[{"data":"REJEVAAAAAFk1QAAeyJmcmFtZVJhdGUiOjMwLCJuYW1lIjoibWVsbG93ZHJhZ29uX2RhcmtfMDMiLCJzdGFnZSI6ImFybWF0dXJlTmFtZSIsInZlcnNpb24iOiI1LjUiLCJjb21wYXRpYmxlVmVyc2lvbiI6IjUuNSIsImFybWF0dXJlIjpbeyJ0eXBlIjoiQXJtYXR1cmUiLCJmcmFtZVJhdGUiOjMwLCJuYW1lIjoiYXJtYXR1cmVOYW1lIiwiYWFiYiI6eyJ4IjotMjQxLjMyLCJ5IjotMzI5LjQxLCJ3aWR0aCI6MTA0MS4zMywiaGVpZ2h0Ijo2MjEuMzh9LCJib25lIjpbeyJuYW1lIjoicm9vdCIsInRyYW5zZm9ybSI6eyJzY1giOjAuOCwic2NZIjowLjh9fSx7Im5hbWUiOiJhdHRhY2siLCJwYXJlbnQiOiJyb290IiwidHJhbnNmb3JtIjp7IngiOjMxNy44OCwieSI6LTEyOC43M319LHsibmFtZSI6ImJvbmUiLCJwYXJlbnQiOiJyb290IiwidHJhbnNmb3JtIjp7IngiOjM4Mi42MSwieSI6LTI1OS45N319LHsibmFtZSI6ImJ1dHRvbl9idXR0b24iLCJwYXJlbnQiOiJyb290IiwidHJhbnNmb3JtIjp7IngiOjI3LjkxLCJ5IjoxMzYuMTYsInNjWCI6MS42LCJzY1kiOjEuNn19LHsibmFtZSI6ImVmZmVjdCIsInBhcmVudCI6InJvb3QiLCJ0cmFuc2Zvcm0iOnsieCI6NDU0LjE5LCJ5IjotOTcuMTZ9fSx7Imxlbmd0aCI6NTMsIm5hbWUiOiJlZmZlY3RfYmx1ZSIsInBhcmVudCI6InJvb3QiLCJ0cmFuc2Zvcm0iOnsieCI6MTQuMDQsInkiOi0yNzcuOTYsInNrWCI6Mi4yNSwic2tZIjoyLjI1fX0seyJsZW5ndGgiOjUyLCJuYW1lIjoiZWZmZWN0X2JvdHRvbV8xIiwicGFyZW50Ijoicm9vdCIsInRyYW5zZm9ybSI6eyJ4Ijo1LjY5LCJ5IjoyNzIuNTMsInNrWCI6LTkxLjM2LCJza1kiOi05MS4zNn19LHsibGVuZ3RoIjo1MiwibmFtZSI6ImVmZmVjdF9ib3R0b21fMiIsInBhcmVudCI6InJvb3QiLCJ0cmFuc2Zvcm0iOnsieCI6NS42OSwieSI6MjYwLjQzLCJza1giOi05MS4zNiwic2tZIjotOTEuMzYsInNjWCI6MC42NzcsInNjWSI6MC42Nzd9fSx7Imxlbmd0aCI6NjAsIm5hbWUiOiJlZmZlY3RfZG93bl8xIiwicGFyZW50Ijoicm9vdCIsInRyYW5zZm9ybSI6eyJ4IjotMC45NCwieSI6OTIuMzksInNrWCI6OTIuNzIsInNrWSI6OTIuNzJ9fSx7Imxlbmd0aCI6NjAsIm5hbWUiOiJlZmZlY3RfZG93bl8yIiwicGFyZW50Ijoicm9vdCIsInRyYW5zZm9ybSI6eyJ4IjotMC45NCwieSI6NzIuMjgsInNrWCI6OTIuNzIsInNrWSI6OTIuNzIsInNjWCI6MC43MzYsInNjWSI6MC43MzZ9fSx7Im5hbWUiOiJoaXAiLCJwYXJlbnQiOiJyb290IiwidHJhbnNmb3JtIjp7IngiOjQ2LjMyLCJ5IjotMTYuNjZ9fSx7Im5hbWUiOiJsZWdfbCIsInBhcmVudCI6InJvb3QiLCJ0cmFuc2Zvcm0iOnsieCI6Ny45MywieSI6MzguODR9fSx7Im5hbWUiOiJsZWdfciIsInBhcmVudCI6InJvb3QiLCJ0cmFuc2Zvcm0iOnsieCI6LTQuODcsInkiOjEuNTF9fSx7Im5hbWUiOiJtZWxsb3dkcmFnb25fZGFya18wM19yb2NrZXRfMDEiLCJwYXJlbnQiOiJyb290IiwidHJhbnNmb3JtIjp7IngiOi0xNDUuODEsInkiOi0xNDMuMn19LHsibmFtZSI6Im1lbGxvd2RyYWdvbl9kYXJrXzAzX3JvY2tldF8wMiIsInBhcmVudCI6InJvb3QiLCJ0cmFuc2Zvcm0iOnsieCI6MTcyLjgyLCJ5IjotMTI5LjA3fX0seyJuYW1lIjoibWVsbG93ZHJhZ29uX2RhcmtfMDNfcm9ja2V0XzAzIiwicGFyZW50Ijoicm9vdCIsInRyYW5zZm9ybSI6eyJ4IjotMi42LCJ5Ijo1MS44N319LHsibmFtZSI6ImFycm93IiwicGFyZW50IjoiYnV0dG9uX2J1dHRvbiIsInRyYW5zZm9ybSI6eyJ4IjoyNi45LCJ5Ijo0MS4yMSwic2tYIjoxODAsInNrWSI6MTgwfX0seyJuYW1lIjoiYXJyb3cyIiwicGFyZW50IjoiYnV0dG9uX2J1dHRvbiIsInRyYW5zZm9ybSI6eyJ4IjotMzAuMTUsInkiOjQxLjIxLCJza1giOjkwLCJza1kiOjkwfX0seyJuYW1lIjoiYXJyb3czIiwicGFyZW50IjoiYnV0dG9uX2J1dHRvbiIsInRyYW5zZm9ybSI6eyJ4IjotOTAuMDQsInkiOjQxLjIxfX0seyJsZW5ndGgiOjIzLCJuYW1lIjoiYm9uZTQ5IiwicGFyZW50IjoibWVsbG93ZHJhZ29uX2RhcmtfMDNfcm9ja2V0XzAzIiwidHJhbnNmb3JtIjp7IngiOjk3LjgsInkiOjMzLjA2LCJza1giOjkxLjgsInNrWSI6OTEuOH19LHsibmFtZSI6ImJ1dHRvbiIsInBhcmVudCI6ImJ1dHRvbl9idXR0b24iLCJ0cmFuc2Zvcm0iOnsieCI6OTAuMDksInkiOjQxLjIxfX0seyJuYW1lIjoiZWZmZWN0XzAyIiwicGFyZW50IjoiZWZmZWN0IiwidHJhbnNmb3JtIjp7IngiOi0xLjk3LCJ5IjoyNi40OX19LHsibmFtZSI6ImVmZmVjdF8wMyIsInBhcmVudCI6ImVmZmVjdCIsInRyYW5zZm9ybSI6eyJ4IjotMC43MywieSI6MjUuMn19LHsibmFtZSI6ImVmZmVjdF8wNCIsInBhcmVudCI6ImVmZmVjdCIsInRyYW5zZm9ybSI6eyJ4IjotMS40OCwieSI6MjQuNjR9fSx7Imxlbmd0aCI6MTAsIm5hbWUiOiJlZmZlY3RfMDRfMDEiLCJwYXJlbnQiOiJib25lIiwidHJhbnNmb3JtIjp7IngiOi0xMDIuOCwieSI6LTAuMzgsInNrWCI6LTE3NC41NSwic2tZIjotMTc0LjU1fX0seyJsZW5ndGgiOjU1LCJuYW1lIjoiZWZmZWN0X2ZpcmUiLCJwYXJlbnQiOiJlZmZlY3QiLCJ0cmFuc2Zvcm0iOnsieCI6LTM2LjEyLCJ5IjoyNy44Niwic2tYIjoxLjE0LCJza1kiOjEuMTR9fSx7Im5hbWUiOiJlZmZlY3RfbGlnaHQzIiwicGFyZW50IjoiZWZmZWN0IiwidHJhbnNmb3JtIjp7IngiOi00LjE0LCJ5IjoyNi4xNn19LHsibGVuZ3RoIjozNywibmFtZSI6ImVmZmVjdF9saWdodGR1c3QzIiwicGFyZW50IjoiZWZmZWN0IiwidHJhbnNmb3JtIjp7IngiOjQuNzMsInkiOjIxLjU0LCJza1giOi0xMC4wNSwic2tZIjotMTAuMDUsInNjWCI6MC43ODMsInNjWSI6MC43ODN9fSx7Im5hbWUiOiJlZmZlY3RfcmVkIiwicGFyZW50IjoiZWZmZWN0IiwidHJhbnNmb3JtIjp7IngiOjUuMTksInkiOjI2Ljg4fX0seyJsZW5ndGgiOjU3LCJuYW1lIjoibGlnaHRpbmciLCJwYXJlbnQiOiJib25lIiwidHJhbnNmb3JtIjp7IngiOjE1My4xMSwieSI6NTcuMDQsInNrWCI6LTg5LjA5LCJza1kiOi04OS4wOSwic2NYIjowLjM0Niwic2NZIjowLjM0Nn19LHsibGVuZ3RoIjo1OSwibmFtZSI6Im1lbGxvd2RyYWdvbl9kYXJrXzAzX2JvZHlfMDEiLCJwYXJlbnQiOiJoaXAiLCJ0cmFuc2Zvcm0iOnsieCI6NC4yLCJ5IjotNS42LCJza1giOi02OC4xMiwic2tZIjotNjguMTJ9fSx7Im5hbWUiOiJtZWxsb3dkcmFnb25fZGFya18wM19lZmZlY3RfbGlnaHQiLCJwYXJlbnQiOiJtZWxsb3dkcmFnb25fZGFya18wM19yb2NrZXRfMDEiLCJ0cmFuc2Zvcm0iOnsieCI6LTUyLjczLCJ5IjotMzAuMjF9fSx7Im5hbWUiOiJtZWxsb3dkcmFnb25fZGFya18wM19lZmZlY3RfbGlnaHQyIiwicGFyZW50IjoibWVsbG93ZHJhZ29uX2RhcmtfMDNfcm9ja2V0XzAyIiwidHJhbnNmb3JtIjp7IngiOi00My42MSwieSI6LTIwLjM2fX0seyJsZW5ndGgiOjM3LCJuYW1lIjoibWVsbG93ZHJhZ29uX2RhcmtfMDNfZWZmZWN0X2xpZ2h0ZHVzdCIsInBhcmVudCI6Im1lbGxvd2RyYWdvbl9kYXJrXzAzX3JvY2tldF8wMSIsInRyYW5zZm9ybSI6eyJ4IjotNDIuMjcsInkiOi0xNy4wNCwic2tYIjotMTUzLjk3LCJza1kiOi0xNTMuOTcsInNjWCI6MC43ODMsInNjWSI6MC43ODN9fSx7Imxlbmd0aCI6MzYsIm5hbWUiOiJtZWxsb3dkcmFnb25fZGFya18wM19lZmZlY3RfbGlnaHRkdXN0MiIsInBhcmVudCI6Im1lbGxvd2RyYWdvbl9kYXJrXzAzX3JvY2tldF8wMiIsInRyYW5zZm9ybSI6eyJ4IjotNDIuOTYsInkiOi0yMS4xNCwic2tYIjotMTU3LjkyLCJza1kiOi0xNTcuOTIsInNjWCI6MC41MzEsInNjWSI6MC41MzF9fSx7Imxlbmd0aCI6NDQsIm5hbWUiOiJtZWxsb3dkcmFnb25fZGFya18wM19sZWdfMDEiLCJwYXJlbnQiOiJoaXAiLCJ0cmFuc2Zvcm0iOnsieCI6MjAuMjcsInkiOjguODEsInNrWCI6MTUwLjQ0LCJza1kiOjE1MC40NH19LHsibGVuZ3RoIjozNSwibmFtZSI6Im1lbGxvd2RyYWdvbl9kYXJrXzAzX2xlZ18wMiIsInBhcmVudCI6ImhpcCIsInRyYW5zZm9ybSI6eyJ4IjotNDIuNjUsInkiOi0xOS4yNiwic2tYIjoxNTMuNjEsInNrWSI6MTUzLjYxfX0seyJsZW5ndGgiOjE5LCJuYW1lIjoibWVsbG93ZHJhZ29uX2RhcmtfMDNfcm9ja2V0XzAxXzAxIiwicGFyZW50IjoibWVsbG93ZHJhZ29uX2RhcmtfMDNfcm9ja2V0XzAxIiwidHJhbnNmb3JtIjp7IngiOi0xNy4xMSwieSI6LTMwLjQ5LCJza1giOi0xMzguODcsInNrWSI6LTEzOC44N319LHsibGVuZ3RoIjoxOCwibmFtZSI6Im1lbGxvd2RyYWdvbl9kYXJrXzAzX3JvY2tldF8wMV8wMiIsInBhcmVudCI6Im1lbGxvd2RyYWdvbl9kYXJrXzAzX3JvY2tldF8wMSIsInRyYW5zZm9ybSI6eyJ4IjotNDkuNTEsInkiOi0xNS4wMywic2tYIjotMTU3LjczLCJza1kiOi0xNTcuNzN9fSx7Imxlbmd0aCI6MzYsIm5hbWUiOiJtZWxsb3dkcmFnb25fZGFya18wM19yb2NrZXRfMDFfMDMiLCJwYXJlbnQiOiJtZWxsb3dkcmFnb25fZGFya18wM19yb2NrZXRfMDEiLCJ0cmFuc2Zvcm0iOnsieCI6LTM5LjczLCJ5IjotMjAuMTUsInNrWCI6LTE1MS45Nywic2tZIjotMTUxLjk3fX0seyJsZW5ndGgiOjMzLCJuYW1lIjoibWVsbG93ZHJhZ29uX2RhcmtfMDNfcm9ja2V0XzAyXzAxIiwicGFyZW50IjoibWVsbG93ZHJhZ29uX2RhcmtfMDNfcm9ja2V0XzAyIiwidHJhbnNmb3JtIjp7IngiOi0zNC4xNiwieSI6LTE1LjA1LCJza1giOi0xNTAuNDQsInNrWSI6LTE1MC40NH19LHsibGVuZ3RoIjoyOSwibmFtZSI6Im1lbGxvd2RyYWdvbl9kYXJrXzAzX3JvY2tldF8wM18wMSIsInBhcmVudCI6Im1lbGxvd2RyYWdvbl9kYXJrXzAzX3JvY2tldF8wMyIsInRyYW5zZm9ybSI6eyJ4IjotMzcuMywieSI6MzUuMTEsInNrWCI6OTMuMTUsInNrWSI6OTMuMTV9fSx7Imxlbmd0aCI6MjgsIm5hbWUiOiJtZWxsb3dkcmFnb25fZGFya18wM19yb2NrZXRfMDNfMDMiLCJwYXJlbnQiOiJtZWxsb3dkcmFnb25fZGFya18wM19yb2NrZXRfMDMiLCJ0cmFuc2Zvcm0iOnsieCI6LTEyNC4wOSwieSI6