVZ7ICeu/PYCmyxINxO/TV50UG940gTM8gJpb4gtWm9s1NWmNNuFtz9Jq451ofYHmn3g5sqvErQCAPbdutrLdnbt6yf9N4nHMTwwPDA8MDyQHmiBgtsgE8RBBXuAwVYQADAKiGQhyAIwdwPw1NkAAECUMhaLJHRJBgKwAaBNoFvBsCD1olSQmwBXnvE61gqELVO3UvX106HAP8eePH4x4ScTvtPvLsJZiAv88T3nQPBft/xjEx/jT31C33Ncnv+kzoucJz3+Ol8veS+4H68B8PFB1nHZj5V8rvHkt+A/15cCUdaTgkoApkCfHa88cGLNSfrZn/3Zd5rMU04iKABIxQ7rVGzPrUVdl9If+Tk6jXszJccixR3wHskrO5Zqq0exa5ltmIdWnvz+HLBex0cGTAwE6Hv8if9NBl0oN9hiMIDzJybA5+lT2twl+2S/JvG+j/CHHtsAAPdw7jMEFeFHAOBQNw79Qz3QmsA5ueU3k+F9xJObCxdGJm9QlSboFlhLq64XnHbrTYw+tFLqWVdqG7UfXPDveMcv/hIXOzcPUtWxrragtrXrh/6RTuIL3QioP47hgeGB4YEb5YHrDF4u2vcEdII/gaEAF+AIgASsAiYNBABCBZ8GAQClJp8WGQDIIICBAOwlCIavAQHB61JAoOr1wK7jgyaYT3mLT119QxutftUx1DHqSwG/VN8K+PGdwRRBfwJ/FuQJ/slTTh1s6c8E/47N812pcwK5fKXMO2TOv+SVXRdabmabtbsA+Lk+tvdDkz9ky/9Hf/RTP7+0P5dlLceRdLu+c+0HZW3IepF1I2tIwCdrSpLAU9Av0Ge9+avvfvf01sgHEjLKAf7oC0oB/wlEc21M+7kmneNdw0pdw07j2+zG6NpVOon3Y4efO/QROpU336LIUl75mte+9aSbqWAfCGCMeT7woecEoK9vKzUIYOAGv6fv9ZnnnzanZB+kk+joYxsA4H7CvYX7/QgAHO3LUfEIDzCJOZzMlW6msm3yIujdhLzR9Oha8N+56Pb9sD/QXp+yDxXcc9HXAEANAmR9b7K2Fe2nrybxOIYHhgeGB4YH0gPXBahcZj8FeIJBQaJAtwYBDASwGASYCkQFoAlWDQT4JBtgmklbguAEyxVIr80LeOeCAAJ6dRxzi6orpU4L/Lf653gcn+NNH+gbgX990t8D/YB/X8XwXX/OCW3QrsGJOkbPc1LnwBxlDlLuXExe2XWjeS+AP+TXAAT/UgMCSVsBAYIMrNdq2yvzua7bvnfuGpB1oUAzQabgX+Dvk33WmYJ/eUA/5RX4E0jwqb9rZdtdS+mf613BLP0lUVbWsOfGOfmGvIe8FHnyVa+Wqws1qWP+FHQzGd3jAPykDzxP+MEdAgL9SvV9+l+f6fvdfMo+Ox7oscc+AGCQdwQAjnXlqHdRDzC5OXKSw29M3kCgXhhJufgOTVkfPtvYXXT79u1HUvXTTvbBG6KUbUBLAQBvwNjRru1E2+mnSby/QepHZOMYHhgeGB64tR64boDl1P0VxEFNAkPAcCsIALgU0ApaAakGAnhSRB7wnwlgywJSwAsIhk8wDK9twXPSFshuySr4FbxXKphHXsF/TzfBf6vt7K++yjE6fn2HT9aA/nzaL/DH1wZZaIP26FMNgjg2zy3U8z1HmW+Ut+ip5+L9sFdvfKynfKLfAu+Cfen3fdf/tN8FoGyuPuCfNmq7K/O5pts/YcYea0HAJMBQQAnw54ESa8r69N9t/VKCA+pRhwQQxVY+dc41p2vPHq3r3Owb9ulf2i9r2Bxr5dNduZ6Vl6InDzUpN39qupkauCs5vvSXPnL9j4/gPZfklalDHTGANqVTuzmWKbs9kB1zjADAMV4bdS7sgZyw8jmxK7+ZWtwmLwRoXmjyXnBLVP2kaRveNnfUPm37YZl10o5te0FDvci5EbMVq94ALLeONrRrO9Ev+yOdujSO4YHhgeGB4QE9cD9Ax1VtM4GgQFHgCBgW+AIwE+QC2AGzgNgMBPhNAAAqZQly4TMYkGBYgJzBAJ9qS7P9ygvKKwieA/SHBAAMLkBtq/qEPhnIEPw7LsYt6NcnPuXHZ4B6gym+2+/H/fjCv0/jqKMP9Qv9cNyO13PoOc3zXHnmJrKcozWfZded9z6Q9EWf/owvXwL/3/HqrzlrpVZAQFsEBli/ZVsH8K7jtjTXe6wFWR+afIJsAAAqD/AmGOB2c4E45QL+BOX0t641XXP2qPpQ17bYpI0MRNA2iTL0HNPkk80unRvzJCPPkXLz24JdWeXVV9f8ZdDN1MhicqxJ9SeyyqeMsqwHP7XZG8tUtPcb/CHHCAAc4q2he+keYJJztCb7ZpLvt9t4gXghVZo3qeSrnnntSWkrUu3Pvkx97UBtj5ueyZs3EdleACCDANqAatu2dv3KPk2io28C1B3H8MDwwPDAjfPAdQcwp+q/IA9qEjBCAZECSgIBAt8E34DQDAQAZAGr+WqAgQCBbwYHsgxecItNQXQrKJB9kBcIC4Z90g9lHJlXZhDAcSZVv4J/20vaAv6C/hbwF/zrL0E/YD9TAn/8g18q8He89n0J/M/NH+fEnM51L+vd0HgVIJ/oyyfo/xtf87IzUsrg1YUK/nny/wef/KSn99pbkLfWvfu1Lus/gbaUtaJAHtrj0cuHTdR3bem6skVZa1a59aD2g3YJLAD8WdvmqwbsOCAoQPuuY7E7+WITKdexlcdta2RVp5XPNi/KY79pozG+vZ7r9xmdarc1DmSnOs4FALiPc/8aHwE8lXuHnSUPOJml6MtDa9pMsv2NMS+oerM6JJ92Ghdn7QP5bT+yL9meN0pukiYDALyDtSYA0LpR289d+7Vfk3gcwwPDA8MDwwN64LoDmMvqv0EAqIEAwSTgEkAM2DQQABUEGwhgsQjA56k2i0cSIBfAi9xEPpNyaQ0GzAUEBMT0ZS4IkIA+AwAC56Tq1jE7XqigH2qwgn6SKuhnXIJ+fQO4z6f80xfZ3k8iAJB+E/gbCGmN0757vjx/eU5vA7hfc214H2hRADuBAL7U/7KveOkv12QAoEUNCgD82VGwWze2mlkrq+u5zVRxv9Zlfem6Uj7XiIJy15tS6yTNtWrlGUeVUdc2bQdQD/jnCb/A/z3v+ffvJ7G+5TsDBAUIDtAX6rt+3flqOz7GOKU69lPk0/4qvtGvVfWm/h+ix9jUP2ScU7X9Qb1THA+9+Itf/OvccwzkjgDAKdw6bBzrASd278LYTIb3KW8o8PXGtSZfbaT9ie/1A/m2H9bPtrzZehMW/HPT9KMs3DxrdJa8daDa0bZt7drOvk2ic4ET8uMYHhgeGB641R5YAxJuk47AsIJFQaS7AdwRsASKAaosGkmAXp9yC2rJA4IzVRn1AM0sRA0GYE+ALeAWFPeCAD4dTwpvXuCctIJ/dGuwowf66SP9FfAb5GCsjFFf5BN/QX++40897Bj46I2Pvtr3OfB/m+bz0liv2c2PNR1Hru32a81JviG5DmRdCO/68FCqnUpbdgT+rEtZx/rUH6AP4P+N3/iN9/+X9/72GZSHXLzqytN/1rTUta/ZluMJWsd9bP6cn7LNOb72Mfq1tbeUx/aSTpSvGdukvj/QP/Xx0Gd81nPewL0nAwDITt3QsDc8cKgHnPD1QtlMhrapdTG3bl4tWauudne0tlvz5/qQbQjcBfMZAOBmSZS0FwDIIIB2tG2fO/2bxOMYHhgeGB4YHtADSwDhtpcvBQIEnBkIyCfj+XTcYAALSkAtQQAWlgBgkotM5K0EYBZEGxDIQIAAuQYC3KUg2G/RBM+MKYG/Y0vwPwf6Bf72tQY3ctwA/Xzyjx8od6z4CnuOSd/W3Q2eB4B/Bmvg8xze9vlcx+994BpR1710ua45yW9MAk7XhaeirjelrkNZmwL+AfZs7wfoE9BK8M8DLsE/uoJ/bWUfHUeLOraprOWDlmyjHduw39kHyyqlf1W/6mSetsgntf0O9dy1+t6STWb2Y4fnQC+Pms+ytfxD7IT5qCd/5Geyk+Xhj3v4FfhibeWhNzxwSg84oZPC17SZZNuUF2WLZzIjb92AUl97O1rb6+XPRWNtwxtJDQAA+o2WEkH1hsqN0iBBKwDgDcz+Rl+zX5P4rhsEsnEMDwwPDA/cSg9UQDDyDzY/AJcgsgJMnzYLnAXY+aRc4Cpwdmu8T8fr03CBcVKDBOgKkDMQAFA2IABgTtBsEKBF7W8F/eYtdzyOAfuOA6BOcjw+5TeQQXAjgx2Oiy3+gn50qVef+NMO/rPv9Ie+JeivwD/P15jT5+d0+uPYmx5rrWc/9wnPe8lLHveyP/cJv/s1pK974Ye/Wf6pH/G4lwOaWJsd28ZCPdZ2HLnGS34zlZ1Lrg971LVwrzzluZZlHcu61C3/APwK/nmoVcE/9Vy7ai/bkO+Nw/5G+ez41cMu7dpn1tdzfaEd9F2vJ7X/9rVHbXuGZt/n+MnE/pzDc6A/juGBW+UBJ33SvHA2kzf2qXVhegNplaUs7Ux8trHEHxUAOJsOt0dxc+oFALxpeRNyPNHf7N8k3h/IxzE8MDwwPHCrPZBgYPB9oJSAUn4uEJDBAIFrBgEE0QBokuAZAOwTckAyTxABDzxFhJKQUQagJhAgaK7BAOxmEEAQLbVfUoF1PvFHZjn1st8+6Rf0A9zpj/0H2Av0pX7UrwYzGIP9r/2mfYMQAn+DLnkOPC9Jx5zuz2l8c+DNb/PRH/3Uzwfov+Ev/K6zn/7Kx579w//hobsSZZn+7vOefEZggLpTe5sD21Q912wtPtd6ydPeuZRr22N51poCY4E07/vzXj/gH7Dv9Vrf+U/AnWtXbS71yXZZ/8LX8c3ltU1dAhass/0lAsbR6o/9og46rsldl7sOR0/7LTrTrzxfPX6qvgf66HgkPyezbNDhgWvrgdZkZzC9i2Yzle1T66JckmX9ie+105MfHQDgppQ3G/hM3HS88eRNy/Hs+t3q11Q0juGB4YHhgeGBAZDmAVL1T4JL+QSh8IJTqIEAQTVgthcIqIAaMA3INxBAECC3E8MbDAB094IBCagB8LafVJAv0D4E+LeCFvQrUwL/2le3+Wc/6ZvAH9/NAX987rmQ1vM28u15vvYOyLrqtV/wmC2wb4H+KssAQOUJIFzgFwGyy6zvOFrrvJRtJp0LJdeVUAEx607WoAJpwD9P/wH/JAIBfAOA1wFYz7qrNdetuXbVbrZVefRdF0PJo9MbX61v3n7TL/pHon8ZnLA/UMdKm4wXXRN5+2Id20na6+Mkz3PV4ieVvQ48B3p51HyWLfHZ5mZSbqXUWbI3yocHLtUDTnYnJY3JV7qZys6lvCh7fK0z5atd81PR/mJUJt1MZXcFAbiZeEPhRsTNwxsLiwZ2AHAjRVajjepSL2+k9cZDu1OyH9BxDA8MDwwPDA+EBwYwagOjJb8INJPWQEArGGBAQKAt8Abw9p6utwC2gQA/LMbTxtxOTzCAJ/I+VffVAEG2OwNo05QBAfm5Pvm0n6f5tE0fDFJA3a3g036Af+5WqH2irSXgP7fVn3OxdN5G+fn5HreCWdan/hXoL+Ur+M88AQV2BhwYDOit5ZTnmq/ym2mQF0qul1lvunYFAAP+AdF88R/QD2UN65f+Bcm5ZnUd7Nq1UtuS2ia2eHIPxZ7lh1DaZm1NAIB+GqjAbgYB0LNfrtkpB/xT19QKHrT60/B/PUeZn9T3a3h4Dso9kld2CLWtLUbJcXpucvyMZzK+2SXrHtLe0B0euBQPeCE4KSvdTK12kxNb2tCt9mp+qrK/ULNs26Y3gnqBcfPyJloDANyQuNFkEvxDreuFqm3b2o0h+yJvX6HjGB4YHhgeuLUeGIDoPCBa4w+BZtIMBMDXYEDdFeD76+4MWPPEHUBvMKCCbgIBGQzIVwRqICCBNwEBE0EBAwPylLkzwfbdmUAfCNhnMII+ZDDC1xSyD7U9gw1zT/yXgL/nYs35GzofmPNrbnzHgv+54EAGAuDR5XsCU39Yp6091G1R13sXoZupI/vk2hIqGAaEC4bdAQAFGAvSWcOyZnWtWqlr1yVKPWxh2yf2rIOpl31b4tHXFn0kAMBuBZJ2XWPXvrped8zUpQ5jdryO1fFkf9KfO751fqaiPZ6A5/Ac38m1/67RsabtbvSHYyMglcnzRzn+QH8yspmSNrQ56PDAPfVATnh5J2WLbqbeHZqwQ52WvUm8vzAp50i9zZQ/aAcA70uxA4CFhVFFgwDcWExcjF6QXpRcmN5saHdK2ZcpO47hgeGB4YHhAT0wwNAHwNCxvhB81iBAKxAwtyvAYEDdFVCfwvvOvUA8XxEwEJBAXBCeT9/dGeDH+wD5NfldAoG/7/b32iMQkLsQaM92DDoYWMin/QP4X3wOHjt3vQ/0KE/o54D8sWUGAKz/zm95zNl/+KkPPnvPD33QGR8X7PXnAHlrPZrrwUP5zdT2/kkxa07WoqxNAb4kn4YTFCBRVtepFVCbF4RCW8n2WBMDutlhAOimjVz3uv6Vtmwhq/Z4ZYE199oggOMG/NMfAwH4wHU7Y699w4cl9c7DpLY9PI9kevwdzcP+YmsP/jmXgP4nfuYXflEvUY5ejmvXp+zXYb0Y2sMDF/RATj55aC9tprK1qWdjMrG/GG1TWdbZtlNvRt70vDkK6rlpGgAgCMDNxJssNxySutaFYs8bnW1NnaHt7Iv9lE7F4xgeGB4YHri9HjgWOIx6fdDWCgQoW7MzwECAuwJ8Qp6BgATnbsUHmLsN30AAoJyFvcA8gwEGBAD4rUS5tnPHgbah2m/tOEjQL+B3i38L9LMrIndKpK/0X9IxB/tzcK1v5u58fMXfp/MC9VNTPiQI6Bf8w5P++td/2Ktm+lbXcOYPoegems4FAFiPCvYF/K5TXZ+61p2jAvKq45oWOfawDejPbwsgo1zdtVSb9FubvrKDfWSUCXizb/TFdbk7CPLVB+r2ggCTzzcl1XMwFW8Pz6X5Hl2rV+s/BFZgXIzlHPj//G/6m0+saRcY4JrA5/gAX09GN1M6tg+1TyM/PHC0B5yESeHn0mYqb6W5OrVsMrE9kHNk+WbKH7UDgAAAUUVvNFx08CZvsNC8Aa4IANDHcQwPDA8MD9x6D6wFCkPvOLCVgLXyCXAFvvlqgIGANTsCAOs+oW+9jw9Qd2s+YN338gkIUM+65EmU+6S/BhUE/rSDDnUNJtQP+hm8cAwENRiXqYL+utUfH1W/kWc+SsfcPG5u4rfeDZB11jHg/1Wf/LgzkoECbSiTAvx56l/B/2te82Hfy6sAtN/rW8hdc4boLrbq1PxdFXYC9aCZtutZAbTrUanrUdek0LUp61ofkAlPmU//eVrPgzLWx4D01DUAUNtULtUm62pAPADe13mwTZ4HcEtBAMrRYydADQJgN8Eya/PJl5uS0rfyk8qlgmra2T79x68J/h/4Zz/xzx74z//5t7cJfpf2AYEpEOBOAHy4GxP2xjE8cGU84IT0gqp0M/W0ymp+ToeBos8hlU87m0m4OgDAzYKbG+CfA54bDHKTN1ooF2/eNLm5rQgAZH/p8ziGB4YHhgdupQcGeDoePM35roJT8q1kEMAAALQVBJjbDcCTdrba5xN7QDwAnUW9AJ4gQE1Zlnw+5ZfPp/0ECAT+bvPn3X6/IVCf9Cfwd3w5Zv2QtOWvOZ+PssPncu+mx3v/gvi1lI/6CewB97/z4489O3vrA1ugj9zkdv986v+mv/chZwCqXn9WynNtl3yveurIS6kjDyWd2wHAepM+J6iWX0Opa2Id21rTUk4Z618ANd/G4jrlul4KAGjTNlqUNgksAOBZb2ObBI/9BPG1vvZZo6OHPv0jEQxgJ0DWxyeNIIC+labfK0/+FMf2XNIfxr8NAExP/PfA3wBAi04BAV4RoA7jx8bUoc2UsDmO4YF77gEn3hylbC5tduXSnu6ktrcDn0e2b/3NpHBQAIDtR3fg/9n2o0bcQLhI1wYAGjcZ+2L/ss+DHx4YHhgeuLUeGKDpcNB0UZ8lsE3AKyAWIPuUHPBsAIAn6YDrfB2AAEC+ElADATylJ60JCADyE/ALNqifoN+P+rnNv27xt8+MwfFAHSM0x558+kf+oj4f9dvzvHXj471/n9wfAv7f+r0fvAX8gP5MAP2a3OoP/ZEf3rxx6se9WJ+tbaPqkSdtSIJYHzZJXXtCMwGcybcoMoE061wS+QTb5AHZAGqAOdco12UGAFJf3nVzy6Y62Da4AGjn6T+2oQD5uVcBtIF9gwB1J4DfBLAP+khfTlTfJp3ElzoftueS/tMvtvWvAv8GBKYgwAgAcIrGcdU9wETnSJoX2qF8tZV5eI+0uzoAwMXITcgAAJSbUO4CQMfEzStvlt50vUFPndlMKfsibz8HHR4YHhgeuLUeGMCoDYwuwy+AWewKaqEJfBMcC5pbQQC31beCABkI8ON9vMfvu/x1uz+gviZfA1CXum7xn3va3wL9OaZDQb/+uoxzMWzemff1xud7/2sDAGzp//JPfczZD7/qQ7agP5/qA+7ZBZBgv/IEDaY+bGo/rlDeNaOUvsJD98kggNS1aI8KngXggHDXubmmFaRSBrgGmLsThzz1tJVUu9pkzZzl8uhRhh5gnwdwtEGCX9oFkHawwQM7gwCs5amfQQD0SxBAv0ont176sT1/9IWxbwMAbPUX4C/Qzg6AS+/0aGB4YI0HmNwcLepFdgittrS7bST+KK+2DwoAcBPKAEAGAbhYM3HzypulN9uZAEB0d7DDA8MDwwO32wMDCN27AIDgX7omAEAggCCA4NodAO4CyCCAP9nHU3l3BRAQMAHeSa0P/rVkgn3q+6S/tc2fvuWT/gT9GeBIPoMgLd55OYIAlzs/8+4HIAL4HwL+v/ZzH3vG9v0K/CvQ7+V5kpp9uKJ8b22LfGMS/Etdj7Yovk6QDnDO7fKUm1jz+v6/AQAoa2UCALkGzjoCcuzCt/SQ2Q9fBeChGzsNCAC4lZ/69KPacGw5HuwA+gH/JvLaQDfW6BUvpK+ZDubhT3Vszxt9Z0zbVwD4yB+vAeze+e8GA8YrAKc6B8POPfSAF1GLIjsk2e1qC3nKtHlQAICbBxHOGgTghsdNhBueQQBvXt70vBnFzWWz65N9yf7R33EMDwwPDA/cWg8ItAa9XKCV/q2AN4Gx4NkdAAYAekGADAQYDPCn9qSA9qWUAF9d6+d7/bRHEMKARAv453jk65hb+fTR4O/NfMwbH+/9LwUAeM+fp/4k+F96/Qef/dbbH+w+5WcHQG8XAB/7y/avGO9a0W6Zz7Wk/GZS2ibBv9Q1aVLXq6xjAcWsawHzrQAAa1z0KHOLPutjADr1KKugHPuskwXi2Iavuq6fbYM62AS0+x6/AYDatxyPfI6L9qhD2+wIwG7aoE6s0/WjVJ9fFqWd7UcA8UkGAM4FAQwGBN1+DHAKFuArxrsbA/bGMTxw3z2QE1F+jlKW5T2egVlWefJ5aFO6mQq3QYB6o6g3IC5GLixuPjUAQN4bH+XcTLgA8+an/bix0Lb9yP5P4nEMDwwPDA/cbg8MoHVvgFb1cwXAAmWoQQCogQCAdgYBAOB+WT93Bfh6gNR386GHJOsL+CvoF/hnX3MMdXy9fPoFHfPJKxv09HPVux8gaA78b4H/ix5zxhN/wP/rvuLBM7bvm/IJv6Df7wBkmfzuvX+bv07UdWSuK+E3JIF/UtelUtetAnQANyCZPOvfXNPCI2O9CxgH+PMBQNbAGQDItXTW0Ta62k5d+4KM9bcBCfpDXQA8da2PDnUcS4tSri3HSH34HCN1A0CnP5kP+hn+1Ef7JwB3P/233wVQgT/l41cATn0uhr374AEvrqQ9nu5ZNsdnGfqmzcTvb4zeMLhJ1JsPNw0SNws+RNQ72A3AjUobUm3PBADsE30dx/DA8MDwwK32wABVpwdVa3wqwE1gnAC6FwjIHQGtoIBP5qUZJFjiDSpYV2o7gn76IPDPPudYWvwavwydezsf8+ZnEKD34T8CBGz3B8QD7gX6UgF/0t7TfwBntn2F+dba13Vk0s00hm1K8A/vuhTqmhcwzjoXUE8yACDAdk1bwTwBABJ1CAqgL6DXtnWwD4hHt+4CQEd9KTLssbbGNvUNAJBHnm3luHLMyu0H9QT/UPKOE93Jb+lH/S2dik9+nAsA8A0AgL0/9dcNAKCzCwAwtl3fN1PvLrOvJx/8MHh7PODErBQPVNlSPutUPvNpB35D8gbhzSFvcN54uCmQuDn2dgEQFOCmlDcibGnXdmx3ovTBNLHjGB4YHhgeGB7AAwNw3VvAVf3dAsoJquUF3FJ3BiRNoH4KPm3brtR+QVtjQMZYpTnulizLB3/v5mS9CxIEaAUA/Hk/AP3ZLz947iv/FfCbr+Cf1wXYMcCvDNR2r2G+rnPvWuu6FnVtCmWtyhoXQA3o5z17n+YLsF0bQ10boy+YN2AgkHYtnJQyADy2M2DgLgBtZx15+kd9gwDYIQ94pww96ju+OWo7ruuxQx/sBz6h/nT+N1Nyna5vnRY1r/xYug8A0I8t+N8FAFrgH5lb/9GljuPf9fnYfox6wwP3xQO9C0q51M7VvPIeRd+0mfjFAAA3FW4SJm423LjqLgBuft48vBFxMXqT9WZEm7tkP5JOReMYHhgeGB643R4YYOvega05XwOKWymBdvIC8R71KX2LtmQ9O8qzbflWf3tjRLdXNuT3bw627n6spf7u8558ZiCAJ//nAgDlZ/4A/NvAQMgr+Af4s3vgGoN/1o8e8rmmhN+YXIdCXZsKhlnbAv4F5wYAXNeiZ2KNixwwzoMv1r8kQTnlroPlrYM+ttkxaxsAcNbY6tpOUusbBEjQTl10HVOOs/L4wvFTx7U94yHZJjo7v+nPKbvFD9DLOB6i/4zT9/+3wL/19f98DWAC//qPvu/67Vy4jH4Om8MDJ/NAnajmK7XBllxZ1al59DJ1AwBcSN6MvEFIuVES9SQQQKSUG5o3Set4E6k3pKn9zS5lPybROIYHhgeGB4YH8MAAX/cPfPV83wLWyhJ8yycFsJtv8coqsFdu3R61H5UyFmSOKXllg169uTZzF3yIjwISBCAAIH3ntzzmLrDvE38DATcQ/M+46fw6d1LckBIMuzZlrcr6FfAOiAeYs7ZljevTddezUta5rIcppx5rYCgBAeSUo+t6WEo76LJufs97/v32o4H5moF6tlOp5bSBLRK8eowpxxggfjt+/ZC+oI71obSRdibde7VWf4h2aX8xABBBAXcK6IfdGOnzOIYHro0HlibsUvnagebFvJkq7W+KXHwkbwbebKBcXJm48RB1M/KWutaHatObEu1NKfswZfd5+HEMDwwPDA/cag8MUHb1QFk9JxVsL+UF7+jJV7qmbKmd2s+Rv/pzqZ6jpZsfT+zdCZBBAL4DUJ/61wAAW/556v/Dr/qQs2c/9wnPW2rrmpS7Ps61pfxmGsM2uQ6FutZl7ZoPtXwyD1BnfUt5rmnlWQNTz10A0BowsK7rY+pglwADAQDaykCD+raR1P4iQ4/1uHaRddba+7HrgxbVH9UG8klfP0on0fYgf8rjrl8A6O4AGAGAU/p92LrHHli6cLJ8DU/3Uy+Hoxxa+c0k6wYAvNF4s8kAQPLehKTetLyZQL3x0t6U7It0Eo1jeGB4YHhgeAAPVEAw8tcDxAHOOVdLIP2U5baXc8R+pGzw12MOcZ7W3AX5SFq+EmAggNcCDAQYDPDpv1v+2UXAumxNO9dYx/XlZhrDNrkOFfCyVgXk8/TebfmAcnYC1Kf5rmulrIGpaxAA2goYuC6GEgCgLQIA/HpWtkUZOtpPmmtp5ORreY7N8XaofpHiG/gtFkiqfEcnsscQ8Kc+9gEAPwC4KgCw+xUAzgc+mTq1mRLjGcfwwPBA8YAX/faCn8ruCgDkzSVvXgn65bNc3huTNy1vTLS1S9kHL1TppDKO4YHhgeGB2+uBAdauD1i76LkSrBsUwF7KtK/M/KA3d44ccudjLfbUj3jcy9kVwE8BGgjgKX8mnvijswNJhzRxnXTr2pL8xuRa1AAAvgO4sw0fUA4g97XWCuZdz7q+Zb0LaCcJ/rFneVLXxjUAwC4AvwNgAADdrGu70Np/y1IOP4235YdDZfit1plEl3aMAMCluXYYvu4e4EK8yGH9ekFvJqN3BQHyBuTNaw3NevXmRDu7VPswiccxPDA8MDwwPIAHBri7ueDOc7sW0Fe9mtfeoDdnzlzkLsgajCeoD3/cw68A8BMcID/Z3FzE7jWrm2tMxr1f4wr+8VN9+t9799+1rNR1LqAd0C+t4F09KGXosgPAbwAQAMiAQw0g2B60gvzMM76Scvyn4qcm9gc2T31sAwD4yR0AfOV/uwuAj/7Ftv8tH78CwHnEd/hp6tRmSpfRv1OPd9gbHrinHvCiyBvCZurB/uaYN5x681oKAKR+2vFGRTu7lO1nn6bicQwPDA8MD9xuDwwwd3PA3DiX41weOgdu993v6NHnWjLXmJvJ4rk1LmtVACNP7nkHHxAO+PdpfD79z7WsvGtd18TYgkeuDlQ9KXq8WkA7gP+5AEDacQ0NZSwl5VgP4Scze6CcvkPOkbbuSC737107AM4FADIIsPsVAH8GkI8GlgDA5fZ0WB8euGQPeEH2mlkqz3qpmxc1/IaUN5i88XjjgnqzqzR14LN+2rWtiWYfpuw4hgeGB4YHhgf0wKGAYegPkDnmwM2ZA94HBj3KA7m+3K9xJ0vbda7AnKf2PI3nfX8CAKT8In9dy1KP9Wyub+fWvuqljkEHf23g13713Xf9EkBtN9fQ8Ixjl+o4W/lJtQvyUz/1Km9effKXcSzvADAI0AgAgEvw+dSxzWV0btgcHrjuHuAC5vBClm4m2T4I4I0Lmjcv+CXw37t5YX+XbLPSqXh/o4Ifx/DA8MDwwK30wABzNwfMjXM5zuWhc+BW3vROM2jWlRy5vtxM+W0SwLOO5Sk/X+QHjPNEnp0APJ0nMEB5rmUrCNdOrpXlW2Wuo7HrrgO+N0CibQIPbmPPdrGZbTuOieb4evykdteaWv9QlkfKk0+dy+bv2gHQ/QjgCABc9rkY9m+wB+oNYzONdR8AqDcwb15rqDfBA25cN9jNY2jDA8MDwwOHe+BQwDD0B8gcc+DmzIHD7xijRnigub6dyvc7ANyKTwAA4E9iN0Br638C8MrXdW6W51oYnvVzBh7yo4O9nQdpj/7vUo5vEt0F8pFxJJBv8cqkd2qd/ztXdl7z4rm7AwD1vf+anwIBT/zML/wiXgHAt/h56sbm4l0ZFoYHbqYHvKChps3EdwMA3ryWAgD1hnfAzcs+3UyPj1ENDwwPDA8c4IEB5m4OmBvncpzLQ+fAAbeKofoBD7iOdF0r3Uwq+/Ut61gDAIB+wDeBAJ7MI6ectWyuX+Wxk0l5j9Y1MbZ99YAn/wQB2IFA+3UHQNrMNifecTneSbQH+ylDfujRq9+TH2p/Tv/uAIBb/ivwN98OANyLvs6NY5QND1w5D+RFIQ81bSZ+f5Pk5tO6efWCAFW3c/OyraRXzlGjQ8MDwwPDA/fTA4cChqE/QOaYAzdnDtzPe88NaTvXmPD7p/8+hWe7PwEAEuAfYH4I+MdmJta85nP9m2tj7BNkoE12HdQAAH1r9UG7E63jIr90pE7yh9Rb0j1F+akCAJtTdGbYGB64aR7Iix8+02bKb1Pv5lVvZJmvfNrQ7kSzPftS6aQ2juGB4YHhgdvrgQHmbg6YG+dynMtD58DtvfNdeOSuMTEkDz0XAADwkwDi+d4/69hcu8JTt6S0W/m9brXjGhmQT9vsPODpP4GA3AFQ+zDT9lTUPOjT0pE6yVOv5pdsnar88ADAtBOg8QrA/er/qfww7AwPXKoHvECgmTZT/twuAG5i3rikRijNV5o3PuxFyrbkp+JxDA8MDwwPDA/ogUMBw9AfIHPMgZszB7wPDLraA6wn83B9Kb0rAADwZ9u9H/1jHTuzdt1MxrW1RNHdprTnWtodCAQffP3AvlCW/dDOjrbanYq2B2XX/XiIsbNDgnf6AfbnfgbQbf/Q+Y8A3gRfXPdzOfp/BT2QF0brZrKZ+rxNrRsXF+dSqvW0N9Ha3iTaRxqzX8jHMTwwPDA8cGs9MMDczQFz41yOc3noHLi1N76LD9y1ZF1vbgMAbsEH9AP+fe+edS1r16n5TSdVe0v5vZ1cE9OOfSAAwJN/EnwrEFH6km1ORTfq2I4NXxEEaQYAdqD/HPj//G/6m7kDYHcOsTWO4YHhgY4HvEDyhiK/mepsU9644OfAf9XdXYh7W5NN7SedxOMYHhgeGB4YHkgPHAoYhv4AmWMO3Jw5kPeCwR/kAdaXHEm3a07WpIBLEk+ZSQtP3Dc7O7lmTbvNdqIO9bcp18eso2mX4IOvILgTgeCAutbd0bk+TCo34nhI32QA4NwugAgCIN/uEph2Cvj9hh3u8BzdCKeMQQwPXIYHvEjqjYX8xuTNqEW5WFvy3UW4tzHZarUxifdyeeg4hgeGB4YHbrUHBpi7OWBunMtxLg+dA7f65nfc4F3PUls+1537VwAE/77KunK9mra0nz1VVvU2k9I+0RbrZtoG9PMtALf/069On6pN28r2bwL/EP4hOAKgB9xvn/bn1v/Y/k+ZAQB9tzuXN9U/N+EcjzFcAQ94gSSFz7SZ8tvERVXTHPjfXYT7+pOdtJv8VDSO4YHhgeGB4YH0wKGAYegPkDnmwM2ZA3kvGPxRHmCdyeF6c/uBOdatpHzyP+lsQk/9SieVfWABnsM27uQ+0Fatu5kU9on1MUAf0GoQAEredXXoV1u2KZ1Ub8yxLgCQAYEpCPBRT/7IzxwBgBszB8ZALtEDrZtG6waDbJOpBgB6+ayz41v2p6L9zbPVJ8rHMTwwPDA8cCs9MMDczQFz41yOc3noHLiVN73TDTrXlNv1Z65XBdnIpiZb69Mqo2falGZvUyYPrWkzyfY7EXwNgKfdAFjyBAZ2/UK31k/bU/GNO7YBgAyONHcAlAAArwsYPJk8spmSfrpxDhoDGh44lQe8SJLCZ9pM+X3Km2iLT90dn7YqP6mMY3hgeGB4YHigeuBQwDD0B8gcc+DmzIF6Pxj5gz3AepPj3LrTdesk39SyRn4S7cGk9pBx1Pwd6Z2/59rc6absrg8SAnoL+N806mF9rl3Kr/PB2PY/Bbj9DsD0nv8DCfiT370CkB9PpP6UbrKPpuGNY3jgtB7Im1PlN1NTx6Rqxzw9h+eo9I50/B0eGB4YHrjFHhhg7uaAuXEux7k8dA7c4lvfRYbuelIbrjmlm6mAZL7Sqai5JkVv6VCnRWs75LdAF9Dvk393JkxlLX3ar7aR3aRj7xd8wlN9tvf7nn+L+vQ/gif67ib5ZYxleOCkHqg3ksx7ASXdTK0fkqiLftpIfioax/DA8MDwwPBAywOHAoahP0DmmAM3Zw607glDdrAHWHNy5Nqz8pbPUco8tGl+jtoWOvJ7ym4EQH8+/Uc26W6K/pTd14e/qcfWN/qFIABP9/e/CDB9FDCDAAn+8ePklM2UsDGO4YHhgQM94IWzv0FN9Su/mWRzqepnfqq6vziRc0jv5Mbf4YHhgeGB4YEHBpi7OWBunMtxLg+dA+MWeCEP1HVlrkPlbaDqKr8IrTazTXno/nsA8fR/g3xKqTdl7zoov4nHOb+4E8BAAKBf4M8OAYIn4Tt9dhP9MsY0PHByD3gTaVEvpkPoZurhnD4DqG0hG8fwwPDA8MDwwM4DhwKGoT9A5pgDN2cOjBvhyT1Q153maUhemjI7kmXK1tCsJw8lbUh+l2D39N8y6aSyPchzSO/kbt5fx70PjrhDgmCASeBfnvzfdN/cvLM9RnTlPOAFSMfkK93syiqteuQ5ksrfKRl/hweGB4YHhgfOeWCAuZsD5sa5HOfy0Dlw7mYwMsd4INeZ8tJj7B1aJ9uSb9HNZNhEuWlit4d1zN8Wqh+gG1IJlGxlkzz1puw4hgeGBw7xgDeYFs2L6yI8/dF+8ik7pM9Dd3hgeGB44MZ64FDAMPQHyBxz4ObMgRt7Y7t/A+utNVvylmxtz5fqZjl8K9FW6rXyyG7L0fJR9c9t8cUY5/DApXkgLyr5pPBrE53MupmHH8fwwPDA8MDwQMMDA8zdHDA3zuU4l4fOgcYtYYhO5wHXpWmxJcvyY/g5m1kGb6KdLKvtzpVV3ZEfHhgeGB5Y5YG8scgnrTz5VqIx5fJQD+2YH3R4YHhgeGB4IDxwKGAY+gNkjjlwc+ZA3AoGe3M8UNe+S3lHXvWUDzo8MDwwPHDpHvAGBE2ehpfydk69Xl75oMMDwwPDA7faAwPM3RwwN87lOJeHzoFbffO7eYNfWvtSvqRz87wyRjQ8MDxwZTyQNyB5qZ00v0R7+soHHR4YHhgeGB7oeOBQwDD0B8gcc+DmzIHObWGIhweGB4YHhgeGB+6ZByrYX9OwdVq6c2Ut/SEbHhgeGB64VR4YYO7mgLlxLse5PHQO3Kqb3e0cbGsd3JLdTu+MUQ8PDA9cSQ94k1qidF6dKzmQ0anhgeGB4YGr6IFDAcPQHyBzzIGbMweu4j1p9Gl4YHhgeGB44PZ4IAF88rfHA2OkwwPDA8MD99gDA8zdHDA3zuU4l4fOgXt8uxnNDQ8MDwwPDA8MD4yn9mMODA8MDwwP3E8PHAoYhv4AmWMO3Jw5cD/vPaPt4YFL9sB4mHjJDh7mhwfulQfqxVzz9KMlu1f9G+0MDwwPDA8MDwwPDA8MDwwPDA8MD9xbD7j+l9K6fI/e2x6O1oYHhgdWe8CLdnWFoTg8MDwwPDA8MDwwPDA8MDwwPDA8cKM8ICZYQ9Ex4YRenRvloDGY4YHhgeGB4YHhgeGB4YHhgeGB4YHjPCBgoLa8NGXHWR+1hgeGB3oe8DqrNPVrWebhlxK2rJN2Bz88MDwwPDA8MDwwPDA8MDwwPDA8cMM9kEAg+dawa3nNt+oM2fDA8MBhHqjXFflD0mbSN/XqTSp7m/LQcQwPnNQDmz/yR/7Ix33Ukz/yM0kf/dFP/fyHP+7hVzz9mU9/7Wd81nPeYHrBC5/3k5mQo3PSngxjwwPDA8MDwwNX3gNPe9rTPumrvuqrvvrKd3R0cHjgZnpAECKdG+Uanbn6o2x44DZ7wOsnKbwJ38j36GbS2aff83t+z/8184VPG1PR1jaUg7JxDA8c54H/9v/x3/6Rp37E417+J/7oH/jRT3/2s88++RnP2KaP/chnP5rpS5/+Ze9/5JFHzjI9/PDD2zx1lGPjuJ6MWsMDwwPDA8MD19ED/B85mw6Cx9ex/6PPwwNX2AN1kW++0hzCXFlLL2UX5W37onZG/eGBq+4B53pS+EybKd9MAH/Sk570pD8g3wkGpD35yew4hgcO88BDPNnnaf1nP/z4dwDcE+jDA+xb6WP+8MecmZ7y5KeckchjI4MABBMO69LQHh4YHhgeGB64xh54iADAT7zpTW+5xmMYXR8euKoeYNHPIb2TO//XMqml5iu1/BhabZmvtnryqjfywwPXxQPO6RZFZtpM/D4lwJcH+JOe/OT/20fJWyZNGxOv7dr2VDSO4YGGB5hcbOP3Kf8c4BfgQwX5S5RggTsH3AkwXgdonIghGh64vh54iHsIT3qv7xBGzy/TA+94xy/+EkGA5z//+Z93me0M28MDt8gDLvRzyD0QoFzdVl3LjqXH2sx6yR/bD+tpq1LKlak76PDAqT3AHGulzSTfJoE8VJBfaQYAsizram+i2d6UHfMcJ4yjeIBJJegHoAv8fbqfYP8QwN8KCLgLIHcCPPKJj3xD6dLIDg8MD1xDDwD+v+1VX3j2V7/yOf9uBAGu4Qm8B13+2Z/92XcSACAQcA+aG00MD9xkDyR4la8Lf8ZvWfoi9SyXztXRRur29NWt5datdEkv7bV47VlW88qhWdbiU5b1Bt/2wPDXB/yiL6CVJ78xJXhPUA8PNsvEmoqUsqyjLW1P1PazD5N4HDfGA0yGCw5mw5P4533ax2y39J8C8BsoaNFWEICPCF5wDKP68MDwwH30wFf/lc9//ff8/Vecve7vvnybXvMdLzl70Ys+/W9PXfKfz33s3Wj6inhg8573/Pv3EwDgeNaznvWcK9Kv0Y3hgevqgby/Js94evmUJ68PUpb82nL1KtWWNMtbsixf4rN+i1cGlcdmj7e9LFfWq5e6yWe968rneHq8Y8tyZbeV4otMmym/TQL2BPFzwJ9v5xgEWAoE2MZEs+0puz3G+dET15kC3D/nuc89I33qFz3zXTxNB0wfGhSgjmC99eS+JUt9eWlLXxk6NQjAjoA/+OQnPf06n4vR9+GBW+qBDU/8f+QfvvKMZABAyo6AcW3f0plRhs2i5Q70v/P3da977T8qKiM7PDA8sOwBF/BJezzWKLM8radMXtrSo6xV3tJtyWpd7aVcvtKWPWTqJY+sJ0ePQx31ktYy9aXqmod6tMqUSdW937TXn5Qnf7/7e13a12dQ02bit2kJ+CfIhwf4k1hHyUPVyx0B8AQRbGPXpn2wX5N4HNfeA5/0uZ/4RsA/X9X36/y+X/+kJ3zoN68dILoC9KQC+h5N3crP1RlBgLVnZugND1xpD2zB/w//wP+8Bf+9IAC7AXg94EqPZHTu0j3wJV/yJX8hAwC/8Ru/8X4WKpfe8GhgeOBmeMCFvKNxQd+iVUadOZk2perWPHLLepQ6liVvXWmrDFnrSHutcmXqtajttsqorzx561SZeeuknmXQ1mGdVtllyLK95G1LmVR5pVku36PUtazauS15xm/aTPxGYA71yX8CeEF9An/APj+hSwCgBgEyEEAdAwAGAWhzl+yH50Q6FY/j2nmAk/3iL37xr7sDwACAH9v74Vd9yBkBgmlgm6XB8RN/AvgecK9y9Kus5rXZoui2dgIs9XWUDw8MD1wJDzzEk//v+67/6Rz4r0EAXwsYQYArcc7uayd+5A1v+NEMAMB/1Vd91Vff106NxocHro8HXLS7mKfn8lmmvFJ1Up685T26RhedPNIW/FyiXpabh+aRNpHP5Xv2Ui6vLfPQlMlLe+VL8q3RS/5jH+aaWdKxXOq452y2dHr1U75k87qUOyZops2U3wYABP5Qwb/AP5/wwwv6ofwyGyllVd8ggIEAAw60PaXsz5Qdx7XzACeW92198v+lT/+y95PI/4Ovecqj3/jipz76pr/3IWe//v996OyXXv/BW9nSO/aUt0B6TybQ75Urr3rklcnXIAAfJGSSX7sTMzo8PHCLPOA7/wL+FhX8Q0kjCHCLJkgZKgsRnvjXAMD4ScDiqJG9ah5wQU+/erx9XipX7xDqop062k9aefWltV5LXvuTNq3fqneInvXXUNu0X7Ud5Umrju2kLWWnoi3byrI/yVsO9bDc/GVQ25DahvlKLW/Rqlvz1lHeyyu/adRxQ0kbk0/+Bf7QCv7zaX8C/yd+5hd+EclAQC8Y0AoC2P5E7VP2cRKP48p7gHf8X/h5n7ff8s9T/69+8Z8+42n/f3zzA9v0H37qg7fA/63fe4cSBIDnaR1P+qdBeuL342XCCMwTvLObgDYA6cortV6lqWeZMvNQUg0CvPpbXn32ok9/xpfvOziY4YHhgSvjAT7uxzv+det/zRMUYIcAugYB4HcfB7wy4xkduXwP1O3/GQjgScjl92C0MDxwaR7INVWPP6RxbUipC3/RpJ2kyaf9Kq95+zZH094avraReXiPU7a5pl+H6tDPuT7WcZjPeim7CG8/0oayHs1+zOms1dOGfTDfo+pdJ+pY9Al502bizz39bwH/1hN/QX+LtgIB7ghYGQSgr+O46h7gCb1b/KEkAgE86f+dH3/sGaA/k0//Af4GAgwMfM1XPPZs99N7OWEfeMbH/18eBYhj95te+YIzPt5F4qndj3zXF5x9xzd9yvuQs9OAwIBgPmkCe+Tm1WnlkZEMAkh5wnjVz8vo3/DAbfMAgTlAfG/rf2sngEEA6pnG9X27Zk5r+79BgOc///mfd7u8MUZ7hT1wbl009dO8lK7L92jqwHuobz6pZVLK4E+Rqq3Mw+dh+0lP0Ye1NuhLtm3flmRr7d9PvdbYHJfjlPbklrdo1mnxSzJspo5tpAze/BJNe1VX2y2qbqvsqsvsO5S0Ifnk3+3/BAAE61K39gvs7wL9n/9Nf/MuWewKsD4UmwYBbJM+7Ppj36STeBxXxgNMgD/7gue/7TM+6zlv2H7dfwLmgG7AMenbX/HHHuXJPuD/PT/0QduUAQB4gwDowSP7rbc/uKUEBV719Y/ZfiOAj3MxYf7Msz54C/IB+//0h/5SM1FmIjjwN77mZdtgRAX2An5pLc88vEnwD/26L/zLZ0zgK3NSRkeGB265B7hPAOB5mp9P++WhP/gDf/NcmQEBygT/UnYlTS7d3HK33vjhs9gR7Lfo+A7AjZ8CV3GALH7zWMqrm3otHllPrg1oT0e5dg6hm53dVh3bzDJlUstqXvm9orafVJ4+JN/K36t+LrWT/ZRv0SUZ5XOHPlAn8/JJk6cOeVPNt3TVWaLWRY/D/BK9o319/zI+02bizwUA+H9oAKC13f8ukA/wb6Ud+E99XwswqJBBAAIAnSAAnvacwI/jfnqAkwjgbyXA/6/81GO2QF7wL61BAPKAfZ76k/w2AK8LEAyAokOQgIDAHPjvBQWQU49gAD/n1wP9yBP4q6ecMsaLDZLBjt+3+b3fdz/PxWh7eGB44IEH+IcicJ97+j8XBMhXArRFIJF/hsPHN9cDAPwW8FfG7oCbO/p7MrKxeDuNm/VjiyJLeY+nJ6lbe2a9qqe8RbW3lm6iD3N15vowV++QMvpish55+Uqnon0ZvAd6HtYhL7+Wbu5Rnbn+2G8puvI7djuuyqtXdaue5eq3KLIqt16PVv2lvHZabdW66HL05HdKr/5fxwrdkATePolnvQMwZ01lACBB/J4voP8Pv/SnfmpNIMCdAEcEAa6+d29DDzlxAOAMAJB/6Rf8d+/PJ/qAd8C/tAYCXvuNjz1ja/9Tfv+HbME39njS/+df9LhtQIBvBxAUwCZ0DuTPlf3cG77x7H/95685++nXfdYWuAvuBfzSOTk6rSAAfR5BgNsw68cYr6oH+IfFq0CA9gr+Bfw9OeXuApDWVwKwTdDzqo5/9OtCHnjoV9/97l8T7LfoO97xi780teDC70KN3ZLKPV+lvMfroixXdltoHXvmk8cf5ls0ZfCZrJuylr560qrfy2+mCpRBSeolr6zSSX2vX8tOkbcP0F6aa2eqtu1fUvm5enNlm53Nlk6WwZuXZh1llaKjLPXX8FPV7ngp48AOhzT5bKPKzadO5VMn+apX8+r2qPqUc5DnWKJ3tO7WU34VaY7JcW+mjnaf/oPzBOt70O9T/Qb4JwBgmgsEuAsA2wYBWMMZgIhdAPTPvkon0Tjuqwc4WQn+5fnC/8+//oO2W/rZ1u/WfoC/rwNAkfPEH+AP6KZ+BhQ+9iOf/ShJOd8U4GOCcyB/qYwAADrYEehXWgMBtZw8OvTVnQBQghj39YSMxocHbqkH+Kfxra9+xdt9Yt8C9AJ7qAGBJT10MxBAEGDp10pu6Sm41sN+5de/8m+1QH/Kfu1X3/3+3aLkWo/1mnTehardrXnlt4Hm2CtPXlnSKjcvxW/yUI6kWbaG3+zq93QpX0q9uqeW2w/syrdotkt55lv8pLLah9qT2peW3TUy7GhLmvXWyqwzmduPN3nLk2a5PJQDPY41NG1eFr/Ul+xn8ttBzIzD8rSfsqvI6+NzT//BdSSf/hsAALDvAwALwN8AQNJ9MMDgwURrEGC8CnAVp0m/TxuAr0/F4fmJP57S+1E/ntq7G6AGA3jCD/hPkG8QIan2ofyU4LGvAAD83QXAxwKf92l3QLz2e0BfwF/LqZdBAAIUT3rCh35z312jZHhgeODUHuAflE/+e0//Bf8C/xoE8JsAUvWl1DMQQFvjFwJOfRbvnz2CR//lvb+dWL/Jo8PC6P719Eq17OKYTslLU2ane2XKK23Vq3ato+5NonVsvbxy6P1Im6ndTPZBGXn5tVQbayg2bUOqrNZXDj02VZvmJ5Pn/F/ztKcufCtZvkSti17ymVe+li61eUj51K39WKnHcUj9e617TP+s06LIrupRfbuZOnrX03+AuAEAn/63AgAJ8OE/7bt+8VHT0779TWe1vBUE0D7rOAMA/J/l/7KvJdDHKdW+T6Jx3FcPcIL4Wj/AnKf5btcnAFCDAAYCfOefJ+YJ9AHTuQMgywTplLMAX3rSP1f+1p/5+9v6fE+ARDCAbxbw6gKJXxAgmEH7FfTXYAA66LKjwPqf/fDj38Gkvq8nZjQ+PHALPMA/Jd7PB/jz0b+6xT8BfOtpv7KkvSAAtrBPO9yDxi8E3IwJ9q3f+i3f2UT8DSGLlJsx6ns2ChZteWQ++ZZOliefujeZZ8wmxqkPlM1R9ed0Llq2mRo5OJVF/RZ8FDtz/Vpqj7rqVDvKu9S+QcNO1beNan8uX23UfNqkbK2trCdfba/Nz7V5TNk0jNlxrLV5VezYjzUUnat44HMOfb+Z+H0AoD79993/c+CfJ/i7HQAJ8AH+/+8f/Q/7ZCAAqp71tnS3E8BdAPxvzSDACABwmq7RQSAAEMw7/e4CaAUBCATwgUBeFUiQD28QoAYCDAAAzi+yA4DAwD//8VdvvwWAnX/y6j+z/8UA8ibkBAb8WUEAPj8vyEcE/ZlBgD8/R8hOBuq98y0/uLXrxwxHEOAaTd7R1WvnAZ7Ccy0CxgHmFfwL6g0CqIPcJNiHqie1zHxSbEUQwH+q186Ht73Dz3rWs57TwPldEfq33WfT+HO+J69r1srQV7fSlq2ejro3hTpOxiMPNfXkll8G3ezah96VBMzS1ElQbXlLFnWy/3e1FXpryrDV1Mu+qJP9Qmbe8gbNvs7xm0bdlLXqUt6SV1nqpc1Z3vFPbaiHXfikta2rlr8q/Z3ctr9Wk8dfrXzK7mjcu795DjdTs/sAAKA7t//7dP5cAGAG/P9//tVvvf9t/7/fOSPBExDIAACBgH0QoAQAaGshAEBfs+9TdhxXzQMPPf2ZT3+tuwHcCSD1lQAorwsA7FtBAIMBWUbAgDpzT/fXlP3E6//GmbsABPwXpf/2F37sjHdEf/1dbzv7hTd/z3Y3ADscrlsQgFcYnvzEzc+3EjsbxocOr9rldvv6wzv4PPUHgEMr8E+gnjxP7n1FoAYHzFeK7V4gAF3sEYRg69rtOxPXfsSLH/6rkYBbGABwAbt0slt6ypaottUjL1+puqmTslPztl/bS3ktO6QPaafFK0taefK9tJnKSJRLK1/roqdu8qm3B8eCZCl15ZP25FUHvTXJeuqSl2/ROX3L1tBiO33S4jdFfy5PfcqrHWXQmtSt8u450EaOVVnQtJv9oh3Lrhq1b9L72b/JTVfyqD7ZzxPAfy8AsH/3v/H0n63+AH3BP/8zeV2uFwTYBwAIJOyCAAYaagDAXQCTJze7VPt/JZ186ztFxIggALsBBP9JCQCQ98l+An3Bv7sBeNKOrj8FuAbkL+nwMUB2AlwU+FufoALgn/Se9/z7bSCA1woIAlwHcMAFCOinv/wCw1zi3N76CX4LHcA85qn7/QpqMe/c7g/wlk+QLy+QNw+Qp07uFqg66AL21YW2dLQptS/887qF0+LaDvl1r3vtP6oAfyl/CwMA9fyyAPNIvspaZehUufmkyWedKq9tmj8Fta1sv8ev0V3TJ+1Isz1lSeF7abMrg7ZS1qOcfEuvK0sAeUo++6FdZPKHUu1lPWUXsYu9nZ30ZYvfZHsr+bXnI9vbt5NjTZ62Mx9j2Ndd2T/1s/05Xn1o1UtZ6slX/Zq3fo9W/bV57aGf/Fz9SXV7tHQoQM4hrfy28BL+2B/b20zMdi60gH9z6398+M8t/W77T/Cf/0MJArgLIHcC7IMAuwAAgYAjgwCX4Kph8iQeMAjAdwES/PMLAeQJArClvxUE4JsCX/eFf3lbzusE//HND+wDAIDuJYC/VA74P/UuAGwaBHA3AK9EAKq5yE7i1Esw8tSPeNzLW8D/cz62HQggUHAJ3Rgmr7AHuJZ50m16wQuf95O88vPwxz38ChNP5tEDCJ9ivmODfwoEHQT7gG2BPGA+AXrygnOogN56fiug6puHqkvdNYEA9Okj47/Cp3F0beeB5z//+Z+XC5W1/C0IAOTC1PnSklkGnSt34SlNfeutpVm38q08Mg7t38kd/zftyEvTapXVPLopk19D0Uk985udHFp5ZT2aNno6e3kFkOa5X8vPUfUqrXUeaIDVqjOXz/rJZ52eHB3610uUU3eX9F+llp+KYj9tddvLMa7li+1sZ46vfTBPndrfOTtzZdqstLZhe0mTV7/aaeXVzX5py7JWPWUPTAd8HjWfZfeKt3/SfUDIuc6DHtZwJNZfrGl8Ui9wNwCQT/9bH9LNAEB+FFA72qUN2rJdv0XgPWLmertXfhvtHOOBP/FH/8CPshMAEC/wNxhAAACAbABAyhN/nvaT/OUAdEkEE376dZ914QAAAQK26vOrAD7FPwVlZ4Hgn50AvBpgEOAY/11mHS70tU/9644AggaX2bdh+2p54K9+5XP+neB/LaUOiWABrwURMKgJcE9CJxP1ANT5xF4wLjgHyAPwBe7wre366JuwB6+tDBQkj47twxs0SJ3KY5M6jPFqnb3Rm/QATzfWAv6qR920dYP51mI1ZcnjBvOHUHRT37y02k1dyjjWylJ3W7Hxp9qqeW0o14R5aZVbL2nlax1sHZI2k/6xyXZW109QmYv0lCevjiBDqo7l5uco4+yVH2JnyYZ9rNR6xd/6sNKtT6ljv63XsbPVV+dYqu1D6BFtOdbsszJoyi/Cp80W37Ldar9VVxk2WnVatpVZt0cnk+euYfIcqW8+KfxlHLTLke1vpnx3J4BP5QXqW1q+AcCT/d4OgNnvAFz86b/jYUzjOMQDPLVzUQ7PifZGd4idFboPAR55FQAAD/g3EECed/r9sj4BALb/u2MA8G8gAPo7P34nkPD6V3/8SQIAgHV2AZwC+KcNAgsGAaAEAfh+AYEAwAG+XuG3S1XhXf/WU/8K9Ht56u7+qV1qP4fx++8B5ivAdi3wP1aPNjIBvBPcA7gB2YJ4yrI8ecF56hMcIGUAoFWHugB++kJb0kOCAAQ17v+ZGz2oHuCeRWC2Avu1eZ5QVJu3PN9ahClrUWQ9Oa7MMnWllqeOMqll5DlqvsosT5q8+j2ZcvVaFBlH6t6R3PmL3IREfg3dTPrNlOCv6uz+dzfrVd3Mp01414xQy5JXJk19ecvuFe31z/4k9efIUmY/0y+F57xtaqJeS6a9SqvuoXnbq3Z7eexb59C27oG+18LmxG01z9XKNqxr31p0MrW/7i1Hdr8O+yDdTB1ZDADM7QLwNQCe9ucugFN8A8C5Sh93yX5LJ/E4DvIAW3XrV/Z93x7K79mf8inWH/1DH7r9Un6Cf18BAOxnAIAgAEGBH/jeB8/+3t/5wK8JECx4zw990Bm7CXi3vm7xB4BX2VKe9/Z/8ed/4AyaAP4UfH4UkCAA7bzzWx6zDW4QDCEYwO6Iex0M2G6tWfmufw/8Kx8fBDzosru2ygQI50A9ALlVXuW9vHKoCZAuiE8KYBfAw/cAPHUq+P/Jf/6DZyTqpw10qx3r2h9oBh7sU62nLXR3PxPIP6pxXAEPsIj/1Xe/+9fe95u/fkY69GBxw/3zCgzlMrqQ87TFp4z2e/mUy0NN1jV/KqrdSrWf8h7f0u3J0gY6mU/e+ur0ylKvx2+myllGvptaYK6xoO7W79nWRotyjSGXJq8Mmil1WjYvImMMa+pnf5LPrcjK017PR0tybKzt25KtVnn2sfLqV7l5y09FD7GLbqdd5/2mU36oHHuH1unp27ekk/n9tbrEWw697IM+ctjXzcR3AwCHvgbgTgBoPv2fe//f7f9gIdrb7kye/s/m9UYfd8l+O45JPI6DPADwBGjXIEB+iI8n1p/6Rc981+6CPMh+VWabOaCR1wDcBWAAABn9MAgATxlP/N/0D3/X2au+/jHbxE/t+csC0ATpCfQNBEizrMWzA4CdAGnvFDxtZRDgP/3rN5795x992jaIQdCDIMDrvuLBs7/zZQ9ux8U5uezdAb13/QX0h1B2ADzxiU88G0/E6my/eXmeZgvwAcLwlR4j06Z1E2wDwAXZSQHclJEq+DafH/L7+3//G89+9A3fuQX+UsF9y4ZtqZN9kid4YFvqtyhBAF5lOMU99ObNqns+os2/ee+n/FdA/3v/j7ccFQAgkHsDz+WhC6mqn3l56Bxv+WVTJ1n2BZl5efNJ4ZfyWb/qWlZp6llmW5VuJgVl8LNpBjzt66FjWrK3K6f9Zn3tsFCXl7ZkWebivqfXkiurVLtJ6TN5aZbBpw34VhL8Q7M8bemblsyyOZr1lviWHer05D176me5sh49RDdt2D9pLVOufcqVpe6OPzcXa7k2WvVbslq/lV9Zz355rfbo1MRd95SUVZ78qQ765FH7t5kKukEAgHlrBwDv8fstAHcB8MG/TMgT/M/9DGCCf685zyn926Xa90k8joM88Bmf9Zw3ALRNCfx5/x6AKlDnafxuN8DmoEZCme3m7AIAuGM3E9v8Afw8EadtAgK/9fYHtzroA/xN9AV9ggLf8U2f8j6AOh/eA8C30s/+xHdsy3nPn6f8pFYQgC37l7ELoAYB+EDgu97457egHwD9kmc8cPa1n/vYbZ5AgMEAdwecMCDw0LHv+tegAB8GJFjz+Mc/fps2j3vsu+JUD/YGeoB38xOsV95gQMrnZJYlhTcBsBNQV7BNvspSH/CODQIBgP6avv8fftt+BwC6WVd+LgBAPzMIQDu9/hAEwC/8Q7uBU+NaDInF+y/+q8273vsrLzt73//5d/cBgEN3AbzjHb/4S9OAcyF1LcZ/QCfr2DKfPCbn8pZBr0LK/ta+WXaRfq61sVbPvmymCudSLoiTT70eaFG/U06btCWFP5esl3aS5zojL1iWrzqWS2t55lu89aCt8paMsVR52kmw3+JTd027O9/ddR5rH8xr03aUQ1t939nfVGq9lKcN5OZTpyfXXotmfW329Cy3nZZelaX9Ob7Wa+Wz3TlblqUNZTPU87yWTqb290/qcEjv5O7OK78otZ3a1/31wRzkGvBjgAQASEvfAeAjfwL+pAYJzoH/FT8B6DmYBrzZpezzRf1w++oTYXnZV7z0l9niD9gW+H/1i//0FngD/AHggOwE6byzD/jmmwHHPPElevSU3/8hWyDPU31t004m5OTpA6Af8AnlaTkyPv739n/83LOf+e4/fldCTgJ0A/gNDPCEn7Tdgv+WHzx75y6R9+k/lGABAQUCCwYXejsBaKNXVuXoAvx9DYAAADsBGBdBAAIjviLhOBkrfAYEPvvhx7/jGP9zvminAvlD85/05MecA/4GAKAEeG7f1XR7RsxT7AT38AneLVsrU187An9pDQAIygHZLbCdcoA7CZBfgX/m2RlAO70AAG0C3u1Tq68ZBLCPSekrefSwc8y98/bMsssZKQuXR//tHzrbgv/f+pN36BQEOOY1gB95wxt+9HJ6eaWs5gLRjikj3+JzYWZ5lZ0iv9m1j60ev9TOVHU7BvQ4lvTvdflm6tM+uQheQ7OePPUqnzLLlqh11vRDEFtp1rUsZYfw1D9Ev6VrHxLwI8s8vHqVtmwq2/mTubPJZLm02sy8OnM0bcOjW2XmW2Utmfppr9eHqjun1ytLeavNbMPyVp2Utfhqp+aps0ZWdSLfu1dMKvv7ZtXJssqTv8wj+7KZGtrOH+ag1wBrFgMAS7sAEui3+P2X/wP8E1TQvlv/veY8h/RrStlX+Uk8jjUeeIhtvPzkHuB/+47/tANA4O9P7An8eSLvFv0E6/AECXhCDRjlxK1pHB0/Ord9r38KAhBU0B5gmKf9gF6o4FQ53wMgcECdCv7ts/2Uopv6fDiQBEAHlLsjAODP7gF2AcAL7g0EzNEW2K+ybI+PiP3yG/+Xs/e+/eO3YwfoZ7Lvv/JTjzkjkWcM+DxfF1i7Q+AUW/4JHnzKH/y/b5/2J+iv/CFzYe2cGXpXwwMZAADIJoCXb8mrzDy08sqgXCcA5wT2CayTB8AbFJBPoN/jCRCgT2o9vUcmcJcuBQG0I81+amNcJ/duTrN44V77X//Np23T+yIAwGsAh74K8K3f+i3fee96f89bYlFVjyozv4aic9G02dmArk0XbfNe1Wc8tCWVJ79/GucieA3d2dqDwApoWjass0RbdZUJWsnLz1HrnZLSXsvenC/to2CnRdVp0VZ7ysKf3fPaspkybJHXZqU5tmivO3eW9Fs2so7tt2SU9eTWO5TaH22btx1pz26WZ90Wn22kPW206oQszzH8oWmqsq0D5aD+ZR7aTwq/nzvMO3cArAkC5OsAh4B/3/+nDQMAOefp0y7RP9PEjmOVB3DwF3/x/7gH/oB/AgE80Qf4C/792r5P5AGfBAEAoPDIUwfgCjAFsANIP+lzP/GN/qoAvCAV4A8Q5cODnGD6A7A3JdhXhk22+RMQ8BsAtGf7x9AcF+MReDMG2jE4wO4BggHsCiAYUFMC/F5wIHWorx47Ad7zr757GwD4zbf+N9vvAfz2dz/mzMRHDjPRT5MBDSl9NiiAr0n4Hz9zMfGBvos8+WerP8Cf9/wr2Cf/4IMP7uXw41WAVZfjtVTKAEAF/AJ5wXFS+QT38nNlBgASQMMLrKEJ3slTh0BAD/C35NignnZtz7ygnTz10aXfte/oWXeOam8EAS7/Mnj2c5/wPMC/AQB2AWQAgFcBtumAjwF+yZd8yV+4/J7fsxZc/NFgi1dWqR2s8szDL6XNTkda9ZE3U12g9/QmebV5aJ72qSM9tH5LH1t3pR4Acay5KFZWKXa1I822qr751Jnj1ZfSp0zKoSmvvOXq26b5e0GzT0vA3yeSWQd+rp+OqVLrVFtzeeostafdtbTVL2Rr698rvVY/j207bR1qI+su8K1rfkk2mdzfq+A9qHfZR/Zte/6di14XBgJYt/R2AeTT/bu2+u9+NnCrEz/9J/jHbisAMA18s0vZR/xhHn4cHQ9sAOI+8Yey7Z+n/gB7flJPIJ3gPmWCzyw3aGDgQGCtjhQ7Am0AveAeKuiHphw9+mYfoGk/bafOKXiAt+OlD+40cOfAP3n1n9lv+wfUs4OA1wxIflsA4C/Yl6aMoAI/QcV2VPss+K+U82NSV4rv3SVAQIDdEaTXvvTBbXrVi6YPJ+4S3xj48k99zDmfp//hAfspWwv8MzBAEGD8KkDnSrzm4lYAQCAsGDZvQKAC/dSzrEd7gDqf9KMDIDcQsLTlvxUAwJ42BP0ZaBDw08bbfuFtj77lrf9sG2Tw1QDHxDjQreA/bVo2ggCXfzH89a//sFe1wD8BAIMAfg9g7XcA0Hva0572SZff+/vegovOSumYC6+kPXnqyG92NqRr5OiuAibozSTbatGlepRTT9qy0ZNZBzqbWqDExXjSqoddZFL5Xnu1/pJ+2rVu9if5teXq3U+a/Rbs9MB+6srbd/Ly0pbvLYNqYw3Nesfy9Ry2+qdsro3WWOf0T1G2pl+naKdlQ79lH+QXaO9+0JNP5rb3mKTwl3XQD46k+/us85LrIQMAdwUBAtBnEOAuPvVi238L/DvHpr5tdv3TZ1N231/4cbQ8wM92Pe/T7nzlH9BvEICn/oBIgGU+aRZYCrAF3cgBxTyFB6gD0HlyDkBGrj568AmgLTNQQB2eWhsASOAPz5N47KivPft2vyj9wFf0n8T4DQq4ayADArxGQFAAWYJ/eGT8MoABAMaK7Qr+kRmgqUEAPpCY6Td/5YPfTzIokAEBdggQCCAIQJInIMAHCBP0w89t988n/gn8K88F3ZqTQ3Z9PZABAMBuBfs13wP2yhM4K0uaAQBAtE/qBetQdJDzLv8c+Odn//7Fv/zx/a8AZCCgvgZAWyYAO/bpF20B/gkCkLCHHcsdD3mB/hwdQYDLuRZYqGw/9lee/PMKgOC/BgB8DcBvAlTKT/8hQ48F4uX0/L5YzYUfHTBvZ8yvoakD30qbnRza4rOOOvsFaWtx3pPt7O9tlDztZNk2vzu3W3nyRZdy62d/e/zWnja0a79TrqzquBBPmrry2Mq62k65vHVaVJ2sL5/62R95ylt8laWdytt+lV9G3n61QH9Lpj7U/igzn1S/SbPMekvUOtmmsmNp9qfySzbt75Jeq5y2WvJjZPaj0kNtHVI/+6/fZugh94nJzP6eCc9BfQ7pndzl/M3712ZqYnue8A3XAYkn9CbW+Oc+CJjgvrzf39Lzyb/2+L9tO7TpOaQfU8q+TdlxnPMAzsNpULZ//9kXPP9tft1f6tf1BdGC/wwECNjVgQJ4Aed8wI/ETwcCEnNrOeUEG0hsQ+fDdQB9EqAeG9iGks9gAgEFktv9qcM3AtAjbbfpT0+2qVsDDtnPe8UbDNB/UPpGcscAlI8VZlCAgICBAb43wHcAeAXAfmuPQIA8tIJ/QH6Cf3gDAC3KLoEMCPjag7sDakBgzbv+CfhrUCBeBbgXN61z18HIXJ4H8mcABfvHUgB1rZvgX16AD6iWB+zz1B7gPgf6BfkAdYC7iWCAZdBWAID2DAJA6Q9P/LWhTYMK2PBL/+i2ggDYqQEBxoQfRsDs4vOWxcOP/PDmjf/1Pz52u+Wfj6y69b+CfwMBBGH3uwDio4AGAPIbAfA/8aY3veXiPb0SFlr3ZmW52OrJqs6a/GYa+VyqNs7puiBsUReM0qqz0G6zHepoR77Yqf0lv5mScvht0k5SyjJ/Cr62V/O0sdSu5dZtUfuKv2vKsuTVU5Y021SuzPxlUftVKfeTKsu8/VFmXmr/5/ynrjakyOGl8upflNa+zdmz7aTwNc3ZoMw21at55YfQ2odefslmrx7yXt3sP/yK5H1hiU6m9vcQ+Dyoe1mHtu3f/v6EH7gewJckQDtrFkG8fAvoI/OVAaiJOiRsYXOA/wucVrb5C/T9qr8UuVv+Aa8mwCXgU2ogQEAK5ekxX6cX+GsTSiBgLhFwIBiQuwUAydj0yb/AH/BvIGCOGiQwMACwZTz22Z0D5i+btoIBCd5rYMCgAIGB7asA07cACALYb8G/oF/qOCrwN98C/shYDLcSZQQG6B++fO0XTN9a2CUCAu4E4Pzm+/8J9pPPgAA8ZeNVgAtc0FewKjuKBOanpABnEmDYp/uC/EOAvmBecA84F6gL3KWpC3j3ST/AXfAvBbgL1Ake+PTfXQW2Q169XhCgBgDIW4d/hFfwtF/5LuG317zmw773d973IWckwL7gn3f+/fhfLwiwDQb4LYCJCvqh/lygsld+/Sv/1pV3yGEdzEUfNc0n74LwInQzGZxL2kYH/pxuaxG+tGifW7xjjzZatNWWsqwz8dln+mt+Vf+1uZYujWfJTun7fnHfq4e+SZ2ab50DdStVt8pbedpRnvyczDLbOcRfWafyawMBtp9Uf7Vo6sHXdpfytf5l5Zf6Yfkx7euXQ+rSHvq2C106R+r22rG8RXt1lDuGBeq9YTPpya+lU5VtHehlH9mnzdTY9jrUL4J0AwBQeQF9BfsGByxPSt0K/mkL39L2lLI/U3Z7IBtHeoAAQILz5PnYn0A5wTKgUvCfoBXQiR5AfPvUf/q9d+wRSEi7PT6DAgYeeHKfbRAUwD6BgDnAv6bMoEAGGhgboFpgLYC+TJrjm+Nzp4A/Z2ggwSAMNPsq0EeP+viTsS09/W+B/yozGID/CM7wmoDBACh5dntwXivQz3wrIMDFnfN08NfXA9ysAauCZClgXX6OopcpwT0gnCR4X0utI01QLtivVABvm1D6AtCn/z3Kk3r0/vdf/tfbnQC0ZTIIAMUGugQBfOovBfAnT55vh4wgwEHXxUN83I93/H/93Y//DwJ/t/UL/n3679P+VgBg+/Q/fhVg/1HAEhBQ/qxnPes5B/X06ivnYkreRRe9lz+WbiYbJ0kuuKEuSNfQrHcRnnFk/RgXvrlrjOjWOln/fvD2x/7WPrTKlTmezLf8X22ST71WeZXZv2yr6szlbW9Op1VmPegSqKQ+etWOfc4xTLzXz0Z51st2D+HTxmXyrT61/EMfWj6xb4wdvuUDy9Rt0VY/lLX6Yxm2kk/byqWCXO2lbvLZX8ejLPOFdx6soVPVc8CfOhzSO7nT/dWufdtMpvf3vPSPuwCkrUBAAn2+m2NeXeqS9Df29S/t7pJ9mbLbwz6aHxQPfOoXPfNdFZAL2AHZgEbAYyYBJmA1gSd56uRT/97ugtqm4B853xwAULKlH3BZgwD06VRBgBooICiw3SUwvTqQrw0YFLiMwIAgPv3pE/0MCOjrlGUdwT+UBMjHNu/sc07YkWH6pCffeY8fPxPkyZ0AFejP5fdBAD4kOJ0r0rmdAXxYMIIBT5mCQoL/FvCnDPmTn7j5+XGF3hwPfOurX/H2BM73gs9gAO3l03vLBP4V7M/ls+8GAAT/rUCAT/UJIGjXAIDUQAD2ahCg9fRfGfrsguA7C/xDvDkz5uIjYWHA4uElL3ncy9jiL+BPCkDnl1Uq+Pfpfw0CdIMBAfwF/dJ3/4tvO5tGc50XINn3yptPCj+XNlEOv5hY4KHnQs98r27qybsQvSjV3jG0198qP8a2daqflC/RXEi3dLUrbekom9Pp+d+6SZf6lLotnn7M9cU6vT4pV69H1ZMKAs1Xqp3smzx0l+o1pHx/HVS7h+Ttg5S68FLlLdrSsW1tmO/Rlo9abaUMv5Df+Wfvh9RJvte28gSRyFp9UneJVlvoZ1+Sr+NwPAuU+bCZUp0X5qeiZhnyPNC/jMN+QDckx6xvE7gL5KGC+wr2lauT9fNc0Y5tTjT7cVljnZq5AQdP+SsYF4QD5HxqnAEAeQIB8FCAaAX/2DEAYFBB2moTGT85KPDGNrypAl8CBO4EWPsqQAX8S3l3CWyDAhO4TX8YCDkVdXwCfYMAUsulAn3y8tkX/Abg5yk8IIHvBwAYACS8YoGcwACgG8r2fYIFjJVAxxLwpy2CB62UQYD8ZgA8bazZGcCWoBtwiY0hTB540ac/48sTOJ+KF9SnPWWCfGkF24JuQfkaCojHDjsSbLMF+gkImLj20Kn2aR9b9gOKDv01CADQN8gg6K87AZDfwiDAQ/zTZ4HAfYL5BdD/c5/wu1/zdS/88Df/6rff+WI/YF8QL92+v882/enjfIL/DAD4k3/otwB/yutOgHPfBdgFBf7a6//Uj93Am4CLLIYmv0Q3k+7q5KLOReRFaV3Au4B04Z75qtvK2x/K5HuUcVO2NH51enZa8jXtz9Xrja1l13G07B0iq23O1W31I/VrefWxumv6XvvVymtPmjrOoZS1eOu2aPS/dT1t6jha9tfKaB/dVj/WyKxb29NulZNv+Uj9VpuON/xylw/Uyfqttqssr337Ja26x+azT8nb56TwjcQ8UN6aEy3ZVGV7X25RZKc6aJsjqf3ZTPLtfQ/fVb+m7w0GJOBXJuiX1vOAT2lnl2xbOonH0fUA79vn03dAOOBQ8C/gFYQnzUAAegDIFrAX9FeaupTxKwP1CbvtA3JpW/ArpZ+AeJ48o+sT6C0AnQIEBAlIAPlTBgnOBQZ2uwXonwGRBOKH8o4NajCgUnVawJ/28CN9Yez/2/d/6dl/+tdvPPv1d73t7Nd+9d3v56cESeT5uCBgg48wAsrdIWDggHNKkAWQT0CAJ/7YZqwt4J8yXwswALB/PWDaFbDd4THtDHjxf785960AdwdAxy6A7mV77Qq42QuYT00T8Gtb0C+tQLuC7grOe3m28VO3FwAwGCD4h7JNn9SyKeinDJ5+wtNvAnXUE/gvUYMA0+Twn/G1mydrOvzVf+XzX88rUKZ3vfHPb5/gA+IB/ibygn6fxm/fz999lR9wz/2zgv8K+jOf/N727ucBydcAAHleO1gzriuo4zxKmgurlNN9yyrdTGXNlAtiF3JVdop8XTTm4nOOby1ctUW/4Nf2Tx+gL590rZ3Uy76k/BDeMaSt5LVFX+UvSlttHmqz18f0aeXn2tBei1Iv5dVOlq3l00btZ+S711LWr/2zDz255VJtkbeOsjma+tq6KK3t4YuU1XyWwa/tU++67/UffcqkqdeSWZ59yr46jqTwrbzyiTIfNoXWOTIV79cAlHFIK78tPNEf28j+bCbb586f/tA/eR4E/SmTVx+afoSnjSllu9mXqWgcTQ98xmc95w0AcYIA0G988VMfdSs3gNqUwL/FAzYB3Qnqk6/gn7wyghDYFLQCYMkL3G0P0Asv+JXSX3QpMygBtTyp43GMBgpOFSA4FxgoOwboUy8YQB8pQ4dFKbyg3/6bh6pDWea1jy99/1+63eY/fTiQBTPbUvlJQYIABgR4uul7xe4S8KN+BAcMBuDrBPpzvED/tbwKsHsd4Gue8wfPvv4TPunRj/3IZz/KKwF8LDBTBgGICDYn7hBeOw8A3ADoPNEWqCev7FRU8A+tAYAWGF8j41pBrxUAEPTXIIA/O5hgv9dWBgHos8GDBP+0U3cFWM51+4IXPu8nr93kWNFhtgfyKgn3r5oA8QQEDAJATflEH5BOnmQ57/ybAPiCfKlAP/M++bfMvAEA89TZLVBWjPBaqOTCqi64WvnNNKq7Ul3Arc27+HMxeEg960BdVB5D0w48fZDO9Uc/oCMvnavXK8t+oGO+p1/l9tl6SY+xV+0v5Wt7S/pZbt2UwevPFrW81iGvvaTMjcxXXjtVnvmebXSsT1/loaXv9ZraWJ51enz2pcf36iqv/VNeqWPqtbMkx546adv2pZbVvHKptlo0z229B6Q+tjJvPetQpqzyWQ/efs1RxwSdSXVOzOUnM3vwj94pj2qv1Y/N1OB2fktz/NVH6ddalvm0gd0p1bYn0ThWeQCnP/KJj3zDn/ijf+BHeZouiN2C5N3P6AmcBeOVAlzRN5DQA/8Cf8E/ryAIjKXYoR9u76ftBP7yUkAwdQDz2FiTBNWV0pa2DEDgj6VXBebKDS5gjz5iP8ckaBf0Q+1Xgn5kmW8Bf+oC/rsBgOkJfr7vb1CAxTNBAXcJsFMA/hd//ge2Hxv7ke/6grNvf8Uf2/+E46FBAD4ICPD/0qd/2ft7wD+DAP6CwOZxj33Xqkk8lK68Bwjm9MC9gYAl2quf8gT+8j5Z7wFv5P/y535uC+57Ojz9/43f+I33EyjL9gTjAHPAfw0AkAfIr+mDbavbCwII+CulDwQBCOxe+QlxQAfZ4s/Pn5pqAIB8C/wL8qX8coq8VPAPNViQYD95Af8aii0+OHjAMK+qqgu9Fq0Lr8xvpgGdS7lwq7wLPOTwlldePal6SS1rUReZx9JqM9tNXr2UyeMX+WOp9nt0zi51LO/VV67eqan2sy9r27COlHp1rmV+ya52oK3EXEl52luqm/WSTxv2X5p9n/ijr6naRq+vVa/VD2UtXWQ5tkP5Wr/XxpK8Nz77k+dR3vsAOsrUr/1Sbp2qn+XyLdoaB+dcuXyZB5uSz3nR4if1/dyB50CPQ3ond7G/1ZZ5KGnTSo5VH0v1V5ZXvmHPtqSTyknHiL2bf+D8pz/z6a+tgQADAFCe+JqXB4wDbOvrBBkIqDxf+hf0S7EB8DcBmGkD+yaAMPqCZKnAek0AIHWsP0cZL/YNCswB/rVlBloyKKAfBPcJ+Okf+QwYZNCAMp/2Q1nsmr8L9EcgoL7rjy6LYQICvCPLTgEo54HxsxOABM85QT6X3jQFkfiw41rgXwMB42cBb85950Uv+vS/LXgW7JtfQ7NO8q26gn93AAiuK13zZB7QT1CMAACBgGyPfgDyedLvLoDkkRkAwE5tv+bz1wLcEUB9bAL4aQ+b8NIMBCDjtR5+fvEmzBwCRwJ/KGBfmoEAAX2l3FOrzHyCf/gK9jPvU33Av3JpDQgA/rk3X5Ht/yyKOKR3cnfnlUurPnIXWEt0M+luU128Zd7F3qkotudsuWDPBfwxvG3kWJKn3L6kXB7fyCdNu9rIcnn1WlSdNTTbSFvUzbI1tg7VmbPf80+2Ues733aU+bmpKetXPsefvHMmZclrBxl8li3x1q39LHnHUuld46OeNo+hpd2m/VYbS+O0vPrHPlLe4pVBW+1mObzt9KjnMq95dM336qVcG8rMJ5VXp0Vr36vvHXOVN/JL9+Kpyv6+DX8vjqU+baZObFP6AT9lfsEHvTbuxfhudhucCH4iEDAL0BNcC/wzEJDgD5BvEKDuBuBpP3ZIvO8PeGRxJrAHCAv8aXcLjPm6/JRoQz2AMHxSwTu2tavtFk0ZvEk7S5Q2LjMooL/tRwYEks9ggE/9K/DfBgMC8BsM8J3+VgCAOvroZ777j5+RPAeeJ4IABDHy/Ld4fMX5JgBQwf1cPl8FeNITPvSbb/YVdztGxzteCZ7hW0C+Jav1lvIZAFgD8ns6gn+2/xMAIBCAbV8DgAr4//mPv3r7sU1epcmdAAB46qwNANAGgQF2ALSCAAn4Wzz9IQjw0R/91M+/7jOLbf8ZAJBP8L92B4DAH1rBP6CdBKg3VWDfA/xVj3swvzxwH33P4uiQI/WTx4Z5aOWVJd1MerNApLUgvgyZC3EpbcDPJT82lTpVZl/rYtX8Url6lVpPWsvJU1ZplbXqrZHNtVvrc449z5VW3Zq3v8iTr3qH5O1PoczLTU0tu469R3MOqVPt5FjUkaIrn3ppo/Zzytv/Su8aU9ZNm2v5rL9r12v6XFvaU988NMd3DK+NtLmW16e9dvN67vHWrf1Qvpa25kqr7tLY8DE6+rqV35V5rlp0Utnft5NH99RH2mz1pco2Uwf2qY41y3Z8rd/KT6rN8SIfxyEe4CkSYBygJyjNIEDyAD2e6mcAIHnKAamC1gq6sQ+4zAT4NwlAsUMSHCcvKEem/UprmXnsVV3bWENtm/7jr7U7AZb03Cmg/+2vfhT4+7Q/qWC/0gT/lBkEgMduBfKeE88BeQIAfBuA/lf9mqfP1OF7D2tBfwYA4J/6EY97+SFzd+heTQ/kLoAK4nvAP+U9vtqaCwD0wH59Gk+eJ/J+JwPaCgDwAT5AP7+0QXrrz/z97RN6gwCHBAAIEhhsoH3GQX+h2MGmoJ+n/fij7gQgbxDgOn9Hg63/7EQiCfyTZhAgwf0avgYABP0J8pNPkK/cOlmGXf6PXJGn/62bAIsmDumd3Pm/lrUosl7aTGXbVBe3rQVwylqLcstzQa2eZZWqq14rjyxBffJZryfPNnOcyMlnubLUa/G1TtaTl2b9lizL1/CH2OD8atNzXanlF6XZ1pyt2v6Ud35uGmX7/leb+MGU80ZZj7bsIEO/ls3lW33djaU5jo7+Od2l9igPO/jN+vqwUsv3tLbR81NPXuuTV1e+paOs6pqvNK/tyldd87Zvvkdb9npzKG06hjU0zs3e9ztZPUc1P6ntrwl4D/Qu69B2i9b+md9MnSGRh5Is69FJZasD5UBvHKfyAN8HAOSxE0DAD8CDl8ID8vgFgQT98HzojffHKRe8skASwOYT7SxXXzC5FAgApFMHoJx2aKvmezLkBgKSrgkAtHQMapwyIMC5mAsKZABAvgYAzCfwJ5CAn/R3pYxluxtkCsqgB+8vB7BzY64utiznQ5M1CFDBfuYffPDBM/M34Ynmqa7L62qHf3Q+PRe0J6ifk1m2hgKY0YO2gL2yuWBAPv3PIAB1HAN9B5gDyg0AQNkNgAwwfkgAwKADuw1Ign8pwD6DAAYDbIv+yNPun33B8982zZXr+E/xIXzYCwAA/gkGGARYA/rVAaTDGwTwyb+0Anu3/wv8AfzyUmTUv49P/3vnWLm03jqUS1vllC2lzaSzTXUxu3bRXBfRa/LYXqOXOgns4TOhl+VZD741FsaLvI5bea8s9Xt2D7GR9nrnInUqv9RPbFJH20u02j8mn23U+lm245mjm0jO2b2s2qj51nloyainXBs1r1zdFk0d+Oj7vs87mWNLmnzV3+a1v7PR1Iky/dWi1K3yrT3bkOqHJYo+OtKqrzwpvPmqX/Ner/UabuVr3bXttGz1ZLUN8rYzR+P8nAtepXzH1/OT+Ullvw5AflnHnG3LksIfmuh72nAsyswPegIPPASwB3jyFBcwZyAgKQDPAACg30AAT33/3t957DYBGrEBmNwCeugOsAs4sQMQr0kAqZ6gEjkJAE5/tNcC+S3byqS13lIg4Le/+zH73QitIIAy+sbY8QG+PGUiIGBQQP/Snm37fYAW8CdIwJjTrz0e39IO9Fd+6k6b/GTgU37/nQ834sNeXeXU45UAggAC+0oB/TWhQzvcKE8wp4eJ++gBfrt9DYhHJ4MDPb5lywCAH9QT8K+lPfBPIAAbBAAMArQCAPzEpkEAyun7mlcAsG3brSAAY/WVA8F/3QFgAAA5uxN4nes+nu6jmn7Ws571HD5CagCgtQtA8A8V3PeooP/srR9+DvwjF/BL84l+ixf0pz484J974H1++u8iSFr9r1w6V46OevKVbiadbWotYluL3t4CGblg/KI6rfraTpptVnm10RqLi3jL9IFy8slbntS6Paqu5eZb1HMhTZ2WLMuXeOuvpUv2euXYpyzpijZzXm4m/ZpHtk+2jUxeqp9bFB3l6s9RdOfKsyz71+BzPPKOp+aV7/3YsIcO9aAkbSxRdaH75Dj0zTEUG0v11uhUG/U6buWzztqxtOxwD1Hu/cR80mwP3jZ7FF/XsvR/8K3zNxWfu4+T50D3so/ahvkWRdZK9DH1k7f/ynp55YMe6gG2X/OUF/An6AfQwUtZ+BgAEPxLAaUAP3R/4Hsf3AcECAxgE5kAMYF4DQKYR4dk2/YJ2qqfMnmpNqXKKxVMn4LST4MBjP+UwQBsYZOUAZd3fsudQAU7LwwEwDNOfb+GErjBtucUHmB+aBCAehkEqIC/lScI8OQnbn7+0Pk79K+eB1qvAgjwBdYtYH+orBcAqE/+My8AZ7t/PvmXp5x+2E8APq8AsPU/dwEQBACMA9gZWw0+ZJtZhn1fPSAIQLvuAIBiizZbwN+ggEEAKL8McN0+Cvjyl/7FV9YAgMEAXwM4JABgYMBAwJqn/wn086l/8gYBePrPvfQ1r/mw773HV1td+NTmLYfKq2O+UspTBt9Km0m+T3WBWhe5uQCuvIvli9C0eRE7WTdtwtcxZZ7xm9cXNa98jlIny81XmjrwcS44V/vzIq++eaiyNTTrLfFr7M3pZN+W2prKHW+do5sog2+muX5Q5jnU/0v6x5bTP+t2+tobZ0veGqv+oUw+aU+eOvDqQbfJfkPTX/eLz2u1XsOt/Np+tuoqy/tGj1d3rr30pTx+lk+q/4PWc2V+Utmfc3noRQ/sn+rQVo9epB1tXsTG7azLbzDzzjdBgAT9CbwB0AQA8uk/PFu+KQNsog9ABfgD+kkASqmgWzC+llKv1q35ni31pD29UwB/bPA0HmoQwCf2tE9CzhN25IDkUwQHsEMiIIBtxrgG7M/pYMuPNnLeeR0AgE5/GcdcXcrQQbcF9Fuy3CUwvgdw/e9D/BP7jld/zXabvsC/Be6zrMe36gnQl14BSOAtDwAX7LeCAIBz7GYAAKBtAADgTyAASmCgFwCwvUppn2Tb7gRAj4AGyVcLWoC/ytDlo4DX6XsAfPzv1AGACv4NAkAF8gnuW0//s9w6gH/uqdy7Wfjdp6vTBU6ldEeZvHlpdhmZcvlKN5POPuWCVD4XuC56k/YWyPdazjVharWdfZbPscEz5pYsfSEvxX/yF6F5HnY852oTqeaz7KA+hM1zNpbkJx6fbdc5eUheG+do7afntspPncd/2ITOpLnxUS/Le3ZS51g+29q3o0/qdVDzXENV1sqrJ606a+TorE3VfivfstW6Z8zJtNGyjw+R68s1dDrv+3Ow41vndSrazw956FU46O8hx6H6h9geuh0PbNjqDeADQApUAXIsesizAAK0Pu/TPma7/R/wDzBEzvvl6AkYAX4AUgIBAEmTYFib2sXGsUkbPVrt9vQuEgAQ9GuD8WWyTb+LkB/2g8/dE/jqIkEB/W7QhQDMEljvlXM++fDjj3zXF5x9xzd9yvt8HYA+9uqknHFjowJ+wD6yBP3MJ4IM6DP+6wRmOtfUrRcTWKzgPUF+LVubxwbgnNTbAVBBd837BN5AQNJff9fb7goAALINALgLIAMAhwYichcAbRME+C/v/e3tLgKDAHwLwNcPEvRXnr6h+1e/8jn/bpp01+IfKIGTXgDA1wGO2QHgu/9SwX++/19Bfi9vHbb+cx/9c5/wu19zny7q3jlNefLZTeVSyuDNy0M3rdRaqOYC10WvNBfIyDIPLyCH1nyWyatT7ZhXby21XlL7Ls3xVT79ceiCPusm37PTOh+TLM9V8s3zp41sr/LqLFHqVZ1qq5WnTpVXO5F3Tm4mmXyLUm7KcmV30dqHtfloZ2/TupaZn6PqFmrfsS0Prfksk1dHurae9Ss9Z6eOxXlar4k1ea4t9LzGKtWGcvNzVN0leoyNvD8kT1uZh1eW/Zhrs/p1Kf/AB+Z5np967ia1c/d18lftoM8eyStLulSeuoO/iAcAd+wCAKQD3AByCdQFsVB0/s6XPbjVA8ASNAC4Ud9EXuDfoxkQsK0K2Ht5+9MrRw4gh6orrXVSLog/hFLf/lsPsO8HEAX+UMA++tAMBLhtPyk6LDwzKODT/rkgQe7AMBCQwPwQnvf5Af8ZBOAcr7XBWA0CJOCH5xUBflpS0M/YmFev+4oHt8Gli8znUfdqeGDuewAZDEh+bSCgFQCo2+5rnkCAsgT9yfNkHhCeOwB4yp/AXx4gC0gnAACor4EG26ryugvAIACBAOoYBMA2bSfoB/BnXh7dpz/z6a+9Gme+3wsWSYB/0i+8+XvOfQcgXwOoAYBDvgWQT/8NAvhEPwE/fObVEfxTl3s7/6tYpPVHdSklrQWQMikNy0tTljzl6shXupl0tqkuSlnQIsuFbS54XQTXxbH5tQC9p6edSnv6c/Jqw3Hk2JLXF8rMS5HLn4J6DoLW81Tz23MW+nfl7VfV6cmr3po8ttA70mYd0zH5zdR+1iO/T/ZrjqrvWMyvpWl7bZ2dnv3eTHn5+0Xpw/485pjkvRZa1OvpWNqy2ZNlG1zXmacOeevSd3nLUl8+7w/cRzKfPPqZh9dG0myz8vpziXI+ptSbD1PR/t4O74H+OIYH5j2wedxj30UQABAGaKspQXMC2hb4ByCuCQDUwACLrAwK0Idst8WrA/CWl6KfvPWVSZVDsQNw5+N/9QOAmWdRaMKO9VqgP4G+X+6H+uQ/Qb+8X/BPShm2AN9+X6EGBMjXAMBFgwCcJ4MAnp+1AQD0CGKwc8RfB+BpP3OEIIaAH9Bf03X8uNn8VXY7S/N7AIcC/Z6+4Hztk/cKxMn3dgEQAACw2wbAmifsdQcAQYClAEAF/ub/5c/93PvrLgCDALTPuAgCQPnQX+uXAWoggDzfAyDocpVnGjtDAP6H7ABYA/79DoA0gwACeqlAv1LKsx73eP7HXbEP/+WirsUrkzId5KGttJnk+8RilHwuSuvCNRe4dRFc83NgfK7saU972ifVcmxXmXn0TSmTl9b+5VjqONMHlUe3yi6az/Mw8ZyrzY6uPm+7OtSbTfQVHfu8pH9J5a1xXYZslS8OGKN9PGf3SF9qKyl2M3+v+P14HEuLOvfr9UI+r6dj+JbNlgzbS+216ilr9a3eG8xz75Cfo9ikvGXbdnu05Wdl01zwvDAP4Ot8mERbWVL4cQwPzHsgAwBuGxcgSxMoEwRAD6DvU/+kxwQAakCAvICThVjtB6Bb0F5p6qKXqeqSx362ZQBAQE99F4MsCOG1qU4GRuAB6z3wb5mAP2mC/sqrJ7CmLwYDfJLeCgAQBCAdAtxTl3PB+cavKV/LU4++sqMAP2MPwE8AwFQDAMjHTwPOX7fXoZR/hvWpfgL75KveXL61A0CAvUQNCOSTf3kDALYN+AZcZwDA7wAcGwCgf61dAPSBVwH8DgH9xD8EAQT8Up/8J6Xsqr8KQADgsnYAJPjP1wDcBSA1EJA0gb/b/rlnXcGt//WyZyHYO3KRiE7mK7+ZyrfJRSe0tVjNxW1rMSzQbtEK6s0L3DNPffMtWynL+j0+9eGz746pjjd9cdm8/t/Ren4yvz1PRX8L5KtsLl/HM6d7YBl93TSSY6BMXt3MXzZv+1B5+6FMufnap1qu3iE026z272U++2y7W1mdI5mv1wp5r6NjactmT1bbqMA766FrvtbLfN4T5L1XSJX3KPYoS7vJ24+k+JW8/k0e2QMfuJ48P5VOKvtrSj4p/DiGB+72AECLIAAgUgAJ4BP0AZIzsTDqgf9jdwC0AgBVliAdUAkIF9An35IJ2NVzPNihHZ+mQ8kD8gX16DJm2+yB/h7wB/DzxN+t/wL5pBXsm08dedphHPQJoMzTdJ6y5/kT9Fe6FrSfQg9/4Tv9ws4HeGSU0X/OaQ0GMCZkjOs6bGu++4oakvQA/zj58Jug+qLUoEEL6AvuW2VVBtgX+EuRAc7tIwGAY3cAzPWlFwDwo4DUZQcAlPYJAiTYb/EEANB95BMf+Yb0/1Xi/QnApVcA+DWAfA3g0F0AAPoaBEiQ3+O913NfImA5+Y6F1v06bHuJ0j8XhC0+Zeol3UwK2+QC1AVpLlLhcyFbF8Bc570kkJ8D56mDnZqvtlu2mF+kVlmtn/1nXHWs6YvkXZxLW2UpW8Pr/6CcH85Jnid55Fc12Uf7Tz+rzHwtU36/qD7ttd/qb9aRX0NbbbTst/QuW2Y/tuOYm795zeS9YYn32ks9bLWuw2wjeXXTxlo+Abp9qZT7BTKpfOZrnZqnP8jm+pVjksfn8On7B85f8705MKnd1/9ZtD+O6+QBAgB8hA3w7vcAAMKCRwIBAEJB2xz4xwbArYL3y8jPBQRYyCXol0feKnMXgIEA+ose4B3QSjkpQS1yU33aX0E/4FcAn1SgnzTLsVNt0zc+wgjof+SRR7aJ9+nhOTeetx49Bbifs4Hf9Msair5zi3PqrgADAeN1gOt0N+n3lae/X/1XPv/1vWCAwF7w3aJuzV+z/T8BePIEAsjzpB3ALfiHEgDwCTzt1wCAT/99BYB39OkLgL4GGOby6NMOKduHt09+CwCa3wPAT+4EkBoQII8uvu6fiftX8qJPf8aXL+0A6H0I8BRBgLmgAPchgpImFnr3wVMs7FpHypNH18Vgi1cmVRe6yZSLTRegLkhbC9hc7OKrmlog/LJlFwkAMEbHWxff1Tc1r760+s98Um3kOdjxeW7yfMlvz9tM/W15w25XvtJW9qvasm9zlDqW93jL19DJ3B7soM9R67VkVaeX3zTs9XSRoz+XrItOi1d2GXRqct/mGvv0cZ+cH5Xm9dK7R1S5gFia5WlvDZ91e7z3KcqzTeWV1vsYeXSqPOupk7Ie3+pnb6zp7zwfO76ex0l87nqgfBzDA30P8LNrCf4NAAjk3REgmCRvAECKbiZANHqXAfp7NlvBAJ/2t6gBAajgk4WfIB+eBaFP+7WBbgYDALgJ0BP490A/AD8BP3yC/spjh/4wdkC/wB/Qb/qYP3znFxo+9iOf/WgGbzxvlc4B+GPL1gJ/9DJlkAA5/mWsuTOAgMc0izf9mTxKrpMH+McGGBTQt8B+lWWAAFA8B7CXyggAAMIr+M4AAH0zAOCH/5LyCgABAPoyFwDI4EPyBgFaOxF8FQDb1Jn7HoDgH0p/CQLsXgW4clMiAwBL3wGouwAA78cGAagr+G9R7jkCf/6XsKC7z85z8eYiz+4oJ59lypNa3qObycb+HfBcbOaC1AUrMnkX03VhfNkAv2U/n/gnn7pzi3fGkONy7NUfmZdXN2mrrMrMQzkHjcQ5Uy4vVb6laSvspS585s/Vn8rO2TFfqDa0I93WnXSz/LL5qbmD2lNfeur+bQ7ozyG6tZ/2X0p58hfVr/U3k/Fzqc61nPfyeS3lfaLKW3ltzFHqUd6qX6/l1LEMWlPeHygjX2nqJF9t9fLapJx+SbOPrXFXn8c5qecr85Pa/kA+juGB8x74fZvf+30Cd4B/gn/lUJ/oCyJ7wB85C+Kfft1n3VPwX4MCBgMS0Av4AZuATPICeajlUEB/gtLM+0Q+qdv73eJ/KuBPG+y++MYXP/VRQH8F+4L+Sj/5Gc/Yv8rhOWvRY4F+rdfbFZE+nOPxGzagnBt1DbZwPgkGEAS4qk82z19ZI3eABzbsCqhgv5U3WNB6+p/AOvmlQEAvAADwpg+0yT1N4N/aAdAKRqzpw1wAwF0A9N8gAAEQXwXIXQAZADAIQCDgKn5DA4DmDoDLfA3AVwBaYP/srR9+LhhQwf8VuMe4YJNyObm4S97ypFWv6lO+MdXFZWsBWhfbucDNhTCAm3wCb3hBeVL4TLXOXD7tqKct21PHcmj2NRfjuRBvjb/6iDx6KW/Va8ladbXjOZmhs+cOO426zodNo6wp69hBV1sXoYfYmZqcbdPySrN/tYy8B3oe8ln3GH4zGaSe9BgbrTqTya3dJdqqe4zM/kP3ybmaNOd5gll57xe9vHJp2pvj1a/U6zmpfWhR7wX1/jAnr7otuylTP2Xytf/k67jT33F9rjmv0+m79GPD/0yC+3z0uZsonxLrkt3/2M2l92w00PbAk5+4+XlB/hz4VwcKwCcYkDLlfCn+3/7Cj223s0L5aNbPveEbt8GA17/648/tCOAJdQXtl5UHPBoQEPADqivg90m/VBCaFEAOuJ9L9en9MU/7AcK8fwrgZVs/wL+C/JpPHXgCBnX3RisI4OsdFdSvyV8U+KdvGTNtQg2upJ+R0R5+4R1nbpLTzPYG2J7kQ3ptPMD5XBsIaAHuHtBPIJ68+vXpuzsA0G0FAAwEQNkBANBu2dX+HDUA0HoNgMAEuwDoD+M1COAW/wr6M48O/eJVi901cmXmAQubDAD4038tyg6Augvg0B0APvmXZmCAYOPPfPcf3z75538E9xYWalfGWefvb9zrONZQ74s92nzq7yKzLj7Ju0h10Qp1UStNsF15AXkLqGcZ9eby1k+dHl/7YD9zDPCOrTVuZOkX+Rbt1e/JWzaUTed500icz71c3UpT5xA+7XTq9ebTVZNP3d9fJ/Ac9NFjibf8fo6Lvtq+fPY/+2i5+qegm8kodqDbxPyAz3ki7xz3Wqq0d82lXtqQl9KOPDTrwXsd247l5peo94aLUNqgvm21bFlWqf1NmuOF19eejx3tneup+NycJ3/KYwOYZ42Ra4/Ks0aqssyz5rsCAfdT+uXq2zoG/FfQn8D/n/7QX9o/IeMnnggA/Pq73nYuvfMtP7jVQZdF12UB/iW7Bh8E+lLAKHyCUvgWGE1gCt8C/crc6m++Um3RDjsWvvrFf/qMJ/gJ6CvYz3xPj5/bI2DTAv1VdmgQ4JTAn0U4oJ/U83f1GXmCBYyDgNSTnvCh33z1r7rRwzUe4J9B6xsBc0//50D2UlkvAEA9AwC8Uw/gJ6iZOwD4R7Y2ANAKEmQAoPbDnQnsBEAvgwD0h5T/SCtPv0gPf9zDr1jj93upw/nNIAD/M+YCAKcIAvjU30AA9zDutwL/K7ZbgkWdh3zS1qIP/Za8yjaT3l2L+LrYNJ8LUnkXr7nABWyTr6A7AXuLr4A/dSzryWp5K4/MZH/tP9QxQR3zGupiXLqmTtXJuvJQzw+0lVK3xWcd7SFLPnUs01YtK/k6n3r5zVSvV3aMfDK3BzTWrzLzlMvv2Lvy6lQ95S2K7LJT9qfXh+1g4o99qnWVH0s3k8FzyTmStM5r8l5X9RqrefWkLVstmfpJ87o+hOe+kPreJ5JyD8l8i8dGymu+lmWb8DkW+Rx7+rycl975ndTOXTPkL3zws7h1vdHLs1OxlrVkrAnwwYU7NwzMewCwJJj3yb/fAJBaPke//RV/7FHAPBEenvRDTeRdMGdAgEUugQB2BADEWXy5/VLgjlyQruyUFMCIfUAvbeeW8wT/pwD+LeCaAQPaAMjy5OlznvvcLugX5EsJACSfAQF4wP8Tn/jE7U6NCvbn8mue+vf8lb5bywv8e77Gf+kvgymVovczP/X4t/611/+pH2P70biRzN8DrkMp0eXWawCtp/8JrpNfAv+U16fv3KOQtQIA+fQf3n9stZ2lPmQ5bZHmAgAEA6jjLgBo/jSg/YDy9F9KAIBAAYuJq3TOWUDUAAD/J1qBgN4ugGN3AnD/8n8O/3+u6C8msKDjaNGU9RZ+c/LNZPdcACAXmfIuQCt10ZqLWXmBdlLAO/keiE958taRVjtzcspqso9Qx1DHRp7xS/VFj+aCHB49aa9OS64d65vnPNVkWYuqS1nyS7qt8rShrYnOzatatol68JYnr+yUdGpqf2gXATyH9E7uA3978qyjDjSTOilL3nIpZfKVzpWpm7ZTf46vdXr5zdSIZfDnkvMi54zzNud269pKGddg5r3mpGmr8rWe17M2pehZlte9skrzHrHEc39Z0llTnn2o46rjTp97Hsr58bwlnVS6c56y1Qf9Aai3nuoL6ivNtYllyLCRefVYv6/u0FA83AOCfGgmggGZl88gAE+U2Zb+I9/1BWeAfwMALIb/+Y+/eh8AsMxyTjbl5AGgbk0HhPs0mYUZvIszQL/BAOkpAgEGALQJxS5Pg+a2oPukvgXqkfkhP2nVE8hCAb4+7Z/b4t8D+S05oN8E+Cet3QGQQYHeboBTA3/ONX4A/Fffpq/0o6D/d973IWcmZfqcwAOvdmD7ii7sD79gb3eNh/iHYCCg9e5/Bd+H5gHevm/vU3cAOU/daY+dB4Bon/xLuecBtvknNtdmgv2WXu4CsP1K84OABkDoW90FQH8MAPAPlQAA3y+4iv9U6y6A1g4AZQYBLroTgJ1nJID/n/uE3/2a6dJioXTVjuyTCzn6KH8RupnsnAP/LCRzoVkXoZlnseqiOhe3LoYr6DafwP4YHjtL9bIt+Urpcy64czw5Tnn8Ap/+0V8uxrNsideWtKWvXWnrfFl2ryh9iLQ0/9BFB0pa0p8rn6ofXd+6UA7a8WjxyuwPuikzP1eeOvKVtmxWnVa+J1Oedu3jIXQzGTJZz3yT5vzLuez8hvaS12GWp40Wn7rJ53Ws3RZtXf/opRz+FIl7T89OLcu+5rjSB+nr5OOccY48b0kn8X4ewx91fNSTP/IzBenSFoCvwL6lU2U1j318d1RHR6V5DwDsAfVQdwDMUfWpw8foBPcsNFkEs93fxFMdtskaDFAXStAggaY8gDNB59qAwDHBAMF/rZvBAHgCFAYEBKgC0UoFn1UuqJX6tP+7v/b/uX0/vwXilUnzyX7KBPqVAvof//jHb9OxAQDOi+fDcyFd+2S/p2eQB3v6VbBf/Vfz+FngX6nnAFu0jX3O39Of+fTXzl8No/Q6eIB/igBGwC+AuQWkq2wJeKvfevLeCwBwb+OeRyIQAMDmn5e2jqEZAGj1heCECfv4gMT4+Ecp4Ifyz5e+QZUTACBQwCLjip3rh+jnmp0AGQCQZwfAUnK7v8CfnWdf98IPfzPz6Yr5onbHBRzyFq+sRTe7OtLUQXYuAJCLTPhcgCafi1T5XOBWsE1+CbSvKV9jp+q0+mJf7XuL5njl9Un1E3kX4q2ylGmrUnSQpS68du8XbfWBebNLzCf4nFfyyqGmWmZ9dVt56xxKp2b3YIe6HNLklUlbZcrUWaLqQ1tH1k9e3ZbMMqjlyshfJG2m+nMJ25Ynr2xLc47WeezcrvOefF5/rXJttcp6MmxW29nOHM/9gXLvEy3KfSXleZ9JuXwtz3zasl85LsefNH1d+XKu6ryYircH8oMPXssU9EMTsMMn6M8y69Ry8tVO6lDGeu/gjo4Kix7YVPD/lN//Iduv/68JAgDiSSwqWbjxnr/gP9/7V4YOC1JeCWARJuhfohkUEHwCHnlCD7DjCQ4gXuBeAX0rjy4BgFZZlWkXStk2IDAFKmgf4FrBaeYT8POEm/4zdt7t52l/gvolPkG/W/vnQL/gH0oAgPEu+XquPAMBjMPEuTh0RwC+yB0W+il91+IB9zX1AgDUd57Q1hXe4rt4oQ6Fuz3w8pf+xVdWkJ1AP/mq18vXp+3kAeK9HQA1AMCT+BqUaPUjZckvBQDoDwEAdgFADQJgg0AA92LBPgEK77n8QyX5GsBV3AXAwodt/wYBfAVA6g4AqMC/UoMAgH1fC4D+6rf/ybO3/+Pnbu+9An/au3tWXTlJXaSZTwpP2uxo5quslu0DAC4uc+Ep76JU2lpYu9CV1gWu+TVAH53nP//5n1d1sVFlvXzq2rbUPkIZk9TxVaofoPgp88r0X6VZXuv18tVGXeCfIk8bLTu1bfOpu5trdW6Zh84l52pL5675ubOl/BA6Vd0DZep5yEvn5OpI0ZVPKm+5eWjytZw8R+rI3yk5X6auOlLlrTro9NJmKiNRDl1K2mnq5Rxx3kC9BpK25r7XXatsrQwb6qY9eWnrmlcGlUffPJR7SKUpq/cY8z0dy7Fp36SOQ5o+rXz6Ps6j50s6Fe3nAvxBR+vJv8B+jtbAQOrWIEEvf8W+y3OQ366kMpOqBgAA/gQBalIOdRcAX/r/tld94RbUC/KTZkAgPwKoDgtUFmcAYsDlHPisZYJRgJ1AFD4DAhXIZ7739D91Kp+BAHnt5C4BgSugFqDLO/086Qf0f/qznz37vj7APoF+8hXskwfY55P+BP0PPvjg9um/AQBeAaDf1ZfH5Fv+5zwsBQMoRw+/8HR+LfDHpz7ZbwUAUqb/DTIwL0wEAcZHAq/k7eioTvFPE+DbA/SHyAHfhwQA6g4AwHcrALC2DwYCet8B8Mm/lCAA/RX8Q/nnST8ITACk6aP9dCcW5XwzgPv/UU6/xEr0iUCFQQAogP+YIAD/W/637//SLfDnp2hJPPFncXWJQ7gM0y7eoByZb/GbolPz1EG2TS4cXai72ITiK/PyLk4r5Vo0uaittAXWW0C/pZcy7JpPXhlUee0DeftZKWNC5tj0Qc3rk0pbPqw6h+Rzke95OpRigzppK2VZlnzVt062v5tDzifn4n5uOccKVX9JL8u1fSidmt5eLy2qTJvmpciTr3rmK611zG+NTX+qPnmOpMlnWY9v2WzJNpOBY5P2rL/PMye0m/OjNYda89/rC0q5VF3Lzfdoract60u9xqXKpVVOvqa8r1DWyld56shXu/Yhx4gfybf8OXNdcp48R0kn8f5AvurIJ/+CdGg+re/lW4Bf3VqGPWS2YTkPL6aOru7vqkHdZiVOaA0AuANAKvDPPDLAJAEAdgBwwvzQHws2AT40gb8BgSpTbkCAhdoxAQFBqQEBKDKCAgnmAcFrn/5nPXnBf6X4BLsAT4Amr0h86dO/7P0f+5HPfjSBfO9Jf0+nB/x7YD+Bv+DfHQD00UCA3144JgBQ67R8b0AAoC/wV5Zb/gkCANqlAvikgn9lCfhrGToC/hblPI4gwM26873uda/9R2uBdk+P+xDgugYBWjsAANMCa8A2rwCsCQAI8nt9QN4LAPj03wAANL8HgG0S/yjpXw0A0EcS/1AJAFzFXQDOSnZ3GAQQ/EvdCVCf/psH+JN44k/i/8lf/crn/Dv+32n/GtG64DEP7aVNlMGb0D/HtxbrufDMxah8Uhav5Osi1sVtiyZIlzcIUKnlUuzJz1H1Wu0rq32u+RynvL4hL7+WaqNS6s/Zq4v+PGc9XlBgXfTkj6HWr+3FfGJe5fxynp2C9ub5WvnUtT1wsE6Vmac8efV7NHVbvDJp2lEmzbaR1cNy5ea1ibzKLINuWolzmvKFc7xoo9bP+bZ0rdRrI/Nz10leP8lbJ+3Ac61Lve5bOpZVyj0EmfeSpClPPnUqX+3bl5a/0p/Jp9/jfOb5n8Tn5gf5tceGbfiC8TkqcK+BAeukHJmBAOulTN66fAx6bYeH3oIH2M7RCgAI9qHJA/xNgEi+/E8AIN/tl2cBysKYRTJf+jcoUMF/yuVZ+LHYI7F4q2BzbT5BKUDQYMBFAwAGAqQGAr72cx+7DQDgG0B/D+grF/BLlUOXQD8gX6BfaQYGAP7aAvCTCFIYCMgdDGv9OqenzwmCuBsgwb/fA2gFAAT3SQX3FfBnPvWx2wL9Vca4n/oRj3v5wiUyiq+RB+orAWvAdgLxCvzNEwAAlLPTwI8A1gAAeQIA6NRXALKN5Gv/zB8SADAYQJu0jQ12IfBPlvsu998aqCAIwHcA2L3FQuOqnmL69gPf/z1v9v9B3Qkg4JcC+uENAED5XWEWUVd1jCv7lYu4tfxmsr2YctHoYtJFp4vQOVoXrnVhm/keYF8C/b162O6VKc/2k7ffVUbeMujc2C0TZOg385b3aOpVPm3Be26gnDNpnr/kLc96F+XTPnOLfJ1jqZN81bO+NqQtvZDNzf1J7Ry4mdO9H2X0j4O287AvyLKsyi1TnnnrZlnlN5PSNnlezF+E1vOm7aR13tW5zfWR879eL+qrZ946UutZbr7SvL6P4b1nUNf7RdLKq9+itm8d8tlfx5IUf5LXr+lr+TindR5MRfvDObQX9JgE/xWw13wF+IL3CuZb+Tldyni4wbh7/RzyAzzAOxUZABDs16f+yqWU8/V/nnD3AgAGApKyS4DFJ8BesG9AgLw7ASxj4Yr9OcC5tmwL/nfv7QtSDQj4DQEB/bGUAADA+nmf9jEHvdsv8BeoJ61b/BP4J9A3CKBM4I9tXtkgSMHTd4A5ibEzToMBzAP6bkBgrV/n9PQz7Qn8pQYAAO+9J/8J8nu84B8btFOBvnn7Yh7KWMdOgANuGNdAFTCRIHst39v+TxBgbQCAf0691xEE92v6MxcA6O0CQI5t26cvGQTIbxVwD6aMAMB1+DAmPxPIAsSgsDsAoIJ/qeAf4H8DFgq5QJNPCp9ps8tDVyUXjFAXlLnYzMVo8i5UXcBCc4Fb81kmOJdyzWZCblBAnR7Fbi1TZpuUyx9CHVuOu8frs165cmzCS5UnxRZ5bXpepJ6r1rlTp0ex2Stbkmd7yTPXyEstq3nlS5R6Mynne4ufqu6BdKv8fsvsX/ZDmZQy+R27H1PKl2xYvpkqbVP6Xpm0lpG3LKl6yNRJajm0Naec10md70nzmpCnjjrJZ7l21bNM6nWd1PtCyiqPDrKk1rsozbbsZ1LHJK1+TZ97Lqbz4/lPOonPzSXyswc7BROYt/j69F6dpeBABguqbs8G/9tnOzwK13mAJ6AZAKjAP/OA/xoA8CcAOYkJ9Nfy1KsBAcE/C1a2qfLBpjmQuVQG8OvpVFBIPr8h4JP9pYAAeui4A4D3/AX1SzTBfvIAeMF8C/QrS+BfQT8AlzH1ADggnKfzgGGCIL1gwCleFdDXrVcABPFJe4Bfeequfeqf4F+eMY+dAOvuF9dFi3/Ga4B26gDyfeLfoks7ALiXAbrXAP2ejnIDANBWX3zqnzRfBWBc7ALg/kkQ1VcBMggAzy4AtsazmLgO55YFEVsACQawM4CAcgYBeN9/91oDC56bdDieXMgt8ZvJAYupLhxdWLrQhOZCFD4Xq/K5KEbWWxBXsC7QT5q8+tirfMosk1pmP5DLJ+311XElTT8gz3yLVydtyOvHVj1k6X94z0ulPZClXquuskqtA3Ve9HjLT01XzNnevJ+qNgFPT/+qynMcS3yW98azmZQog+4/+HnoeTu2bs4peeZdL7WuB3Rb10TasF7KrGeZ116l3A+QeV+QTz3LetQ6vfKWPO23ePvt2KWOUX/mNcp59VxPtM6JSbQ/KPNIXtmW8toc6xp2OALIBfo9sC5o71HrW97LZ2BA3aTsXj/X0ZE53AM8/cwAgABfsG+eQIDBAHnAP4lF5lrAv6THgs4tq9jlGwOnCAAA6v0OQC8YgHwbAJgAM+AQoArNgAAgvxUUMADgE/SlAEAC/eTzaX8F+DVvcMA62CHYQB8YSwv0+/Qd0C8vBUTDM+4aDGCOAJQZ55z/DinDt/SxPv0X4M9RwT91DWAI6OeoQYiqg8/GF0YPv39c5Rr8wxVQJ9Bv8XNP/wHga3YA8A+Lr+9X+0t9aJXTH8D/XFAiwX/ytJ+7APjn/W/+1zfs76sAf4KuUP6pf9MrX3D28Mc9/IqrfC47fduwEOI8u/hiIdTRvc5iF2ctiizTZpeHLqYKAnJB6SIzF9F1karvlZtPCm8ShAvSpRXwkzepkxR7mU/eMqll9uFQ6th6NBfp8D29NfK0pd/zPOT5WeKznjx15Cvt2WOOUOZcSV5ZpXM6tZ1at+Z389g5zpyWv9/0svsyDXU7Vukh482+wW9T9e29yNfzbb7OvwpuLc9rQp6yln6VqQ9tXX+H3gtOqd/qT0vmGPRHUn2Z59FzvaOtOTMVnZtX5OeODQ8JWDMkAK98DQj08tazfC6fZfAZLOAhwFynR9kKD9QAQAX5GQiQNwDA+//uAFgC9oeWs+0f8E/iC/qHAEt1AXuAWZIgHmALrxwgKOiXUt8n3gJGgCppa2uy6ysDBgMAx4fuAKjAX0CfQD95y6EV9PPKAe3bT0H9sXRNMIAx6yd9fizlPNB32hXcJyUYQF4Kjy7no4J5z2nKPY8pS545QZBjBAFW3DSukQr/IHkSXkF55gHgvY//5dN3dADW+Q0An6hD/WeVtivfAvupY7kBgN4OAPqVoD95yrBj4ik//7x7uwAIEPAPfjqtLBbGcXU94PlpLepStpmGsCrlwlHeRaULTRegrUU0C2IWrS3qYtly81BBuTQDAC3gb7n6UO1IW2VVL/twCN9amK+R0YbjT9qqq3/T3/CeB6nnJyll5NVp0aVybWjX+QBFNpfPsuSznnZ7NOslv5vLOb9PxXONLNnyOmrpWb/Slu4a2dSdxf6ssYNO9gm+++Q/z1H6/RR861w7N+vcdt5TLr+Gai9pq1695ur1772iyk+V9/r3nlD708rXcThG/Aqf/s3ztTv/zoGcM1PR4f/n6RsPN9wFkE/nE5QL0imXd10kbelb1qpTAwWpe00/6ss5uBrHn/ijf+BH53YAtAICNQBwyh0ABgoyAHAoyHzr937w2Xt+6IO2KYE/cp4W1wRIBnwiF0ALDjMokCASPYMIyA0I8CSZ9MnPeEbzFQCf0vOk3gAAgD6BvnwP8FvvkUce2T6Vpx8C9mMBf68edk34Bx8yVsbIvCHBn3J3AP6cCwYc+tTfc7lEGRffShhbi67GvelUveCfaILsFp9Av8cDyjMA4FN0gwD8g+SfVcv+obI1AYBeEIBXAewr7dIndwHwDr0fBLT/7gIYwa9TzbiT28kFHDxHlZHf7OTQ1SkXjvC5qGSRmYvQ1iJVWV3Y9hbOCdRbvAGApKmH3cwnb5nUMvtC3rIeVcc6SR3rHEWf8qRpI/mWnfS3/nfh76JfWs9V6s3xtDFXnnadH8jk6zxp6Vdd86krb1mLxlxuzfm1Mq6Heo1YN8vgW0ndpD095Kl3r/lWv+4KAOh7Kb6HT9o6H2tl2m3RnHs53yuPXpU5d5Oq09LnGqM8r7W8BuG9T3jtS6veRfP0ARvZF/supUxeqr/0JXl5qedlmnt5/uvcm4q3h3Iy8IsHuwRbuwAyGJDgPIE7fJa16qS+gYAaSKh2xrcAFk/bvIIBAEG9gN+t/0nvxw4AtqeuDQAAHBP480Tcp/0V9Nd8DwALegGPGRygLVLK0aU92uWn/9a++8/T/B7oF+xL+bUAdl3QtsDcvv/mW/+bu7b1W3YIfe+vvOyM1Kpjm46VHRCXGQxgR4HAHf8vgX/PCXWS10bKW+WMhyAAN975K2eUXicP8E+1BcJ5Ss5Tdp6g94C/8roDQABtAACQzW4DwHe25VP9nizL5S8SAHAs2CJgAeXXCQD6/CoAQQD6TP8dw1XdBcDi5jrNs0vsq4s0F25zdDP1Y3Vy4Sh1Qemi00WoNBev8HVBm+WtBbOL61x0+4RfmmWVx6ayHm+5tNePVjmylr6y3phrufke7dnRf/ob6rmoC/+UJ1/rmO/ZzLq1DecD8wNeKt/KO5cq1ValVS/zMZfn5nyrjGtAee96oLxXdhG5dm3/XlD6a7t3Af70afV/K5/6LZ46yK2rTkuOzHmVcy3nY2uO1vJeXputcq4n5F5v9Xr0HuB1n/nkqadOtZF525FSJg+tqdXnlswxpi/1vdRzMM0D50LOu0m8Duyj2DrYdp9BgATkAviUJZCv5TVvgCDrJ295DR6MXQCtM7VSZgAA0GMQYA70W4a+rwBc5g6ANQEAgFwCf57krgX+gErArGBXOzxVVw7oBXiScls6cuonuDRIQH2+XfDVL/7TZ/V7AID53AFAAMCn/fCCfSm6bPHnVQj6JAi3z9L/+m8+bTuO9779488IBrQCAoxB/Uqp/77/8++eebzvN399m9du1bcf9MmdAewEMCAAJQGq1wZx1rxC0ALuLVmel8qnfvLoMYYRBFh5A7lGavxTTRAuL8Bfoj5V9xUAwbNgGhAN4K4BANs5hGLDIMBSv3L7v7wfBPT1ByivAvAaQL4KYBCA4AC/CHCVvgXAP/aXvORxL7tGU+wyusoCjqNFc3GX/GbSX51cNEpdTLrgrIvRuoBdk88FMnwurC/Kr7WnXoumbI6nLMdL/iJJW9Uu8up3z8cctQ468pXWMvNp1znQonWemIein/nKWy5t1WHuIm/M4ZzjS/zq+d9oZ7Fup39ZL/uHPPMX5Vv29m1Xn5tvncs1MusnXVOv6ji/mI855+r8bJWr39JdknmNQeu1esi9x7prggDqZtuVX+p3lus7aPVr5j1H03xrzRHmHUeld6Qr/rJLkLWCT+YF5S3aAu8tmXUpq3YT7FtXar2xC2DFieupGABogf+U5dN/eACSHwHkPX227JPcwn9R6isASwEAgCVP3AH9ADeo4B1gmkm5lDIDAAB/QCyJcsFugv9WEGAuIGAwgHYISOCvz3nuc/evBgjwWzRBP3YE2/YraYJ9eAA7lKf4GQQwgJF14QkYAPy3gH8C/e/9P96yzQMiPCjD3lIwAHv4j/H+nS97cB8MyFcFDg0GANCpY0ABynmuoH4uL8iXoguf+axPG8xxbtq9a2fIr58H+OedQHzuI3sVeK8JAPgEP9uQt0yqvEUF/3PfAKB/Av4WpZy2CErQBrsA+IfqBwENXBgEuEq7AFhoeE8er+TctWCbAxCb6aokoZNUXjn5bXLRKHVB6aIzF6KVr4vaVt7FcKWHLL5ddLeodrAvL02ZvP1InZQlj475Q6j1erTaavkNmf72XPSoesfQnk3nQYsyV5A7Zw6h1uvZ1Zbzs9C5uX/X3C51t/P9IjL7Vik2kS3YXtP31KG/jkk5MuVV1n3q3/J1lTEPlCWvbIlmHXloL9W5Wud7LcdOlc3lW9eU153X/hpKHa9j66+lrT6kbK7/lFXfLZ0D52VjjjBXTnLkBwFZT5AICgDIBecVzCtXpwJ78pZJ1UlKWU3jY4AXOK0GAAA7CfjhE/TXvAEAP9RX6UUDAmsDAIB+nzobAEggnwGAFg9YVd+n/7/z44/dBwAAtBkEAPALpBP8+3E6v1xPGfUEmlKAMTsDCAbkzgC29gv6GQf9mgP9CeIT5MsD1Pc7Aaa+pH7ygHrAPYdP/LVB/SxHh+CA9dUzn9S+43P8+7qvuDsYwM6ANU/80UnwbzCBwE+C9rV8Bf3mpZ4rgwDT5XWym+cFLtVR9UQe4J85wHgJXGcAgEBBBgAA0279h/JPas0vAFTwn/nkacsgQPZDHsAPn7QGAdwFYADAXQD+LKD9NwDgLoBHPvGRbziRq48x89Cf+4Tf/RruGWdvfWAbROR/DbJbvtXPe5CL/kPoZjoRqU9e2V2gIReZdQFaF6y5mO3xc4tlF9Z1IZ6Lbsu0Yz7rqp8y9ebKUl/76ptXx7yU8conTX37kBTd1CHf812CgOQ9L8rqeSGfNlvlLZl2pXUumAdowCcVfCxRbbRotbebp87XpMxn8s7rLDs5vzSmWj71q/bBfs5R6jiuWr+br23XfMvPKeNcH5Kvus6VpOhkPvnWvGvJqINc2tJxjmeZsqR5fcp7Dea12eOtcwjN9lu8faZMXpr+Sj59n3w959M8Yr605tok3sqTwq8++D/MwwLWDax7WDeYyCdAF/hXeerAq5dygwhZVmWW3fK1wepzd5eiAQDBfwJ9t/u3AgEsygD9PukX8PvTfTUgQB4d9Zdo2uk9MQZAGgCAkq/J3QEAbxaVAGtAaQJ/eMA/wN8EmIUXyPr0X5rgv/IGAaQGA3iSD8g8l6Z+2Xfk6CSQbvEZyGiVIwO8Q+k/fYaHkocHvPPU36f8APv6dB+dDACgo13k7hRQht1W0of0m/NwaDCgBf6PCQIkwDdYUGWZh2c+feoXPfNdu6eQ3FDHcQM8wD96wfRayjcAAOm8AsA/QAE01H9craf5VZZAv5aRp3xNAKAC/l4eewYB6DeBinwNgP4bBLjfuwB48s99l/sxu3y4zl/yjAfOvvZz7+wAusWBAO89SVsLvM10eZIog5Iqn/W2OrmAzIVlayHvIrXS1iI3ZXXxXBfglPcW4FVedWu+6vfytU+Zt07KGA95qWVVN/Pw6Ckzb13tpa/kq48TDFDWA0fWb9Fqs5XPdup86OVzDi3xPRspx8Zu/jqHnbfbObsry7md8pPxjoX25NfSXR97fXE8UvSOGk/tT/pxjuc898otcy6gV2WWraWtuaaMuSoPrfksk08d+ExeV3mdwed1eAivndb1a1ml2R/57Duy3lj1ae/8KK/nPuac80o6Fe3BP/zRx9Of+fTXAupZOwj+XUO0wL5APSl65g0CVJnrqtRTlnTsAjjyVBoAyB0ArWBABgYszwBAC9D7FB+Ay0JOoMu3AwwI9IICBhB4BYAn5vVJMUEB7Jkq8G/lbZ+ggE+PAaWAVoG/NIGsIFrwDwXUS2sAwLwBgEopbwYDdsEBAhK9QECCf/uefZ3jBf8A9nzqD5iv9bY7CCbA70GwIHUMHmxfDZj0yGNnblcA9ZeCAZ4jzrcA3ACAoD/zyDjXAvolmgA/dXtydDgfnOtf/FebdzEvX/SiT//bIyBw5A3nClV7+Uv/4ivXgH9fEwCU9wIA/gIAOi1Qf6jskADA3E4AdwHktwAIrvKPmyAANAMA/AO+n98C+LoXfvibz375wf3Tf65vwb/XPZRAwBWaSveqKy7koByZb/GbokNemfyeupB0YSl1IZrURWyLutBt0bpAdjGdC/HUsRxZi1eWFL6X0o51sr3kl8pTV7utdntltX76q/oV3yOrVL0EEmkneXTNy1u/RfN8OxeSOl+SUp75ymf9Od56u/m6n6NLeeot6cyVZ3370KJL48w62V7aT/nEc/1uMlUbNa9uyuXnfEsZ53ZOx/KcA2t45hF6zqeso6xS52RSdMgnrfUyn7raqddX69pcK/MabtmsMvP0A97+rKE5Jn03d54830mdFxOt/xMm0f6g7OiDvvkqAMC/BgHIJ0A/hk/Qn4EB5VDk2mZdfvSAbmvFVgDAJ/7uABD8J607AFoBAGWAJgMAAnYWcYI9wDwgP4MBLEINAkAzAJDgP+20QH9LZh8ow1buDhDkZiBA4JwBAHnB/hzNAAC2WNDyFPynv/KxZ+/8lsdsdyYAQEk5zgSlNSCQgQD7vIZun+onsN+9259P8QHyHluAvwsQUFeAvw0iAPoB/5ONfSqBgrk+1WAA58PzKVVG3tQKBHBOE9Cv5dPHrTr4nXOb51CegMBfe/2f+jFuPNwQb+s95DqP+5Vf/8q/tSYIgE7uAKivAPDkHJBtAOBbv/VbvvNFn/6MLxdE8I/dhZf/2CtlgYA+9X7g+7/nzbyiMPeaQu+Jf0ueuwD4GCD9rT8J6D9yxvaCFz7vJ+/1eSWo9tqX3gH/XGPcH778Ux+zDR63ggCf/fDj33FLvg/gQo5TIt+im115Uvmqj/xcykUkfF141vlKPhesla8LXhfGSXMBnnJ4rx11lFW55YfQ2lbNZxu1LPOtNilvyZVZnnbgq7/IV5/28q26ynq2ta+eNNvwnNe5sCbvHHJe1TrahmaZ+tI6T5fy1FPnGBvWadHs5xLfqq/M/rWoOmspNlK31a/qa30urXWUZz3mReYrn/NmDZ/zTb5HW/Z6uvW6Iu+1dyxNG/JJ4XuJflrW6zPyOsb0bz0/mc9zDz/Nh3qvz/xUfJqD3Xo8oPUBgkEAqLsBaiBA0J4gHgDfkie4V1+wb1mVjw8CHnhuWwGABPoZDMiAwLEBAAE5T+AF3oAwtnuSAMAEA0gGAADpCYyxAeBLkKjdNdTAQ0u3FxAQ8PfoXADAMhaz7p6AftKTH7Pd3vqqFz3mjIXvdlfAtEUeP9QxM37BKnoZAJCfA9uWAdwB7a1ju8U/yniqn4B/D/YB/rtXDChHjwAATxvRsY5trqUs+B0LPmDRb7Cmgv8MAsAbYNJHLTB/qIz+CPaX6K+/+/H/4Tt//hPfzg2IGyM37wMvxaF+nzwAWJ8LArgDADAOkAY8A5J5l95/fsjcZs8i4xRD4Z85fbP9Vh8T7FOeefnWLgACrPyTrrsA/IdNOYuSU4xjrQ3+F/HhUIKv7AL4nfd9yDYIwCsAXN/cDwwE8P+H+yf3BXYD3KJAAO5kQceRC7vKb0p5zaOP7FzKxWQuMiufi9PkcxHbWuy6EG5Rrhvk0uTnZJQdk1p9UGZ72lVeqeVVP+UtHjvWqTar39KnlRc41DraRJ581TOP3eSzHc9vnQPMlSqbyzu30NEm1HzWVRda5+hSPuvKz9WpbVhHmv06htdOpb0+Vb25PDZa5a1+ps/neOpmeWsuVFnm1/DOtcugzndo69pD5s+NSnt6c3Ltt2j2ofJ1zPgLWfot/Q9fzyfnHFnr3O/mVf1/QJ6j0jvSI//Sb9YKroME/pUK2AX7AnkoZRXIp57BgSpLG1l/7AQ44GS2AgAC/UozMMACjK38PuWfo0SJWMABuAH9ADGAHsBQwCflPX10BMEECnrgn8VfC8TPyVhgzgUAWnUzWEE/AYZrAwGAdRaw+A6f8XN+JvLI+QlA/JOAE/v6IscvD9AV7LJFXX+uAdts799u8Z+e7AvqMyAAmK/fA2gFDrbAfwf+qYMt6h3Sl9pfgwDMEcbK+eA84x+DAEmRZ6JMv8wB/jmduaf+S4EAy2tAgJv1AZflUL3HHviJN73pLS2AjUwAbgCAJ+hs+TcAAGgmAEBwgAXFqbvOwqDXP0H+EmUc7gKAOobWLgD+IVN+rz8GyH2SYCj3vQwCcC+sQQDumw8++OD2Q7UEAsg/+Ymbn2exdGr/XyF7uXhrLfCUbaY+k8y3qOXQfWotKF1s5iK0LlDN5yLWRS2UxEJY6qKYBTa8VHmLuhhX3/yxtNWGtpO29I5tM+sttaHfoOlX+CxLvtXXlKFLPutUWW3Lc5vnv8erm1Rd51GWwVsuzTkYc5M5vJ+n8OhVmfK0Ia+u9ZQvUftVaavv6FQ59pG32rG/0pbOXP2qbx+tY3+qz9fmcy5QJ/PwLVnVMc88g69zr5dvzdM5GznP5fN6S17gL82yQ/lWW8iwY1mldcz6SOr58XySl09az/9ujrfu91PRHvzDn/Tg54PzyX8NAJD34YKgPwG9/FIwIEF/T5e1GbsoTzrAm2qsFwCo4J+8MsEsT+jngL9l6AGiWdgJ9NdQgO0W6E4BAcAgT8XziXALrM/J6MOh4F972S4gk0ACgQrAYg0I8MSfvgNM9ZWgPykBAHQAqgLHFmUBzEexsGlgpO4Q2PppCgpkcIV+VYDdyvsUfxsMiKf7+yDB7mk/dfcf/8tt/4D/3fv/+KPVxhoZc4JxMDaBP/5j3gn68Vfy5qEmyjnXcwGAXlkGYVrn4lhZBgTG9wOu3t2Uf6TveMcv/lIrCNAKAPCPiAAACZ4AwGWA//TUl3zJl/yFVv8A/8gNAiSvrO4CIGI+twuAf6K845ftXybPV3xf9cmP2wJ97nG+guVOAK47nv5/zsd+4JsA3BcIApAIokK5pz71Ix738qmvLIJu4tFa3CnbTAOGh5paZVVnq1sXk618Lj5zkdoCAnWRS74uhJcWynP6LrB7C3YX99KWXsu+fUr7ytTPspbdJVna05a2ofoqfSg4SFnyWX8N36qrzLagnuceCMnyHu+8WSpHz3kXczjnsnyTWvdU1H4ndQzKMg+PXKqO9NB+WS+pNpDBS1Ouvn1bovU8V/2cDz2euWOZ80hZ0ixr8XXutnSUqUteHrp0/VHeuy9YX6qtnr7l0lrPPNRk/6H6TFp977lM2jrvyOKa8b6fdCreHshOftA+H+NL8F+DAuQB7qYE9JXPJ/+W+aRfmvIMCPAAg524Jx/kTTP4pCd86DcDnHwaDeASdCXoT/AvqGUHQL63L+CHAvoBcT499yn1GuCvjqARsObTYIA4AO8YIH+RAICBAKh9EIhCCQiwcCUoAI9Mv+LbBP7wyLDTe7+8BTTxy5c+/cve/7Ef+exH+cnARx55ZLubgD4ZILGf275MYBq/68elgEBu3feJf77b764AwL5yggbkLwL86Z/nGPCP75yDzjVk6XfB/hzFFxXot578IzvFU//WOevJ+H4ArwsQqeSfwE27r1zH8fAPuAWwleUOAP7xGAAA/N+rd89YQBiQsF8twC/wT4oerymY+BigOxnYCZDb+Bgf/0Tv1c/r8D4/AQBek+L+mT/JmkEAytAhGMC1bwAgKWU38Jpy0ZY0F3fym+naMymbo1tdwcMczQVo5Vm0uoCV5iIX3sUvlMVy5nuy1LFOb6GNnEW6C3Wp+pWm7eTRM5+8Mmi1ZT7bTN5y7ZnXVtJsp/qwl886a/iWHeop9xxCKyAh7/lvlTkXsqynrzxpATKtuazsrrn7wG5nQGse00ZL3pNln+BzPIfw1U6vvZTXOplHL/NzfO1nns/k0at5ZchbybkyR6k3V17LnLvKc04qg6aevLReW+bXUGys0VNnSd8+VZpjSd96vjinyffOcc4Zea6BKeU9f8ruA+LIL/XgARdrIgIBuaZwF4BBANYYgHapoF6KXF6KLFOVk8cm6xp2JVzqQG+CcZ6WCFQBWwm8BP1Sy6HUAeQTAMiE7B98zVMeBWwDQg996i/4hwLesJHgFhBIEuiupfSHxeMxdde0Yb/wC2CVcbOI5SN/fPCPRSnA33IAZw8cVjm2EvgD/mt6+OGHt/bph0/Qs9+eCwMCBAPmAgIEA/JpP08Q3eYv+N9++T92BxhoOITSH88vfScwwnyD4jNfGcGHnj/nK7QmfG+iDJsGAVrgn7LLeupfz2MvTxDoZ777j2+fuO6eXt6EW8u1HAOL9gTWyRMAADzz/j//ZPjnRtr9BM3mXg2Yf/T1lYAE+vCtoADXMB8p9BcB+Cfd2wXA+Ci/B+/TPcQ7/N/3Yb//jAAAieue+0INAnD98F0Ad1hxT2NHQIJ/eF4FmM7FpS907tX5jnYcUy7uKr+Z9E2WkYevVFnzPWIXlNLeItSFai5k5XOhWxfBLKJzAV3Le/laz8U4VNDdo6mrHdsxr47ySque+tmmPGXJqyvFNnxto4Kc9GPla91D89qznnnPIdRz3KKWp76y1BfU9MqcX8y33VxlvjpnnctSy1bN3TqHyWd7mVduf3MMc/ySftq1PfuV+dRr8epmWUtGeau/eZ4o93xIs07qJp9zRH4NZY5VPWXOvxZt1WnpeV1V6jUoreVr8mvr9vRqfxlT+jT9Dp/nd453DnGtwHeumUl8b/8n8nDLdRIPSzIAYBCA8gT08MgqsO/JW7rUJQAwdgBwyhcOojUCqgT4LdBPOcCMRB0DAFB2AwC2AGmCzQTzh/AAXmwYRPjp133WdvIQaADcAWwpS4C7xKNP/5b0Llpu/7Bj/wGxOSYWsPnkP3lBItv+/8mr/8wZT/sB9wL+5JVVis6nP/vZZy/9gv/u/fSDgEAGBewXfeK8ANh7wQACATz534J9nvabLvjUn3Zzuz/zyTkHANAPUP1FH+GZGwQEOJ/UIwn6K6UMvR74b/k+274f/Cd97ie+ceGyHcWX6IH6ywA+cYcaAOAfmP/U7tVT8jrk173utf8oAxQ1CNDKo88Y+A4AgQACAAB9dzMYsWd8/BOlfLeoqM1fKI/PAP5c6wJ/KU/4uWdyX2oFAggCkLg2uU9iw1cACADcwA8CAno8BEDk5ZNuJrmpyjOfvPqLYKouRHPRmotZeRfudfF70Xxrwe7CG5p8S7fXPrq9spS3bB4qw57tSbMNeXwIf6gvezbn7NkG1HMozXOdvOUtmnry6MlLc14loGnM5f1ctUx9KbaST9uH8PatR1vj6OnSLmVz7dPnufK1ZbaTfWmdG2XqmXdcma98zpPk65x13vbk1rW8RdFJec1b5nyHmrwPmD+Gztmg7bSprtQy9eyr49avnoOkOWeQe/6TR+Zch+6uiby3w9ejJas6J8nTJx4isMZgTeHrAfAkAwDSBP4+zVcmTdCvzCBC5u/XuuwkjrtXRphMgigDAAIxqfIE/9QBYJIAXYAsgBkLtkPAvgCUegBSwCmJXwHgVYJ/+ws/dsbPb5kINgBm0TkErKN/rwIAvXaQ88RZQNsCn4DcN332/+vRCvwryJ/LP+XJTzkzPfGJTzwjIICveNLu0/b0Hb7B95wDgwGtgACvBRAMyFcFDnnary4+oB/0gbnj/OJDX5TNgW58ZiAAPfLMO+w4j6EGApSRdzcBbdzrLf9zY6pl9O3pz3z6a+/VPWC0c7cH6hN2gTagmR0A/CMDNO+e/t9t4B5JMggg4G89/bcM+pa3/rMt+CcIwFh6uwAIAPCP+8Rb6R7iuzOAdq7J7Yf/dk/+MwBAgI/7BbsAuDf99Fc+9uwNf+F3bXdU8X0ArhkDAVBeEyD4zL2EwMIN/efvwq0u8DK/maYeKWVzvPpbmovJ5F18Js3FqrwLWqkL3d6ivS6MXSDPURfVlbLoNlHmIlya+nP2l8qwo07alG+1Z1mPYo8y7Ur1m1T5qWjahc/kOZR6jqHKoDWfZfJZt8XnvHLeTXP43Nycy1tHmvaO5Ws/cyzySat+zdd+0NcqM0/dFq+sR2ubNZ/9rTy6VdbK5xyRz/mIzHzyyo6la2zl9eV1WGnqrOW10dJnPMrRy6S8jlm/6V/PE3l4zq+0d66RO9+hcX3k/X4S75/8I79fx0M8kc9AgEEAAwEGAQTzPZogXx1kWZ928N/9Gux1avchn+gLxKBL4F+QdSzwZ3EH+Ad0Asx84g/w/7k3fONdwD8DAfA8qSJAwO4A6uQT7gS38ABct4/XssvI4xMBKDyJdqA+iQbkCWQNCHzdF/7l7RP/Hrj36X+l6Av4pQB/noqZkOMjgwBSZOk7fMX5aAUD6LMg/hiaT/3xBfOOuQYI4PxXILyU12/qkafv+D6Bv3ko46MtdK13Vei2/9P3COgjaWxhun+3Uf4RC/rdAUCeAADvxvNPiwDAvXr3f84TuWMhgb79T1l+DNBdAHwLgH+YdRcA/1yRn3KMgHOuPxLXYysAQCDgtV/wmP0rAAQBCACQ/uH/8NA2wXMP8vsAGQzg3kUA4ete+OFvfvZzn/C8Od9dk7JcuMnnIu8YfjON/VzKxWTlW4tQF61SF7OVutjtLeBZJLuIrgvlXt6FdVIX6S7As6zyPbvKs6/JW4695LVvH8wvUWykjnltQ7P95FNHHlvyh1DtQk31PC7l5+oxR6jvXJHWeeW8q3OTvCBHnUqrrZrvtdnTUx+6NPZabt0cc22nl6euZdqRIrdc2tPNtmv/zHPO5Hu0peO5hh4yz9bo5hxOvlc3r58Wf+g12bKBbMmO5dK0U/uu//S557fSPN+eZ2nO/7he8n/BJN6Df/grcfA/mXUFgD2TIF5Zgnv4BP7qVpl1TrlmuRJOu8xOGAAQkGUgAB65OgKrLZidwJZP8KGHJJ7qANYEOwB5QD1P+llw+8R/LSUoQOCA1wQMCGDbAIAg/DIAf88mC1wT7dc+8CTaxAf9AOk98N+TC/ilAv98L5YgAHLOncC/RwkG2E/8x0Kdc+V5PgT4504Bxqlt+sFPd7H450kggZBTgXCDAgRa8D1teQ7kGZcBGLYQX4VgAP3B114Pzin+IVzmtT9s9z3Q+uo+/3AAzPyT4n51D96R73cwSgwCJNiH7+0GAPz7KgD/jBkTQQ0/BsjYGCNlJBYq0dxRLE/luZecvfVOwI//Kb0AAEEAdP0OAN9SAfST2AlAIMA8OlzH3EMMBNAG9UlcVy95yeNeds2vpQr8OQe52IPf7GSVpp5l6pPfplxQwrPQVOaiM2ldrJJ3QQtlkSttAQUWyHVhfGg+F9ksvFspdeSX2nGBbr+lWS9tyVfaAgNVB5vIktpOq13LKk0byVe9uXyOGz7PZ49fU6c1V5Axn6Q535yTUOdgj+acTN426bf8HG3VTf3W+Fs+oo668trJNno8upRZZ4lqp+o5bvuSNPudfOrIZ7k8dG4e9cqc+2vK1U2a9eocTz34vPbkpVV3Lm8dqHzVVz6nY9/xnX7Ux5478vJQzy20N/9310re45Ofiq/mgQ9YP7GLUuAONQAArfIE/FlW5eNnAA845wnuBftJAU4mwBQgRUC4FvQDHNHl6YxABwpg/8Wf/4G7gL9P/JPCZ97gADJs8ATrnW/5wa0tZPDsEuADa/mUW3B12VTgCQVUQ3ttsuVfEJ+0BfyzXB49ggif/IxnbBPnj10cBgIMAtB+D/wrt4/6zIAA58tF+dpAAOccMI5N5xDv+PJ73wSATg38AQJsEQZQE3TQ754DxuQ4pfSPeUkdAwL3KihAO/RT4A+lr5w/eL6OfsClPFRP64ENPw2YOwAyAMA/qKv0vvnLX/oXX5mAv7UDgKBAfgwwdwGw5T93ARAQMABwitcAePoPWOf65NrnfrC9F5RXAAD/yPM1AOoRBKjJIAByAwGA/22aXguAIjcY8JrXfNj38gSCxdVpp8o9s8bijiMXeYfym6n+Xam1wHThmQtR+Fyk1kWri1qpC14XwKegdQFuPhfgLsotk/bat5892qun3UMp9rKO+V47LXmrPrLUzTxjy7LK17F7DpNWnV4+68AzZ6Q5f+CdZ85B5qd8i9b5aL7arX3otV/rZb5lA1kdd09PedrM/sJnGXyW17KlfLYnn5R+m3cM5ivNcnlpnTvknWtJ4WuqdWt5K6/9VllP5j2g0p5+S27dVlnK0Gvp5lj1HbT6mvOKLM+v8wBar4NyD6//A6biq/f0n061DsYMaOeVRIG9gQDyFeCnrFWGH1vtDFnDA79v83u/j8UYoIP3M/mKMom8oA1QAiBxa/ihwN8nMdjI9/vnnvbzxWpAvqBfwK9M4M9TK8B+Sw/7toHevQ4ICDwFooLrStnWL5iH8sQ+qWXILaOOPwUo8G9RgwHUY0dHCwQLhqXo1GSfOYdrggE+9RfQ0g94nvqzuAdwXxRoU58EcBf8s+CnbVP63vHNUQMCzHF2JxgUOFWwQjv0O3fB4BOuN3fgeO2xlfmGvtPcuBtdLRH/4DMAACjmaTn/gO73+/8tTxEEyF0AGRBIOWNiB4CJ1xrcBUAQgB0AfOeAcRIEOMWWOuYx4J/ENcprWQB9kjsB/ucP+j3bjwIq5/+G+tTpJf4voVsDBHP6XHv0iURwgl0CLLJafr0CMoE/XZGvi77Mb3Z6Kav8flv1pIv+OdDl4tOFp3moi1QXsbl4VeYi10VvLoTX8NRDT9qqkwtweBfhUmVVj3zayz7K225Seepqo9pugYCqY77ayT4dytf+pO01thwbtCbOaZXN5dV3LkhznsDnnHKeLdGs4zys1PYqre3Xer18tUO+Nf6WHjLble+1gzyvrzm9XlmrD7WvVaeWr8nXOeWcznnoHMyye8HXa7B1P6g6vX5ZV30p+vLSlo30U/q1noM8nznHW9eD9+uJ1nt65qfi/f8K+OtwPMSuANYdrdQC+1XvFGuV6+Cok/YRgMGkwygT058HrMDfJ/lLAQD1AFM+8c/3+wXlCerlBfLSBPzISAD+HujPetqE0qaJPPV5bYDXDwC7AtxT0QSe2CTfsw2YF9gL9pNaBuVpPz8p2AL7yvgVgM957nPPXvh5n3f2xV/8P24peeoZlFgTCGgBZQMDjCWDAQaHoNSjXEAL+Af4s+gXVEMJApgOfRUggT/zjcU+bQv8pczBi4yZ+oAL7NPORQMC9Jsxe13gQ+YGwJ9dG35/g3ON37jW/JnARz7xkW/wOj3pDWAY63rgW7/1W77Tp+kGAHhaflW3mfE6gGC/FwCg3Kf/UP6x8jFA/pnmLgDy7gK46LwDaPNEPoMABoaZ/9wfSIJ/KHmAuolrxqf+LcrrAb4i4PcClKFfAwQ1j32CAbudHSymrsKR/cgF3rH8ZhrUNrG4hG8tMl2EUiYPzYUqPOsFZXVRSz4XvbkYTl4dZPC1LOVZngtuF+FJ5VMvbWtXm/Zjjtb6aXstjw11q701eepqQ1rtqdOy53gtM590zgfqtepnvdZ8yPnivHL+mZfWuadc6ryT1vboS5Vl3vmrTDvKpZZDc3yVz/KsU/ls51R8bcO+KK99Na+e+SXqOU/q3Luf1GtdSl/gazq0j9Xe2vrpH3l96zmROgec10m9NqDet3e0d/+fiq8d8KfP+4Px11cDBPqsVdgdkMGA5PHp3tBgDvPAk57wod8MWCIB4AR1S4C/lueTTYA/T5ME4QnKKy94T1p58spq/UPyBgNYJFOP1wgICPgNgR5YXys/NAAg4E+wr0xqAECg36ICf8B/K331i//09hccPMctkH+IzIAAdQDdAGZk2AfA+iSbPD5hkc38YM4YDABUGxDABjxA2aflSZEL/n062AL+BgC2fZrao33SsYEPxicQMSBwaDCAflMX0G+iTwJ/wT9+MyCAHt9TII1gwGH3s1No8w/fAAD/hADKPDHnn/kp7F+GDYIWgHz7bUBAymsA/hqAuwDYfpe/cMAugHwN4KKvOxD8c3u+QYD9Vn2260+J64ngGNcZO2KoQ+KVIQMEUPJ8KBDKKwMV7GcQgPKa1IcaIMg6yKlzWcEAFnME3Q/4NkENAjBtlPUWgnPyzVR/m3KBmXwuQpN3sZrUhWylLnhZAMO7EJZavkTVr3RuMZ4L95ZetbXUB8trPfOtNpZk1FVHXnstiq7yHm/5GsqY0Muxya+l1re9Wo85gcy5kfMm59UhfNrQrjTbr22r06LYVJ68Mmnar7w6UsvNJ80xXJTHbq/P9IFy+7JEPZ8tPcs811LnonP5WOo1K2jXTsqR9crVV0eqvlR56vd460B7OinHJ+ST4kvyUM9FzgXPX70G8n7s/XpHW/f2qWj/PwH+uh+bXhDAYEClV+WbTNfK8Uw6nviz/V+QJkDzSX4F+DWvHvUENod82C9BfQX3lkl7IL/W6+nNyf/3X/7X2+DCL7/xf9k+dc0dDABHxnZZAQCBv2AfWmXkAYZs/c93/gkE8NS/Bfh7Mn/C8SKAuAYK8BdPyvGTwF9KOyT8RyCABE9AwEATAMBEECADAQJ/wT9zbgn4ZxCAPp0iCOA4oAYz6Af9zkBF5Sn3+qCeW/4F/VLAPzs1SPAk9A0CJGVnAOeR13jGawKXdtt9iG8BAJ6JNH/TK19w9oIXPu8nL621Exlu/USgAQAo9zrBv7sBCGzwT9VdAPkawAX/uW4A7FwTAH13ArhFn4CAwQHKvXbU5T7g/xgCaCauCwMD7hwwL0VeAwC9fAYGkqfvvirg6wIERFjQsfDmf6iLten0bchThg6/5gHQ/+tf/2Gv4hsE3AMMXDL+A6/bBP3MlNZCcI2s+dTfMUDrYjTzLcBSF7QudPGDScDgYjjl8tLUkc/68LnwdoEuzbLkrVdt2e4SrfW0l22s7QN1WvZastS1LdtO2qrbki2Nc6l8yWZrPihz/uSc6vFeX5ZbV6rNpf5arn6PYrdXpo0WpU7KtZEyeOVQx2CbmT+GT9u2Vdufy3NOKZembut8Ow9PQb1mpD2blGdKPesmVRc9eamytJF82pnT1TfowGtDefoxz5G859o5Ds17Mf9TIrXu71PxOfDv/wnk1/qYCwLkk//dK5mbaz3Ye915QT/ACDDGwgpw72KrAv1WHvAjsKnv9x+61V9wLth3m38F9+al1juWYufd/+Lbzt71xj9/9p9/9GlbH/TGynjxE2NmAdoLChyyA4Bt/QL/CvprICADABkIWHryn4EAdH0lAKAJmK1g/pg8gBv/MHaBP5T5lcBZPoMB1MGX+Jb5ZyAggT88YIBzk+B+LU97pwgCpG8cC3OBAAhPMA1c2Hf661yBMlaAvaBfKvCXGgAg/w++5imP4hd3AhgIYB4yJnT5R3Kv7yG3oT3+Uf/sz/7sO/mHc0EgfE/dZRAAwF9fByAv8DcQwHb/uguA7XbICQ5Mnd8cMwDmJaD7HLjffaDPIAC07gwwECD1K//modjkXsF1532A63Cbdvdorjl3FADmt7sHGjsDeoEB5dTDlgEIKfc8/y8oYzwGOs6Nq7wGweJwhU9zQSfvQpDq8mvpZqozGwTIxWguUOVblOsEuQtbqItfFsPyh1DruZiu1MX2IRQbLtbT3tp+ZR1526+gQXmLZl35OdqzgXyunmU5PmTkpVk2x6/Vz3OPvZwTOXeYZ+adc5mHTx3LoNrs9bf2ofbD+mtpr52Ut9qs5baXY2nx6LXkjj3LtCnNNg/hnSut85xl8K35KLj2OujpKG/pKZOqC1UGzZRlqa88ddNG1VU/5eqnTL76pJVP/3t+pJ5D5z5U8M89OlLv3j6pnAP/5G/SsWH9UZ/21zw+vkmDvtSx8FSCL4wDHARdLcDbkxkgSODP9nkA+BzoF6D3gDtyEtvxBf/WOYRmH5LXhk/614D+ng+Us/Bj4cmCU5CXQBNeoCtfqeB/DSVA4AcADQBI2QkwFwgQ+LNbINOpggD4gjkB6AeQMr/gAbyAZsFyi+oTdEnkWUwDpg0GwOdC3wX/HOW8ZDm26Zd9opy+SRPcX4THD7TLtYJfmBsk2nV7f1JBvzTBv7Jvf8Ufe1TgD8Uu16+JgN6l3jiG8WvngR/4/u95cwv8ExTI1wAMBuQugHwNgMDAsa8B8JQbEM31C4gXuOeT8F4gIMG+9VJmUOAQan2DB9zL+R6A3xXgdYDXvvTBc4kAQk1cd17XUu5Zgv/9roYJ9GcwQB49dt8tTCoWfvVQlrS3QGzJN5PBfXLBKc3FqLwL1RZlMYs8F7Xy0FwAV169Kq95F9bI5aEsxKUuytfStANvm8krq+1m3dreHGDI/qYNeMta8tpG5ufqZr9zLMfytLWmbj2v5qWteVRlzD1k0izXDnRNf1LHOmmjx1NP/bRR+axvWa2XOjmWi/Bps/L2Q+q5k1Z55tFRTz5pzj94AbZ8LTef10by1qsy60kthyZvedLUUZ515C2TKpciT558+mKO16f13Jh3fnuf9R4MjXt06x7uvX9Su9kH31uqgD/z/LLPzfbAiUbHAo4v/AOAWLAAIASyh9BDgb+AX4AvEE9qmTTL4NNGLTPfAvu1DDts8Z970n+IL6ouPmURiH8FZoBZfC7IrVTg79P/SnMXgGWC/hatgYAe8M8gAP27COClrkA3n/7DM94W6O/J0AcomwTTS+Cf9hPsy2cQAF67STlXjMFAgPSiPvE6Y07QHsDeJ/4EAEgCfGkL/FvGTgB3ATi/OHfOrxWA4kR3k2HmunjgJ970pre0dgFwv/Tpv7TuAjjFawD83yEAwPVpAGAL5hu7ADIQAE+QYPsqAK8OlCSQr/SQYMCc7raPtrkD8YJ6Ansm/weQt7xHa9CDVwtWziMXfC2aMviltJl0tikXnPAuRKVrwImLWWjqp9yFsDTL4JGnTL0WrQtuF+6H0mqHfG1PmbqUyyetbQsYpLU86y7x1EWn2jBv2ZIdyuv4TpX33LXstc4vspwra/isM9deqw89mXbmaK9uyq2fMnnLWnTNuFs6LVs9mf1Yos4f9CqfMsqce9A6x81LU7fFV73MJ29dZVD5Vj/Uz7LU78nTbtWnjuOHVr/oN8sor+elnk/vtVDvx96fJ9q7l09FN/rJP+PbHviFDy+bBvjXMysok48ng4AKwBiABGDkouUQChCjvl/0B1zPgW5BuyC8UsG+tJaTX7LRqoOMftk3bAj6WaQdMuaL6hoQ8GkRtBcAMBBQqaDfQAD5FvCvMr8NkEBfmdQy8muCAID2FigGMLNg56NdzjXmGzZ7QH+NXF8Bng0ECOx7dCkQgB1BsyAcSn9px2BAjvOYgAB1aAvwzzzi2qEdAgAm8vgLgA/NvKC/UoIA2KKfjIM6JPrOzp4Vt4Whcrs8sOEVBoIAJj8Q6JN/AgDy7AJg6z87AEi+BvCyr3jpLx/jNnac8RN/PGU/FwCYwHUFxDUAQH4LpgXiMzQDAbYzB/CzLOvugX95ck9fa7qrbyVQkIEAx+YuAfLsKsA/B/rVRSHV4DmUraGbSb/5CkAuRuVzwapMahnrDPlKKWMh3FoMWwatyTotmgtt+VzwJ99bxFuvR2m3V5ZAINs6hMe2dnrtqLNkd65+y39zst45adWp58y6a3XrXCGPDeUt+8poo7aHH1ptV5n1kmpXWct+tWM+62b9Wq5N9R0n1xO815XU8kqtv0Rre/YHWn1l3rmkjnlpay56jUlbOofKqi3zUBM2lR9i3zrSaiflaVcfJE0/pX/hW+ennkvPdQH/vfs493oO7/t3cjf8L+/41wDAsTsSb7ir7gyPRQXAXxAmgDoG0LJgAfT/yHd9wXZ7vgC7B76XQLuAf0mvZ1+5AN88FJlb/O8X6J/zMeCUBDgUxCXgF+xLs0yest5rADUIQF6wLxX0V0o58ySBb4vPIIC8AQAA6SkDANqHEgzogf45OX2r5YBnxpoAOkG5wQDapb5+SF6ZFLC/53fgH5lBAJ7cs+B//OMfvw8AZJv4zWBABf01T6Al+56Bg+kOcKv+OdyKG/rFB3kuCOBrAW/7hbc9+qNv+M79BwEJBLALgMTTfz4I6K8B8BoAi5dDu2IAgK31AnNBtoBacNyi6NwFtCMQUMH7XL7uItjmZ0A7bWefuHeT3/dppq62tcH/0QT/8PwPWLlrx2taymmQhybfKlMHuiG54EzqYlTK+Zbv0bqgrfnWIhhZb4Gc+nVBnflchMPnQj35ucU8etVO5mkv88lnG/LZVvKWS7EDn/Z6MuXW7dFqK/OOI/0Hn75ec06sX3W1ZfkcrW0emp+zfWhZtk1d8/KH2KNur161a95rpXVtee0lpR75rF9llmVfUpZjco4gg7dMPqm60t48XCtvXR/KpNWWcinl8tJaZymf9ZKv9Ry3NH2lDKpcnyf1fHtOOe95//XePNG8X+e9XX5SuT3HV/+Vz3+9AQB4/Hd7Rn/ASFls+X4/AAGQA3BioWFKUCIg7YFWvjQO8OedfAF2Au5DecF/q14GBJJXtwX4KUNu2Xv+1XcvfsyvN9Z7LXc3AueDr7kD1vODgD7xT5p8C+wL+GuZYN8gQKWWAzSZLwLZHhWYWw7AZkELcM7E/EP3Isk2sMUcrmCePPO4JZ+TYYux0l/BN0BaUA5FTrtLwN9rCopdAgzQlNMX5hjXZS8IUIH+XJ6+0Ud3AEgP/LL4AXeXoXqdPcBCw1808JWA/DWA1i4AAgDsAmDbHQGAI55WPwDA5RUAvqwvOAccb4MAE4AWICfQlqfMtH+aHuB/b0d7pWwLwpXNgfWFMvu4Zpu/wB9dxsHOB8F/DQDwv5pF4BHzygUiVV0UJrW8RTdTnW3KxSd8C4goy0WrsqS1nLwpF8HwLpKhtazmUzf5XHTD1wW7i3lpLW/Vr7LMU7+Vr3aX8mkDvtrNcsvmbKZ+5dNfla9+vki+2iZPX6TyqZftIScvrWVZ71R8tpF82rdP9ssy9VOeuur1qPW9PvI6St5yadaTX6Jr+uj5kdpv8srkK52bm3Nlvesy66gDzaSO5eYvi9Yxm08/yetvzwvnLnnyeY69B3tPnmjrnu29fSq+fQfrDoD/WNu2z/3mkU985Bv8aTeBUi46AB/kE6AIUgAqAH3K0UOHJ/5sNf6Ob/qU97EFVBB+DBX0S7UhyJcqlwrqzScV9EOp79P+ew3iT9GegQD8z7n4xhc/9VHOJaC8BgQMALR2AQDqK/DPvCBf8G++UtquAF8QnjR1AOD0HVCaAQAANnrSiwQCtNN6oi/QPzQQwLViAECwzRgyEABYB7TTroAeP8gn5ZrKj4XVIAD9mwsC0Lb9WKL2U+Av3Tzuse+abhOb9q1iSG+zB1h8/Oq73/1rBgC4f7L1328ASN0FAPgnCMD/AAIAx/wKAj+d55f0+aAnuwD2wHwXABBgC/ylyAH+BgHM74MBO+Ce5T2dWudkeQIM9MMgxMQL/BP8Oybu89wjuKcc8OHOXAC2eGUtisy0mfh9cvGZNBenPX6tvsAlF8Euhivt6eTCuvIuxKF18Z/goAUe1Ldu0rS7ltfeHM020NN28soqXWvXetVXma++z3yeh+RTJ/m0m7z9gCI3nzpzvG2oQ15eqm3z0JbeXLntVJp1tDuns9Ru2tMO/u1dY5ZBPQ89ij3LtN2j2Q95/ShVDvW8zdG5uWkZ9eWXqNdr6nk9S1tlKZPPdpO3fI72xpz+ke/52/MnzfOd91H43b3Ze3W9l0/F4xge2HmACfdJn/uJbwTEmAAjAAxB5RxABYwIOgH7gH63+v/TH/pL2yf/PP3nC//HfJVfwJ80QfwxvMCfuoD+977947fjnRvnVS7zHHDeOBcCRM4fiTznBlDOx/wICAD+fUUAkJggX74GA3xlQLBvEKBSyrEJKE6An8C/8gBjFrfMQUApC1uDAAL+UwQAaFd7Av6LUMA6fSUlmIY3n7sBGF8GARL4yxsAQBe72zrTubUcyjkl4aPWTgDaXgL/lttPwb+Uj32OG+XwQMsDLEAIAvgdgPw1AHcB8JOHfAuA7f8EAHgdgKDAN73yBfwc4EGHvwKQ3wHYBwB24BnQLkCutAJ6daHy1DF/MmC/Cy4I7u+y686Cifo9Ae7ZgP4E/tzXyRMMBPh/7ec+9uwlz3hgmwiOHOTMDyjPLQ5rWS4o5TeTqW2qi9DM52IV3rIqb+Vd8CbtLZKRo9cqZ4Gt3MU2tC7OWwt5gYSgQVp1BQbapFx+iaqbNrWXMvm0Z92UVT7ryUtTt9pKX1Vef6bP8zzJp15L13Kp7dCv1jlSpt4pKX04xJ769j1py06Wy7f0ejJ9Qrn18Wnr2mnJ6jlJG/JzNPuFnnnnUObhlZ+aOnd7tF6j5qGZqG9ZtUWfU5ZjQG55yuUtNy/VJ/pJ2vO55ytpnlfvpd6Hd9T7s3QSj2N4IDzAJHr6M5/+WsAFgIMEsFgL/Csg5ov4/PSe2z39GT5AP+kX3vw959KaYICg/xiQX+sk6HeL/3UE/gZlAH+cL58Os0Cs58S8gQCpAQEAoFvUAYEC/zlKEEDAD9BP3jz1sQd4tV/bXSHxHrxA3ECAAQCfpAv+sSFgvyi1LdumzWPBP77n2hGc42tscT7os+MATOPjBOnbay12AmArE+XYxQ51t2009Dmf+Nc2MtDgeRXkL1FtCP6lBAHGlqm4cQ527wEWLdxXCQLwGkB+ByA/BsjWfz8GCP+a73jJ2TFz6mue8wfPvvxTH7N9DeAc+I8AQIJ5gwAV1CtPWnXuAuoJ5OV37c7qBsC/q8+7MoE/rzNwPf/0V975X+z9HcD/qhdNPwU7JXcGEQDAF9AjfMnC0EM+qTw68tCaNpNsn1iMkndROkdZf1gunwtb+Vz4Mt/M1wUz8rly9V1wJ3VxLs1Ff4KDHu9iP6m8Ng+h2T71tJVUHe1aZr5F1UmqnZRl3fSTPL6Eb/k7z4+81HNgPqlltgHNflRePeTy0pZsTZk6SR1ryuBTbt97NOu2dLL8EB5b+tDrZYmq36Laa/Wxylr9TL97vtCTb9Gl8ladnKs5fyvv9VqpesrNJ221e1GZY62+S9+2zkvvnHr/hMZ9uN6jzU8q47j1HmCCsWUQUCHoBxAKFg+hAJB3vfHPn/2nf/3G/Tv0Am1oBeHmBfYEAQgUkAgQpJwdAwQTkFnvUJp9wQ59vSmgH6DJYvGYc2cggHONDRaabicFuJN82g+YB+RnUKAGAQT+yNldAHDFJu3QRu0j+RoQ2OanOgJ/KfMU4H/Rp/8J/g0AYPfQAADjoi9bUD7xfJSvlxgn+ugyHkA1gQD8i78N3qBTdwXwgT7q2c5WB71InDvaRicDDAYCaI+2lsA/5egJ+qkvL/19m9/7fdPNk38m4xge2HuARZQBALf+SwkC8NEddgHkxwDJP/xxD79ib2Ql43cAeBUA0L19/z8B9iQzACD1qT76yrguE/yrQ/ksmBf4Nyh1W6m2U/PU4ZUGruXXfsEdkP/alz64/SUUAP6L//vNFugD/vkAIsEB7hvoAP65107uu6zrMheP8i26mfqwT7kwTZ6FLHlplilvLXZzUVwXy5lf4ll4o1MX4LmwTxBwKJ92WjztIu/RVh1l9AW+1SflVbeVTzu1nvrS6qfMV1/nOZJHR75Hq51sQz/Zn6RVr+bRtX6rzPJaRr41R6pcnVb/ldU65i3XBnJTS2ZZUm2kX1vXTpWlfuW1mZQ27VOVZ3/gq0/zfFU+9bNeS0/dWka+dT0omwP46vSobVEuP0d7vqBOLTOf/pSv56SeP/J538z77o6v9+dJPI5b7wGeEgj8BY+AM0HaIcAfEM1TdAC5ILsHzucCAVlH8A9lschrAyReI+DpEUGCNcEA+wMlMHFdQX+eDxaHnDMBYwXUqXsobzDAeWBbglaAISkDAvIJ/JEBJAGo9EF72Z9Wv5EBwqHU3S5udztSANqZTrkDwCDA2l0A6BEwI9HfHuifk+MLxohvWbhDSYB97Hp+t8GAxhP/BP/y+Jm6rQCAgYC1QQADBRkMMAAgfdITPvSbb/3NdDjgnAde/tK/+Erut/U7AO4C4Ik/T/7dHcZ3AP7qVz7n350zsiLD/zC/AwCQbgUAEugLtgXm5LnPkCxLit7aAIA2k/72dz9mb5ft+oB1EsCdBMAnz2456iHbjmcC93zcUB2AP9v7uR9wr4FyX3703/6h7X2Ha/8/vvmB7b2EIMCRP2XEQtFDvlLKXVAmr0y6mQq3KRenx/CtBW8uinOhLA9FJ2mWybvwrrS3sO+Bg5YcG4IFabVLuwICy5RVueXSVpspQ6+2W/PaklquHeXS6qea16/6vZ6nzK/htWc79CP9Y79Sru4aaj1trqkzp2N/11JstXQPaUNd7ejX1nXTk1GHMutKsQmv7R61D5Wmf1tlef7UbVH1qg3zlkOdu6ekab/F2w8o5Zk/hNe/+l+a5613D/V+u6Pch7n/ej+GjmN44IEHmFQJ/Fn8JCg7hAdMA8IF2Qngl3jqtHRactpgRwDg/5+8+s9svynAdwXgDQj0ggHsKrgJoJ/zIihmwccC8JBzdaxuBgRsH4ApWIXyLQF2BQD6AYvI6J9117S9NA9tewt0JzAsYDcgcGwwoO4EIL8UBBCQM645gH9oGWPEtwQDTAYE9sGA6dxv24c2Ej6nzlwA4NDXAZYCAXwgkH904/46PKAHfuD7v+fNNQDgTgCe+OdPArIrgO8AHDqHWBgZAABIzwUAEpgL8lMGjzxla8C/+oB9ee0I0OkbT+y5Xt1xhgywDshHTt4n/ujCk9Ahcf1jj0QwgTrcX37lp+7wX/fCD38zCd2VPwHoqTqUupjMxWWL30yG96m3cF2Sc47RyUWwC2MXzMdQ5hr1ksJnysW+4BjZHLiw3LpZTxltyEPNJ7UfqZe8dtf0RV3qy1svZWm/8tkf+aSeA89NUsrIS7Nsjvf8ZDuH9ou61Ekbla82l/Rrfce+hlK3jivrWZ46WT7Hpy/zejmETxvwrfbq+C+a199S7dW88hZF1+TcPgVNm/LSVj9Spu9SBo9cmTpQ/e05qOetd6/M++zEt+7F3rOn4kvbHYbtcVxVD/C0xI/7sZhYAlxzoA1Andv8W0A+ZQnqk+/ppByeOtYzGMArAewI8COD0J9+3WftAwIEDN7+j5+7BUuAUcZ7kTHP+eOyy+y74zh1e4f4RVAPpR/UpV++i7oE/G3LMZnXVuaVYZMFL9Sxo8fTMMCwwYC1QYAW6E9ZLwCAnHYZew/cz5X16lQ5Y2SsXKdu/c+AwF27Aybf4B8S7a8JABwbBKivB7gTAMprAfyTuqr3wNGve+cBFjR8CFDQLyUowMcAeeqfrwEQADjm5wANAEAB7OeCALE1X3CedA3An9PB1tlbP3wLyqEAf5/0cw0D9rmOfZLPtQxI5yN9JIC6yTw+qIkn+pme/dwnPI+EHnKvOSgy8yc62y4epZh1kZm8MulmKtwn+rTr1/abAJYpX0NdELtAdsGci+fksxx5L9VFuYtzF/pJBdDI5njLpGlDnnbkpcrsQ+bVkWL70GRdafZPW5SlXF1o9it5favP8xwdw2sPmu3Iz/Vprp/Wh6qnLWWtfNaDt19Js89reW1V/Z686pFP/3qNSCmTb9Fanrbks037BT118nwca9fzJnUOJ3WOt6j1pNYzn7TXR31FufwhVJ/nuZq7N3ofnaj33Radigfwxwm37mCBwKID0ABAqABLQLVEARbv/hfftmqbv6C9AvlD8gL+WsdgQJaz0GQngCCIRRfgEKosKXLSsb5Y8tUpy+njVe5n9o05Qjp0/L0xev7quWrpc759F39NICABf4vfPmVn2/0uYZ92K1hfk+cpHWBgja46AAoS7wOT3OKbAYHcHeAOAXxPMMbt/ksU4O4T/kNpgv/kx2sBt+7fTHPALKAE/lJfAyAAwK8B+DFAXgv4jM96zhuahmaE/G9juzy/BnBuF0CAf0G84N/8Gpp1ePr+vt/6k3d+chD70/cGyCPnuqN9E6CfvgHw+R/MInAaBouzq3bUPtV89teyFkVW02aSzSaDAqnXW/DmotiF8tLieq0edly0u7jPBX/lExwkn3o9ufah6Gc++VqWtuVpo5Uot/2kLV5bUnXMJ+312fOgv3sUPcuSV8Y5ltdmyyfZJ/jUSb5VpqzaWMqnXfvWorX/5Ft6LRltIJe2dLTfovovr5U1PLayrrZtn7z9Sj+s4Y+p5zlaY1+dpfNHec5teWmWpyzt2laljlF/HUL1tbSeL++HeY8Mvt5zMz+pbQ9k47hNHuCJP1uzLwr86/v9LUBeZZlPoJ586iS/Vgc9dd/7Ky/bgqs54Al4WwoKoDNn416WVdB7L9tutSXoFpQTUAF0nnsavXsKTZn9P8Sn6kIN2CijT/DmpcjpB1tfeU+Wj+sRCCAIIJ0LCLTAvzLqwdOGwHyOJsgH9KuLnMAI+UrV6dEMAvzmr3zw+0k85dwGBKbgBAEBgwLbIMAk4zUMgP/2Zx0nuiYIcOh3AQwW9L4PMF4LuE3/bfpj5XsAgv+kvALgrwGwW4v87jsABy1WANk8dec9eXYBbJ/K8yHARgDgEBl2BPxQ6gL2SQB/rmPucQB9tux/9sOPf4dP8fOpfN8zV74kz0Pydvz/z96/AFu3VfW9KOAWyCe6p1JekYrmFHhPrOPViliWpkjKbCBlTDaE0tytZeDySCyDiBUTCBgjhMo+WhEVOAEjklMciodBkCI+Npsc4wFiFIVwBWJ8JCGIkhSp5Fi5mlDRzV53/MZev8X/a7uPMceYj/X4vj6r+mqtt95663200edc49/6YyhLCt9Km0G+OPnA26I+HPuwXGk+eGdZyuf4+mBPPgHAoXnt2y725edo7QeARdCSVHmLpg3rpCx5+4ms9iv9mT6f4lv6yFJfndpW9sm+KEtdy1Imn/rqtah6llkfav+SZv+Tz2tL/bX8lE3lfjeWUOqkXs1Tpt3aT68//VF56ihr8SlT7xA079mh+bn+VR/VfMuXyirN++Jv4MTvJ7+1/K62fnNTNqhcyuAz/eqfQ3qAJYA8FAEGeEBpgbklMkALM/4JtOeAumC80qzT4pfq2w8o2wDoG31cci0tHQDkCGaZ4Q3gOvKDjGBBq96xZCwfxfbYpwDQx2qv2tUftq9PGEc1WYauSRm06pO3HP0E73XFgO1Dax9rHrssjWf2GSAKT9CL9KPf9RX3kpglX3JOgKC/RZ39F7xPgXX6Z5nBgFYdy9Sdo64AgGYAgCBAK6FH8MG3OOAbAgDbzgRwBv/QgYD+toBD/rpfTVs/8srv+lCC/9wGwAoADgNkNQDbAAhcr7lKQDe/nW4FYAZ+fL2eAYAVwYAxeHBaD9BPYBnA77YCyvldeumzvuhewT4PhUN/edi6GT5ep5Rrlk8K30qbQZ6p6pyV+eBbqQ/H9aGZB25k9cE781lH/Vad+qB/SCBRbdd8C2wqS5p9SvCevDrKKqVcmbrbaPY3fSufPp7i9X2tY16abcnTP/hWP5WrW2mrjva26Wa5/YNOXWNLnvppY45v2UmZ34dD02wDfqqP6Zc5fqo+8rl6lFl3m57leU+n7vlSuTa3UfuYVL8lrX5t5b2X/vZt+c2sv6GZH6qOH2T9cwN74BqvUWIGJQFWBVcVQLXy7O/nRH8Bdwu0H0Im8J+zZR8E/R9+59/fC/Tn9eIbZlEBo4BTwCLA0T3OUB70cgUFugle095anodWkjahAE36MrZ5GoRwCboUnUxZv/KtPqEjyBaUC9jNQ9FxLFGn2to2tuyLdrRtWwYFsg11bMsy81L0BP6Cf4F/0gwIGBRwZUBrdQDg31n/ViCAe4DvAdj0ZQ64t8oE/gYFpC1dZQYAEvy7CqAVAEBG//Qd9yEDJQQCtq0M0Ke7BAOmVgT0bQE38H+fLZfGQ8477n7D2XkAbgN41Su+9eTn3v6DYwCAIADbAB77Zx77Q1vMXVdsAGA8QG9YAQBdugoAvQr6Afx/eM9DrgP9/N7QDsF1HvCu60DP4AEfMPPhcym/Oa2f+sjGswJ8CJb6cAxtPTynjHtFXppllc8Hd/h84BdQJE0+dZNPkIHcOqkzx2/TT/tLgfxSvbRdeftcfVZ9St771SpTVu2Ytx1p7Ucrr26LtvSRtXSVtcrtn9TrkC4Zm+pCtQNNufyUXN9C8/uRfOq0eNpA3qK2L81+wuujJbRVd0q2xF7qLO2L9zIpfOaxm7Jsp/K1/+bxV/L6b4qm/71H3kMov4WnKX8jt/FDlbPfZXg/1OufG8UDPDD94zsffa8gbRswE0RVuivwTyAvLwXcJ9/K1wAA+qZDvbYPn+gXgBGACHD/jKc//YRX133pH3vivSROsee99aZHP+rR48n26AAgqUNdbJCqD6fygv0W4E8wDw/IBJwaBBD4A0jl11L67FJ9eR5qEyTa9/SVskNTxipt0wf6YzLYkv1C1z4hF/gzqy1ATdAPX4F/lrMiwLxbAwT7gn+p8inKfeCe4R8Be1L6nfkpPXRSV54AlVsADABsA/8GAPAt44hrxb/4kQSPf5asCkDHYIBL/pfSViDgUY/YvP9G+d3t17HOAyyLr6sAeBsAZwEA/t0G8LRnPOXdaywDzDmBn5l/luKzJJ8tAXW5fwX7lLvEf1wxEPv5qc8qOmyfrki4mR+apq69ys1D902bwcaYfAD2gdgH5KRTD9Zr5T60Q+vD/mXKJ2ARrBybcv22C5++km/5O++TfNWzfqUtn2+7ztpP8616Lftzsto/8vVavEZoLVuan7JL/bQv73ejRdFBru4Suq2f6Yc5f1mW+kt56k7ptsqm2lIOdQzIJ029Ft/qC3ot+Tb/ZTn3o97Xeh9PfwuX/qYO6tcB//xdpqx/bgAPXAP4M2stQNoVpAE2LnrGX8APBfTvOtPPtZjwB4ARwANwBwh90x13nPC6usc+9rEjsAfwL00EBQgSYANbglUAIPeg+l/QL/CCVrA/lQe8AVRboP862aA3BgMqHYCpQQL0sUXCF9gWuNq+fazXcF5524caFICnfe4nPEvaAZWCUoAo9+FFz/qGM0BPfgr8I7eMOiS+PwYBkuIzgwBSZHNJn+66OsBAAdcLWAH8O/tfl//PBQFoHx/irwrW+R4YLOS7wdkBnJmwJBhwqEAAryC9AX5/+yXs4IE8D8BtAMz68zYAAgCsBmAbAA9AS81zyB5BMn5vmf03AJAz+4D9GgBwP/+4p38oF/Rjjweype13vdEDPmSSkV/6wNrS2wx2rkv5UDwFYvLBehvvg3fVqw/0LTBwSFm2t4tdQc0xKP3Bbu1X9hm++jDz9V5RNud7yrVf27U/ea2tFQ1L6mmjpUv7yKXy9ss+5nV6XV6btOrskq8+JC+oz+/FUl579rnSVrn9xgfw+iJp9WWWWb/S1NHP0izblddW7Zt57E7xa9us10YeX7bklunr1r2L38DWb+ScbKh69jsM3z83ggcYLI//use/jof4fcAZIAPAwR7HJbPydZZ+SR4wP2c7QT97+teCfoE+FF8I9gF1AB3ADzP3gP1dAP+2wADBgL/++L95tioAAEgfSAJaAfYulAADM7gC+ZEG0AeMImvSUz3KBP+pB99KBgewS5+9jn3G2pK63EPaGtsf+g7v/SVokcAfXuCf4F9wT1lNlgn8pYwTg0NQtwXoG8F/DQ5YPkX1Hz5sBQS4Nr5/+MbZf2SCFKkBgCWz/+gK/rnnFfzXPAEC/EyggTHLIYr6edt5AeiRqs25PPoEEQg29O0AN8J/o92u4a0/8ePvYyVAaxsA5wGwLYCl9kutA9gB8czmA/4NABiANRDgbD/L+53xR8eT+nnYW9rmTazHQ2d+pvLKk8KvTZuhzph4QIbPB2Ufnqfo1IO38qynDNp68AckVLkyaS3PvDpQ+bly9XahCW4F8JVit+qpY1mr7exz+iz59OsSPuumffnsh3207y2a+kt52kLXNls0+ylfry/l8JSnLPPKK602M5/jv/L1+1HLzae9yrf6XPtnvvpozn/WgVLPfLWxLW897aR+ytTLcnj6mKmWt/Jpd6rc9qTVr5lHJ/N5X+T93Rvo2t/Mocp1H3+DrxP2zBXyAAP2cd/8Z97p7B1gYQmwQoeH/NR9z5u+8uSuH/uWk7vuevvJu9797usSr9P74K9+8F5SBfmf+E+/ckKq8jX5CvrZdrDmID9BIdcDaMEfAjhn9wHmxwD8NSDgNgFXBrhNIMHfLsDfOoBhZ+2RYbeZDApQHjygFeCLDYAqZQlYAdbkpVnW4tM2/anjKsfYWh7b9IN7Sl3uM/bpO6DR2WeAPQEekiBfcG8+aZYJ+imvwF+bBo8YVwQDakCg5ZelMu8dvtM/gn8Bf1LBP2DFAMDcnn+APD7k+uaAOGWCcXh8gf/9bsHjN8E6gH0qeV9a7RkkyEABPLaox3YA/gleoZ/h3tUDeIAZOwMAUFYA/PRb/97ZNgC2Bax5HSBn3/A9YhWAAQC2A/B9APST+F5B0WOmn+93LO8/wFXd9CZaD5nKpDgJvibl0izfDEISMuh1AQAflvNhelfeB/ekrYf9fWQ8x83VT2BybF4gTTvJT7Wb/U4fJX9M39d+tYC/sqXXhF5eV+Xz2irPtSLb55qtm3aSt1zqeK/U70al6KUs62lTmu3Cm2q58qTVb+ZTZ45Xf45Sn/KkczYtm7OZZS19ZdDUneuH/lpC837I5/065fP3sPKDyvjbOEcp40Pd/rlKHmCgAfyZDQYQ7Qr8eah/0/f+uRNmrJ0Rh7IcHuAKeKbM9EMvePmJ6c1vfvMJKQMGv/ze936SYIEBg6kgQK4CkF9yer9gJCnXz3Xw8AbIEfDvuqS/AvqleYE/5wPIJwUMcb8E8vtQ7JAEj0up4N8VBAlSE/DLQ5NH33zWbc2Ec0/oF+DdwMDS4AB1bDvHN/IE/wBGQCn3XvBPPgF+Av/kBf5Q5AaMoAn8Bf9VZp62vX59wnXLr6HeR/zFrL3jvC7737b0H33q4y/GSQuIt2QJyrPcYAABCu4HNtkigP/nVgXUQIDgP23DK5f2lQBX6b/R4frqVgBWAfD6P84BYPb/19//1vHVgGteB0gAAFDPbD6URAAAwE9wmXFMnuCAB/kd7kq6peKBqYdMH1xRV6dFU2adzVDnuuTDcqX50E1Z5tfw+eDvw3/KKhho5VNfPvW0mzL5CnYzrw405Yfmsx14++u1QFs+nZLP3Y+0KV/bn7s+gf+SQIZ20r5tQr3WlMFzrdLWdR9bVse6+frdOM3z3bnuO0PeOtLaZ69Pannm4adS+rTlR+1BsZE61k15ylI+1f5SuXalWQ/ZXD7LKp/Xt433HkDLvcp7529giw7VZn9LKe+fq+gBBhbAH3C0FEw5q5gzqICW7/vWvz2C/ApwMxBQ+dS1zGCBQQKpgYLXvPa1Y6DAYEEGDHjQY4k/1wJYgXpd8lLKAZVcO/0XsAEgBPv0Kft4nrxgvwYAMk8/AbBrwb+AEuAFeMcGydnopOiQAKUJ1smrJ9CUJki1jpQy+aTJZ/3kaTPz8gYHaN/gAPeXhF36j44AWODpGKCcpekAfYCowH4X4G/dCvwdX1VusOHVL/vaewwCQOk316JPoVxvzeuDFk1def0DoDcQ4Mx/3fNPXvCP/xgjFWy38gBvwDqpVZ4y/IFtvpfcD88LoO62FQG0k7ZstyUffp83V/E3uvd5Pw+wFSDPAfBtAJwHsOZ1gGwBEPgzw08gALBfQf/pg9Z+ne61l3qAB1Y+0uSVSUfF0EU+lzZD+f3ATD5Qt/htD+St8vqAf4y8gEMwkhSwmvkWn4C28i19ZeomtSxp65rTV5RnXp57AN+6F8rUlda2sh/y2d8lvPVatLbntSi3Xy2a1+C1tvQOIbOtpHwHZlJ+f67TSxvZb689+6ssqb5ZQ6dsztngfs2VU5Z25/htdpaUY7+l12q3+ngu37iHee8qP6g3f1ORT32w0T9XwQMM+pzxF8wnuJ/jAVI8rPPwDkD3ZPvzAsgA86lAAYEIk7OygjIpck/mF+yfV9+n2hHwSwH6mZCbVwdb9B8gPhUEEDgCctET7DuzLegF+JoAUAmmzI/LqR/+sJdzYjUPxCbG0p//a1/3EfxrIKEF1gF6FagK/JEnbx5ZypOnjanE9XrN1MEPgt/W2GZMIzdoABDlWgTujh2DAo6tnPGv4F5Ab11s4oO3v/Krx4MBLW9R9AxQwI/XMFADWvS1Bgi81/hOwJ/UMTLKBltQAgEkgwDu8VdOu1xXAu0W7xjZBtpbdZXRDu153duCAdaD0n627WoB+7Vmv/dV+A3vfVzmgac+9alP9xwAlv2zDcDDANkWwMz+Ekv81gH2CQK4BYDDAJntByAssdF1ju6B+hBqPh9w6YRy+SyX3wyFqwMArYdwHt6rvPVA78P/XFkCEoFCS9+yKdoCqi0Z9VvyJTKB85Ruq295Lfgs81N89W3Nt+q12p7q5y5y/WY7rT60ZLXvrXzWozzzu/CtNpAx/kvyu1EpesigY6o2W/3CNyk3r88qRbfKzKedyqvDfZRfQqsd83PXhl30qn3rJlU3ZUv42v5U3nsRtN63Vn5Qb/4+ppx6mT/NdnLZPTCe6g8w4iG7BYTmZAJ/AM1FAP8p8DwlJ1BAcKKmKf3zlAviWzSBvjy0FQTgGgFA3FPBHiCqBfYB+OgSNDCAIjhtBQT+0mNu/TWWT699wOVHzCABNgw60CeBOZR+GhAwOCBVLk1deNIU+G/JbZcyATKA2PFuAABqosyAAPUBpCRn7fEdfkNGfwTylJsAtejgA/sAVRfKQXkmyrBFuyRXrNhPaPaPcoF9pYyHKiPvOGlR7XEfuK4E2S0egD03W5+gXF5w3rKnDJ/hC/oBzcMDtUPb6FfwT3m2QXnfBnDZ/zUdrX/XWAXwjrvfcEIAgK0AP/+zrxy3ARAM4LDbJS0D9AH+BAA40O80oOSD0BITXWd3D8z52bIWVUbL8nOUskybIX+/5AO3ZeZ3pfWhXzvKa175rlRwIrCt+RZQUvcQ1PaSrr0WfbKUTtnPPsDntee1Vr2WbksH2VTbypdew1K9tAtvvZQrq9QxXWh+J7bxZ98XbdvuUqrPpNTTt5XfZlMb1k9q3ZTJWwbN65Bv0axzSJ62sh+ttlO2x70bql73O8m9XvJZqrfEVtc5ggc2nuq/C/BnGTD1mO28CsD/PIH80rZaQF+Z4N68VPBPXl5d85QBggSZgm3yginAPq9F45WOvCebHxPHGDNbBgHQIb8W8GtrimIP2/YRWpP9NkggyDcgMILVAQwaEGhRwP2awIBgmzZaYFugDU0ADg9Qpo514ZcmQX2ltpHtZtuCc9ulba+XazHhS/xI+ZiGQMBUMICAwGjvVIc2sAloNjmOBNvI14J+QXulCdSzneQZnwQjCJI85wkPuA7co1dtGgDQNpTEP/epMdrlN64H+P3hIEACACQCALwOEHp6DsDWi+d3sx/ot9VN56mw9KEz9eAz2V91sqzym0F5p+TDOfXhtaN8F5oAI+unfI4X6FSaoHcODFe9JfnalvlWP7km5F5b8nMyyvSv/lYf2mrLfiyh1m/p1jLzlWZ/pvi8htZ1TNWjrVbZlDxtlzbr+F+S32gj+1Cv/yLz3Lds3/uYsspzLcjymrxOqHJ1av1tee1bv9ozv41mn075JfdMnaHKGfiHzw86fuSlyju9bB5gcO8D/AEfAIIO/B+z6iwAAfwUTRDf0hHcL6XYACQxm8xSfMA2S1uZhR/G5KX5oo4/hMOKAvoq4JfWgEDm1cngwDiLD8A9Ba5QgwIAWPi1AQFXDlAXG4JnADLfAwE6tAXSlU3ppTx5bJsMIgjuAfWAX30ATd8knzrUSxsGB6B5ba4QMAgARQZgzgP5BNEtsH0omW0QYMgAQPKMHa6Za2V1Bbq1fe1ADWLA920Al+0/1Pn155lPesILmP3n9X93ve0l49sAOBCQcwD4P7mtJ/x2nf6eblPt5Rfngfxf1+KVJU2enpPfljaDzoWlbUBgW7mARPCzlhoYSLotANBqw35M0anrQL9V5j2hTB6aulm31S79bMn3lWUfks9+zvFZ5xh8tL1t7C8p32Av+6nf9/Xjtvq0WXVaMnS23evsf/Lhq+uuMXWwP5fPsl347MMEv+0+DdXOfufkWxQZH+z1z1XxAACQZcg80CfYWMIDZJj1B1D2Gf/t4L8F4lO2DfCjuxTsawtg44w9D6b8Ax7G5uaqjE/6y2qDXBmQALbFJ9hNHl2BbQYGDAhIAb6C/KU0gfMYEDidVed7JWhPyveL/NnM+uksPW2T0h48QY1Mreu2HP3ab69NakBEYC8d5ad9qX0gn0EBvv/4NwMAFWSfR14AnwEAeQIB8HP9oD46fFfgT78jV+Ur0vt5YA/8yCu/60Ps+/dtAB94zxvHgACz+wduqps7Xw/Uh9PMJ0+vzEvtKXll8rvQzamdbXXR25ambFxXrwII7SJPPvUqSBIQtYD6EtlcACDr206r/ezfNp76VcdrbVF0kWcdbbT6oiz15Vv1LKtU3Spv9XFCxhjYmLADv42mjnz2QXuFTo23tfKNdrNNeX2rbzLfklGv6lQ9dWzDfNVr2WnJrJ/25L22pJZVavvKa145FHuZr3y2d8pfNzYG2ZL7NKiNH3T5ZB3zY0H/c4U9wKniS8B+S4fAAQfpnde77pcuo79MegnwKy9Ir3Lza8A+18zhe4J9HlZJpz8YV3iEXt91zwzgOnOWtwWIU5aBAPksr+AZoCtYllZQ3cqrC00bBgWQnYHoGaAt2K76o51YzSCQ35UK/KUZpDBAYVCAPrG8Hko/KKd/Fx0ASHDfCgYA7Kf6iL510Ns89JaPXD/ieu5m88Dtt9/+ZFcBuA2ALQFLDwK82fx1xa/XB1wuQ17qpfnwW3VST17dKbo5badVPleGPuWmVv05mfW20gooyLfAD7IWaE+ZPMAf3gBA5dWT1vZqn+YAUtU1H76b8sHoY/Uvkjb66v33HnMN8kmnru0sGNCwPVmnoZttTfFDteu+S1N617Vb/Z1jgDLvecqTt7565tfStDnHt+ziL+TQmpS36s3Jqh3y2sqylmwon/L9NvlQ9bp7mHl4P9jxkzyymlev08vigfe86StXzfwz48+Dfwf+7Rl/wbs0Qb68tOosBfzUA6x4+N7pzNTmsoypc+7HtRoUSGC/lCco4NsNpBkoEJAD7AG/CfTlCQjIq7cWmAvEp+hae9v0bedML4ISBEVa/iMIgA9c3QCAThC+C582AOtTgH2pbb4frgJI21kfuckVAJ+3+ay3nPP47c1dQg+wCsBtAJwDQECAbXI8EJ5jdzf8trMCinFJgJcA1QMf+MATEjwyytA55/8DUw+Q5+ienZta+mDqNdKQdVo0Zda57HRzek32k/x1qQVK5gCRZYL4NdS6Ldrqx1pZuTavWcp1y0PJj2kCVJ2Vq7eUTvV7pn72aw2/cx937MtQbfY7Ynlew2YQXpem/JPyHCMph6esyqbytD1Vtoutci1n4whbWWbetu3HlI7l1ku9GT79vI0fzJzdO3g/1jMvRd4/V90DPDCwjJfZffclz1H0+nL/64G/IF5awb3yFl0C+KnH7D5gn1lvZqEOffjeVR/Htf/8E+CBON8s0AKyczLBv8EAACWJvGXOhJ+B55iZHwMAkW/pIAOAWyYvKK9UvbXUoAQBCkG91+D1tWhe8/2u+/Ta3AYAIElwvZQX6NOWfYLSXgL3tUEB6u4SAGDc1PHU8zefB5ipdBsAAQDeBPAXv/7Jd5/H/n7a4G0UfKfG78fpm134P+CrbTmwFR4Z/yP4X4Iudah7hH76MAjdNFKWX7UHRPtbaR34tXxJPnXgj5Xoa7Zlfk17m1Mb0OuSYEWaIGwJPxUMmKtrWwl8UraUL9ey1h/X+WGwRf2WLO1SPpWvdWs+6x2Cr/bX5lt9eMDwQc5HOsVb3rJTZZvByFlq3V/GS0s+JdNeLVdeadXb1l6pX6/H/KbobctTb5tOlqtve0vp0Mz4QZ/PFL2v9FPlU3nlnV4FD3DYFacbZ2JLQCbeRW5y1p+Hjps1VSC/BPCrMwf4sQsIEui7lH98GDzfWaerMHQX99GH6daBgnMBgCwDkAomuUfMupEAmQmMqQPAdrVALtdvgfkE/AYDql7Nt8A/AB9wT7sCfPoikKaP9NvZ7hal3GuBmgTllp0FPYYVAPSF1UBcJ4AfuwL/RzziEWe8Za12sw594PR++s6Bhqa8lsc96kFn7YzgaGjXNpNi13uWbdS+kKdddNHjH/7iwdUVb2gPPPOZT/pHLP3nDAAOBOT/5DEPiCSwC3gX9PM/1lexLqXUMRiArQMFi32gHGfMErQB7Mzz8DwMiM1pss5lHSM+7M71Tx0puvKVtspSlnytS35tqvaqTcrzs9Y++ptMFRyZ9/7vS7VXae0D+aozl4/6u/jgGHU2p306hu2Wzdoe+arXklUd8nwqrTLLR+WGfsuuss2gf5bm7muWUYd80rSTvHopk7csbU/x1jml9n8p3ZT6mU8bKW/x6CKvdTIvP6id3bvKk5/6UL9/blIPXOMLwD96HiZYNcBDEDNlPGAAVEmCopyVcGZCAFzBMw8ryC57MKH2e1t+DdDHj/jz9EGtf9GO+CUjGMBYBewBbAGW21KCf8a73eP7wH1zaS7gESCZKUE07SwNDlTQb6DArQdLZ/JbfbFPUnUE+AL+FqX/Y1DjFPwTAGAbwO994I+OwQcAO/YqyEamf6BLUu3X937zp4ICBgToI/3GXoJ/218SAKAuerTXl/87ujvFA3zHWQXwc2//wTERADjWOQD8HxD45yz/UuBf9bBhIGDPVS38TzoD/viE1RH8v8rkHm9AoA/RQ72r9P/MvkoZAvWzpix1W7wyaPK02cq3ZLV/ma/6tYzyNWkz6I9pChAhXxsEmLMV4+isbfsA3Va3UX/N9S7RHbpxnQ/J86GunyV2lupgU9tL6mxO9ZfoqrOkzmD27GN/EEzxKtvGEroZKp2lvJfe9yyHT51atk/e9pIWe0uuZ05nM9ibK7espdeSqS8dzF93b8j7QYfPFL2v9Pq/6l4v7bnugVMPbHhQAHABkjJQwAw3iQduAwAVME8B7PMKFEy135LXvmcefQIjzubjCx6U+ii5eA/UYICANwMCyACHjFf0t/UaHcY6+gmwK+Bl7FtOG9lmi7dv0qyrbMoOulNlAmnBdlLbkKIr4Af050oEtgYho516rTVPG1W2Jj/Xx2q7FQCobVHHAAC/WdvucS+/uTzgKoBjrQBgzLFsnxUzhwD+rUAAtmljh/E9PkDy4AuwE/jzO0d64h0PfwrJPAEBdCIIMNa/5CNm28Os5VIuR77SLNt22datdZRvo1lvStc+UK5OypJXZwndDBXHlKBI3vvfosrUbVFtD5S+jO1U2qqXsqI/d02D6plv5vQo45NU/r6S+//NcnnoLgnraaPmd7G5tA5t+al9UD5Fq37m59rfDAbXJG1ZJ/MtHhm6Uuutodq9jHS4tLPxAu+HvvKR3pfrf7sHLsAD1wUKmKkg1YABINoH/xYIb8nWBAta9assgb28OvQN0AfQp+8AfR6KBn9uLsCnvcmVHuDBlXuWqwMAswBDZCvNjerYfOyfeewPUV8QDa0g1XFtWebpQ02tAMGczLbRYQZ/KlFOW+hXkEyefqFTtzcA/JeCf+2mD1oz9+qtofotqQEAZLaTNpEL/ne9z7uMjV7n6niA7zGrADgE8GnPeMq7T3/XD3IB2AKY8/+kAnfzz/qTm5P/7fP+p3ve8pmff/KuB3/uyb++5XNP/uMDHj4meGSUoYOu9SqlDdpa2X8eEjeANsG/oP85z3no8zIZCMggAHWHdFUfNJf2e6ne4IqzT9aRrxRlZMrPKk/IsnyOT3st+ylTV1nSzdDIWUrwvSuf9k75bA9+tr0sD77aMD+onPkWGZ8Wbcnu0/6UvvmWjaky+zFlP8vlW/Ytk6pjfh+atuSh+cG+nynecumaPm2GSq2EDeXya+xW3WrLfKW1Xs0/YPgok5cqPza1PSgf2jvE51B2DtGXbuMm9cD9ggYGDAwUCMwF6pVaDm2VKaOcQAJAwZl82iJIwVaI09n8/qW4wQYi95Z7fHp/D3J1PHgzdnJ1gOAcCvieA/K7ltkG9RP8m5fWMgMPAuoEzvC1z7V8Lo9NygXlLTpXf0mZ4N4gQK1jude3w+zoQcZFN3L5PfCiv/NX3k4AgNUAgOFD9JjfA5b88z+mgnXGLIAecC/YX0qpQ11sVLu0RZsLgwD8XxuX1fLdANgD8gX93/8Dn/mK9/yLWz/w6/9q85G7fnrzTuQGB9ClDkBwsHHV/j+2+puyKX6XYZG2sn6Vm5eqa16KXF5adc1Xir515qh60s1Qb0xzwB8dy9Vv0LQpL6UNeOiaZH3pUH38kM+P+RatMuopq3zazLKWvrK1dIldbO6Tsg34XT9eG/XlW3Sfvh667mboK2mp3UH1ftdWZXnNyVc989m2sjmaZfB+bMt80lZZS5Z1Ot89cOk9cI2HEGZ1AXLM7gHgSTwE1QQIsBzdnMU/1APfpfdY7+C5eYAx5bg0ICDg3hXoZz1tQQHqBq88CDHB/hIe29riu1LB9NK8dXl9Gd8xkmcoIGsFAvaRCf6lgv2a53fi3G5+b+gqeuBaBHz37j/gmNn4Cv4Zl4D3nOVfCvyrHjZagQDaXLgdgAfBMdie4B/gD+D/2Edv/c9/eM9DTkwEAwwCEGBwKwA2htQfKgcnTHzSN8mjXvMTJmbF1YZ56bZ21INOpc1Qdl06Df5cJ6s6JY9t9KfaUK6O1HrkTepO0UH1ug969aNMmuUtWZbvw2u7RZFlsh1l5Fu8sm3U+lL05U/ZZn6bjnZaNrb16aLKN0Nnl7Sd1+51Wi/L4PmkjvmWvnqpIw/NT+oir/nU7Xz3wE3vgfFgwys6Q3HT37wbzQEGBADqztgDuBPUL+UF6tgB8FZwy8M5Qa59ggEVQAusW7QGBwh8zN0/gAM6BgcyQDAVJMg2MmCA3L62KP2lnbn+9LLugUN7oLXsf9cZ/wr8a94VAbkagBVu9GHLdY3/I/k+8pvh7P9rX/uZb67gnyAAMoIDBgFcBTC0sRlSfyDd4uwtPjqm/9J28vTYfIsiq2kzyKYSupTVOueVH5o+ux54PrSdH/PSpWXotepYP8tavDJpracc2kroK2/xKat6tcw89NAf2s6P+aSVJ78mYX+bvjrSbfqWq58Ung86+cm8vFS9mleedEpHuTTrtPileq26XdY90D3QPdA9cA4eGGcbAaYAdVYILAkGJPAnkLANaHMdPNhzTsGf/2tf95FWQICggysEks+24DMZeABcu6pGOjS5od19PwTumEWl/27X4HpNGTwggIAfawAAGfX37Uuv3z2wxgOMUQ7lS0AO+K/A/dB52sg26cOW34hx73+d/WfJv7P+leZWgNtuu+1xfEcH32yGdNUfPlv9b8nWDIUp3WPZzfaWtKFOpdhBNpc2Q7lpTu8QZbSjneSVDcVn4w8ZH2nlx8LTP+pIs2wbv0udtGl9KWXyUFOVm5/TrWXWSQqfH+sgS77m58q0p460JafMcnlptjklqzbNt+pWG+ahVd/8VJnlY8WZP9ZPFWWVpk3Lsl6WK5/Ss7zT7oHuge6B7oEr4oGNhxQCtutqAEE3oBZAvOs18bAPKMBOKyBgMCADANkX5QDw09U1u3blGPWuAfhJl7Bvx7jebvOSeYDvF3vwPe2foBQH+B0a7E/Zoy3aJBBAH+gLfWq4iQfI+y3/n5r9NxDANgBWAXgg4BU+B6Dhki4aPMC4EFzIXwW69OZ5bS39ubKW/hqZtqVZVxk0eXTW5FM3+bQD70cd82vomrrqbqO0P6Wza5n2vDbzU7TVjnUrrTaybtVt5a2/tqyl32XdA90D3QPdA1fdA4BXALpbBWIZ++bQ18bWBN57XgMCAn36QADA/DjTf9+s36G70u11D1x5DxAYY/m9M/HnCf4NCtCm7dMX+jTh2LPDdgH07v0X7LeoAQC2ARBo6wGACc9eDbEARGqvzSeF3zVht1V3St7Sbcms36LI+FCvfpRVWvX2zWu/2lFeqXrIsyx5dDKvbpWlLfljUtunjeRts8rMV6r+Umr9OX101JO29GtZ1kPfcmnLxpQs6ySf+lPy1Ol890D3QPdA98DN4IHT2f7NeV0r7REMYBbRAAQU4L/PyoPz6n9vp3vgojwAIM7Z//NY9i/or9TtAK4CoG/FL+P+f7fZAOgJAADwW8BfWQ8AFC/e+FlBCXRbwhupb74ls2yKzrVlnWoXeX4sT9lF8nP9sWwJRWdKz+uz3PxF0NoH89LaJ+VLadafqpM6Ld56lpmXKp+i6kmn9Kbkc/XmyqbsdXn3QPdA90D3QPfAfh4ANLAtob8lYz8/9to3hwdy9v8iwb/BAIMAE6sAdgoAcAZA3QIw3N3NzXGHb5qrFHgkTR5HtPItWerqwJZeyiqf+ZY97V4lWq9pTd+t2/JFlq2xeUzdVp+UVbq2H9Zv1bNMik7y1mnJLDsvehn6cF7X2tvpHuge6B7oHuge6B7oHrghPLDh1P3HPOYx4x58TuYXiG+jX/HZnzGe2E/9Vnrcox508vc+/TMW27M9+sBKHvp0+kaATXj6ugCAWwDmVgD8zv/v//nfOSOgvwUgvHjjsS0gogxq4sorrwxaP+pC+VTaklWdzCefdeHnPtZDJ/m5OkvK9rFl3aW09r3WW9Lfi9Cxn9vabumlLPmWrW3lrTrKttXdVq6dTrsHuge6B7oHuge6B7oHugduZA+wPYbl/+y9Xzv7vy0AYFAAvTWBBQIBrgKgb40tPOMZAJzm7ysAmeF3uX+lvB2A2f8MAJyuDtrcyPf2Jri2OVBTy8xDk083Vbn51IFPuXyl1pmSW35VqNdBf5Of6n/VyfwUP2XrMsmz73P9mtPLsuTn7K0tO5bdtf3o+t0D3QPdA8s8wLudef3bX/z6J9/9tGc85d1/+WlP/eCznv2sj9X01x//Nz+5JlEfW4//use/ri8NX3Yvulb3wI4e6A8fOzruvKvxZg2W2jPj/q9vWT77D0hfGgAgEPBNX/rgVSsB6At9om/llYCMreZrAJnpr+D/Yx+99T/n7D/bg/gfc/q2jT5Oz3vAHb+9ek9rvtUDdKb0lEutX/PKpVPlyqXqX0XqNVSa12JZyuTnytS5CLqkX+pI5/q5RGeufi/rHuge6B648TzAXm2A/vd9698+WZPWgP8puwQFCDTQhxvPs/2KugcuzAP9gefCXL+u4c/bfNZbvuR/+ZLVs/81AFCX+nOi/6M//yHXbQ1YG2BgFQB9o4/lqsYAAEAeQD+1CkDwX2f/OUBwsLcZUh+nxbE3ULZ1b5VVWi97rtwy62Q+ecuhU/LUSX6tfta9DLz9l9Ineell6Oex+jB1jVVe8+mnY/Wt2+0e6B7oHrgwD1xjhv953/3cD//QC15+kqkF1ClHLlVnSQAAXfSSWn+KskqA18tdmHd6w90DV98DrQebq39VN+AV8JYM9tqvXaK/LQBAOUEBtwFA1wYA6BN9o4/F9WfnAHzZl33ZV2UQgNl+zgPw0D+W/efS/3j932aw2cdpcewNkK33tOZ3ucSWjZZsF9tXsc4hrv0QNq6i73qfuwe6B7oHbh4PsOSemfYE+5UXkFegrxy6BPSnTtbdlY+AwObmuWP9SrsH9vJAf7jby33nV3nz0Fs+8qw/uVm1PB9wvzYAwIGA1ltD6Rt9LB5hfJ2tAsgggKsBBP3kCRCgw4qB2Pvfx2hxas/ezwPbxsi28vsZHAS71GnZuayyen01f1n7vW+/6nWuyVfdffvS63cPdA90D1ycB1zaX4H+XD5BegL5Kf6b7rhjDApA51Ktn+2s5d020DiY6uKc3VvuHrhcHugPNJfrfkz2hpn5tYf/CeDzDIC6BaDO/u+ywoB26Bt9LBfA+BpXAQDomdU3COBqAIF/Bf+x97+P0eLUK5xt3csqq/m83FpW86l7s/HdF5+6490Xn/JF57oHuge6Bz7lAR622M8/B/Kd4VdHAJ4g/Wu/8I+fmJ7w1Z99L4lDpOTNM6u0S6I+B0w94+lPP3nRs75h1dkD9jcpBwt+ygud6x646T3Ag1J/WLoCwwBwzX59Qf0amgEA7LQSv9u7gn/6Qt8aAQA8y/jaAOgNAjDDTyIY4Iw/eQIE6HTwfwUG5OXvYv9du/z3qPewe6B7oHuge+A8PMBsPwBeUL+ECqAF/gD+XcD8IeoYENg3GEDw4/SAqfNwe2+je+CyeqAHAC7rnSn9Ynn9MQMA/D7X1QFrggz0rbEFwKtwnI2BAIMBgH0TslPgvxkqqW/9TrsHlnqgA/+lnup63QPdA90D3QM3hwc4NG8uACDYlwr6obx/+hAg/lA2DAawpWDXgADbBE4fOm+OAdCvsnvgeg9shiypfy65Bzhg75gBAFcFrH0NoEEC+tY4BDC9KqiHbhopyzuIS891vnuge+A8PNB/d87Dy72N7oEb3QO8E/mRD3/Yy3k1EomHo0x/6TG3/prpzid/4clLn/VF95L+8Z2Pvvf7nvE572ulv/o1f+S1aY8ZF9Ktt956QnrEIx5xwuuYeCczPA91lkFZCsoMfisIkGAf/klPfOLZ8v6LnPVfGjBgqwBpl2AAgYAbfTz26+seaHhgM8hI/XPJPcDv/q4z9LkFoNrgxP96DkDVEeTPUerQx4VurGDf/MLqXa17oHtgRw90kLuj43q17oHugZvMAwD5qUvmgDmBPuBeQA5oZSble7/5lpNXPPNBJ6977gNPfvoVDzl51//xkJMPvPnBJx/7v66d/Od/cR+FR0b567/7gWeBAAMCBgegJE5bxnYmZCQAMMDdg/bgmblXJkj+ga953L0J+BPsC7h5aJS/apTrdGXAmoAArz2cutdd3j1wA3pgc7oVpj8UXvKby/+ZXYA5oH0uACCof/TnP+TsbAB+75UvpfRt7n/lJXdv7173QPdA90D3QPdA98DN7gEeigHzLouEOovPTLryb7z9wSPAB7hXgP/fPvTAkz/4L7ec/OE9DzlLJx9+4Aj+CQQI9gX1gvPnfsuf+CTg/0e/6yvufdP3/rmTVnr7K7/6hNQqQ0bdJQlwTHu2zYMfD4IkHhqn0lUJCLhNYO0hgj0QcLP/AtwU1w/o7wGAK3KrCTbvAsyXBgAIKPt/jd/9pcBfPfrW37hyRQZT72b3QPdA90D3QPdA98D1HmAmnwchwONznvCAcRbcByMpDzvM2gPoW0ngD/03b3/wCPZf8OcfdII9wDYz8IBvwPo/feU3jun/+xN//WRJ+oXXf/2JiSAAWwYy/e9/84HjigMCDPDbEnoGCwg8EJCgn6RcZQDv6gMDABkgUHZZ6S6rAjg08frR0XPdAzeMB2oAoK8CuNy3dsP/n11O6ud32v9drVUEbAPYZwUAfcL+4L7NChf28bbCWV21e6B7oHuge6B7oHvgQB7gADj24efDD8Cf2fyP/9Snj8v0Tz5wHxD2AerO777lDPT/l/c94ITEcn5n/AH9LOsHWAP6XZov4J8C+YJ6qDP8SRPkY9u0DeCvLWe7gral2FCuPbY3GNQgOADwz4CA/GULCLgqwC0CHngI/cE7n3e/Vw3+5ac99YMHGm7dTPfAZfEA4Gt8P3tsAeiA7LLcnYl+cKZMC8A7Cz9F5wIAgPec/ef/3No20KdvE92+n/iZT3rCC0j3K+iC7oHuge6B7oHuge6B7oF9PMBMPrPYgFhAuLaY1QXgM4PP7Pwf/uwt4wMQS/vRBfgjJ7FUHxuA2O945kNPfutfPGhc1g/Yr8CflQDoC/qZSQf0M8PfAv0CfYE9ABtwzZkBJkC2CZng+zwo/THhF3mpwQHL6J9BAfwt8DcQkNSyi6Q89Lr1gfuUgYAW37cF+A3q9AbwwBgAAPyXAEAPAlzim/uFj3rk4/kdZcZ+Cuy35BkAMJA9RQmGr7GPLvbp21LX/fRb/97Jj7zyuz60VL/rdQ90D3QPdA90D3QPdA9MegBwz4w+QBSQD1AHyDvDD3AW+DNrTxn7+EmAd8C/5QBaHmwAiugxsw/Id9bfGX9ktEWgAOC7BPQL9AX3BA2mkjqHCgAA4A0gJK9sLTUgAM2gQF6jQRT8mekiAwC2bSCAsxAyENBaDdDfFjD51esFV8sDZwGAL/uyL/uqoeubIY2yq3UZN19vd1kFwG/uFOBPOf8n124xWDv7zzkBP/f2HzwhnY65m+8m9iu+NB4gcNXPrrg0t6N3pHuge6B7YJkH+OH21XiATEAyYByQDjAHhPKAA9gD4CMHzAP+KUNOPUE/ZdQHFLIiAHsAf1ICf2yTcsYf8Dg10+/BfM6Q02YL8CPPMvQPBfy3AftDBANoQzutgADXw/XhX3x/mYIBGQioKwBqMOCRj3zkFywboV2re+BSemAE+4xjAgBlFcCl7HDv1H0e4H7xu7kGqG8LAFAOkF8z889KA/pA3dMg0pJbdI3Z/5//2VeOqW8DWOKyrnMsDwD+X/R3/srbSadBgL4C6ljO7na7B7oHugcO4QFmQXjwAEQLkAHjAHlBPoAO8A/o9JV7gn9m/JntoC4yEnXRBfgDTpEB/F3ub1BhDvjf9WPfchYEYOk/h+thk35WcF9l6JHok9e0DbSvKReYr6lzSN0aEOAa8cFlCwYYCMjVADUgQL4fEHiIb3K3cQEecKb/GsC/EQDoD8EXcFPWNMnr9vidai33P08ZfVjz6j8APzP/v/Rzrx4DAG/5sb97tjVvzfV33e6BfTzA/25AP8GoTIzHZz7zSf9ozXaWffrR63YPdA90D3QPLPQAwB/gzoMHM/Uklp0D/gHsgHV4l/xTjgxwz8F86FDXFQHkkVMHGQEDQCkgP2f9Af/kORAQ4IqNnPFnP7/gH+DPafoV4JOvScAP0E6ADL8vYJ+qn/LkDwn2t9mi3bpdAF/gVwI7mbgv553oh9s5WuBf2eO/7vGvWzh0u1r3wGXxwFkAgBUAPOyWFQA9AHBZ7tRMP/hftfawvkMGB2ibPsx08X5F7Pt39l/al1/fz01dcBwPXAP4MwYT9E/x6BGw+p//X//zlx2nO91q90D3QPdA98BWD3ze5rPeIvAX7AMgAZrkAfHM8iPjoQRdQD8yKcEAgCQgHOBvwgb6zPxTfwT6QwAA0E999/pzPgCz+ADDPNhP4E8QgBl/gX8F++SnAD/tAor3BeSt+i3ZNoB+3uX0ER+QcmXAZQgEcDaAgL9uBUD+tGc85d1bB3BX6B64PB44CwAA/AkAnC7h3gxdtOzy9Lb3pOkB7h3/sy4iCECbtH0aOGr2rwoZYzn7bwCgnwVQPdXzh/bAGuDfCgiwWqBv+zv0Xen2uge6B7oHtnhA4A84dIYfIA5odAafAAAAG/DPa94A7oJ/ygD/1MEGdQgKkKwD0CQ/teSf+s4Iu88/gwCc5A+4p40p4A+oFuRKrwI4P89gQAYC8BHBAHxK4OaiggGsBuBtAXNbAjgckFdKbhnKvbh74DJ4QJC/MQBwuuR1M3TOMmj/XHIPcN/4/3ieQQDaos3TMbPYQ8ymAvpd/m8AANrfCLDYjV1xhQf4fWst9W+B/G0ytgf01SornN9Vuwe6B7oHdvUAP7Y8aACoAfEsywcUAsgA5MhIzMwjA/yzt58ggSAfCoAFRFJH4A8F0FOHur7ej1l/kysBXPIv4GemP3mW+y8F/gDcDvo/9RaCueBCBgPg3SKQwYDz2howFQSoKwL6aoBdv+293jl6QJDfCgBshn5Yfo5d6k3t6gGA+HmtBHDmfy34Z0wBxBL0V74fCLjrCOj1Wh5gPG0D9buUM45b7XVZ90D3QPdA98ABPPCoR2zeD7gD8APoAeXOsAPenfmHRw8gD1AX/FMu+Kee4B9Z7vcHuFMHsC/wh5JHl+DDnU/+wusO9hP8Q7HtjH/lc8a/g/5loH8qIJDBgNaqgPMIBLCyZGolwItf/OITtgMQEPihF7y8z2gd4DegmziaBwT4ZwGA05mtzdAiyfKB7Z+r4AFmOg1mr3k7wNIzAbBpkH3Nsn99R53W/n+DAP/y51978qvv+/GTpz71qU+3TqfdA7t4gKX6b/2JH3/fe+9+6XUH/O0C9qfqnK5Y2ezSv16ne6B7oHuge6DhAU5gBcwBzAHggHNm+ZnZZ8YeGQkZ4J8VAoJ/DugzOAAFKAIo4ZUTUMA+MyYAdlYVkAT/BgOmlvwL/t/+yq8egT/9xE6Cf9qlHVIH/vsB/xoQyEAAZQRfeDA9jwCAbRAEIAn4oYB+qDz5V7/yzv6e68Z3vIsu3AMA/A2JfdmAf/bIngI75D0AMDjhKn44kZ+tUszUr32lXysYgA1sYXPNaf/Vd4wzllAL+JOyJQDw/+vvf+vJx//Vm05uv/32J9f6Pd89sMQD3/7t3/6d9/zex04++ouvOhr4NyhAEKBv+1tyV7pO90D3QPfAjAf4IeUAPUAWoA6Qzx5+wT8gDxlAHhn8l3/xw0bwD/gGuAvyocgA4vB5aCAPMgQNKGuBf2R3f+enjcGGN33vnxtn/gH9Jvb/I6ePLvuv4L+D/sOC/hoEMG+Q5SICAW4JEPS7FSADAZQhB1zNDP1e1D1w3h44CwCwlLsRANgMHUKnf66gBwDbviYX8L7LigDqCPyxhc19XME4Azgl8IcH/DP7/5u/8pNjAIAgwCf+06+cvPCFL3zRPu31ujeFB67ddtttj2PVCMD/rrvvfkcF/wSdBOyHone97SWjTWg/u+KmGGf9IrsHugeO5YFXv+xr72EfPaAKMAfANwGyXQ0gwAf8Eyhg5h8gTqDA4AAUYIgdwT8UmYfIwbu/P2f+Af+v+5b7AhDO9Av8zQP+E/gD/jMAIDjt9HyCAPi5BgIYG95rZ+2PRV0JYCDArQDmoRwe+Ng/89gfOtb3p9vtHljhAWf3z5b/E6AiAdL6KoAVnrzkqtxPwDv/J/n9A9AbEMjVAfACfsrRpQ51sXGIyyTIBGDKAADgn/SB97zxLADASgBWAQDkAHS7bDc4RH+7jcvpAV7JJ9j/+Mf/4ydP4lPB/6EAf9oR/Csj388EuJxjpfeqe6B74BJ7gENaPvQzd4yz7Tx0eLAfIB5gzp5rggKe5o8c3pl/HlIoB+AL9pndxxZ57DH7DxUQwgP+WTFQwT+rAnK/P4f9MeNPHz/yzu84ec+bvnIMLAj6E/gTiBCM5goAbPZgwPkEAzIQQJCGceB9hz9WYpw++9nfdt0WgAwAsAqAIMDjv+7xr7vEX8fetZvDA2cBAPbKAvB6AOCGv/EbADhL+HmdLufrbB56y0f4/0mCR0YZOugOHtkc0itTAQD3/rMCwFUABAT+79945xm0+5Ef+eE3sC3g9H3sfWXKIW/M1bC1YZb/5971rl85GxQNhsBRAnPAOYnXTFbgrt4uVFvah55+Z66GN3svuwe6B7oHLtIDzPoDqAHwgDSAukv72cvPnn/AvDP7gnz0eWihDB6g5xJ/wD1g7Due+dAz4P+6l94yzhCj1wL/BAGY+f+F77nlDPwD9gH9nvbv8m5fA/f93//91+35FuxRTmIrA4lVA5wVwCsCMwjQgwLHDQhcRCAggwBsA3ArAJTxYxDgMV/1mO+6yO9db/um98BZAIDZVQMAjEsCAbECYDN4qoOtm364HMYBUwEAwD7L/g0AQFkFwB5utgLUz29/9KO/Y0Cgj8/D3JvLaoWAz0t+4CX/8Hd/93evm+mvY4KZf8C/QF8KMJeX7gL4t9Whnb4V4LKOot6v7oHugUvjAR4wAf4AY2doAeYCfYIAgClAvrP3UGf0AdLkWQmQe/jJe4Afcmf3pamrTPDPawQBjcz23/Vj3zKCNUE9AO6VP/zKk9e89rVb05vf/OYT0l13vf3kXe9+98kHf/WD9/7Ob3/0k1DyyH/yrf/g5LWvfs4YJOBaCAaYMkjQ+f2DBBkIYIWG442A0zFWAzBuc9xMBQH6bMGl+Tm6GTsCqN+QpgIAEQToAYCbcYQc4ZpbAQBm/1sBAAICuRWgAj7zLAFnmwDnBbAsnFliQGM/mO0IN/AcTfL78/rXv+6feJ9bFNBPgIiVIgSLAPhzKYMB2wD9tnJsoUN7UPKkfc/JOEcX96a6B7oHugfO3wOAf5JgLME/QQCAL+AfMAXof//bP/0MzCfAzyX8CeiX8gYQCDgwO7sU5M8FAt74xpeekAD5/EPI043//a/+nycf+8gHT3hoISjwbz/8Gye//N73fvIdd79h/CfC2QId9O8P+ls+NBDA1oxjBwI8EwDwX1OuJDn/b15vsXtg9MAYAOAhmy0AADNm/03IewDghhspl2ILAIApzwAwAJCz//IZBADoAfiWfP77J/7HCf9ff+3Xfv3fACIJDhgYGO5qD2hd4qHN7xGrO1r3OQE/s/0Ejni+YjwJ/HNspdxynsngodtA/ppy7JH6WQCXeHD1rnUPdA9crAeY9Se5jJ+Zb0C+y/SZ2WfpPGAYYP57v/XgT5IE9YB2+X3peAjgsNXgn/3U3zp55c+9e+vs/hzwp0zwL+UfCP+EmMngnxWJBx6i1SQecAgK8LDCEjcSAYHXv+b5JxyImKsCAK55rkAL5F42mX1u0Yvqq4EA2j9mIGAqCMA44dWArBJgq8jFfht76zepB84CAAD9DABwUKWBgcE3myGdB2A6jzZuylt92Q4BbAUA+P8o6G9Ryl0NwGwvwQAToHBNIgDP++Gf/9y/8RJXDHC2ADO3jPvGyoENsob8phxPx7xogjQEb/Ij6AfwMwZ4fqogf0neAIDgH7oG4FddAwgCf8rlz+k385i3otvuHuge6B44nAf4BwrwZ1894JYZfhKBAPIAfk/ZZxn+733gj153SN++YL/WZ/WA2wS2Afs15YJ/Xz3DPwWAvw8xUgMCBALee/dLTz78zr8/BgR4QCEQQFCAwASAFbBKMACaYPqiQPTadrPPlV9r61D6BgLozzECAaxeIQhQVwCQNwjgeRGH+5Z1S90DizywGbTG5f+AHvb9M/sP+CcJhigb9ADnxwLo2qY//XNAD3APL9trAN0C4KwtwA1Ax//EFvBPGcHymgCFrUSQoJXUxW61RZ5+8H/5J972qnE/N4EC+kh/SczuEjiQwnOIMemJdzz8KQRbTr8zmwPeyhveFLP+bOMQ+BMEcGk/9yTHi/dDapn3yDzlNRkE4JnMQEAF9rvmBf9QxsMNf9P6BXYPdA90Dyz1AOCfA/U4XI9T9tmDDfD3lH0P3SMIwIqAXZb3U0dg737/FkXnD++57wwBtiKsAfhLdQ0E8A+Ff0o8dAj+pT50QFkJ4EOJsxxsFSAYQP0MBABayUMPBYiPbUfgn8Bb2aHbXuMX+0Mf8q0BhzgfgCAAbwaoQQC2mnBOBCsB2BLwF7/+yXcv/R51ve6BA3hgM9iYDAAIZALMHCMAIPi/1mdXD3BHwwSn+PP/ldf55av+/uMDHn6yS8IGtrCJ7WhqFcu48v+h4Iz/bfw/TLC/jff/5BzFpuXJK2tR/y/vS7kmDoQjUGBwgHfVA3RXOewmUCZQxTMO4D9n+3OmH39OpQwEoGPe8VXptiAAAH5pEEDdpPD9MMCbYOD2S+we6B5Y5gHAP7P6zHKTAPm+Vg+ap+0DyJeA/xbQtx7bBHybAGcKkMi7fYA3DLD8nzwH/m0D9YD5H3/jd4266JM8LBDKTD0//IJ+Zv9N1OMfCjML/+5f3t0MBHg2ALP/8CRnMIiEGwigPr50a4AAeg3gPTTYXmPP/gq6DWIoX2NrTncXe/YJ37IqhYddkoEAZPJr6NwqAA6F9M0AzMIu+zZ1re6B/TwgsAeQwDP2nP2HMlOLXL2htUMHAM7A/2B7DEQcoY39nHQFa3O/XFX3rgd/7k5gfy5AgE237p2OjVVe4nA+trclKAO0Abi3gf5jlhsM2Bf4z9V3xR+rCgwMnL7ScJUPbyRllvxX4I+fAP8m/Wa+UgMDAn/zBgNyrMFnAIBntgTvAn9l5rfRaod8D/bcSCO1X0v3QPfATh74vmd8zvsS/MM721/BP+C2LtU3XwE/clYKcGYA4A1A+L3ffMuYWNI9ldAB5FGHwADg3/3/gHVWJBCEMGDwhz97y8lUIpBAynLeJmD6/XfcdkLCHtdK8IN/YIJ8Hmp8+AH8mwD/8lICAUTKSdTjtYJuCxC8XqZAQO2LoDyp/ZZaNgful5ZpS7q0nn1hnBgIEPDvEgSY2grAKgDfFGEQYKcvWK/UPbDSAwJ7KDNwGQB4/Nc9/nXk3QYwmN4M6RgBAOxuaOd0BYBBgUHcP2s9wOz6rbfeOs7Uz4H4Q5SxGoC2aHNlP68BfgVrgjNA3jEB/hLbBgGg/E+WVlA/Ja96c3lBLZTZYrYSEHS7mVbCcDBjzvinT6rvqs/RzUBAgn6Bv9QxltTl/wB1eUH+GvDfAv7K2BKy8rvR1bsHuge6B24cDxDhBlA78w/4JwGGk6ID+P+tf/GgcfYfCsBP0A8P4OeNAQn2Bf2CegAcOiSCAzUhF+TRD5ZiQ1kNIJiHjm2fAnyBvnLKMmU5PAEBymtggP5znawg4C0B/CMjGMDeRKhgv1JXAbgSgCAAPD68zEEAQbcgvFLvQ6Xqteor20a1kXRbHcupQ5/Isy0ggX/yBga20bmtABz6SOI8gGc9+1kfu3G+/f1KLqkHrgH8Ta0AAOcBHDEAANA/O1jtFERukA3p0IGGweSN/8GHj/78h5wL+DeAQBCANtcGAZ75zCf9IwMAgjTA3BKQfp46gM41CdDa0q9gtuYT+OIXAiQEA27kUcsp/0xy8NyDP/CBfpnyIXJ1pBkIqEEA8wn8HXeCfmkF/TVvcGCKCvql2GWc38j3sF9b90D3QPfArAcA9sz2EwCA1gCAQQAOAMx9/+7bJxAAgAeQAXQFu4B49A0U1GCB9aUs9880ygeg/okPffXZtoAE9MfgCTAYEGCFgMGAl73kaWMwgH+G7v2vAQAOBATwEzEH/HNIDgmZ2wIAqwmkBbOXgSYITz772+JTN/kl15T68NqHX1IfHesw7p71JzdngQCCAGsDAVNbAQhAffBXP3gvqwEYC6ezs7Pfq17YPbCHB+4XAPAAQGb/SeQBdgYJhrYOBczHWX5mOrW9MAAw1jvth/weLti56qH8sHMHakX8eF4z/4J/qSsB1vxmAW4BSAnQzjMAAJCsgYRtMsuhUwmbU2VVLoCt1GAA/mBlwI14mBzXxb3nWqtfMp/+5BnHspbPXA2QY0oemkEA84J1aYL7lizLp3jrQfs5APWXque7B7oHbhoP/NWv+SOvBeA7+58BAAMBUM4DcOk/wBygztJ8AJjL9QX8AH1BPXQfoH7vv//iE1IGEbDfSvu0k3UNAFRKkIMZYM4QYLY/k8EAwD4pAwAEAcj/2w//xriqAJ/tCnaXguJ99Cooz74Ktitt1VE21xd1pGkX2VRd9dWBUhd9VwMA/jMgsG0FgOXPePrT73cgIAcEchYAQR7uf3814E3zE3lRF3pdAAAADuAX/EM5B6AEADZDZ5eC3yk9gfvZ4YMAR88bGOzbRta3zhQdqu390XY1pBzKp+bvk17wX/b8A8QF5edNaZs+LHUDwR8AlADNWVkAXgXmx85PtSnYzPKUKZfO9bPWq/kKaMlnIICzhJhNXhNkWXovzlOPPfGAYsE415nAvvplW16/LVkFIOh3rEEJQpkE7oxLeWgCfe4DW0ShKdcG1Lra6ecAnOcI6211D3QPXBoPAOor+DcIACWxQoDZf0C4wB+wBfCHuipA0N8C5ylLsD3Hn3zgc07+4N/9hetWAKQdeWwkP2dzaVkF/5k3EPCOu98wbgcwEEAQgNl/Z/5bFABJJBy/A1YFrgLZKcC7Tb5v/ZZ9bGZKcH6efPYh+VYfWAXAuRIEAUgEANYGAVgF8OIXv/h+QQDOoSCIQyII0A8EvDQ/YzdiR66xvJ/tWaRWAIAgAPIdtgEAkjdDEjSn/wTQYwAA2yQDAOUcAHW1h81MWZ5trOHTxlp+TTtH0+VEfoKR5w36a3v0Yc3bAfIcAAMBADpAXwXTVbZvvtonP2VTObSVtJV6aU+5spaNlAlqpYJbASwrAq4oqLwGOBb8Q3lW2RYAsHzKf/ppagWAgF//ZfsCd0F70gT48uhjh7be/fM/efKLv/yzY/qVD/zzExMy+4L+jb6V42g/bN1w90D3wNX1ALP/Hnrn8v+k8r7yD5AN6BL4ExBYAvoF6EvBt3q/94E/uigAQL+sc0iK3QT+lTcQwMwws/4AfsAhe8UF/7kSQB46LicfzhjAn4BawSx8C4wvkSU4XqK/REeb9m+KVltuBUnqORCuGGlda7YnX/XI0w/a1L7tYzsPljQQYDDAWf5tdGorAFsAuNcEe3g94NX99veeX3IPXBPcA8DhmfF3BQCvpITn4ZWy05nHzXBNgOS5D+We6L8JxQTXZ+Af29lGacc62LluxUBDL5qaZLV3KDrZ0HkVcO94S8kxTvuvAH9bnj7QF/q05PpZcQLgAiwZAHBJuKD60LSC8W32E5jP8YLTOdpqK20a/FAmsIXmagAALID0qgWIXfafABye69Vv8AJ+qPKk8voJqo8E3o6nFq3tZxBAoA81WIFNQD0An+cqk8H6Si2HUofDHZd8H7pO90D3QPfADeOBPPjPVQAtymw1gAuwBRX4A7adeV9C14LzbSsAbH+t3TX6FfS38q976S3jjDHgkL3iUIIAvDqHQACAP5PBAf4xccggbwoQ7OLfCngFt0uodpIuqdfSwQb9MdkvxoFgPsG2fILuOV79OUr9VrlAX/stHWXqQFkNsA38U86BgM973nPvYel/JlcBEARghgEQdsP8IPQLuSweGAEw4Js0FQAgCADIIAG4T0E3dac+o93Q3QyKFWyfAXnbb5w1QL2zpL1KT1cLoGcbA3v2UTZHN4N2pqprmfLMD1Uv/vPIhz/s5Re59L8GBegLfVriGe4ny6kBZAI1wJbADqBXE2UpW5vPui2+2kPH/kxRdbSXNpK3vEXVa7VRAwEGTPAbqyj4Hi3x90XqsH3BIIYAnHsOz/UI+lvXb1mlVRc/6RvHU46tlNkHKAGABP7IAPwA+AruySMnQN8qa8k47PAifd/b7h7oHugeOFcP8FDH3v6P/uKrxgTwh5cq59A7lv8DENnz757+JYBfnV2BuisAOANAW0nXAPl9dFugXxlBiru/89PG/ZWctszScV4dx6oAPhX4mzcIwJYAdFllIWivgLsFzqdk2mjRqTopp57tIxfsA6YTSG/jBd9L6TZ7WW5fltpWXxtLgwBTWwFcBcDDRF8FcK4/WzdLYwDajTPvAvGc/Qf8GwDgt5wgAYCNekOifusz2kUv9AXPZ2WW275nDVCHpc2U5wGB5K2DjraRDZ3YDCnbOOMjQIDO/VJto6VzKhv7HuXkL/zDfWPG/V/f8rmrlv9Th/36U4kA5a5BBfqC/aWgFAAL+BKcAeAAcgLiCq5b4HlfWbalLWXSlCMzIVenysgLWlNPW1NUO5W2AgEC2Mt82jzfV+4v/ccf3OME4PDpq+T1X/VF6mQZQQbHUqW0g0yfOfMPRUa/mLFvgfh9ZD0AcOE/lb0D3QPdA+fpAWadWQHgAYB54F/yAFOWugO8BfIJwjk1P/MtflfwPRUA2NXePvUE/C3K3koe1jjlGWogYIwADH9aqwAIBBgEYDaZIACvHQR8C94TiCdIrzz6yqy7jaqf1PYq6AcwC54vA10D/Ktu9p/7tm01QOtAQAI8zDIQvGEVwIu/58n/4Ty/u72tG9oDAuQxAMDsPmANMG4AAGoAAPAPQBd0D57ZDKkFgEe7AnVsFoBOvfst/afdDABQpybaxl6m0h/7dHZttIWObUZfzlYg2I62yBs0gMprI/Kt6x/Uzvez6+z/tgCAgQH0dtlasGYVAPeUVQCAMAGb2wAAdi2Q3JJX2Vy+ltmGcinyKT7L0BGoSrNcmTTbqzLLrI/tTK0gAH7DfwRTTsf8+Q7ELa1xYB795pq8XgB3Jq6Bsnrd6lda9fSRAQDAPMkxJTX4QNCJ9tEX9PP/dh+gP1X39a9/3T/Z4qJe3D3QPdA9cON4YGr5P4f+5TaA97zpK8/Av2DfVQDmW6A/ZbsC79/7rQd/kkMASWkPvtoczyIYXhlY5YfMt8D//3jTg64D/oB/H9CYQXYlQF0N4EoAAwEEAdg2wIPC2iDALgEAAwQEAOBpEz5ny5NP4HwZ+Ars1+Sz/9uCAFOrANjq4QMJDy+ApBvn16FfyQoPTIHNKfmcaepsSIBZl/cDwuANAAj+oYw7EkA9QDR2sn3zI7gWqAvAbVPATTn2aNMAA3nkHEioHhQb2kuaoF37Xpf10s4Ujx2vraWDzZSftpXXPogu5LPh/8AuAH1pAAD7/H7VZf7b8vSJuoNXNks8w2tPcysAoAzACKgD6M2lJTpz9QWSVUe70Bb4RD/l2klZrWsbczq2q652kWcyEICvSAJb/r9fptcGPvGOhz+F/tl3rofrt78ZBEBGmdeun/SBeX0ktZy8vsAWSeAvpT14/De1xH8KyO8q7wGAJb8CXad7oHvghvAAD1S5/N+l/wn84d9790tPDAAA9gHTAG1O/Wc7APkKzGt+XwBuACDbatmkP/TR4ERL5xCyDALk8n9m/wH/rgLgAYuzAZhN/8E7nzeuAiAIMLUawIAA/8R4uwB1BenOzOdsffLq7UPpp8A4wbSy86C2u6QtdfehtrMtCMAr//IcAHhWAXCvCALwoMJbAW6IH4fLdREC10qP2cu14HGqb8rX9HV89d9QYQS1AnCA9VQAgKAAAQDKBcLUH5LtS8/AP7okQbrtUZ+2BP/oZICBMgIA1CMJ+NHPpLz05zqgjn7agVcfqn30sIesBh9SXz6ue2Av7kO/WV20DYy3yjMAUJf6v+UzP3/8P8P/F9PaLQa0Sd/o4xIPMQ5e++rnjPuwAWcANwMAFeQJDqdo6gsMW7pVL3UpE2xKLScPr7xFt5W37Gsn68KbqFOTQQCowBf/uRpg8D3fzYv8XANw22+vRZrgX55r+fe/+n+eXTe6Ld+kTPtQ6gv+pfgk7ft/dVdAv6Ye/797AOAih2Bvu3uge+BcPfB9z/ic9xEAYH+/e/2TGghAB2DtjDs8h6Px4AEABWxXwF/z+4JuAwBsB7Af1SZytikQmDh2AIC2MwgAiPRBLMH/2JdhRQK6P/2Kh5wsXQ1AIIB/SlNBAEB+gn/4XYE/dQkuTIF/wLUgeRe6Kzjf1taudqfq0d5cEGBqFQBnAXCvSDzEMFt6rl/kG7cxQSt0nA2HDinlQ/Yon2wD3s9SuXWgmyGZ184UHe0nEAZ4MaYAavCtFQAGAADq1h0a2AxptCdNUI0tksBa8Czottw27YPAPmnqyido98wA27cNbGpHfcost0w95AYf7C+2kZsv1z1kL+7D6/YqeG+B/ZZsLgCAPnb9nwPdJQCAjTWvBHzVK7715PWvef548jrADUALmBPcCRqlyOXX0Fa9lMELLuEzr7xF6QNy+5I6llVbyqWWk5eHkjeRb6VWEIBT9xnnFzVKWYlQZ/+9HvxDnwXmCdLRSV9mXj5p+kY/0K5BEdrAPkv9/X+6BsTvq9sDABc1Anu73QPdA+fuAfb/bwsAEBAwAOCp/4BFHzw4hf0P/sstWwMAU6C9gvipPAcAEgSApk4r0IDsY//Xtev0ss4h+ZMB3LP8Hz/oEymz9wQiMlAAD1Bn5phVANu2BPCPkJNusYXfqetKgAwC7Ar+tUcQgGsABFeAvA2Ibyuv9uby22xZPmdjnzLsTwUBCHo9+9nfdrYK4Pu///tHPs8C4IGIh5jLfNjTuf/Q7N6g4HUzmBhnjgF6sccbuToDe/DPZrCo/SUUfVPqKxuKt36otwEQCGoBv87uwwP2Xf7/l5/21A/KO0tP3QYY3mAXOeWAbWwB1skL0GnTcsrQIbnNQH11sEMS9CdNQG9/sK9c+9ahHexmStvKsZFBAPIm2uE6h6T/B/biPp+3+ay3nEcAYNdVBvSNPi71EP4lAOB5AK4CMAggyKsUIKhsiqc8y9SvVB2pIJ68PHXkoTWv7lp5rZdtWAbFLrSV8JUAGP8BfHmV3UVtCfiJt73qrJ/2W+o10d81QYCWD/QVZekDgwBQ9/nvC+bn6vNMRblU3R4AWPor0PW6B7oHrrQHeOjitX7M8k+tAHA1gAEAgDWAFjAqyP2OZz506woAAPehAgCeA0AwwrMHWoCeMnRaZYeScTYBtggAGARwCwArEQgOVPBvnjcGsKeSZePbggCcC8Bec/zubL1BAIMC+wYAnP1vgWdB9y60Za8lW2O7Vf+QsrkgwNQqAM54cNaCBx0eZl79sq+9pwcCdvqZFLyNYFjwCAUEZn6wvhlS6k81qI7l5qFTn81QYEp9ecrkoWfL2+GjDN78wE5+tDUGALhWgC3AeE0AgN926uGnoaWNiTxyQbXgPn0KX8tp+2nPeMq70ce25QJ3qfbMQ70G2oUnacdrQk8e2ybtEPBAZv2kabdcs76cdPZ5FDzqEZv377L/nxn+uRUAdfZ/1zaoRx/X+ILfNIMAgEJ+6wB0gl3BI/RQKQGl9hNQUp55eSj6LdrSmdJDbsq20oZ9rNeMvJWaQYDBt2vuxb66t9122+PqvbP/2WevM1cAOGOvf/P64a0jTVm2QftsJxCInxf1/7Xt9bcA7Duaev3uge6BK+GBv/o1f+S1SwIABAdqAADQaQDgG2+/b7l9nYmv+UOAbrcBMLu/ZIafIMB4HsARDwV0hh9A/5s/fF8gAJA/B/4tR/9Hv+sr7vWAQPf/V8pKAYIALDVnG8HaIMC2IAHlcwGABNcC9ZTtymtrKd21nV3rtVYCuArA2X/PBHjNa197dhYA7x7+v3/jnWNwje8O3zNmLK/ED8PxO7kEmKmzGbpzBqoNAAAABXsF5FpP6tWYn6NN3Rn7Y9/o35C0e11fT8soH+WneXSnPpSNuoJsATMAWYCdKwCYmXcVADqUoZf+YcUE16H/BNba1J+CacqxQbk2MwBgfan9SmpZgnWvCZuU03fr0G/rJLUfyKaCALZB//HfafKeDNn7fSyT3k/hUILNQ2/5yC5L82sAwP+3lfIbtSv4pw36Rh/XXC/jiRUABgEAhYA4gaTgDpqgMOWVb+m1ZNajjCS4lLZklrVoyuCxnzR5y1oyy5b02b5D8RkBlFwJwFsCzuv/BW3V++Y1ZD+VcZ3019UAGQSgDD38U+umDD0SoN8kCD9vahAA2gMAa34Fum73QPfAlfUA+/+XBABYBcAhgJ4BAOAFhPogAiAS3FfQn3l19qFuA+AcgCV2AOEECty6sKTOGh3B/zj7znL/oT1kUFYEONs/RdVbEgTwTACCBdy3JUEAgH2mqVUCSwMACdR3BdXWS1tzvPpraMvemvrqYodXH9ZAwJJVAAYBPvFbzzv50M/cMd4vtlhc2R+Mw3Vc0AVtfSzfDIXXAeoEqAn6BLfoR9KOtFWmTJ370QTPYXusR7u5HSF17VOVDTZsY2Cv+yg/CwAAfgG9UIE94Nkl/4J/AgAkdEjo4B/7IE3/Caxtw7IE6dghAf4zAEAdADk0E7rmBfGCdu1Sbh/pP3XIZzAgbStPe9hKu44Fr3Pw6mZI+hOan5TLZ/lBef5PArR3SbkCwP+3lbL0f9ctBvYJm2svmlUABgF4VZtbARIoCggFfDVfdWt5q14CzASVCTiVtyg2kUu1lzLLkNWUZdaVWmYeisxkHpqpFQTAt6cBrbW3ZpU+5w9kACD71eK9Rupwz10RAG8Z9fBb0soD/PkfmQD8UOAfm7vYev5z/8ZLVjmvK3cPdA90D1xFDywNALACgADA+9/+6eMy/hoA4MR7AXYC/sqvAdZTupy27yqAKZ0qB2QTvCDR91q+Tx7bv/A9t4yHDnIOQrWfwH8uIEAZ5zEwwz+3HYAgAFsGeE0gM8tzQYAE/slPBQGQA3wBvQLgpFOgWnnqzvHqnzetfcr2a1nNo8uDdqZvuuOOkxe/+MVn5wGwEoBtGjx48ADCww2JAABjlu8I94EgAKtvruJvxgH7DPDaDEkA1qJN8A/YA0QCCAWBPCiTBIDQU/u0MaYsy/LkB137QR37OL6n3voC/grsLYe2+mN52MV+fsa2rZ8gWJDMdcMDiknO/LcCANRPn8DjO3wmSMcWCV3LbNdgAhT7BgDsgzbMawtqGbYE62mXvmMPin14KHWh2oRHhzz1TdpMSv/x3eDQzWnyXrZo1RmqHOdz7ACAAQGClAL6tXSXAMDgrWuAR4AqiT3sgEBBo6D3EBSb2tG+tAJN85TLz1HKSIJX8ylrlaUevO2pa38tM5/Ua4DWIABvCMCvjOvjjMzR6ngP6VP2RT7ltd/kuTZXLxgAyjrVDtdIHf4v8izDykbfhrQLYK91dgX+2vn2b//27zyir7vp7oHuge6By+GBpQEAVwBkAID97T54QMf97gO4rqC/5vcB29ZduwqAegB1X1lYQbp211LssIQfu4D/bfUzGNDiCQIAELcFAdgKQACAQIBBAMB7BfmZr3wNAhhImNsGkIB5iq/AuZWfqnvR8lZfU8ZKgAwAsPLlec977j25FSBfCWgQgK0ABAEYt4wZvisEAe588heunnW7HL8ce/dCQLYZLJmUSSfBP6APIChwJc9DMikBr4C70gTntJ/l0Z+zNw5QnnVSf4q3P7VP9u+0Ha816dgf6nmNAusEyIBiksBfKmAWRNs+7dqnalc/2qbltgF93nc/98OAdHQB4/bFvrVoBe2CeuyQsGkbz3r2sz6GTfuvPQMD1K326KeJMVB8y7hKv8ojr4myo30OtQWgzvKzdL+eA1B1lgQCdtkCoLNYPm4AgFUAngeQwE9AmBS+JuoslQmqpbaXefmk8DVPm8qlLVktU0dqOX2BV17zyGuy/60gAH7lu6nPD0nZZkCggfbpk/1IyrVkPnXzGuk7yfK8Rssq8D90AEAgvyvlPIRD+rfb6h7oHugeuJQeWBMAIAjwnjd95dlMP7Pp+aq7O7/7fN4EQEBhl1UABgEOtRIAIPfxn/r0EcxtA/5ZnsC/tSIAGeC8FQQA+JPcCkAQAJA5FQSooL/maxDAckAvYDzB7xpwnvVa/Bpb56mbfa3tWlaDAGwFqAGAPAyQBx4DAG5bIVjEthSCLtgFvFzKH4jjdeo6MAaIHpraDOl+csG34BVqAACwKACE1kCAgFAbUm21ytGZSoLMrKdNZCm3Danl5NUr18y144OzAICAWTAsQBYktwIAAmp0qJc+0W/VLnr6D0q5dmxDsG5fkMtLbZM8Nkh5f9QzWGFQgbwBAAA/tr1G5FP20rb3hvvhCo2Wf723vvHgVGcgx/sc6xBAwT0r8AzGE6BUvpTucggg3mIcC/6lgEnPAxA0JhCUT5CYPOU135KhIzBNCtDM/JRe6sCTaEd+LbVupbaPvJW8VqiJa3BWnYAKKyve8mN/94Qxe+hRyu8RbTB7rw/sxxRFz7J6TVVOnmuhDs8uAv5KeaahfFfgfoh6TKic/nYc2s3dXvdA90D3wOXywNoAAPuYPVWfGfUv/+KHnT14LD0IEACfgHhX3lUA0DU2AO4GAajHdaypP9YZbADkWfo/BiSG/Fob6GcwIHmCAMzEGwQQ9ENN/MPknx5BAHiDAIL4pTSDAK4CEJgCggW+FRDP5a0zR+fqX+Yyron+eSaAZwFkEIDDAHmYIDgDJQBwz399zYkBAO6920VcDcB38XL9Ohy9N2dgX1A2tLgx8SDGAy8zVCSBNEBPICugTCAIr26lABZl2hGMKzdvn6TIqZN6yEjKoCmzjaynrnZPr/c68G9bAGiAcCsJzAXTUuQCaIGz7esn7FKmXfhalvYA4TUAAFDX/9ip9sgbBJCqgy1skmiHPJR+I7P/8LajjaT22XuO34pfrxtPliUd/O84HNjjfI75GkBAPr9FBgA4M2Ap8FePVQNrXgOol3L2nwAAM9WAVQFlazYYQFhBo/m5stRBD0Ap2K/U8koFrknhsQ09VLJd7Upb8npd6JAMAhBMIaiCb9luMfie8XqwD78N3C+SQN0+6Cf7rXyKei1S9AgssNefZ5QK+jNPOc82dQl/zR8C6Lds8H/6rT/x4zfb/+CDjaNuqHuge+CKeWDpWwCY/eefgQEAQS9giBkHZv9ZBg+woWxb2gUs1zq7rgLADkEAAhn2mXy1P5dHn6X/hzpTIME/PEEJggAsEfftAAJ//0maJwBA4p/pP33lNzbPBCAYINCvgQHl0lYQYBdAPgf+LdvFrnW0AVV2HtR2acsgwDOe/vT7rQJwdUYGADgHIMcV44hAAN8XVgSwouSK/YTs2l1B1wh8Afo5I5sADV6QLaAW+AEGAYhToFB9QHfy5LWBPO0niEduErgLNs3PUduA0o668F6X1zo48mwrAnrU4boEzYBswb1UkF6pAJq6JPuhn5QbAIDW9gTn2OacCwMA2Y+sn7z2bS+vg75hj0QbJHjuI4k8OvBsr8Fuy17apu/4jHulP09nSzfpV8uSDuWOxYE9zueLPvehz99laT4APQ8BbNlg+f6+KwCwSx/XXD3+ddaf2WmAv8lVAABKQKCAMGnKk0cn88lbHxlJgAo1CNAqq7ron0eyXfpNe1LkXktS+y5tBQEIuqy5T9t0+S0yANAKAtiXJZRrQQ9K3wH/rIBLoD/FTwUAWmD90DL+R5P6AYDbRksv7x7oHrhhPMBD1NK3ABAE+PA7//4InAX4gBbAqvvfed2eZXM0QdA+vKsAPvGhr74OWC2xCfiivwQBxtcELgwCUA+gxlsQ4Je0tVQnAwH4lSADS87558Q/TqLhAn+o/zRZKQDg5PDAuSBABf/mAf8Af6iyXAWwFlgLko9Bsy/b7Kdu8vg0U5Yt4WlXPey4CoD9/6R6GCArAEg1AOC4cBx7uOV5vf7pAn/IBF1jACABWeXr7L9gVirYFWQKDC2vlAdeUsrJC7rlBeuVYp+62sly7VqWbchblvUSuHL9lKEP8E1gzbVmEvgnWFemX7Bhn/WRgFrb5GnPcuoCvhOgZwCANrSvjUptV5uUU8eAggEAgwHIbQ/e9qlnf7HVSvQdnzl2DCaZN4iTlLJh/G+GxBg86od7vsvS/G0BAJbu5+w/qwBaQQJn+qcofaOPa5yAzwkAAP4B/IBHqIm8h8IJCqUJepNfUo4OYDppC/ynLPUrT/7QiWvSprz9NU+5PNSEnolrEEjrX1YC4Ps192pOl+8NtjPVlQD2hz5v4ym3z4B/Pjy78KwyBf6VO7lxaIDfskffBP7QX/nAPz+5/fbbnzznq17WPdA90D1ww3iAZbZrAgAEAQD9gnsBDHnBMDPrlk9R6+1LcxXA2q0AtE2f6SNBgDGYsQDQA8xZ+s91es37XketbyCAtu7+zk8bASbg3yAAvIl/bqwS4PR5ZPzD3SUIIPBn6wEH1AFwBdiC3SXUOsegrfZrOy2dBPvwLZ01MtukDjwP4QAWwD/L/6HcDx4yeKiBug2gFazKAIBvDDhd7nnD/NaUC7kuAJCALcGwgE2wDEjh4dckuGS2WJCYwJNydaE1n7Jqm3xN2qINeah6KZNPwKpMynVRV/Dq9SLz2gTOgGcBtBSgLHCWl6IjePa600eUZaJPlNseW1oA5AB0eAMA2GWsQ1tJm94H21QXm9jT/mh7sEe/aUvgD48Me9qoNvUtfceH+M8tIwn+HT9Sx9gwJh2HZXgePLsZD8odAPsUCJ+S5woAl/lPUVYCsCJgylZLThABe8MVb9Zctaf/C/QB+74OTjBJfmoVAEBR0FtpLcs8/BIgio5BAPiLTFwf7UvzGlrXTrmJa8CH+Be/EgAg8DLcq4MErvgueL+S0p59sy9LqH1N8C/A30ad0OA5pgXaDyFL0C/wB/yTDuXTNd+jrts90D3QPXBhHuD98+wf51V/APy5xD8jtgEI7J05B6gCIH0TgCsBpOonraB313wGAXKP9VJ79B0gTxCAJf1z9dBjVp7Zf1c9zOnvW+Z2AIIAP/A1jzvbUw7gJzHzTzIAAOgEcBIE4JWCLucX3M9RZv8F/gJbgS50G0BO3WPyc/2oQN/8XJ1dyqo/aMfDAA0AQNn7WAMAU6sAGCuUcVbAmH7vYye/9Eu/9JsX9sNw3IYFXtBx6TtBAMGbQDhn/wFvAGPBM1QAmEAxAaPlUupQrg3l0Coz36LYyDpVJ8uyDXn183oEp1DK0QXw0pbgGcq1SuFJzpxDlVlHf2AzgTTyTJTbFjYE5mcBgAGkE2ihDJn2K9Vmbcs+aw8qb/9tE0qiTsuegYD0p/4zCEAAAF4512ewBfnpCgDH4XFH+2D9kQ9/2Mt3mZ1fGgAA/APmWyB/Tkaf6NsaB+BTQCiz/QI+AONU4rkB8CighCaYVF51lEspB0hbdxsv6K/6yo9J6XPat+/Ka155Xqv9NgiQ5wE885lP+kdr7tmULr+x2K3BG+5tKwjANdmvSukndXYB/wQHjhkAAOzTr6QCf+iP/MgPv2HKR13ePdA90D1wQ3qAcwCWBgD48f/IO7/jbBsAoAVQ6TJEDgJ0T3OC/Ra/LzjO+jmDmvI1POA+DwesdSkHkDNDfszZ/9queYIA3/etf/s6sA/gJxEEgAI64f1nujQAkMv958D7HFieq3fIstqHY4H82s5UnrFPoh8vetY3nK0AYBXAu3/+J8dVGcxosALgE//pV8bXAbZWAXifxyDAAP79EEC4AX94BF6b4do2dQWAoC1pgmUBsgBQYApYhJcmCFWXMnmpgLLapRxZS17tTOlho9UPbdsH6nO92Rb1aCdBtgBfKngW/EspF0B7ffYDm2nXa7EdbADABegCc2xShtz2bce6tmkbtqO+wF+KbWwy8w9vu8i0Zb9bFP8J7B0vBpDI57hRj3LG3ZAchwN73A99AcyvnaHfFgCgHBC/1i5BAepQn76tuXrAJzPRgL0MAMBnshyZYLEFcClTnrQlR5YgVD4pQDTz8DVpp8qPnbddrpO2zEPrtSMzCa6ZpfetAGvvW+se89v7E2971bhaogYBaAsZbdM3+9Ki9m9X8O8zC//vjrUCAPDPKoIE/vKnAcGWi7qse6B7oHvghvXA5hde//WzM/+5KiDPAQDsM2ucSxJZBWAQYG4FAEEBQc8+FDvM4h8qCECfAfi1TwQAAOEEPM5j9j/bp20S2zXYXy7gNwAA8E+eFQF8+Ee6LQhAQENwuwSoq9uiS+rvqtNq71gy+rjENqDfAIA0twFwXwD+PNSwGsBtANu2qxAgYBVAfm6wXx+B12a4rrMVADyE1Vl/QVwCuQqSAYYuURdoAiABny3QCLAUeENTp5VXN/Xmth2k3hSvzaQZRLCeAFqA7fVBucZWUkcAjQ2vC96kTfK0R566gvEMAMDTFmXwtiHVljTbUIf6CfIT7CuXUgdb2kl/yOs7xobgnvHimEl/ylN2+rDP2HMcDuzxP7uuApibwd+nbJfZf7zE8n/AYQv8AwQzGRBA1gKOKUsAnDw6FSybz7LkBfItmWXnSbke27NPyjKf1w1PGQn/4UsAObPzBGBe++rnHOLQ2GvcT9siaJNbAbYFAbyv1ON/3LZl/tvKXQVwiOX+1QbBCQF/0te//nX/5Pjf/t5C90D3QPfAJfTAmnMA+Cf0+++4bQTJAGEAc55CDHAyAAA4nwsCJMjdlycI4CFq2wDWXFvYyX6jOwLwQc4y+YuY/T/rwxAEeNP3/rmzmf4E/QYBoIBQot0ASP7R1SBAHvbnsv81wHwKHLdsTOkib+mnbK7uoctodxebAn8pAMl7wH3goY8AAPeB4Bl7/OfGX5Yxnlk14OcS/nTs2iWB12YwcLYCwC0AgjiBXAX/gjlBLYBQIAwwJxhAHhApuBU0QgXvAsgsS5sprzx2tWNZy55lCWSzT9ke16U+1DqCaoG01GtuUXUE0WkPu9q0HBl1sFWBfwXqBgP0cbaVduEtg2ZgwTYMKNgGFBm+zb7pC68Diu8cC1CDAHW8oKteIwCw6xheXY+VB8y477JUfx+g36pLH+jL6WqIxddC8KQu/U+Qn+Bf4KpMMDtFW+BXGXUEqfymkpcmr6xFkV2mZL9rX1vXjC5+FKCzCoAgwDOf9IQXLL55E4q8WUAgTzvcT9sh4EAij5xy+yKPnPqAd/5XbQP5c+X8ryRV8L5PnmehBPzyytd+Bybc2MXdA90D3QNXzwOvftnX3rN0GwA/+r4OELAC2Ac85SoA9tMDmhNIw7dSAp59+TwPYJ8gQPaDPpPn4L/z2vuf7SePT8m/6hXfOgYBagAggwCU+Q+Zh4UaBGAlA7P/Cbj34RPQLwXSc+0ttXHRem5BMADAWQDcBxJbNt5x9xtGEM8DFIczAup/77ce/Mm8r9t4ggY8NPF56lOf+vSr9wtzvx5fFwAAVJhyBQBAroI5gRxU8Cx4FZhCAZGkBJGCR/QreKdsbQLUanOqLm1ZJoiVVrnXo031KpBuAf4qE3hTl5Q2lUlpB546NQDgjLz+hE61ZZstmna9P0ltB4ruXABAv9UAgEEAxwjlXJt6jKWLWP6fo5/X7fFb0QLl5ymjD2tf/cd14FvBoLQVABAcTtEEueoI8C0znwC5yqib5TV/mQB/9sV+Zt+9bmTyXi/6gGzBuasATg8EzCG2mieIIIjPQAA899ikDn2xP/aJ2fU5YL+0jGcWAgCH2gYgyBf0S5Xf4Iftrh4LvUL3QPfATeYB/qmv3Qbg2wAIAAD4MwBQzwI4r1UAAKlDBgFYDYBNwDKvSuKMAK53G2A7ZjlBAHz/g3c+7ywIIOCUAv7h3QoAcCTIw3WYmPmfA+D7li0F5rWdpfWOpUd/tJ28MqnL/2sAgDzA/9WvvHM8uBHQzwMd9KXP+qJ7GZ/jipLhPk7ROn4IQnHApasBboDXFV0XAPAMAMBZDQAI5loUYEcCEAJgAZQmAWUFkoJHQKp8UgAjecG3VB3zUEGzMnWkyFu2qJd1Wrw6tpGgugJwwXmVU4f62qId80mRo0t9bOlDKH403wL/yrJ/lbdfacd2oN4ry1v91kdS/Or9r2NDOTpcJ3l0GrP/jMNz//C/cpcDAQ8VIKBt+rDLhbP/XxAKzQQYNAkSp2gC3KU8tgTECZxtI2VzPGXnnehjbTNl8tCWP5CTBNwszTcIsO+BgHwvAPnarvfQfFL7w/2HB7TznLEU6Lf0AP+kQ4B/Ab6APymrCchzzQQFd/ke9DrdA90D3QM3jAcIALBEee3bAAArgGJmFDIIAFgG4AD+5wIAzrBX0LNPPs8D2HclANdAH5ktf91LbzkDbfv0b9+69Ok9b/rKs/fNC/gB/fJS/hHyj5l/qgBQAgAe+lfB96HzguU5mm3O6V22srkAwJ1P/sIT3q6Bv9mywXfqvXe/dPQ73wu+Dx//qU8fE3l4gjp+Vwg8ZXAgx4tnA1yhIEALZF0XAGjN/rv8P8GdQC6pABugJ6gUUEIBn4JdwSOUwICrAMhrR5q6czz2W+UtO/YjqXWVmU8QnIBaMA3lejNlGbz1tJ1U+1Lr6kPBeAYA1EmKXrZlm9DUg9cmPO2kjDxtQe0T/dUfSfEtSaCf4wHecutYToCJsTb8094MqTUuz+X/OX249dZbLyQIAPin7VM/rL5eZkxbAYAEh/ACRKiAVpl5wXzm5bOeegnqtVVlrXwF3ueVp9/b2uI6ss/W0Q9Srxff6n+CAGwDeMuP/d0Tgqirb+ZpBYKugOFWMMd2ofW+2pdD7P03ILA0AMBzjSm3B3jSfwJ+efV/8Zd/dgye9Nn/XUdMr9c90D1wQ3ng+57xOe9bug0AQIMu++EBx61VAJwLAIgBvKCzLSXI2ZcfAdQw03qIMwHoC9fBNXLAIQD6os4B0C+CQw8FFOzXFQAGBPinShCA5ehuBUjgfUx+G3Cn7W06l7XcIIDL/6WAf4C/lEM0OQAQGYEktpIwjggowbcSY43gAN8b77fULQEvfOELX3TJf4QE+lK6Kw/dkHh4Xbr/P0GfvGAb4JjgX34KUAI2BYnQChyzTF5QKpgW6JpXr1LLpYBf+RbNctowITcJoqGZLLdOy74ydaiDDUF6i7baMABgm0mxnXkBfsqor13KqeOqDfpY/Uje++T9T2oZFFtQypnpK+Cf8XdhHwJc/I88z5UAtEWbtL3jhV8DdOaScEEjYNCUoBFeEHsIir0EzLaFDPstimxbAsSiA1iEmt9Wb5dyr6HWVT7lJ69V4J0HArKPf8d7+oBtAQDay7bhvdfQfU7+F/hDeU4hJaBPXgAvFeybF+hXSjl2BP5smyBx3bv6rNfrHuge6B64oTzgNoAlqwD4x88sNAAFYJqrAHjIYBsAs5qUbQP/2hDgHoIePAhwOivLdgfAG5R+AsoO0d+1Nmz3ZS95WnMrAEEBAwNuBeCfK6CU/h97C0AGFS4KwE8FF5RL5/qHDr7SX1BAvHnKtUMAgKCAwF/KyhoeKAkA4HuAvSsBnPXnu0JCztgySIA+PAEB5H6nCG7xPb3tttsed4l/hCrYz/wYAAD8uwWABzLAibP/uf8fEMdqAAGdoE/ABzAEMAIiAZWCfyiAM0Gl4Bc5ILEFMlM2BUS1Q3vy23QpFxhDSdY136IJmgHM5AXO0ATSlqcd25Bmmba1g61WyvZsHz3rz1FtVx3r2x79so/e06Tw3vMcCynz3mHLccOYKgGAY3xtDCpIZ9ugT+e1EsCZf9qc7dRMIf6bAv88DwgKBYvSKUBb5ei3ZABl5FJ4daEpz/oph59Kgn7KBf7KzE/VPaQ8rxG7eS3y+hRfcy/cCsAqgD0A7TVWEhjMkdIG7c1Ryg6x/N9AQGv5vwAeKuiXIquA37z1yBMs4RoB/vjqEIcnznxVelH3QPdA98DV8gAAZc0qAAIG73/7p58FAAApgCkogNYVAhcRABjBOaD9gCsBRpungJ9rJAHYXLK9FsTvq08QgPZ5NWACflcCJOUfK6sACAawCgAQy70SwJ4HnQPau5YJvr2WXe1YXz8I+vGTydUTgPKUISe1VgAQBGD5Pw90nAMwjpfhvnHv2J6SaTwfYByz9wXVCA6gzzgjCGA78MpZBXKJTzFOwL8Zfg1NysdXAAIseHitAYBc/i+foA9wl8AP4AjAFFRmECCBpQATGTrmK9AUSFaqvlRQax6qrZTB06aJevItynUg1740gTg6mZdXV7vZD2VSdK0nEK+U8lZbyGxrjmqv6mAX2VygJvvuvfC+1zGg37EJbwCAMfYZn/EZ/4/TMbgIoA+62z6O40o32ypaTr/YOsdvxzHeDoBNbNMGbdnuLpRg41QAACBoEqRKBa+7UH43BaHYx0aCY8uVtSiyJQmwL+CXLqm3qw7XZV156Zyv9AdA3SAA4HafVQDeW8E/FH/Tlu1VajkTCzxbCOLXUuq7AmBuxh9AXwE/90nAL50D/vv6aZfvTa/TPdA90D1w6T0AkHAVAMuW5xKzj/zzAYwI8AE18MxSAv4zAACYUW+K7guIp+pnEICZ0ym9pXKuk8T1Ac6YmeX6kC21cSg92gQE8so5Z/wrtcx/zC5FF+yeF90HnB+ibl6nAN8Z/RagF3DnaxMB/8itD285Mh62f+BrHncvwJ8zADIAQHCNscI9Gw/1+9BXn3yikSi7LxjwqQMDGS+MMVcH0C59oW3aveRBgM3w4zemUxBylnf2H/m2AABgjgQglBcICgyZ6QdMAm4BlwYB4JElmIQXwFa59pC3eGRZBzuZn+ITdNt2yhIgW54yrqMm9KqMvPW0P0XRQx87U6llX90ss00pOvBQ+0Q/LIe3bfjWSo30pffC+y5V7n3BJmUEjo4w+98C/GfBrNOxPpDlH07k57V8zNT/61s+d++3BGADW9jc5bT/Vs+feMfDn8L//ASJ8oJ/QaHAcQ7IbivDBu35Kjpmu+GRC5y32chy67ToeQD+Vrt5LZZnn1u8vsXX+N+tAMxs7/N/oHV/877We0vb9E8A7/PFrpSVBIJ8KaAevgX0BfzqZJ2c8WfWH+DfwX/rW91l3QPdA90Dpx4ATM6tAmA5s4EB9jUzqwkI5tVmAnuACuBY0C+1fI4eChhXO4cOAmBfwO9sLDTltQ/HyNsHXw3orL9BAM8BAAi5FYAoOwAyAfEx+KWgnWXzU/vpAdTVTvZVIJ5UMA/lOjMJ1gHPuyZBN20KxLFFe1wHARa+F1ASKwAImI3vzx4CAMz6t4B/S5ZjhnttMvhku/TlEv+IAZjOABJg30AAlCAAD65TAQBncQX9AEKBX1LBn6ATkGkAwKBAAkyBKGUJMpFnXl6QaT6p4DZl8NjSnrzgN/upLGmCZu1DTZZD903YXGoj27cPyqBeg/bIwyuX6g/L9FP1Yea9B/W+e++1CXXc5HgbxiFjcZ+P4H8zGBnHtDQCDeqsaofvwCMf/rCXGwjYZUUAdQT+2NoHENbOs2y6FQAQiAoWBajQFoBNWerUerQF6G8lymgP0Cx4xy75KSrAnqLakabtqTqHlHP92JPmdaTP4PUVIBxf+EaAfVYBcL95o0DeY+8plDaT0ja+WhsAUD8pvLP/CeThE+gnb5nUPf4Afff5C/yh+74toX4fer57oHuge+CG8gD7bgkC1DcCJPCHz/J/fOej7wWQAFbmwP3SQECCnkPyBAEAX4c6HNC+Acq4bgIAzNCedyCA9mnTrQAGASplJQD/aFmux2wBoBFwnYB6LV/BuXntmN9G1YcmmIevQP5QIH7XAACg3z7WAABvAAD8GwC468e+5SxgRiCAczMS6DsWpyi6jrOkBgIYd4w5fITvLumPUTMAIPgXoAGgTLn/3+X/BgAAf4DCBIHwgkPAH0BUahAA4ClATHAuiDU4gA66Ak/BpXlolVEXO9qH2kaVYxuZ7ZIXQCufol7LNjpVf0pO+1NlylttWjZFDQhI9a1+sp759PEU731Oqi52sMl4YLwIyhljw3djJ2B++p2y7mbIXxfMoo2y0kDd06rrCPYA7yzb5/WzAHoS4D5XB8AL+ClHlzrUxca6Vrdrc2p6gkMAoKkCRQFqBa41rx71BbNQ8szitsB/ytBBH7sJ2LMdQbo65rfRDARs022Ve03VR1UXHyizj9n/KV5Ajn18IvAloLr9bk5rTN3nvMfwjIUaAEhQ77L+KYquSfAvNQgguJc625+BgHf//E9ed/05449PCIoQXJ6+4l7SPdA90D3QPTB6gGXLbAWohwEaBDAAAGUVwD/7qb81nmgOQNkWAFgaBMBOAp5D8ezXP0YQwP4JyM7OBzidtbX8WBRASOCmgv7MEwBwFQBnAgBeE3i3+KXAXUBcwTptzKV9wDx1D5XWBAO4Hq83+8+11wAAq2n4jrBqJgMAU4C/yqcCAI4j7jsHcDLu6Bf365L9jAmGoGcn/gPImJ0kGQCAB7iQagBA8A8F3AH0pgIAgEFAIKAcPYErMvLITQJGdOAtB7AKKqWC/kopNwBgG9qCpm3BPnpLEnWX6KlDv2uizamkrvXX0OwbvAkb8tjXJn2AR4ZfoOiZ18+UyU9RwX+W63PsMTYA5Y4vxt6QHIsDu/hjnXH85lh1vBqgOgXdm8GydRY3MqG44XvAEv7P23zWWx71iM37Nw+95SOAfBI8MsrQQXews5mwtZeY6wbwtQIAAl0BoqAeOgVelQtisQuYN5FPoF959ZSTpw59wDaAegmAVwe6LQnSpV4neQFxvQ77WSl61Ld9bdp3ypDppyma/mMVwHjA3TCLv9fNHsYvQQB9agAD6j2G5xrol6BfoG++0iynjMSyf0F/pQYBEuzD06ag35UPHu6XM/4A/2MEwvb0ba/ePdA90D1wuT2QqwAE/oCYBP/KCRSw1BnQCzAB5LMiAFAihSctCQBgA11BzjFoBgG2gay17QPKXKLN7CzXjGytnTX62OfsBR6oc/l/DQCQ5x8xH/5ZAvoBjYJ/Ab/5FgX8IhfsJwheA6TndA8F7NfYmetPljnbDk05fmHff10BQACAtEsAgIAAZwJsGwsGAejTX3rMrb92yX5dBETXBFDMyAigeEiDN1/BPwCrBgAA3IA/gSCATx45YDMBoYBUWQYA0KUccGo5MoBkAsw5Hnvasa7UtrEnGLY98y2a+pTXfKuOeuia6IeJ65O3f9qVTtmt8rwG26o65m3TvFQblOt7/UweXkob8uokxQZ2uRfO/jOmGHPD92EzpLNxWL4fKW/xGw4QxI5jlDGb4xL+CAGA0s2Ly04t/xccCgyhAmPoFHBVjs4UaBbcT9EE1amTwNU+AKYr2BZ0V2r/p65JOf0GgNJ29mUJbx38V9vHN8j00Rylr/THvvA//UDvt7/2xje+dLwubJsE/uS5TnxagX7Nt4D/FPhnYoJEMIAAAMv6Afu2j9/uettLzlY7VOD/+tc8f1zqf/qdv7gvTG+5e6B7oHvgqnrg+57xOe/LAwEF+zUAoJzgADOQvhUggwCC/13oNuCzT3k9F2AJ0FraHoBcUE4QAHDO9bMCYamNtXq0x3YMQP5cEMBVAPwTBjBmAEDA7ww35aacyRf0twB2guJj8632W7KpfqTulE6V6xv8kWX4bioAcM/vfWx8qHMLQJ3pb+XdKrB0XHL/GTPcrz/15V/wjkv02yOo2gx9GpdPJ+AHOGWaCwDkrD+AL/MGAKAAQ8oBg4BGQTgAkXwm9CyHJ1GuboJMeO1LbQt9AS08dgCtaXsKZAugk2Jjn5S2vC5pls21gd5ceZalTXnKbVOKb+Ep0zfpN+TUz3ukrN4L89rGjrP/jKkA/4w9x+FSejZesYM9xiYUwO/YI9hAPtrS/tDkjfFhNhUQJuCXAj7hBcVQAbTgewrAWncOMCewrzz1BNJpI/WUCyArtXwf2urDUnvWxYf4y2CAPquBgJo3AEB9bBEAABQfAgCzlcCVAHk9+hAZ7fMckQnAb0p58oJ8Z/0zzyw/tp3d55pY2UDi2kzKKGd88h0cvm189/qne6B7oHuge2AfD3ggoDP/0lYQgFUALHcGEDnrDzWtBf8AGeqsBcFr9Y+9JUBQhh/Yp+973I8RCGAWmGDDs5/9bZMBAIIDbAXw3b08OAAYK7gHGCe4TT51Ky+gTv2WLMvX8NiiTW0upXNtaGNOxzJ8RQCAPiiDKnf23zMA+E4A/kk87KwJABAUIAiwNADA2GcMQOnj6QPRPj8Bh6orINoMBsckoBL4A6xMAiz6T6qz/wIvQJ+APMG/wNxygCSAUrCZwFJeMCrQFKCSV4e24LPMetqWIkePRNvm5aHylJmm5JavpdqbomvtzelPtaEfpPoTW9bRrv6TKodST8Dvvbifre9+7odrACCA+dn4cxxWGq8KPNvn76w/Y5Exynh0DEJdbRDtHAyE0DbL+y/4u3ztJ972qnEWlv8XNU2B/7kAAHUElQnYBcSUVXkrnzasoyxp1k35ofjs9y42rQ+4Bvy7WmEqEKAcH5O4J9RldhyAfMj33HN43tQ10W9XAfBMQUqgX/kE+oJ/KKCfmX5AvwA/qWA/KcEJ+sZ3ZPge90/3QPdA90D3wKE8wMOOWwHmwL8BAYIAAJ/XvfQ+EAKAbwUAkBkQWLolYC2wX6pvkKFuCVgDupa0ZSDAVyRy3UvqrdGhDRKz0L76L7cAyOdZAGwFYNVAgll5gbG0gv2pvPpS7MlDtS9tySyTqpN21vDaqTRt1LJWHqBPsj/owAO4mYlgqb8zWxwAyLJ/PjwI8XC0JgCwdgWAY4UgAOOLPh3qt2BPOwYAoPcDVs6sCvgrbQUABPkAyAr+zQsY6yoAQWNSwGkFndhGliC16gBMqZu21BHwQtFLO/CCW/TlW3RbeatOymy3RVNvjs/+btPLdrh28ukLfKVP0m/w6Oq/pNkmdbOebaBPYIDxwv8ugAGgPJNL+VM2xzs2scm4hDq+oAYbtMH4HtJBAgBsk+FAP7b0sKKHvgy2z/1DP5z1FWhmEGBpAECwCsVegvLKAzirLPMCUmRzfJart4TSvyV6qbNrWy0b+JfZ/hoIEPgnxZ/+zwFAA5KZET/kQOH7BOCu10geXwHiAfcJ8M2nzH39Lu9/60/8+PuwS39JAPpmGt5AQVCDfvA94Pt2yOvrtroHuge6B7oHigfcCiDI30YJFHAewE+/4r7zADIIkMDfAMBSKrg5Jj3WWwJafcYXZ9sCTpdut/S2ydJ/6AL+OIth2yoAggGAUsApDxp1RjuBMfwU2N8mTzvqKhNg17zyStVbQ6uNmk9btcw8OvD0H/APzTKANmOeh7V8mIP/2Ec+eLYckoek3/7RP332ForWsv+UOfu/SzCKccCKE7YllK/0RWSbAQAe4niYE2RV4C/gagUAAF4AMIAhoC9BmbyzxFLBJXUSQMIDIluAU5mAlbrYsT62TcqyHXgBKjwpwSw8bVRZ5reVp+4Ub7v2wbz6+7RRbWUb8Fx/pvSTvJT+0Bd9Zv+UU2ZftU0ZPHIBuQGAVhAAWSsJ4qGUMy5zDDrmHF9QZAKSU1DiWN/rewbw55WiHMjLwaKvecqjTn7h+V92wmqAvQzvUBlfZgCggn/yBgES5AtSlamHfFsAAGC5Lflbm6BUXqrOZaH1mqb6Zf/xGf7ifwtJnyZN/2LPbQCMyx1u92wVA2ie4cL35Lbbbnscbd1+++1PfupTn/r0b//2b/9O0vOf+zdekgkZ5ejHd2W2vV7YPdA90D3QPXCBHqhbAeaCAAQASDy4vOttnzbOck+dB2BAYMkqAIDuNjB8qPJcDQAg2wWALekL1wRII6HvKoElddFJ8C/vKgD8P7cKgIflX37ve8cAAPv1WAVQgW2CY8H7oai2E0jLT1HrzFHqTpW37KbuVLlyr908dZHhO4Io+TDHzD8Pb3wItOBjVsh8/Kc+fTYAAOh36X8NAMx9B7z/qUMQgEDcJTgPQFC0GX7Gzt4EwMMjD5I8PAIyMgCQoD95AJcJAAZwBPwJygDj8lDBeV0FAMAUdCbYFGBKBZ5QQaz1tC1Vjp716ZtJoArNhG7mp/SqDvlW3ZbeGpk2pa26U2Veq1Tf6juofqqUMtpSri6ybA++ldBnbFCfscS4yuTsYcrkGYsJ/NFl3GFP6n3O8UU71mVsD2nv2X9O9Qf0A/hNBgD+1f/6VeMhn/u+6m3o5+KPBwAC2vlNkzrrLPiHCkahglR46pHUXRoA4Dd1CjQLktXJ31/LpFnW4ulPS45srmyqzpy8Xs9UH9WzD/ixFQjQ5/iWvhoAOOQ2gMWDpSt2D3QPdA90D9xQHri2NghAkABgVA8FFPQnYFnDLwXH++rV1QDHDATgE/buEwgQwG/r/5TPqIcN7PHgPHcYIGUAUz7s8QTMCm6hAlyB76HpFPhWnn2xP5a16BId623TrW177dSvZTyA8fDlQx/gn+TsvwGAj7zzO7YGAFwBkOB/SQBK4J/jwoASKxQAOhf8i3QWBABoJdgShC0JAAjGEoQBBgFnKZNHLqAkCCCYpI6As4JJdaDy6ABqyQtMsat9KbK0q405avvbdCxHX17akll2DDrXnuA/KT7Rb1LvizTl6kNtS5n3QTk0E3qMJUC8ifFAOznG1GH8AeJzHDLOqEMAAMr9rYky6jieh+/XZkh7BQB4rR9buAD6gH8oq4agBAHe/qw/PvLn+aaPGgAQzEsF9VDBKJQAABQ9gKn68CQArqfoSwW9SfldNe9vbFLK1GnRKVnaOE+e/w32yevyGmo/shwev+FnfJsrAvwfhI/dR3/obQAX/P+jN9890D3QPdA9cBEe4CHA8wDmVgBYxioA/tG1ggAJUjIgcJlWAgio6moAgdk2gL6mHKBGeyzdZ8YWPzB7K4Br2UofJm8AgEMG8f3cKgDK2ItHAIDVAOcdAEhQPQXME2yrI6W+vHrmK7WtKYq+ZfDaUwZNOeXkeeDi4Ssf3Bj3PKTxEfxzCODvv+O22QDA3Ow/99Ux2RoPludYgDcYdAm2AtwvAODsv8ALsCZAA4C1Us7ICs4EmgI0wR5U8AYIBhiiK1iswDjLElyiZ946glHBa9Jt7WhjDW31ufZJe1Nyy1vUOtKWjjJ0pvS8F5Vu8xfl+lDd9GPKkrcvSSlnbDCWGEPkKa/jKQMAjEFn/R0zOX4cW1LK0D/k7D/L+wH/An9AvwkZ4N8gAPnzCgKwjFvQLoiHJvCX57cwk/Wk/k6SFwTPgf8EwNadowLpSrOOZSk7b94+QE21D+ooV085Ps8VAQYBKOcAPV6JNzwr7hWQuohnzd5m90D3QPdA98Al8wDnARAEANwD9JnRFPC3KHqcgl6DABWk7JOfAkOHlNc3BTBLS2DgoG0MQQDBGvvMCQTgl1Yb+osy+aTItfWDdz5v6yoAgSr72AG6gt8ExQmEj8XTnknAbb7S7INl9ltwrhya+nM8utZXTzvVPkCfB2GoD7jwPLD5lgUDABwOyPJ/Qb4z/VPUQNOS2X/HSI6B5BkL9P2SbAUYtwDUFQDO1LYCAIC5qSRYA+AJzqQAVnkAaQvAAjoFlC2dBJbw2ICiaz1skE8Aqy3r2/YU1fZc+ZQt60qnbLTkU3WUS7MuspZcHa8datJX0PRTlWceXptVbpl9kWJbnrblkTuGDAQ41gwUUO54ktpXqeMJG2X23wDXTv+1CSTksn+Bv9QAgEEA82wX2KnBFZWYSfb3rQYAMhCQwB+eMsFrAn6BLGXwBACWBAG0NUX97bVcoFyp5RdN9UOltV/2H7m8dZARCHC7BTy+5iBAggCMqxW3uqt2D3QPdA90D3QPtD0AmP+F13/9WRCgBfxTlkEAZvsBK62ZflcCtMoSzMgLfgU/50HrtgBAGrJDts3MPwGAb/rST20JSPte/xxFH9AH5X55+n+LsgpAsHrXXW+/LgAgEBYALwHSS3QE1oemtN3q85I+Zd3sF3LLDADgUx423ffvwzEy5QZVfB/yIZb/c89zLFR+akygx/frErwVQJA0vgkgVwDk7L+ATKAmFcAlBaiRAHqARQEalDzyBIsCSeUCO+QCV221KDLl6GuPtuSltq++eWjlW3n1LNOONMun+GPoYrPa1Xf2g3wmfIKvk+qnOWo7qaPfLYNyvxkHjA3yNTlOHDuOKSgyynPswDs2KkUf8H/I2X9m8wH1JEF/UgE/KwBIBAsoh+f70v5vfRjpXADAmX9oDQC0gKzAVSDLbyf8kgCAdavdVl77UnXMS5Ufi9qO1HYyD59JHWjVa8nUwf8EArgXvg7w2GPjMCOsW+ke6B7oHugeuBIe2CcIwJkAAJU5oD9X1gI5FQgdOw/oz5lbVgMcKhAAcAeokQTxXk/r2qdk1KE+2wp4KJ87C8DDAHldj2BZsNsCwylLXrCcsvPm7YPXMdf+nK5lBhSgrMpgBQwzW4J/Hsh4iBX8U8YH4O/s/yf+06+M+3h568Mnfut5142dHEfyOft/iBUAjBHGAv1/zhMesOStAAJ16aF+l7S38TRpQJTLr3lYNVWAJnCrVGAHSBMQAhYZ84JAeAGqYE6gah5KPfWyrrrKpAlw4ZELVC1TF2qfpMpaedtMSrBOeymvdrSXOilL/ZSrn+XySeHNW6dF9YF+1TeVoldl1qGdase2sh/cP4MAlFtmPyl3rDiG1J8D+zk+tHGMpf/u7U/Qn3wNABgEQM7bAoYvKN+tY3w2vKbNICe/b6YE/xkAgBfYC2YBqc70C/b97RTUJgjexmt3GxUcS7fpn1d5Xp9tpkyessqnfpajx70hCICcwwB5pd4xBkW32T3QPdA90D1wk3qAIADL+90OkLP+LT5XAkwFARL4Jz8FclMuSD5PWs8HuC8QMD9Lu61/AjUO8csAQF7rEt4AAKDz1S/72nvmAgCUCVrf+MaXXrcKYA5A1zJAs4BZAF11LjJvnyqtfaIcmUGQ1730vlUZPGjz8Ar45yGXhy0fxgwAeKii4J+9/8z+/+YPP2jR8v858M99nxs/c+OCeowFAksAmC0/W4CJzWkStCfdUn2yOG2MqwDYClADAAn+5QVtUICYeUEdIC5BHwBSoEhZC+ShnwBP0JkAUhsCyWyDMsEp1HotmfXUmbKrvKWnDWnqzvHot8qn5HO61DEQgd42G/qiBfC9R62yOX+ib7tQ8tzHvM9eA3bQIQngrd8aE+jYnxwb2idA5cw/QaxhpDumJwf9loJr/K4QADAI4KF/UwEAVwm4GoB6R3w94OoAAL+LFbQm+M8AAL+fBhesM0X5jW2V+RtcKbpTslZZ1T1UPtuS95ptQzk0k+XQ1Ml81dHXPQCw5ZvXi7sHuge6B7oHdvPALkEA/olTz1cEzoGWqxAEqNsCmMXdNRAA4OeaAf8V6M35qVVmfWzibx7aW1sAkOU2AFYB8EBZQbF5tidkUt6iAm3LBNbmz5van6S1D5QJ/KUEAJ7yF77k5NZbbz35kv/lS06e/exvO/nJt/6DMfjFw5fgH7DPR/APvee/vmac/d/2+r9jzv47PhgTrAJYcCAgoOYMoMMPSaBT6VDU/KiXhcqgo31eZ+ZWgNwG0AL+gn4oAE9QJqAT6FGGDIAHLzCsgE89gZ7AL8EnNtHLlDIBbtZJXXj7lbTKySewbtmwXDvaqLq75vO6qm3Lsu2qQ14/yOsffZtU3Sqzjm2ZV992qQdvfe9jUm1Uqo5156i6jMmy738zjGPG8l4fggqA+pzVr0EAygX+GRggeMB2gCMeCDgZAADouwrA5f/kBacCWQFpUssEtdqpdVNvG29daCbbkGbZefC1387SE0hmth7fERCwL1VfOdRrkKYMHh+z9x/KNoD+JoC9vpq9cvdA90D3QPdAywM8uB8jCOB5AAKXNVTge96Updr7rggArLNkn7TP7L/+wgfYIaDAA/DcKgC3ATCDzVkALHUncX+d1a9gmXwGA+CVtXRbsvMMCiTwl7dPgv2kzvx/7Rf+8RH4A/4f/ahHj4EAggHf961/e3zYIgCQ4B/gT2Lpv3v/mdkX5E/ROvvv8n/p1JjO+y3fotTnVZOsAgB0tL7TIbvm682kQ9kmUoL5CoJqWSs/2tK2WwGWbgFg5j9BneAQGYAtQT8gMfMCOgGkeSiytIU96m9LglT0ap3sp7x65ivN9moZeeurV2U1P6Vf5VN5+0AQgqSe7ZBvJf0i1b/mqSP4Vgat9pUphyqzvtT7SV59+w+lnrpLKPYIOh1y3z+Br/wO/tWv+SOvdRUAgJ5gQAYBKvinDB0CANAjBgCuASIBl4BUwGsCf4G7AQDKEsAm6AeQmk8dbAuKXb6e5S1+ajVA1a0AuZVHtm+i3Skb9in95n59rpdAAAn/asc6mW/13XLL9DF5VgCwfWP4ze6f7oHuge6B7oHugcN6gIcYQCJAZ812AP6B/+h3fcVRVgIAfqbA0rHl+wYCAKAs1c5+tsDcEhk2CABg72UvedpsAMBtAABXThDmoEe2eJD+6Su/8bpkcMAAgUECwXSLZqCgVX5sWWtmP8F+8gB/8gL/L/1jT7wX8G8AAEoA4Cs++zNOHveoB518/F+96WzmH/8RRAH8M/u/7dV/GQyoAYAcA3P8krGQOtyvhasAxiAA4NxlzwL24VdkEykBvj8wylp6o4wl1AAhbBoAAGRlECBn/QH95AHzgLgEdQA55Mqe9oynvDtBv+UpA9gBECkT/MNjW3CJPXSmkrrqJ+DMOvZrjuYMf8sOdVNnW9+y/X34uT4v6QO+Sb/qM/tkPqnXr07mbTP1sd9K6GT/tZd15Vv1kTHuDgn+WenCIa+kfDMHIL4GAZjtz0CAeQICBgqgrFDyi3dgOhkAqIDW2X9APsAUCggFlJoMAKgjgAX8Uj9nxCmrSaCrnPzSYEDW0Q5036RdaLXldXFtBkla1CCA9edsttpp6fN//MXf8+T/cODxsNbcht92xjznEZD4Lq010vW7B7oHuge6By6hB/hxBwyy939NEAB9Xj3nK+8SpMDnSoC12wGoPweajl02vTWg/dYATv9n5h/gmbP/9LP6ZWnea+Q1hvh5aguAclYBvOvd774O7Cf4v+vHvmUsMzAgRQ5P0EAgz3UcY3Z/jU1n+RPcT/GAfhL952Ea0J/AX/DPCgDLCAIwAwfYd+k/AQBWA/Dav31m/7130G0rALaNEb87UHQZZ7xvHPA983NyBuAB6Dy0JQgyEAAdbGxOk3WSnm0lSN2sz0oitwHQRm4FMAAAEAPUC+jIA9rJQwX28AC+lFmWlHISdrChPagyQaeAU/C4hNY6CULl074yqW2YrzTrqnsMWtutAQjK7UurfcF1i1K3yrVhu+ZtI+VZ1/vmvaNMmXWRtepTnrayLmMmx30Z50N23Ye9+gB2gDxgHx7gT9ALoERQgBl9yqCUA/YJAhgIsJ7l/AYtXAHg93JVp5e8BQBQ6+y/IB/wbwAgecvnggC83x7QnMB2Gw94JhgATd2ap0ygvQ9ttaE928AnLcCfMoIeJK5ZH2afq03z6kht0zw+J/A/3Gzu+7l/GM+Ma0A/v9305VWv+NbxYEK+U+feod5g90D3QPdA98DhPWAQYO1KAIMAgC8A/zYwsxT8ph42Lyq1AgHM+t53TsCnggFcO+Bz38P/8rrhuW4CCgRZfugFL59cBWAQgJkID3HkYUqQn9RAQAYH0OUBBr0aBBCIz1HrzFHqC+Dhp3RTT/0WFfRDmRGvM/6A/UwGBJQ94hGPGAMAAH5P/XfpP6sCmP0HdOcsf/K5LQCQb9plrNb7PpXHNodwsvqGrQAzvwSChRHAO0PP95yHtwRFgvnB1ibSdfXVwQ68bwFQngEAHhrZbw0FxAHCCAQI3qCAdw8AhAruedBUD526EgA95FKDAIJFqYBQ8AgVKMqvpfZrjlaATRvqw1OuTpapcwxqe1O2LZ/yh76Epg72LEt5XpfybFsZ1PpzNPWzr9TRLvedvBSeMcJ4zzE7jG/H9cCu+/CdEfwTAADYA+JJgHhWAxAgAMyjV1cDGBTIOui95TM//2QKUPEdeuTDH/ZythjQBmntgYGtLQA5+w9QJzHbneBe0J+UlQDkXapeQTR2BcR1NUCCe0Fu1m/x1FFe65hPCr8tTdmrcvyRQH+O95rRsf20p6xSdaCWKeNevPbVzznZEuhdN4i3aDMOAfwAfdomwbcSv82Mzy0me3H3QPdA90D3wGX3AD/mrAQgCCCI3EZZMUACTALSACeAlApgcjVALduW3wVQHbrOfCDgAeOsrIf/cT22v+3atpVjx9UFPAhPnQNgAADg6j2ZotxTHqxIAP68xwQQdg0CGCBogfVdZBkkoL55gC+vw2O2TdDPDL8AvzXbn6Af4M/sP5SZdMC/AQBWA+BDwD3gP0F+gv/kc+m/9126bfZ/2/2nvK4AYEsI2wAIoGz5TRHsjEEAHu6cnZ8LBADqB7ubTMgMImCHhEw+KbYB9YAxgT9gTF7gmMCfckG9wA5wn8nylLUCANTPlAByH16wmRR7gtKUb+Opk/WSp27Nb7M3V64tqHy2oazlG/3YKmvJsIvc/qhj3nLl2l9CqZvXYL9bdRkr/D8T/MeY5jux0wdgn7P4AvkE+q4G+LzNZ70FsK4OQJ9kXjD/v33e/3QP4L7VoUc9YvN+9AwcQA06cF2tOi0ZgA5wCaAFoJsE/lKApwGABP0t3gBAXQVQAwACY+QC26T0K/PyyqXKt1H0M23Tz/JsCx4wbxBjDvyrh65nAWQfpnjatk11sj8GAPhtbd3XQ8r4zSZQJOiXtoB/lbFNoQcCDnk3uq3uge6B7oEL8AAPSgQBKjBMkFh5gSZBAEDJkjcELAE+LR1mw+sSe8HWeVCW4wPqAH33/Lc/Pa4EAPhzOBurApwFtu+ANwGcsjWUa+J6t50DYADAe7GNeg/R+9hHPjg+7BAQQG4QQMCd4B2Z+eSV7UtdFaAdgC6JMZkrFp77LX/ik495zGPOlvMD+hP4A/gJCEwBf8A/CZt8ct//J37reWf3OIG+fAYFWuB/G+jPcepYQCY/RXMc4RNWAUyBh9OfjrMAgDP2PEzysJbJYECCJX4HMjELlQEA6lhPPin2AfgJ/ABqBAUA7QBAqMBfyqwScoEifE3bAgEJCAWaLYpeSz4ny+tp8YJSKTrylVpfeerKU3Yeyb5I53