LTE3LjcsInNrWCI6OTMuMTUsInNrWSI6OTMuMTV9fSx7Imxlbmd0aCI6MjYsIm5hbWUiOiJtZWxsb3dkcmFnb25fZGFya18wM190YWlsXzAxIiwicGFyZW50IjoiaGlwIiwidHJhbnNmb3JtIjp7IngiOjEzLjk0LCJ5Ijo0LjEsInNrWCI6NjYuNTgsInNrWSI6NjYuNTh9fSx7Im5hbWUiOiJtb25zdGVyZWZmZWN0IiwicGFyZW50IjoiaGlwIiwidHJhbnNmb3JtIjp7IngiOjguNzgsInkiOi0zMC45NH19LHsibGVuZ3RoIjoxMSwibmFtZSI6InJvY2tldF8wNF8wMiIsInBhcmVudCI6ImJvbmUiLCJ0cmFuc2Zvcm0iOnsieCI6MTMwLjIyLCJ5Ijo0OC40LCJza1giOjguNSwic2tZIjo4LjV9fSx7Imxlbmd0aCI6MTAsIm5hbWUiOiJyb2NrZXRfMDRfMDMiLCJwYXJlbnQiOiJib25lIiwidHJhbnNmb3JtIjp7IngiOjEzNS4wMSwieSI6MzguODQsInNrWCI6MTguMjksInNrWSI6MTguMjl9fSx7Imxlbmd0aCI6OSwibmFtZSI6InJvY2tldF8wNF8wNCIsInBhcmVudCI6ImJvbmUiLCJ0cmFuc2Zvcm0iOnsieCI6MTMxLjIyLCJ5Ijo1MS4xOSwic2tYIjo2LjczLCJza1kiOjYuNzN9fSx7Imxlbmd0aCI6MTAsIm5hbWUiOiJyb2NrZXRfMDRfMDUiLCJwYXJlbnQiOiJib25lIiwidHJhbnNmb3JtIjp7IngiOjEzMy4wOCwieSI6NDQuNTcsInNrWCI6MTguNywic2tZIjoxOC43fX0seyJuYW1lIjoicm9ja2V0X2xpZ2h0IiwicGFyZW50IjoiYm9uZSIsInRyYW5zZm9ybSI6eyJ4IjoxNDEuMjYsInkiOjQ2Ljk5fX0seyJsZW5ndGgiOjMzLCJuYW1lIjoiYm9uZTI2IiwicGFyZW50IjoibWVsbG93ZHJhZ29uX2RhcmtfMDNfbGVnXzAxIiwidHJhbnNmb3JtIjp7IngiOjQzLjQ3LCJ5IjowLjY3LCJza1giOi0yMC4zLCJza1kiOi0yMC4zfX0seyJsZW5ndGgiOjIzLCJuYW1lIjoiYm9uZTM0IiwicGFyZW50IjoibWVsbG93ZHJhZ29uX2RhcmtfMDNfdGFpbF8wMSIsInRyYW5zZm9ybSI6eyJ4IjoyNi4yNCwieSI6LTAuMTMsInNrWCI6LTM1LjAyLCJza1kiOi0zNS4wMn19LHsibmFtZSI6ImVmZmVjdF8wMSIsInBhcmVudCI6ImJ1dHRvbiIsInRyYW5zZm9ybSI6eyJ4IjotMC44OCwieSI6MC45Mywic2NYIjowLjYyNSwic2NZIjowLjYyNX19LHsibGVuZ3RoIjo0MiwibmFtZSI6Im1lbGxvd2RyYWdvbl9kYXJrXzAzX2FybV8wMSIsInBhcmVudCI6Im1lbGxvd2RyYWdvbl9kYXJrXzAzX2JvZHlfMDEiLCJ0cmFuc2Zvcm0iOnsieCI6NTcuOTQsInkiOjEyLjUxLCJza1giOjEyNi40Mywic2tZIjoxMjYuNDN9fSx7Imxlbmd0aCI6MzQsIm5hbWUiOiJtZWxsb3dkcmFnb25fZGFya18wM19hcm1fMDIgY29weSIsInBhcmVudCI6Im1lbGxvd2RyYWdvbl9kYXJrXzAzX2JvZHlfMDEiLCJ0cmFuc2Zvcm0iOnsieCI6NTUuMywieSI6LTI5LjcxLCJza1giOi0xMjkuODQsInNrWSI6LTEyOS44NH19LHsibGVuZ3RoIjozMSwibmFtZSI6Im1lbGxvd2RyYWdvbl9kYXJrXzAzX2Zvb3RfMDIiLCJwYXJlbnQiOiJtZWxsb3dkcmFnb25fZGFya18wM19sZWdfMDIiLCJ0cmFuc2Zvcm0iOnsieCI6MzQuOTgsInkiOjAuMTYsInNrWCI6LTEwOS45MSwic2tZIjotMTA5LjkxfX0seyJsZW5ndGgiOjMwLCJuYW1lIjoibWVsbG93ZHJhZ29uX2RhcmtfMDNfaGVhZF8wMSIsInBhcmVudCI6Im1lbGxvd2RyYWdvbl9kYXJrXzAzX2JvZHlfMDEiLCJ0cmFuc2Zvcm0iOnsieCI6NTkuOTIsInkiOjAuMDksInNrWCI6LTExLjIyLCJza1kiOi0xMS4yMn19LHsibGVuZ3RoIjoxMiwibmFtZSI6Im1lbGxvd2RyYWdvbl9kYXJrXzAzX3NjYXJmXzAyIiwicGFyZW50IjoibWVsbG93ZHJhZ29uX2RhcmtfMDNfYm9keV8wMSIsInRyYW5zZm9ybSI6eyJ4Ijo2Ni43NywieSI6MjIuOTgsInNrWCI6NzguMzQsInNrWSI6NzguMzR9fSx7Imxlbmd0aCI6MzEsIm5hbWUiOiJtZWxsb3dkcmFnb25fZGFya18wM193aW5nXzAxIiwicGFyZW50IjoibWVsbG93ZHJhZ29uX2RhcmtfMDNfYm9keV8wMSIsInRyYW5zZm9ybSI6eyJ4Ijo0OC43NywieSI6MTMuMTEsInNrWCI6NjcuNzMsInNrWSI6NjcuNzN9fSx7Imxlbmd0aCI6MjAsIm5hbWUiOiJtZWxsb3dkcmFnb25fZGFya18wM193aW5nXzAyIiwicGFyZW50IjoibWVsbG93ZHJhZ29uX2RhcmtfMDNfYm9keV8wMSIsInRyYW5zZm9ybSI6eyJ4Ijo1Mi42MiwieSI6LTI1Ljc5LCJza1giOi03Ny45OSwic2tZIjotNzcuOTl9fSx7Imxlbmd0aCI6MjUsIm5hbWUiOiJib25lMTkiLCJwYXJlbnQiOiJtZWxsb3dkcmFnb25fZGFya18wM193aW5nXzAxIiwidHJhbnNmb3JtIjp7IngiOjMxLjMyLCJ5IjotMC4xNCwic2tYIjotMzYuNzIsInNrWSI6LTM2LjcyfX0seyJsZW5ndGgiOjgsIm5hbWUiOiJib25lMjciLCJwYXJlbnQiOiJib25lMjYiLCJ0cmFuc2Zvcm0iOnsieCI6MzIuODgsInkiOi0wLjQyLCJza1giOjE1LjQsInNrWSI6MTUuNH19LHsibGVuZ3RoIjoxMSwibmFtZSI6ImJvbmUzMSIsInBhcmVudCI6Im1lbGxvd2RyYWdvbl9kYXJrXzAzX2Zvb3RfMDIiLCJ0cmFuc2Zvcm0iOnsieCI6MzEuODQsInkiOi0wLjM0LCJza1giOjIwLjcsInNrWSI6MjAuN319LHsibGVuZ3RoIjoxOSwibmFtZSI6ImJvbmUzNSIsInBhcmVudCI6ImJvbmUzNCIsInRyYW5zZm9ybSI6eyJ4IjoyMi45MiwieSI6MC4zNiwic2tYIjotMjkuNzQsInNrWSI6LTI5Ljc0fX0seyJsZW5ndGgiOjIyLCJuYW1lIjoiYm9uZTM3IiwicGFyZW50IjoibWVsbG93ZHJhZ29uX2RhcmtfMDNfd2luZ18wMiIsInRyYW5zZm9ybSI6eyJ4IjoyMC43MiwieSI6MC4wOCwic2tYIjo0MS4xNSwic2tZIjo0MS4xNX19LHsibGVuZ3RoIjo0MSwibmFtZSI6Im1lbGxvd2RyYWdvbl9kYXJrXzAzX2Vhcl8wMSIsInBhcmVudCI6Im1lbGxvd2RyYWdvbl9kYXJrXzAzX2hlYWRfMDEiLCJ0cmFuc2Zvcm0iOnsieCI6NzcuMjksInkiOi0zOC43Niwic2tYIjotMTUxLjQ4LCJza1kiOi0xNTEuNDh9fSx7Imxlbmd0aCI6NDgsIm5hbWUiOiJtZWxsb3dkcmFnb25fZGFya18wM19lYXJfMDIiLCJwYXJlbnQiOiJtZWxsb3dkcmFnb25fZGFya18wM19oZWFkXzAxIiwidHJhbnNmb3JtIjp7IngiOjY1LjgyLCJ5IjozNC4xOSwic2tYIjoxNTAuNDQsInNrWSI6MTUwLjQ0fX0seyJuYW1lIjoibWVsbG93ZHJhZ29uX2RhcmtfMDNfZXllXzAxIiwicGFyZW50IjoibWVsbG93ZHJhZ29uX2RhcmtfMDNfaGVhZF8wMSIsInRyYW5zZm9ybSI6eyJ4IjoyNC40NSwieSI6MjEuMzh9fSx7Imxlbmd0aCI6MTUsIm5hbWUiOiJtZWxsb3dkcmFnb25fZGFya18wM19nbG92ZXNfMDEiLCJwYXJlbnQiOiJtZWxsb3dkcmFnb25fZGFya18wM19hcm1fMDEiLCJ0cmFuc2Zvcm0iOnsieCI6NDIuODUsInkiOi0wLjA0LCJza1giOjExOC44Niwic2tZIjoxMTguODZ9fSx7Imxlbmd0aCI6MjksIm5hbWUiOiJtZWxsb3dkcmFnb25fZGFya18wM19nb2dnbGVzXzAxIiwicGFyZW50IjoibWVsbG93ZHJhZ29uX2RhcmtfMDNfaGVhZF8wMSIsInRyYW5zZm9ybSI6eyJ4Ijo3OS4xMywieSI6LTYyLjk0LCJza1giOjc1LjMyLCJza1kiOjc1LjMyfX0seyJsZW5ndGgiOjMxLCJuYW1lIjoibWVsbG93ZHJhZ29uX2RhcmtfMDNfaGFuZF8wMSIsInBhcmVudCI6Im1lbGxvd2RyYWdvbl9kYXJrXzAzX2FybV8wMiBjb3B5IiwidHJhbnNmb3JtIjp7IngiOjM0LjU3LCJ5IjotMC4wMiwic2tYIjotMTU4LjEyLCJza1kiOi0xNTguMTJ9fSx7Imxlbmd0aCI6MjAsIm5hbWUiOiJtZWxsb3dkcmFnb25fZGFya18wM19ob3JuXzAxIiwicGFyZW50IjoibWVsbG93ZHJhZ29uX2RhcmtfMDNfaGVhZF8wMSIsInRyYW5zZm9ybSI6eyJ4Ijo5NS45OSwieSI6LTE5LjY1LCJza1giOi0xOC44NCwic2tZIjotMTguODR9fSx7Imxlbmd0aCI6MjIsIm5hbWUiOiJtZWxsb3dkcmFnb25fZGFya18wM19ob3JuXzAyIiwicGFyZW50IjoibWVsbG93ZHJhZ29uX2RhcmtfMDNfaGVhZF8wMSIsInRyYW5zZm9ybSI6eyJ4Ijo5My4xMSwieSI6MzUuMSwic2tYIjotMC45LCJza1kiOi0wLjl9fSx7Imxlbmd0aCI6MTksIm5hbWUiOiJib25lMTIiLCJwYXJlbnQiOiJtZWxsb3dkcmFnb25fZGFya18wM19nbG92ZXNfMDEiLCJ0cmFuc2Zvcm0iOnsieCI6MTUuNjMsInkiOjAuMDgsInNrWCI6Ni43Mywic2tZIjo2LjczfX0seyJsZW5ndGgiOjksIm5hbWUiOiJib25lMTUiLCJwYXJlbnQiOiJtZWxsb3dkcmFnb25fZGFya18wM19oYW5kXzAxIiwidHJhbnNmb3JtIjp7IngiOjMxLjMxLCJ5IjowLjA2LCJza1giOi03NS44NSwic2tZIjotNzUuODV9fSx7Imxlbmd0aCI6NTIsIm5hbWUiOiJib25lMjAiLCJwYXJlbnQiOiJib25lMTkiLCJ0cmFuc2Zvcm0iOnsieCI6MjYuNjgsInkiOjAuMzEsInNrWCI6NzcuNTYsInNrWSI6NzcuNTZ9fSx7Imxlbmd0aCI6MTIsIm5hbWUiOiJib25lMjgiLCJwYXJlbnQiOiJib25lMjciLCJ0cmFuc2Zvcm0iOnsieCI6OC42OCwieSI6MC4wMiwic2tYIjoyOC4xNiwic2tZIjoyOC4xNn19LHsibmFtZSI6ImJvbmUzIiwicGFyZW50IjoibWVsbG93ZHJhZ29uX2RhcmtfMDNfZXllXzAxIiwidHJhbnNmb3JtIjp7IngiOjE0LjU3LCJ5IjowLjZ9fSx7Imxlbmd0aCI6MTAsIm5hbWUiOiJib25lMzIiLCJwYXJlbnQiOiJib25lMzEiLCJ0cmFuc2Zvcm0iOnsieCI6MTEuMzQsInkiOjAuMDcsInNrWCI6MzkuMjYsInNrWSI6MzkuMjZ9fSx7Imxlbmd0aCI6MjYsIm5hbWUiOiJib25lMzgiLCJwYXJlbnQiOiJib25lMzciLCJ0cmFuc2Zvcm0iOnsieCI6MjIuODgsInkiOjAuMSwic2tYIjotODUuNDksInNrWSI6LTg1LjQ5fX0seyJsZW5ndGgiOjMyLCJuYW1lIjoiYm9uZTUiLCJwYXJlbnQiOiJtZWxsb3dkcmFnb25fZGFya18wM19lYXJfMDIiLCJ0cmFuc2Zvcm0iOnsieCI6NDguMywieSI6LTEuMjQsInNrWCI6LTI0LjE3LCJza1kiOi0yNC4xN319LHsibGVuZ3RoIjo0NiwibmFtZSI6ImJvbmU4IiwicGFyZW50IjoibWVsbG93ZHJhZ29uX2RhcmtfMDNfZWFyXzAxIiwidHJhbnNmb3JtIjp7IngiOjQwLjc3LCJ5IjowLjUxLCJza1giOjI4LjUxLCJza1kiOjI4LjUxfX0seyJuYW1lIjoibW9uc3RlcmV5ZV8xIiwicGFyZW50IjoibWVsbG93ZHJhZ29uX2RhcmtfMDNfZXllXzAxIiwidHJhbnNmb3JtIjp7IngiOjEzLjQ3LCJ5IjotMjYuNjl9fSx7Im5hbWUiOiJtb25zdGVyZXllXzIiLCJwYXJlbnQiOiJtZWxsb3dkcmFnb25fZGFya18wM19leWVfMDEiLCJ0cmFuc2Zvcm0iOnsieCI6MTAuOTksInkiOjE3Ljg3fX0seyJsZW5ndGgiOjM2LCJuYW1lIjoiYm9uZTIxIiwicGFyZW50IjoiYm9uZTIwIiwidHJhbnNmb3JtIjp7IngiOjUyLjIsInkiOi0wLjA5LCJza1giOjIxLjQ4LCJza1kiOjIxLjQ4fX0seyJsZW5ndGgiOjMwLCJuYW1lIjoiYm9uZTIzIiwicGFyZW50IjoiYm9uZTIwIiwidHJhbnNmb3JtIjp7IngiOjUuNjMsInkiOjQuNDQsInNrWCI6MzkuNTgsInNrWSI6MzkuNTh9fSx7Imxlbmd0aCI6MzEsIm5hbWUiOiJib25lMzkiLCJwYXJlbnQiOiJib25lMzgiLCJ0cmFuc2Zvcm0iOnsieCI6MjYuMTYsInkiOjAuMDUsInNrWCI6LTIyLjI2LCJza1kiOi0yMi4yNn19LHsibGVuZ3RoIjoyMSwibmFtZSI6ImJvbmU0MSIsInBhcmVudCI6ImJvbmUzOCIsInRyYW5zZm9ybSI6eyJ4IjoyLjA2LCJ5IjotMy41NSwic2tYIjotNDMuNiwic2tZIjotNDMuNn19LHsibGVuZ3RoIjoyNywibmFtZSI6ImJvbmU2IiwicGFyZW50IjoiYm9uZTUiLCJ0cmFuc2Zvcm0iOnsieCI6MzIuMDUsInkiOi0wLjA5LCJza1giOi0xOS4xLCJza1kiOi0xOS4xfX0seyJsZW5ndGgiOjQ2LCJuYW1lIjoiYm9uZTkiLCJwYXJlbnQiOiJib25lOCIsInRyYW5zZm9ybSI6eyJ4Ijo0Ni45MSwieSI6MC4wNywic2tYIjoxNy4xOSwic2tZIjoxNy4xOX19LHsibmFtZSI6Im1lbGxvd2RyYWdvbl9kYXJrXzAzX2pveV8wNSIsInBhcmVudCI6ImJvbmUxMiIsInRyYW5zZm9ybSI6eyJ4Ijo1Ni45NSwieSI6LTQuNzQsInNrWCI6MTc2LjA5LCJza1kiOjE3Ni4wOX19LHsibGVuZ3RoIjozNywibmFtZSI6ImJvbmUyMiIsInBhcmVudCI6ImJvbmUyMSIsInRyYW5zZm9ybSI6eyJ4IjozNi42OSwic2tYIjoxMC4yNiwic2tZIjoxMC4yNn19LHsibGVuZ3RoIjozMywibmFtZSI6ImJvbmUyNCIsInBhcmVudCI6ImJvbmUyMyIsInRyYW5zZm9ybSI6eyJ4IjozMC43MywieSI6MC4wMywic2tYIjoxNy4xOSwic2tZIjoxNy4xOX19LHsibGVuZ3RoIjoyNSwibmFtZSI6ImJvbmU0MCIsInBhcmVudCI6ImJvbmUzOSIsInRyYW5zZm9ybSI6eyJ4IjozMS4yNCwieSI6MC4wMSwic2tYIjotMTkuNTEsInNrWSI6LTE5LjUxfX0seyJsZW5ndGgiOjIxLCJuYW1lIjoiYm9uZTQyIiwicGFyZW50IjoiYm9uZTQxIiwidHJhbnNmb3JtIjp7IngiOjIxLjU4LCJ5IjowLjA3LCJza1giOi0xOS41MSwic2tZIjotMTkuNTF9fSx7Imxlbmd0aCI6MTMsIm5hbWUiOiJtZWxsb3dkcmFnb25fZGFya18wM19qb3lfMDEiLCJwYXJlbnQiOiJtZWxsb3dkcmFnb25fZGFya18wM19qb3lfMDUiLCJ0cmFuc2Zvcm0iOnsieCI6MTEuNTUsInkiOi04Ljk4LCJza1giOi05MC45LCJza1kiOi05MC45fX0seyJsZW5ndGgiOjEwLCJuYW1lIjoibWVsbG93ZHJhZ29uX2RhcmtfMDNfaGFuZF8wMV8wMSIsInBhcmVudCI6Im1lbGxvd2RyYWdvbl9kYXJrXzAzX2pveV8wMSIsInRyYW5zZm9ybSI6eyJ4IjoyOC44NiwieSI6MC4yOSwic2tYIjotMzguMjEsInNrWSI6LTM4LjIxfX1dLCJzbG90IjpbeyJibGVuZE1vZGUiOiJhZGQiLCJuYW1lIjoiZWZmZWN0X2Rvd25fMSIsInBhcmVudCI6ImVmZmVjdF9kb3duXzEiLCJjb2xvciI6eyJhTSI6NTl9fSx7ImJsZW5kTW9kZSI6ImFkZCIsIm5hbWUiOiJlZmZlY3RfZG93bl8yIiwicGFyZW50IjoiZWZmZWN0X2Rvd25fMiIsImNvbG9yIjp7ImFNIjo4OH19LHsiYmxlbmRNb2RlIjoiYWRkIiwibmFtZSI6ImVmZmVjdF9kb3duXzMiLCJwYXJlbnQiOiJlZmZlY3RfYm90dG9tXzEiLCJjb2xvciI6eyJhTSI6NTJ9fSx7ImJsZW5kTW9kZSI6ImFkZCIsIm5hbWUiOiJlZmZlY3RfZG93bl80IiwicGFyZW50IjoiZWZmZWN0X2JvdHRvbV8yIiwiY29sb3IiOnsiYU0iOjUyfX0seyJibGVuZE1vZGUiOiJhZGQiLCJuYW1lIjoiZWZmZWN0X2xpZ2h0ZHVzdDIiLCJwYXJlbnQiOiJtZWxsb3dkcmFnb25fZGFya18wM19lZmZlY3RfbGlnaHRkdXN0MiJ9LHsiYmxlbmRNb2RlIjoiYWRkIiwibmFtZSI6ImVmZmVjdF8wMSIsInBhcmVudCI6ImVmZmVjdF8wMSJ9LHsiYmxlbmRNb2RlIjoiYWRkIiwibmFtZSI6Im1lbGxvd2RyYWdvbl9kYXJrXzAzX3JvY2tldF8wM18wMyIsInBhcmVudCI6Im1lbGxvd2RyYWdvbl9kYXJrXzAzX3JvY2tldF8wM18wMyJ9LHsiYmxlbmRNb2RlIjoiYWRkIiwibmFtZSI6Im1lbGxvd2RyYWdvbl9kYXJrXzAzX3JvY2tldF8wM18wMiIsInBhcmVudCI6ImJvbmU0OSJ9LHsiYmxlbmRNb2RlIjoiYWRkIiwibmFtZSI6Im1lbGxvd2RyYWdvbl9kYXJrXzAzX3JvY2tldF8wM18wMSIsInBhcmVudCI6Im1lbGxvd2RyYWdvbl9kYXJrXzAzX3JvY2tldF8wM18wMSJ9LHsibmFtZSI6Im1lbGxvd2RyYWdvbl9kYXJrXzAzX3JvY2tldF8wMyIsInBhcmVudCI6Im1lbGxvd2RyYWdvbl9kYXJrXzAzX3JvY2tldF8wMyJ9LHsiYmxlbmRNb2RlIjoiYWRkIiwibmFtZSI6Im1lbGxvd2RyYWdvbl9kYXJrXzAzX3JvY2tldF8wMl8wMSIsInBhcmVudCI6Im1lbGxvd2RyYWdvbl9kYXJrXzAzX3JvY2tldF8wMl8wMSJ9LHsiYmxlbmRNb2RlIjoiYWRkIiwibmFtZSI6ImVmZmVjdF9saWdodDIiLCJwYXJlbnQiOiJtZWxsb3dkcmFnb25fZGFya18wM19lZmZlY3RfbGlnaHQyIn0seyJibGVuZE1vZGUiOiJhZGQiLCJuYW1lIjoiZWZmZWN0X2xpZ2h0IiwicGFyZW50IjoibWVsbG93ZHJhZ29uX2RhcmtfMDNfZWZmZWN0X2xpZ2h0In0seyJuYW1lIjoibWVsbG93ZHJhZ29uX2RhcmtfMDNfcm9ja2V0XzAyIiwicGFyZW50IjoibWVsbG93ZHJhZ29uX2RhcmtfMDNfcm9ja2V0XzAyIn0seyJuYW1lIjoibWVsbG93ZHJhZ29uX2RhcmtfMDNfd2luZ18wMiIsInBhcmVudCI6Im1lbGxvd2RyYWdvbl9kYXJrXzAzX3dpbmdfMDIifSx7Im5hbWUiOiJtZWxsb3dkcmFnb25fZGFya18wM193aW5nXzAxIiwicGFyZW50IjoibWVsbG93ZHJhZ29uX2RhcmtfMDNfd2luZ18wMSJ9LHsibmFtZSI6Im1lbGxvd2RyYWdvbl9kYXJrXzAzX3RhaWxfMDEiLCJwYXJlbnQiOiJtZWxsb3dkcmFnb25fZGFya18wM190YWlsXzAxIn0seyJuYW1lIjoibWVsbG93ZHJhZ29uX2RhcmtfMDNfc2NhcmZfMDIiLCJwYXJlbnQiOiJtZWxsb3dkcmFnb25fZGFya18wM19zY2FyZl8wMiJ9LHsibmFtZSI6Im1lbGxvd2RyYWdvbl9kYXJrXzAzX2Vhcl8wMiIsInBhcmVudCI6Im1lbGxvd2RyYWdvbl9kYXJrXzAzX2Vhcl8wMiJ9LHsibmFtZSI6Im1lbGxvd2RyYWdvbl9kYXJrXzAzX2FybV8wMiIsInBhcmVudCI6Im1lbGxvd2RyYWdvbl9kYXJrXzAzX2FybV8wMiBjb3B5In0seyJuYW1lIjoibWVsbG93ZHJhZ29uX2RhcmtfMDNfZm9vdF8wMiIsInBhcmVudCI6Im1lbGxvd2RyYWdvbl9kYXJrXzAzX2Zvb3RfMDIifSx7Im5hbWUiOiJtZWxsb3dkcmFnb25fZGFya18wM19sZWdfMDIiLCJwYXJlbnQiOiJtZWxsb3dkcmFnb25fZGFya18wM19sZWdfMDIifSx7Im5hbWUiOiJtZWxsb3dkcmFnb25fZGFya18wM19ib2R5XzAxIiwicGFyZW50IjoibWVsbG93ZHJhZ29uX2RhcmtfMDNfYm9keV8wMSJ9LHsibmFtZSI6Im1lbGxvd2RyYWdvbl9kYXJrXzAzX2FybV8wMSIsInBhcmVudCI6Im1lbGxvd2RyYWdvbl9kYXJrXzAzX2FybV8wMSJ9LHsibmFtZSI6Im1lbGxvd2RyYWdvbl9kYXJrXzAzX2xlZ18wMSIsInBhcmVudCI6Im1lbGxvd2RyYWdvbl9kYXJrXzAzX2xlZ18wMSJ9LHsibmFtZSI6Im1lbGxvd2RyYWdvbl9kYXJrXzAzX3NjYXJmXzAxIiwicGFyZW50IjoibWVsbG93ZHJhZ29uX2RhcmtfMDNfYm9keV8wMSJ9LHsibmFtZSI6Im1lbGxvd2RyYWdvbl9kYXJrXzAzX2hvcm5fMDIiLCJwYXJlbnQiOiJtZWxsb3dkcmFnb25fZGFya18wM19ob3JuXzAyIn0seyJuYW1lIjoibWVsbG93ZHJhZ29uX2RhcmtfMDNfaGVhZF8wMSIsInBhcmVudCI6Im1lbGxvd2RyYWdvbl9kYXJrXzAzX2hlYWRfMDEifSx7Im5hbWUiOiJtZWxsb3dkcmFnb25fZGFya18wM19qb3lfMDUiLCJwYXJlbnQiOiJtZWxsb3dkcmFnb25fZGFya18wM19qb3lfMDUifSx7Im5hbWUiOiJtZWxsb3dkcmFnb25fZGFya18wM19qb3lfMDRfMDEiLCJwYXJlbnQiOiJtZWxsb3dkcmFnb25fZGFya18wM19qb3lfMDUifSx7Im5hbWUiOiJtZWxsb3dkcmFnb25fZGFya18wM19qb3lfMDQiLCJwYXJlbnQiOiJtZWxsb3dkcmFnb25fZGFya18wM19qb3lfMDUifSx7Im5hbWUiOiJtZWxsb3dkcmFnb25fZGFya18wM19oYW5kXzAxIiwicGFyZW50IjoibWVsbG93ZHJhZ29uX2RhcmtfMDNfaGFuZF8wMSJ9LHsibmFtZSI6Im1lbGxvd2RyYWdvbl9kYXJrXzAzX2pveV8wM18wMSIsInBhcmVudCI6Im1lbGxvd2RyYWdvbl9kYXJrXzAzX2pveV8wNSJ9LHsibmFtZSI6Im1lbGxvd2RyYWdvbl9kYXJrXzAzX2pveV8wMyIsInBhcmVudCI6Im1lbGxvd2RyYWdvbl9kYXJrXzAzX2pveV8wNSJ9LHsibmFtZSI6Im1lbGxvd2RyYWdvbl9kYXJrXzAzX2pveV8wMiIsInBhcmVudCI6Im1lbGxvd2RyYWdvbl9kYXJrXzAzX2pveV8wNSJ9LHsibmFtZSI6Im1lbGxvd2RyYWdvbl9kYXJrXzAzX2pveV8wMSIsInBhcmVudCI6Im1lbGxvd2RyYWdvbl9kYXJrXzAzX2pveV8wMSJ9LHsibmFtZSI6Im1lbGxvd2RyYWdvbl9kYXJrXzAzX2hvcm5fMDEiLCJwYXJlbnQiOiJtZWxsb3dkcmFnb25fZGFya18wM19ob3JuXzAxIn0seyJkaXNwbGF5SW5kZXgiOi0xLCJuYW1lIjoibWVsbG93ZHJhZ29uX2RhcmtfMDNfaGVhZF8xIiwicGFyZW50IjoibWVsbG93ZHJhZ29uX2RhcmtfMDNfaGVhZF8wMSJ9LHsibmFtZSI6Im1lbGxvd2RyYWdvbl9kYXJrXzAzX2V5ZV8wMSIsInBhcmVudCI6Im1lbGxvd2RyYWdvbl9kYXJrXzAzX2V5ZV8wMSJ9LHsibmFtZSI6Im1lbGxvd2RyYWdvbl9kYXJrXzAzX2Vhcl8wMSIsInBhcmVudCI6Im1lbGxvd2RyYWdvbl9kYXJrXzAzX2Vhcl8wMSJ9LHsibmFtZSI6Im1lbGxvd2RyYWdvbl9kYXJrXzAzX2dsb3Zlc18wMSIsInBhcmVudCI6