xAGXpVR5k2Wnll1vUe1HtW5dRr+QE7VZfxwvhjrDuGh+/DZkg7g3/suZRfQA6Yh3dfPxSQTxCAtpmpF+ijaxAAGfwr/uxDT6a+v9Y1YAB1GwF0qt7p9/468swnPeEFAMwaAACUC/4pA3wCOp3lT+DPfvTMGyiQUhcb2BP0J+V/CnnbyZn9CoQTBMsLlFPXskNT+kh/SduAv+VeK3Xwgf203wnwU2bfs1wZvuWNAPyuXndDD5hhbHDQ4Otf8/wTksBfCtiHT1oDAOZZ9XXArnVT3QPdA90D3QMX4YFdgwAsL2dW9a1vHvY+/9aDPzkFbBLMAHhqvgWCAMJuM2BWPIHUefL2lTYFqoA+AaI0waHXY13zS6jXtu0cAB6QebAS/MsL7FOOTDn73Zn5ZguAch5kXAnAAYCHAPsGFAT50rQt4BfsM55MyNy+QN8+9DN3nLzoWd9wQiBAoO/+fvM52y/oZ/af9OjPf8h47oH7/0c/DOCf+5Yg3/spzbIE+8lzz2re+5h02/3P8SJPfbaEEADAh1t+H86CAIKhVhAAgCOgp7wGA8xD0UN/W6oBAIEhAN4VAgL/CuoFmQQMDBrUQIB5dZIKKAWaa2gFqVnXa2hRvn/Ipcm3wGtLZp200WpLWcvGIWTaz2tPnvLMwyurdc1bLmCv9afy1CPAyXUZ6IRH3/ssPQb4Z7wD6gH4JED/2/7f18bZfIICyl0dINAfvpcb6hoEEPhDmfmfW8rPdgL0DDIYaKAt2qGNLd/7s2L6AMAE2Dr7n+AfwEq5YD6BvjxA1IQsVwBQj/rYzNlwQXFSQbWBAMGugNk89qqslVf/UJRroI8k+y3I30ZTn/6b7Jv5pF4TMvWkxwwA8BsP8CewQ2oFAAT2SykrTc4GXWe6B7oHuge6B66uB3YNAgDORtC44FwAwRBASIDTAkWAf+SANhIHoREEUK6d86CsAqBd+gAQo03ybBOY2ioAeGytENh23ZRrH3DMg+/UNgDKeDgD6APkBfzM6gvs5aXosALA0+8zCMADD/eSdg10CNqX0gT32BDgJ2Wc5Qx/An4DAVPUuk964hPPggAJ9OWlLv0nT5CABz3OAODEf2b+Bf9SQT80gb957o1AX5oy+LnUGustWX43sMfYWxgA4AeIIMCGRBDAmXwAPLM2pgT0gAYDAehbBxlJXeqytB/wrR0oAF9QCICjHBkADTk0wb98gnoBYwL7LE955QWEU6ByTk67SxLfN/UqT16ZNHWrzLJWvyxr0dRvlSOzL1JBtKBanSpXP+3aHjJ4y+SlyqXW24XqK6h9TDu0wf1mbDAuGZ8Gu07H/c4z/0P9B7AHHzAu2HcZfoJygTllyAHuT/jqz76X+uPbMk5tICOYwPeJsqmPKwAIpmsvAw3IuM6p+innfA6BZg0CGBCgfCoAIPCH5koA9amL3W3gX4AM5f8MgQcDAfx/EvgKhqX23fJWPsvW8gYw6D/9MgCQQYDs+1wgQD2vq/YlwX/yVU/f4nPGdN7PfXlm/XlOEPxDaacGAQD+S2f/0eV3f9++9frdA90D3QPdA5fEA8w6AwIBjEsSgJI91Jwoz17tO797OB3/bZ82uxoA4ESaA8OA/W+8/cEnD3zgA0++/IsfNlLygCHKBMpzYOtQZYB9lv174B/5lm2DAQD/BJLyyGtQAKCXyesy4LDtIMA3vvFTwN8AAA9XAv5Kx/v18f84vvfeIAABAQMGPATBC8AF3NAE8ZVPPXjrC+6ljC15qHqVMg4zUU5d+sY1AOBZDQDAT5CfwF85wJ+AwQd/9YP3svIB4C+gF/hXsO89k1Ke93wb+Pc+Zh1k21IdC9ph7BEAwO9zM4nxMzIGAdwKAAAB5PNwmcBdXoAvoBL4Q6lX6wLgAWWAfBKgTJ4AQSYDARkEENhLAfSCxwruyQP4puSCf2gCxcpjP2W2V6kAVLnAOCllqSePfesltTxl8Nmffflqu7YJmLZNygTXUxQdE/XQI9+6xpTPXce2e2Rd26PNlNl/wT/j+pDgn+8PY549/YB6QTjUgIDgH4qOAQLOKBmqZ/DhGmA8vpOTLNfBKoGpAABtLPzej20wYw/gbAUAkAk46/L/BP81AOAqAOwKfHehBgKwU4Fw5lvlLVnWmeK9Xsqd9Qf8L+3/XBCAMmzShu3bz6TwmVcXav/w+SGBNbP0ruqoAQCDALn8f+nsfw8ATH6Ve0H3QPdA98DV9cCrX/a19wDotwUAAGLojKByCAIA0HiAIRDATLnL9yvo8YBAAwHOdkoBv9QX/P/hPffNvJNnRuU8twPQF/b7C/4T0G3jtwUEAJX6QB+lDzgH4AfvfN7kCgAejgkQEIAR6HMvtgUAAP6Z2A9PEAAb3EPBOPw+aQ7g2wYgX16QT5sGJKA8pLltAQBPX6WcAyDQB/wnT/6b7rhjfDhj1n8N+M+AgGA/qdtdGAPw3L+U1bHh/UUuP0UdA5ZTJwMA3/eMz3nfgl8XgMgYBBAgGQQQ9CdIVybNgEDl0aEuIAxAZgKopU14gwIGDAT8SQX21BfgVcAvcIRmok7NCxgrtZ9SwW1SyjIPr36WKbPP5qEtWdpJXn3r1D5P5bNe6mQ/sh1+K7IOPOUkypYmbdiO9VKe/dmFx5Z2qU8fWQUFJc9YIiB1DPCf3yuW5TPzTgKAu+RfioyAHMvz2SLA9yTrr+SvEQDIgAL2DTbAszJhqU2WewM2WwEA5AJOwaF0WwBAAL0UOLf0EngTDAA8088EyPzuJ0DelReUY5t26I+z/vbNmX+p8qTbAgCU0wb9lNpnr0u51HKo9+OQAQAO+fO+QqcCAJ4FIPhfugqgbwFY+m3set0D3QPdA1fIA/y4EwQAjLUCAQn+MwgAzwwwWwJYAs5bAgRIAhqAFHwCnQRGAH5WErD0H/AN4EfG698IArziBx40ygRZ2JI/JAX800fAF3bJ72OfgADX7koAZ5elytGhLZZ988A7tQWAh+QaAMD/cwEAyj8eKwAMBHgoHve7gvIE6PvyBAUE+DwI8eDEgxeg/nd++6OfBKjTJ/pjIk+fKUePYIABgZ986z8YD/cT+DPbT1CA1QHj6f7M+MesP74G3Jv0vTSBP7ygn/suP0XRaY1Fx/0cze9C8trLAACgY+FPSTMIAFAR6FfAnnl1oAYBUoYu4FswCAWcCfqlyEgGDBL8wxsASFvwjP0K7jOvDnpzyf4JeOeoulLswkvhqW/5Umqb6pPXZu07OllW81P6ym2jUssrVU/QPUX5HcrfIvnsn3xtY00e32jbNpFxvxlHzNAfG/z7/WLWHVBuciWAQQHk7/zir/yDNYf0abtStgq0AgC0SVoTAOD/N8ASYF2DAAk4EyBW8E8+y11VkMB4Xx4wngEB/h8QFMjAAMDdfAXPAuekAmt0uXbq0s8K/JG1QH9Lhu62IEBrFQB9yGTfKrX/hwoAEADKeydvECDvdW4FMAiwhPI2gDqGe757oHuge6B74AbwAA9arSBAC/wjIwHMoNRjyTKBgLoaAABFAtwAdgQ8yAC+BA18vaAgHEoC6LEVILcBAN72AeZzdQFe9I+25/TmygT+U1TgLwiFAj7x26tfeefJK3/u3WczYvXhfJcAACAacA2wzoSMMu9vzsID2rmnUwEAgb3g3ro8FPFAxcMXtg0+CO7HI/lPT+W3L+qYhxoYqIEA5M9+9reN+/s5HDCBP2Xu9denAn+BvtRy7wFygT73Vh46N9M/Nw7mAgBzZdisAQAA0MKfmNkgQAL+bXwF/+gD3gWQ0gT+APwMAAgEDQJQH2AnpVwQmWDfei2qfpYhAzRK4acSOqZqQ/kURZ8yaeWznv1Blrx1su05Xn1pS5cyy6WpNyVDTt/4nRF8z1GvA9stm9nmEh4btT3aYHwwrs4T/Pv9YhsNs/wGAQD/rHRD9q9v+dyThStyNDdJfZWgqw6grDYgrV0B8MQ7Hv4UQGUNAJA3ALBt+b8gEfAIcESf3/ME7PsGAKbqt9oQmBskoC+tBOBHB9vYSVvaqO1OyVNvWwCAcoF9gn545Mrk1YUeMgBQZ/4F/97HGgSYCgC4EmAuGLDi/9DkuO8F3QPdA90D3QOX1APM6APsnOkXIEJbiZlXEnWYreRhqbUaQLAE+GFbACCbWW9m+TlHQJAvOKKcVQFsA4BHzn5ugB7AjLw296XY33Xpf7bdAv0AfuRQ+g2vHjJBKPT333HbCLp9KK8BAORuAVgy+4/OVAAAoC0wH8EzAHpILrcnuOMDFZQ8tgT2AndtQPOT8gT3LT51k0eXdmyXPpB4WOHaxtn+YcZf4D+3338O/GcAIMG/91aZ+Snq2N1GDYJlQMw62K4BgJUzjs0gAMuoAfUJ/AFZ5AXx5lMHHjAHiAewkQBoJHgBv7P+yAX81qG+daDkBfzaFDAqJ0+Z8qQCUcrhW8nvjmW1nbRnW6lj27aRZVXfsla/rE+Z9ZLC75Kwaz3bNy9NHWWVWrcGAehvBefkp2xOyWt75tHH3l13vf0s0SbjgzGX4B9QPvy7dFwf7T8nKwBY/cJ3BaBvEOCQM/92nnY4fNAAgKsBmP2HX7MCAGAGqAR05goAeMGmwBBAKNhPKmBEBg9QTUB8kbyAHSq/rT8C+G16c+XamKIEJAT4CfhTJg81cU8IsOBrxoFjYi2dAv8GewT/9Z5PBQHmwD9lfC/W9rHrdw90D3QPdA9cIQ/w8MMM8Efe+R3Xgf4MCmQwwCAA5dQjCDD1poAET7nPXwAEFfCzAoDtAeQByAI9bKif9vbhAV22vY+dEdwP+8Qr0HfmX2o5bcEjh378pz795Be+55azV1F937f+7XHpP7P/PKTrdx7uWsv/KXdGHgp4TtAtwEYmP0UT0CePPp+pevvKs78EAAwCGIQgUEEbLvfPE/4B6wB6E+Om8hl0qeCf+gL+NbP/OR7lt1EDAanHeKgBgB1mHQVL45sB8u0ABgEE+wn+kxfYKxMoSgX85NUV8BsAAMwB6NGBmhcESimXT2pbKYNHDljk+yAV8EuRW3/KftpN3Tk+6yRPnWwTPvNps9YjT3mLpm6Wp7zWzTL5KR37lf2FT2CePP7VFrbRtQ2oZdKUqUcZdqpdxgfjM8H/8G9zMyTH89H+iwK4nfkHmD/qEZv3c9AfPAG4Rz7ykV9w6MZpA/sZaKAPyPDB0vY4fBDQB8DMAACgdGkAwGAAYJEAwHnN/s8B8DVlgHT0oQSs8QM+YYVArgqoNrNeq6yW1zx+EvxDBflQ5SmD557gY4D4rqDa0/6xYxL4m4euCQJsWwWwZkwuHbtdr3uge6B7oHvgknmAf0yuBhB0zlGCAAC0XA1AEIBXyjHDD8gB3ECZ7X/rmx84zv6z1589/4B8E/nveOZDxy0A1BH8j+BuWAUAcBqB3cALntDbJdEmgIsVAPC72LAOAB7QONIBSAr2K+U6UkaeOpkIBPzmDz9oDAbc/Z2fNgYECAy8501febavHoDPPSHw0koGAADLgup9wfmh69svqfbNGwAwCMD4GlchDFRwj//0qWAfannyyEyCf+tDvZfQmrfMsWwe6jhcQ6cCAL4GkBU1pB0CAP6aAJzuFwRg1slZfgF+iwLsAWsAevkEtQJ/gFuCfuogM5EnObsPFQwKEClPmXwCU3TIC/KlyOWh5NOefdamNHWsU2Xotsq0UcttK/udOllvCW9/pEvq2F7SuXrYtt/wdWY+gTq8unMrAqbawz73CDvveve7x0Se8cP/HECGB1kydod0dPA/tPEA9uTnnn9AOAEAEgcErjmVH3tLP5uH3vKRr/jszxjffsNqN7YGrAVaBCcAewBLQKdBAAGpgBMdgf4U1U4Fw5cxX8E4fUwZgJiEvAYB1Ms6rWtET93kU1c/SyvgVy71fhAAWHuvGVfU4T6ZWsDfsjUBAFcATAUC9lmtsPT70PW6B7oHuge6By6JBwAgzOoDNJ3pnwsEuEwbQOoBga4GYK8/AEmgzQMPqwAA+wQJfGMAs/55ACAz/4Ax6p6Buv9039LvBFwJyJbw9AMQBuBaor9Eh34aAIAC9JEJ+AGdlVcmtVxqYMCgAIEBk/tGk37oZ+4YgwSs4OB+GABIKtC+jDTBv4cB8lDL9Zx8YDiBf/BnTfhuLjlupOhWG95f5PJLaY7DfXjaqwEAVtTs8XMwBgGG+mMggOXCPEAaBEjgD6A3L7gHmAHaSIA6gS1UHWgNAKBPAEDQrw3zCRAts41aluC+xQtIqU95tZP2a1ltK21ZD53kzWddZdaHyls3206+2lmSt77UOjWvPGnVIZ8JHyZAF6hDAf1cF+VpJ3nbqjLy2E575Bk/jEnG5kWAf75b/C/yAD724JOYmWdG3nQsAERwgRUIp1sddvqqcxAgQBDwyW8lydlmAWddCl6DAM7+U7cC5gS8l4kXnNOn5F0FwDXhh12vR5tT4B+7rALAxxX4mwf4C/6VAdAB2rvsqxfct2grGGAQoN7v3AowBfoNCkD7mwB2+mr2St0D3QPdA1fXAyyBBMwD6nOmvwYCDBAAOlmeDeVsAM4EIAgAkOGwOwIBgG8SYJ+l/gB+KTxyVgoA/gFtvCYPYEZ+3AoA4IsVAAm6loI22j/U7D9tAtSlgnf6LJ80wX6LV5Y0wStyzgwg/Y83Pei6ZHAASjn3ghl0gPVlBfz0j/HCGGJc5bJ+rpUxBDBmTHh/E8CjM5X0mzTryadN+RZtbQvIsbeEN9A1pevMv3TPAAA/PM6inq0GAHAx48pKAEF/0gT38ALapAD81CMIkLP+AEEBP+CvAkKBIrRVjoz2AIlTifK0C4+uMihJPeW2nXl1pfYrdVM/y62T/pG3jjraq/Vb+dTN8qXyqpd5+5UyeOQGAPClgB0+5bWe+ZZdZGkLm+Qn9vtvTscsY/foH4IOzPi7AgDwz978DAC84s8+dNW+/KN3ujQAkAQQAkQBmwYAAJwCxW0BAAAi9QG7uwLmYwUHBOLb7KcewNwAQKte6rbK18gqwBfoSzMIYEDmZS952slwG/ltXvwBhHs/W2DfsqQGAOr9NwAAJQCwLQhw2t/Ffe2K3QPdA90D3QM3gAeYnQCQAOgBaIA1AZugzQAAlAcID2lDnwAC2wEAM1C2AACmWO4PEGIrAKCf5HL8EQSeLvknAECe/d8Cp6kAgOXQFohD5uw/AYApnV3kuQXAFQACfwAqvDR5ZYDUltxyaCb0M1FmYMDgANTVANwT99CfdzCAAARAn1l9x04CfcB49Tkz/twr7iVBAMcGeoJ3KD6TVl8J/JFnHfjaXktWdTKfY20p31r671jl+gT+0gMEAPgFul8QwNUA7LsW/AvoAfPyUgAtoE1gC3XmX2oAQCApKDTfAodZZrmAkfZIzDxXnvbVn2qH8lZKfXn1tGseqs4cVV//kE9bc3WnymxbOqWX8qprXpq6LR49/S3glxoM4LqyLnVa9pGhi71ffu97P0nCFnUvcsl//ksmGLYtAMAqgGNtA8i+7MP7OjhAp4BUsAkgrDPArfxF7v0/BCDHRtrBDwDllK0B9kt0edbBvmB/G+We4HsO8Vtzvz3rIcF98hkQSB4dgwB5z1sBgG1BAL6za/rcdbsHuge6B7oHbhAPsB/ZswEA+jUQYBBAOTRXAwBqXA0A6GfpP6CZmV0TAGsEbQn+B/DmVgBXA8wFALAhIEvAJn/o2f8zu5wDELP+8oJSgGoCfHiudU5uXak2oSbKMtWgAGUCYX07gu/Bx95HgwO7rBSgjm8R4J6PqzQG27Zhf+gHff7UaonrgzTcl+vSEAAYz3wYxgfgmCAA9xUdr12a1195/Kue1HtGHn6UD2NR+Tbq+DoUpb16ACDflz3OAKi/OpNBALcECPahgDdm8JUB2gThUEGf4F/q0n/LoYJFZZlP3nJBP8AxE2CSshYA1U5S7UGpk/nUk1dP++pbXinlytSt7ShXD5r1lshTR14bUuXSpfKqR54EUBe0J3X2nvuAjmPBdqXYoAx96kO5l4yni17yn18MQI0BgFwFkCsAKL/sAQC+wwA9ACYgFGoAoM7+JhCUBygCeC969l+wLt0GwqseeWUcAkgQwHy1NSWvepnPOvL4jODJNvDvfcHnBF5zHG7jCfBUYF/zGRBI3gDA1DgwGLBtJcDTnvGUd2/rZy/vHuge6B7oHrhBPcDDG8CE98SzLSDBvjz/EOWhrgYAbNZtAQQC2BYg4AJQARih48x/gH9nTwFrcwGAFijDPnLAI8uwD7n3375D68x/BfeA0wr8ud6UqVPrkufaK6XdBLLZH3muXR6aPhrBLz4d+kY6A+wB4vE3909QnxR962ILH3wqDT4fgHy2PcVzfwHBJO4PgJ8VIwYBkCOjPvcRat+h+MV+yGf5VLtr5em7Nbzjd6oOW2T4bhFkgx44AOAv0mQgwNUAgn7APIAWCsCHB9SZAHmWUQ5PInAAEBRMQlt5ZVLtJ+ivvLaoszRRpwJz29RG9rXqZpvJW1dbaSP51EteW9Isk69lNT+lp3yKztmZAv8ZCIBnHLTs47+0AU97E7P+m2FgrloK7UA+BOUQPQ77c++/r+Zj1v8pf+FLxjMA2AJwrDMADnENpzY2AEuAXwJR8lPAT/APBShfJPgXTCfY3pU/pC37sMRmbr3IeyBvQAZ/8xy19N6zWusn3/oPxtUMCeyTz2BA8qljIID2Af3efwMA0G2rAHY5t2DpdXa97oHuge6B7oEr4AFmJgEoAPoRGA7LyxP0t3gDAR4SCLhzRQDgB2DuPmvBEkATEEcwIIETsswv5QGOgEvApG8gWAsAt+kLRgWh0FYCrFZ5ypJPWwlqK0/fkNlH/AKftNYxb52klgmst1H00bEeNO21eO4J99fxwJggAfa5V/QdHRIyxgorRhgrtoN/5CtttZn9csy19FJWxxhlVbYm73kA2HH5P+A/AwCcwXGEn4PJIAAgjb3ZBgEE/oA6wJ7gXwqwS/A/FwRANxP2yEuxmYAf4GiiTGDeAp3KtKfNbM/6yqwjtS56VdcydVtUu5Wia31pq/6c3rZ62qt65qXqtSg6+L8C/ZpnNr9lD59Z/4O/+sF7XS3AFpPLNOtfv0+AGk7798A/tt3IQ3lLwFBnU+tdtrx7xHMVAABQoDdF0WG2HLC7BOgKii+aTvV1Sn4e/XXVAaCfoAopAwCAcA7VWzN22C5AAID7VMF9zSfgzzLapSyDAI6HDAC0ggAZFOirANbcua7bPdA90D1wg3qABydAG4AFUC/Ab4H/lKFHvgYCsFUDAQAqgRI8gQHTGrCFrmDuOU94wPiKJ1cB5PYDdQ5BBfcC+TrTvy1vPSmgVaBbKTPuAl/6LsCVcv3yXpv626iAHtpK1G/JU2abU5T+cT8MzgCIkQn8qQePjHFCOflW3/XNVFu7yGl3n2RAq2WD/nDdzv5nAODIM48EAjYkT2DnOw1Yo12AG+CexKy+oF+gnnmBvysAXAUgqE3AmHyWAx4F/JVSVkG5ILbaS7llUIG9baqXNPXga1IXuXylWZb8nF4t25bXrrTq7yLnfgL2Ae9TiftQbZNHDuCnHjbIAxYmgD9jziDUwF6OD98BVsEQdDOdLv2/sBUKazxD/wF1AL/cAiDQm6IAVMH/RYLnpQB9aR/RW6o71/aUjZbcVRSt1QDcE+7Byv3/137iba86mQoAJOBvBQhquQEAqOOhBgBaQYB8IwDjbM247LrdA90D3QPdAzeoB3hYArzwykBXAwjyE/hXXh0CAdRn1vd7v/mWEeBxPgBgCXAkaEoQtUsQAKAP0OJNA6RHf/5DTtjfCaBkRQCAEh2o7e4CFq0ztR3AwADUIABguSVHlmUAXmQt4IuMtitVpj+tq9z8FE0gvytvn/RNi+L3mqqe9/B1z71PN1cB2P9ap5Vvzfq3ZNR1/O1CCV7luMVGBrSwT96ZfynfB9I5/GQIxO4XBAC8AYhYDWAgwFleAB6AEfCHDB4Q2goAVHBKPkEkPPUr6DcPsCSRt03qpI1sQ7k6SaeCCPZJXYMF5iu1PeTyS2mrTktmn9LuUr1tddIOPPdzDvxT5j3WtmPBegJ/xoDL/QkoGVwaxvJmSI63cxjaN18TgEtA39IAALqA1asUAJgD65YJ/lsgXZ1d6DZ7lhMIgM9AAIEZQPea/f8EYgkAkKifs/pzgL/qZSAgVwPQnxoAUCbozxUAyPoqgJvvd6VfcfdA90D3wKwHWDoJaGFbAGBfgF+Bf+bRUY96GQhonQ+QIMwgQAVYqZM84PEbb3/wCP4BkNgH/BN0YFUAAQhWIDi7LBhtAcglMgBpBgEE8pUK/A0GSBP8WwebBgCkAl8pfYOX4gP7Kw9NHXW1AaVN8/D7JNuyH7tSgzMZtNnV1rZ6OXbQzfw2fumYxO573vSVJ2/63j93XRCA78GPftdXnEcAwO+0wGxrIIDZfQCjSVAOMKQsk2BxG8WGQL9SgD9tQSmDB7QmiMV+zadM/Rawz75VvZb+XDtpK/lWneyfuupJq9z8FM16yaNf88rwpyC+NfOPz60LxSfcC+sI/J/33c/9MIDlKs36O/hvFIrvAXgAQIIAAD9nelsUnVz+L4DdBRxfpjpch6n2a9s1biuv9lp5bLgawG0B3AvANPdo6Xjj8D8DANtWAUyB/il5axVAjhH6msmAAJTA3tJr6HrdA90D3QPdAzeBB/jnBjhzW8C+gQBA+bZAAGBsG+ACOALsb7311hHks//f2X7qUwb4p72xzSFAwGoBZmdrIAD9beCRcg/CE+AnoFcm2JemTspSLiiXUibArtR+IrffqSOvHhRZpiXAn75O6aWtbGdXnvvGig3uEzYMCiyxNzXLX+viq11Szu5Tv45Ly6G0ybhz1j8pAYAj7f+f+xU6CwIMSpOBAPf8A9oBgiYDAQYApkCqwBMwaZoLACTod9YZ0AovMJ1qS/tJs17KtaUMPXUrVbe2W+VT+SqvdrblrS/dpl/LqafPAf3/9sO/cVIT8gy2pD5l3hdm/JnVrMCf18cyjobkuBrYy/O5/fbbn8zr1S5Pjw7TE0Bba8YXGaAvgR/L/wXK0hagvYqybUB+n/Ksm3z6KeW8JYBgC/dm6V3m+yT4h04FACrAr/kcC5XPsZDgH96tAAYBMgDQVwEsvYtdr3uge6B74CbzAA+EgBgDATnTnysAKq+ebwygPisLtgUCAFqtJIgDNGKDpf8cJJegXh1BIAfSAf7RY3UAybMJrFdBJzasnxTwSyAAcCzol5dWeYL95LXVogmy5ekHfPYn+2mZskqtpz0p/YavNGXy6lhXm/tS/E+giftU70W1vRT0Ww8/7JIq2F9iI0G/PN8b0gX+ZAjYNkMfZgMBAElAokEAKEARwEkgoALPmgdYWx9AOZewS3sJzMmT0m7m1VfPvIA+5ZWv7WTe9qgjn3RKnjrJT+lXec1ro8ozX/kE8hX0m+c+oMc1c3+c7Qf4e48JBLVm/E/3CDN2HEcDe/k+HHbJ60tZNs91DD2kv5MfZj0/b/NZb6HeaXBjUvciC575pCe8AGCXYK/mAXjIWKIOUM0EiBW8ShPYXhXea6r9rddU81Xf/BI9Zvv1qfVcAQAw56DGpWMD3QwAwHtPl4L81EteO4wBkuC/5ueCAMN1bJZeS9frHuge6B7oHrjJPODbAnY5HyC3BkwFAgB/CbRaQQCAHXq87oktAIB5ErPI6FMmiNSWYNCVAYBNkqfQU1e7UOpZJ6mrAADAAv2kBgEqTeCPDep7bQYUBNfk//BnbzlLAlH7ZT77KCCHoidVB6qO5ealU3LLk9pX6hwiuQrAYM6+NrneQ6X0tzZz5h8Z/SV4IeiHshUAegkCAP5KCeA2AB73cntQIDNUACeAoEBRAC9ITPApWIUK5i0XlAI0pxK2aYc6Cca1kfblKav61tWWOtTRlrKqo1z7UuuZr3SqvMrNS7VT88jXyNDVx1Mz/oB/fMy9A/TDqwuPDH9wOGRrj/9VAf4Obsbvr3zgn58QBOA6WcnwyIc/7OXI1YEK/Ln2j33kg6M+9VieTaD7si2H5rsKoBPktajlzEwLlCsVwK6hS0DyGnv76s71p5bVvG1PyS1Pyqn/AG386jkA8Ky0AFyvCRy98Y0vHff+ZxCggvjMT/H1/qMn0J+jBgVcAUAwIFcBrDnLIL9Pne8e6B7oHugeuIk8YCBgzfkAbh8wEMBhgQQS2BvtigCAOIDKWV4Bl2AZCrgH8AMWAY7IqKdsLhgAUDM4AIizHsEA+kBdl3ML7ASjAGB5aALiDAK0eAMC1kmQjz/ywwOsKyfu+a+vOfn9d9x2FgwgMCD4ziAB/Oi3oY+2YX+lXo959eq11Lx6tguVT3/sy3NfuKfcE+/RWpuOF68182t4x9uSOvSRPtd9/wYDCABcsoervQIBAkfBrFRAKrgk72zzXBAAPcBYC5xrWwrwJalvHfOWS6knP0XVsY2k1FmSr3pZZxtf69a89ZGTBPPO7rcoANhZ/t/57Y9+0mCA9y6X+QOQAb0GhBrAf3Ym/RL929twbgHXzm8oCYAPuEfOTD8BAXwg8IeaPv7x//hJEvVZRUBQZLi2zWW4PvojyK8A0DxAEHDKDDUJoJspge1SXjtL9c9bbwrMe930Z0qn9rWlx/XjVwIBBADIsyKA5f9rZv/5jiXwl3cbgPdwDc0AgfUIAMhLa1AA4M9YqgGAl73kaYu3M1yG70TvQ/dA90D3QPfAxXngmgcFrnltoNsEBLlsD8hAAGA8gbggUDAGOPyOZz705HGPetAI1gkCCBgT1Ldm99HTDhTb1qVdVhWwSqDq2IcEzykT9AOMc7bfPDLqAvxNY9tDngfV//6J/zGCfvj6wU//400PGoMA8OhA8SMBgk/81vNGQE4QAOBq3+2f12kemtchwF9DuYa0dwie+8gsOvfee7LGrtfp9e9K04dpw1l/ZQaKWvv+L+Hsf+tX4iwQMBRetzXAVQGAIN4aAMAWeALwSbkqIEErPOUV9AOsWikDBgL6ak8QDKWMlKBfPql61ZbytCmfuspsM/Pb+CV2pnSqbfT0Pf4D0G9LAH78n/eILRzcS5f530DA/2xsE2h79SvvHEE9PgLcA+r5zYSaF/S3KPXUBaixPxq7F3m+AEEZQFsL4An0AKUZABC8C4ZbALeC4Jq3bpVfprx9nKNT/d3mE0A/gJ+EDWf/8fnS2f9HPvKRX9Ba/m8QwPsnTWDf4lNGnZpH5jhJaiDAccRKgFwBAH+6debs+9SZ7oHuge6B7oHugUkP8G5lwDMznh/9xVedzV4L9LfRDAQQSPinr/zG8ZwAbHJgIK8QFGwJDHnlH/v/mbUHgAEUKavBAAEloBI+dU8+cF8AAEBHXcppE1uCvKRzYDTBs8EAQX+lGQCgjIfTEfiXpf8Aez74x5l/8yPwPw0GIBuDAkPwQfDqNQj0uQ54KeWW5XUpSyqfesfguQf0j3sF9V7PtYXePkl/aYN8lVmWFB36JfhnzOayfwJaLv+/gMP/Jr+rEwXNQACgw0AAYJGl4oBTZuwBlgL8DAYI4NGDp6wF+luytDMFjpGbKtjPvP2YslNBds1vqzdVXuXmpbWdVh5dfYxPAPNLAT/6BAuoj50p0J8z/qdAZjOMDcfBVZnxbw3nDasbuP4WuE+ZAQJplskTCKD8F3/5Z8fxzHeA70Kr4WPLAJGCN8FiUt8AAPDPVIHxFBhuya3bKrsMMvuX19sKfAj0pUv7jn6e/u/sPysylt5vQHWe/i/wl7YAfN7XNXy1lQEA7JiHr+Df/HBdm6XX1vW6B7oHuge6B7oHHgDQAUADhggEjKD0dKZ6WxCAcgMB8B4a6PYA7LoqAKDOa/4AXyy9psxy8gCzVjCAMgMCBgMAcgQCDAAgp75gr4LBOTBKGWA5UwX/lOXsOSsE+LACgDLaxQ7tchI/H/yI/Cw/zPqTR5/644n9p8EAePue1yEPzYQN8tIsq7x9q/JD5rkP3CfSXADAvrSuVdkcxb/13tY89Vuz/si5ZsE/YF/AX+kFH/639ldJALgZKp6tCKiBAFYFsJwakO3MdAYDBKEJwtFrgf6WrM5cT4HkCvgzD/g1teq3ZOhXeZVN5au82mnlqUOi3wDW9CV+mQP+lKGjr6irvwHAANU605+gP5b5c6+97wN79T/M1hP4ePfP/+TZrL+Afo4aCJCmLoEAEj7H126hOPXjeTltQwCA1AKF7EuvQHgODK8BwWuB81Lb++jRp7zeuvqhXvu2tuaukTLssxUA369ZDcIhjq39/wYA3AaQ4H2Kp+1WWcpaY0PgD2WcoC/gl3o2wJqtDec18Hs73QPdA90D3QNXwAOcDwAg93yAtYGAGgyoqwKc9Xe2H0AGcGfJP2Xu5QegUVaDAcgNBOTKAIMC1FmSAIHoJU0wDKiuKcvhz0D9APKzDLuuAMB/qUugRF30AK6sCOBDnQSy6NnH5FOmraSWS7PsmDz3CtBtIGaqLfsF3SXho/TTGhv0qYJ/gwAs/YeHAv6v6JJKASH0ugMDazDAlQEA2QSwBgQEqABcQS6yBP6A2VaaArgCZ8GzwD/llW8B8CkZdWtZS1Z1ar5VB9kU4Ad4bkv4xAAL/sQeYJeDGwnKcD9MAP4K+mO2fzPcW+/zFfivsqqL1zzIkiAAQB6/CuKlypMm6G/x2qGMVQHcc7ZVnNeqAH5PplYBTAUAKhCeA7otkIy+qVV+3jL6ksB/CT91zVPyvCbbc/Z/LUAmYDq3AoBAgKB9DshPlU3JtZkUXa6NQAB7/gX/UMYV5QQCzms8r/pWd+Xuge6B7oHugcvvAR40PR+AQAAz+jnDv2RFQA0EuCrAU9UBibziD9DobLHgMYMB8Ge6w2w/gQODB9QHzKHDdgPA3TYwqI7gFH35pClPXh1kgvwE9ZRn2VwAQFvUNwBgW9Dk1U1ay82nzkXwbgNote117UIF/i3w72y/NO2njNUJLO8X9Lco5Yz/y/9Nne2hAHEMBAya160KaAUDxtnX4cA1wCnbBACrJIArIB/wT54yyw0GtIIAVWZ9gg0GFaCtIEAF5IfOTwH8BPn0LQMjXOs2kJ/lCfhtT8BfZ/l5aF8B+rmnN+wH0IWfnvH0p588+9nfNgZKAFrvuPsNI3DHr4B4fjf5fTVITXAAOfegFQBQZjnjjtld7HJWAAD92KsC6oGAAsA1AYAlwLeC4LV1sv6hePogIBf4MzNvQja1EmBNH7xW28Mm/gVMs6d/zReH7yX3zBn/FnUVQAXrmW/x3Hvvf4taLvV6EvjDA/q5PhLBAfJrr3ONT7pu90D3QPdA98AN7gECAb4xAKC0ayCAYAAPadRnewH/zAksuO96DAScLuXPYABgDTDJigRWBkAB+8gBeOj+4T33vULQWecEfkt4QWrqKpuj6BsAYAa/6p6VzawAsE4rAEAZbSRVfxu13ja9Q5dzPwjIuMrDe5m+3ZVvgf8E9tVulnGdlDNG2OJSQb8z/8qv2NL/Jb9Cq4MBgCFmRzmBHaAEEE7QnwEBgH0F+5kXFCOTh5IHzBkYwD7tZICAtgXPBAHgM1mesqlggTrUMQCR10Vwg77QJ/uf/Z3ivQ6DIwY1aI++MKO9FPCfAtDNcFNNee+W3OsbQmcE44/YvP+xj33syZ99whNOnvTEJ47pm+6444TAAAnfcmgg95DVArwxwMCAKwWg3DfBPxQZ+tSHjv+bYouAwYBjOJL/qa1VAIC3FvgVKAv+ki4FxbvUWWp7iR7tqwcv0Bf4Sz2wD6oM3ayvnW00r9nZ/zV7/7332w4BNCAgwBfIm4dOyQT2SdVPGTzXwHMU5XX237ED5SwJxtc/+6m/1d8K4E3stHuge6B7oHtgNw8wM+WKAEASIL7O8JPfltgOkOcLcEAP+/IIBgDCAI8APQAb4NFEnjIAHAEAAgEGA9wGMAcAKWvNGiMXHELltZX5Fp9L97Wl3lnZMEtF2dl2gVaw4HQFgGcAYCMT5xxgo9LUuWge/7oag3ukP6C7Ju8ZVL5lK8F+8vaBfhFsaoF/Qf+HfuaOMTAA+GcGcrdvypWolYByM/S4uTKA7zyzXybPDsiggDPkBgYSQE+B5SVywXelAHMDBgYNaLMmygTygvkl7S7RsU+2b7DCQMTaGX4AfwH9eX/gb+oPAIwxyOoUgiiP++Y/806CACYCAwYFWC0AqCfw4sw+S/0F/wYFAPzM+qNHGfddqg7BBADj6W/B5pA3obUVoPUWAMG/NEHtWlCcdbeB50OV1z7aBwMACfineAIB1Q79q7LM2w6U+s6Mr9n7n/ebMSDQn6KA9AT9Avkqcz+/+knhWylfY5iz/wQCGDf4A/+hx7Vi4713v/Tk9a9/3T/J6+h890D3QPdA90D3wM4eYEUAAA9AtXZ7gPoGCnjoYvab9O/+5d3jP1B0AGOANlYGAOI86M+AALL3v/3Tx4CAZwYAgFvgUNk2EGl9qfXm6BnIH/buoycIh+ca+aBDnhUBHBZIXj3p2QqA4VBAZdsoNg0IbNM9RLm+h2IPoM09YjWGiTx+Voc+rkmCfOm2uhXspz59JE/fWuBfwE8AQB49xvfOX46rVzHB5mbo/v3ODACcujTdYIA0gwIcrAagqrPrAGQAegXiAukloPu8deibgQb67sqEOrMP2OS6CYqwhx9/6BuofhPkJ8XXkfI+DOL+2eKBa4A5gDR7upmx5z4QACCxOsAAQQ0OMD4B/yTuZ4J/eAMABAlcGYAubQ192mzp1+LiuhVgSQDA2fAEuGvAuvXW1FmrSxvUqW2Zh3IdU4BfOWBWQEsdng+W9CXbgccegHiX2X9vJkGoKeCvvLUNoIL/qaBAC/QjY0zgA66DyRL3/rsCALDvWw4IdGQQgLo8a9x1993v8Do67R7oHuge6B7oHtjbAzwQcco/oKmuChDgSwH6zPwD7pW1KEAYXRL/8IliYxsQJ7gE2AlGOQuAYMTU8n+BJDRTAsV9ePoLqHfmPm0J6vknTNsGAKDoCco5aBDd3/3d3/3kktP8rXcMql8rpS3ANvcBX7vqIu9LBmnQT18s5b1H6tc88jnQT7l+YbwwNt/0vX9uHEOCfGf8pcrRZTzv/cW4ugYShG6GyxgTS5YTuGZAoK4SAPTyu8BMLaCYpe8AM2dlCRBkkABgnasHANs5ew8QnwP/uwYRpgB+zuY7o09/6T8z+1wL18S1MSOdYH8PwH/Tz/If6CtzDaBGYIBADOOQoIxj0aCAWwnIc28NBlTK1gATqwhYEcD4wCbjft8+8716/Wuef/ZqNwAbAM7Z/jmaIHcJKE4d66bsGDztpF3yXpNgNcG+4DWBPz4h8SywJADgtUmd/WdJPL9b+9yzbQcB1gAAAL4VAFAm6K95gX+OB1dKOvvP9eBLnqHwsb7Vr24FcLVlXwmwz53vdbsHuge6B7oHmh6o5wSwzJ9/TIBakjxyAgDKWgGAlFmfYAD/4KgLaGOrAMAzDwAEFM6BToFkiwo211DsANadJYLP+pRTxgfAT94AgMECgSp1uUau97wCAAB8D1IU7Ou/CvQB+wRZSAJ/wDXXO4J+zm44TdpIXyzl894srYOeAQH9SZ4gBYCeJf8CfMaOfKXo3oD7/pvf14XCDAbIb4a6Y6oBgW1BAYEywMyl3BkgAFwbHDBAAACviRlbE2BsKqljfW0D5E20WUE9YJFEHwGQdUbf60iwDxhs+UNfnVJ9KB3E/XOeHuD/FPctxyDbCQxScdaFY2OKMo44c4AzCR758Ie9fN/+05c8DwDwK0jeRgW50ATaS/i5urvYW9umQLWC/gr+AcfInOWeasc+53XBYx9Avfbk/9Z9xYaz/VN0CegX8EsNBEgB/gB4fOR1MRY42I+Akf7AJ5brF/Loct3YIDEBweeXfumXfpPvQOvauqx7oHuge6B7oHtgLw/w0AyQAlAB2D0rADBMniDA0gBAKxiAjH+MHHADuKMtEoBPIAgoFAy2gGQCzRbfqlNlI6Aflusz+0+favknTsv4xwuPPv+IXS1A3jqUs+wUOwJo+38sCoAXzOM7wL3nKkBf99wJwB/nMuwC+r1uaCvpE2jeT3lpluOj3/utB3+SMq6F8SDwB+ib6oy/QQDGKqsE9hr4N0dlwat0M1z2mHiwbIFgZYBkU4LoKR5gJFADjJOYeSUlr4xgwpKEPr9RU+2m3P4m9XpaVF+cUn0kHcT9c8k9cI1xzAqCHAfyjkmoY+gQ1+NWAJZ3C/y2gX/LAXwmQeBSar1dKP+D6cPSttCjHSkA1QSgFaxKnfkHJKM3FQCw79o1D6WP2CPAcgjgyziYAv7K6yoA+j8VFFAu8Icm+Oea9LE+QqYv9CeymvL6febiWeS3P/rR39n1HIRDjPVuo3uge6B7oHvgJvDAX/2aP/JatwgA/kmAXIIBUBNL++SXUFcGoMtbBfgHB+ADyAFqTawSEDAKpBNgwrdAaEvWqsdMPoDeGX7qadMAANeqjP6O+qcBAeXosvyfAEFtJ/New76UGX/OTXjOEx4w+spl/VPL+V0hAOCn7ezTNj59gm7Lt+pss1XL6YvAn3vOWGMcMM4S9Av0k8oTLLjJl/3v80skuE26GQyepRZQrrIE2HO8QGxf2mqj9mkufwomzq5xuN68fvlB3D/dA4s8cI2ZXYCqgFeAL9CWKpcm4J0DhBUgtvLVVitPPeS237KTslafuBYALcAemikDAAJkyueW/9tP+2Ye+/j0mU96wgsW3YUFShwsKdifos7st6jXZNkU+NfHSQH+rVn/9Hfy6OID2uI5yRWJBAJuv/32Jy+43K7SPdA90D3QPdA9sJ8HPDjwrh/7lrNXCdZAwBLwX3UyGMBDAmcGAABzdYAz3a2AQALaKXCqXABq3qV1UJbukyhjawLBAT70Fxl17at6yChDlwAAgQT6I+DOvtk2FPnSlPWyLjPl46sXc0Y/+VOwP9WHatdrrDT1KDOlvPIGbZDLS+kPoJ8yVzEA4pnB575/5J3fMRsAMDjAagDq3WQH/u33JV5WWwBc6Waofl3atmpgDoQfo6wB7K/r79D/ek3mh6L+6R7Y3QOsKgCskpgFTsAPn3nBd1JBrzSB4EXytT/kAaWZMgAgTyAAP+APZPwfpW7rWmxDil/gqc+e+d3vyv1rEkyYAv4pF+BP0QT+8DnzT9+9t14T1w3fuv4pGQEAfId9not8XhkfTIY/L/mBl/xDzsy4/1V2SfdA90D3QPdA98CBPQDgYok5AJ1/SkSmAcYEA6AV4K/JC7C14+oAAwKAREDfXECggtG5PICdj30fr2MIBvCPFj5XBwD6LRcEQwHh2MEGgYDXvfSWk+d+y5/4JKsZRoDeAOIA4KXAvPbfeu7hN1/1dslzPa16U3JBvXVqXjmUfpLQIZDjzH0Cf8+YYHZfoA91778yfEt9VqgceHh3c9MeECzP0c1Q/SLSXJ+ybPrqekn3wJ4eYI85gJetAAYBBP9SgWGlAkXpFCg8D3kFqtkneK8lgwCVB7jiA3yBPv876TvXXa9B+0mxhy9ZLbTnbanVryXQn+IB3VPgH7nlgn+ul+vkGry3eT3y9drn8tTBh6YxCDA8Z9TPU5/61KfXi+z57oHuge6B7oHugaN5AAAGECMYAHgD7POP3rQG/Ld0tQOlfFtAgNcKJggVdCYQTR5gawCDNgDxJIC/H0B9rghADxmJpf8kAwYECd71tk8bX2P1pX/sifcye6He77/jthEAY+tdf+n/cy90H/CeqyHymrbxgnlo5VM2ZSf9q05LRpn+p5x74zL/lz7ri8YZf4A+M/7O+gPwBflSdDIgIPhnBvloA7sb3tUDCbbPk9+1v71e98BBPcBJ8wYBmAUXLFcqSKxUoAgVHCav7Lxobdv+2W/zUGVcKwAeUAxYhueQXGa09Un2P23IA6xf/D1P/g8HvTmnxpYcBkhgQJCfgF+eMhLXw/V57VKvo9K87jne5f+Af1dTwPMcxDNK/fzar/36v3nhC1/4on4+wDFGTLfZPdA90D3QPdD0AMvQPC/APdweHlhBfAvoL5VVW4B3X03I1gTaBiCSWCLvnvgEqILSBN8A93GGfwDzZ+B+mNWHB8hSH75+DBRACQKgy/J/VgDwLmuCAy961jeMJ/9yWjl2fvtH//TJD73g5Sf/6n/9qrOl8ALppZS+A6a5vryOrJ/gHnnmBfopy7qVT/9Z1pLpW3Qop3/009l+z5NoAX+DAFJBP4EAZC75J3jQHIRd2D3QPdA9cMEe4H9hngcg4K0BgMwLGqG7AsY5MLm2jD6srVP1scE1AloBzQBaggBco6CZctvyurHj7D/bKo51O6dm/qvcIICAP6n3lr57D72OFq0+2pZP4A+PPnadtKjPI+YJBvzIj/zwGzgngED56dYoArJ+riHv2wd0R6fdA90D3QPdAwfxAMEAgBpAHODG6gD+aQH0BfFLQf+cnq/ew6Z6GRQAPNI+/eDVgwQFamBA0CoV4AqSzUMB9OOM/hAcGJf9n24XoO0xQDCA/+945kNPmP2n7ZMPfM7JU/7Cl4yv/yEgAAAmAMAKgKWrAATp2Q/6OhUAsN8tmjbmeMG9VN2a12dQAT/+pW+8lYAxIOjnPgjmGQ8CfWXQFo8e949tJ5zcfZAB2o10D3QPdA8cyQOAK175tmQlgIEAAWQGARIgAvwyf178tnYFunP9IQDwi7/8syM+5W056HLdrBAA7GvDtgC7h977X281wYUE+x4OKM2yGgRwST79dPY/r2Ebr6+8XvNSgiUGT2gLP1mWtnnuaK0GMBCQlDOKeIMAiXtA6qvo6qjo+e6B7oHuge6Bg3mAYADgza0CgLxjrA4wAFCDAgYE3F/uSgH6A1AlGRjILQQJbuUBwi1grQw9tgAA+nnPNK86BAB7JsCd333LCVsBmP0nUW+bTW1L0aedDABYJhWwT9EE8lN81sVu5uWpi+849yABP/v6AfwV9Ffg3wL8ytBlFQD3qR/0d7CvYzd0HA+MM2q8nQBgQSJY9UWf+9Dn94fs4zj8sltl1jXPBAAsCvan6LYggCDw2HQKmLbaBaySpuoIZgkAuGKO/9Hqe83moZwbgO+OfY9f/co7xzcCtEB/BgDecfcbTkgEAhL8G8DgftLvqYTf8vrUa/lTGeOFtggw4EPlUmwYLOLZh0kQtzBOUfSw9Ssf+OcnT7zj4U85tn+7/e6B7oHuge6B7oHRA64MANS5OoCDbWpAQDB/CFoDAto0MADgJCjgAYP0DUCbwQGWshMc4OA9AbNBgaQAY/JQdMczAU4BsnIPADQ/Ba4F2S1KXfoI+IZfAvztt/as06ItHWTY4LoMmOAr/Oa2jwTv3FNAvKA/Z/zVg1ZefcYHKwhOly/2b1D3wEV74Br7awH3APtHPvxhL/9TX/4F73jUIzbv/9ov/OMnU4nyi+54b//iPEAgyJUAALo58E9ZAuIWUBRICgSPTafaU85MMrPLc0EA+giQ/bcf/o1xUhpdrtO+aws5PmALxSFf/Td196dWAST4h7/rrref/PJ73/vJd//8T14XAOCaWisABOZcVytx3VNyyvCBASN8op+SZn3HDOU812RSRj/pP4GYF/2dv/L2KZ90efdA90D3QPdA98BRPcA/X98oYEAAMAgABKS7VSCX9wveD0EzMJBt8M+TPtAXgK3nCtBHEjPdrQBBDQ5wFgDgHPoH/+WWMx6ZSaC9llKffmQAoGVD0N8C+Utk1OewQq6NxDYK/ELQhgcKXtuY98KgyhT4JwhgIEBqAACfk1g1wKqJI5z+fNTx3I3fmB7gd6oF8r/isz/jZC5lQICAwY3pnX5VSzzAGFoSBMgAQAtEJgA8Jg+43GZfHQIAzOznrH6rriB1WIM+bgFo6WQAAJ8t8e2+OoBhVgBMrQJg5h/gTADgg7/6wXsB0Dk7zz3zviUob/Fcc8rNV8rKAvw1Bf71XdrSv61xw/9q+k3/OaRyX5/1+t0D3QPdA90D3QMH8QAzawQDmPEF2Lo6AEAIqMyAQALOQ/M1KJCBAUAtCfCbwYFcOUCAwJUDUmfLoawkIAmoDRoAtAXrLSBfZQQVMgCQ5dhZAu6rjn2AAvpJbFcAqHsf8A8PfAZn9L8zDvooAwACewE/+QT9ygH++K/v8z/IV6obOYwHrgHkW0D/0Y969JlcvtIMAhymO93KVfUAAU3OBZh7RWCCSQFdgjx4wV+LUm49aLWX9Slz9rplS1nWUSa1DKBKMm95UspdMj8FbJHTb3x0jgHgazUAkMEAAwAsmwdAs4oBniAACR8uDQDoH2gr4S+uXz3yqVfzlKmvHnn9brl9PwX/eRjgVf069X53D3QPdA90D9yIHgAEtlYHACzPKxgguIW2AgMZHEDH2W8DBIBczxvIlQQEN7YlggcEDAwimE8ZAQCCCawGAMwL4Cuwb+XVBeT79gOAOAkfG3ThupmxIcGnT+R5aIOH6gNB/xylLUA/vuBe973SN+I3+WpfE2NS8A+YB+BnQEB+jnIeCOVsGbja3ui939cDbGdixpnVAO7vFqRXCpAzCe6kAjwpckEoMn6LSfxmm8hTpk2AK33IA+bSnvw2KsiEbtOlLZJ9mdKnX+e1AoB7Sls1CMDSf/f+M3suiCYAQCIYgM+XBgH0O9T7uI1O1VG+rb59pq/Pf+7feMm+47fX7x7oHuge6B7oHjhXD9SAAMARcAnwdDa6AnIB6rFptutMuDRnxFt8BcgEDZYkAgvoMUPP7L8gP3lkrgwQ5POmAtq0f/qmAv0psK9+pdqD5nXSVs3Tb0A/s/2cCXGuA6k31j2wzgObzUNv+YhBgKR1tp8yZckD/g0C9PMs1jn/RtUGcLLPfduZAAK9FmgEPAMAAaFQfrPZi89yfJOnwJunHD0AOEDcV9phfwqMH0JuPwXLcwEAyujXeQYAGGccOliDAM7+u3weIO0qAAMBgGz8ZwBmCpR7L9UzL816yqZo6sJXPWT2lb6fx3kKN+p3tV9X90D3QPdA98Dl8cA1gCOzxoBIggHMugM+AaYZEEhwXkHrIfMCXwGvFPArP0UTICef+vDm1QFIw9M2rySsyTKvc1+Qr505Sl9qoh/01SX+3Le+zP/yfJl6T+Y9QADg1ltvPSE9+vMfMlIDAc78k5/iXTVA+edtPust86310pvFA7yDndUAS1cCTIE+gX8F+4L+StFDRj3aZrk9qwEE5bRzCNCvDewBekkGPGwrdWwXevoKwHNfqp5BAIIBBABy9l9QLfiHsjoOynk4CcS5jkxZNsWnPnxLb0qOLmXO+nNmAUv+2V55s3yn+nV2D3QPdA90D9xkHmC2AGDJfnxmxwXLgFEAawYF5gDsrmW0IzBPaj8E8JlHL+W1LO20eEA1dVyiXykPeKZdr2tNPX1MHfrbQf9N9iW8QS+XAwCZwX/Rs75hPJzyzid/4RgEeMQjHjGeAeCsf4saFIC6CuC8ZzZv0Ntyw1wWs7M//da/d7Y/XrAsTRAoQEQGePYAvgryt+UNFvD/ge0ItC8YT1qBepYt4emv18GKA1YAZD2vR0oZs//n8QrAqQGUQQC2AeQBgK0AQAYBKHdFQN63pbx+kG6rpy+5T/YN+taf+PH39df8Td3hLu8e6B7oHugeuKE9wIPVi7/nyf/BV9QJsFtBAcArD0NrAG/qtgIAtteiyEwGAqTKWzQDAe7Zz36cFy/Yh9Im109/Af0s7+cUfwIyffbhhv6K3RQXxzhm6wwrbPjOQRnfzPqzKsDVAHUVgHIDAxkEuCkc1y9ysQfYGgLwZIYcoCzwEzybBxjCA/wS/Nel/9sCAJYTCACwcjihe/MBkyTaRsbqANoVbC6l9hU72ADY15UGAl1swhMgoC+sjljsvCMo8uyQ2wHcAuDMv2DbvNTVAOTxq9fFPcMP3sdW3jJ9Uql+Z6WBs/z2A8qMP8C/BxiPMCC6ye6B7oHuge6Bq+sBwCgPWQYFWJLuLDrAeiowINidA9fU3RYEENAL9KXIW7yyFkVG30lz/TpEmdcv2Mem7eNDAT9vcOh7+q/u96P3vO0BAgAG26QEAT70M3eMs/oEAVqBgAT+BgcIApD6awHbvr7ZpfyPym0BLaAIEAT8A/pNAvq1gQBXAgDMWQlAe/CsCCARkABsEhCgDFAqEJ2i6NhvbGkPW9ihnuAWPXUF/5cFwNKPV7/yzrPXA2YQIIG3PKAf3mCA1HIp/iQB5KsPDb5I1bVuyyY6LPXvM/43+69Hv/7uge6B7oHugVUe4HVDninAFgJWDHjInuB8LjggyG4FAFrg3UCAVB3bUi61PCk8YGTfAACrHhLgy9/zex8b5YJ9+kJb+IZzFwD7AKPHfNVjvmuVs7ty98AV80ArAOBKAAIB/GYA6h/4wAdetxpA0A/NYIBbAS56lvOK3YabqrsGqwHPAmoBOL/ZAv+kBgHWUoMALHVn7z1nAgB2XWFAOe0YBHAmu4JXgT39pN+sHiBhjwMPkaPjigCDAwB/EjqX8GyYDasBCAT4VgAAt4B8CRW0L6HYQ09a6yBnpp8+cI9e8gMv+Ye33Xbb426qL0e/2O6B7oHuge6B7oFjeoBXgBkYYMmvwQFn3gXs2wIAgPWlSZsJ9g0ESLW1LQAgmG/R7LOBC+z7CkNfX5hgv8/uH3O0dduX1QPf/wOf+Qpn/pOyAsBAAN8dgD2HBNal/4J/AwKuAugHAl7WO355+vVlX/ZlX8WKAGfJAeFTs/8Cf8C6/FIKyEcXYMkydvJ8rC9P2wYCAPcAevIGKQD3An/BP0EFAH4GBsizIoBEIIBl/5c8mHyNFQGeD0CwZCoQkAC+FSCooH5JHtAP4CexzJ+gRH9t7uX5nvaedA90D3QPdA/cJB5g9o7ZilaAgFlylsabDBgkFcxXmsBfoJ8UsO5qBOoCQgDzztgD9hPca68Ce5bt+yo+ghvO6HM9LE/uDxc3yUDul7nVA6wAcP9/BgDk+Q7e819fM54N8E1f+uDrtgMA9gX+BgKQuQqgn5Gx1f1dYfAA44T3uAM6WQEASM/Zf3kB+650RP0B/KsdAwHI6Quz9oJ7AD+8iTLAvyDfcoE/emwzYEveFdsSc41VgwQDAOMCc/xBAqy3gL+z+tKlwJ9gw113vf2EQBABof6F6B7oHuge6B7oHugeuPwe2PCwYLDAgAEPPa9+2dfeQyJg0EoGECp1e4LL8a3LCgWTh/ABXki0S6IfHXRc/kHTe3h5PMB3aS4AYCCAIAC6bAXwDQG5/N+VAa4AgPKGgctzpb0nl90DBJ4JBPzcu971KxkEqED92HkDBYBf3o7B+QHM5APqWfIP8Hfm31UBlBEEQA/g/7KXPO3kkQ9/2MuverAZUM6MPAD9zW9+8zhLb1BAanDAAAHUMigg38RWA/b0Yw+7rDzgkMjLPjZ7/7oHuge6B7oHuge6B7oHuge6B24ED1xjG4wgX+ry/8yzMgf5c57wgJPHPepB43YADgfMYECuCHAVwGU59OxGuFk30zXcfvvtT/6RH/nhN/zar/36v9ll2f8hggQEAgCzgHmW8TPrLw/Yd+sCQQBm/gkKEDD4U1/+Be8gMH4D3q8Ne/L5TnMoHwA+EzLKuHYTAQTTaTBkcwP6pV9S90D3QPdA90D3QPdA90D3QPfAcTzAChdWujC7CN1n9uw5z3no8z7w5gePe/0F+y0K8He7ze+/47aT97zpK8ctNmytecJXf/a9BAEIBpA8JyBXAuzTx+N4sVu9Sh4AdL7whS98ESsDDgHs19ggCMCsNQEtwD+z+8z2syoAsP+Mpz/95M//ta/7CKC/by+7SqOq97V7oHuge6B7oHvg5vLAtdPLvVnozXV3+9XekB4AXGweestHANg1ceDe2qXG2Ps3b3/wyX/+F9sDAAQFOJODIECuDviDf/cXxjxbcwBDzvoTCDAAwNaAfiDgDTkkL+Si2CbA6gBOiP+lX/ql31wD5tfqsvKAgwE5JZ+xzRgnCPBNd9wxjum+5exChkBvtHuge6B7oHuge+CG84CgnAtr8cr2pTec4yYuqPtpwjFdfDU8AMiYAv6tQMDpkvvN1NWxHJfzMr73m285+d//5gNPlqwAcFWAAQCCAJkIBJDQ40wPgNKz/uTm5Lnf8ic++c9+6m+dsFKgbwWYuiNdvo8HDAiwQuCuu+9+h6/3A+wv/Qj0PWzQPMv/Wfb/pCc+8YSAGcva+f7Q5j597nW7B7oHuge6B7oHugdubg9UgIo3lM3xtWwur72k8DdDSr94/ciWfNRfS7FtncovabfrdA88ALDBIXoV5E/lv/yLH3bCKf0v+PMPGkE9r/djTy52WIJPAsT89CseMs76M/P/rv/jISev/+4HjqAd8J6z+4J+KWWcA6BeBgCSp5xDBdkmwMGBfFg98I23P/ikA6c+sI/tAcY5KwQ4TNBT7D2ZHloPpeNwunfc/YZxmf8b3/jS8YA6zh6gPvvbCcANfd4cu9/dfvdA90D3QPdA90D3wNXxwBTQU76N5pWqi6zy5qEm9bbl1duX1j5o79hy2zkU1V/baLYHz8drvS93/3zVSf3krd9p98D9PADomAL6ygH8HMYn8Af8k2dm/+QDDxjTx3/q08dZfmQkZvv/4L8M5R9+4FgOjw5v60ig3woEIGMFAAlwn6B/igf4OxNLG3/pMbf+2v0utgu6B47kAWbrCQY89alPfTrp7MC64RV3vOZuTKcH2fGdc4a/H1Z3pBvSzXYPdA90D3QPdA9cYQ9UIJf55L3EKss8vAn9Fq/+Epo62ur0U37VF/p6Ka31WvmWrZQlT/25fJbdp9n/3hQeYJZekD9FAf0kDuBjxp8EwH/FMx90wgz/f/vQA0/+8Gc/FQgA+P//2fsbYOu2sr4TPRCi5E0MS1JdIbeM3SXpSip2uhQrFVImV0CMVwWaih+xjEQwoQzhYCQBleaCoUPilYOBvnIQNClyLh8GEIoY+3BIDDmQ+IEgAdFWydWgkaT0Jtr32oZSOWff+Zvv/C3/+3nHnGuur73X3u+cVWM943uO7zn+//HMufAT+EsQIInnawAf/dAP9AC/nvJLDgDo/TeAMdCf/hAFxOf6xK9+qC8nIOuqdCSnyby64N+bIq9K2ZdyLi2wtMDSAksLLC2wtMDSAksLbG4BQRkxW/b0G4uT/sQ3jfbqrvF1G7+69b9MueoKdWxzmfVr3Tv7QXuVpNvkN0TZKMwr89uYaIlwtVuAj+WNgf7q78k/wP+jr37oGvDzYT9IAAwq/gD///KBO3qTwL9l/8RHHtur6//7n/4XZ7/2c/f34B3QLyGAnPMaQJIA2D/5Gx/vSQC0BwYtgNWp9pT/svDtz3jkB37kRTfblvbV4N+V/WTLf6rtupRraYGlBZYWWFpgaYGlBZYWONUW2AS8DG9J/OaY1RAPuZXhRIo0yH0M7+KeukENkzKOybHy79Muu6Tdtg9LfMbLqjNzxk0rTpf0HMmUbuzLdUVagL/1qyA/3QB+3Qn+UeEXzHOaj8Hvg+/8vWfvecfv6eUv/vBDzzB9vEH93zRVkt5/BgCwJxkAAYAfpEAF+WNutABI4/U9L/i8ByEB0HToumZ1Ct3DGvOYP/OYFwDuBfpT8ippMZxC+y5luLotwKsRvEpxiBrwzGbuRJ6rLl+fa9iXa2mBXVvAcaTcNZ8l3dICSwtc0RZg8ntpd0FoyVUXWX/s58wUIBwDoIJWNpXVcLqEHzIND9gx43uJyIs2qL96z7Tjpxt5DOM9zFu3Mu+vX0vid9GGvuSeKcf6F3/GgjLHhfY6jnRPjcEMq+O4jvPO7RzYRXbJl2ufFmCsCO5bknf7NXxMT5X/j/+rG71aP4Bd8N+ShiMx/asAG4gAiAGIBF4PANzzegBaAajyA+gB9nO/BUB60nGRx3OeeMfaAAb2abtd0zKHBP2tk/4pAoC5tet9l3RLC1yhFljxIVLISdaoHcu9Ii2EH/n0f1na5YnEL80yr3Zs4SUZ+5a8qjvDFvvSAksLXLEWmANMVl2dzpkKfBIUpV1AlVLwVWUFcjzcNhlBbJVsfvFLiX2OYfNKvJbEbzHHb4Ox9rf/7Bvdc2SOhzpedG8ab4TXcco4bpEMOebTnvNDe51PuOuc69zMVebhnDnbRbu9L9qwBfr1S+Dve/5IDCr+qPdzuo+EEAC0t0gA/H7rzTdV2QH1PRHAxwIhAsbIgMGfuLxaAODnb/3QCkALQBJgExFAeGoB8FeBkBj8AwHfLUAjgPF5xJFwgznhu/z8/eEUwJ8KgyzoyrlsMI/YWUvWp9ECgHPXn8/79N9/BhnAM2yb0pGGtObTkoYTd5u8l7hLC3Qt0K/F7FEe//jHP6Fzr/Tr5HItLbC0wBVoATdUc0CDcVZdvdbq8IKUKhPUYK+AXmCUgGkKYAnCWnIOwJsC5p//uM//B4Qjx8wXfskXvp6wlNgvwjzhax53v/fZ1W66KslXv9Y99LtIWdt5yp1h2OcY+3pqTMwZU62xqN/YWGa8V6Kgzo06d3TXOVaJAeZlGOfrJtklOQesiH/tLza9gv0q3Sx76u9f+CE5RZcEAJyj8i8RoMo/hADgvRICEAEQBRo1CUbJgIEkIC9IB+4PAQAR8G/f9k393whKBoy9CpBaAGgDQEIAtNUygAzoTwkPdLrOWGXuAPoB/JhtTvptG6Vl/ScvffSD135Q3sYVZE10zV3/U8DwjwH4d01z3delG9QTUo6PjLIG8Q8jz/qzqx7Es+4M7TBrlKwe/rCPAfCnDOue90FLYFbGS6SlBW62QD8f2c/c9fK7vns4lCDkus/Tg/U/bed+MSX+SzserJmXjBot4CRFbjKrLs5WgL8CGgZ0mjFwhH9OBO1uDKoEwOE3BuTGwCBgVuA4BWwFxsjb3XzpX/+Sj51SG9BvlOd/+otPvc8+xK19jhwbH5sIgjoO0+2YrXJqzOfcqHNH8I+EAFAmGTBBBGya24azRGC/LS42u7zPr0kCQD824QB9APMaoHeAHNAPqGVDzmk6G3QJAT789xu/+CkPQAQQD4O9RQgAcAH1AHDk+jsBA+g/942A8COv//Ndj+9fD4AE8J8CIALIp2oF4CYOV/9RwA8/cq2tYL3Ik3IA2hl/2wyCBPytD/iR79TJfg2DLEA74aVP/cy+bWlfzPARw22KtsS9Ai3AOsb6+W3/97/6ztfc/YKPvPZV33B2z/c+Z21wv+RFT/2PrMmMtStQpVlFpN4Qb9Sd9UjQ7z+MvP6ZD+2JM+bDfc/9Pb0dOfcfMdQAmCIADPOvTCnTrMIvkZYWuNkC7Bl6bNDJ3Ess7TPRAqxjkJy5zlX7K+/6ujPisI8c2nYixyVoaYF5LZCbfCfsmFx1WY4CfwZxmgQuCWhawKeCI9wJotK+C7gfA38CxG2AbAJf7chDmL/wzU/5bfPRPiaJNxZ2Uf6tMqSfdTmEpI/IJ2XaDdumL43L+IA4SPKgNWamCILWuGTc4p/jV3trzLfmBn45f3Je5XxLAkB7EgHM3cGMze/076KuL/yv7UUbAfI95a/g31MxQGivrg/4RmVfM4BxwDbA1E00EkKAU3pAP2QARq0AZdUMAABzLwx5ru8ZoL/eGzfxICcA+BAB/mvAGBFg+Cd+8flnv/Hhz+i1EzLf3/4vNz9iCLkBMBkbAIw1xrJq/YKTCuR1zyUAIETI69Gf9eizRz3qUb3BTrsiFzXlsR65mv6sc2xwv//7/s7Zu+574znz7nd+59kPvv3v9obwt7zpBWdveN23nEEGMPauZo3Pl5p1yDVICRBP4A/41zA3nGuveNYfe3BTO9R/Nsl1qmXn3qQ5X8rFdUVb4KKe4Xkf9xNXtMkuptjsDyvY3+SWDGBfeDGlXO5yXVqgNUGdqMgVJoEDdgFFAo4EItgTpLSATAvwCIZStoBUC3i1AJp+ADnB3ZQUNO4CUCvIJo/ql27si5luA9vwGU9/+plthx1//b76q75q7ca/ujO+6ZDV/OWve9pP4qfUPjVeDNtEFtTx2hrT+uXY155zhbmEu86pnG/OxZyf2p27dU4710PmOlDtXbTrqREAkHTDDREgAeDJPxthQHwPjiv4lwRAdmGAcE7/3VADXLGTh1oBfCOAuH4zILUCeEWA+yC5J2l8Rx9AvC5Dqxz4dQaSgTwlAvy3AN73T40A7PyVIBdx+vxrvkOeEAuc5rvhYCxCCrRO+AX6Y3KKAKDMvKKAhgIkxhd/5h/v2w9ZzQJOmJJX/2Lt4rSfTS9A/0d//Iea5r3/5gf6cOJoIAUgAlhLr3pLVAKAdQPwzzzy1F/QL/DHPwkC5uMYEcB8+dov++wzyAK0aVjnHvGIR6zXKtcspWsic/2qt+1tXn6e5V4+13Uv8pJagHnlurcJ8LfCIT8xkKasoZdUjeW2J9oCTvSUq66svREMCA6QAgbBBJINXwUeuBOgYBe4KAU3ygqIBOopBVXIr3vG175XA0Cr5lnPftbHx8zzn/+8T2qe+7JvfgCDW/s28n/5h3//jPjI57/uBWfIatJfe0uO+aU/9mOZF73jOw6Sd7ZFlj39bSPDW2HGuQj5spe9rO83pIb7vuQlL9nJOL7W8oXP+wXG4/MHmWOTsYsb6Ziu0rGf8wF7nTfOJ6XzrUrnZ2vuShzkPHfu53rgGuGa0clcS9LeBV3NCxAL0FfdVvCfEgC+Bt4J+Aeg3ofpPwBmtQE8uWZTLRmAlgAgGJAOWAe0qw2g1B9CASKAMvCKAVoBgPG5WgGo8hMfMA3Ix0AEkCeGfwLg+q+f+K1eC+BcXaxTJ9EGoJykQfWeckAYYMaA/pg/eWSYRMX773vF2fve/b39ye+Hf+xNZ29961tvIQBoR4mAhQC4mnPOUrO+sHkFwAPk6fsPffhfN8E/pMCPv//9D7RIALUDyMu8r6i8wZhm7QF8M8cq4Bf4M3+wEw8Qj6xEABo5rG+s6bQH9n9+91860/A3oKR7yEMeMkoCQFwS54q251LsoQV8vu/ZICvH0oZ82Buc4mW53LtcWhnZv7VAvX4Ae+3I6jZMEgDJXvHSKrTc+NJawMGcctWVpjc8ZHNT70KQm/85IL8CDAGIsgKVCmQqqK8ASOCEnDItwCa4mwsk73713T0YRKZ505tecab5zne/8ux199xzhnzbO17blG/44JvOMIRrvwj56p/+nnP3w63J+6dftRMPvymZeZ2KnQ0gZUmJfR9z773vPKsGFVT8ACFThjHSMjmuql0CAjk11mGHmSdK7GxyW8b553xU1nkrMYDclRyQGEC6znQy1x/tnfdpX4J/CIB6+s9GHD8AKx/260/uAxSPgWX8EzCTN5t0CQClWgHkX7UCIAIA7/09IBW6PIn3jV//8DM+RKg2wSQRQFmHtFUjgBN2Ttp5DaD/DkBHAqAN0GsgDGluqV/nT73IC3DC6WMC+Sl7kgXUA8P9Af3MXcAfBjcGouJ7737pLQSA4B+5EACnPbc2lY51jI0sAP4n/s09o8C/agT8mx+6e60BoCYAfpAI14AEuIN1GZItwb921f8hBFlTAO8AdAzkGBKCUfJADYE/97l/9F2YN//9/9uZRiIArQDy8uQ/pXlDHmzqzyX8JFuAZ/EdT3rSk56KGUrY+w32TSLjrsAPmxKceHjWB3u6L6TornuC+JRjQD/jVHuSAOwRL6QSy00urAUcoA7WKbnqSrVW328Bfyaw4N+TwEoAJEjAXkGE4EIp+FC2wL8nnMp6op/uPD3V/vQX/c3fwY589rP/xhlyffrane7rrnKb0/45cTnRJt6xTulv13xt0zl9MBWH/t/XOL6mJGFpHKdV5rhOu/Ogyjp3nFNK55yyzk3n7hxwLxnoOpHA/jqA+00rtKf/AGpAep76SwawAQbwQgBgsPegexsioIvLiT+Av260kwzgXXuAP6AdQoB7YXrV/ADzgGdfDUDiPkcEtMo2QgQAtPknAK5f//Vff+ATH3nsTdKhlcfgBwmAhgL3BZi0gH8CfsIBImhF0A4Y/sIQYJegX/CfBECe+AP60718pXzTCD/tcIhN3uUHxEMCJdB/z3vfu3Zjz/AWASARQH6sfadd83ml4wSf+S34VzKXWJdYS1hTPKXHj/nBOiaIR2uI+Uda8hL8p0QjCBJgTBNAEqAr9WpeyZdYe7TA2P5+jyxvIecn8+LZDyaISGKQ8Dpn3RR+LvIlOSzjDXHPUA79L6RY7NsqgN/kniIFEvxrX0iAC+nKo98kByb2KbPqwtfA3428G3ukm33Bv9LJkIBBEKGsIEPwoRScKCuIqSAHN4M0ARH2Cp7SnWAfew8Y91Drn6stgNo8cZEatAL2NZy+k0dKT+mvqqz1Sfc+7WW7K+2PuX3YiieJQBh2NEv0m5I59hyTOU61O57rGMfdmg85Z5xHSueZss5H5yky5zF257fz3XXAtcG1Qsk60pnWWtN5Xzxbzk2PdXn6DwEg4FdKBkAMAMolAJQ9UA+Q7Lv7t5yaE2c4OScM8Ovm3U06EiKADT1hEAEQAAJt7tUiAvAjP7QCZhEBkACFCGDzDwng9ds//2XnPwYYdTxXtyEvXi94/fNu/q1fgn5ACqCDMP6uD8DBCS2njrgT7LfslOk7X/r8c4CfdlIDAPtCABxrZhw/X9afVP0H/CfoF/ArkxxAO0vAf+877lrb1QJgI9zVYHX8Whz/DpCUkgCo+Kvmjx9zQHBeJeuXBIFpmJMJ/LUzJ3kdAAJgjASAZFg0bo7e3z53GbvYkRjs+1zmm3IqvxX7hS7Ctvc1/6m8LzOsr8/Tnva0p995553PHQqybR13Lj97sU1gfyp8GyLgOmhC7dzQ1yBhDkon1ZQ8B/7