Im1lbGxvd2RyYWdvbl9kYXJrXzAzX2dsb3Zlc18wMSJ9LHsibmFtZSI6Im1lbGxvd2RyYWdvbl9kYXJrXzAzX2dvZ2dsZXNfMDEiLCJwYXJlbnQiOiJtZWxsb3dkcmFnb25fZGFya18wM19nb2dnbGVzXzAxIn0seyJuYW1lIjoibWVsbG93ZHJhZ29uX2RhcmtfMDNfaGFuZF8wMV8wMSIsInBhcmVudCI6Im1lbGxvd2RyYWdvbl9kYXJrXzAzX2hhbmRfMDFfMDEifSx7ImJsZW5kTW9kZSI6ImFkZCIsIm5hbWUiOiJtZWxsb3dkcmFnb25fZGFya18wM19yb2NrZXRfMDFfMDMiLCJwYXJlbnQiOiJtZWxsb3dkcmFnb25fZGFya18wM19yb2NrZXRfMDFfMDMifSx7Im5hbWUiOiJtZWxsb3dkcmFnb25fZGFya18wM19yb2NrZXRfMDFfMDIiLCJwYXJlbnQiOiJtZWxsb3dkcmFnb25fZGFya18wM19yb2NrZXRfMDFfMDIifSx7Im5hbWUiOiJtZWxsb3dkcmFnb25fZGFya18wM19yb2NrZXRfMDEiLCJwYXJlbnQiOiJtZWxsb3dkcmFnb25fZGFya18wM19yb2NrZXRfMDEifSx7Im5hbWUiOiJtZWxsb3dkcmFnb25fZGFya18wM19yb2NrZXRfMDFfMDEiLCJwYXJlbnQiOiJtZWxsb3dkcmFnb25fZGFya18wM19yb2NrZXRfMDFfMDEifSx7Im5hbWUiOiJtZWxsb3dkcmFnb25fZGFya18wM19lZmZlY3RfMDgiLCJwYXJlbnQiOiJidXR0b24ifSx7Im5hbWUiOiJtZWxsb3dkcmFnb25fZGFya18wM19yb2NrZXRfMDRfMDUiLCJwYXJlbnQiOiJyb2NrZXRfMDRfMDUifSx7Im5hbWUiOiJtZWxsb3dkcmFnb25fZGFya18wM19yb2NrZXRfMDRfMDQiLCJwYXJlbnQiOiJyb2NrZXRfMDRfMDQifSx7Im5hbWUiOiJtZWxsb3dkcmFnb25fZGFya18wM19yb2NrZXRfMDQiLCJwYXJlbnQiOiJib25lIn0seyJibGVuZE1vZGUiOiJhZGQiLCJuYW1lIjoicm9ja2V0X2xpZ2h0IiwicGFyZW50Ijoicm9ja2V0X2xpZ2h0In0seyJibGVuZE1vZGUiOiJhZGQiLCJuYW1lIjoiZWZmZWN0XzA0XzAxIiwicGFyZW50IjoiZWZmZWN0XzA0XzAxIn0seyJuYW1lIjoibWVsbG93ZHJhZ29uX2RhcmtfMDNfcm9ja2V0XzA0XzAzIiwicGFyZW50Ijoicm9ja2V0XzA0XzAzIn0seyJuYW1lIjoibWVsbG93ZHJhZ29uX2RhcmtfMDNfcm9ja2V0XzA0XzAyIiwicGFyZW50Ijoicm9ja2V0XzA0XzAyIn0seyJibGVuZE1vZGUiOiJhZGQiLCJkaXNwbGF5SW5kZXgiOjEsIm5hbWUiOiJlZmZlY3RfbGlnaHRpbmciLCJwYXJlbnQiOiJsaWdodGluZyJ9LHsiYmxlbmRNb2RlIjoiYWRkIiwibmFtZSI6ImVmZmVjdF9saWdodGR1c3QiLCJwYXJlbnQiOiJtZWxsb3dkcmFnb25fZGFya18wM19lZmZlY3RfbGlnaHRkdXN0In0seyJibGVuZE1vZGUiOiJhZGQiLCJuYW1lIjoiZWZmZWN0X2xpZ2h0ZHVzdDMiLCJwYXJlbnQiOiJlZmZlY3RfbGlnaHRkdXN0MyJ9LHsiYmxlbmRNb2RlIjoiYWRkIiwibmFtZSI6ImVmZmVjdF9saWdodDMiLCJwYXJlbnQiOiJlZmZlY3RfbGlnaHQzIn0seyJibGVuZE1vZGUiOiJhZGQiLCJuYW1lIjoiZWZmZWN0XzAyIiwicGFyZW50IjoiZWZmZWN0XzAyIn0seyJibGVuZE1vZGUiOiJhZGQiLCJuYW1lIjoiZWZmZWN0XzAzIiwicGFyZW50IjoiZWZmZWN0XzAzIn0seyJibGVuZE1vZGUiOiJhZGQiLCJuYW1lIjoiZWZmZWN0XzA0IiwicGFyZW50IjoiZWZmZWN0XzA0In0seyJibGVuZE1vZGUiOiJhZGQiLCJkaXNwbGF5SW5kZXgiOjEsIm5hbWUiOiJlZmZlY3RfMDUiLCJwYXJlbnQiOiJhcnJvdyJ9LHsiYmxlbmRNb2RlIjoiYWRkIiwiZGlzcGxheUluZGV4IjoxLCJuYW1lIjoiZWZmZWN0XzUiLCJwYXJlbnQiOiJhcnJvdzIifSx7ImJsZW5kTW9kZSI6ImFkZCIsImRpc3BsYXlJbmRleCI6MSwibmFtZSI6ImVmZmVjdF82IiwicGFyZW50IjoiYXJyb3czIn0seyJibGVuZE1vZGUiOiJhZGQiLCJuYW1lIjoiZWZmZWN0X2ZpcmUiLCJwYXJlbnQiOiJlZmZlY3RfZmlyZSJ9LHsiYmxlbmRNb2RlIjoiYWRkIiwibmFtZSI6ImVmZmVjdF9yZWQiLCJwYXJlbnQiOiJlZmZlY3RfcmVkIn0seyJibGVuZE1vZGUiOiJhZGQiLCJuYW1lIjoiZWZmZWN0XzA3IiwicGFyZW50IjoiYnV0dG9uIn0seyJibGVuZE1vZGUiOiJhZGQiLCJuYW1lIjoiZWZmZWN0X2JsdWUiLCJwYXJlbnQiOiJlZmZlY3RfYmx1ZSJ9XSwiaWsiOlt7ImJlbmRQb3NpdGl2ZSI6ZmFsc2UsImNoYWluIjoxLCJuYW1lIjoibGVnX2wiLCJib25lIjoiYm9uZTI2IiwidGFyZ2V0IjoibGVnX2wifSx7ImJlbmRQb3NpdGl2ZSI6ZmFsc2UsImNoYWluIjoxLCJuYW1lIjoibGVnX3IiLCJib25lIjoibWVsbG93ZHJhZ29uX2RhcmtfMDNfZm9vdF8wMiIsInRhcmdldCI6ImxlZ19yIn1dLCJza2luIjpbeyJzbG90IjpbeyJuYW1lIjoicm9ja2V0X2xpZ2h0IiwiZGlzcGxheSI6W3sibmFtZSI6Im1lbGxvd2RyYWdvbl9kYXJrXzAzX3JvY2tldF8wNF8wNiIsInRyYW5zZm9ybSI6eyJ4IjowLjQ2LCJ5IjowLjM0fX1dfSx7Im5hbWUiOiJtZWxsb3dkcmFnb25fZGFya18wM19yb2NrZXRfMDFfMDIiLCJkaXNwbGF5IjpbeyJuYW1lIjoibWVsbG93ZHJhZ29uX2RhcmtfMDNfcm9ja2V0XzAxXzAyIiwidHJhbnNmb3JtIjp7IngiOjQ0LjEsInkiOi0wLjA2LCJza1giOjE1Ny43Mywic2tZIjoxNTcuNzN9fV19LHsibmFtZSI6Im1lbGxvd2RyYWdvbl9kYXJrXzAzX3JvY2tldF8wM18wMSIsImRpc3BsYXkiOlt7Im5hbWUiOiJtZWxsb3dkcmFnb25fZGFya18wM19yb2NrZXRfMDNfMDEiLCJ0cmFuc2Zvcm0iOnsieCI6MzMuNTUsInkiOi0yLjA3LCJza1giOi05My4xNSwic2tZIjotOTMuMTV9fV19LHsibmFtZSI6ImVmZmVjdF9maXJlIiwiZGlzcGxheSI6W3sibmFtZSI6Im1lbGxvd2RyYWdvbl9kYXJrXzAzX2VmZmVjdF9maXJlIiwidHJhbnNmb3JtIjp7IngiOjY3Ljc1LCJ5IjotNC4xNSwic2tYIjo5My4xNSwic2tZIjo5My4xNX19XX0seyJuYW1lIjoiZWZmZWN0X2xpZ2h0MyIsImRpc3BsYXkiOlt7Im5hbWUiOiJtZWxsb3dkcmFnb25fZGFya18wM19lZmZlY3RfbGlnaHQifV19LHsibmFtZSI6Im1lbGxvd2RyYWdvbl9kYXJrXzAzX2FybV8wMSIsImRpc3BsYXkiOlt7Im5hbWUiOiJtZWxsb3dkcmFnb25fZGFya18wM19hcm1fMDEiLCJ0cmFuc2Zvcm0iOnsieCI6MTkuMywieSI6Mi45OCwic2tYIjotNTguMzEsInNrWSI6LTU4LjMxfX1dfSx7Im5hbWUiOiJtZWxsb3dkcmFnb25fZGFya18wM190YWlsXzAxIiwiZGlzcGxheSI6W3sidHlwZSI6Im1lc2giLCJuYW1lIjoibWVsbG93ZHJhZ29uX2RhcmtfMDNfdGFpbF8wMSIsIm9mZnNldCI6MCwidXNlckVkZ2VzIjpbXX1dfSx7Im5hbWUiOiJtZWxsb3dkcmFnb25fZGFya18wM19oZWFkXzEiLCJkaXNwbGF5IjpbeyJuYW1lIjoibWVsbG93ZHJhZ29uX2RhcmtfMDNfbW91dGhfMDEiLCJ0cmFuc2Zvcm0iOnsieCI6MTAuNDMsInkiOjE4LjE3LCJza1giOjc5LjM0LCJza1kiOjc5LjM0fX1dfSx7Im5hbWUiOiJtZWxsb3dkcmFnb25fZGFya18wM19qb3lfMDQiLCJkaXNwbGF5IjpbeyJuYW1lIjoibWVsbG93ZHJhZ29uX2RhcmtfMDNfam95XzA0IiwidHJhbnNmb3JtIjp7IngiOi03LjY5LCJ5IjotMTkuNTJ9fV19LHsibmFtZSI6ImVmZmVjdF8wNF8wMSIsImRpc3BsYXkiOlt7Im5hbWUiOiJtZWxsb3dkcmFnb25fZGFya18wM19yb2NrZXRfMDRfMDEiLCJ0cmFuc2Zvcm0iOnsieCI6Ni42MSwieSI6LTIuMSwic2tYIjoxNzQuNTUsInNrWSI6MTc0LjU1fX1dfSx7Im5hbWUiOiJtZWxsb3dkcmFnb25fZGFya18wM19yb2NrZXRfMDEiLCJkaXNwbGF5IjpbeyJuYW1lIjoibWVsbG93ZHJhZ29uX2RhcmtfMDNfcm9ja2V0XzAxIiwidHJhbnNmb3JtIjp7IngiOjcuMTQsInkiOjExLjMxfX1dfSx7Im5hbWUiOiJtZWxsb3dkcmFnb25fZGFya18wM19yb2NrZXRfMDMiLCJkaXNwbGF5IjpbeyJuYW1lIjoibWVsbG93ZHJhZ29uX2RhcmtfMDNfcm9ja2V0XzAzIiwidHJhbnNmb3JtIjp7IngiOi00LjU2LCJ5IjotNC4yNn19XX0seyJuYW1lIjoibWVsbG93ZHJhZ29uX2RhcmtfMDNfcm9ja2V0XzAyXzAxIiwiZGlzcGxheSI6W3sibmFtZSI6Im1lbGxvd2RyYWdvbl9kYXJrXzAzX3JvY2tldF8wMl8wMSIsInRyYW5zZm9ybSI6eyJ4Ijo0NS4wMSwieSI6LTcuMTIsInNrWCI6MTM4LjU5LCJza1kiOjEzOC41OX19XX0seyJuYW1lIjoiZWZmZWN0X2Rvd25fMyIsImRpc3BsYXkiOlt7Im5hbWUiOiJtZWxsb3dkcmFnb25fZGFya18wM19yb2NrZXRfMDNfMDUiLCJ0cmFuc2Zvcm0iOnsieCI6NDQuMzIsInkiOi04Ljk0LCJza1giOjkxLjM2LCJza1kiOjkxLjM2fX1dfSx7Im5hbWUiOiJlZmZlY3RfZG93bl80IiwiZGlzcGxheSI6W3sibmFtZSI6Im1lbGxvd2RyYWdvbl9kYXJrXzAzX3JvY2tldF8wM18wNSIsInRyYW5zZm9ybSI6eyJ4Ijo0NC4zMiwieSI6LTguOTQsInNrWCI6OTEuMzYsInNrWSI6OTEuMzZ9fV19LHsibmFtZSI6Im1lbGxvd2RyYWdvbl9kYXJrXzAzX2xlZ18wMSIsImRpc3BsYXkiOlt7InR5cGUiOiJtZXNoIiwibmFtZSI6Im1lbGxvd2RyYWdvbl9kYXJrXzAzX2xlZ18wMSIsIm9mZnNldCI6MjA5LCJ1c2VyRWRnZXMiOltdfV19LHsibmFtZSI6Im1lbGxvd2RyYWdvbl9kYXJrXzAzX3NjYXJmXzAyIiwiZGlzcGxheSI6W3sibmFtZSI6Im1lbGxvd2RyYWdvbl9kYXJrXzAzX3NjYXJmXzAyIiwidHJhbnNmb3JtIjp7IngiOjguMzMsInkiOi0yLjIzLCJza1giOi0xMC4yMSwic2tZIjotMTAuMjF9fV19LHsibmFtZSI6ImVmZmVjdF9yZWQiLCJkaXNwbGF5IjpbeyJuYW1lIjoibWVsbG93ZHJhZ29uX2RhcmtfMDNfZWZmZWN0X3JlZCJ9XX0seyJuYW1lIjoibWVsbG93ZHJhZ29uX2RhcmtfMDNfaGFuZF8wMSIsImRpc3BsYXkiOlt7Im5hbWUiOiJtZWxsb3dkcmFnb25fZGFya18wM19oYW5kXzAxIiwidHJhbnNmb3JtIjp7IngiOjE2LjgyLCJ5IjoxLjk0LCJza1giOi0zLjksInNrWSI6LTMuOX19XX0seyJuYW1lIjoibWVsbG93ZHJhZ29uX2RhcmtfMDNfcm9ja2V0XzA0XzAzIiwiZGlzcGxheSI6W3sibmFtZSI6Im1lbGxvd2RyYWdvbl9kYXJrXzAzX3JvY2tldF8wNF8wMyIsInRyYW5zZm9ybSI6eyJ4IjoxNi41NywieSI6LTAuODQsInNrWCI6LTE4LjI5LCJza1kiOi0xOC4yOX19XX