d3Cvd9CMFAgKDChgSTGCvYAO3QAQpSFEmkNGegIePqOEGCGFPgORH2JACKU9ZcWvnhBd7S3r6CzjD3gJz+itbcTyJJ0x7lYBH/ASYAFTsAlUl4Dftu4DhiyIKBO15P/1S7lKHTEN74LZdUtqe2b62vX66ka3+Sz/HxCbZGlOOuZbkY4P4O1aRjF3HcY5tPx7o+FcyF5wnSueSMucb9jon65zNOe08d97nWuD6gJxBALj+XIPl9Y47aDPAvqf/2DH1VQDCWwSAREBLG2CUDBiIANK4gVcDgM08RiKADffrX/Gw/t4tImCtqt/lSX6cxr/0hTf/Lo+Tdl8pEPCfA+8DKYEfJAIgnlcC+DeA/sOAfGxwIArW6ap7IAYoG+2jNgCgH1IC4A/A4KQfgI+Kt2r+937fM9f+LfCPHwTAtz3ry88RAIJ/5aKWfHWnIhvUPP1P8J9gX3+IgLRLALQk+V6nDTCq+4D4nlAbJCr+EgBqALiGQAZw8i/wJx3xcQv6q4QEeN4zP+cB1kCIA4iA1CSQYODZcnVH3cmX/IbPYZ/NuLtSrzqTmGCbivjcNr3uVh7GaYVt9HOvsTFiO8Kme9fw6m7net6XNJpV2M/HOpKLvy6dAvj7hHn6n5K94pGqsmR7AS3gQOVW2pErTV0sXDQS6LPxd2ImMNCe4KECiwo8BCRKAYsygb72BEHVnsBJewItAJunrII3gb3+CfTwS/eUXeCYQDLtCUK1A1KxJ1jVLphNmYB3F3sF4eShX9r1Q162aZVrl7qbhvbFbjsj7Y+WpA/xz77EPjUWWmGOrxxvjkclYxV7jtlKCDiu69jXnUSAc8b5pHS+KXNe1jmb89k5rmQdmCICXE/KpiPXHuxeadfvysjVwx/2McB+iwBIEgCgPkUA+FpAD7jHTsur/0AEALzZqLPhbhEB+LHxBtj7UUDKggG4r8kHwHlnJAIoM1oEgPk+zhC+BvOWZ/Anb/Ij/rnXCYy3SQ75kJ6TRP6mDbAv6K8gH1JAYqCG6W4RAAAcwT/2hQC4MtPtXEHZn3j6z6l9Av7UBPD0v0riVOCvJoBaAGymu5uuzt34ijpYs3nnPwkAwDxrg6AfEoC1BD/Avq/lkIa0+BOH+VnBP24IALSB0M7hXwJYA9UiYH3iPuTBunlFm/EqFHvVFfIG/f0zP/Oz/+5bnve37sLdmd6/kztfPPt3OPWe+4w33qorIGbfy/xqPvhrathcd+ad9rnpd4rHPm0fgD8nbYJ/7ez9dirwkuhCW8BBXeWqK8X6dD8Bvid5bujHQH4CggoWEkhoF2QoBSFIAAqq+y3Dx8zwn/qoWX7ALz+E5kf8lHw0DRDnx9PSrh+Sj68h+XAf9ir5OF/L8BE5P9xX5bE+dgcwJ++Ulw3WD3n/WrdjtePcfGu/5jhgrOCuYybHlmOuJfHTOGZxa0fmWMfOvFDWOQJJ0JpT+uUcxO7cRDpvlXWO5/yXCEC6Xrh+uJ64xkgGsP4Mpq5NnffVvKg7m1sJgDz9x08CgA0vp9mbCAC1AYh3C8juwPOYRgCn5wB3wLon/27olfpTJu5DGsgGiYBbiIcuP18NSCKgL9cA1G8p4+APWVC/N7COSxyJgLSHn2UDSPDhzHy/H8AmuOcfCeYQAPy9J+0g6E+JP2P7ao7A27vU9d1/v+4vESDg151SLQC/AyDwr4QABMPXP+WJ33rVW5r1mL8p7TWCOtAPoJcIYH1iHrCWAfL91oav3yTwhxTAPUYASAIY/s67H9vH5dsArI/cgzLgXl4FONqoWnU59++of/xjP3n2mte8+o2dGz/MXLBa4/VunvN7gkHzRWrvrM1rU3gzEWXk2TwEtvK4gfo+8ZoZnLAngHwOiN8njqA/5Svv+rrlHzxOYFw4aVpy1ZVvDfLZeLsJd1PuJt1NOzI387nJ155AQHCQEvCAmtyY4SFdTQUu6Qb0aBJIaQdstczUF9YJ82vsSr7MzgZBAyDUD7v+Sv2QbCTSTZw57oyDfV8jCUA+2lMeEpifWl6tOu/bnqZvgX60B/BHMv7ULNDu+EQK9vXTLdhXJtDHz3GPTOCPZsEa9HfaKTlfAP241RAQ7FfZ0gpIAmATCeB6gMw1w7XEtcW1xrVnAwHAktp6QON/8hfvjksACPZV/5cA4L16TrQ5pUcK8ufI9cm84HhKdmAa4Axo5+vdqQ0A4HWT7ykcJ/TE59ReEgB5jggYADplh1yACIDI4B69an8LwFPGMf+p8tewuDeaAKzbSQRAAszRACANYCMJgGrfc0N78uP0OhYQUO7pP6A9wX2183wG8Kc0DgRABf+61QJg/3KV25A1W4DPegWIF9xDAhDGuoAB3EsOKJn3GNym43QfgADgF+yrEYAWgP6GSQSQjjD+KQQ7+8ur3LYnWvb+FQCewT6XsXdlXXUmn7falVmdTX6Et+JkHi17TbNrPqN5U2f2JRHBe3qvG+xTBg3FiHbaVubKPsB+m7QJ/rVfp9ehTrun55XulkHdJVsP8M5+Cxng5hzpwuAGHpkbe+y56ceeZAD2JAK0J6hIUmDOyX8Cm5YdEJQgSbsAS8A1JQFshFcSwZNcJISBEqCHG3CoJEyweEiZ4J18Tw10n1p56BvKlFJgvo309QDGUb4isOk1AYE8AB17ytbrAOnnayZKwvJ1gXxlQHDfkr4CkFKwr5w6+Z8L/Ova4LrhOuLawkZD0D88YFesRZ3JtalzXv2LEzU21J78V/CPyn0CZU7FAc9zwP973vF7zjDE79X2K0AecQPquSfv/buxR0IAaNAGwLCpJ+/UBLiFBOA+XX6+FkCdMOdU/DcB/gzXrrQe1T3c13sDKiACPP2XAEiNgAxLOwQIbZAn/9rxHzbHV39A3h41WLGvAPwnUBfQbyvVAGAcmV9qAeDHO7dXtWlZt5n3rFMaQL5AHgkhQBjEIaf/uHkNgPXBbwYQzzQSAwB55iXAIkE/dgzgP40EAX7Mz5/+wFvO+JvCq9q2J1xunrX9/r+TvR33YMfdusb8a1zizY1L2hq3JycGgL4q4TUu6TddpkFqTJPuGi/jaN9Wmr95b5t+q/gA8SkQz5o4FV7DpuIL+qsc+m2rci+RL6cFcnBqX3VF6U1u0tkAYdzEK93cu9lHViAwhyiYQxYARCpQEcCkTKCT9hY4ws93q33fWmAF4MIvQdk+dt8Pr++Mb3IDMolTgWd1A2jxmwNs/94H/+E5UIwboKw8NSC/TXkkRlIekoSpeUn2IFttL5HEayMt4klyKiXEFe6USWZhTw0A7YzPtSZAd+rvyb9kGeO9nvzrdg7lHEuyTgJPmWRfEoF1/rMmuE4gXTtcU4IEcA1KycqI+ypeKzfUykoAAJLX6u4C3U5+/F/dmEUCQBRAAiBJ0+fVAsqRt3F+55Of2p/so27LyR6AP4kA7Piz2QdkpxYAdgD/OW2A4R5oA6AFAAkwqQ0wp5y13LhJl2aIw+sPlJV/ABD8AzJ4DaBqBgj+P/xjb+o1ByoBUMmAbvBd1TF4FefNzmVmHWJDysf5Eqx7si/4V70ff/w8/ded8T3lT9Bf7WyUr+gYuaHmD2OedQoJAcDHNQXygnvAP6CfNGoCMOdaJECSAZzuA+4BGHyYc4wASDIA+6/93P19muVfOHaeElMJ8zmbdtP0fsPzuRVuvG0k+UxdfTh7hrteftd3D/cm/qZ0G/MsEWp+uDGrQerunDtdpq9yp8zmJGLtY81LAyHOWjgF5Cvon+uuwF/3VSZD57TzdY9TB+w5d5IC2N3EK93cK3PjL0lQAcIcgkDQkTLBSYIW7QKa/Co6hABupF9QTwlAwo3MD64lSeAH2fBrmSQOkkBI+xiRsIkMqOFzyYFKFkgUKCtwlSBIiX0bk4QC6VrubYD9prgJ+Ik75a4g/lBuNo7kpeSVkZq3WiJIDMRBGgmDKtVKaZEI+kkSpBT8j0kJgJSpmaPd+ZZzEHsSAdjHyADnv2uCa4Rrh2tLt8CuBnNu7en8dHfW079oB4G/shIAbLABrq139+dqAqgtIBHQg/KZ4BptAMyrXn7zHV8APwAgDZt9AH99FSAJgUoEQA7wOgMEgB8J3KZcLVJE4iLDbDuk4AS1YQA+4B6gAfioBABuDP9I8FN/78/0J//U2VP/JATQ4jj90XZ7l5A9BOsXG102vQn+6WeB/xwpOWDc1AAQ+Gf+EgSsa1etF/jqPwSgGgA57/EH7APwJQIA/cZ51Rc9vD/xlxyABMi4+psWSRyJAF7Pwc58BexjTwIAf8gCSICXPvUzz5iHrKkX1cY8l3ie/bUv+H330E4Xee+LquOm+9AGL37xi7+NZ/WmuFuG9x8g7NLwTK8XfqmdYJyU2HXX9LozfMX+g3yHwAzr7YRT15E4Q7LZgjwxqzD6dV6Hvzhg+oG3f1fTsF6xLm5LBEzFF/C3JPPm8DVccjxGC/SDv8s4pQO1JVdd3HOvDrhxdyOPdHOvdNOPFAggD0EGCEyUEgApJQOQEgKpHZB2wH8agDvuFtjXrwX6BfzKFugH0OPfkhXsp3sX4H8MkC8h0AL3hl22pN6WQXvK2i6b3JVM4aQeP+QmQ18TpzUW5vj5OoCvAjAused4TXuOa+05F7TnXHEeKecC/jqXnefMedcBJOuDawZryWDqWtN5X+2LL8cL/JUSAGy4MRIAv/Xmh66JAMAzp/nbEgBqA/hawPqUvHWKnn4dWYA2wG/84qc8wPcIIAHUBmCzj53XBSAKEvS37GNEAOkpV/NVhSQrWnb8Bv8E/LwuAehHi0LjdxRwC9YgADzxBwxCzuH+sTf/6TPaHaCSwL/aFwLgdOcha47q/mh+2OdKwLlAnn7H7mm//kjC0t+4SPIS8CvNP+VVA4icqgPy07AmMedZA7AD2HvTaQOg8k8Y/qQBlCN5LYB1zBP/d3zljXU6/SUDjEOeAHzAw/e+8os/iX2MCOAfPpivlpMPA/IMOfSo5Jkk4P/2ZzzyA5AZ1Vy1Pt6zjXgmrwZia9XZfUbvmW2fvBIA5M3lPdKtfy/ZV3SWFY7hMi7OZnr69klPetJTkSYq8gZjasjbPEqUrZx9mZ78VX/oa++97753se8ZUmdZt8pwKjLr4Bj4T3/WyClQz+n/pvDUEKjgnzD9psq7hJ1uCzj4p+SqK35v3MgrmURpcuOfJEASARU4sMimYVFOUwGJQEWZYAa7IEfJSYFgKGUCJ+wAd+UccEYcQXra9RuTAsgKLFtuwCn+YyAVoEuYgPeQUpB/yDyn8rIeWV/bxHYwTP99JX1EHmN9Zb/OHQ8SRNvK1D6pdsbkM57+9DNkaq/kWMaupgvSsY+s88N5o6zzK+ce9pybOXfHAP8WoP8oD8fLWmr9AKDgXwkJwCYaiZotoBYgqklg7en+tlJtAEC97/znyfk5+wCwIQEw//gf3VTxBQRIALD5bn0LIMuqvZIA3CsJDcJ7IiDBfhIS2ks47QToR7NAwI8dogTSBJJAjQbyJw6nimoAAOYAEvxzAMQBhjwBI9RT4K9duXyJ/LJm0PR9WafYrLaAP8A8wX891Rf8t0C/cQ1LkD9lv0r/BMD+S/COFNTrB/BtgXY0ADK+6Von/xABxEeLYJQI6Na/1sm/GgGQAoTzpXq0edA64F6QETyLpkfIeCj7VZ5dkLQYTvnVdmA9qMAfN/63yd+B5nM47eMNOj9kTn7EWXUGqems60s/pJcaA3cwth//+Mc/wYBOZrxMm/aI3rxnhs+x9/dkjPEXiwMB4P3mpN8qDh8hTaA/ZYfErCC/ugX5vD6gvSUF+0rzwQ0xu1UllsiX2gL9gI0SOFg3yVWXpjeSAMokArSPEQKChwQU2BNsYK9gJMGKAEZZgU6CIOxjRADgCXCVppIBuOeCwASNY8Cy+kMKCEbngNrn/us39MAVCThWTgHs2y1MQoF6Yx8ztDdhc9qdOPXUn36z/5COE+1K/edKxty2p/2M8Truc144V5Q5n7DX+ZbzMeeq8xfJA9h57rxnTXCdGGRdVzrv63WNEQAQAYB/JOrxAOQkAfwQYILmbQmA1AYAmAuMPUlfEwAD+FdbQBKA+GgDcPqv4RSfeAL9TbJFBADUAeykbYWvyzWQALYLYJ3XCTAAe/Lo40b513Xs0monLieVAH++BSDwR9LOABOAvmBfEiDl8v7xyc3LFRtegX9LRR8/T/EF+7qrNFxNAMIzDqA/T/61KyUbrtI/AaDVAojm9B4Qj2EOAO4B/swPT+uZIwngsZOO9Yt02AH6gGTnaMYHtJMv9wNEJ7GQ9/gnL330uQ8CqhEAGcCrAJgsC3Y+ELgJlCfYB+iThvJSHoE95WoBf/0N4/l3crPheAUSE1S57R23Sd/vC9hHdDdZdaZ3D7IT5y7zvYP9BvsOQulv9h3nYv6uw/z0MQ/9dRs+JTONduPjXnXG/AzXbbxDyNUU4B8LE6xXYD/mX+MJ+pWEQxhIGuDPHvEQFVzyOF4L1AGpOwfslH3VFa03Av+UAgClwMAJy6TVCCISWGhP4LGJCAC4CGiUCXqwJyjylQBPTD1J9XT1Sd/4N/8DfkgMxABgDDtyjgHkEU+wZ5r0N/xrX/OKHjSmBFTi3iQBpMRryb/yttf3/sokDaod9zEM4HtTvhlHe0umH3bN3e9+70a77+UTF7uy2o03R0oo8O4+9pas7/Xj9v39KiEK8EPmO/3ax97pT38IgJbxvX7mAnbnCXJXEoC56hx2Tjvfnf+uDa4Zncy1pXOuH5jYr/TFybGn/mOSTShq6wJdXwUAIO9LAEgaoA2g+j0AH3As4FcKmJGSAGoDAAzQBgAUe3q/CfwbDuBvAX3CKR9yHQ6YD+APQAfAAyogH2inPm4Xz/JaVupBfOICSmhv2o9wtATQtEjwT3sDPqgbBIeAXyIg5UIAnM40ZF3hXdapk/h8599TfEF+nu4L+I1jGP7aIQK8VwJ+/VJeFQKANgS0A7AB5ox1SQCAMXMFwCvYrlIAD3iWOEAK8ltEAHmw1hGHe5O/+aQkHkQAp/68GgD4p5ycztOvfDcg0zKnSQOoF/RRP4jrBPt5ui+Yl7SgvL1Bu0Az+BGH8lJu1pRrDmh4Fq8OPNvz+Y6dS3nTdf63j88+gr3DEGR8pSl8jWDVefTpBrkOHyymW8dxPxLpTDNXktdqMNrN3zx0pzTsYBI8NAbyN/kL1iu41w0ZMEYICPyVpGFtzm8NLB8EPFg3b5VRDrgx+6rL0TDsa+MmPaUTJqWb+yrd/KcUGCAF9S1ZgX4L7LO4V5DSAv2AmQr8E/yrGi0BkGrTgn8kBrBfJYBdEoAwQf028ql/9+99kviAdqRuJf7YU2LfxgD4iS/wR04ZADrhm4D6dQmHLMm66E6JXQMgx46cYyR9kBA46Z5j7wH9xHv+EFKSVkgBf5JcOQ8S7GvP+TT31N/5y5xmruc64DrhGhLri2tOyi74+l1jBACn/2oAsHHmpB2QKvgHnAJeBdEC+X2kJAB5JsjHniSAgDoladi8QwKgsUAayzZXrkH+APAB+tSROqnCTxzqzqYe4I+hXVTvt0yWGTV/SAHK5Ab9IQ95SL9RB9DjRx6ko5wAG8BGgn+BvgRAlYRvOmG8fiP3NGuEiv0UCOfUn/fFBfstmSf7hqcfdg3h2BPka89yYGfTe1UIANYltGIwAnckBqDMPBEUY68EgG7mEnZAsumVnq5XjQDjSwRwnyQAtBPP1wCQGMD/z37w7T1BQLhxldQHzYaexOgIBoG+0joJ9nsCoAB+tQ6Q1AXQz7ongcuz7jRnx8FKxXP5UFefF+/eP+1pT3v6kOlU/usw4pNuUxr2GV0c0qUZkjVFfw8+9jd88I9Ipm0maHgSf4Xh/ux72OcMfn3+nf1CLl514ABnE9CfCmftEvArx0C/4UrB/yvv+ro+D9ZHNLPIU3IBDHchjXEb38QB3JKrrl1642Y8pRt1ZW7i055gXnuC+l2A/Ri4F4AkKNEuYEmZ4CbtACDcFegn4E/ghF2Qjx1wnwaALuDfBuS3gL2gnjDAubIF7I3bCks/QDvuKXA/Fpag3zj64daeEvs2xnxI85U/8C/XafVvSfzSX/ccaVvYRqTRvo20/VNi17T6F79tTY417Y7DOk4d02Mgn3GfcwS7cwjpHFNW4k1wj8x57tzPtcG1A+na4prTydaa1Hlf/2vsFQAJgJR/6Uk3waokgKryh9ICkDzIbwMIqJFJCqR/2kkLWQFgB6zPBf8ZrxIBaghQPgE/oJ56n1Px7wgD4hJGPDbvgHMAv6D/a7/ss/tTTU4PUfd/3jM/5wE272z4qR/fQyAtbtJuOvmHDCAec+T6j9bTrSFrCuBa8F2l6v4CeU/vBfie8OtWGl+gr3+mlwAQ8CtrGdgQswm+At8BuAH49vQfO3MJyVivBICgWcCNTCP4BmRzUi4BoCRf8iCNZAJpcHMvwiELSG9eKYknEcArAD//E/f1r/NYBvNCqg1Affp6dHlafiT3SDKgJwA6f/MXzHCfb3vWl/fAnzbRQALw/DvdmXKSJbvBXmFot9wLjBW2jxP7CNOMxdefeHOuPj/3NF2CufnXvFd48H7/L/+HX3qg1K/GPZqbjwyyNk4B/DlhLRJAkI9sEQLMF9Y85w1xfB2LdRICAL9FC+Bo3d8PXnJ3EFe56sI2frGfjTuTVOnm3s2+0kkj2FcmWEh7BRVTgD/BSdoriMGdIL/aAUSCI4F+ygRSgH3cSI3AS8nH1rAD5rDPAXUAQ+IJEKsb8Jlh2Kuf7rlAVXDbknPAco0DQMcvJfaLNN4/y1DLuY2btiR+yk3ta98QT7uSPtYfP0zt9/QbGzuONU7ysY+BfvxzfAv+6xzIOZNzqQL/nJ85bxP0O/eRrguuFQL/eFj36w1rzmDqeoSbS3nTdU1/OTn25MgTf93KJAGe+NhPf5ATM0kAwDKgVzJAEL+LBDibTm2A/sS9A/8J8jfZ3/7Wm+r4aA0ksN/W3n8EMLQBklDoSQJeBwiDej9AQcCvpP04+QP0+9/iSNz4087EZbNv3QAHEANs7OuJv243/chueK6u6RA9+WqxFrGRFHD73j/ud933xvW7+oL3TTLJAO0Cft0SA7jRKPDem6QbYk7kWBtPsXFZkwDdzAFAOnMKO+Adg70FlvUTeFcpaGeeJfjXjr8EACCc9IJ37kk5iKO/+RmHNJAWfguAvAxTmhZJnuS3JgC6k37cGMJYGzD0GQAHySsHriOQh6wduQ5g5zl4iv16omXiOb/qTL8PYJ8Q7s46euX+IO01QZ9v57kajO45aczLNLrnSNKsOnPjOc95+PPf8IbX/9NhXOyS15z7jcZhD3cIAoC11BP7TcDfcIG/6x4kAq/pQAJgJAGIv5Doo114kAAHXspVl3NvnHhu1N24K93Q5wY/N/7YE/zvAvzHwH8FKAle0l5BDm4BUEpBErKaBFeCLeUYONNfVe0EdPjhFgQKJvHXvo2s4HQTuK3AeAyck89Y2HXwt362l+2ie0zSN4Q98R+8/sGpfrKPiaO9Svscf8eFUlIgJXaJJceYbmSaOo4luHLc1/mRcwd7nWee/CuTDMC+DyHguuJ64zrUyVyfWvYuyvW5aFs2kS3wX/2SCECl3dPwHgwPQJmTd0H8NlJwXtNABJBnnv5Xe4Jw7JARlI9yJWj3HtvIrBt5A9A5pScPXwtILQBeB2ATDqDntN+TO4E/m3dPNgUekCps5jnRY8MP8cB9zCu1AFrgn7lwfUbk1aoJp+kVdO8C+lukgCDfMNz6SQgQxoY2SQfL09IEYNNLXAHlKWoDoCLP3IAEwAiKE1CvQfNwai741x+APWYA44B18s77aAd893E6AF+JAMpimQTzxNXgRxryoCz6p8x0xCVPyAXmPmsDawanlhjsgH6BP+sHBpKB9UWSUBKAtfxUiZ0dZrbP3x2Szkpi/qsutvaUszLZEIn8VoO5Ic7p3PhPXaazPFNxx8LO3S/2OpvuPZbfTv7s0/Z9BSA1BCQBWif+An+lwF/J2gdhKgHgerhoAezUtbMSOdgcyMrZp/5joD8BfwUD6a7AQbfAImUFIbgrUNFdAY1gR/CTEnuCJE/2AVH4IwX6/KUabqXgqwXIMqzaAXr4pcReTYLGKZBZwwSlSEHqlCRM4JuyBfAf/z3vGSUEvuz7fvZB0syRxKnGtOlf/cbc+qfEjrHMU5IwDG1WJX7bGvqSNMjsx9rH27hzzDimBPu4tSMZxy2ZY52x71xwjiDr/HFeKetczHmq3bmszHmvPdeJShrm2iIpkNKHZjy4V92q5xo2JWctjpcdiXoJ9JVsIiUFEvSnHdDqxhUiwA/jIQHGqvFXQN9yE/8Tv/j8s0/+f1939hsf/oxehR5tAPyJ32sDdMAa0A0whgBYg/44oV+XoQPqgAU+yidY3wb017gQCryTL/GAxEAOUEYM4dwff+KzsWfzLvDHzgYfkMFmHRAB6M84/PUfAJ+2J2/qSt74JQngZh+5fPzvcmYQ68Zr7n7BRwTbSMH5j7///Q9gBO4tmQCecE/2sZtP2vEzDfaM40kWZaigv7otrxtfNsqczp0KaGQ9cnwLyNUAENADpgXaAn7mm3YlfqZRmlYJUOc+3ks7a1t/D9aRzmAXxJMvZUIbAbv+GafeL93eO9MB/AEpABEkIF8p6IcQkAxgXWkRALTd8Ky6nIlxwLsO9eAZe6hr1ciI/FeoqWvYLwzx9r13nzf5s16Q7zDPVp3fnLznxBmK2hTr+3ehqzD75tu82Zgne65DEgCQAQL8TSQAcwgjocZ6mBoArIOsiZIK0fdj1Vn8t2mBmMRrwO8GOzff2t2g56bdjXxKN/xKAUHKCiAEFikrCMGdICXtCWqqHfCOHzINIB43wIm/R8MIqrRXSTgns1XipwHQYQf0KStA39YNQCdNSuzVAHbxE/hqV+qfUuA7RyawJ34C9atgp95ZB9zUo7ZH+hteJeCedk1Z7biroR/xq2NgGyIg4zIWcTt2lYB/7EkKpJ05gdv5cggigHmd8xy764Ay1wrtuaZgd61Buv4oXaOQrGFpuvVvNRgepFOmC571oCfepV31Q4AC/SkiAACrSiybZU6r1wB8IAFaYL/lB+D+xK9+qDeQAJ/4yGPXJADxJQIgGiAGqmp+3re3dwQA8SgXee+rBSAhwH0rCYAfZeR+vAIgUQBBgR+gn406wILNOaAhQb+vArDJx592RXuAuNwXEgBCAf9KAqwe/rCPXdqguY1vzBpRgTWAHND/oQ//68kP/LXIgAT6GS7gV2a89BPMC+5bspY347CJxrBOXna3UgYJACTjnjnDWiPAFkwDzAH7gv8q10RAAfAC75SsFZIA3BO79+R+PaFY8iF/4koWmJ/lxJ326rYepuMerAEC/zz11y4JMEYALGvC5AiuwHf97L7r5Xd9N4bxx36gy8WwyQw3BJLHqjM3yPvXf/3XH+CDeLgH/04c/bIeq+5O2Ln0u+k68i97KDSN8hR/HzsaVkkCSAZUKfiXAECy7lUCQAKVNRAy9MjNcXtlz0bbDbjSTTqybuQraNcNgzRl6LiWyb8bww5rr6l/aZbu/Cu0t771rWdj5t5733l2SMODnfyQafgLOPyRGMK0H0r+7Xf9eJ8nclsD4CVNC/wK2glPYKz/seXffNd/7rUAUqad+4+5M+wY5ZTgQCb41z0mAfe0tcBfkkC34L/lrqQAbsC9MoF/2pMESDJAwA/RpV3Qr5QAUB6CCKhrR64r2F1vUiYJkARAJQGSANiDBLgSiz3tKNjPk3/93AxzWsYmFSAOKOeDVvixAUYCeBOMA2Ar4BfMpz/xeuCPFsBv/vmeCPjtn/+yNbDOuBAN9T55z7W9A+C8BsD3CgDpgvh9JWSCGgCSAWgZUC/KRpv02gDd/QnHH5DAKT4gX40AgT8nfwANCQIkpAGvA6AhQF0hAagXQEgSAHDEuLwSA+waFZK1RDDNxhHgD+jXJIBPO8/rdKc9w7R7wl+l4ZmeOAJ6y6bUP2UrjHdjUY/lFPQyu4t1m7Gd8wE75h1feaM/be8B+TMf2s9vQf8a7Hf+SQqkfwXjAm/mLHa1AZivkgDMuf5+3bonCYA0LyTrH/G4l3kiM07LnXG1k4Y1AaAvKYj05F876wdaWKzRSZjw+sRl9t8VvHcPxiH4Yz09FEDu82ZvAQCGBDggubB1U1O/ICC2Tr9HgtUhCQDJA9axFujHr4J/5hP+rNktAgB/PzIY42CPKi9J+xagMWHMGfhuvnNDjr1u3HHXzb1EgDJP8VvEgH8zlhKCAHclBdLN/5fj9n/MIQWwJzmgPUmCTXYIBOKMEQmAeMIOBeY35QMYJ862QN/4gGEBvVKAXN36byvHQDn+p2Sol2WdU8cxUD/lD5AnXECfdv3GpCCecO27SgA9aRPob7K3tAAkAJStVwLQxsl5jt35r6zrRGstqesNbtciJGuTRg0AJetXmtQEwN4tcqvOuGGokjUQv5O+UCNX/d/Tf774z4YWAA2w5XQ7wTXg1lNuNs6AWCSn1ameX0mAMQKg1wDoTv4J718H+I2Pn0kCJAGgff0F/tYrAPh1AJwyszknz0OSAP29u/wB5hrBPq8d0F6SAD147+Lyv+GAeoE/IB+Q4ebd7wUQzqsAGE4Dece3z28gAagPJADj/KQH1TUsHJtYNopuIgHhP/nTP/kgRgJAmQA97WMAnjgJ9jNe+mvPPCUApr4D0AL9kALpT3oM9bys7mNcOycE/pIBnsgLpiH4kgBIe4sE0E+wrYQA0ADAuY8kAGVhzuG/JgA6kiFJAPLh3sTbhwTgHpAc3Jv1AMDCGpBaAQAb/CECaJeFANh7pNZn9qrLUb99M+/zyX1C2vfNvKTfuM9gj3PnnXc+d6hfSX5cJ/Na4H4oiSaAoJ05gUngX+2o+bt+tyRrIVoA4MnjtsbtlbuTadVVe/0aABMhN9ZuuCUL3JAjc7Pe2szXTX8FBbgFDFVWgNF6JWDstQBPM1sSUOSJaErVpVWhHpO+FoB6v2BNe0pPbVunui0/QaInxpvkFChthQGA8Z8DhGucbUH9/+unfvMB0iA3mZ/8//zOmXG0j0njTUnvu02Za33nuG3LlK12H/OjvwlD2teOgZSMFdytMcP4a/nr5ysojsuxMc2ccPznnMC/NYcg6/IVnBZJUOdvJQlaa0FdL1primtOrkPYXadcu1jHNKxvg3HNS9kFndx1g/YB9LPp5O/z/E9sZA/4O/C6BvTYE3APYQBsSQA2wGgIsDlnQwx4TRJgigAA8BOfOGgEYFrxtyEBdtEC4JR/E2EACcDJvwSAkrrahj1p0rWRZAl183UANu+cGnLax2Ye4K/BjWHj7z8J0KZ9Pl37f8VjHvEzJzeSrnGBmPdoDQr8P/qhm6f+qvwL+nUnOG8BecMzTHsC/LQbbtqUEgCbTvkT8Cfwb6VjnbuMLmUtlgBAMk9Ym5AYwbiguwflw6m/AD8l9moA64J/pOBfiZ/rmfdfg/+iCXALEUB4lz9g3ntoV6Y/gP9V3df/ezOUlfQY5j+kIWtEghv8qRPtUwkAXue6jH674vfM57T2Q1XJ/FZdhhr9DnEP8ppzZbxD3n/Ove9gXifwZ/1J9z52399PwJ/zhdN/wrinwB/yALtSrQAIBeJ2lcr2mlXHJdJ0Czjo1tKNc0o31inddKfMjbmbdWRrM49f3fTjboED/SpRgLsFNvBrkQYVuOAG5Cgr4Nl0iip4kgyYKwF1xE0p2EsA2LILHA3TPQY2W/6AXPzHwO4cAD0FxAlLII99yvzXT/zWZPhU2rzPpjLNqRdxxtplG381LpC7GDVBWnJMkwRtFsJacpM2jBo0Y1Ltm5SppdOyp6ZP2mFzmXOpJVTncZ3rrgEp6/pR1xnWnlyTWKtyDWONm14eLyz0BnX59mc88gOAY0BpPd0H5ANiAZ1rEiCBf2f3o3eQAwBTTv7JD1DLhp0NNIZ8UGMHyKcRxCMBzZ/sTvzz3X8/Ckg46QDllQzg44BrjYNSPsu9rRYAZZW0oG6bvh/gKwESAEj80ASgPQAVlIU2Ioz8aR+1AQT9SEB/vhLg5h6CBnVfykU+1ImxeWEj5ja+EfPcTeOHf+xNZx//2E/27/onANcOEaC9ygrgq9v4+gPqtRvW8iMsCYAK7HUrE+ynvYZf1qsArJkCf8B32isJAKCuBEAF/wDp6ichIBAX+FdJOIQD85U0eb8WIUB88kBarhbo78s0gH7WSMtnesuBm3BeBQLQCPxNT9tUs3wU9MIWq20A4hrzdKXbJt1UZcznBmr9zJupyEPYOs2MuFNRsj5T8dZhlG8fkL8pbQL+JAKwp/q/a3lLQgKwJpLX8nxdd93elhx0OXCwrzRJAmDPzbP2JACw54bbDXiSAdsSAlOkQAUJ6a6AokUI6NciBlCDhhBQSg7MIQVqnDnEQJIBkgOC/DlyGyJgCsgKgMfA8hjIngLpfGgFkD9lzjZcrbTkO3VfyYGxMo/VseVPm9k2U+0n8CdO2tO9LSGQJMAY+D+kf+uVmDECoUUYQBL4TY8WMdD6Lgh+SQhUO/M55zd21GKnCAHWjhYp4LrEWrX3SrpjBpSBOgD6UUUHhPbAGdA8nOL3UhDd+QHw2ZgCOtdhxjVeJwG7nJYTh1Nx8sd85H/7qjPNj735T/fAF6AvCSABQFkqAUBY/02AX/1Q/x2APjz+IcC0yh7sR5nOubtyUQ/AOGUkrykDuCY+4PtVL+/A+1DnsTTUh7YU4EsEkA4C5aUvvPkXYRISEgRs5tmcAPyx+w8Bgn7ADht/SAFfB2Czb39QTvp1xyGxJJvRAsx3gDEbw5/94NvPeAb8v3/h59aq+gJz5aYv/xOvgvoxP/McA/2GSzqwcU0Qn/YpoJ9haWeNvKw1iw/ZCfbHpK8cAYYBygBt5m2aCv51ZxwBuqAbydxKN2WABFgTAGoBdPcW6EsIJIjv4xNnMNx3CvATX8KBV3+4L/mRnvUBLQHzIsy1IkmAhQCYMbGvRxRx1epJT3rSU4MA0P9YtawYTvfG+7FP2wTkdwn3VYAE/kkIQACk+j/xWetY19UAUOLHa1AcIm2s0BJhqxZwoFS56nLpXw1QSgYI/JWeqiURkCQAdjZFaeqmPN31VC/dudlPewUGuisJoFvgX2WLCMDPd6IlAZAV5I+5AfOEpUxCQOAv6FduAv0J+InbOulPPwAo7inw2gK++I0BaPzHAHgLsON3iGss77GytMpvvVp1nmqjVpjtmu09ZrevNvVvhqsdgsyxU90ZVu2o+eM39ioA/rwCsM3rAK35UucUbuddC8QzV3Mua8953wLyrBmuKbneuA65PrluIVnLOlPXus7rQq4VdftrX/D77hHws6ldA+MB1K7dLfDcxQHYAtCJB9DHTT4YgTwSgC/Y/9j933iG0a0ErJNXptOvB/ihAYC/rwBIEDCX0QrALfBXTn0PAGBOGgAD996k2k/d2Oyreu/JO+logzEiYOy7AAB2SQBIFcqDIS+AP/mzgWczjz3/GhDgD0HAf35DBAAKKJckACAlNn4XMrBul5swf9gIsiH89z/9L/pHCc8CgDegPCV2gbjAfF/ZIgpqntyT7w+kBkCCeOwSAcr0q3HTzWadtfAy+vuP/TcP/5Yx4K+/oFdg3gPlDpgL7ltgnzAJSuMhAe8J3BP84w8wP6cFIPCXCFAOQJ/45iGAF/gbhj/3FvAz/11zXAtYD6wf9TEP/FgLbIOUCwFwGSP2Uu6ZewsKoPuYhfEeq7hf2ifvDalYAT7rUvXb1c37+0kCePqP5D6tU//qx3qPHwTCsI+brNMSuLkFGDReDqCWXHWRepMbae1uslO6AVeyOceem/RDkAJsBngYChjGpGRAlQlK0t4CMC2gk34AfNxjJED6A8IkBBKkAfhwp0wQ2LIDMvEXbKZdvyqniADAMOEtUCxgTjDtCXsF3mzK8GsBdXZt+G97mSZl5u/9alkkKbLc2lv1tP4toG/b1TZtuVv9NeWXfZ/jYhu740oQn+OuZZfISmILskvCS8nYrvMi50wL2I/Nx03AXlCvzHXDNQWZa47rkdI1q5OtNa3zPv5F+agrgF/QD5CdPOWvoF9SoJOAXQAteQCeMQn0Afi/9KOvPfu1n7u/N9gF+lUmOQBwJS9AtEQAblT/8xUAgD0fBYQEMJw5zDcCcAv8UwKom4QG9erqymabDTT35t39MTBPnQEZbMYF3Nj71yG6vMYIAPxpM9pOLQAldRVokL/aAvQPm3f+IQAyALAv6MeO4VUBvhvAqxV8mJHvNJAfdYJQoFzdCMtn7PEH3DW/A4QfJ0ZsBlH59/rl//BLDwC20yQo34YEUFuANNozr7l2CABeTYCsSACPXT/Bv7LGa7khAC7rY4Csw8xB5gZgF4MbCZEHaGYuY/QHWAvWBf9VMgeZUz/xb+7pJW4NGkKkB7gjzct8uRf3xe1pP/n37k6u/SADBrf5madx9SfPBP3Mc14BYi1AMucNtxyuTQn6tUMcQJ5c8+m5VO9mC7DmrzrjvkN753W0q78X+41ved7fuosPCrIP6u426/nDerIruN+UjhN81rcWAQCYZ40T7KsB4Kk//mln3WftZF95tJZcMl63QA4eB/McuepyIB7ynHFzjszNe9rd2OdGX3sCgX0JhApOKjmgu4Ic3BUIJRGgvQW2qh/ADr8K8ACJ+KWswBHAqZ/2Fght+QlixwDuGAkAaG6RAILpCrzTnUB9ys6mbgzgt9LlPardcrVkC/jrN9Yu2W6tdk0/+gZ3SvtrStZ+T3cdJ+l2HKWs4626K/hP4O84PhTw3wb013nu/HdtyPVCu2tLrDlTa1UXbd7DkYhbXDcAKawdqPULrD2hByT34F9QX8E+7ggDDANME/AL3AH7v/JTb74JyLtTetSgMQD2HrR3QJ3weuqPW6KAcAzkAGXdlgAA+HP5jYAE/toFxWMkAO3BZp9NN6DZE33SJahPAoANNSQAJtOMkQdzSADKAFGgJgD343SfU/4W6Ad0AE7oU/oMUqEnEDrw7ykjY4Axu8X4WaKOtADrBydJgETAv88Cxp/q/57OqwkAWN8FxCdhoH2XfNQAYCMr8B8D+/orW+DfPC6aAGA9Zr/ERy5V8RfwA4AFwQJ0xj/zKUmACvp1C/SdYxBtzDn9lcRP8O89kZSFcOznAH9qAKR9iOs8RfJNFO5FHr/15puvBzDHAfyCfuojqFcrCEk6ykY4a5JxkKxVmG5Yr0aG9lX35jnLVZ+3N32vz2/WM+tba9i3A0A8vtdh29S4h3L3+bMXes1rXv1G/tawy3jVmVn3Zc8ikGf90X4oCYj3I34SAaj/s54L/pMI0M9Tf4kA3WgsHKrhlnwurwUYnFwt6cCtctXFv8W4+W8RC4KHCio4XWTgV5NAZRNJkORAJQV0C6Qe9Vdf+V0AMCX2P/m8H/5hQRn2BHQCvymwmOAywWYC0Sl7Atop0CswbskWuE6/CsqP5eae5J33btlbdUg/2gH3VHtku021bw3L/trUr4Y7DlLWcTLlRhOAcMdZS1YiAHee/DuGHdPKHP/YJc2Udf7k3MJe5x5uT/2ROWedx2MkQK4BwxpR1450d1EOcvWA/znPefjzAXuAUYBrD/IF9wJ6ZOcHYOxBo+EF9JOWPDBjYF/wgxTs93/X14H+lgTk/8L937E2kgBqBXAfyk65JAGwqwHwGx/+jDM+7EeZzmkAdKr/XKQhvqC/yl4LYKj/LUTA4A+Y5iQRSX4QAdwPO4ZNOh/dSw0A3MQhf4zkCpoEpksJwCeeGgBK/AQAlQTg1A/1f079ABqUj7bIfxqAAKAcgAAACHlpGBcHGWm3cSaCfzaAv/Ir/+kBxpxzALvq9moA1FP6MfBewX2e+o+lMW/JBt2SDuRBeSAlsAv+BfZI7WOaAIa3SAA20sckAAARrMOcWP+5z/2j7wL0A3AF2IJ8JABZYK6/wLyfC8+8SQIAjDHMIeKnEeAD+t9592N7IlC7YUrmFvlyDw3uc1oA5A/Yr1ICQDmEk14iALt1hQTAkDegHhBP+X0VSGIAf9Yk7kd81gjjC/55ll336cvzl3feu3rynL2uV7+HYI50FXQ/kXXV7wan8EN7EH7sNiH/lYa+GOyWp3NOXqsW2Gcdavnv6lff/2ctE9QL8lnz8tQ/7cQhPusme8PJGi2BV74FnDQt6cAek6uu9msjOPC0UDAhwBB0JCBJsFKBjABHmUBIcATQFzhh5+MVCb6SCMBfkCYRAADETyA4JgGZhFWwOeau4HUT0M3wBMpTdoA34QLwtOt3LOm9psqXYdQPd9ZzF/tYe7f87a+xPs33/Ynje/7pr98Y+Bf4E669vhbgX/4x/vIVAO2OX6VjW5njvkUAMD9y7uScahEAzsMp8N8iAJzf8eBj7o+tDXU96aLOvygbgP+eez7trYBeQCcAsge2gFlNAvxi91TfNIJdAb9q/ID7vPJ0vwX0qx+vAqQWAPljOO3XeE8IAAyAGTBL3Tjh5574AXqRPeHQAX9APq8CcOFPfCSmEgDkdwvwzzYZSADu78ki96NdzJNNOhtqNtcYNt0QALQ/8VDDx58TOe7HabxpqySN6v6SALgB9wAAw/ETYNBeCfrNH3/BPqeXkCu0y//5rsf3deHVj/mja4lZW4BnMhtHNn6o+jPeBP9KAPe9976z+Q0AALpAX7C+SW4TX+Av6KeMkBRo46Cp4Kk9UmDPBlY7UruAv7r1N69DEgDsiViLWacZqwLgBPLMgZYhDh/AE4wnsMfOe/0AZU/SVaHPeIL7Nejv8oMI0DCfAPT+HZ/l8p6UC/s5LYDu3i0SwDR9mCRBFxd/1hfWZSSgn/thlwQA+FMXPvrHGuMpP2sQrwhgKIskAOsT6xVtW8f0NXXfCGB8Tat4xx3sP1784hd/21DXVj3ddxhW3fofWnKfVWe8n3LWfY71IUDJAoA8J/7+9V99/5+1DYA/ZiQCJAz4QPSsii2RTqYFGJBeLbt+SuKmXbd+KbFXs+r81iZBApMXM0YEsMmXDKigJQGNBIAyAZEgCSmAQlYiAPCVZIBEQAI7QCDuMcDY8m8Bz01+uwBf0wiiE1zvY5dE2CUPymQ6y7erpM1Iu6ntDG/1xVy/7PNt7YJ8xlMF+vi1jEBfmeNUe45j7DnGK+jPuYG9zh3nlHIO4HeupnQux/yuc7/l7qJvf0ESUpeXvfzTXgXYE7Svgf4AXicBboLdzv7gv/8T/ek6p80AZ0A4HzQDNABwuDzd7wH3yMl+C/AL+lXv9/Rft6f+LQmQFcgj+7/86wgAADV1B0gnAdBrAwwEgXEkCioJQF1vaaNsu4E44b5swPsNffeXfZArAHw215UAYCNOP1AuwL+GzTflFaRXAkA34RIASAA+JACGexJO/sZDUh7KSP6AFEA/hA1tkRftBODhBHX7UbekoAWYd4B/NoVj4J95UjUAPJ0XyI+d5lf/dJtHkgXpp7YB90itBOYwhnJRZk+sBP2Ae+1IwX2LCDAsJRv1UC3eaqCw32FN5nQfsI92CmAcAIwEjGMX7AuYBdnGSwCPHWDMWOeVGYzq/Pjprx0p6Dcf3EkAmB5/5hfaS0jTWcYs3zktAE/5BfmDJA737OtR4uBXSQBO/Kk73/QgDC0G1iDWnfwuAHWCGGDdgeyQBLiN3vvneZtXdWfYVbVbp9Vw+rwaKqJ/1gu/NBk2Zc+8tCun0hmW99Ru2KQEUAvWjyXzNQDsCfYB+KxzKQ0X9OMmHDfpJyu0BF6rFnAStKQDfUquutY4ZwQRAosxMkCwgkxAk2BHAkBZQVIFUYKrBP4tgKZfCwzOBZXGA6BiF6huKwXBKXcF1aYDpGMfkxlmmn0kdSb9tnWv8W3TbaQETqsvt/VjXJDG8bFJAvCJg8z3/FPNv47RCvYd28oc/9hzbuSc0S7YV+vG+YZ0DiKdl8g6Zzt3a4533rcQhfjtfFEXAP+9P7i6n9Pgc6C/gPlbQO0t4Y/sT9J7MN2dDAuaAYsAB0/oAYxcyB5kj4D+DAPsk58f/VPi533MD0CCH5vpFvjnpA0iQi0AQK7v+PevAHSAF0l++PcaAJ2dPAHUqtGzEcYNIVBJgHU73tJGRYOiCwdgs5nmS/2UhQ24AP9Rj3pUv9mWAKDMbMx7kqED7PizGSfd2OsAYyQAIB8CADLEvqUu5IWhjf7t276pJ2xoi7xs6/QH2NxGQGDnOVcTMgf9SJQf/GMMV0P7o24/VwMgQX6Ce+2AfMG9kjDtSNzkA8AX7Ndy4WZ+f/RDP9AD/gT9gv30Y/ObJ//GSfCPfYu/AbxBGwL0BfsCZqQgPyX+LZAtUE+gz7iWwHj/fa/oN+VszDF8pwE/gLykgFI/wTh5VwKAvInHKTzxmI+sW74iQJokJbTzClFPGnSgnbqsT/oHAoBw1gnIxVa4+QLg0QbgvqQhLn7ch/VNMgO7eZIvaw4aAcQj/m3y5f/ck2uv0/m6uLN+7kWOUbe8z7b575SWfVoCf9Yf3WnXb1fJmsGHXFnLBPTaBfwpPflXEiYhwPq2beMs8U+jBcYGqf5jktJnWNoNw2/MrLqwtRFsJAARmAhUBC4CGSQDT1OBkAAJOZcIqITAFDHQAosAUfy3AaTGBdxiT1kB7zZuAXbKfUD7IdJSfvNJu35I/bepa41rm86VqdJPGtX6la2+bvl5+o/cdPrvaT/ScZeyEgF1DOf4rmPfOYHM+eIcQjqvkM4155/zMefoYM/53Hkd76LcnPiswSon0y3Aiv9wOgxoxBivP+Hv1OT7v8zrQGIFBwJF/LkA0RABFbQbD0mYRqAvAaC/8XVXaT6A/TESADAN+Ab0ApIlLgDXuPvydv8OQDjlp44AfVRkn/LkJ5/9qf/2yQ+yUYcQkACQDOjJlNqe1U1bD+1KfIA/G3k24xIASDbbqP3T7pAEkgGc3JOeOGzGCRfsj0nipCYAbu7HfdnMUx/ai/a2z2gH29t2tb317xur+4EwYFwdb9Ren5xZFziNAvyzWcy/+qvzSLcfARSk50m9wH4X4G9+gn5O+9E2EPgD/lX3tywpiUf52bBSFwybaWXa8WMjjJ9SO27N1DhiHRXsA2YBrozfliGsmj7et/yPPWgH7DMHAOKCfTbfgHv+3QBJvQD6aSjnv/xn39wb0gH8BcwpAfaA9UkCoAvvCYl4LcB01s06UHbiAsiJg39PAHTtoBSsszZsIgEgAADxEIGko5y4MQB/AL9GjQDqR31ZdygLa9dtRP75jL4+i9F4TVZdEPU91nWD7wcwn/e8wTZ9cmNXUL9NugTyFeizdoyF17isP8vHAPccHSeUfO5kMl5LOtjH5Kqrb28EGkjBB1JAIkgRuCSYwZ5AJ0FQgqNtCYBNp7gAP+KkbIFB/ACTyrlgdCweIJewlBX4busWcJNOe4Lxfe1f+QP/ss93ShKWhnumu2X/2+/68T5NS/6Vt73+DP8M0y/lc//1G85wbzJ3v/ruPs7/8g//fi/TjV8aCIOXvexlvd9zX/bND2BHap7/wuf9wibDqyktIzmQxMAUKcC4zzmRc2WMGHC+Of+Qzsucq8P8rfO78+4v1wTdW0vKwbv9AEjB/FoOoBRwaDibRMAyoBnjO/MJArALCMekcQT2xMNPQDkmidcK01+ZcfRrkQD4AXapC2CZE2/Au4SGrwR8/Jce8Z8lAyAAUPvnb/G+/Rv+514dmDYhvBIAuAXo63ZNcoV2j7aHiGHDDRAB7PuVbQkA/nqP/uB+xIF06MvV5UEY8bif/oSNmUoC2Le0Af3CZT/RhlOG9jacNFyAIZ4nWw/K2yQBc48NXW70BP+0H+1YjafvAO0K1gX+m2Sma9lJL+gH7LfKYDlqGOX6+Z+4rycxqFcF/gn6AfuVENBP8L9J7RWV/gT7guT0SztzHYCPej0klSf5AHzuyZjF76c/8Jb1qX6CfewJ+AX+KckDAzhWg0AiwI8IAq65P98M4NSf+JTJcgGmCae8EgCkoS5JAODG3w8OGiYBgL9f5ocAsC3WZMGgKUAe+AHgWYOIBwlA2ViP8K+gn7rxWoDaR8T31YHbiAS4TVarjdV0j7IxYongHubG4x//+CcEAaB/iX6Ls49HuuFZs7olxoTHsb8DAFEAwGdN9RQfN2tIrvvakwzQLvFImmE93KqOE9Vfgk6oBVoDfsrPsJTY06w69yoBhQRAAg/ByLbgH9AzRQAkgMIusEKqig3Axz1GBiT4lwzYRAIQ/rg3v/xMQkA3oB5/gX/a9atx0t+wFjEAeE5SQHdLJtAmTbov2p7gXTC/i7z73e/tiQDkoczr7rmnz6sl8ZsykAdpkjyALNCMkQRszAlDJknASV01kgN1LiQpoD3JgUqyOf+cj0jnaSUHmNdhcs5r74I3M/bcgw/89eA0gKigFKDJZpITIN4P5X/i0zz72X+jVw0GsHAJAreRgE20AZAJ3Kfsc/M3D+PX1wF8DYANtyBeEgBVesA+FyC6V7fv7JACuCEK/sG3/q/9ph01eQx+aSAAcN/SvsOpv6SAG2eICMoCuKc8nMYlCcDJP31DnmooUBb8SAMBQBgkwCd/88/3RMYYAYC/JIB5ck9IHU//qbttt40EGHIBthjDDMblutkCPINZQ9gQagCgU2r/tCegW+CNZFPpSf0m0G9cXxuowJ9wTvvRLGiB/gT6WY70x04dfvaDb+8JACSAXyO4162UBGCDix9u7JhNH/9jzQW4CmyRPbh95s2TdAA36xbrF9+tgGDxNN+NtQCfvsBPMK+/kvJgN1ypv/HMRxJA8M9JOaAZQA/gJj0AXwIgSQDWJcrbEwTdesCagGEtrnW1zgDwHrR38fCTGJAAoC1oG4gA8urbCQJA05UJP0kA1gLyI52aAJQfwI8hH8LIi/uRDoOdOl0zEsDnqjKXM/xu96vHGQdqhK3bk70TGgSsrduUgXU4T/NZe3SnXb+WfNs7XrtO0wpnrYVQZd1hbZgC+4YhXUdYXwD+fFAQQ5m3qeMS97RboA72MfeUP2GYVTWCfwEEUlCBFGwwgSogSbAigFFWsCMIQk4Bf8G+cgz4C/aVY6Bf1fGUaZcIqH64BfTEkQxQclqNPSV20mw6yQbEE+eiwfym+1mmTeWfGz7nZP9F7/iOvi1aEr8E5mN2+sqwll0/Tv+JpxZAyjGgz78CEIZMoJ92xiomx3WOd+x1PuB2riBzLlWtAOad4B/pnHSe5tx1Ppd57vyvsovWX/hPXtyT9/8BgqiGAyDZOD/6sx7dq7gn6K92NpichgtgAIp5IlyBYw0DOOAH6GTTy2UaAXxNY3iVFZAAVgA0qi2Tj5oAvv//+u7De4BnwDbgGWAMCYARSOPPXwRyQQDgz1fvv+kL//YDbNLJS7BP3DT6C/ZTAvw5eRf4UwbuSxw1L9yI8woA4fijHQCQoL8kANAA8DsAaDBYVsL5lsGYVgB1IR/uS18CSiQBaF+u2s5z3PQF1/C3gBvH4OQAvSaBAFo2dABNjMBfYF/Hb3UbDwloB9BPgf/W+/0J/nlNQNBv3vWe1T0VTwKgagFQZ4E+IB+3En/DtBvedfvGccP6yGsAgFcAKaDVk2/Gs4bTajbQkI2sMwL2Ktl44wcgB6RjV1KuGn/MTT5JAvhNAAkAgDcEGesHkhN/P/yHH/MQEK/pCYDODcDGUN+U2Mmb+nuPbAfSs6ZDErKGE6dFAnA/SQDWBIE+JID3kChI0E8Y5aae9MM1+hioz1VXodWccWnkRc5qgal5bvsbR2nGuFeDMa5hk5K9WQu0b+snCaA0/Zve9Ioe/LPGolUkAcA6kmA/7Zz8Ew/DGsmaxethEgD8m8BkpZbAa9ECdZBbKQd4lasuwjkDWBA8CCYq6N8H+FcQlACpnvgDoDj1931sgD32FgFQ3+8G/OsHqMMN6MOkXb9d5Vzge2rxWkSFfrQF5Z0jt2k32z0ldvtJWf3wT2N4+m2yP+PpTz9z3Gj/0r/+JR/DD6lxrPkRwJQV0Dt2c0xXUJ+AfldQD9B2LkrGOU8F98gyl+tc191FO+zF17YBoxXkb3KzySbO99790h4sAvzmgETjEB8NAIA0AF3QYXhKw1ICSogDwCcfTu4B6hjALAZQ3APjDz9y/boDG1zqC7CWBMAP0JwgHj/y4oIIIIwTdoxxiYPJdNohAdbfA+jANgBflfu8b08OED7E6WVn57SfDTsGP9659XUAgD3p/CgXbuqPse60yxgBYLkoDwQC+UBuQMhs6ovsl5ad9sJ/IAFWhx2tVyc31FtRN3Vjh+RjeRBTtFGO5Sm74Bvpqf6YFkAC/bSTThV/85t7z6l4hHHCzsm/BAAkB5tYjCBfcK80HHcSAJtO/2vvc+IMuAX0toxEAGQl7Q8RgGwBeP05vQfEs3lvxcOPuBhJHaR+EDzUD1CsJgDgWIAO2AboQzAkAUA4gF3Dybv21AKoJIAn8C0ihHtBAKgBQHuQ5yYSgHWhT9Od6ifgJ52A349XUnfGAHX+rEetPlj76Aq6fdb276gzj7s6rP2uYH2uWpGzrbGvOoPkUt503fxt+WX4OTv4R7C+qwT0A/QzvX5IwD+vRqFhxbog2FfFX6m/klP/BP7YNewhz1VkcVzbFmBAj5lVF7Y2AokW6Bf4e9K462l/AiTsAielp6VKTlIFYlOAv4I+gD5+eYoLQMWt1P78172gJwKQ24DYKWDcAvmeeKfEfpmGcub9dads1SX9aDPdc9vPtq5tT58A6qu0fwX8Sv3nSAA+8VJid1zlOMMu4HcsHhr01znk3ELWU/wE/c5PAX/M4bF53kW5uIty/eHVH/z+TaC/Fc6mkpM2AIBXCxi2/IiPPyQA4BNwYh4JPIjTawQMIP8cuBc4o2I/xwzx8xSezTekAMAeA3jHYOde2Pt/B+juD6HAqwJIwX5LmodgHaIA0iFP/AX7rXJz6o8hPmWDAEANlzRobKj+DynQExNd2XrtBdqoA/+QAWMEgGXivgAnSAA2/NSVvqhaGa2+m/KzX6+ZSvDsCQmQFRAiAYWAJMY0V47tMXsF6rjVABDc+yFA3S05Bfxb9xgrT8uf9Mz7JAB8DUDwrxT0IwX92pFsgrclAOiQnmDtgGeLANCPNYpTcv6fm7ENESC4r/2EG/AOCUC/QQQgMQJ90grgAfHE5URfw6l+f5rfnfiztjC3AOKAb0/3AfXEoTyAalToBfwQFhjj97KLz4l7Ne/4yhu9+j0EAPehzpAiCfYlDWgD1pCeAOjIgfWrAF3erCepCQDwJ0/uTTmpI/1GG9DHtAdtZTvaptfkXwH65/Ib3vD6f/otz/tbdw0TH7/LuFp7hMsox0Xc07qu2D+xb+puqt/B7p/gnTEtkE+7fpukwJ94HIYkAQAJwPrROv1n7rDmefov+OffAzSuj5Rrl7XxYA22ZHQhLZALjIM+5frdfgGFIGMT2Ae4pEpynmzWU88pwJ/AKlWmE/SjWp0GAIfKNRKQ2DKASvyRCTR1px+AVX/sqJXjRk4ZQDPhKb/z3a9cg2ntf++D/7D3UybYPgX7WLnSP+1ZX9tHP91jMtvZPrD9W7LVt+nnGEiJfcrwzjnhnPI7riQB8JMEUNsEmeO0kgB1fNfxv6sqvwRAnvj7EGO+Cv6V3Yqy6kzO75adhQf/C7lYF1ogf67fd770+evXAgSBAMUWeNCvR0TdDyfenEKzkawn+Wdxgt8Cy/v4cV9U7tmoswkGqNcTfsC8p/+AZ8C/JAT+LQIg/chf4K/6fQ/+K2FRyQzcneHEXsDP5p5NPBJSQNAPQUG5Af+0H+VCcwG/apIA4NUCCAAM95AEIJ/swynA3wojLWCB8X4hg/c0bnKDb4gkqAT4e+pPmzju50pBugRAC+RXvzzxn3ufXeJRL7QaMBABGja2uXnF7um/Uj82t9hJg8bErt0I8BTwtySAWLKS+7HO1NcCAPMAWiTgGCIAUC+g/5Hu3wMA4ADoOUawDrBmfQGAA6p74D34kTcaTIBsAT//NpIaAPhjBPKWAdIA0E+ehAHakdxHAoD7kpY02D/7T35274bo60mKrhxrImCwe+pPOspBe9G3zGcBf0tKAlxx4s/n8MpneTcm9cvh2fLL8EPYuceqM0iui7jnzTtdzq/1W0G+3PXyu757KIb1P0ipWKM3AfuxcAG/JIJSAgBArwYAazavSLUIgNQCIJx1sMbjOcKcw1Dmg1R+yeSkWsCB7cBXrrpSngP8gn2BRp4+5snkGNBnc1/BTgVDnuojAU4V5Osee78a/x7IDzLBn+90z5EAUuKlbIFUQLv+2gG3LTAPKL4OhvrVeugnsFfaNmMSLQDCJFJaoF4SoMrsW+wJ4qs7w7DX8OrO+IB83IB/gD8ygb8EgBoASMauRECOaex1zNc5keRYzqVt3+N3vkrWCfyVzO/OON9bsgu++IvypjYAp/sSAGnXLyWbTtw8FAGFXIJDT6Wrqj4gVTANkAfscjrPu/L7APvZaQNkc9IOCEYC4CUCsAOaJQEkACg3YJtwSIIE/WknP4iF0RP/CvyTGBjKR1qIBAA7BAAfB6StJEu4H+WhfbFbxgr+cfevAHCPLk8AhAQArwIADCBifBXA/ttF0v+cZtwOJADzJlX+2bQB/tkE0g67AOxMIwHQ+qgfm0lIAIE/wDzTaicP7SnH/DNOy84Jl6f/gn/qTN0BjYJ77BjBvxvejGPYPise+yDU0FsEgH6sUdgB2Zy8A3YF6gJrgTbSE3vsuxrzJy9P6gHXEgNqAvSAfCAeCDcO8bRTBuzkA6DHbf4pCSMOdUX7gHoy15nj1JuPo0I+QHDg7uvZ3RsywDxJT1rC1YhoAf/0u2YkAMMxn837DM9t067vy56f/X6Xwaoz+m+b31WI39eN58Wdd975XF5PjPoSdpCrfghwDOyP+bO/qUYCQA0A1mDXVbRlWAs98UeqAZAyiWPiaPAnfVf5g7XBQRpyyWSnFrAT+8E+dKr2VedeCRqQAokK/MdAP0AlQUwFOBUAVYCUp6cC/qkTfgCZgA0gt42poFI34B97JQvGgGz1lwxAjhlANGEVTE+5X/3T37NV/Km85oYluM80+Btm/QnXvknSvsRJaftPSfqacPpZaZ8bhsQvJfZtDCDf039BvzJBfwL/fAVgjADYRALk3NEuEZBzDrsknHMT6XzNOYy9AH/muXO+Jbvg/iLsUi5OcRLcb2Nnk/2UJz+5VxsFiKKy3n/gLoHthB2wDWCGCJgN5Cfym5XHALQBx5zWQwTw13+SAGoGCKipF+QFgBs/whP0Y0e7AAlwN11fFu7VKq/+yozT+fVtSNhgfC2BMnMfyoIfZaF8GO+bcq0B0OUDUIAA8HsCgAS1ANjMc+0C/k1D+pe86Kn/8VIG8QXdlPUBAOsGDrVPTn5aoHkfP94praf9uPEHjLvh3HSPufE25UMdqavgHwkBwIZX0O/Jlu6UhGHwo/3Y8LJ+7tttrF0C/jEpEQDI7cFvB7IF+AmksVd/3dtK8+V+AnjBPesNQBsDEaBd4G8Zma8t4E9ZLCtSbQDms2s3H3jFDfAnf8A/4B17nz8EQFc2SADyoIxoGvGPCsThtQf6NgF/y866QdxrogmQz+fW0MxntHFb8bb1W+fFSfi99933ri6DVWfW/ttmODO++StnJmtGM4+WbCboPIm7GgK1Iw92sV5XcM86VP2qG3CPXwX/uvMVANZY11nWZ/IX0CtV/8edGgGGKyUJ2HMerBGWjC6sBRy8yGpWnd/6pB+QMBf0MxgEJgIV5TagX8APyK+n/gItgFea1AAQ/I1JQDxhFcxPuQGmhG8CsWPgXmCvTOCMXSCP1P6GD76pt+vXkqY1TPccmXGwX4axvWhX7JvaN8MB+7qnCIJNYWPjRH9JA9wtwiDHIXbHaJWOa2UluioRVueMc8k5pmyRABIAgn+kBIDAH8lcH0xdB1wjuuDTuSA4xrQB2FTO0QjgBImv7venzgFeBbFV+u67hMFaE4C0CYiPZR/KCIiGCKDsnO4L8gX6SOoEWK7AXzcEACSGBAD+5HWuLajHWN1a/p0fAJ681J7o7Z0mAtoAlBN3Av5qTwIAgCEBIAkAADmkFgAkAF9tP52RfbiS8G4mGzU2aZx8cyI+dgK/CVDXcDeQ+vcbye5fACQBeL8/T5qMp6zp9T+UzH8ASBKAVwI80Rfw60ayGdadBABtyDp7iN5h7VIbAJX4TUQA4cTTsG5hAMyehONOoD1GAAjEp8KJ40m+IB8J0Gb+YQTqgn+kcS2H90qJPQ1pWKsB8uZLXpzqc79zBMCgBUB60kEA0DZ80JBXIgD89FML+KcfJAAfMOv68iSfbXuOMZ/ffTbxbN8z23PJuccKw56D0/C4z7Ha1HtaEO5/rq5DgH4taVrDcN9o7IMy3DR9XOI3TMbZy87erIL7uW7BfktCAODvmuz6i5tnBGueoN5nRsq0SwgoCVv+DnCvbr/wxAxirxzQq86zN0wKgYLgQTDh6SJS0CEIUQpSlAliKsBJAFSBfp70YwfgA64S6Ff1/pe85CU9sEfyH+sAduUUuG+FCSyRAlPB6pgEsBMmGEfit60xXc0n3beznTaGrBjrh5Z/9if2Vp9v6+d4kyhA1vGZ47aOad2M/ZwLdZ7kHMLu3EI675DOSaXz1flbtQF8ADr3O5lrgmtFlV20y7+ou6dIu0hOnkjnqZenWC3pR+8A2BjAM3JNFBwL+Nd8B/CN+j5lEsQLsAHZGMqmPaWg248N6oYAQLOAuKPfA6jAf8TtyT9583oCp//km2X0viklACBZOHmsBACvGfBRRl4H4P1kLk/0d5Gmv+IngrdMxAr+AcGHAv8tkK4GQAJ/NpluNFtp8NsUPpZuk78EgN8AUKIFwIYV8C/AlwhISZiGzTHA8tAfu2LtEvxPEQHGQTNgyhAP8CzgHgP5c/zJg7xcB7Gv38fvgDjAnFP63m8IA5Rj+ridXxIBlikldg1xIQBYz8gXO/n0BMAA/C0DabDTFhCDkB/Em/sqAGQAawfP21smzhX3YM/eVcFndf8hSv6TfqjW2n/PapJPrw2M7EwPopGD6cRBL/O9wT8fsK/pcl/7xZ36cnXuFWaElCAO142nPe1pT2dvFPufPv2Qzng3Y5//JWwq/HzsLV1j3wFgPRojA/L9/ykCQG2sXJtbWgCsd4L+atdNuHEoW1fN1ZZVXaJfUgs4gFPufdoP+EhQUgFLAhoYIwyABykIqhLghF8LUOEn2AKEJeAfA3F3v/ruHvQhNcTFLmB83T333GJnghFe5bagfix+BfvESz/dlwn41RQ4dBmsW0rsF2HoT+5D3yJx28f4MRYwLKpKxgpux0/KOu4gnjBj4xd/FnzGuBK786MlmUd1buW8SzJgDiEgwSfhFw9EFnRMrhNp74Iu/6Lc+2gDSBxABmwyuQEnHRt3NsmAaTUDLlIbgJN8iQAAv8A7AX+1C7jRYPB1AoA3BIAkgK8YrF8LGAH6zboOcdUG8H5zZK+B0BEeSQBw0ue3ACBqaGsIAIgAgOAuwD/TQAJwKshcufzRvH8JqAcbM079D/2+fwLvBO98XApDeG4udZsu0+h3aMk9APqC/tQAyO8ACPg98VeymTUMifsYBAA97dolyJ9DBBi3StYm/ADhfj9AsC/wFpTrPyUF54Dtc0RA58av10Ia7OQjiQopIBng/cwr3dUuwdCDf0D/kHcvJQE6KQFAXV2P0SDYRguA/mTOX5N/BqiLhs9o/Puv1tcIe7jJe9WZ/h6MX/YLSv1HZOfdvMjLK+3pt8LBPx/4Ab4GUO8xDGWxPEMc0ppvX27cvMsPAYAdLQbyDXKBNJdyQTSOAf3qz15Vvxbwx4/Tfwwn9oB912fX4jlaAMyXlpEAYO08NEF6KY1/m9y0ToZVV++dCIAKNhKIYE+gkgQA9jztxD52+s+JP6BIFesWmJIIQHoiixSQbasBAKgzbZ4aSxJskgkqW0Ce8ATSupFpzzitfGr4RbmTDEg790932mtYLetYXNqauJvafCo8+5B+3fb0n9cHSMf4qhI/TWts4ufY5XUAxnI1jP2qAcCcyDmTc0l7nW85H9UAQFYtgBboZw0YzPoh2bm1d9bTvqgnqrUC+pbc9GpAK80mP7UIAOKXog3QAW7Af78hj9cCKvDXDRAHaEMAsIEGdHDij78kgEQAsgflgHpNaiQMYL/5qsAQ5vcGtiUAABEAfzb6gAs2/hAOlPuQWgCQAVycDDIvTnuUT5eO8l8E+G+B9rqxbMW5CD/KkQRAEgH453cAEuhjTxIA4K+BSDnmBpd1fPXwh32sgvpt3QJiADvzBZA9ZYyjbMU1DCCeJ/xpJw4n8ZRXrQBJAGQF+7qVpM/7rEE/JECSAQMBQDrupYYQ9+ZfAdAemPMtAOY634jg3xaum/ZPrBD57E57RNnKah43eNaG6n/v5kR9yM14q85d7UOUtSDcy7i6kYarZbBCo2H4CN8qwzt77ybsfe9730eHODfQeERzoAvPq7+XJALEAs+AIQ3xVp3x3rgv7KJtBfVI1qB0t+wQAVMEAGF+jHVMC4C1j2eHoH4M8Bunyn3+KeXCGvc2vZEDuR/0XRukXHXuNfiXPRMgIJlAAggGZxoBRwUiAhRlApkW8BcAVWAkYBJAKQVVz3/+8/r/ecctCENKAgDWJAKU+M0xgkTIgGoXbBKmfY4UyAryKwhuubeJ20q/i1+Cce1Vki9+GuqPPeVYm9CehKXEvq3x/f9N7/cTzrhQ5liZsvve/5x3/hmb9X1/3X74z3GurHMh5wl254+yzjPnHzLnpfNVtf+cz85xHn7BkLMO5LrgmtF5X62LNkrQfgzQn/lrhwhgs9prAgiMEywf097dDxAPCcG3ATzBF/RXyek8QPpRj3pUbwhPLQCJAPLxtYAmAdCqU9Yde2e2IQHUOqAuvOf8W29+aJ8HH2zEkB/lRQuAfwTgyhP9Xe3kc8U/Crhis1hP/o8Fuj1BIn/Bf71Xxqlhx3JzopUEABoAkgD48y0ENru0VYJ+yQD9U7IZPiYBMKywKzSZBPFzZCUITINqvCQAaxKAGVCN3MeQB/n2AB1wPhgJAO7b+3X3TAKgkgCC/QT+aTfftezy64mAoS7UAeISg78fFuR7AIB7+gu5yaAFQByeGVfrKTe7tId+jvd7hNe85tVv5O/wulKsOnPDPQX2weC/xhXYO2NYZ+2vvmzsQdivdD69u0rxR+e/Ioy9TMTPNH0485S1ZZivfdnIg7Sd4UL2xj0Q+QH+yTv2RH3k4ce0+lW3/oeQN1ogf8xPLYBNBAD/xIIGAJparteuz0jmDOsicowEEPQTT8JAO3Jo50O0wZLHHi2wHuBdHmlfde71pGTSJjAQLDAZEkxoT7BRgYgARQl4QX1ZmarMgHzcFezjHjtB1V+VagC8p/qpgq1d1W3cqm6nNJzJ0zKAbvyRp2oA4JIDVe4C+k81DUQBZUuJfa5JUoFxgzvlJjIIgsA4Y2SB41MJGYBdAqs11g9BAuScdJ4qmccY57Vz3Ye1Dz/WhMHkWtF59ZcPOqX+Jy2pY74WIEhXTpECGZZ20la3+SkhATiJvxQSADDegWNU5NkQT30DIAkAyszpPH5VCyCJAOzEaRIBAP0xMoCwzvh6wiZNAE/5ISiw05aC/7e/9SH93w0CQtACwAD42fDtCvxNRx5cPLNOenCPFI4TGME/gNfN3S5Ae5+0u9wv0+x77xYBkK8BYGezCuAX5OuuknD8jq0BkF3Kuswazsk0axhaTWgHCO7nSIA45EAF+4LocxIQD8BOOQB70xOGFo6G+QeoF6CfIwAE612aJAF64qALE+gjzT/9tK/LNJTF8pHGOKxzEIT4kT9aANt8CwDwDwnAPwPwrMx+WOy3tID7g5V7ii7GajDuD4zTn9hDEgwq+/gT13id9ebFvgR1/AF4672Oh2ZBaBesugiGIbWTrsc2lI0Tf/YADTCf8fv0EQf3ajAZr/PqL/2qNPxgcuw7AC0SAOCP/yYCAPDPN1rGvtOCP2udIL+SAOmPnbhp8OMZtMyjgw2DjRkxEMfMqgtbGwa5RgDAxHMiI+k4jSACmSADe4J/Ab+SzVMagD6nnEgATwsIzQH+gClO8JXYW2SAQE0JAVDt+iEBg0jA5CbJBMt4uvFL+1xgOjee4Jf4Lbt+m6Sn8+SjvUrLpH+9Z8ttmhpmeTL82HZIG+9hnygZB5UM0M8xMleqTSLg3yTHxj3+zhHnSc4f7M4tZc4/7HV+5tx1Puc8Z967BviQHB6CrbWkW0au7kVbbHotQPB+KMmpOu/WC4gBsscyeQ+APx8E1HCC7ocKPYHn5FywrwYABADAXgJgigRQswBAP0lyJCEwEACkQUuBclqOFhkgASD4J85LX/iwtcqv3wPgw1/8IwAbeC6B/D7SfJhXV2nUs2Hk5AagimozIJq6HBJYZ17a9wXr5nMoSXn4AKAaAJ78KwH/hNFWnvhXKSmgvGgCYGTc9SefrPW8tz6XGAAUA44F6oLoNbgWrFeZoHsA8oJ/paf65MU98Edjp7/fkJ/3TiLAdIJ4JPEw2g0z/brcXVnwk+QkL7QAIEUgPbb9FoAaAqwhV1z7Z2TYbOVdn/+txMYxbNVZql/vZk8B+Ee9votDPAxheZk2ZQ1fdR6YjFPz6YL7cOJh1q8MYB9MJ265DFt1IRr9bomMlkCQEbeEH8qD+wDqWYNaoF8/9rtT4J+9r38BmATAmBYAr88kCcA6mSZJgAr+WUff8LpvOXvLm16w/CvAoQbCEfNxkCNXGkkCpCBhjChIoFGJggpSBC8pK9Cp6tCekLbAk6rVSF8LUALGPIH1FYGxk9v0B/zlaa9gELVx7dvIBJtpF6Dip/2UZS2nbiVlx77J0I7Gadnx28XQZ6RLmf06Zle9n/Cq4u9YSpljrtpbKv51POPOMZ9zQXudN1Pg3vkHyK8AnzmrcR4PIN+5nvNfe7cMXM+LTfOhAH7NBwCNH5tQJG5IAMC3J9+cfh/bcD+0DwD+aSQBEnQLxCkn5fYbAAJyCAOMrwCoCYDED0kaSICeCGid/qffQAJIGkxpA/SkRhffU39AjKCfTT4GN/8IcOjXACAPuD7xqx+6Mt8DYB1gYyYBUL/2fwyQfow8D0ECSACk2r+n/5IASQCwiWXjWqXgH4mhfS/gFYBdF9/+Q288B9yH8RxBg4B178997h991xMf++kPohEAWEaLSZNu4/haAesCfsbt03/VV5094+lP7/ORXBC8A8bXQD0IBUF9JQGIK9CvUjKAE37V+/u8gwCAwCRPvwNAeakPrwFwoj/3WwBJAlzXvwSdMbDcA1TZSlrj4M4L9ypN7D0ybtpJj1s/7UrDkVOX8VddJO3Ifa8+D/dZQ2aHyHesXCtB/picC/4hAfgAoK8ATGkBQJ4K8nme+FxpkQASAMRJ8A8BgEEbgPVorIKL/+W1QA5c7FNm/cqA5ACAQnChdGIgPXUUoCgrmMFdAQ9uwVCVCZ60t0AWfgCyTeZL//qXfIw4yG3MX/jmp/w28ZGLubw2yD7QnhL7JrNpjBg+Ns4chynruMXdGuf41TnhXEnpfELmPHPuIQX5SudqN7dXxbTmehdlfeXasPa8DhbaumoDJGhPEK//mKyg33iSAwBrTqMumgBI4J92/yFAgA94Z2PNhpl4lQAgHkAcrYAE/RIBEgPEA9T7bn4P3ivw1x0kAGm4Z0sbgHuap/m60ecfASAAlHwxnNcAAOwAyH1O/zMtJACbmqsw7tlouWljA8d1CDA9J48kAtI+lXZuvKk8xsIkAAT7LSIAPzQlBPkV/OMW+DMGtJ8wAbBxmPbPiu5VggT8APt0A/bTCPjRtEQ78tue9eU9IfCUJz/57NnP/hs9icDH9wTyr/qih9/8PoDgvwPrvaZB5x4jAXrSYAg3juBfKQlAuCQCYawdSQKwBlNmiIltPgYoAcCY4KOAPK83Nuj1i7DqqoThYg+wGmQndrrMo8cPXQ7uK5Daa8b6G6fKGv+i3ZaP+6b9KOVgvRkD/+kPwN9kOP2HAMBIAKAFAFnMmpmGtZM1sAX+JQJ83iBZHwX9agDo/v7v+zuLNsBRRsdhM60TrbpX3e2aRICAI8FIgpQEL9gT2KS9AiHdLeDUAlj4JQhL+xh40x+Qh7aBYK8lAZL4p6z2TWBzKlxSgTjaU07ZCTs1Yz2y3PqlxL6PqX3S6ruWn30/JnP8pH1s7LXGaQvgM65z3KfduZLzB3vOLck3551yD8B/2JXkCuRGH+T7tYL2MSnYJ1x7Bfw1zHBU1FV9B/COGVXwp+SUBgHpAPkJ+rGjEYAGABtlAT2gnfhsrMfAv0SBgB7tAU/+JQGSGCA/T+ypr+maciACiA/Qb2kD0E7mp1QTQPDPyR/v/B76NQCJAEAmqvWnPKRZP9yMsXFLYHxMoJ33OSV7vv8/RQJIAAj+AfrVCPz1v8oEAGO4f5Z0JIAn+pUAAOB/50uf3xvshHPajxalJACvvuEPUUCYRADgH/V/yADAucA/paf8xBHII5nXvDJFOGuS8VLir9q/6bkP7/+ztpEH6wKGVxG2+UtACQAk4wLJvDryvK977H0BpSrvu+TTl4U9BCr7Mc5XXRvskp9NR9o+D8be8CX+/l5GaMgaXt2NJBfmRVnyqu4MO4gdcjfBftrRANgE/FX/58v/AH/+CcBXASAA8E8SgLUcN/NAEqASAT5v1BAA7AP8AftJmOb6OTxHj95eB2n02yATO0JJlbFvMqsuzmwiAOBSwYwgR5kASLvgvyVbQAtQhv8YOBsjB8bAX/oDHnGnbAHKuX6AXeJeF2m9rU/WrRWmXytehm1rr32Ufag9gXzLPjZ+WmNOv9YYxc+xXKUkmOM/50cC/bQL8pEC/ZTMycGMzd8ueLmmWoC2pa9Um/Ud26ox0CIJBPsZJlHAJhYwrUo9UsALqMbUsAT6AGFBNHbCANtr/wFMA7rJR9DPPwFgB/xzD/Ngs4whPZtqCALyE/C3ZJ+2y597e/JfSQDJgd/4xU95QMB+CxFAWYs2gHEpj+1BGbDjZ7gSkAHwZ6NfXwNg8yJ4P4Q0v/hrqKkhdClhbLrYqLFhawH+lh/1GvMnbE648U5NJgHQOv1H/R9/Nq+CfzaqbFzTrZ+S8ABGl9LXh7gpzxVeC5AESA0AQL//GQ4R0Kv6Dyr/kACAfzQB+ICy2gCSBLgB3oDyNQHQAf2eAFCWk37Bv2QAIJ74rEstIuAcCdDF6+N3eUMMsK6QD2sCWgAQg2OvAdD3CfqrnblE2q69V4do80Ye+ZwmGPdqkJ3Y6dqbAOAZyEf7hnf2KYTl3KlAQyLyuIO/7uNDf+k32Kvo70l8TBfYpw9Z45+K+yjlZH+YoL/a5xAAgH7WRcB+Swug9beAaJIJ8FMyN3BrWDNZI5ESA0r8DGf9hMxgjJ1Khy3luNkCDlzbo5+AnWOTXHVxzpEBdG7LJJjBnqAHu2AoZQVO6W6BLgAZ/gKzKueQBGNEQQss6ge4xC7IrBIgq1/Lrl9K7NfJUP9aH/2mpO2mtJ1t+7lyDNjrX8dKdbfGW47Hlj3Hch3vdT70m7IydxLgp505F2ZqjnbRzl11np8LXBzjLUD700f0qWOBMQJZoGFTjUkCgXdvv/0Zj/wABvtXPOYRP6Ph9QA3vpx+AcQx2KvbEzJBPRJjfNNWyfvxqLRKAgD01wC82zBzekaaFuhPP4C/JACgPE/+W0QAaQXsnPDfQgRIAiA7UiDjQmJIBLRIAPLj3X82+hjIF+p5jNcAIBEAuKf6PQDGIpstNllV9X8TwD814J7l2afstAMAv2UA/xjeDbfdEvinXeBP20KycMp1HQgAVzmeSaxFEADPe+bnPACQB8SrAYD86g78o+6PxHDarzYAJABaAfijDeBrAeSFNsCaBOiAemoB4J8n+57muxay1mEnThIB2iUBAP3kVUkA3KwLrK+7vAYgGQDQOaL2T//c5pkCKOa50vWLz3K7qCWP9Qwn35WG591gP9T9rFvK7hbNq78n7TIQBqZpRj4Rz77MQ1nSfpDi8ZFo1qFdwD+EHif+gHxO/DH1WwBqArDualiPWUsF8wJ+JHND03KbhjJrXE8XEuAgQ+JSM3FCtuSqKxn+yHMmQUyLJMCvBYzwqwCqRRq0QBh+bJKUbt6rrIBvzD2XRBBYjkmAK2GABe1VGo7MMNJ8+Qv/hxfjJ/jAXe2AZv0PZTe/OdLyZ1z8NJRX+66SfiLtWH+lP32Ou/a9Y2Ns/OifgD7tOTbHxm8d7zkXtNf5UtytuaZfF3XNkmPPizjLdSItwLiRAECyWWbTjcR849c/fG3HzaYcsIvJd3M9vUPizyac0znzkCj4hfu/o/9CvgSAoB4wD/hnYw7ZANA2bEyuyQNO8TtDvJY2QJIDpElwn+TD2t7lle/7E590SQJkPoQT/3P/xB/oN/poAhzj3wBSg4DNEBuZExlG62KwmWJjxWYsAfTtamfzyqY1Vf8lAvD72Q++vW8rwb8nVwB/jRtVpAbwf8/3PudaEQDDILoBMck6wtrx7d/wP99CALC2AO4lAlT7VxvgrW99a08EuD4ZjjYAQL4nAkIDgDXnFhKg85MAUEp6JhEgCcCrThAAvhJgGsJ9HQBNoV1fA4AEANgg2V+sJ9zhLP1zmefB+973vo/GV+Uv83nNvVedQabpnHtf5kdGaW9lbPiqC8To7qwnd1G2/mIfGK846H0wyVq/LQkA+EdDQICv9HsA+S0AwnwVQMl6Slzuy5opCSD4n5LGzbXWtZXXBRj7B2ucJaOTb4H1RImSOrFbctXFwz8l9t4ImpQArLQLuMYA2SZSYYxgYNAKCDdJgCZxKuDc5BaktsBr+p26nXpmXTbV23DbLOWmtq7h9JPGvkygXu11nDh+qnSMVem4bEjHMOO2Nc7164L7cOQ+F/nNvbaJOzfPJd6GFmCssekG1LPpfuVdX9efvGHXSAoI/iUC2GTjRzgncGy+sePH6RzquZzQ4eZv8/hrKwyvAiTIZ5PMxpqNM5tpwDggewz869+D9gGwA8JR9xfw+wqAGgGSA9w3Af4t2gADoZBxAPn5SoBll0xAch+1APwOAIQHV4L3Q9pP6QSYNY+NGZuqizz9Z1O4D8Gwb/qpe5M3J/xJAAD6OfFns8qm1A0pbSfoH5O0LfGuMQHQr1aQ8awxrCVVAwACwFcBKhHgawGuRaxBrFHEIw15ntMGCCKA9ecdX3njjI8IooUAYBfIK9UGgDDw5F/wr5QEgFggnSQApCDrAv1H33uyX6VAv/rjNox9wIZlfdvg/rnPPoJ9Cs+ELoNVZ6aeyX2aIc5UvC5K85qTZt97NG+8g+chyzGn3jsU8XwS+rG8snA+wp4uxiBgfhstAAgAvv6fp/8AfczYqwCCfyXrLesp80hQn8CftdX1teVvmOuuJABaVez592yWJfkVbIFtJ2TG1z4lCdvVrLq0515rqGCvupmY+FWw2HKz0ONfAaeAFH/sVdZw3SlZgNJd7Ya3ZPqN2ckvw2r+LfemetR22ORutal+9kHK7Cv7FbnB7Dp2xtJ1t1s/2InDVeVN31v9W/H0M80ir14L3ACkA/jZdGOwqwGgG3IgDXHYkKN6C/i/9953nr3nve/t39tls43xY11uwHmXVQJAII1KPyf/aAokIAd0C/bHJCQAYD0BexIBEgBKiQDySwC/vu8IAUBc7kFZKbdlz/uSNyQAIIIPAfIawCEBf82LVwGGU55LH3HL6f/NbxUkIcCm1Xf8E/hX8O8mdAz468+mF4P7mmoArMcxz161AXJNYk1hzQHcY6pGAH4QAZCPrEfYSc/6BDGA++Vf8IQHmx8H7AgBNAUgADCe+ksAKCUCJAE8/U8SAD9JTeJhIADu/b5nbv13gEkGMHaYa+uGOoyFZ7iGHLGvBtmJWy7jIrl033TN+817mM+8lJcTa5c6rkvK3o896dpjviXbJu1TOWS8vco9dRO0fisBgHvsOwAQAL7/L/BPma8C6A9ZIPhHsr5CrALkJQES6GOXBGjJn/7AW84whkEiuKaiCXBKpPpU2y9hx22BOoG4W/q13JbIeDnx0s+0hu8rV12GWxsWJNK1ZALVKTtg13DtKQXDly0pY6sMY2XXf1uZ7blLnwxp9h0PXTbnHsitsWeclNi9TKN7G7lP2m3us8Q9bAusfA1AkK8GgJKHOw9wDaw5G27UbwH6bLAxP/7+9z+AIR9O4EiPP3Gw/+N/9LAeQLNhBogDqtmQQwAA+jn97wF5B8YB81PaALyjT9xKAgDYSSfwr1INAeLcQgQM+aV/2kkzRQJAnPzIG/5i/y0AQPoxtQDYyBx2GGyfG2BNcFpP/xMQ32521f8F/J5YefpEm80F/4B+NQAkANBo2763rlyKG2rv+XodGgJJAkAujmkDoEEAEYCRAJAkeN3XftbNdac7re/Xn+F1AOxoAPjagMA/pSQArzNJALQkJICvGUAA7PMdAIkAxtGRgErde7QGyzoOeyrmfhdp1Rn9W2mafpxQD+mb4dfEs98P0VY7kLXrtOxFt2iPPt0W8XeO+pIXPfU/VhJgEwHQ0gAA8PMKQIsEAPhXEgA36yprqQSAoD5lAn7tSAjZdJMH63H/bZXuGwc7N8iS8Mq2wJxJYxwlldWutAF0z5EZB/s+ZjWkR+5lhkVnKw2EbUEz8VkcU86xt9Lscu+5aWhL4u7bppF+nz6uabtsz42ZdGtPiT0v8uNSpr3ll+HVjnu5rmgLACr4Bw1Bf56+8WBHhY8HPlICwA21p/1stNlw80Dn5I28fFWAkzkIg1e9/OY7+wDpSgBICkAGCOyntAFIP0YC4F/Bv+7UBsiTfO+ZfkkAYIeYkARAZlzsfAgQwysPxyQA0Ao4EhiYPYL5KBTgFGByu4H8Vn3pb9X/2aCmkSjZBvgD+NmYIiUNOK26TQiA5jjklRM0BJIIqNoAEAOuRaxDGAgBtAhcs1jfUP332wCAfAC7KvwJ+qsdEgDDh0urNgDEJIQAmkCsA7wCALHAdwAAG4L5XaSnlsN+pNk+R/bs9wSvec2r38hX+od74Zd7hakiGG+1RZqp/DaFWTblpvjHDLfus+/BNxnQdh0SbJPe+qacfd85ESkXcypJgE0EAMSo7/srPfHHnX8LqL8EAOsqhnUXP9ZW5kOLBBDgV7AvAYB/NZAHrLE80+bUf4lz9Vpg2wm0TQ3NW9lK62QkbMqe4cY7hFx1GR/NzAXUlxWPugvklUdqD/qKdj5En5lHl906P+1zJHHyIj8u5U3X8ru0wNAC+R7ua1/1Db3qfyUAACFsstlMa/wYFxtvDK8E8FAnLRtviABVdNEQQBuAzXJqAKS6P8BfcA/oHiMCOJUXuGMH3L/9rQ/pT/L4/oCgvyXHiIAK+qub+1FWiQDKl3HY+B/7OwAQAGgZ7KheepDxLphF3Z2rBYpvFz/qzwaVj/0J9lPaVoD5ucav/ksAkN/tTgAMA3fFOsXpv4BebYAveuITez+ISMG/WgAQBaxFvk4AQQkBoGEtqmB/yq02AHEA+qj5a/7t277pTEMYBpABaNkF/GeaI7wKMGc9cC9yg78jjffM9d8mD+Meex+S+U+V07CUlnFX6b0zT/2m8jROppuKX8NMt+oC0uhf4+/s5lUA1PslASoB4Mf/8PeEH5CfRiJAAqCSAPkqgCQAay1kgiRA6+S/AvyW2w+yEoYdA6FwxH/d2Lmtl4Sn0QJOTkqT9lo6w6rMdDVsjjvjYD+0WQ15Ihdzvg1oa9rk0G1e8+tusR5bhHGlbNlvxjr/m/EyD2MZ3gprxdFvkde8BWD32Ryj5gdY9+RfCQhx4y0BoEwigA04D3bYfE4LeC2AzTfaAGgNfO8rv/iTqM2jFdAC+JzwA64F+NgB+UkUYCctBsDvB/mQkA6q/LcIAPwkAbCTdwL5KXslAUgrYQEBwOYf8Fvf3z+0++1ve8sHLmM4MkYEuGzM2JRdB7BPXXapB6dSbF49paVtAP2bgH//bYwgBaobEgBjW6MRcDtrAORYT20AyEUMpACyEgBqADzhsx56hmEtghAAvKuq32sDDB/xS3A/RQIQRlxeG0DVf8r4GsAmTYA5JMElfbiMPcMq+gB77iMiaG2dE2cd+YCWvlwQFQNZQdatslonZNoPVZS8Z9q3yX+bdH0dOORSWzYOvLbJZ1b52COwPqEZWAkA3JIAgv4xIsBwpfsGCIBNJADzSRIgT/9boD/9BP1JBEBmkwckW2hfzGqLJdLt2QI5qdJeW2MqLOMSz7gpx+ykrWG4L8ushnu3JH6nYC6rbWo/dc1xru90Z7zqpxvJ1Yp7M2T5XVpgjxb4a1/w++6BAODDYzzgNYAQCQA224J/JX71tQBIALQCUL0FmJuekzvIhgrq0w24F1wDvFtkAQAcw/cE+JAXBMCj/8in9h8eFPwn2K9+hnGqX0/0p4gAyqkmAKq/Zx9+ZP8RQD8EeBEkQGxw9+jt7ZLy+gGglA3VLoD5OqVhg+p7/5xKzQH+agGwedbekoQz38iT9l4IgFvG6Y3/yx/6A//r53/+56+1klh7JAA8/WfdgXzkbzslAXD3BEB38q/6/1obYEsiABJgCvwTRpzvecHnPQjAB2Tkqf62dsbFLS1xfI/WvulQd903b/dBlMe87kBbATMUMuNY7lVnWQGWMdgH04rbBc2+1ukBkqGptfYfyclw5Ui0UW/S9fW56+V3fTeva5TvNYwm3CUAEi5fBagkAATA297x2v7UH/CvAehPkQHsF6ZIAJ4fXKy9zCdIAMG/UrCfQH/K7j+3SN4yxy6JaNulK5Y0R2qBfSZiq0jmNyZNY7hupH4p0z4WR/+MW+24F7N7G7TaWL9tJHG57J+brpu/1a+6x+JmvLRnfO2bwo23yNugBXjAA9DZQPNA5EOASJh/Hvx+CBApAaCUCOCVALUBOGElHXmSFw9wNgi8bsDJeQL/agf4pzaA4Dsl4ZAFEAEQDWgXVLCvGynwr5I8Bf7kqb0lIR4sA1oL1IOPAf7az93fb1IOfepf82PjctFDETVJNkoAX65TBvS7nurPqRN50wYY3yNtnfp7sg+AbwH9KT/T0N7MvUUD4NbRrjYARIAaAIB/DCCE9YtTf8E/EgKgf0efd/8hAQYiABKAj/j1GgGdn6f8U5oAEgAA/CkiwHgAfoDKnNP+FjlAumv0vjJ7jlVnkNXeec26ct9iPi2/zGx9L75pcO99973rGKflRQsh75/21UASZJkzfK69rxOg/33ve99HWZeGfFddBpiDX1/4JV/4ekkAnuVJAowRAIJ/CQHdagAg/Q4Akn0CJr8JkCQABECSAIJ/5BToN4xnKHFZu1ljMay7aDteo3l28L5fMpzXAttM6oyrXTl1t4yjPWXayQd3y88wZcapdvO4ynJOPY1zCJl5YK+XbYy/dqVxqzvjGmeRSwscrAV459Z/C5AQgARgYy3Q5+QNuwSA0tcCIAHYkLNJgN0HPPFwhwggjI0D2gaAcQB1ywC2JQGQagMkqCedYfz1YIL7jJf2jKPdfDYRAJAClINvGlA+SYCLIgAgBL7leX/rroN19oyMAKyAEDZkc4DyZcQ5JvC3Po5hNpC0Rwv8s5mcAviSA8RJu2nckC4EwMaB2WsDsE7xmpEfAmRdYp1K8C8BgJZTrwWQJMCORIDgfooAUBOAuHwvABIA4NIC+VN+jLVf+tHXXocTSvYy/feZ8hR+AOKtfU5rEPTxSD+cduNumVbaVee5Yv3ENAiAufm08savL9sQaF6tuKtB5Tzjt+LhNxWHsF4DAOIB7YdjagBYQPYCkPi8JjhGAHjqn6Bf4K+fBID+c0gA1mKeQxCwu5AArN2kZZ0F8AP8k3RFq2v5LoA9vchjtcDUpPaexhmTxDPMNC2ZcbDrniPnxOGec+JlnH3sc+83Fi/vbZz0S7vhSC/DdU/JjKu9yrH0xhsLX/yXFrjoFrjBx4BQ5a/aAPmhQIgBNuWcFAD4AU6y+jzsedWAMDbtxGNzDECvJADq9vi1tAES0JsWKaBPWePqzjjaLQMA/xMfeeza/MaHP6N/XeCTv/nnzz7xi88/++2f/7I+DP/+a+AX8E8AagPwQcBho3f0/udECTDKZk0gfLtKxjGnbGwiVf8XuE/JJAXSPpXG06lFA2B6iKO2+4Svedz9rCeAf6QEgK8A+D0SxjLAESIAUK4mgKf9uKtGAPEwxlHitwn8Zzjx/XcAAMgU4G+FQR4wXgbQOt0oFxfqHkW56c7EW3XmBgCcU+vhb/Pwn5tHF/WOOwS8veNm2k3pvceqS9PbGwQA2Rkv7ZvyNi7yUFeWgzxbZcCvJ1SoC2N7pE6HKlOfD3OOecaJvyQAdgyvDgr+lQL+TZL4kgDuFwD7VRNAEkBCLTUAtHvaX6XELc+0/LAg6VjXJQgGEmB10IZbMrttW6A1eQ/dGN6jSu6j3y73rGnTrX0bmXG3tWddMu2Uv3U2fsY1bI5spddvTM7Jd4mztMCVagFOL/gbwSltAAgBNgQ8vH2YI3nAc2rAJp1NhBt3WHiBvCBcKRFQPxJIOMBdQJ9SQJ8yw9OecbCjSfDOux/bq/YrUfNX3R877/3jTgMw5xKoH1O++z3v+dBFDBpOldgsAXxvV+BvvSUA2HjSJpgxEO+pkuGt0/5NYZAFy3upm0c5wOcxf+YxL2BN0aDyrxYAdojLLief032mtK1kgMAeCRHAawG+GoBfJQK2JQDUBkAyFhhDgJEW2B/z4+9GKe/mFjlYjHPtVduvuGvcViGIs8I85zkPfz5r2I4EAPmk6ZyTl3FXXaxzhrGD6fzPxQkgTXzCtrnmxJ8TZwXRO5TF8tVy6L/qAjC6O+vxrq97xte+N0mAJAAq0G8RAS0/DgumSACJANdj3MwjCDWBP7KCft2pNYCfgB9pHCVx+TjgMDaO15BLzksLDC0wZ0FoNdY26TKu9k3SexpvzK3/MWUtw5x71TTp1j4myd+wOffaNc5F3GPXsi3plhZotcA5bQC/9u9rAXx1m9MAHtYCfyQgigc9G3VeL2BzjiEdYFvQX6UkgNoAqOKr+k+YID6BvXbDlPpXSTh+EACYBPeb7O/5xzfjs0nnot7HJADIm/+ObnXMIf14JxKg4uaL/nMDdlXlLnWgT0kHEYLqKeA/XwGoAL+6BfvbSEgE3nc/ZH9e57xoq7/8dU/7ySQBWFt4b3kAUaPVlwxIIkBtgBYRICGw6TsAqQUgCUBatJ4AK9uQALwGADlwQWOi7knSvbZzEj+8d07brv1HGprwc3/RTL8EwB1JNuk9+57cB0A33G/V5Xoj3OTT5wXBzTcCBnKCm6/DcFzA1ZeDcr74xS/+tlKOqdv36aYiHDBs9axnP+vjkgAtAqAF8is5wF4Ag7+SdLw2mAcHPH80rMOu4fgB1pMEEMSnlCBogf2Mp11NgOFvOFcHbLclq6UF9mqBi5zkFLTer7qzMhnWsuu3q/Repq/lG/Ov8cznImSW6SLut9xjaYELawE2S3/uc//ouzjxRwUXIoDXA3DzQOdBLQHAw5oHPa8A8B4hqrkYPuAHGcBmAgAOyPdje2NEgNoA+xABAv4kAiQJtiUAJAggAj52/zf2BACg8ZgkABoHw2b2aP2NKiSbK/oRc1VB/yHKTf3ZIKI6WjUAqmp/dSfwT3JgzE58CIAAV0fr4+uUMfOB035OKHl9Ymi/2c9gTlz5Bsq3P+ORH1AbIIkAtANSI6AC/LluSABeCWBubfNdAAhGtK8uqs8AyID87n6r1j0Bp1uMUfqhB93lfXXynt1HQznmxCdO/448/UpdNPh3JvPA3hueaXfeeedzY+wYT9lFPfrFvfqPBVLm4W4Xef85FbyRmgC+AlDBfIJ+SQGk9oxfSQA0BgX+KfN5lCQA67NgXzC/q0wS4KJeuZvT6EucpQVOqQVObVE6pbZZyrK0wG3RAvw9F6dtfAxQEoAHOw9q3+vjQY36Px8QAvDzjq7v55IWAoDNF5tvTvUhAjAtEoBwSAKJALQB1AgA0Avkp0B+xjGefrsSABABpPWvAY9JApD3cEJxtDFG/myg6Ef67xBA+irmQVu70ZQASA0AAHsL9CfATxJAeyuNYXykKjb/R+vjJeN2C1StgCQCsEMEzAX8rXiQAGgQbEMCoAXwC/d/xxnrbbvUh/Vl/IWavpm751Pin3bjtSTxVuQ5kJe456Zt5Tfld4PyA94gHPjuABK/uLfpLccNgD9xhnKtipaD8Y8tLY/3OVYbmf/O0n8GSAKggn4Bf0tKAAD+NfgR178HZO1tGZ5LPE84ZIBIw+wK+FvpJAFYp49Ntu/cAUvCpQWWFriQFjjZRfhCar/cZGmBiRZQG+ApT37yWgPAh7PqfGwS0AAA8KsBgB2Dvw9Z1Fx535UTdYB+SyPA1wIqEcBfA+KXrwYI8PO0vxIFgn/k29/6kDPV+j3d30aa9tj/DgAw5f3niW7ZKwgNADZibLTcbF1FAH+IMqv+j9p21QAQtE8B/lZYy8+8IMq6zlueOXuN4P0Tuxb5ekB+I+BQJIDgZez9//RHC4DXHFwr969hM4fWuJvya4W1MiZexk17K/4+fjdoI55Lb3/bWz7AWvma17z6jWMEwNCeq+6GaZIQoCzHLC/518v7KWv4SbghAXh+89pfgn/tLeCvHyA/SYBMQ9gpkADMz+V1gJMYakshlhZYWmBpgaUFTrUFUKEF3HOin6f/2CUAUPuXAMAOAcBrAV2dVlkvNm8SAa1XAwD5EgGE+zd+SIgANQgS3FcSQHfG6e3De/1TwJ/vFoyFQwJgOLXzOvQrAeR7zH8F4BsAbMAuggA4dYKB0yA2ghAAagEI1pWe6E8Be+K2wqvfsbU7cp4t9s0tkK8HQAJgVOVHnb91yj/HT00AxhXaAAn2W3bGICTAH179we/fXOq9Y+wKPE2HrGbfQpk3+aS95rsmAAD+/OsAHx9sEQCA/0HNe9VlorHcNd/F3WgBXr3hmd8iAQT7SEF9lYQJ/pGmkQBg/8BBgpoAHirohuTFrkZN60R/Vz/WfubnsCZPjblGyyxeSwssLbC0wNICSwvcJi2AGiXfBkDl378G4kEuASD4R6oBMBAAzRaSCACsj70SYFi+FsA3AjD4EZ4gX+CvzDDsaAGMgftt/CEBjvlKACTAsf67+Ouf8sRv5eT7IgiAQ5zSz8ljF6KBjSXvlrq5HCMAJAIOIY/Vp80Jtnhu1QKQnAD3b/3Sh/Zq/P/87r90htn2o4ASBNuSABAAaIgcWQtgqzZpRE4AnfZG1O28eB4MavpTCXsCAGDP84g0od6/6hImkMOOX//l/cHeiXNXxs+AMX/jbAo33pWXaKNNkQAV9HtAoCRcIkACAJkkgESABECSApUEYM3eFfS30rHuL+vyrcN01Xlhlmv/FrhtFov9m+roOSx9cfQmnr7BsMFZ+mG6mU42lA0BoB/j+/9sXNUAEPzzTYA5quxs5tAI4D17AT+EAFoAAnn9UyOgEgGA+17NvwP6Ffjr3vc1gCQJfCWAjbvXobQByA8tgGN8HTwJgDng+jLi7ALoty0nJIh/OcUJ7BgBUE/x8zsBNWwTSYD2xclO7KVgtMAKIuA5T7yjB/5oAexDBEgCcOo/RxOAteSivgWwQ3fzzL4BSAd001a4B9OJna9+LzCXAOju0v/rAPsITOv0v5SkJw06v9xzpL1EXzszzhz7OuF1s/DxTUiAt73jtbec6EsAAOIrqJcEMKwSAMZXJhGQdp4HELas16zVCwlwvBG26rKuxrtV/+omnn7Yl+t8C7iIVHk+1uI6RAvYxuY15tZfafxFHrgF2DQAPlC54uM9B85+ye4CW4BNF2CGdwQxfNyM035V/0P9f5t5dYONBh8MTOCvXRCPm+8B8DqAJEBqBEgEtMiAQxIAkgG7agMA8KcIA0gA3gs+dLfy0SzAL4CZjdVFgO1twfkx49Ou1BkV0DkEgK8ATIF7vh9Qw1vkAB+hO3R/LvkdvgUAlmg7cZqPBsA+RAAkAPnMIQEgAO753uec6oci+7WcD+i9+z3v+dCgXk/jb7PG21lTaabCvB9xVoPBrumss66pe6wgI8iFcRD1xKtPx/MPg0d3TeV1M8Y1+IWMhgSA9PfL/qr1C/CR2nnG6EbqBuyrAaDEL02m0+5rAZzi+2pNnuhv+qeAJA3Sbh6LJsDNQbrqxLHMzTvcPr8uDFW2WsA4rbDFb78WyLbVvknud8cl9bkWAPzz0Z5cePnPcwgB/O96+V3fzcaiPGzP5bE4Tq8FAOxoAqABwMYAMgDQyl8JDadEOxWaccC7nffc82lvBfhLAiAlAtAQ+J0fuvldgBYRQDzJANP0csZ3AAT3c6X/MACg55oC9hk2RQKYz6FPBNncSgAcE2ifat60K/UH/LP581RpjgZAC9RX4D/lFljsNCmWRBfeAv5rQBIBkAGYbV4N2JYEgHy48MpuviF7phsA3x2/+O+eyzvpVup/2bKvI4VQwyAK1JeVvQom/G8LK8/057/web/AM3+MBBDoC9yrW/8E/9We7koM8HoA6zaaAGjV5J4y7QL7TdI0PAcgctmT3hadOVLJVee/NsOGfO3OsD3sXdJrd7mIpax23GOGBjH+tWucS6yQbTrW7umffaC/RTcf3Yuc0QJseAH4bK45ccO44LIwpx0375bfjg/WGU15slHYEPIOHYYNM+4DF3bFqfXLXv5prwLQJwkAoP+Vf/Z7m0QAHw3kVYJKBJDHXGC/TTxfCTjkvwQAVjl1OTAxdoMNFgCdk3DMKYL1Y5bL03/WHLUAOFVqneRPAXrDeC1gDjnQzYvVgefGkt0FtADzDyJOIkCtgG2IgLkkAFoAjKsT1RbJfZH2bfZGN4a1bJs09vAuaUy7i8z7aU+Z9l3yv6ppbvBxQEgAXwngeSJoF+DPkakNoN28xiTxyBsJCaA2QN1LbgL+hpOOZwCS/Jh7tysJsOpG5NowUTXpf2B7l921u3JhwD7H0AiZ7to1ygVVKNtwTrtPxbFPzHOqCnPiTKW/lmGojfEu+Od9+u/vT4Y58XThnZK8JnAEIHkt2/g2q9QNxhRkQCUCPvzWtkZAkwg4ghYAZAEkANoAfhcgT/t3sUMAkO7QXweHlBP0nzIJYBkPJWlP6pubxUoA+I5/Avo5rwGYTlKgyuUfAK7+SgWhzfdKJALUBkDit8lsQwKcqBYAnZh7pm07dYXmHyfrQ8JN+ybDld5/2/seMn6W5ZD5Xqm8mAvPevazPo7mn+BfOQf8E0ftANMB6rchAiQBOGACvAvkp/aWhOX6LwFgWvJ6y5tecNuQAKtu1N1iBP5IOjrdu9hb92j4dV79tep+Nb3Hif+4IKTErrEuY9J4Kaky7uXavgVst2zPVZfN2vAAGh5Ca78M7+yZttq74HXfeC/88hrzzzi3g/0G4F/DRhpAw6KL4bQUUgCZdhZpQMrt0EBLHXdrAQiifE1ANf/UCPAvBHlFIIkAT+u3OeHfJi75H5IE4BWLQxJiL37xi79N4I88FMA+9XwgANh0ojrqJpF1CLcaAC0gn2RA2ivIn3IvHwDcbZ6fYipUoes3AuZqA0gCMN4ALa2/BVQL4BgfAb3k9txlX9Tvv3jtINbAXfK55Kpfz9v7UWBeCRDAIyUBBPljbv0F/uYxpgGQ/qZhHqG9BXhnLQfMC+hZ313rqyTMuKQjH/LgGXBbkwACf8C/ZhfgX9N0U2C1g7kqM6dfqLrCKvu6CjbHZGkP0yqpO/blmm4B28h2U666ZLd8NZYHSTXZP6QJY16bZJdk3ffYuUhz217M/y/+zD9+hpEE+IG3f1cP+gH+LLioOH/1V31Vb3h/HEaZxZjw21UV67YdMDtWnGeUrwhIBKAR8PF/dePs7MN39ODf7wRABKA9sA2g3yUuJMAv/ehrwZyzvwnQ0hIw/Wc9avXBHZvnlmQAmFMH68cqH5vA3BRWAqC+BjDn9B/gn8RA2iUFlrXslmF45T34BspXPOYRPwOo3+a1AOMLOsZIAPK+8o30uxXYZy+0uvPOO5/LfmLIbpe8/DeA3y3RYjtIC9AvfPeHvRsfBkwCQHslAgT+SsOntAF+/P3vfyAJgLRLAkgEQLBJsjHPMEkKYHf+kZa4gH/Tr0mAa/7PLatuBNxi6FCBPywkBjf+aYyTYemX/pmudc/0I266N9i74Eu9XIyQmBVGQFmBZsttXNN20ryUndctYJKw5frddrE9bLNV1zh9P2Sb5zhMe8bB3uiTPj/yHIz3GZNdtHWfZdnwvy0u2lfwz5fhJQPYVAP8dSO/+k99ypok4HQFldmf/4n7zmD+b4vGWip5iBa4gVbAvT+4uv8WIqD71wDAPwZS4NhaAJAGSQIAaFsAf44fJABAkufpIRqJPH7mZ3723x0LZJ9ivrRhPf2XDGAz6OlPEgCsU4J5pYB+G8lmcp+PYh6qz5d8jtMC/HVgiwiYeiVAEkCQUkkAtAD+7du+6QyS4TilvhK5rvdWrH3sy4ZSu5/aphL7fH9gm/vctnEZq+zr/DaA4B4pEaCfgF93Sk/2kdoT7Fe7xABaCKzf1QDsNQJ93cpWGtZ4/uHoOs/BVTdabzFs3Jlwgn8aAIPfXCNpkPETcGmv99cfWcO2cHdRj3q5AKXEvsIAHgWUWR82AZr0N24DdJJnms65BpXYl+t3WyDb6RwBY1vb9krGpnalce0TpP1SZXfr1YjJsminpNi5lDdd1/SXthPkv/wLnvAg5ll/dtUDffz1qxJtgdXDH/YxWGX66Jo2z1KtI7YAH9HyXwQgAzj1RyOAvxBEOwBw/rH7v/HsI//bVx1VG4D7/ML93wH+7D+8Nwfwt+KQ/pDvBfPPG6cI1I9ZJgF/qoKqBloJgAT8EAFVEyDDN5EBpD3iUF+yPpEWgAj41i99aP89AF4J+Od3/6X+HwPGiABIAOJ5EtkiASDOT6R6l1WMfv/E/oz912UVYrnvvBZgz/eFX/KFr/cjgYBywD1f70cmEYB9jAjAXwIgSQD/elDQX8kAwgH5FdBv65YYYO3mrzkZf/Na4OrFWnVFXgl8UgLi2UgB/nnXA3sC+mqXMKgy42X+c+yUbQ/TJT36JcBD3gL+BZbZBmk3nLYQdAo0yW8weY+0d8HrC//b7bLO2SarrhHW/eAYo52z3TlZdpymP/bsE9PbNy1pfym5f5gsm/YueE3sYL+u1w1ORirAn+uGJHjC1zzufvrgujbQUq/jtgDzFa0A/0GAfwZ4/Sse1n+s7xO/+PxeTf/YRAAfBuQeXADcFsDf5EdaNjaHmguscccE26eUN23H/0gDtBL8SwioDurGsQL6TWB/KpyNJ/+QcdxRvuR+Qi1wQ40AgL9EwNjfBkoCqIacJADkFGPrOp9Azuw393lET/vM5Eu0i24B9tF892RMIyBP/CUGBP2VFEiQD8CXBEh/7ZIFzKdtQD/zrsaHBMCP7wG85EVP/Y8X3YbHvt+qu8HaCHRS0omCfwiAJAEET2MSskBjnAq08l7ajaO7JbPcW9i7qAe9XIgEdWvQyaaTcifoTMBpeyCtL5L4pBNkNgCl92pJK2e5dN8u0jZZ94N9YD9ku2+y134hD01rTGa/0X/2HbLrgFUYy2k/VXmt+osvmFfA/56v+CsPjpkaFzenIKwl16phlspcdAv0rwcAxtEGgARATR9gjuGUHnMsjQA1DgCju5AApOHi78gO1XC3y2sAtFv+9V+LBIAcUD20fghQDYApoJ+kQcYjr+X9/0ON2CuVzw3mKhoBgP8pbQBJAMdgkgB8HPeQmj9XqgWXwl75FmBfzN8GThEBFfBLDgDm0y64B+xLBCglAFISJqmbAH/MLgGQ4ZIA1/FVgFU3utZGUJPABzsbb8E/HYm9gieBfkqIA4x+pqn5V3fGs0zbyKxTsXfOg18J5m4BntQtgb9twf9aa7e+SNtijAgoYDLvrZ0KXmtAGT2Y9bT+fR/QTpWEsZ1pd9p/yhDH+Er7ZkxKDth3jtkJMmc19JVlp2pZJ9xX/mINENQD+v+Pb3jh2RxDXNNJArD+XPkGWSpw6S3A3P/2ZzzyA5IAEAEAf4kASYFdPv43lUYSwNPxTaf+NRwgy+aEteUQjXg7vAZAm42d/icRwGlrfQ1AUJ+Afls/NpU8Mw7RX0seV68F2D8A4DcRAZAAkARoozDHNf4jAPuIq1f7ky2x+6yTLeA1LNgK7MirAa2PBQr0U6oRAPAfIwMkAKpMImDs2wACfqRAP/0kAghj3effeK5Tv6y6ypwzbCwqwGEBo+N4r4MNuCSAALYlBf+k094CVeSd98NtvPRPu8Bqjqz169yHuFw8Uq7BPws1INAyUyfMFOAkzHhI0goorWcFkhNkAHW0bNV+iPqfYh7UF7PuB9rNfrBtax98+Qv/hxenqeHpNo8paZ8rp8gAyhrG8qfsgs/1I+4refF1f0B8EgB8IX0uESAZwCsBfA2dPriSDbEU+qRagGdTBexJBKARABlQ4+zj3ud1ALUADnUiCDl93f8GEAJg6vS/kgCeGLERFOwjUQOtBs0AyAGkcUxjXD5melKDfinMpbQAewLm7Uuf+pmjGgGQAPd+3zObJACvFVxKwa/fTdljeaVdv0UesQXYl4Mh8xsBgPUE+RXsVyLAuErBfiUBcGdYru0CfUE+bu2VDNDNOn9d9p6rro/PGYGm4CWBDqCcToME+J/+4lPvQ7J5EvwL8lMC/tNkfEF+3gM7/sbDbVnmSuuQstZzcHfiIJeAbRR4UqcEkgk4sWcY9mwb672QAZN9ZR8gz/UD7acGRvZD7YMxd+2bOe46pqf6EBKnEDmrrg5ZH+xcypuuK/ZLm/DxvyQAAP9zSQCJAkgE/06QteWqt8sV68ZrWVyeFX/tC37fPRXUVyLgkK8GqAkAON32dQDSsFnhmXCIDuHjTJThOhIBtNWc039JAP51BDsbxfoagIC+SkkAgb9EAB+Owizq/4cYpdcnD56FSQTwjQC/DwABwHcDACK8DoDEoAVwHd9BvqRedX+16u6v/ZKKcvveluduiwgAsCdwT3JAMJ/AXzvS8EoE6I8kTEAvCbBJSgywtl+X77kw+NcmATOAhUUKwJSGDbcEACQAnTcF+AnXSAQI7jPftBNOXPwqkEq3ZcRPgFWldcp6Fnvn3Oty8UCOAk9B4xjITH/jKq1z1m0TGUBZBpPl67yuNoikAuWifl7Wdet+eM73PPZ19IEy+2OTnX7iA2P2V0vahzlWsw+rZkdXodVgrFOV1DnrjvvkL9aCFgkguJ8jJQCe+NhPf5C1oqv0lWuHk++o27SAzEmePf/kpY9+MMmAYxEBkgC7vA4AsD2UFsBrXvPqNwr+lZbpqkvaae7pvyQAkjS8DpAkAEC/gv8xt+Afybp/m06ppdoTLcCejm8EPO+Zn/MABIBEACQAbkgoDOCD8YimyaIFMNGgWwTR9nfeeedzuyTL/mGLdjtGVHAaeJJvBPBqwLvue+MZKvstEJ9+CeqTBJhLBHCPTUQAc884ErzXQaNr1XXkOSNYVjJBBOaCdqQEwF/+uqf9JIYNk6Adu4BfSXwNfsYnTcsQbhzvnzLB1BRJIGC2PrW+g7sTO125aGDH3AI8LaugsILJKcBpGqV5Ia0bMoEkdU0wSZkGYxktt7ILvhZX1m/dD7QNbUSbMVZoy+wD2n+Tyfjb2CEFWsRAqx8pp+OU/puhFUCnXck+ZAMDeAfIzwH8GYc0fAwQ4EO/XouRu1TiJFuAZxDfCBgjAngt4BAaAbu+DgCw5dSCdWPfBmQuoQVwHcH/Nqf/SQCgCQDo4hTWjR8ySQDtyiQD+GAU4P+6vTO671hb0jdb4AZ7YbSQWHPQAIAEgBDguxSMS8goNADYxzRzWDy3agH2WOy7ukRXch+1VWWvSGT6hHkAXnz+C5/3C2NkAMBdIyEwRgbobzyl/kj8mF+t1wPUDJAI5vR/GDdXpFXbxVx13msj+FCyIRA40SEJygHxAP9nPftZH8fA3Bgu6FdKFhAHg1sSwDRIiQDspk1/wpME0D7mnyDZOimz3oO9E3tdgs818ORetp/AM8HnGOhsAUwJgJQJIrOuDEzB5G1CBOTifUs/0BZz++H/8c7/67/AjPXNtv72pUTAFBlAGTFj/VdeEbCeKRnA2RZ7DehjJ2Z+AOIB84B6XguorwYk8CeMbwiwftBOxy7fkv/SArYAz5hKBEAKAP79PsC+RACaAOTFVT/6N+bmZJ6wQ2kBvO997/soYBkS4LoQAbRnnv4LphLob7L7YUA3gEkGtOySABAAGP4Gy7G0yKUF5rQAe0bJAE79IZJwd2lXc9IvcTa2QO6V3EdtTLREuNgWYK/H85c1lO8FqBlQtQMkA5QtkC/gN0ypf2oQ4MeHOLnfD7z9u3otMEje67KWr7puPGcExwJXAQngksUowTp2wLwEAFJgD3jHnoa4EAZf94yvfW+SAAL9JASwGyfvySCophIEhksOJDCmPlnHUv/OufPl4oGcJAAEhEjB5BTozPjakwRIexIC9t1MIoCK52K4c0NccsKD9IP9UaX9tYt82cs/7VWabckAx+wImbMa+s660wVXqi9d4J33zH0MawWGdYR5zpzu6raigsu1tMBltABj8JhEwC4kAAAXgMD6v2+boA7L15clAa6D6j8fjuIEv4L8bYgA/5bN06EW6E+/1AbAfoi+2bdvl/RXswV4/vP8W9T+r2b/LaU+aAvccL8IEEcNH4CepIAEQJWCfaWgH6lfleT7tne8ticAuNewBz1ohS4js1V303NGkIEUPCIFlVQccJ2AnY15EgAAfPyIg3Qj72ae8CQBMq+0k1aiIP2TDMBuWPXHTVkps+VHWi/rWtugc+9zCcBuIQD4+BxlAawL4hNEzgGapmvJJAG0W2/qXE+Ui2q55abuad+nLS4zrXU41w+0gR8BtI1sS/ui9sMh3ffc82lvlQBQJhFQNQOy/+xDx20SATO0AmiP5VpaYGmBA7YAz5dKBOQ3Avb5xwBIAD72xTV28p/+agF8xWMe8TMHqOINCABeBagkwFXTCKD9aBtOcabA/lQYpEF+END3QNEEaJkkAbCjCYAGwAH6ZcliaYGlBZYWWFqgtAB7e57HEgIA9jS8QgB41+DO8DE78VH1J1/24+W2V9q56kp/ziS4ECgLQpBJAADQNQB1SICXvOQlZxhP7AT9uDWSBZIA5iGQV5KWOEj9WjLTpz0JAMqdRIB1o761DTr3LlcCLOwHBZ6C0yoFr1UKbpX2YQtEjoBH2iDrtEubXEYay4zs+6GTK8Ayfc0iQRvQHraNbZdtm6D/jR983EfGTMbb1r4LGQB5YR9SF+o0kwigL2wT7Mu1tMDSAgdqAYmAd9792PVfBCYRsOtrAduSAIBdXh9gfdu3anwMUC2ASgK0NAJOkRigPbh8fz9P/wX8ygybshM/3xGdeh0gNQCui8rovuNqSb+0wEgL3GA/4/7MPeuUJC77ny4/930jWS/et1ELrBgz/NuKpuI/wsWyPLvTmEZJPMbZdWy/VVeptWHyaaiwxgloIyIB14BtwLlGAuDuV999xkcbAPyEIT31RxKPcAx2iQHjm59x078SAMatkrJJANi5lp/6WDfrm+0w2Dux0yXI6sEn4JoFKoEn5QB8VuBZASSgs/rhTqDaspsvcupEuQUguxqvOpN1uMoLq/U4R8bQ947pSgL0bTZ8DDDbfowA2Mff/CECNGoFIFMzwHIiLbtj2H5kLCcZMPRl7c/Oe92/2C/1Yn4wH3inEXP/n/jTv/2eT/lvzjDY/59/+L/7JP6oPVLfSy3scvOlBTa0AM+aN7zwIWd8zM8PBkoE7POhwLmaAIfUAmBdSS0ASACM4L8F+PWr0jQXLQH/Y6r/UyB/bhhaBbwWACGg4fUANATUEvDDUQNQ2TCCluBr2ALuQ6q8hlXdvkrMC57trJ3s2d3je5iH5N8Rxgx7A9KyL+ruvtq+BEuKpQVuvxZYdVXujSA4peBCsCF4FkwjmagCfCWn/xAAL3vZy84S3CfoJ/ytb33r2b33vrM32DGvu+ee3piePMgv8xHo572TQJAsYNEgDgtKGhcK65d1tj0G2YmdLxf6JvCsBEALdLaApYCxJVtEAH6SAS0iIE+TBY8j2gDWB3lVLsuKXGF40FDPKTIm+4L2s62zP+7/5S/4T1Mm486x3/uDq/sxkgDKTWSAc9OxvCMRYH/aXrqPLVc8uAH6//vD5hsIgeFBf+zyLfkvLbBTC7DOQFr9o7/9kLPUCIAA2OVDgWgBQCb82s/dD57d+DoAcf7t277pIP8I8IY3vP6fVhJAcJ9gvuW3TXjGPZSdduAVBgD62Cm//nNlJQZ4LUBjWCUFIASuy39F7zQhbu9EPFc1q7Bf9PP2snthxT6FZ7fYgb066tXs9/mo27aGv4nTPP/5z/vks5/9N86++qu+qv8QKmQB92FPdNkVX+6/tMAptsCqK1RvBMECiZSCjEoACKoB2p7uM6E51WdCA+aRuAHyuAH8bibYMEwZHtzE5WuMkAPklUQA9/K+VRImAaCUDKAe1CnraP1tj5CddasrF/X1ot8Cnp7orgF6/AVdC3RWIGmcMZmEAECyB7blr+jsW9pC8EhZMUEEWA8awvopt2qcC4qcZbPsyHNkTJIA9AXjwr4YIwFoa/phCvxvE1b7VCJAKRGAlAyY0gpIQqfVn9Gnq649sm2yzY7eTYyvPOmHAPhPd/yhc0SAbqUkgYTB8iGko3fTcoP9W6AnufgPbzUC1AaQCFBLYK6cQwIAfPk2AJvgfavAmvHj739//yz2ewBqAoyBfv19vh8K0G+TD23A/QH2gnsB+i5yLA/zRybwB/SnJgDP2H37Ykl/ci3gM3TVlQyju7P2F+71vmPD3mpIcj0E+w/2VOAE9uCAc8B6gnzc+POPPshnPP3pvQHEa57y5CefYXB/0ROfePb5n//5vcRNfNIB/iUC6j0Ie8LXPO5+9v+Uhz64Hi281GJpgd1bYNUlXQl8lQmKsQsQmTgYGDWM4B/pSbwgHJAO4Ae0v+e97z1z81A3BWwmBPkA/WoIyzS4yU9Sgfu0DOVQSyAl5aTs1MN6SQRYfyTtUkzn3OoSTPkwWD8AyD/bdRsSIIFlBY64x4gA/CEDBJDbEAGnAhi3av1bI9sP5x7G9oX9UftijASw7e2Pf/k7f+NBzc9/4ot/u2WMu0n+2A8/4sPVzCEDLDvSse1c3oEIcPze2pIH8uF0FEAvmBfcjxEBkAAa4+I+UHGWbJYWOHoL8KzMVwP2IQLmkgBsrLuKrfat3JOe9KSn+nzmOSwBgOQZ7XMagJ52Abt+Sv2PLQH6gPIK+KfAPHENT3CfeaS/9gT/fh/A1wA45dy3D2639Ow9eIZBaleDP8+1AcztPb53bNsb3J9y5D4y90zYjePzuFH2oz9vd6zf1smoK6TjZz1q9cHHPOYxPQbg9Ru+oA7wF/AD6AHyn/0nP/vsUY961NkjHvGI3jzkIQ8528WYXkme3J/7QBJICvDRN8rBAaGEwNBfW9d1SbC0wFVugVVX+FECQBChbBEATKA0nv6rAcDJPQ94mfgE+4S5ocAOSVBNxiGuhACbCOKiUcDrATB8GggBCADKgpGUgAiQAJAEkAhwYZ4gAXbt5ybw5IHBPWlbygBoa508C+gr4Kwg0vCWNA+lJADSk+QKHn1A+YBlUc+HWtcYPrCs367tcxHpallX3U1vIWTsj2yLVp/4SoBtbV9AALSA/5if6cbkz/7U6mOaJAQqGWB/2pf5modzl7rZp4zx/iE99GmjX7O97B/9dO8t+Uo5AF4CAPsY+NffOLr/j2944UIA7N0TSwYX2QLMNzRXeDWgagRs+32AT/zqh/pna/4LQNoJJM6hNGXe/ra3fMBn9hgJIMBHtsyxAb/7DSQf/WuB/wTy29glBUyTwH8K/EMCsOZe5Di7SveibdwTAfSf9rSnPf3FL37xt917333v+g+/9EvdULtp+Isu2t6/YWQ8YiBXvuV5f+su0l1gvW8wl3nG8sz1OSwB7/PWehEv9xa4CRuev1dhH7WxadlXP/qPfGoP7AHdfFHdC9AN4BfsA/IF61PS+FNxCCOeBneLRCCcMlA2NQYkJcAH7MWH/thY1yXC0gJXuQVWXeF7w+JbT0IFDkwIJnUCZuye/if4xy4BgJo/G4R82OMG0GsA8NqRnOxXU+MQb4wIyG8FAPpTM4ByoYJkubM+1lWQJAlg+4TsrFtdgiYX93Ogs/VgaAFOgTuAcwwspr/AtCXNK9XJW0RAtgnlFDQOi+OqawWM9eqsa0IA+6lelhfZ9wX1cfxnf0jK8MBu9ckYCQDYn0sE/PL/77//rxjSIOlD/VJ+/Jce8Z8xkgFICYEkA9yAtIiA3JS4MXGcU3/aYaRvbTP7FPchrhucEAD+E9R7sj8miasB/L/8C57w4CEKs+SxtMAltED/asC+RACAnyuBf9oJ4/l3iPqxRkgAKKeIgDECQP/cHxza3vriv8B9jhTcG1fwrz8S0C/w9yOAVe0f8A+oPUT7X4c8eO6gTQLA59sSP/MzP/vvat8zZrnwR8MEbRf6gba2H+yXKjlpviAiYMWegectz2Gfy9jzWZygvz6beRbTHl2/rjpzqGfrhQ4T2gCCkef553367+9P3FX1Z57Tj+ABQTlSU8F9dRNPUK80bZWEP/qzHt1rFHDyr2YB/tgJw57EAHkQl/JCBGAgBiAD2BddaEMuN1ta4AJbYNXd69zpvwBY8AcIkgBI4CwBkOBfNXtO/gHxLuhsDiQCWAwE+gB74gnwdftBQKVxJAaIZxqJAO7FPUgDCQDwVxsA6esAljfrYh2tswuy4Ig2CtNZd7oEUciDkQBV5TxJgLSPEQG+W54PKx9QPrRolwSMLIoCRuoymKxf53XSD7Isa1/+MRKAutsOUyQApEqSM2Mn/vp/8jf//Bl2JCbB/hx7EgItIiDJndqfEgFsSLNfGe/26wQRUPuWttz5+sOrP/j9X/yZf/yMD/p5oi+43yT9Z4AD/df5znVYEi4tcIAWWPE6TL4akB8K3PRdAF4jmCIB2IADoA61oc1XAZIE2EQEtF4VcJ9wKEldyWsf8J8AX3CZfmPAX5X/fOcf8M/fSB1gjFzpLHjWAPjf9773fXSsr+k7LsIZK6iNq8GxCfhLCijpNzQDaHsA6hEarz/953nK85Zn8m//l4ed/cYvfsoDSdZDBuTz2L0WkmczewzKNzxz93qeHqGOo1lSXsrOM/wJn/XQMw37b/oNTQ2kFwB87ol/C9gL/pU1Dm7CAPlJAvitAL4bwKsAfj8A0E880kkI4OY1AV8RwE4dRxthCVha4Aq3wKor+5oAYHPAIo1h0AOMAcqA/RbgJwxA7cf1IAAA/4BzFnA2A24OkIB//LED1AX0SEgB0uHvPwEo8TMMu2lbJAD5E84rASxEgH/IAE//JQCQWbckAWyDEQKANtvnEnzOJgHyI34CzRbYrKfOSQCkPcmAPD3Oh1QFjYwHDG3Dw2oELFo35T7tdKy0PmAtI3KFaZEAgGTqLQmAlAiY2y+CfmUF/5IAVW5LBHj6ACHgpmOqTw9MBOzUX4wnTg0gAZ71Z1c9EQAZALhP856v+CsP6iacuKT5c5/7R991KFCzUwWWREsLHLAFWFf91wBfDZhDBPDvAMTjypN/7TwXsR/qNQCqfOeddz43n+/aee5XIgAw1zLuCSjfIQz1J09BY4JBgfyUJP6U8bS/nviPAX/A/+3+1X9O4t/9nvd8aKx/6TMuwuk7QT/9MBf0T/WpYWgFvOY1r34jhAAE1gGmbf9f9TxHed4C/CEANGcffuQZ5j//8Kec8UzmWVwN+yzS8xy8KgQA+yGe2QJ+5Ff/qU/pzXv/zQ/06wxq/5yk06dc7OUB2VPgvQXoBfVK06dspTMc0iEJAMB/yxBHgoJyQhSAHyACFhLgADNlyeIkW2DVlWpNALD5EPwyyevJv+AZwA/YF/jjL/hnE8CkRwrQAfeq7bvIA/pbYB4/Fgv/BtB/DMj4mc583XTwAOEexOcjgRAB+S0Aymk9JAEkAqgv9cb0wKRrjxESYNfOTNDZA88W6OT+PBQwFWyqvt8iAASYVSb4T3slAvLhJEvdIgJomyQBPDVmLA2GunFVedP3dH6zP1ZdsdYkAHWi76kn9XVc1H6hfyQCtumbTSTAg//+T/SaAZICv/PJTz2rphIEm7QCap+6+aBO1s++ndG/th29aT9j3/riXnwwiJN8DQB/zBAH4M983fpmS4KlBa5AC7D+ANZf8aw/tv7XAAA+htP+lkYAJMAv/ejN920F/inZiH/vK7/4k4es/hgJIBmQ0me0REC6eWbva6gfz38AH6r4Ar+5cgz4C/rJMw2gX9NS+Qf8364f/WP8MjbmnPZvC/rH+pP+I0w5Fk9/tAP2IAJ45q3V/wH4AH+f0We/8JAe/FcSwAMXCXqeyTx/ee7SZl2e+Vw95FQ9SF4cBCbw186zmrWKPTeq9IBpvs7vBeiWABDMt4D7lJ+gviWn0nGqD8D39J+yfO2XffZaE6ASBORPWUnHAaLaAANBc5B2XDJZWuCyW2DVFWBtWuA/CQDAMoBf8A+Q5lQdU8G/gF/QjoQMwEgQECeBvGQBcQH9LCQa46kRgMTPNOTJZsLNRpIAEAD5QUDroJQEYGGjvpIALMiCf2S21WDvxM6Xi3z/EDkECVBP/ysJgDvBf9qrCnk+nFRTq2Cxqo/z8BoWyFXXKpisY+c82SvLue6PVp9IBEgCILclaAT09If2KtlE4AcJ0DJuMqqUEEgiQK0ANx6SPJUMsE5TRABtEn1c2+1kO3gp2NICV7gF+m8EbEMEjH0UkM04BALr2CHbYxMJkM9mn9WCf6XP7F1IAOpFOogFwB2AXZC3jUzgiF3gj/TdfgkAgf/Uyf8Pvv3v8nFS1snb5mJfwDv9U/1If3HRX2hq2GfZ/tv0W8Ylj5//iftmkwCk5cOBW3ZQ/+xjz0N9eZbynF2f/BfwLwnw8X91o9cEyP2W+6tCAGxZnIuJzt5YwO+p/7d+6UPPMM954h23gGo+ssfFWABMA6qngPqmsBbwT7+p9MRD5R/wLxEg8G/JJAHQZIDUIB444WJae7nLsVqAPSxjGewnhkV+/dc/5R8e656nmO+qK1RvEugKcmgg1f5T1T+Bvx/ZQ1UGQM9ERwLMAfISAAJ4iQAe9hjD9WdzQFoAvuAfabzUDCBP7uWGAnu6vQdpeC0htQDsdOoCEaAGgCQAIIh2wGTb2F4hO+tOVwVP65Nn7penzgKzFtDcRgtAQgCQmOA/7T6YkAkYp8AibTRxWlzrSWOd6oYoy7rqyrnuEx70tV8YI5v6Zqp/KuifcrdIAPzyxCHJAPzp5xYRYN9uSwQ4D0aInuzXU+1fyrhcSwtc1Ra4wfPp25/xyA/wnQA0AFoaAWgB+D0AnsdVA+AX7v+OM14xOHQjbCIBJOd9Xgv81QbYhwAgrSr/u4B/QKPgU7vgX8CfUvDvqX9935+T/3vfcdfBvrdw6L46Rn6829/6kJ9EQI8EBzAo8LeNbfsE8tUOqK9+6SYP46SdOJvyJ3xLEoBnXK85yz4gCQDB/k15xy1aAJAAkAUY9lhXhQBgn5fg//XPfOjZR1990/zIix529qovengPkDn1F2CrAcAYEFBPgfS5YQn6q31THhARqQGgJgB+mCQDLDPaDBj/RhAsAW6g748xl5Y8D9oCN8AnPDsB+GC/177qG84w93zvc9ZGP+Id9O4nnNmqK1tvBDhs8pnoDOwkAGBK1AAANDMBMABrTtgB6ExyAXwCdoC6wB07YQB14+sH8Cc9YfipBYDM/CAEyC/BvvfVDzdGEoA0agFYdgYCdVEDQBKAelN/DG2BEfzYXiE7617XOdDZOnWmHC2guYu6uafOnhS3yAAfTpIBagMAGH1YXUNtAEFr9kf/kO96d00EJAngPGn1zdS/A9gHygT+nvzjh13gj1v7mJwiA/woUX6YSCLA/p0ieZwLM4mevSbEknhpgaUFplvAEwyA/DvvfmwP+PO1gPoqgODrV37qzT34Zx2bvsNuoYAon71TsoJ/AOG2BAB1Yg/B++IAOMDkJqCXgFFgSJqWEZxOnfzn6X+SAID/Y7Xxbj1zvFTsHecAf/qXvqLdbdvaH7gF8VW24la/7P+0k1e6M519T5m2+FBj//E/noc8/yUAqtr/eTLgd78H4HOYZzD7KvZT7Cdoy66n3Iscr9O2zJmxDPjn6/7I+577e85+680PPWfwA0xLAEACAKaZ68zVbTUAAN+bwHwF/7rnpFMbQNBP2QX/kgHEQWsB/x94+3et/yGAbwL4bwHgCsgAcMOgHbll6y7RD9kC9AH7VfAcGO8lL3rqfxTcV9CfBAD2N7zuW26b77WsukbvDZNbI+ClATFJAjDIAcwYGpaBz/sxgHUexEx0HvqAcAC7oF8g74m+gJ/4pBPcSwCQB3FMj50wJHlhcJOehwrxcXNf/JC6CTNOfhAQEoA6UCfJjSQALoAEyEU+QWcTbNIXCTTH3jn3lD8l4FGwqRR0JhGQdh9QkAGVCJgCioyfBIlMxmFRZKxlPTvn6T3oKNRwZVmx9/1CXSTLqCf1rX1TvwngdxbUtKCdaz/YHy0pEQDAB/yzyajSjYb+xNWoGYD7GERAo39pQtpsuZYWWFrg+C2wYg0CRKAdkN8G4PSfC/kjb/iLZzzjjl2cOSQAz2nMtqf/fWW6H4G/p/5j4C6BXrUL/JSC0nTnqb9EgKf/C/i/4w6ef/Qj/VGNfVWB/1hfCfhrP+E2bEqSr+Gm8V7KVt6EYezrAYRvmiY9AUD92ZcB4tkz+RyeknwQkLiYSgAMz9KTenbSHnnyD9D/nR962Dnwjxt/PgQI8NcApP0XAOwtYD4H6LfS6SfoH5PGa0m1AQT8yEoCQACAc3itCgn410AC+H0Aw/jgZz1FFk9sGlRL+NYtsGIO0t7gODDdK+/6unOn+4B6jSBft/Itb3rB2fd/39/pDX4z14CtC3tKCVZdYXoD+KfCNKSGDQUmCQA1AGhkADQEAKCeB4AgW/AtqAfEEwfwnRIwT1zTCfIB7OQn4Cc9YfhLKuD2nqQnH4E+dsKJmyQADyf86/cA1ACoWgAMKCct7UC7SJIgbbtBdmLvKwHn1iRAS9Vc4C8Z0AKX+iX4T3slAuprAWw6qzaAY6gSAV0LrQaTdd274Y6QgQ/gLCf2FWaMBGCcsBkYe1Wj9pHtbB+kFPSPnfbrvyYDhq8NNzcevI/YGQkBZSUDKtEzpfFBH4/0r21Gt9iO2JdraYGlBS6gBXiWsw6hHXDv9z3zDJV/iAHm7AXcvr8FX1rnmazheZ123JhNBIAgUnBJfE+RAWyA9haom+Mn8BP4VykgbAH/FgmA2j+byNth80gn88qH/ZLSPqOvIGho5237SSCvnNOfxuF+2JGkVxqekjAM5bOfZ/xjQ/+Mc898jgAYefc/n8u/8eHPWBPxV4IA6D7O6+k/7/rXk3/cEgDEE/wrJQDQDECNHn+AdwLyfUkA8moRAPrnvaqdsgD6KRcEQNUEkACgHoJ8NQD4LgB2tAMI4xUB/gUBYgB8xIeN+YtEwoi7fLh4/ycQ+MvT/QT7gnmBfJUJ8mtYdVcCZ/9Sn14Oq65IvRHYCtwq+KcxaHAJADUAUP8HVLP483AHfGMA3hIAhKsBIAkAEYAfcUgHiCcNBrebBdykJ0/8dBPHB47xLQPxNeRPWu9BHpSBiQmJUTUAqJ9EAHVOEsC2sa1su0F2YucrQZLgCTkKNCvI3PQqQALLOXaBacoWESBAHHstYAIkrrr6ZV1pvGwH3Kd0ZVn7vukKN9k/9lFqalRNAIgZ2rj2CQC95QfoJ8xT/jUJ0IH/tOdmo2kvZEAlAtT6qGSP/UzdMEmMsRka0QQ4pX5cyrK0wG3VAsxRnmMXCf5tYDUBeO5iAIQ863lWIzU+ywGO2JXYBfxsvj3tB6gB2hLIzbUn4BP0kZ/gH3vLJOCvdlX/+dr/sAbaBNdW8r6//absO677oV/tqwr8K6DXXWX2Zw0bc5vGcNyOE6VxlPg7DuxX+nMDidPvASQAOABZawDMJABSA4DnKs9T5ugpagDk3/3x3v8YAcD3ANAAAEQD9jEAa/56kYu9NyAdIAzYhgxIMC4JoMywufYWCaDfpjxQ95cESI0A0gHgWwQA4J86ItEEoG7kg5s5wFoCGUBb4IedvL70r3/Jx/iHlw3j7NquH1tW7AbPMbCZ6vx5kl/B+xw3ZEHGq26w4ZZlvHLRV12J10ZgyyJEY+fJv+C/EgCe/vNwB2QL/gHqgO9KArAAJAnA6T5xTY9dsJ9+2HmoGO4DR38WF+4v8Fdyf9MQTjr8/CCgrwHQ2b7a4CsB1HkLAoB2PNSVYHMSZOZJMyRAAsw89U97BZacNOsHiNSu2niSANglAmCuK0Ac0wbIk+IRoEidT/myfNk32Cf7h4d63ybf89jXjX0TgNcCbGPbHimgF/DrrnKtAeDGQzmlEZBhG8iATf08QgLU9jrlvl3KtrTA0gJHagH+Yo3/f+f5y/NaEkDwj0yQzyZbsJ+nxwJ0gdu2cgz4t8B+9RMYKgGIaefkfzg1dt07UmueRrZ3vfyu73YPhvSaAv61vxKkj4VNxalp6F/i28+GT+VhXMZW7c8Z3wJYsZfhHwB2IQAg3fMjgOwV2Cd1PbzqzCmNo1Wq/6MBANCHBODDfxg1AJCEA4iTAAD0cv3oj//QWgOAcMA2YLkC/ureBNxruIB/TNb46YaUSPBPXdAQoLysS4D4NIJ+7oU/bgA+pAfjCs0ANALwp76SABIB+EEEDP3eieWyBcZAfwL3MXsF9Okes5OXYRAM152cWXUNvTZJALRIgAr+OUUHaPMASPAv8FcCwDG4ie9rAGgApHo/mwMJBPLjYYKfwN374M9igkw7+Zsf9/H+SEkA8sNQBsqvkQiABIAAkARIAiCBDm2VbTfYO3GwiweA5haQSVl4YGBa75v7rvkU8E+wKeBUCjJxSwQgBaqy13lSPKYNQFk3/F2g9Ux5sIY8cEaUkSvLuurc6z7iIe78yT7qT887IoB2SqImCQDaV0KGPqj9Yb8gBf76cdLf+4dsnv4n+K/2IAOqVkB9PaBqA1Bn6h4Ej21Eey3X0gJLC9zGLYC6OIC+ZQBiAvyWFKghBXZzpOnMU2CPWztS8Jcyw8fiQAS8+53feXY7/XVU/r0f+zAu9mGAI/ux9o0gXJnh+iG1Zzh2/avMMOyOD+OlH/Y0OTbsXzU5gtAZm7E823oCgP1NEgAQ9pueu7/5kYf03wCoBEDsK8fue1B/nteUH8OBnwY3z/PuZjd4nnOqr3nWn12dfc8LPu/Bf373X+rfswbI4pYEgBDwJF2Qj+QbJLxDD6AGYAN8NYLsBOKC9/Tb1m4eLTmVl68ESARIUgDqMUkAYH/bO17b/zsAeQL+cQP6qTd5kIYxSVz8IAMwxMGQhngDEXDQPr5qmTHewF0cyqreLygfA/v6t+Lh1/I3jbLGwc18uGrtt015V13ktWHxofGZ+BoXBjpELQBAMoCZk3zANIu/wF2QP3YCTzyBOiBcwA5AF+wL1slXw0MGAgC3dplnJGnynq1ycG/JBML5FgATb4wEgPBIAsA2kSjJthvsnTj4JYhaA0zu78KdANMTZjUBJAEAlWOq5gBMQb5gUymwRCYJUIkASQBPiiUC5mgDhMr4qms560ojYj/ly/JZZuS5PmK8MH/sI9oD0IyhjdCegAig3bKv6C/7xT5QC6CC/h7wDyf+vX0f8D+DDKCv7W/Kn31NPalvIQFWXbvYVqfcn62y9Zsf6oSJsdqKu/gtLbBTC7BO8Gx91F995Xf9d3/kLb+M+e8/4/2/g9FNGJuRq65eTl3f/ra3fEAgliBMkK7flDT9mDSteQrmqzsBf8suMGyFARJ78P+UJ37rTh1/9RKt3ve+932U/ZZ7L/ZjU8A/+ydBufYqjT/mb/gmaf+bT41vuEQQ/Zvgf0a/9s979ss8G7YlAPgGgJqUPEdJTz4DAXCs5+WKZzPrCO+lrx7+sI8BWAXjSIA4YFlwTBzU/z/3T/yB/sv/T3zspz8IcM39Nnt49tFqAvhPAP5dHmEAaNqcC9DvdwC4Z96/vhJAObI8lmsb2QL/6TeWF3EoN22C5DsAYJ5f+7n7e/BeSQBO+gH3pKPO1IU0ECSMQ8kD4piW1wVoT0hRiQC+EcBYuHrLw34l5tnAwWsF/T/49r97TlW/AvYK3AnHT8NJvoZ/AKjxx9z4gwH3q9Vpp151xVsbgS0dgWEQYlgwAMKVBOAEnwcAwL1FAAjuAduCbwkDgDiA3TgsKPiZF/HJOx82PnSqH+lIjyGd4N+8uY9hxCVfJAREJQDUAKDj6ysAtIVtY1tl+3X2Q18+CJD9A4cNIA8d7m8fAbx4gKgJIAEAuExgKahM6WmzfoBIwaYyQWiLCJijDSAItg15EFEH6oIJcGVds+6HbtdD5pflvaWPqGftJ4mAFglAW6plQZ/UPrAvJAKUgv88eWj5Zfhse0cwoA1AWdQK2EQCUGf6d+hX2+iQ7X6svG64QWLj4waATQAGPz7oA1PPWGbsHqsgS77XuwV4ngr2/9Cn/vuzOQZSADKAuXWVWwf1asA1wEwwtqtMcGceAv2UkgBToL4F9Kufp/687886d5X7YYuyr8G/BzAAf9qeNrYPADqa9NOOHAPlNcx4YzLjGwc/xoBu7PhpdDtOHAsV/AM6urZxD9Jqpv5ZzzysrwDwnNz0bJUAgPxnHyABMDxPpu7bKsscvxsCfgEv4JSTbkAoBsAOGDe8JT0Z/7ZnffnZ8575OQ8I8gG0+L3iWX/sQSQGP/82DzDsawD4A5IhAiQAJAHwqyQE5SB+ylbZpvxIP2VaaY1PnQXzlI2xBVgH0FMnwTzkAGCeNqFtMYQZl/jMFTCH9zMe9SYt5ALxSHfdwaeDljmUwH/Th/oqYJcQSODvX/5BJkgoKDP+lJ37XPfvAKy6TugNnYBhAeKhJmhhMywBACBWC4CGAVgDxgXdAm9P4lNKAkgAkA4gbtokAIgjUO8pw/KTRIBxkRjyqfdN8G++3FvmEg2A+goAk6+SALSDAFaAY/uF7KwHvwRQ/UNnGxJAAqBqALSAP4AxiQDBZpU84JIIwA1oldFOTYA8IeYh5ymx7ZhEwAgJcIyH4cE7qMvwXB917l4bgDm1iQSQCFAToJIAtHUP5jsgfk6W0/4+rPht2ohsHT6QAXOIAOfIVSABKCunIi3Qz0MfImDMkIa0ADr6+hiDa8nzerUAIB7AD6CfA/wzjpoBV71F2GvwkUDB2CFkAn7thwL+nhLf+467bqv3/RlnvPPPnom9F99r4MSS9qXPAES+1pHAG7vuBOuCccPGpPFa0jQ1zPLgn3bdSsIoP2MD8C8BwMn/jNN/mqTfi/F8Zy/D3obnOM/uWQRAR6gTNwkAnkHxrOQeB7t4Rgk6lYBPnm2Af06lAa6edBunSsPRBHjpUz/zDAlYBQijUYvBTl5I+gkJwAf4spWnzQHVFfwnCYCdOPX+EgH6V7f+LSmgH5OtNPgZHzttRn0Y757o45YEUFJ/AD1xqLd2yADs5mX5JQLoB9qM/In3hK953P2Mi4MNhBPKiPVf4M8J/RjwF/ArW6CdsAr6Bf/K1um/pEHr3ubZNdlVwSBb9+6qS9EbCQAkAw7Dwib4z9N/Oo2P6HlKD8BO8A+w1gjGCReIA9R9mPBAwU1egHPDDC/Yf616ZjrjIUnPPbwPeVaT96Bs+ZeAkgB+EJB6VhJA4JrtZRt28tiXIHOtat4Cl6qYqwkgCZAnywn0tSMBkTzAkBpPmZX6t4gAHmqYsRNiSQCJAMbZCAmw6hrT+tKuV2USWmbkup+cV4wftSFoi/pKABsC1eztL8kW211pf6xlVeE/prsjAuj/FhFAnexn+pe6x8bmZPqRMrGucaLPxobNUJoxwL/JXw0B1s7hRIfxu1xLC/QtwHwQ/O9KAJD+ujQn7QERADAAmO1jBP2CO8F/PcXfxQ1IZMPI+n1d2n5uPT704X/d78049Rf4C/oB1fhJkAio7U8ATQL2lj39yE/3mCRONcZ1/BCuHWl87I4Py+zrHIB/CJ6uXVYb2qZ/vjN2kwDg2T2LABheAeB5z/OSMcU+KJ6TG24/P5jnEYCzZTh5lgAAfAK6AaOtuPhzEk4cgD+n/UjSJwjGDgAmLnkCZNUw4DsAGPx5jk6RAJSNOLUsgub0b/lluHbB/JQ0bkvSBpSJsZYn+9RR8I9U8yH9iGMaNQq8h+Unf+ykUxsAAuG6fRuAg2S+5r8J1LfAvn4CdAH+JgnJYNqU5KNJIgA/0jC/58+2qxNz1RV1bVjIMJs0AADEEgCA7nrqDvDn1QDU6zW4AdtqASQIJw/zmQP+Af6mwe6lH3mQPwbwLyGglGggPn6o7TDBpr4DUF8FkCCxzbIdO/sxrya4lASowNKT5foqAMASsK8WgCfMFfhXN8Dz3IlxBwIBn8QTpGJvgULKghEcChAlVASKjD/M8CBcdY2ZdaZtTwZAUpiRK8t8jgSgr1AZlAigHSQC7C82BRIBkClJBPR9QLuPnPTbR8pz/TWTEOD/fGelKySAJxq802g/Mybp2wEIr7r2uuz+W6v4e7KfoF+/TSB/m/DUEKAtTqANRobt4n0RLQAx5In+LgSA5MFFlPUi78Gaz6sBfCMggdtcO6BOYAf43AXkt9J4Ojx85X91kW1yCvdiDc8+EGjTxraNJ+cA6WpoU9JDGJgWMJ52wXnLz7CUGQ87+ROurHbTWg/HRy0/4H/mBx15jq12JgCm/wHgYN0OcBRkphRoAszZ/yIB3ALRjJt2wD/PPgAsBED/YcAOzFcCAAALyJcc4B64GQNcuMlLAoDnrnbKgR2pnXJR5ixLljXtGadlJ+4m00qnH+WgXow7DKAeA+gX8DvWqad+SEkA6tuqD+XCH0PdIQEwpEXL8GAD45IyYv/LAWuC8QTdAHOAdwL0tAvUOc0X8HuyT9tiiE/+AnjiGSfzwm5+xM8yEUa5CJ/xbyCX1Jr73XbVJV8bwazgFoCCGdMAANwDogHUnv576l8JgEoEeELfIgIS1AvulYL/VhzKIvgfA/6Cf4kG7k/ZmKT5GsAcDQABK+2W7djZL+ISYK7BJRNLUMkDuwUqW5oAAEVP/pX4pVmfMHeAT/9bAOIABiUDJAHmaAM41mhT6kGbbiABLqKND3EP+6nfLFAn6kYdqWurvwDOSQRwotAiAeiHJAF039IvM0H//HR3nCMH6G+NfU6ZkwSgntT5GKcbczuJdmcztIuK/zZgf05cysCpDGvrsH7MrcYS7xq0AFonf+q/ffKDkgC7SL4dcA2aYrQKzAs2XrxnL2ibkgL/CuAFetV/rhuASBlYw0YLe80DeB+e9qKN6QPaNE/MK+BvuWlH0gmakIDyKgXq1b+6M61p9HOc4G7ZHSst8M/Gv+vO1YwuHSUAOAzZ9Dx1X3TsDwAybllvePYBIHnu+C0AwCZAHjAK2OTZJcidksQHvH/tl332Gf8IgJQAUAJYJRXIF/CPQSWeC7CcBIDgX+Cvm3KRDkl8y0XZtSsF9bqnpHE3yZoHwJyyUQ+wA4ATO+MTg93XHwDulQCQBKBNJABqXXQTTp35RwE0b2hb+m/G2DzJKIzDMSAuGEdWU0E6btqddqG9MZIwKdFaIkwCoOYrwAf4U65KAFgm1v+TbNA9CrXq0p4zPHABKAATwQmLxxgBANgfIwAE/Jyua/QjXWoDCMZboF7grxyLU8E/QH/KAPxN0yIA5nwIkPbSlLbsnBdyCS57EoCyJAkwdrIMCeCJspoAgnolgE67MkmANfAcTqLPPeyCCCCfBIWcavPAUxMgT4khLRhvjL0ZJAB1v0rXub6SCHCeUXdJm0rc0F4tbQDalb451/YHB/uP7POf0gigj9nwTJEA1I26Uu+u01adsT2O2ocQDqr4s2lJMweoZxw2SlPuDNvWnhoCjP2hfY7aNiea+YrnDYa1AONaMJBHJ1rs7YpFvSAAMAD5bQgA3/8n7XZ3vbqxGQO8IgBgE9AB4tJUoI+7+s0B/abhXmwAWT+ubsvtX3JIGME7gJr2wY1pAf1NfqQjH05IkdUI9Kv/vu4cN9nHlFe1f4iOLfqbZ1j/VX3mM89t9jWQ3z0BEHuj1nNaAoA0pCWP4fl4IXsb9ovUtZICFfC23BIA/DOA3wEA6AJQAetf/Jl//Iww0vLcBLxLBhCHC3Ds81iwj1s7adIugcCz1TIJlHUrx/wNVxJvriENgJz7e1FnSQw1HRi/1BESgDpIBgD8MeAhJOkkAMjbMqfEThwM9+LVCQAu/xKw/8y+2BzQqgG4A7rnnvgL/JVToF8iQEk7QQCQFgKg3lNw78k/8VrkBP6/9KOvPRvm5sU22hHvturyXhuBLJKNusCERWmMAADEA6IB2mgA1NN/gb8fBsEtCSABIBAfA/ZOtClJWoyAPrUAKJuq/0qJAeJhtiEA3JjaRrZbtmVnv4jLh4RAamcSgFN/T/6ngL8PsV7Gw20KgAoKkTzwfOhVIkCyYgsSgDa2DS6ivfe5h+U811eSAGxunW9JBECOtLQBUiMAEqA33fuEU/2we9j50/5WPvRtEgC4JX3o59zgMF+6hlx1xjbZp13H0p5T8XeTodwEzhPop32bdJvibgpXQ4BTG9bg6wR+xzqNOlJfTjg0bE41hLFhZa4cefyMFfGQ/jeojySARID/CADIr4awjL8FUDlkuS87rxVrJKr4nMoA6AFzaeaA/Kk4AEI2h4Ma+OqyK3yZ9+cZRXvQXp7+A8QBOQDqepK+CfwbLglAPgJ+pUBf95g0XkpBPhJ/3WlvgX8JADb7W7T3DdYsnmktAoDnYH1euofCn71QPh9Z1y6SAGjVk/uzx2XNVUtAsKwUBPNsxI4GAN8BAPSi+Ys2wLd+6UPP3vGVN854PQAQDOAFIAPiBbKAWb8TINBPKQGQEjt58Cy3PAmY9UPib1j6V7vxNknqSvkoNxcAk/LkvgK7daS+kgK0jQQAdtqglsMyp9TOvTHkDXHCnIAEuAr7Asrou/7ML9ZWTXWnP8Dc8Dzp97T/R3/8h84weeJvGDJP/83H/JEQAoJ/4nOPSgBIGvzKT7357DWvefUbW3PmqvqtuoL3RhCLZBESjLAQCP798r/v//sPAEkA+BoA4B4yIF8DwI7J038Auaf/UwB/blglAiAXBPuCfyR+hEkAUC4mpK8A+CHAbbQAbMtBduJCrzWwFFTah2yWPFFugUk1AQBwPJw0edp/i1/38PJBpqwPunPu0AgQGAJiKwnQ0gbw9I96DYvdqmtZ63tMEHmsDsyyr1/fcO6xkUgSwL4DRGOqNoCkiiQAfy10ru0PoBFw/vRfQmCQQ9/OJQDoz6EfD953tCGgqqXivwlwG86mZhvQb7qWnJuP8TbdG1BM/Zjbwxw41hi96HxXbDjd5MyRbIzoZ55PpbAHH1cl/4M6Kb9kBzIBfstOHID/Vdj4HbShxjPrT2Cf9KQnPZWTarQEIAYAdFMgv4Zx8gupQB7XcH6Nt96GENoEsA5oFlQDpgEg1RBOvLmaAZIAVRNAwJ/Afh+7JAASwoK+t4x+t4D3/hkDjfVkqoXWBID7LJ7RagBAAKz3R91zcm0f9k8SAOx7SM+4O9azcaoSU2GUibWZ9TYNYBkwCpgFPGHY27OPRiPgR170sLPfevNDeyKAZ6NgGMCP8TsApPcEHXANgE5ZwX+6idcC+OknqM+yt+wZT3tKnknc2wtwSf3xw2i37NaDukoC+FFA2mjs9J+ycd+UaaccpGWO8EoA9+76bzXVh5cZxn5vDPwnGNcOUBeU4wcoT/Dvqb7YrhIAkgGSAwB6Tv/NX8l9vBf94hjWL+NhhwDg6trySu0vWn2/6jzXRvDPRMcAQDAV+PPRPwAxwB+AzD8AAPghAOwMQTb+Gv0E4sRNIwGwqwaAoD+lmgC1XFkWwrx3EgCSAJu+AUAb0V62HzLatbNe+CWwXG1DAvAQGiMBeGBpAJU+wJRbA80gAgSuLSIA0CsIznZukAA08lWdkOv+4qFvn22jDQCBojaA7XlMIuDsw4L/m68F9P0ffZokgERPnnDQl4UA2LvvaDsAEcBIEC4jj9RvrhSEK+em2xRPkE+8tLfSGT5VhuuiIQChwQZnDugfi0NbMLZccQGDjDPdi7z9WoB1geczzxFA/S2mU0eFLMCfsTMAr9uvoSZqTLvk6b/AvwXGJQP88JlA2xP/MQkQN00F/rqrbN1fciJlAn/Bf+v0X/C/w3u+awKAtmLfIgHAnkoNAPdQSvdSlQCIPeTez8WJbt0piLnEM/bzPv33n2m+7Vlf3hMASE790QJ4zhPvOHvVFz387KOvfugZBwf3Pff39K8DCIQBw4BWABcX44RnoIAZAJ2GuLiRGsN1A4h5hmBa4Dn9jdeSCfjTznOHe3qBHQD8LWOZlKSjfkjqjgo7dvLMco2Vu8YhnmlpQ0iAU30dAAxZT9QF1kjAdroB/sTHT0COhGxJ/Ahuwz0G/iEBCCP/Fvj33twPuyQDkv7R33hoAUgA8FeoO02gE0m06sqxNgle54B/gL9fykedH0AN8KZDBNt0jEAbKRGARDNAg5tw4pN+HwIgAX+Ww7JkGep9ufecVwDG/gVA4Jbt2tkv4xJQImeTAALIJAHWzHUH7gR5gv4xuQ0ZQP4YQeIYCSARwMNVsuWakgB9nyUR4HyUCKEtMGpxVG0A+3FNBHSaAGgD/Ocf/pSDawTc0tdBAtR+RWNBzQ768VCbHNqHkwkB9D6g3zyQgm42FdpbMtNkOuPW8H3d5qts5QcQpk1oZ9aAy1iEtrnnnFN/N2puyMZIAPw9Hb/zzjufC7gb2mGbIi1xlxZYWmBoAQAxAL11+p8gXPCfElCPAXhz4s5Je4sEUFODuEkwCPrzPpvsgn/ibQv+Of0fnk3b9P+aAOA5XQkAtSpb2pQ8J3lW+3wsz8ZtynChcVmzn/BZDz3TPPqPfGpvR9Uf4A/g9/QfAgAiwH8JUAsAcMzJP6r0GIA0zzWAMUYyQKl/gurqx/PQZ4VSUJ3u6meY0ueMkucK5fMCjHJvygKpAfFB/SA/+O6BYZZVSV3YUwja8RfI572xW8YqM57PQdoREuAJX/O4+7uBsLrQwTBxM8A/4LuCfFXqAdcaT/yJW0/7PahFUk/x3SbwTztz/wTz3o/74I/0mwJJAuCPIT7lxS4BwDjoqn1yBN1EV6yDVp3tnJEAYDMt4KDjALuq/HvyD/iXAOD0n/f6AfCC7wTbrVcAfPdfiboQ6Vvgf1syQBKC/Ly3rxpIOCh3JQA4ZaRtWKgxtpltWNq2c17aJREwiwTIU2RJAJnqlOuHWGgC3AIEt1E3D9AoaJUIANwKGpME4FSP9h5Oa1ZdC1vXKzkhY4RYD+q07re52gBzXguADDivyh+n+Nv0Wx9XTQBll1fXnxI69Cd9SbnoS/uwB+3nPwIYTbDZSt9zYuxpf4J+7C1QvMmPjUeNI8hGSgRUmWEZP+0130O68z7Ya960B+1Ee7FundoJJxtJNjRuZJRsethEsVnkGQPR7Otj1Ilw+gKD3XQpOZHifT0MJ7ybR9YSY2mBpQWyBdjj5Om/4DqBecueJAB2iQBOesmvRQTgR7gkQAL9vEf6V7vl2xX8U9+s/0z7mgAg/RgBkPso7ZADPiNJR3oON7r7nvRehucIgFcCADun/rzzj0nwz36D1wD4RgCAVwJAbYBP/OqHelztB/EE9UjW+jE3eWUYdvx8PgiUW5JnBqYVpp/hPFPI2wt84b14xlAvTNa/Jzu6NsHfuJYXIgGgycV7/NyPe7TKZBlqmfRH+syDBGDunMo3YcCOLfCfABw7wNoT/wT+nvqDDTGAfg04cwr8e/oPwJ86/efegP8WAYBfJQAgQv32w7333XflPsDIerZKI3AVyLIAYZIASBJAIsDXANAEAFRDANA5TA7AtQBcoJ8fAnQzRzw61omVclvwX9NSFsrAppEyIJMMqAQA8SmXmg2QHHPV/2k72zHbtrNf9tUDyrETZR44AGxPkysJoCo3oE6Qz4NLu7LlZ9hsORABgkdJAMGjRAAMO+MTUHzNtAAcK5IAyFu+DfD4xz/+CdTfkwb7EICd2gDZlxIrSAgAza5EwKZ02Yf2H+W074K8mb3JYQynij8P+TQV+E65W0B5U/wE2pUE0E2ctE/lmWHblifTtuxZVu0ZD0IA4E17Dirys/vBQXoIWdX+2eSwSQLws167Rit56BNOPOrj5vAvfPNTfptNFm1PGIYTKTZHnMwAKvg/eebOIcq95LG0wO3SAvX0PwE2IDuBeQX9LTcABX+0AVqaAPiRryRA5l/BfnVn2bCnYQ2YUvvn5J/n6o792j+rea6RB886nsXsYThMUQNA0J+ScOJJkAc5filr8jb1/4rHPOJnIAAE/wDgXvX/6x/aA372CWnQDGDNlgBAsp7z7jUXoM1nOuu5xnVe9yZJnqTJ50ECZp8R+OmvX0qBdZ78gym4P8+VVzzrjz0I2UGd//7XPOzs9c/83Xqj8fCqrh0kAtAMIB115t1/yA/GOBfEB/fy3papSsORhmm3rOSF1ts2/XiMuHwjrgX+68k/wB+QDtin/5EYwD2YrAJ/MeYc8M+4apVB0oH7toB/1QKwzJABrBMSVvQdWobHaL9j5rnqMl8bgSuyRQJABLBRxKRGAB2MgQhgszaHABCIbwL+5DVFAEyF0Sl5MYC4H+A/SYDcVFp2CQCAv+Cf+kF6UFfqTztcEQ0AxxAPkv4B5WsK9PMYiPQUGbBYNQHWYL4D6xX0V/c67panyoDHlvo4D8gxEmAYz9bTel91aX3OkQBztQEgAFokAO3bmxEiYBO4n9OvEAyearixEfxT/uEUetV1kHUc7at+Q9SBVQGsGwSkfhcpBdQtObccpN0Ut8ap7k3pa/hUeX1lgHVtOH0a7Y9DBTAO2MS4caE/WX8hkAH61bBGs3Fiw/PUv/v3PokB+FfTb/w68M/7qdSL8eNma9gYrQ5VhyWfpQWucwuwJwSQA5wB0AL+BPaCcIG6YZviAn7Is2oDoAXAKZvpzX9KJvA33rbgn7Vvj77s91esaUkA8PytBID/ssR+CTvhxPM5yXo1PB/J86Qv6irAFfxPEQC8FsBzqRIAgFZOVQFWgHeeVYBl1vIE+9WdYWN28uKZkSbBc/qn3ecSZaVclA8MQRme98zPeYAPHFJXCACAfm+Gbx64R2IvBREAMUA82sq6U0/qzUXekBVJAliWOWUlTj5LwSuXOXC4/9ipe57+e+pfwT+vV4DbEvyr9s/+YBP4h0jATJ3+EwagT7Cv9kH6VS0AyIB8DYD+Y95fZntve+9Vl+CcaZEALERMcAyLI0YSADAsKAYgs3Gzw9i4Aa7VAAB0C7yngD8NaR6bAH4rHD8Nm8VKIpA3ZaNcGMqCG0aJuAwsXmlonfwn+E8CgDbC2H61XTv3KVyCrP4hNUYCpCaAJAAgTiJA0OjidmwpUOX+lMOHZJIAtv0AWlZdY1vXU2j3Q5TB+vR9l5ocLDr7aAPYvmoDIHcH/7/7CgDfGvj4v7pxZn/lyT9lLn3VbCPiQLbxUZsEsjx8Mek3ZU/QnHbTzPUz/j6yda9WfnPizYnTyrv6kY8mw5IQYG1rdtKenvy1lJssALrrcQX+uFmfWbPZJD3uzS8/+ytve30vsWOSDMBOXfxAVVfMXj2X04A3vOH1/3QYf3uWfkm+tMD1bwH+/rD+S4JkAAAbsA+Qx1QCIIkAQXmVpMMPwJ+vBGDnPobXdC13kgDbgn/2uHv2Zv98Zq0kLzUAJAAA+f7FMocbkgBJALCvgSQfwMSqKw95nvyFFkCqwE8RALwG0BMGnQq8QBgJsQvA4/LfAHguzQH87gmm4vI8qEC6ugXcyHwuUS4MGId7CP4B9Jz6r8E/JEBHAKQWwO/up+44+5V/9nv7cIgD6oxWASRA1pv7Zrm0K7OM1U4cDHnw/L6sgQNWEtgL9j1x1004BqCdp/4A/7FTf9qJvQA4TYA/JiEIIBW4hyr83tuytE7/1Twg3yQByAPgj8H+/vte0Y9Vf9ifgEUuq813ve+qS7g2glikwDYJAIBvEgB0tEQAwNmNmp0k0EbSaXRsC7jTiILzqTg2NpJ8aPT0w46fYeRFWZD617AMh92TAEgSwHrucPpP257S1YPJBJH0M32sOvkUCdCrj3N63AHF/cH/7wLGybziffJNJEBhza/Ew3OLwdH3XRd/hbEP2SxkH471YxI6kjr057pPh36lb/1Y4O8+vOZ/I4D0gn/u6aaGMca6MvQRdZjqnxUPRgysPg/vBLxpT9Ba7XPj1XTp3jePOennxMkyteyZR9pbcVt+Y2noAzYqqOp3fXawy/f+2bA892Xf3JOvrMVjhufD01/0N3+nBf4lASoRAFkACcC9KDhkEieOnXVq7B2sjsfKCALD71/wKoevc1BP/DGQ9QOQuMp17f/Wj3Wja8vVsdpzyXe8BTidB5wjW4YwCQJAeRIBCdKTHEh/05AuXwmAAMA9hwBI4E9+24J/npnjLTA7hHnWj1cJAJ59EAD3//IX/KckACQCBP+E57Pyqo139sUAX4B9nogD9tlDVENcnisSAJyCQwDwLjwXp+GcuvLcAXDX55WAP0/89UOmP/YMmwOkBf+UT9DJK2mo/APee9Df1QFtBsD+OQKgIwEI958Psu68Ros/bcR3A6gf5YPw4ELLgOcwz60s55i9EgC6KT9t1o3HC1/7wYct8C/4BjwLyvPUH8DOs98DYDAbhvZXEj739J/8IPwB+d47Zev03/JIKlQCQCIBWV8D6Duw++Ffh2avGCcQcdWVYW1YeDRzCADYYbQAMABnTnAA2nSYnYXETccCvjXEw+BPp0oSED7nIh5pyYP4ptPfgWTelA27afL+2nk9AeAv+PcVADUdIAIqCWA72W7ZnoO9Eyd1sSj0Dys2kpQ7ASTMNYaHFyppCRzPAcaDkACPnH3i7Gm1JIAPTE+XqQN1CRLgwhe/C+hl+67vP0mA2oeSANmP2ZdsSkZJgCAC1AhQStRUYgC3xAHgn7yzf9gQzT35pw0BMjzABKU+wN0I4K/Rr0rDzaOGV/eceHPikO/ceLUMY+598ptKS5im3puNiQQMcTitP9T4Zt3h/Xw2KmysfuVX/tP6mcHzohrCIWdR9U+wP2Z/4j94/YPEpU5spvgiM2VnjWAN76xXcm3o51A3N9jouUndJOk3ToPYmJX+O/k26EnDruzUgTUBd1eHVanH4jxSC/DRTEC4781XVf0kBDy9J76gvgL9dEsIpB9gH4IuCQfcc0gA89kW/A9j6hAt2D+TeRaTp89enoNzCADV/0k7aCid/PyMRrsBMEYLABKAk3FMgmDIAAkBgDNgGtCPkQBAMi4gALgAxIAyTt6JByD3mcSeoD6zdFcSwP2DkmeCYLlK1lMAt1/U5/5opwn+AfwY6iABoJ9SAoD9UhIA2iFA+tcBBg0AiADqygXxQfmoSwv4p18tu27qQB4HHNvR1eNWsFELcCdwBvwDzAHZAm6e9+I1sGI1kjBzwT95QwB40p/AHztlpBz57r9lEfwrJQF8DYC6pBaAY7XvvOHnKv094KrrzrUREAooBIYMpFT/p6M9FQccA5T5cB6bNMA0nZmdmKBbfzodUA7w5/UAJGmzIbUL7tMt0Ccf7BjSK70P0vtwD+w54ExDGSkHG1IJgAT+Cf7ZTPlKBG0j+KTdsj0HeydO5vKhguwfWPa5fd0Cj1MkAMBPYHg42dYOyO8CAGITZFJu6jA8PFdD/U6m4Q9ckHX/SQJQ72NoAwj+BfhoB2gA+2n+3Ts/pVf7p1/c0OzSLwAWHmBpEsjmw18Aq3QTgJv0+iMNQ1Z3hs2x1/TVvSmPTfE3he9aB/NFaresbpzYZGEn3D7AfqgxDJhjk8LGh/WXNZo1uRoe+PhBAHD6XwkAXgO4+93vPfc6AOBfQx0oP1oArNeHKv9l5MOpPhs82m1Xg6YAayTlZ93g9aHhmXUZVdp4T9Y0xgoEgJvbqIPPso35LBF2aoEb977jrv4UHgIAYC0RkAA9SYAkCATuAv0qBexVCva5F/lBKJg243rqryTsEsE/Ddzvp8YIgDESAM2AN37wcR/xeXlFCYA72B+nFgB2ADKgV/CvhBjwXXiANuAekO3JPUAfQAbww6AWDqATNALKOKxjr05c0/rM8tmWMp9xxnNNyXWVMnAf7gvxwDMK8A+oB+DzzwaC/yolAJCo+wv4U559+I4+D+rPqwQSGoBiLgCl5UO2AH/LL+uCnTgN0nenhWBOIp6vAv0KuAXiLfDPs7/iRdoef6X7A8eA4HxMEo/x0yoPfmogCO6RY3mRj/EyLXXyWwAtEuDd73nPh4bDyDnNd2lxVt2d14bFC8MmQUAo+JcAYFBJAOS/ADCJAdCCfWQaOpENnWAcsoBJjAGYE1cgL9BH6of0YtOoIT/yJvz/397dhVzXnPUBL4UqffBg2zMP2gPbA6E9EU88KFaCYLWxCMUT8YVAe2D1rTY2UYJNJMWKIRU9sjEVQttYsNCSKpiIxEZKkfRDrLUHtSg2UcFaKqUUoQk+Xb/17v/2uueZtfda++P+embD3NfMrPm45pq1Zub/n1nrJjnXlKe+uNQbEkC8tKlXmP4ZWBAaiI0QHdrMteA/BAB7xX7VppP/sf4OIPJSEuBawN9AeawsBMAxEkBfAMH7By/te6z2v1SvtG9eeIQIyPPLFlyP0OmdBuidCJhfD5gInoD/FuznNAYyJoSMsrOYUfc5fYIAyOQdAFqlayZ0EySXyT15WilvG5c8PZnye9dOxbX1rC1rTbo1aY7pl/yRNW0WX+KqreOX59Ibdp//hQWKcgPuW+Bfw8Zn47J+bnf8gX8/aXIt4P+bfuqT84mBfAcAkLyS/vdeTAiTJeCfBZ9FXxaHx9IC0eYyO7ycZ/TeG7W+wh39jAlpk/YiRKYijH3jdwMLfN/f/esfz+4/MA7QB2yT4k4RAa4D5gH1FcCf8uc0ABIg9R7LE/BPT64lK5xQQGg4uuu/Gpgnr2y2eR5Wrvu1ngAA8BEAv/4HX/v/esf/Xc+rctaRZf1yZRVvWtzOrnZOAQQwA/uAPxknDCSba4B3IBsQjjTWm4+E4QokARAGjAF3CIGQAgGF8IRdWmkRAyEVUqbyslYwl3HmIGMJJwzwA53AYPL7yn/a0gL+NqxN4irg7/m1/2CrqY10Y4cASW0w1kXnqmfG98jo35Owy017fF84TLQEtrPj7rr+Y1tS/5m3ueC2JWk9IP0SSG/j3RPul95phID/Nbv/ubdCAJAhM8iQAMY5r6/kFEdwqo2LN9544x330Qfn1rGbMh6cwQsYPEYAWDjYGW/Bv4cHeNZZwHhAuE4FrisAD9CW3oMrTfLIx4A1HD/J5aYhU25ungB+1+jiOld1SNh19XEhJLSDM4ggAZwGyEmANeB/P7EcbDrZ9zH/AiIP/28+xE8PON7/SQDvnpfTANM7VPm3hF4JAFABT4AzE2jZ1dpNhn/OC8S07dCHlQRoTwNYkGRR0r7ewYbAfEsC5JWPyKSpwN89EZd+SF0WQiHGpr5If0TfKar/qwRAJutM2AGkkeIrkI2/5kveGpd0p+RS+W2+WnbPL/3astqyt4Z79USntiyLoiyMYtOelL/fW9tijaEWN8Z+Y7kxuHXG6swD5gJhgL798J941+XXBiRAjwBwP6l3m6aPIzXwb3EX8EsK6yOLZjtgvqGQeSsEtnjOAlift2V4BcN7qICeI4uIgKnFGVMeR+OLFtYliItqB/1qfCnJhvcKFmBTi9oQAAHVIQEqID9GBOS1AOnPJQGUz/VOASAEAvzJ6HkK/E8musV9rsxdJQD+1oe/8iPmxpYACBFAIgYqAWDeVs6NdJyKvd0PKTcfbd9/C8C78XbMWwIgpACw/OVf9kUz0DWWtQ4AjnMNSAbMgzXgCOt2ABBYa12AIcApXXBH1vfKss4HuKU1jwCGOVXw4fd8xfwv/pxmOLbzrx0B/9pqE6sCf3EJxy+PbwHUUwD09EMEZMzWbjYw/xrDW7dEBBgn4Zbb9fZbJVvjVfBvVzzgmMy79rUvAv6D2SKz41+lPjHPB4ynnGNS2hzZr7pkB38N+K/l65dKAiinJReEud/41Adefv5/f+RA5ujP/SsBtxhzLure3ZT7jjN4cSYATudy2f0H/rFKwD9gDCDnIcpDaYc9gF3HpgMD1PMQWqjw61xgPa4F+QHorsevXPlStodbvcKph0z9dddfvuR1XZnCGRTCHmqX9oUE0GZtDwkQcBNbxXatTafwY/65KeMOJIBJSPvWkgDtTvGxXfzj1wrYr8B//28E7f6HAGhPAtRd59foFEDurfQhefhAYJ7l9GWvP9ktxE4lApbIgJAA0nLyKqMF/+rybOgLi3d6TS56Tt7lX0sAADsmwCqXQGoAbkCtcMBvlUl3qUyZPX0SJ8259azJu5QmurXXA/pJ16LnMSndco+tv6JvgVLjrvG654zH2HOTZ36/8nufe4kEyE4/6QSAcV47LHi8IoAkCAngvwHceuffM2bhC5yqy/ywv9/XG2UhZY79W/Rpn8WeBaG5yfxpXqvOPFid+TVOHnbKAhIB4HSEvrAg+tCHfvQnnsAHjHbsG3uwCf/+NMCCFUf0VgtYNPfAfwB2iAAAHLAHzsXVVwD4q3P9HBIgIL9K/oRDACg/ZAHdERgICM6uP4fs2mqLDennudezn/kW0f6DH/+qn+sRAMA/55o0f+17/8L75DOeTHXuNtT7qJLmPwI44u40AKCbnf+eBKwRBXbZgWHOkfuWDEg4u+LGMnFIAYDd+GYNH3AHtHEBcpUcAEBbJ61vECgPMfqRb/nSeZceSA+415Ylpx21fQH6Af6R4jlpEQvaagzWLu3IKQC6GN+0MySINUQAfyszrkfK66O3t7w5rO2A4Rb0B3SHGNAH6Q/zPSwHe8UF8CccmbXBFvCf/u7pZfcfSK/3SNIvydRN/+RDBrQkgLL920OO/5M//d3zvwp0KkCffvYzn/mtN99885237I+tZe+mDAcXABvQEALgGPjvEQAWJhZwgLyO1InCWahYoAT8W7ylk3NjWBgmX+JyQ5BunpQnP6dsC53UQVZSQPqk5U+dIR3oE7BfJZKjupAAiBB2MWCzU7VdteneP4lH/wswO5AA6f8eaAxgbEHi/KG+/TcBDHjHwf7yl+WX8rYEgDDygR50yikAujeg89F3wJUUPPTjOacB0q8tERDQX2XAfwgAtufs/rtn6rPR9EV0XGxyJQCA0oDUJdkDrtL2QLf41km3lL4to00n3Ku/jUudp8pbq0urR6/cNo3FRFzVu+dPXJWLHbbygvvAAsX4DOBnHO7Jz/zij738g//+7nmH7+/87L97yVXwD+gD/AGBFkQAf04JIAF8N2BSzf129Z/FT92RzoJM+7yzbn64pFL5laV9yrbYDcluoShsYYiwzpxGxmVeNA+GBCAtcJUH/EfPt33zV3/KAud73vVdH9w/q5eofuu8L4zvdGebuD3Rc5O+vnWDHlP5QDLgvoYAAL4DxgPu5avAP35A/BISIPW0wD87/xX8q1N9OfIP/Ptg9T3YeV4/OYVoDgTqWwIgwL/u/jspYN40Z+6fvyd7Hxu3gP8QAIA9cNwC5AqWe9fFAd7IAR8YBJQDhEnjH+BsPCMTNjaGEEAKANKts+MfB9TxyxPwD5gf/pvB/lsG9AH+WzIgupPalHQJ94iAAwEwtW1+ZWKvv3YZhx0n900Ac7WxWnyIgMSZG+qcI1ydcfGWBID1JTC9BP5dQwQE/JPBb8FzLfBPONK6YMvRf3UA7GwY8iFkBH2Ac/EAvDTcEvDvxUtfTwIoO0RAwH8r1YsMsJ753V/9yXlcNTbcw1h0sordlOKOM/iEADAYcR7oduc/u/+VAKg75wB1dux1okVJXZAEnGexQkoXcJ+0iReO380jXAF/wjUuJIBr0SFlpC4khXQB/drlvf/WAf6O0+RVAPYICVAJgNae+/AkHv0voIy8Cglw+ccBcxpgL6fj/z0CoH0VIBOp+1hb9pZ/shPqXv8t4k5fViKgkjo9YienASoR0CMDxK0lAC45ARDwD4RWl/gqW8CdcPIFIJtA48+1KnNtjZQv9ayRtZ7419SzNk3KJGsebY5zreqacPK6thS35SbspbV7a7EG/BuLsyAwHrfOxG/CtDhrP/4XIkAbLXoshLiWALjVEUj3tAWW/y5gkWk+s0gLGCXppb09O5yK88zmw3faZXEK/Fvk6pval64LZ55r7cjO5rhKAuiDfBvB/G6eZ2enALTtlH6P4fpMupfvArD5IAEu6xkgGXAO+A+oBtxbl533SMDcSQBEgLQB4aTd+BAB0oUsqKD+lD9kQ+oj1RMds+ufeu+A/7deb7nMOKdzz/OuNbR5NvNrCIB6CiAkgOP/riMApJfPsz9V9aTXK/Mpr/0JAK8EcMBzQHHAv3CcuOyOtzLpA8ArKZAddGPa/EqT15r2DqAPQRB/LxzSwOkD4B8opzN/Bfz8CUfvnF5AdPS+FZA2VyKAX7yy5lcmJt1DYphPgH/EBL/5OOM9aZ7hjPvmGK76E2c8lP5W9xKisAX/CQd8B2QD5ZnrA/6rDOCvceZ/c1d24HuAvBcnPftFhxAAduU5dt0K/Gs9LQmgvLr73xIANRwdkAIwpnn39LByuxS7qeiDq7vYAQoV/FtMAcIc5QOaW+mmRQZYdADYQL1Fic60SBFPti5pXI9LmuRRhnTCOUUQMiFxwjVOfPJlceRGywkFCyttqOA/QJ+Maz8GGAJAJ7JX7FdtOvmf2i/g8SokgJ38EAFLu/qrTwnsCYCWBFhBADzpyfSCG+jQl5UEsMDP823RkYVKdvBznB8J0BIBAf6RSdM7/p/nIgTAfmGzm9oTvRb7pZ4ACDBdKyuArUA3fuUAjplUK1Du1VGvt37pU+5aubWO1Bm9E25lyq3xtY2trknfk2lLrgnzX3AvzlntmAOilQAwFmdcfkVOx/6lB+wD+iORAln8WADRL9dIeW4xwSpTveY58wrHzhZcsZPrwjMonQDBVruxkzbpS3NpwL82t85iUDo6mC9fseGeXHEtJIDy2AsJoC762S3ycbT9c7pV5QdJP29YNCTAeB3gvK7wDQg75QB0JQACstcQAAHxAfjAeQB5CABl53rSr5EV+K8F/wDJLcaABQvP81olAJwAAO5DAuRDgHX337Uc/zdXPgcCwPribV/61pf+60cBQwIEPEdWcGyd2LqWEEg4xEDANADutEDr8loBkF2JgOz6IxHs+HP0DZAH7g9uTwZEZ2lCFADxwpE5PaC9cfJVvUMk1NcAcoohJxaQssZ3Y3XmcrIlAcwVLQlg7jEvuB8X7tezoxGFAfsAdvUHeAf8A/IwYAX3AfyRrsVPmsPMq1t3/wPUszMf8E8nQJys4H8ruZDylQH45zTAFhKgEgL8+w81Lq6Fz+6kFRl3U5qDA2AzeBk0A/6z213f/Q9YjkQI8Fcy4N3f+67f0IkB2unULJoquE8csF4BvDSJC5CXlh8BEBIg17LACQGQ/KT6cxN6zYCT3gKrEgA55q+9aXuVdnXYJjsnbGXA49iw2nTyP7VfBWebSYD6SkBeB0AAXAb+cxLgT80nABAAcXMdzccAOycAHuTheiQdf6c/KxHQIwHYbokICNhvZQiD5FNGiAV1LBAAR81zCQFgsuQCxgJmW5l0FTC3/qQh22vCud6WvRRO+ip75a6NO1aOhUJ0jD41/Ra//NIf7bQVF7/+W7/uN5cAai/ewsEYH2D/t3/nm2d/jv8D2nQjAeMc/5f+7d/xnZ9dodKmJJ4foJlO5iE6W1RafCEcsliLThZhW08BmE+8n68MQN3cpm3Kb13IAPXqb7r07Jg486A5z/worTqcNJiM8EK95rnJv5vck/lZs9TXAdwL5uYn04BHoKgFPfBv999ufXbVI1vwLxwQHmBeQbw44QD9EAEhA4RdS7qaN/6U28roEt0QCim3Hvu3Q3kL8HOiu14YI8x5nidz4TECILv/IQDK+vHJr1mMeyEBAogDkAOKyez8V9AfQqDKgOcq2zyVEAgpAGCrN0SEVxO+5iu/+A+5+fRAeV1BOjrJSwLpMwEwlZHTAMLao21c2iZeeq6SAQH6KbeWLU6+WbdpPDYmIwEQE8A/x2+crgRASADSeMf1CABztnvxxD276bJ+rYA/ILuC7jXgP1gsgD8kgLkqeHArQE96QL/qmB36uvuPXEj6APs1Utsq8A8RcAkJ8P73fuPv2Gi2Xt7UGRcm3k35Z5fdawoEGLQEQHbC63H4eiIgx+YRASEDLJR0bCUBagdbkHAB9RYmAfEWPlwlBKSTXryyuSxoUoZw8qZs19RLF8CfPtIgKUJahMxoCQA3PBfQH2mA52Kz2DA23ctJPMlfgONmEiBfjJ8/DDiBcwRAnN3+NWTAsTQV/KeuHEcHQnOUbj/57ybrP/nJ9Ap30KE/KwlgcsjzHtA+L1o6RECAfgiAhLP7z/bJq6w8GwsEQPTpNi0EQADsKbDqKPapNLluMm1drh0D3klDJl3i2vKWwkmf/D1Zy+9dT9xSWRYF0rgePZI2cTW8xd/trA2R5ghjcMbjANMliQD4ez/+Ay8B/+oA/Cx+svsBHFcCYM+sb9DudFJAM+BfO8whwDd9UjdQzqb0QgBs3ZG2I29BZ+HHTtqVjxqGCGmlNOrV73Rasqd4182RiG/3B0LjqQNmY1glAfivvfA9fXc8zRSAcgX/dfc/IDugu5UVnAe4txLQ7xEBbboaruVWf+qnFz3zakGAf47939P7/r0ON68d/hOAebB3CuCTn/u2P8zH/+rx/7Jm6ZX95OI8gwA3kMwFhAO9wG9AcQXyrT8kgPgK/lt/m6+mXyIGAuoD0kNGkHQLoJeO/toC9BszSaemjJ1Z+8MJf+Mv/cl/3JIBaW/KS31pP+LBPBICgHQKAAFAhlg251Un3phvvmiducf4bh12rRtHOyuwBvprOGAYSDbXLO38u5Ydf/No9efo/zm7/wC9uvP9gZATdtrFAe5AvrLPKV/eHgGg3Wl7yIZ2p39NGBFwzf5a0++7KdE8YBl8AmYp4cbOzrfFVM8hBUICRFYiALi2YHIjhATQ4W4Ai5sA9ID6gP3ILFaE+ZOHvyUAUpZrceLUlTqjh/h69D+kBd17BEAL+tmHi70yAJDs2bgp+OR+AWjzhObe0LYKFgP2AD8gEDAExPOhuIDz7NK3JwEM0OuO///RCQDpc+Rf+eqq4J9O+iWgc7I6/cfvLQvc6dO1RACbZnc/fd0D/xsJgKN9EgIg4DSAVriC/RqftPV64pZkAHKV0ir3mGvLq/mX/DVPLXtNfUm/VIbrp4B/zXuu/2inrbhoPsg4bSyvLuN0Fg0Jv/sj75nBv0UzFyKAnbProf0VFAPE+7F4hVbrkgDmQDO9OEQycqLWGxJAX5xDANBZPgs7tjFHAf/qOEUCSKNe4D46LsnMn+4Di9lb/6eEdRZ+6xSCRTTSxJy7B/GrxnD5LHrjjCHXvgdWtuNJJDOXe+XDIhlwtoveA/8tCVABeesH4sVVMF/9IQJST73W5q1lV+Af8J9df7ojAJAY2uK+ecAOOKyX2HeJAMi//gP+EQTSSb8nADJPP2Azrle1NvnPACEBgGguu+1AMMDdA/CJC9ivoD5xp2TKqPJUHvpkpz479NnxDwlw7D6zBkUOtK8ShAAI8FcHJ75+y6B3CsBYXcF//OYKcyECIPMhfwiAY3pu7eWMFwHWZI78e+8+O+PANcwVVwF+6zdHJY4/a4JzdufloUclAHL8H0AH3qPbJQRAAH9PskHqXAP62zS32LhY6ufddGF2JkrOIMS5gd04IQBIE2yc8BIhgBSoJIB3JS1KAr7rAi8dHsDeyhABPQJAmVzSyKs8C0z+LDTFqTM7/wH/vaP/ITG0obaZLbgK+tkpdouMPRs5BZ/sL5PR5pMAr7wOUE4D/M9/+wUrwf+r/ykAkVCBf3agAdVmIt1NVo/+T7YDrqx47EEe/l1gJXh8wdh9zpZciJ6WCKikQE2TfHlWPBvKRzioc3JVhyn46q8lAFrAWgFx/JFJK8zfylzvyQrecz3lLsmkq3mX/EkbnYQzkZNLddT0bZrkU1bqTT3Xlq/21PYYY3YmedL4nHnAgsH3AULYim8JgJAAFjtZ8Nj9DvgGhI3j2zVbzgGQenc0utKP7gH//h1hDdOHbhZh5szlku9eUY98bGSeanf/Qwak3laqV97ouSSVjUBHlnnWtuh4V+PrhYB9umTxStrJF4egMP8aS6YajR+93wskTQgAcv99g6X0vTJeizj9nZ27+t5/gHlAf2QAOFDOX+UxwN8C/Bo+ls+1OPVFD/oF+AP92fkHTHzDYH9/PGQfznOb+c79bA7MCQBgPx8CrLv/IQCk38+Rz/J+BYgrCQBQIwEAYICbA8wrUK/+U6D92tdDANCxgn/t2PfTyfvMeC5/gH9OAoT0iM7azjb5BgDJ5RSAkwBOBbTrBXM/AoA0XlZ3bQLASaEK/PkzhgT4kwHY5p4QAJGAvvgAfvHVL6/r54JzBAC9KgGQD+/RzfXodW4dyukB/xqXNC24XxO+LwJgN929BxcAWwkAg1cFvvGbPCox0BIBeVUACWDHJx8FtDDR4U4ChAQQ1iEWJFxLANSw6xZZSVeBfwB/ypOOS2cH/Evn2P/sJmKCfnb/K/CnvzaFAEi7A2hio9gsstpz75/Ek//NE9rUCvKqJIDBvZ4KED51IgBxEPDfAv/0j/4oE+mznEyvcFfd6Vf2CglgIeIeb4mAlgyooD/+FvzPi/o9AeD+mVytd7EZSwRAwK+JsPor0G3Bcr221h8gTdY8qbMnk67mjT/XyOhn0jYmIiJN4nG17DZfvSY/J02vnpr3Gn51L3bYxgvG4YzRkcbqjNn8GbvzCkBOAEQGYGt7BcLf8qEffmkM2KjSYnL3sL4xt2R+MX8B/an3V6aPFfpfvwC4uEoAbNDlhfve0X/1ZPe/gn6EAMdOdKikh3pdW0MAyC+duW5q+M3GSG23CAbgOX5jS8/Yxm8L2ArgWz9CAKhXjvTtQtwYVl8FkP8xkBu99j5EHJtlIQ/4Z+ffUfol8A98hwDogf8A+cgK8rf4k78C/4D/AP8K/unvqL82PYQtj9Q5fwfAvU83c2JIgHwMsCUApJO+rFuOFP90LwUQ1+P0dskrCdASAQHJ9ynpAKQ7+p8df5L+W63v9ENOOyAAQgK07eydAkA6hwQgM/9n7o80P5kHewTANcY/GChgP8A/O//AblwP/AfgR2YebcPm+xAA5+z+5/19ekU3OgPdCJS6+0+Hc+qQJ+C+Av6eP+mQEWuAf9LAnVvvsXPS76ZMB2fwMXkG3LbSAMUFDLup4kIGVCLAwiLfAUAAhATI+5NIAKDcIiYLP4uSEAGRlQDI4jDp6rWk17GVXOAP4YAwAPxz3D/6kciKAP+A/0oApP2xC3vFVTs2/in4bH4BbheRAIfXAqZdfGA+DhHAH0IgMt8MyPXf/tcvXrZH/k2wwKqFunu4TKI3W9g+m179I0C+m9p0OBHg3g4R4J7P/R+Af0xKqz/ky7iy7xN15D6avMu/EAAmPOA1Mv6EMyEmPkA31xOO3PJ6gDwm1eSt/tSbCZhMXNJH9vJJC4BxxkZgz/gUlr/qn3IjU2fSKL/WkXqvLdW33GPbr4QEMHYb01tnXjB+LxEAJkxAOx8GDBi/8u7/DMrp5mQCneJSH/mO937n59hb37zz33x01stiDBhdaxnPjTJiF2C+1iGM9EAQmNM4dbVp3EfR8Zh07xkv1+q3JZ1yAXXtz6KU7vye7d5C2ljR7uC3BEAN17LYLuO+dUlNRwdj0Rb9n2NaNgKas3MOTHMB/6cIgArM44+sQF9cDa/xp5zICvzre/50z27/vr8fY1eZ4+bXat13PQKgfvzPdX3j/pdvcs963aKtQHG+B0AiBFpgfJ+Av9YV8I+YAPo5+l4whuy0Md8bUC5yQZ054fDyP/2x+QQEosB/LLAO4JwCsD4AYHMKwFxvLs46gEQAiDMmxhkDzSeXEgDG8gDqnABIOMAfAAaO4S9zTkB+JLCf+Ar8Af5/+S/++X/44D/44D9888033/n2t7/9G7k33njjHd/zru/6oGc9wP6UVH/e/w9ZEfBNP/mjA73OIQCUEWDfA/3i8i8c+WMf9rJe8e8pA/R7Eg71fExjwM1/u6mGgzP49JybPo5iXEgAcokE0JAAbLvs9SSAxa5FTgXnuXF0UF0IBtiTrsVJU68lj3KUyyEYONfUmZ3/AH46Rk8yBEAIjbRNO9N2tqh2qjYs/sn77H4BbvPkZlBgB/ZgG5NYdoHznvjSNwFCApBAP1DfcyEHkua/ffwLXgH/6k6fbAWZz66Hzm/Qnb6dirlDBOjnkAE5FZDnIURAwukPfSKPvO6Vpm9oenSREwKgBbEmuda1aRJeA/bXpFFeBdjV71r0qRNy4iKjU6R46U3wlQgQX9Mkf6Q8rtOhuuSpstWzXjvHT4fzb7FXc5rce2N4xnIS6HZCAsjPzn9PhgQAxN17r9Z2Xoz7V/9kHjG/5PdPfvX/Hl4BCOBESIQAELc/gr6qcqAYuDfHmR9bAkDfA9E5jcA+FfzzyxMCwPXMlz1pJ3iVYhsTee6BbveLHSz9Z/7NSRcLVO3ofXfAWCE+xEHsekoq05hhztb/LZEg/IgA4zyHTmY9OgZuNPvR5OwCSAdY1yP1gH9c4quUJy4AvZVrQP6xNCmv6tcCf/ertdjRhj6Oi3P/upfdi2sIAOmkn9TfTe7e7ouHNJej9AHYVdYTAQHmQHlc4m4hc+zfbjzQ7ug/8H+pnTx/IQGQHeoB+kMARCIJtD8kgPVBewpAXObvuuZoTwEYM6VT9yX6m6cDqBEAPfAPeAfDkVwF+okjP/3pT/8awA/orxmTPfPKX0MAAN+O/IeoqMf/czqBDubDcwmANcC/TRPS4NQHAm0+X9JXW/LupsQHZ6HDJS5hA1PrstjXMZwbjAOcNQCQruC6RwRYEDgNYAFYwXpulN6C5dg16V0PqWB3RJw6erv+donomqP/ZCUAtCftS3tjh9im2it2m+Rz/5mcDhMcG7ALGx0jAXofBwwR4Eg/B+DneL/0rUMo1GP/AZsFYEa3594Ht2pf7Df371TJgQhgY31tcR8yIM9DKyvwL32zm8qr5R9tQyUAAIlMeGTAcOsPmE/6yJr3lD9lnEqX6y3IVmedlOOPzpHJTyYuZSUcmTKkbUF/8qS8Npz4JamOpWttvLRHO+2MixYXJuIlIsB4DoAD1j3gX+OQAMbwM9RYzGKBkgWD+cQi4n/910/Nu++O/VewD4SGANBnwlsWXxbEAe9kBfeAvb4FnDlER3v8X3r1Iw8yf4YE6M2dxs/Fhp95wVgAvFukmuO1ozp9aWcrgH5JB3Z3DSkCvLNl8pyS6u/l2dIXZzZ/KdvOmKh+5AbdOG3bryGW8l0l3jF5gD4f4AvYJgHugP/eCYBTwL+WFf8xoN9eS57UQ0965Ki/EwuAv/vqKsa4n0Lm+dPcp9+tI+srAHb/2xMA2if9pN5ucvK/Fj/PRMA/YJxXA8TxA+J5PQDgDwlAXpMAUF7Af7vzf62OQCRoF1LBaYeWAHDa1ckARMEP/80/N/+LQoQwhwQgjalOAjgVECIg6wPSHG2szHhpDnf/ndsGY0cAfw/8Z4c7+Csy802kOT6gf9Jl8/1tPnAi4BgJoA46tgRAjv9HF5Kex8rqXVM+IqIF99npr/EB/MdOA/ROANznOLebOuKoMznFUSzOxBwXkOxBrgQAQN2SACEC3LzcfCpgOpLvprYA1DF2WuIs/rh0XMI9WfNIbxEE+Ncdfn560YNEAISwsHDsEQBpJ5n2xyYL9puin/WvgrhNrwMskQAhACr4z7+aC+gP8M+X5pEN+kNf7FnE6PWsjX8PjYsdI3dTnTMRwM4WKVyegZ5MGun3faOMlEee/FUCIEA0YJVsXdIsya3APuW0+b78y76oC5h7wJuOJmXMvMmayySt/LQnddU2SZf0riu/uuQ5R7b1binjZMedkcDHuxwDNMFyIQMCXgFtC6BTpwCM62dUfyrLzmIhx/8RAL/+Hz9x5+i9vspuS0C7L+v/2S/5QoTJqvvdc6KNaTPiOmUF2AP+IQEA/Xo9fvHsR+fqsuhJ3M//wi/88lrdThmoXN95bnOf0tc8by5GAgD/ke45NuudAijlxbsz1ltjAM4A/ikSwPUsgpNWPuNVCr21VBed2aTVRZg+rt9KD+Mwgq3+G74A8ABvMrvuPQIAIA84J2u+nj/ln5I1b60/wN9C3riwnz9uZaJblTvPdXRHAFg7tqcA6tf/XZdu39bMk7fS7dGV6zkBjh1/twNOAv+AMMBM5th8CIBrg3/AWx2VgFDvZKxV4/caoyL8QnaQ2pJXXPP9K+1S7/d/4595+eH3fMUf/uQP/OV5DDU3IE7JfBMAsBXO/G0e4oy7GW+Mxe6vNfq1aeSrH9MLERDQH5Brzs78EqyW8Ic+9KM/Yad/KvsqdoQ3j50GoG90JpEBgHnd/aebcA/kn4rTZnavYL/1V9DfXhOO3ehXSQD/ArDtg/sO76YK77h2gR8Q7OaICwlQCQBgGshuiYC8DmCxFkIgRIBFj0VCyABAP8CezHuPZI3XoRZOFhfKyOkC5aq/6lJ3/cXnuH90d50/bUob0+5qj9ZWU/h1+mWiWk0C5JWASgQcA/9Afw/4D/B/b7dZ+pjcxVmocAH6rcz1pJ9kLWcKnp4MQgAErEZmsgtYrmH+pGtl0m2VJtClPD0yoKavfvqECMi7fSbr6BndxYUscE0Z1S3pch/x+kTn3epnjLVYwPQjBEzGFheOEgKR5ot8RKvu/PuXWsZ59+EtdAOWAWdzTBY2AdxkFlvZ/dfPwJ05ZIM+O4S1Osx/7b8XzMLOvWCB1xIA3/RTn3zplQQfJoyOAfs9ycYbdFuVFDinZ1zu25Aa+jAkQE4BrCQAav0vAqzzqkAA/hppEV4Lu4Xf+KeeJaLC/eJZAv6lvYUOymQngDogPjLgvAfCpYlbC/xTHqnMGm79vToRD4771/f7J/V32vCEf/OHAHsEAPDfEgD6an8vZK58wk0/T3XPTEgARMAxMiBf1Qfc6wmBHKVvZUsYZMffTjzgr96AcwAcIXGD+WSHYAjJsHQKIK8fAP8cIsC74zkJYOzkRwQAk/k4oHnB3GMtkDmJH4bZ2iPuxd/41AcOx/2Bf4BVfXHAbI7+m3PiPvrRf/qvvM9/q7HNs4LYrGDdOoEuAH+ICn5OfObA6HgOAaAObe8RAAH9rlfQn3CuR1YigI6IALhzaz9dO/1uKvAVx+BxAcJkwLGFjsksYLq3sx4iwCIuO/E5IZBd+hACeVcfkM+CweIhO0P8WUxIIz2wn7JJ7xuGAKj6VH8IALrHaQO/NqV9aXNsENnYagq+Vr9MVDM4NFiyS+6L3usAwHwlAVoiIEf+s/vfA//6RB3q2g/Qu8nq0eW16oB7aCy7+sW+Ve6m+FOupo9/ynb6FwLABBaQXCV/G94Cgtud/S1516QFfpIu/kgAKZO4idwuKSYf8BfvesBTZMq6RMZeS2VEv6XrxsXTPXe9FJ7vLKARA577lJ5rxoEpzr11s59dDHMPIIuUztf/nUgAxAFPiy9kgFcCzpnItcM8ljnOfzKoJIM+UQenn+o1fgSAkxL5Iciz6GmldlRbXsNwwHhLSuS1BXN1dOBH1Lvv2e0MAqCqO5MB5uq1ZICF8TkL4lrpMb9+RIT0yAiEAD339+zuWDlXvPbCYhm4BuxbgN4D5FsIgBbgL4VTT0gFdQT4IykcNb72PXlFG55T1OE/AWhXTgB4FSBOXNYzzVrmnPqeRR528CpUSwSEDBAPoMflhID4Oc8E6EMKIAZCDiQOuA7or4A/5QX83wq8pm1pB2KiJSuEQxRUEqASAdYJXI63A7nCxrc4Y5C1xH682XR/IL0/+dPfPYNZgBpIBV7VEwKAzM46wh7o39/Hm+o6N3F9JSDgnJ6+V8Dxs49rIcUvIQAQDhXA94C+uKU0S+nFm/vPtcO18+2mAl9xbqI4A1pcQPISCQBwZwc+gL/GhRjINeC95xgI2Afs+bnkiVRWnOstARDwH6KCXuIC+LWhugzO2pq2R3ZsNEW9lr8Z2BkwPfzsw15sd4wEaImAgH/Stbr7n48LZsIECtSzH6R3k9VvCgBey17tNzog/hzZL3Eh1nPYIwEqOG1JANcCcsmA/MTVvK0/aRPfhoGuNi5pI3snAnKtygrqgf6cXKJnrlVZ8/K71sYdC69pf1tmzZPdyoWuevbRFhpAc3ay//4v/fjhdYQQAAG/wNY5BjFmyute4CoBECAdAsCiriUAhH0TAEHhhJxfFj0B35EIjXN0XMpj/kz7W73sSFUCgA1DAFioXnFH/oV5QXnu1x4ATxyAPrVlt9Sec+PnealTd4763+fiuLbBUXoguwX/Aes9cA6gB6zneiuTf0nW9CmrB/zN5VXfZ+I3R86nI+t6yBomzhznmvtmv5bJvPpMTHB+M9jFs1xfDainAgL4SWA5AD6gPsTAkgzADhAP8L/ieNRtvHZpR3b5ERO+BVCJAK8F/O5P/4kDCZBXAcgeCYBM9V0aP4DXXJ6xzsbCpIj7avXvfe973/f97q/+5Evf38g79UiACv6BVoDYB/0A/9WFXzmhsS0nBelkJ53OOV6PpMi8F/BPnnMCQD0VxMcfQiRhUhwZMiDhyJqW/6HmhqXu2E0XXnEBv5EZ2IC9AGeLAS4gm6yAP6A7YLxeC5AnpathpECAfwgCYL+WU8PSVAKg6sMfHeXnp3/IjCq1kUub95NVa5vJXK/tL5PWYcJjI5NaSIAQAd7fz38IyGmA7Pa3srf7rxx9oWwPTDNpbhrkXtveuqzhsXHt81N+NSbf5tr1dxb1LcgFUuNcq6C1TXsKvLfpW0Cc60vxuV5lJQR6+cRxQBL2PuHIWpa4Gl7jP2aPY/mTD5AyLm7utGeWwX++sIiwcABgf/S/fPjwHwmcAgggB8D388NZFnDKwWLAqTegP2AauA74J5fAtjyOUn/mF39s/uBbFj5V0t8zdZaCnUzam/bTlw5OSOQDhT5WGOIkeiAA3O8Wqbe4v8wN5vRjR/DNIZ3mnB2lvF59yIZr17VVSTZGAJwC6gHpVVYQf44/ZVXg7zSCHf9LnpWtNniA9PO8aI2inZ65uk7OGjNrmUm/3eTOnicfoH33VqXn2T0cQgBYD4Cv4D8kQJX1On9LGAT4Gy/uy/5IjY9904v5FQevH/ROAIQUQBDQ2UcB8zpAJQKMo9YPlQTwypywzQU4aEtHuR8//39+++W//8QPH4A0MF3Bf0As8H1fNjvWBh8JtcufkwohAJwAANpDhN+SADBvxy4B9wH/CVdZrxkLjrXvoa7tpopfcQazOINaBrY6uHmY4gK8A9RDCCQcmVMC2cEXHz8ZQE+GGKiAP+VEKq8SANEn0oDCRT9+bUibqkx7yY5NpqjxmywQIDh/MI6tDCa5P0IC2M0/RQTU3f/60b/0TybNhgAYnfBwFmgXLm34Gpq90P8tGRACIKD1lAR8t5IBFci3wPnYtaW0LZgHoEziAf6R8rdp2zJ74digvbYUL51rcWXH/xb9eI174d7LsGsOyLYEgG8RIAGA3/2C6CLdlOGk2xIBoK/UV12IAt+/AbKBLjscAdzRm7z27j+Am/rdw15ncQLBqxDinWSIHlmIIQDc804A7OfUi2y2kHl+PcB40QPmxpKFfFujX5jj2lMH2matMRW221rgtdNrKwCe/wLQIwIquHe9hrf6A/rJFvg75WL+vnYbH2l5xs8730iq68qFdcwYc0935nzax5rdM+YZ57xe44g9gF1JgPjFu85JL+8Nx5/FVqgbAcAB915TQALUUwAhBcT5XkFOKgT8k0gB/y6QyyYCoA7A/8H/+OV5B1pbFxXpXHCCTF67/wHUgG0lAJB3U9ZdJ/uDRHmOAH1ERV4B4Ae484qCOegWBADbxKkvJEBkQH8Af2TirzgP3cT2OvkV56GJy4CmIVyAdaSHLCCbv4YTX0F7PSHAnzDQH/AP+OeUQCUUUl7ipA9JEH2qjM7SixeeJ/OpfWlX2rkfKFpbTOYZv70FTFxxh38f5+FkS7btkQD1RECAf7v7jzSQN/0zJs5He8/d2+LFPWAiBUACXI8B3IDhNWm2EgQpe60MqI8EhrgA/8S3cm35SZe2RiY+MvEkx5bGwUd7dz2sYi+8F2mB5AQAAJ4PEfKbj66lnpMATrtVkK/P3A92/9u6hREGAH7ANlmBf/xOM1xLTwTs13/r1/0moK9+pxPcRz/08z9yeEXBaYbo5D8pWIT5wOEM/qcTJtfS5Ug5ByIASEcGuM/38/mRbKsuvbCe0ZYcuSWFgRHPkrlvT1SvKvAWieyQOQEAjFcwX4mAxCcuYbIC+jV+9QT4q/dnPvbB+V/5vYZjy2E9ZBebq+tJ4bGJcYs7fi5z/gbD5Nvt3b2tTebaj/zR58A/4O91AKcAeuA/JEDIAWm90pDTAGQcEuBb/sqfnzcSEMH+U42PA8I/R1S5c8m/6fMagWcc+A+IDvh/zP+OE+AG/rlKXLTAPyTAua8AVGDPzwXUJxxwX9MmLtKrGuaGOx3wiAO7Sbc7rg5kGhKQF1BNGvA5k2T8CffIgBABAfIJk27kAHr+APukjUy5JPIg6YSjU9UxetNLvHBtW/xt+6fw+PUtcJj0DHSZ9GJnQL4SAfVEQE4GRNZ3/ysBoE/K5Lmb1EidfY1G7LO2gHuhRwZUgAtAJRwAHLkW8CcdIBZ/gFkNrzkVUNPQi1NuC/oTjq7HZNoX2Uuba2TcOOq/7vEwR/jYEVD73o994LAL/7Zv/upPTSVcdYFpvLRbGpLhJ37pq//zP/qRr/18wlUiAOyqZ4c9YL+VN/jy/4sQAIgJwBcJUE8v+KhhCIAsxrwWEJC8zvJXSTUDgjJvXFwoElI7Kvivftc4zxdCwPpiqnR3ccUbC1CvkyUWxiECLPID9qvsAf8A+kgf71tyFrjuW7uE6lT3QxMgG811zeRZl5CHf6XLHnub7Kb4pLlmvaOsR24BpxEQADni75sAp0gARIB0SACAv54CaIkA7/5zMNAaUxgXgX+nB7yiEyAN/HumzX1rynmoNMgJ7/8jLThjXY7/mxe9FmH+IYXPIQC8ZhB7BOxXyU4B/SEFAvgTL0zXyU67h7LVufVS+OACjCMtWKoz8HNunIDrGhZXwTp/BfHxkyEAgPl6KsC1toyEle960ouPTpE9fcVpk7ambbXdxT95x69jgUxoh0nP4MKW7WmAlggIGRDgHxnSQL+lf5Q51b2bXK2vo86Iep0s4D7zrNeTAYBwD/j2APIt4irY7wH6APEeAbBGn7StTZv4nhQ3dvzPezKMPZk79nPFeQWdyAUkAO0AlUVZBf3xA//v/sh77oDsFvgLIy6m6nYnqtx6+cXbv+M7P+sEgHsP2HVf5ZUA3wGo4D/++bTLl3zhS/PB1gofU3r3QAX8p/zsgwjYz1333hT3k/uoAv7WHwIAQZBdfN+V4JAH2dF3T1rIAvnWWmyxb5f5ePzuWqCuUXbTJa7GDZtNBnmdfp4Z/40AAWBnP68CIAGqq6cA4vdKgNcavuYrv3h+BaCC/+r3fQD1rLGrf92HAPDxPwAaAQC0esb3ZNWaYh4sjXEoBADdAe0c/w8xHhLgVgRASwbQoRIBxkxr0wcz0hUq3k1l3HEByVVmcUQGtMUf8E26OeMC3ElxNVyBfD0VkLQpo0rlu570yqi6RMfoHf3I/aLuTjubdk/B8TthgUxwuynd4T24SgLoj4D7gP1W5nr6Tn79cwmD7j7Rz5NeY+I90YlP+bJ7RF9bdFcQzB/XguY2XHf222vHwsB8L28vPrqFHGjlsXp611Jeey1tBvw9T0+5b18z3XfGqzfeeOMdCAFgHhDzKgLwLxznNYVKAPgCv/f+bwW2EQA5/g/gOgkA+PsQID0C+kkLLycVHMN3YucZ9OHOs3QK+LfXH5IEcBzftwDq9wCA/uzukwH7yIID0N/v6I958+y7NuuhVp5d4Mj4tC2QjwHa1fcaQAgBJwMqCQDwc4nLKwFIg7d96R9/6eh/gH+kuLVzvLkhu//+9R8gDbxaez8VC2sD4J8TAHbqM+dk19/8w4UIcELglDOvIkHMu0iGrjM27p20bFed4/6w6GTLZ4M3dlNj7rgA6SpNFpy4+CPdnNVV8N76WyAPzHPiaxk9v3RIgJYAqHrGH92E2/aV8OQdv5UWqJPd4bsA7OuBZe/0WYB+T0pT+8ZOQ4cAWP1wORXiofSRSH73UbMrMxMW4ujpfsyDL624qf27lTYYyR6BBfTl3M8TGeBIbsDwElhuwXMv3AP4vXS9uAryo4O4Gt/LV+OSL9K1nl8cN3b8H8GNeB0VdsYg7/P7XgBnfMyYmGvi9uPa6rFxq3rGTx+gAv7du3b/553/3/ucNeXL3//93z+QABZfz/Dr7/MHyYwtni/kBsceLfBP2DVz2lZbX5revIsAQB4F5PvY1wHkl918aff306XVjvzDAsMCHQsYm/1nAgQA8I8E4OecDAD6kQHVtWSAtF4JyGsBXg1wMsDY36myG4U0Nlbb/Qf+n8quf20MWyIAOMf/HdcP4EcEBPRXMqAH/gP4rff36/xazSo/XWa8sCcF9nhyVd6nlGg3KXvHaegx56ZsXQDgMQmABfQH+Jtwxffy1TqkawmAno5pS72WuEmO3/kWWCQB2NpDpr96/Zi49Kf0Hq4sdCeVatmrNVQuAqCydL68nX8zSQrH+aiK4z1YRY5fGotf9+Bej9X1j4QPboGde8BOXMiACqyP+U+B/mPX66sA6kjagPYt4L+nY8rJtQr8tffBrT4U2GQBwN5CYsp0MwC/SaFO4plgnz5gCdwiAnL8338B8L+pffgvpwAsrjpFPLeo+dVB84K1R75NghQIAcD/EM+jubMS7O4teu4Xurvn1hGjPcMCj90CxgevAADyCAC7+iEAkABxlQSIP2RAJQGcCEAArG23Zx/49+6/3fP9enZt9keTzngaAsC/Aczuf93xDwkQYiDfATAv2eF/iDH50RjwTEV2U76uA9ZyrYLq6g+w60mdEeemDAHAH+d6L2+NkyZ5k77qEB2rrLrv4ycxfhdaIGB9N5Vz5zQAe4cIqH0Xv2vSBPx3CACqbVokA/AIAOA+rhICrb+mQQJgD0nxPk5psUeJ8XtyFpj/jVfIgIDnyIDqyMSvlQH1NX3iInMt4cjEt/KULhX47xf3T65ThsKzBeaj/5Nv09h2n7YzRnun38f/fI8gBICP//kSdcA/idC4T90eU13mLusWC35uv8Z4TCoOXS60gD6+Ur++UNaF6ozsT8QCXgVwAiCnAJwKyGmAYwQAIsB1+eRxCsC3AZS3tuleD0MAOBX0lO85GC8EgPfuA/JJc0/Afz0B4LsHr/OctPYeWZtuNyU86gyOPRegtyQB9+z4m0SF43p5ah2uy+sGqQTAKV2b61Nw/C60QAiAyMNXcQ08XO231u864N8B/2ctjt0PLchvCYGAfrK9JlxPBQj7V2DusQvtNLI/nAVe6L95gT69JlCB9zHQnZ38mr76XT8F6pNeurjERfZ0SFyV4x3/h7uB7qHmedyc6jlr3LuFfk5CAf9xdv8r8Of3L6ZuUfcoc1jgsVjAfwO50kbAi/3/Wn8sTRt63NYCO+A93wFwCkAYqHc6AMjPrn+V4nNyQFrgn7SZsUZda+qf+cQnfvY5jM2elxAANudCAFTAL87rDnb74Ys1Nhpp1ltgNyVd7VqA14YBd3GkRXkL/CuYb/O2YWkNzDXPFl2ntON3PQuEAIjcTUW/QgaEFOgAf+mTd/KetxB2X/lKqn+V8u53v+vz73//+1/mtQD/5gugjwsRIBx/pLgQAQYeH7lCBLhfz9VNo8bv4S1g9xwZAFAHYAeMb5EV/NfXAKpfeUkXuVRHdKmS38Q/dvwf/r55DTXY/eDHv+rn/GcCJMBHf+mf3SEALLqM46+hXUaTXyMLWE8gwy5tsjHcGuTSckb+p2MBmAXoB/4D5oUTl9cCyOpyakC+EADWtmtaXjbT1iR/1GlCAHiNIV//RzyHCPj0pz/9az6i+6gb8UyU203t4Px2a1wL2NtwSIAAeOG4Nm0bVr+4EAjyCZ/Qa7p8R3fh8buuBQLiI3dT8adc0pJ+kW+FNv5FCv3FL//TP+s9cO+v/tVv+IZXCIHs/gP6lRgIAVCl63k9ABHgNYP9jsBFem5s1kh+AwsYN7aQAadOBbTgPqCfjL9NE8Bf48UhKOh3g2aPIocFVlnA3IwEeO/HPvDS8X//AcB/IPBBqUFKrTLhSPTELeBbUzYUyKkpZ835xnHrCJsIT9wcQ/2NFtD32flHAlQiAMDPCYH6uoD4Shqs3f3fqNqjT44A8AHD9vi/jwG++eab75wacNbz+Ogb/kQU3E16rnYB8fLwezBalzRLsq1P/hAI8rTX9+FJ3PntphA3fte3QB5I8lx3Fa0woe4NYB3IM4giBkIIfPu3f9t8SsBHAZ0SqKRAe0og13IqACGACPDKwdgFu0p3PXghxg/3yqUnAyqQ5w/wj2yvJwz0Z8ffuPbgBhkKDAu8ZYEXxjiA3325B/4Z54eNhgWevQWAf8QXEG/OX/MMWH/YoEKWIc+e4lfYn33H3lMDrUORAHbzI6u/JQLy4UBp9u/+v5bjLcIMAeAU7m999jPzh2d932Dqtt09dd2oZqUFdMhqZ7FtMcH1wP7aslJOytjnm8T4PbAFMmCtJQHuTd0QAyZyR/u845fXBkIK/ND3v/vw6kDIADInA/iRAcL5t4P71wPurR2jottZIIs3pFFvhz6gPcf9A+7J9pRAvZZ8rQzwH2TS7fp0lDwsMCwwLHCuBYB+O5JOASIDchoQSKnOxoBNBWQBB/gDgOfWO/I9Dwu4f3zNHwGw5HI9pwReZ/Cv1xFvjv/n2P847v90noXdpOpRF9Dek6fy1ushEUrc5B2/R2KBSgRQaSn8oOoCXgC8kwJOCXAhBXxLYIkQ8I0BLv89wALB/figjRmVX9UC7o2cDPBaSQvee+EW9Lfh5Anw3+8oXVXvUdiwwLDAsMCwwNUtMP+HGWAk/xccyOfM/+LMF3vQv7t67aPAJ2sBa8N5bblAAiAA4qxFn2xDr6i45woBMMD/FY36AEXtpjrvuAr822tbwimn5Jm84zcscJEFXrivKinw9d/6db/pXUCnBIB+u/+kcE4EeDWAM2jtTwTsLtJiZH5sFtjpVycD1pABLfBPWF5ljB3/x9a9Q59hgWGBYYFhgWGB21nAvF9fTwX245BH1p63q/1plWy95Qv/TmU+Lc2HtscssJsuXuqUP5exf2BSnvjxGxa4tgVm5t8ADbzl1QEnBRAB+ZZA/uuAVwQQA3YFxhHAa3fF4yhvDRkQ0B/p3hmT2ePov6HFsMCwwLDAsMCwwLDAsMCwwP1ZYDdVdcqt1aYtZ22+kW5Y4CILONLlWwL1tYF8R8CrA0iBfDhwnAq4yNSPPfMLJE97MgDo5+z4Y/jHjv9j78ah37DAsMCwwLDAsMCwwLDAsMAtLbCbCl9yW+ut5WzNO9IPC1zDAndeG6inBJABORlAOkVwjQpHGY/TAt7pnwH/tNtPTlruHqemQ6thgWGBYYFhgWGBYYFhgWGBYYH7s8Buqoq7xm83FRJ3jfJGGcMCV7FAfd8LKeC0gNcHrlL4KGRYYFhgWGBYYFhgWGBYYFhgWGBYYFjgNbXA7jVt92j2sMCwwLDAsMCwwLDAsMCwwLDAsMCwwLDAsMCwwLDAsMCwwLDAsMCwwLDAsMCwwLDAsMCwwLDAsMCwwLDAsMCwwLDAsMCwwLDAsMCwwLDAsMCwwLDAsMCwwJOywP8HgrJ4TtAleBkAAAAASUVORK5CYII="]}]
DragonBones Name
Armature Name
Skin Name
Animation Name
X 1.00
Background Color
Show Grid
Show Bone