0seyJuYW1lIjoibWVsbG93ZHJhZ29uX2RhcmtfMDNfcm9ja2V0XzAxXzAxIiwiZGlzcGxheSI6W3sibmFtZSI6Im1lbGxvd2RyYWdvbl9kYXJrXzAzX3JvY2tldF8wMV8wMSIsInRyYW5zZm9ybSI6eyJ4IjoxOC44NCwieSI6LTEuNTksInNrWCI6MTM4Ljg3LCJza1kiOjEzOC44N319XX0seyJuYW1lIjoibWVsbG93ZHJhZ29uX2RhcmtfMDNfZXllXzAxIiwiZGlzcGxheSI6W3sidHlwZSI6Im1lc2giLCJuYW1lIjoibWVsbG93ZHJhZ29uX2RhcmtfMDNfZXllXzAxIiwib2Zmc2V0Ijo1NzksInVzZXJFZGdlcyI6W119LHsibmFtZSI6Im1lbGxvd2RyYWdvbl9kYXJrXzAzX2V5ZV8wMiIsInRyYW5zZm9ybSI6eyJ4IjoxNi4wMiwieSI6LTExLjYzLCJza1giOjc5LjM0LCJza1kiOjc5LjM0fX0seyJuYW1lIjoibWVsbG93ZHJhZ29uX2RhcmtfMDNfZXllXzAzIiwidHJhbnNmb3JtIjp7IngiOjE0Ljk3LCJ5IjotMTEuNTYsInNrWCI6NzkuMzQsInNrWSI6NzkuMzR9fSx7Im5hbWUiOiJtZWxsb3dkcmFnb25fZGFya18wM19leWVfMDQiLCJ0cmFuc2Zvcm0iOnsieCI6MTQuOTcsInkiOi0xMS41Niwic2tYIjo3OS4zNCwic2tZIjo3OS4zNH19XX0seyJuYW1lIjoibWVsbG93ZHJhZ29uX2RhcmtfMDNfZWFyXzAxIiwiZGlzcGxheSI6W3sidHlwZSI6Im1lc2giLCJuYW1lIjoibWVsbG93ZHJhZ29uX2RhcmtfMDNfZWFyXzAxIiwib2Zmc2V0Ijo3MzcsInVzZXJFZGdlcyI6W119XX0seyJuYW1lIjoiZWZmZWN0XzAyIiwiZGlzcGxheSI6W3sibmFtZSI6Im1lbGxvd2RyYWdvbl9kYXJrXzAzX2VmZmVjdF8wMiJ9XX0seyJuYW1lIjoiZWZmZWN0X2xpZ2h0ZHVzdDIiLCJkaXNwbGF5IjpbeyJuYW1lIjoibWVsbG93ZHJhZ29uX2RhcmtfMDNfZWZmZWN0X2xpZ2h0ZHVzdCIsInRyYW5zZm9ybSI6eyJ4IjozMi42NywieSI6LTAuNjMsInNrWCI6OTguOTQsInNrWSI6OTguOTR9fV19LHsibmFtZSI6Im1lbGxvd2RyYWdvbl9kYXJrXzAzX3NjYXJmXzAxIiwiZGlzcGxheSI6W3sibmFtZSI6Im1lbGxvd2RyYWdvbl9kYXJrXzAzX3NjYXJmXzAxIiwidHJhbnNmb3JtIjp7IngiOjU0LjgxLCJ5IjotNi4wNSwic2tYIjo2OC4xMiwic2tZIjo2OC4xMn19XX0seyJuYW1lIjoibWVsbG93ZHJhZ29uX2RhcmtfMDNfZWFyXzAyIiwiZGlzcGxheSI6W3sidHlwZSI6Im1lc2giLCJuYW1lIjoibWVsbG93ZHJhZ29uX2RhcmtfMDNfZWFyXzAyIiwib2Zmc2V0IjoxMDMzLCJ1c2VyRWRnZXMiOltdfV19LHsibmFtZSI6ImVmZmVjdF9saWdodDIiLCJkaXNwbGF5IjpbeyJuYW1lIjoibWVsbG93ZHJhZ29uX2RhcmtfMDNfZWZmZWN0X2xpZ2h0In1dfSx7Im5hbWUiOiJlZmZlY3RfZG93bl8xIiwiZGlzcGxheSI6W3sibmFtZSI6Im1lbGxvd2RyYWdvbl9kYXJrXzAzX3JvY2tldF8wM18wNCIsInRyYW5zZm9ybSI6eyJ4Ijo2OS41MywieSI6LTQuNTcsInNrWCI6LTkyLjcyLCJza1kiOi05Mi43Mn19XX0seyJuYW1lIjoibWVsbG93ZHJhZ29uX2RhcmtfMDNfcm9ja2V0XzA0XzAyIiwiZGlzcGxheSI6W3sibmFtZSI6Im1lbGxvd2RyYWdvbl9kYXJrXzAzX3JvY2tldF8wNF8wMiIsInRyYW5zZm9ybSI6eyJ4IjoyMS41NiwieSI6MC42Mywic2tYIjotOC41LCJza1kiOi04LjV9fV19LHsibmFtZSI6Im1lbGxvd2RyYWdvbl9kYXJrXzAzX2FybV8wMiIsImRpc3BsYXkiOlt7Im5hbWUiOiJtZWxsb3dkcmFnb25fZGFya18wM19hcm1fMDIiLCJ0cmFuc2Zvcm0iOnsieCI6MTYuNjcsInkiOi0xLjk4LCJza1giOjE2OC43LCJza1kiOjE2OC43fX1dfSx7Im5hbWUiOiJlZmZlY3RfMDciLCJkaXNwbGF5IjpbeyJuYW1lIjoibWVsbG93ZHJhZ29uX2RhcmtfMDNfZWZmZWN0XzA3IiwidHJhbnNmb3JtIjp7IngiOjAuMjUsInkiOi0wLjA4fX1dfSx7Im5hbWUiOiJtZWxsb3dkcmFnb25fZGFya18wM19nbG92ZXNfMDEiLCJkaXNwbGF5IjpbeyJ0eXBlIjoibWVzaCIsIm5hbWUiOiJtZWxsb3dkcmFnb25fZGFya18wM19nbG92ZXNfMDEiLCJvZmZzZXQiOjE4MjcsInVzZXJFZGdlcyI6W119XX0seyJuYW1lIjoiZWZmZWN0XzAzIiwiZGlzcGxheSI6W3sibmFtZSI6Im1lbGxvd2RyYWdvbl9kYXJrXzAzX2VmZmVjdF8wMyJ9XX0seyJuYW1lIjoiZWZmZWN0XzAxIiwiZGlzcGxheSI6W3sibmFtZSI6Im1lbGxvd2RyYWdvbl9kYXJrXzAzX2VmZmVjdF8wMSJ9XX0seyJuYW1lIjoibWVsbG93ZHJhZ29uX2RhcmtfMDNfaG9ybl8wMiIsImRpc3BsYXkiOlt7Im5hbWUiOiJtZWxsb3dkcmFnb25fZGFya18wM19ob3JuXzAyIiwidHJhbnNmb3JtIjp7IngiOjE2LjM4LCJ5IjotNS4xNiwic2tYIjo4MC4yNCwic2tZIjo4MC4yNH19XX0seyJuYW1lIjoibWVsbG93ZHJhZ29uX2RhcmtfMDNfZWZmZWN0XzA4IiwiZGlzcGxheSI6W3sibmFtZSI6Im1lbGxvd2RyYWdvbl9kYXJrXzAzX2VmZmVjdF8wOCJ9LHsibmFtZSI6Im1lbGxvd2RyYWdvbl9kYXJrXzAzX2VmZmVjdF8wOSJ9XX0seyJuYW1lIjoiZWZmZWN0X2xpZ2h0IiwiZGlzcGxheSI6W3sibmFtZSI6Im1lbGxvd2RyYWdvbl9kYXJrXzAzX2VmZmVjdF9saWdodCJ9XX0seyJuYW1lIjoiZWZmZWN0XzA0IiwiZGlzcGxheSI6W3sibmFtZSI6Im1lbGxvd2RyYWdvbl9kYXJrXzAzX2VmZmVjdF8wNCJ9XX0seyJuYW1lIjoibWVsbG93ZHJhZ29uX2RhcmtfMDNfam95XzAzXzAxIiwiZGlzcGxheSI6W3sibmFtZSI6Im1lbGxvd2RyYWdvbl9kYXJrXzAzX2pveV8wM18wMSIsInRyYW5zZm9ybSI6eyJ4IjotMjQuNjksInkiOi0xNC41Mn19XX0seyJuYW1lIjoibWVsbG93ZHJhZ29uX2RhcmtfMDNfaGVhZF8wMSIsImRpc3BsYXkiOlt7Im5hbWUiOiJtZWxsb3dkcmFnb25fZGFya18wM19oZWFkXzAxIiwidHJhbnNmb3JtIjp7IngiOjY3Ljg3LCJ5IjotNy4yNywic2tYIjo3OS4zNCwic2tZIjo3OS4zNH19XX0seyJuYW1lIjoibWVsbG93ZHJhZ29uX2RhcmtfMDNfZm9vdF8wMiIsImRpc3BsYXkiOlt7InR5cGUiOiJtZXNoIiwibmFtZSI6Im1lbGxvd2RyYWdvbl9kYXJrXzAzX2Zvb3RfMDIiLCJvZmZzZXQiOjIxMzAsInVzZXJFZGdlcyI6W119XX0seyJuYW1lIjoiZWZmZWN0X2JsdWUiLCJkaXNwbGF5IjpbeyJuYW1lIjoibWVsbG93ZHJhZ29uX2RhcmtfMDNfZWZmZWN0X2JsdWUiLCJ0cmFuc2Zvcm0iOnsieCI6MTIuMzgsInkiOjAuMzUsInNrWCI6LTIuMjUsInNrWSI6LTIuMjV9fV19LHsibmFtZSI6Im1lbGxvd2RyYWdvbl9kYXJrXzAzX3JvY2tldF8wMiIsImRpc3BsYXkiOlt7Im5hbWUiOiJtZWxsb3dkcmFnb25fZGFya18wM19yb2NrZXRfMDIiLCJ0cmFuc2Zvcm0iOnsieCI6LTEuOTksInkiOjcuNjh9fV19LHsibmFtZSI6ImVmZmVjdF9kb3duXzIiLCJkaXNwbGF5IjpbeyJuYW1lIjoibWVsbG93ZHJhZ29uX2RhcmtfMDNfcm9ja2V0XzAzXzA0IiwidHJhbnNmb3JtIjp7IngiOjQ5LjIzLCJ5IjotMy42MSwic2tYIjotOTIuNzIsInNrWSI6LTkyLjcyfX1dfSx7Im5hbWUiOiJtZWxsb3dkcmFnb25fZGFya18wM19yb2NrZXRfMDNfMDMiLCJkaXNwbGF5IjpbeyJuYW1lIjoibWVsbG93ZHJhZ29uX2RhcmtfMDNfcm9ja2V0XzAzXzAzIiwidHJhbnNmb3JtIjp7IngiOjI5LjkzLCJ5IjotMC42Niwic2tYIjotOTMuMTUsInNrWSI6LTkzLjE1fX1dfSx7Im5hbWUiOiJlZmZlY3RfbGlnaHRpbmciLCJkaXNwbGF5IjpbeyJuYW1lIjoibWVsbG93ZHJhZ29uX2RhcmtfMDNfcm9ja2V0XzA0XzA3IiwidHJhbnNmb3JtIjp7IngiOjQxLjE0LCJ5IjotMjcuNDIsInNrWCI6ODkuMDksInNrWSI6ODkuMDl9fSx7Im5hbWUiOiJtZWxsb3dkcmFnb25fZGFya18wM19yb2NrZXRfMDRfMDgiLCJ0cmFuc2Zvcm0iOnsieCI6NDYuMjYsInkiOi02MC42MSwic2tYIjotODUuNDcsInNrWSI6LTg1LjQ3LCJzY1giOjAuNzYsInNjWSI6MC43Nn19XX0seyJuYW1lIjoibWVsbG93ZHJhZ29uX2RhcmtfMDNfcm9ja2V0XzA0XzA1IiwiZGlzcGxheSI6W3sibmFtZSI6Im1lbGxvd2RyYWdvbl9kYXJrXzAzX3JvY2tldF8wNF8wNSIsInRyYW5zZm9ybSI6eyJ4IjoxMy45MiwieSI6MC41OCwic2tYIjotMjMuNTEsInNrWSI6LTIzLjUxfX1dfSx7Im5hbWUiOiJtZWxsb3dkcmFnb25fZGFya18wM19nb2dnbGVzXzAxIiwiZGlzcGxheSI6W3sibmFtZSI6Im1lbGxvd2RyYWdvbl9kYXJrXzAzX2dvZ2dsZXNfMDEiLCJ0cmFuc2Zvcm0iOnsieCI6NTcuNTEsInkiOjE3LjkxLCJza1giOjQuMDEsInNrWSI6NC4wMX19XX0seyJuYW1lIjoibWVsbG93ZHJhZ29uX2RhcmtfMDNfam95XzAyIiwiZGlzcGxheSI6W3sibmFtZSI6Im1lbGxvd2RyYWdvbl9kYXJrXzAzX2pveV8wMiIsInRyYW5zZm9ybSI6eyJ4IjoxMS4zLCJ5IjotOS41Mn19XX0seyJuYW1lIjoibWVsbG93ZHJhZ29uX2RhcmtfMDNfam95XzAzIiwiZGlzcGxheSI6W3sibmFtZSI6Im1lbGxvd2RyYWdvbl9kYXJrXzAzX2pveV8wMyIsInRyYW5zZm9ybSI6eyJ4IjotMjQuNjksInkiOi0xMi4wMn19XX0seyJuYW1lIjoiZWZmZWN0X2xpZ2h0ZHVzdCIsImRpc3BsYXkiOlt7Im5hbWUiOiJtZWxsb3dkcmFnb25fZGFya18wM19lZmZlY3RfbGlnaHRkdXN0IiwidHJhbnNmb3JtIjp7IngiOjM0LjUzLCJ5IjozLjEzLCJza1giOjkwLCJza1kiOjkwfX1dfSx7Im5hbWUiOiJtZWxsb3dkcmFnb25fZGFya18wM19sZWdfMDIiLCJkaXNwbGF5IjpbeyJ0eXBlIjoibWVzaCIsIm5hbWUiOiJtZWxsb3dkcmFnb25fZGFya18wM19sZWdfMDIiLCJvZmZzZXQiOjI0NTgsInVzZXJFZGdlcyI6W119XX0seyJuYW1lIjoibWVsbG93ZHJhZ29uX2RhcmtfMDNfd2luZ18wMiIsImRpc3BsYXkiOlt7InR5cGUiOiJtZXNoIiwibmFtZSI6Im1lbGxvd2RyYWdvbl9kYXJrXzAzX3dpbmdfMDIiLCJvZmZzZXQiOjI3NDgsInVzZXJFZGdlcyI6W119XX0seyJuYW1lIjoiZWZmZWN0XzA1IiwiZGlzcGxheSI6W3sibmFtZSI6Im1lbGxvd2RyYWdvbl9kYXJrXzAzX2VmZmVjdF8wNSJ9LHsibmFtZSI6Im1lbGxvd2RyYWdvbl9kYXJrXzAzX2VmZmVjdF8wNiJ9XX0seyJuYW1lIjoibWVsbG93ZHJhZ29uX2RhcmtfMDNfcm9ja2V0XzAzXzAyIiwiZGlzcGxheSI6W3sibmFtZSI6Im1lbGxvd2RyYWdvbl9kYXJrXzAzX3JvY2tldF8wM18wMiIsInRyYW5zZm9ybSI6eyJ4IjoyNy42MSwieSI6LTEuOTksInNrWCI6LTkxLjgsInNrWSI6LTkxLjh9fV19LHsibmFtZSI6Im1lbGxvd2RyYWdvbl9kYXJrXzAzX2pveV8wNSIsImRpc3BsYXkiOlt7Im5hbWUiOiJtZWxsb3dkcmFnb25fZGFya18wM19qb3lfMDUiLCJ0cmFuc2Zvcm0iOnsieCI6LTAuNjksInkiOi0xLjUyfX1dfSx7Im5hbWUiOiJtZWxsb3dkcmFnb25fZGFya18wM19yb2NrZXRfMDRfMDQiLCJkaXNwbGF5IjpbeyJuYW1lIjoibWVsbG93ZHJhZ29uX2RhcmtfMDNfcm9ja2V0XzA0XzA0IiwidHJhbnNmb3JtIjp7IngiOjE2LjI5LCJ5IjoxLjMyLCJza1giOi0xMS41NCwic2tZIjotMTEuNTR9fV19LHsibmFtZSI6Im1lbGxvd2RyYWdvbl9kYXJrXzAzX2hhbmRfMDFfMDEiLCJkaXNwbGF5IjpbeyJuYW1lIjoibWVsbG93ZHJhZ29uX2RhcmtfMDNfaGFuZF8wMV8wMSIsInRyYW5zZm9ybSI6eyJ4Ijo1Ljg2LCJ5IjozLjM2LCJza1giOjEyOS4xMSwic2tZIjoxMjkuMTF9fV19LHsibmFtZSI6ImVmZmVjdF81IiwiZGlzcGxheSI6W3sibmFtZSI6Im1lbGxvd2RyYWdvbl9kYXJrXzAzX2VmZmVjdF8wNSJ9LHsibmFtZSI6Im1lbGxvd2RyYWdvbl9kYXJrXzAzX2VmZmVjdF8wNiJ9XX0seyJuYW1lIjoiZWZmZWN0X2xpZ2h0ZHVzdDMiLCJkaXNwbGF5IjpbeyJuYW1lIjoibWVsbG93ZHJhZ29uX2RhcmtfMDNfZWZmZWN0X2xpZ2h0ZHVzdCIsInRyYW5zZm9ybSI6eyJ4IjozNC41MywieSI6My4xMywic2tYIjo5MCwic2tZIjo5MH19XX0seyJuYW1lIjoibWVsbG93ZHJhZ29uX2RhcmtfMDNfcm9ja2V0XzA0IiwiZGlzcGxheSI6W3sibmFtZSI6Im1lbGxvd2RyYWdvbl9kYXJrXzAzX3JvY2tldF8wNCIsInRyYW5zZm9ybSI6eyJ4IjotMTAuNDEsInkiOjUuMzh9fV19LHsibmFtZSI6Im1lbGxvd2RyYWdvbl9kYXJrXzAzX3JvY2tldF8wMV8wMyIsImRpc3BsYXkiOlt7Im5hbWUiOiJtZWxsb3dkcmFnb25fZGFya18wM19yb2NrZXRfMDFfMDMiLCJ0cmFuc2Zvcm0iOnsieCI6NDcuNjgsInkiOi0zLjI1LCJza1giOjE1MS45Nywic2tZIjoxNTEuOTd9fV19LHsibmFtZSI6Im1lbGxvd2RyYWdvbl9kYXJrXzAzX2pveV8wMSIsImRpc3BsYXkiOlt7Im5hbWUiOiJtZWxsb3dkcmFnb25fZGFya18wM19qb3lfMDEiLCJ0cmFuc2Zvcm0iOnsieCI6MjAuNTUsInkiOi0wLjkyLCJza1giOjkwLjksInNrWSI6OTAuOX19XX0seyJuYW1lIjoibWVsbG93ZHJhZ29uX2RhcmtfMDNfaG9ybl8wMSIsImRpc3BsYXkiOlt7Im5hbWUiOiJtZWxsb3dkcmFnb25fZGFya18wM19ob3JuXzAxIiwidHJhbnNmb3JtIjp7IngiOjIyLjEzLCJ5IjoxLjEyLCJza1giOjk4LjE4LCJza1kiOjk4LjE4fX1dfSx7Im5hbWUiOiJtZWxsb3dkcmFnb25fZGFya18wM19qb3lfMDRfMDEiLCJkaXNwbGF5IjpbeyJuYW1lIjoibWVsbG93ZHJhZ29uX2RhcmtfMDNfam95XzA0XzAxIiwidHJhbnNmb3JtIjp7IngiOi04LjE5LCJ5IjotMjIuNTJ9fV19LHsibmFtZSI6Im1lbGxvd2RyYWdvbl9kYXJrXzAzX2JvZHlfMDEiLCJkaXNwbGF5IjpbeyJ0eXBlIjoibWVzaCIsIm5hbWUiOiJtZWxsb3dkcmFnb25fZGFya18wM19ib2R5XzAxIiwib2Zmc2V0IjozNDA2LCJ1c2VyRWRnZXMiOltdfV19LHsibmFtZSI6Im1lbGxvd2RyYWdvbl9kYXJrXzAzX3dpbmdfMDEiLCJkaXNwbGF5IjpbeyJ0eXBlIjoibWVzaCIsIm5hbWUiOiJtZWxsb3dkcmFnb25fZGFya18wM193aW5nXzAxIiwib2Zmc2V0Ijo0MDI5LCJ1c2VyRWRnZXMiOltdfV19LHsibmFtZSI6ImVmZmVjdF82IiwiZGlzcGxheSI6W3sibmFtZSI6Im1lbGxvd2RyYWdvbl9kYXJrXzAzX2VmZmVjdF8wNSJ9LHsibmFtZSI6Im1lbGxvd2RyYWdvbl9kYXJrXzAzX2VmZmVjdF8wNiJ9XX1dfV0sImFuaW1hdGlvbiI6W3siZHVyYXRpb24iOjM1LCJuYW1lIjoiYXR0YWNrIiwiYWN0aW9uIjowLCJvZmZzZXQiOlswLDAsMF0sImJvbmUiOnsibWVsbG93ZHJhZ29uX2RhcmtfMDNfZWZmZWN0X2xpZ2h0IjpbMTMsN10sIm1lbGxvd2RyYWdvbl9kYXJrXzAzX3JvY2tldF8wMiI6WzExLDI3LDEyLDM3XSwibWVsbG93ZHJhZ29uX2RhcmtfMDNfcm9ja2V0XzAxXzAzIjpbMTMsNDZdLCJtZWxsb3dkcmFnb25fZGFya18wM193aW5nXzAyIjpbMTIsNjVdLCJtZWxsb3dkcmFnb25fZGFya18wM19yb2NrZXRfMDEiOlsxMSw3NiwxMiw4NiwxMyw5NV0sIm1lbGxvd2RyYWdvbl9kYXJrXzAzX2FybV8wMSI6WzEyLDEwNV0sIm1lbGxvd2RyYWdvbl9kYXJrXzAzX2dvZ2dsZXNfMDEiOlsxMiwxMTFdLCJib25lMjQiOlsxMiwxMjFdLCJtZWxsb3dkcmFnb25fZGFya18wM19oYW5kXzAxIjpbMTEsMTMzLDEyLDE0M10sImJvbmU0MiI6WzEyLDE1M10sIm1lbGxvd2RyYWdvbl9kYXJrXzAzX2pveV8wMSI6WzEyLDE2NV0sImJvbmUzNCI6WzEyLDE3NV0sIm1lbGxvd2RyYWdvbl9kYXJrXzAzX3JvY2tldF8wMV8wMiI6WzExLDE4MSwxMywxOThdLCJib25lMzgiOlsxMiwyMTVdLCJib25lNDkiOlsxMywyMjddLCJtZWxsb3dkcmFnb25fZGFya18wM19ib2R5XzAxIjpbMTEsMjUxLDEyLDI2MF0sImJvbmUyMiI6WzEyLDI3MF0sImJvbmUzNSI6WzEyLDI4Ml0sImJvbmUxMiI6WzEyLDI4OF0sImJvbmUyMyI6WzEyLDI5NF0sImJvbmU5IjpbMTIsMzA2XSwiYm9uZTM5IjpbMTIsMzE3XSwibWVsbG93ZHJhZ29uX2RhcmtfMDNfZWZmZWN0X2xpZ2h0MiI6WzEzLDMyOV0sIm1lbGxvd2RyYWdvbl9kYXJrXzAzX2Vhcl8wMiI6WzEyLDM0OV0sIm1lbGxvd2RyYWdvbl9kYXJrXzAzX3JvY2tldF8wM18wMyI6WzEzLDM2MF0sIm1lbGxvd2RyYWdvbl9kYXJrXzAzX2hvcm5fMDEiOlsxMiwzODRdLCJtZWxsb3dkcmFnb25fZGFya18wM19oZWFkXzAxIjpbMTIsMzkwXSwibWVsbG93ZHJhZ29uX2RhcmtfMDNfcm9ja2V0XzAyXzAxIjpbMTMsMzk5XSwiYm9uZTIxIjpbMTIsNDI3XSwiYm9uZTgiOlsxMiw0MzldLCJib25lNDEiOlsxMiw0NTBdLCJtZWxsb3dkcmFnb25fZGFya18wM19lZmZlY3RfbGlnaHRkdXN0MiI6WzEzLDQ2Ml0sImhpcCI6WzExLDQ4MSwxMiw0OTFdLCJsZWdfbCI6WzExLDUwMSwxMiw1MTFdLCJtZWxsb3dkcmFnb25fZGFya18wM19zY2FyZl8wMiI6WzEyLDUyMV0sImxlZ19yIjpbMTEsNTI3LDEyLDUzN10sIm1lbGxvd2RyYWdvbl9kYXJrXzAzX2hvcm5fMDIiOlsxMiw1NDddLCJtZWxsb3dkcmFnb25fZGFya18wM19yb2NrZXRfMDMiOlsxMSw1NTMsMTIsNTYzXSwiYm9uZTYiOlsxMiw1NzNdLCJib25lNDAiOlsxMiw1ODRdLCJtZWxsb3dkcmFnb25fZGFya18wM19oYW5kXzAxXzAxIjpbMTEsNTk2LDEyLDYwMl0sIm1lbGxvd2RyYWdvbl9kYXJrXzAzX3RhaWxfMDEiOlsxMiw2MDhdLCJib25lMjAiOlsxMiw2MTRdLCJtZWxsb3dkcmFnb25fZGFya18wM19hcm1fMDIgY29weSI6WzExLDYyNiwxMiw2MzVdLCJib25lMTkiOlsxMiw2NDRdLCJib25lMzciOlsxMiw2NTZdLCJib25lNSI6WzEyLDY2OF0sIm1lbGxvd2RyYWdvbl9kYXJrXzAzX3dpbmdfMDEiOlsxMiw2NzldLCJtZWxsb3dkcmFnb25fZGFya18wM19lYXJfMDEiOlsxMiw2OTFdLCJtZWxsb3dkcmFnb25fZGFya18wM19yb2NrZXRfMDNfMDEiOlsxMyw3MDJdLCJhdHRhY2siOlsxMSw3MjZdLCJlZmZlY3RfcmVkIjpbMTMsNzMzXSwiZWZmZWN0IjpbMTEsNzQxLDEzLDc0OF0sImVmZmVjdF9ib3R0b21fMSI6WzExLDc1NSwxMyw3NjRdLCJlZmZlY3RfYm90dG9tXzIiOlsxMSw3NzMsMTMsNzg0XSwiZWZmZWN0X2ZpcmUiOlsxMSw3OTUsMTMsODAzXSwiZWZmZWN0X2Rvd25fMSI6WzExLDgxMSwxMyw4MjJdLCJlZmZlY3RfZG93bl8yIjpbMTEsODMzLDEzLDg0Nl0sImVmZmVjdF9saWdodDMiOlsxMSw4NTksMTMsODY2XSwiZWZmZWN0X2xpZ2h0ZHVzdDMiOlsxMyw4NzNdfSwic2xvdCI6eyJlZmZlY3RfMDEiOlsyMSw4ODFdLCJlZmZlY3RfMDIiOlsyMSw4ODddLCJlZmZlY3RfMDMiOlsyMSw4OTNdLCJlZmZlY3RfMDQiOlsyMSw4OTldLCJlZmZlY3RfMDUiOlsyMSw5MDVdLCJlZmZlY3RfNSI6WzIxLDkxMV0sImVmZmVjdF82IjpbMjEsOTE3XSwiZWZmZWN0XzA3IjpbMjEsOTIzXSwiZWZmZWN0XzA0XzAxIjpbMjEsOTI5XSwiZWZmZWN0X2JsdWUiOlsyMSw5MzVdLCJlZmZlY3RfZG93bl8xIjpbMjAsOTQxLDIxLDk1MF0sImVmZmVjdF9kb3duXzIiOlsyMCw5NjQsMjEsOTc1XSwiZWZmZWN0X2Rvd25fMyI6WzIwLDk5MiwyMSw5OTldLCJlZmZlY3RfZG93bl80IjpbMjAsMTAwOSwyMSwxMDE4XSwiZWZmZWN0X2ZpcmUiOlsyMCwxMDMyLDIxLDEwMzldLCJlZmZlY3RfbGlnaHQzIjpbMjAsMTA0OCwyMSwxMDU1XSwiZWZmZWN0X2xpZ2h0ZHVzdCI6WzIxLDEwNjJdLCJlZmZlY3RfbGlnaHRkdXN0MiI6WzIxLDEwNjhdLCJlZmZlY3RfbGlnaHRkdXN0MyI6WzIwLDEwNzQsMjEsMTA4MV0sImVmZmVjdF9saWdodGluZyI6WzIwLDEwOTAsMjEsMTA5Nl0sImVmZmVjdF9yZWQiOlsyMCwxMTAyLDIxLDExMDldLCJtZWxsb3dkcmFnb25fZGFya18wM19lZmZlY3RfMDgiOlsyMSwxMTE4XSwibWVsbG93ZHJhZ29uX2RhcmtfMDNfaGVhZF8xIjpbMjAsMTEyNF0sIm1lbGxvd2RyYWdvbl9kYXJrXzAzX3JvY2tldF8wNCI6WzIxLDExMzFdLCJtZWxsb3dkcmFnb25fZGFya18wM19yb2NrZXRfMDFfMDIiOlsyMCwxMTM3LDIxLDExNDldLCJtZWxsb3dkcmFnb25fZGFya18wM19yb2NrZXRfMDRfMDIiOlsyMSwxMTY0XSwibWVsbG93ZHJhZ29uX2RhcmtfMDNfcm9ja2V0XzA0XzAzIjpbMjEsMTE3MF0sIm1lbGxvd2RyYWdvbl9kYXJrXzAzX3JvY2tldF8wNF8wNCI6WzIxLDExNzZdLCJtZWxsb3dkcmFnb25fZGFya18wM19yb2NrZXRfMDRfMDUiOlsyMSwxMTgyXSwicm9ja2V0X2xpZ2h0IjpbMjEsMTE4OF19fSx7ImR1cmF0aW9uIjo2MCwibmFtZSI6ImlkbGUiLCJvZmZzZXQiOls3OSw5NTgsMjg5Ml0sImJvbmUiOnsibWVsbG93ZHJhZ29uX2RhcmtfMDNfYm9keV8wMSI6WzEyLDExOTRdLCJtZWxsb3dkcmFnb25fZGFya18wM19hcm1fMDEiOlsxMiwxMjAyXSwibWVsbG93ZHJhZ29uX2RhcmtfMDNfZ2xvdmVzXzAxIjpbMTIsMTIxMV0sIm1lbGxvd2RyYWdvbl9kYXJrXzAzX2pveV8wMSI6WzEyLDEyMTldLCJtZWxsb3dkcmFnb25fZGFya18wM19oYW5kXzAxXzAxIjpbMTEsMTIyOCwxMiwxMjM3XSwibWVsbG93ZHJhZ29uX2RhcmtfMDNfYXJtXzAyIGNvcHkiOlsxMiwxMjQ2XSwibWVsbG93ZHJhZ29uX2RhcmtfMDNfaGFuZF8wMSI6WzEyLDEyNTRdLCJtZWxsb3dkcmFnb25fZGFya18wM19oZWFkXzAxIjpbMTIsMTI2M10sIm1lbGxvd2RyYWdvbl9kYXJrXzAzX2Vhcl8wMSI6WzEyLDEyNzJdLCJtZWxsb3dkcmFnb25fZGFya18wM19lYXJfMDIiOlsxMiwxMjgwXSwibWVsbG93ZHJhZ29uX2RhcmtfMDNfZ29nZ2xlc18wMSI6WzEyLDEyODhdLCJtZWxsb3dkcmFnb25fZGFya18wM19ob3JuXzAxIjpbMTIsMTI5N10sIm1lbGxvd2RyYWdvbl9kYXJrXzAzX2hvcm5fMDIiOlsxMiwxMzA2XSwibWVsbG93ZHJhZ29uX2RhcmtfMDNfc2NhcmZfMDIiOlsxMiwxMzE1XSwibWVsbG93ZHJhZ29uX2RhcmtfMDNfd2luZ18wMSI6WzEyLDEzMjRdLCJtZWxsb3dkcmFnb25fZGFya18wM193aW5nXzAyIjpbMTIsMTMzNl0sIm1lbGxvd2RyYWdvbl9kYXJrXzAzX3RhaWxfMDEiOlsxMiwxMzQ3XSwibWVsbG93ZHJhZ29uX2RhcmtfMDNfcm9ja2V0XzAxIjpbMTEsMTM1NiwxMywxMzY0XSwibWVsbG93ZHJhZ29uX2RhcmtfMDNfZWZmZWN0X2xpZ2h0IjpbMTMsMTM3Ml0sIm1lbGxvd2RyYWdvbl9kYXJrXzAzX3JvY2tldF8wMV8wMSI6WzEyLDEzOThdLCJtZWxsb3dkcmFnb25fZGFya18wM19yb2NrZXRfMDFfMDIiOlsxMSwxNDIxLDEzLDE0NDhdLCJtZWxsb3dkcmFnb25fZGFya18wM19yb2NrZXRfMDFfMDMiOlsxMywxNDc1XSwibWVsbG93ZHJhZ29uX2RhcmtfMDNfcm9ja2V0XzAyIjpbMTEsMTUwM10sIm1lbGxvd2RyYWdvbl9kYXJrXzAzX2VmZmVjdF9saWdodDIiOlsxMywxNTExXSwibWVsbG93ZHJhZ29uX2RhcmtfMDNfZWZmZWN0X2xpZ2h0ZHVzdDIiOlsxMywxNTM3XSwibWVsbG93ZHJhZ29uX2RhcmtfMDNfcm9ja2V0XzAyXzAxIjpbMTMsMTU2NV0sIm1lbGxvd2RyYWdvbl9kYXJrXzAzX3JvY2tldF8wMyI6WzExLDE1OTMsMTIsMTYwM10sImJvbmU0OSI6WzEzLDE2MTNdLCJtZWxsb3dkcmFnb25fZGFya18wM19yb2NrZXRfMDNfMDEiOlsxMywxNjQ5XSwibWVsbG93ZHJhZ29uX2RhcmtfMDNfcm9ja2V0XzAzXzAzIjpbMTMsMTY4NV0sImxlZ19yIjpbMTEsMTcyMSwxMiwxNzMxXSwibGVnX2wiOlsxMSwxNzQxLDEyLDE3NTFdLCJib25lMzUiOlsxMiwxNzYxXSwiYm9uZTM0IjpbMTIsMTc3MF0sImJvbmU0MiI6WzEyLDE3NzldLCJib25lNDEiOlsxMiwxNzkxXSwiYm9uZTQwIjpbMTIsMTgwM10sImJvbmUzOSI6WzEyLDE4MTVdLCJib25lMzgiOlsxMiwxODI3XSwiYm9uZTM3IjpbMTIsMTgzOV0sImJvbmUyNCI6WzEyLDE4NTFdLCJib25lMjMiOlsxMiwxODYzXSwiYm9uZTIyIjpbMTIsMTg3NV0sImJvbmUyMSI6WzEyLDE4ODddLCJib25lMjAiOlsxMiwxODk5XSwiYm9uZTE5IjpbMTIsMTkxMV0sImJvbmU2IjpbMTIsMTkyM10sImJvbmU1IjpbMTIsMTkzMl0sImJvbmU5IjpbMTIsMTk0MV0sImJvbmU4IjpbMTIsMTk1MF0sImJvbmUxMiI6WzEyLDE5NTldLCJoaXAiOlsxMSwxOTY4LDEyLDE5NzZdLCJlZmZlY3RfYm90dG9tXzIiOlsxMSwxOTg0LDEzLDE5OTRdLCJlZmZlY3RfYm90dG9tXzEiOlsxMSwyMDA0LDEzLDIwMTJdLCJlZmZlY3RfZG93bl8xIjpbMTEsMjAyMCwxMywyMDMwXSwiZWZmZWN0X2Rvd25fMiI6WzExLDIwNDAsMTMsMjA1MV19LCJzbG90Ijp7ImVmZmVjdF8wMSI6WzIxLDIwNjJdLCJlZmZlY3RfMDIiOlsyMSwyMDY4XSwiZWZmZWN0XzAzIjpbMjEsMjA3NF0sImVmZmVjdF8wNCI6WzIxLDIwODBdLCJlZmZlY3RfNSI6WzIwLDIwODYsMjEsMjA5Ml0sImVmZmVjdF8wNSI6WzIwLDIwOTgsMjEsMjEwNF0sImVmZmVjdF82IjpbMjAsMjExMCwyMSwyMTE2XSwiZWZmZWN0XzA3IjpbMjEsMjEyMl0sImVmZmVjdF8wNF8wMSI6WzIxLDIxMjhdLCJlZmZlY3RfYmx1ZSI6WzIxLDIxMzRdLCJlZmZlY3RfZG93bl8xIjpbMjAsMjE0MCwyMSwyMTQ5XSwiZWZmZWN0X2Rvd25fMiI6WzIwLDIxNjMsMjEsMjE3NF0sImVmZmVjdF9kb3duXzMiOlsyMCwyMTkxLDIxLDIxOThdLCJlZmZlY3RfZG93bl80IjpbMjAsMjIwOCwyMSwyMjE3XSwiZWZmZWN0X2ZpcmUiOlsyMSwyMjMxXSwiZWZmZWN0X2xpZ2h0MyI6WzIxLDIyMzddLCJlZmZlY3RfbGlnaHRkdXN0IjpbMjEsMjI0M10sImVmZmVjdF9saWdodGR1c3QyIjpbMjEsMjI0OV0sImVmZmVjdF9saWdodGR1c3QzIjpbMjEsMjI1NV0sImVmZmVjdF9saWdodGluZyI6WzIwLDIyNjEsMjEsMjI2N10sImVmZmVjdF9yZWQiOlsyMSwyMjczXSwibWVsbG93ZHJhZ29uX2RhcmtfMDNfZWZmZWN0XzA4IjpbMjEsMjI3OV0sIm1lbGxvd2RyYWdvbl9kYXJrXzAzX3JvY2tldF8wNCI6WzIxLDIyODVdLCJtZWxsb3dkcmFnb25fZGFya18wM19yb2NrZXRfMDFfMDIiOlsyMCwyMjkxLDIxLDIzMTFdLCJtZWxsb3dkcmFnb25fZGFya18wM19yb2NrZXRfMDRfMDIiOlsyMSwyMzM4XSwibWVsbG93ZHJhZ29uX2RhcmtfMDNfcm9ja2V0XzA0XzAzIjpbMjEsMjM0NF0sIm1lbGxvd2RyYWdvbl9kYXJrXzAzX3JvY2tldF8wNF8wNCI6WzIxLDIzNTBdLCJtZWxsb3dkcmFnb25fZGFya18wM19yb2NrZXRfMDRfMDUiOlsyMSwyMzU2XSwicm9ja2V0X2xpZ2h0IjpbMjEsMjM2Ml19fSx7ImR1cmF0aW9uIjoxNDksIm5hbWUiOiJwb3NlXzEiLCJvZmZzZXQiOlsxNjAsMjAyNCw2ODgwXSwiYm9uZSI6eyJtZWxsb3dkcmFnb25fZGFya18wM19lZmZlY3RfbGlnaHQiOlsxMSwyMzY4LDEyLDIzNzgsMTMsMjM4OF0sIm1lbGxvd2RyYWdvbl9kYXJrXzAzX3JvY2tldF8wMiI6WzExLDI0MjgsMTIsMjQ0MF0sIm1lbGxvd2RyYWdvbl9kYXJrXzAzX3JvY2tldF8wMV8wMyI6WzEyLDI0NTAsMTMsMjQ1OV0sIm1lbGxvd2RyYWdvbl9kYXJrXzAzX3dpbmdfMDIiOlsxMiwyNTAyXSwibWVsbG93ZHJhZ29uX2RhcmtfMDNfcm9ja2V0XzAxIjpbMTEsMjUzMiwxMiwyNTU5LDEzLDI1NzhdLCJtZWxsb3dkcmFnb25fZGFya18wM19hcm1fMDEiOlsxMiwyNTg3XSwibWVsbG93ZHJhZ29uX2RhcmtfMDNfZ29nZ2xlc18wMSI6WzEyLDI1OTNdLCJtZWxsb3dkcmFnb25fZGFya18wM19leWVfMDEiOlsxMSwyNjA4LDEzLDI2MjBdLCJib25lMjQiOlsxMiwyNjQxXSwibWVsbG93ZHJhZ29uX2RhcmtfMDNfaGFuZF8wMSI6WzExLDI2NzcsMTIsMjcwM10sImJvbmU0MiI6WzEyLDI3MjldLCJtZWxsb3dkcmFnb25fZGFya18wM19qb3lfMDEiOlsxMiwyNzY1XSwiYm9uZTM0IjpbMTIsMjc5M10sIm1lbGxvd2RyYWdvbl9kYXJrXzAzX3JvY2tldF8wMV8wMiI6WzExLDI4MDYsMTIsMjg1NiwxMywyODY1XSwiYm9uZTM4IjpbMTIsMjkxNV0sImJvbmU0OSI6WzEyLDI5NTEsMTMsMjk2MV0sIm1lbGxvd2RyYWdvbl9kYXJrXzAzX2JvZHlfMDEiOlsxMiwzMDQwXSwiYm9uZTIyIjpbMTIsMzA1M10sIm1lbGxvd2RyYWdvbl9kYXJrXzAzX2VmZmVjdF9saWdodGR1c3QiOlsxMiwzMDg5XSwiYm9uZTM1IjpbMTIsMzA5OV0sImJvbmUxMiI6WzEyLDMxMTJdLCJib25lMjMiOlsxMiwzMTE4XSwiYm9uZTkiOlsxMiwzMTU0XSwiYm9uZTM5IjpbMTIsMzE3NF0sIm1lbGxvd2RyYWdvbl9kYXJrXzAzX2VmZmVjdF9saWdodDIiOlsxMywzMjEwXSwibWVsbG93ZHJhZ29uX2RhcmtfMDNfZWFyXzAyIjpbMTIsMzI2NF0sIm1lbGxvd2RyYWdvbl9kYXJrXzAzX3JvY2tldF8wM18wMyI6WzEyLDMyODQsMTMsMzI5NF0sIm1lbGxvd2RyYWdvbl9kYXJrXzAzX2hvcm5fMDEiOlsxMiwzMzczXSwibWVsbG93ZHJhZ29uX2RhcmtfMDNfaGVhZF8wMSI6WzEyLDMzNzldLCJtZWxsb3dkcmFnb25fZGFya18wM19yb2NrZXRfMDJfMDEiOlsxMywzMzkzXSwiYm9uZTIxIjpbMTIsMzQ1Ml0sImJvbmU4IjpbMTIsMzQ4OF0sImJvbmU0MSI6WzEyLDM1MDhdLCJtZWxsb3dkcmFnb25fZGFya18wM19lZmZlY3RfbGlnaHRkdXN0MiI6WzEzLDM1NDRdLCJoaXAiOlsxMSwzNjAzLDEyLDM2MzFdLCJsZWdfbCI6WzExLDM2NDgsMTIsMzY3Nl0sIm1lbGxvd2RyYWdvbl9kYXJrXzAzX3NjYXJmXzAyIjpbMTIsMzY5M10sImxlZ19yIjpbMTEsMzcxMCwxMiwzNzM4XSwiYm9uZTMiOlsxMSwzNzU1XSwibWVsbG93ZHJhZ29uX2RhcmtfMDNfaG9ybl8wMiI6WzEyLDM3NjNdLCJtZWxsb3dkcmFnb25fZGFya18wM19yb2NrZXRfMDMiOlsxMSwzNzY5LDEyLDM3OTddLCJib25lNiI6WzExLDM4MTQsMTIsMzgyMF0sImJvbmU0MCI6WzEyLDM4NDBdLCJtZWxsb3dkcmFnb25fZGFya18wM19oYW5kXzAxXzAxIjpbMTEsMzg3NiwxMiwzODgyXSwibWVsbG93ZHJhZ29uX2RhcmtfMDNfdGFpbF8wMSI6WzEyLDM4ODhdLCJib25lMjAiOlsxMiwzOTAxXSwibWVsbG93ZHJhZ29uX2RhcmtfMDNfYXJtXzAyIGNvcHkiOlsxMiwzOTM3XSwiYm9uZTE5IjpbMTIsMzk0NV0sImJvbmUzNyI6WzEyLDM5ODFdLCJib25lNSI6WzEyLDQwMTddLCJtZWxsb3dkcmFnb25fZGFya18wM193aW5nXzAxIjpbMTIsNDAzN10sIm1lbGxvd2RyYWdvbl9kYXJrXzAzX2Vhcl8wMSI6WzEyLDQwNzNdLCJtZWxsb3dkcmFnb25fZGFya18wM19yb2NrZXRfMDNfMDEiOlsxMiw0MDkzLDEzLDQxMDNdLCJlZmZlY3RfYm90dG9tXzEiOlsxMSw0MTgyLDEzLDQxOTZdLCJlZmZlY3RfYm90dG9tXzIiOlsxMSw0MjEwLDEzLDQyMjldLCJlZmZlY3RfZG93bl8xIjpbMTEsNDI0OCwxMyw0MjY0XSwiZWZmZWN0X2Rvd25fMiI6WzExLDQyNzgsMTMsNDMwMF0sImVmZmVjdF9saWdodGR1c3QzIjpbMTEsNDMyMiwxMiw0MzMxLDEzLDQzMzhdLCJlZmZlY3RfYmx1ZSI6WzExLDQzNDcsMTIsNDM1NiwxMyw0MzYzXX0sInNsb3QiOnsiZWZmZWN0XzAxIjpbMjEsNDM3Ml0sImVmZmVjdF8wMiI6WzIxLDQzNzhdLCJlZmZlY3RfMDMiOlsyMSw0Mzg0XSwiZWZmZWN0XzA0IjpbMjEsNDM5MF0sImVmZmVjdF8wNSI6WzIxLDQzOTZdLCJlZmZlY3RfNSI6WzIxLDQ0MDJdLCJlZmZlY3RfNiI6WzIxLDQ0MDhdLCJlZmZlY3RfMDciOlsyMSw0NDE0XSwiZWZmZWN0XzA0XzAxIjpbMjEsNDQyMF0sImVmZmVjdF9ibHVlIjpbMjAsNDQyNiwyMSw0NDMzXSwiZWZmZWN0X2Rvd25fMSI6WzIwLDQ0NDIsMjEsNDQ1N10sImVmZmVjdF9kb3duXzIiOlsyMCw0NDgyLDIxLDQ1MDFdLCJlZmZlY3RfZG93bl8zIjpbMjAsNDUzNCwyMSw0NTQ1XSwiZWZmZWN0X2Rvd25fNCI6WzIwLDQ1NTksMjEsNDU3NF0sImVmZmVjdF9maXJlIjpbMjEsNDU5OV0sImVmZmVjdF9saWdodCI6WzIwLDQ2MDUsMjEsNDYxM10sImVmZmVjdF9saWdodDMiOlsyMSw0NjIzXSwiZWZmZWN0X2xpZ2h0ZHVzdCI6WzIwLDQ2MjksMjEsNDYzNl0sImVmZmVjdF9saWdodGR1c3QyIjpbMjEsNDY0NF0sImVmZmVjdF9saWdodGR1c3QzIjpbMjAsNDY1MCwyMSw0NjU3XSwiZWZmZWN0X2xpZ2h0aW5nIjpbMjAsNDY2NiwyMSw0NjcyXSwiZWZmZWN0X3JlZCI6WzIxLDQ2NzhdLCJtZWxsb3dkcmFnb25fZGFya18wM19lZmZlY3RfMDgiOlsyMSw0Njg0XSwibWVsbG93ZHJhZ29uX2RhcmtfMDNfZXllXzAxIjpbMjAsNDY5MF0sIm1lbGxvd2RyYWdvbl9kYXJrXzAzX2hlYWRfMSI6WzIwLDQ3MDRdLCJtZWxsb3dkcmFnb25fZGFya18wM19yb2NrZXRfMDEiOlsyMCw0NzEyLDIxLDQ3MjBdLCJtZWxsb3dkcmFnb25fZGFya18wM19yb2NrZXRfMDQiOlsyMSw0NzI5XSwibWVsbG93ZHJhZ29uX2RhcmtfMDNfcm9ja2V0XzAxXzAxIjpbMjAsNDczNSwyMSw0NzQzXSwibWVsbG93ZHJhZ29uX2RhcmtfMDNfcm9ja2V0XzAxXzAyIjpbMjAsNDc1MiwyMSw0Nzg2XSwibWVsbG93ZHJhZ29uX2RhcmtfMDNfcm9ja2V0XzAxXzAzIjpbMjAsNDgzNiwyMSw0ODQ0XSwibWVsbG93ZHJhZ29uX2RhcmtfMDNfcm9ja2V0XzA0XzAyIjpbMjEsNDg1M10sIm1lbGxvd2RyYWdvbl9kYXJrXzAzX3JvY2tldF8wNF8wMyI6WzIxLDQ4NTldLCJtZWxsb3dkcmFnb25fZGFya18wM19yb2NrZXRfMDRfMDQiOlsyMSw0ODY1XSwibWVsbG93ZHJhZ29uX2RhcmtfMDNfcm9ja2V0XzA0XzA1IjpbMjEsNDg3MV0sInJvY2tldF9saWdodCI6WzIxLDQ4NzddfX0seyJkdXJhdGlvbiI6NjAsIm5hbWUiOiJza2lsbF9hcHBlYXIiLCJvZmZzZXQiOlszMzEsNTE3MiwxNzAwN10sImJvbmUiOnsibWVsbG93ZHJhZ29uX2RhcmtfMDNfZWZmZWN0X2xpZ2h0IjpbMTMsNDg4M10sIm1lbGxvd2RyYWdvbl9kYXJrXzAzX3JvY2tldF8wMV8wMSI6WzEyLDQ5MDldLCJtZWxsb3dkcmFnb25fZGFya18wM19yb2NrZXRfMDIiOlsxMSw0OTMyXSwibWVsbG93ZHJhZ29uX2RhcmtfMDNfcm9ja2V0XzAxXzAzIjpbMTMsNDk0MF0sIm1lbGxvd2RyYWdvbl9kYXJrXzAzX3dpbmdfMDIiOlsxMiw0OTY4XSwibWVsbG93ZHJhZ29uX2RhcmtfMDNfcm9ja2V0XzAxIjpbMTEsNDk3OSwxMyw0OTg3XSwibWVsbG93ZHJhZ29uX2RhcmtfMDNfYXJtXzAxIjpbMTIsNDk5NV0sIm1lbGxvd2RyYWdvbl9kYXJrXzAzX2dvZ2dsZXNfMDEiOlsxMiw1MDA0XSwibWVsbG93ZHJhZ29uX2RhcmtfMDNfZXllXzAxIjpbMTMsNTAxM10sImJvbmUyNCI6WzEyLDUwMTldLCJtZWxsb3dkcmFnb25fZGFya18wM19oYW5kXzAxIjpbMTIsNTAzMV0sImJvbmU0MiI6WzEyLDUwNDBdLCJtZWxsb3dkcmFnb25fZGFya18wM19qb3lfMDEiOlsxMiw1MDUyXSwibWVsbG93ZHJhZ29uX2RhcmtfMDNfZ2xvdmVzXzAxIjpbMTIsNTA2MV0sImJvbmUzNCI6WzEyLDUwNjldLCJtZWxsb3dkcmFnb25fZGFya18wM19yb2NrZXRfMDFfMDIiOlsxMSw1MDc4LDEzLDUxMDVdLCJib25lMzgiOlsxMiw1MTMyXSwiYm9uZTQ5IjpbMTMsNTE0NF0sIm1lbGxvd2RyYWdvbl9kYXJrXzAzX2JvZHlfMDEiOlsxMiw1MTgwXSwiYm9uZTIyIjpbMTIsNTE4OF0sImJvbmUzNSI6WzEyLDUyMDBdLCJib25lMTIiOlsxMiw1MjA5XSwiYm9uZTIzIjpbMTIsNTIxOF0sImJvbmU5IjpbMTIsNTIzMF0sImJvbmUzOSI6WzEyLDUyMzldLCJtZWxsb3dkcmFnb25fZGFya18wM19lZmZlY3RfbGlnaHQyIjpbMTMsNTI1MV0sIm1lbGxvd2RyYWdvbl9kYXJrXzAzX2Vhcl8wMiI6WzEyLDUyNzddLCJtZWxsb3dkcmFnb25fZGFya18wM19yb2NrZXRfMDNfMDMiOlsxMyw1Mjg1XSwibWVsbG93ZHJhZ29uX2RhcmtfMDNfaG9ybl8wMSI6WzEyLDUzMjFdLCJtZWxsb3dkcmFnb25fZGFya18wM19oZWFkXzAxIjpbMTIsNTMzMF0sIm1lbGxvd2RyYWdvbl9kYXJrXzAzX3JvY2tldF8wMl8wMSI6WzEzLDUzMzldLCJib25lMjEiOlsxMiw1MzY3XSwiYm9uZTgiOlsxMiw1Mzc5XSwiYm9uZTQxIjpbMTIsNTM4OF0sImhpcCI6WzExLDU0MDAsMTIsNTQwOF0sImxlZ19sIjpbMTEsNTQxNiwxMiw1NDI2XSwibWVsbG93ZHJhZ29uX2RhcmtfMDNfc2NhcmZfMDIiOlsxMiw1NDM2XSwibGVnX3IiOlsxMSw1NDQ1LDEyLDU0NTVdLCJib25lMyI6WzExLDU0NjUsMTMsNTQ3M10sIm1lbGxvd2RyYWdvbl9kYXJrXzAzX2hvcm5fMDIiOlsxMiw1NDgxXSwibWVsbG93ZHJhZ29uX2RhcmtfMDNfcm9ja2V0XzAzIjpbMTEsNTQ5MCwxMiw1NTAwXSwiYm9uZTYiOlsxMiw1NTEwXSwiYm9uZTQwIjpbMTIsNTUxOV0sIm1lbGxvd2RyYWdvbl9kYXJrXzAzX2hhbmRfMDFfMDEiOlsxMSw1NTMxLDEyLDU1NDBdLCJtZWxsb3dkcmFnb25fZGFya18wM190YWlsXzAxIjpbMTIsNTU0OV0sImJvbmUyMCI6WzEyLDU1NThdLCJtZWxsb3dkcmFnb25fZGFya18wM19hcm1fMDIgY29weSI6WzEyLDU1NzBdLCJib25lMTkiOlsxMiw1NTc4XSwiYm9uZTM3IjpbMTIsNTU5MF0sImJvbmU1IjpbMTIsNTYwMl0sIm1lbGxvd2RyYWdvbl9kYXJrXzAzX3dpbmdfMDEiOlsxMiw1NjExXSwibWVsbG93ZHJhZ29uX2RhcmtfMDNfZWFyXzAxIjpbMTIsNTYyM10sIm1lbGxvd2RyYWdvbl9kYXJrXzAzX3JvY2tldF8wM18wMSI6WzEzLDU2MzFdLCJlZmZlY3RfYm90dG9tXzEiOlsxMSw1NjY3LDEzLDU2NzVdLCJlZmZlY3RfYm90dG9tXzIiOlsxMSw1NjgzLDEzLDU2OTNdLCJlZmZlY3RfZG93bl8xIjpbMTEsNTcwMywxMyw1NzEzXSwiZWZmZWN0X2Rvd25fMiI6WzExLDU3MjMsMTMsNTczNF19LCJzbG90Ijp7ImVmZmVjdF8wMSI6WzIxLDU3NDVdLCJlZmZlY3RfMDIiOlsyMSw1NzUxXSwiZWZmZWN0XzAzIjpbMjEsNTc1N10sImVmZmVjdF8wNCI6WzIxLDU3NjNdLCJlZmZlY3RfMDUiOlsyMCw1NzY5LDIxLDU3NzVdLCJlZmZlY3RfNSI6WzIwLDU3ODEsMjEsNTc4N10sImVmZmVjdF82IjpbMjAsNTc5MywyMSw1Nzk5XSwiZWZmZWN0XzA3IjpbMjEsNTgwNV0sImVmZmVjdF8wNF8wMSI6WzIxLDU4MTFdLCJlZmZlY3RfYmx1ZSI6WzIxLDU4MTddLCJlZmZlY3RfZG93bl8xIjpbMjAsNTgyMywyMSw1ODMyXSwiZWZmZWN0X2Rvd25fMiI6WzIwLDU4NDYsMjEsNTg1N10sImVmZmVjdF9kb3duXzMiOlsyMCw1ODc0LDIxLDU4ODFdLCJlZmZlY3RfZG93bl80IjpbMjAsNTg5MSwyMSw1OTAwXSwiZWZmZWN0X2ZpcmUiOlsyMSw1OTE0XSwiZWZmZWN0X2xpZ2h0MyI6WzIxLDU5MjBdLCJlZmZlY3RfbGlnaHRkdXN0IjpbMjEsNTkyNl0sImVmZmVjdF9saWdodGR1c3QyIjpbMjEsNTkzMl0sImVmZmVjdF9saWdodGR1c3QzIjpbMjEsNTkzOF0sImVmZmVjdF9saWdodGluZyI6WzIwLDU5NDQsMjEsNTk1MF0sImVmZmVjdF9yZWQiOlsyMSw1OTU2XSwibWVsbG93ZHJhZ29uX2RhcmtfMDNfZWZmZWN0XzA4IjpbMjEsNTk2Ml0sIm1lbGxvd2RyYWdvbl9kYXJrXzAzX3JvY2tldF8wNCI6WzIxLDU5NjhdLCJtZWxsb3dkcmFnb25fZGFya18wM19yb2NrZXRfMDFfMDIiOlsyMCw1OTc0LDIxLDU5OTRdLCJtZWxsb3dkcmFnb25fZGFya18wM19yb2NrZXRfMDRfMDIiOlsyMSw2MDIxXSwibWVsbG93ZHJhZ29uX2RhcmtfMDNfcm9ja2V0XzA0XzAzIjpbMjEsNjAyN10sIm1lbGxvd2RyYWdvbl9kYXJrXzAzX3JvY2tldF8wNF8wNCI6WzIxLDYwMzNdLCJtZWxsb3dkcmFnb25fZGFya18wM19yb2NrZXRfMDRfMDUiOlsyMSw2MDM5XSwicm9ja2V0X2xpZ2h0IjpbMjEsNjA0NV19fSx7ImR1cmF0aW9uIjo3OCwibmFtZSI6InNraWxsX2Rpc2FwcGVhciIsImFjdGlvbiI6NjA1MSwib2Zmc2V0IjpbNDEyLDYyMDYsMjEwOTFdLCJib25lIjp7Im1lbGxvd2RyYWdvbl9kYXJrXzAzX2VmZmVjdF9saWdodCI6WzExLDYwNTgsMTMsNjEwMV0sIm1lbGxvd2RyYWdvbl9kYXJrXzAzX3JvY2tldF8wMiI6WzExLDYxMTAsMTIsNjExOF0sIm1lbGxvd2RyYWdvbl9kYXJrXzAzX3JvY2tldF8wMV8wMyI6WzExLDYxMjYsMTIsNjE4MywxMyw2MTkxXSwibWVsbG93ZHJhZ29uX2RhcmtfMDNfd2luZ18wMiI6WzEyLDYyNDhdLCJtZWxsb3dkcmFnb25fZGFya18wM19yb2NrZXRfMDEiOlsxMSw2MjY1LDEyLDYyNzNdLCJtZWxsb3dkcmFnb25fZGFya18wM19hcm1fMDEiOlsxMiw2MjgxXSwibWVsbG93ZHJhZ29uX2RhcmtfMDNfZ29nZ2xlc18wMSI6WzEyLDYyODddLCJib25lMjQiOlsxMiw2MjkzXSwibWVsbG93ZHJhZ29uX2RhcmtfMDNfaGFuZF8wMSI6WzExLDYzMTIsMTIsNjMyOF0sImJvbmU0MiI6WzEyLDYzNjJdLCJtZWxsb3dkcmFnb25fZGFya18wM19qb3lfMDEiOlsxMiw2MzgxXSwiYm9uZTM0IjpbMTIsNjQxNV0sImJvbmUzOCI6WzEyLDY0MzFdLCJib25lNDkiOlsxMiw2NDUwLDEzLDY0NThdLCJtZWxsb3dkcmFnb25fZGFya18wM19ib2R5XzAxIjpbMTIsNjUwNF0sImJvbmUyMiI6WzEyLDY1MTJdLCJib25lMzUiOlsxMiw2NTMxXSwiYm9uZTEyIjpbMTIsNjU0N10sImJvbmUyMyI6WzEyLDY1NTNdLCJib25lOSI6WzEyLDY1NzJdLCJib25lMzkiOlsxMiw2NTgzXSwibWVsbG93ZHJhZ29uX2RhcmtfMDNfZWZmZWN0X2xpZ2h0MiI6WzExLDY2MDIsMTIsNjY2MCwxMyw2NjY5XSwibWVsbG93ZHJhZ29uX2RhcmtfMDNfZWFyXzAyIjpbMTIsNjcxOV0sIm1lbGxvd2RyYWdvbl9kYXJrXzAzX3JvY2tldF8wM18wMyI6WzEyLDY3MjksMTMsNjczN10sIm1lbGxvd2RyYWdvbl9kYXJrXzAzX2hvcm5fMDEiOlsxMiw2NzgzXSwibWVsbG93ZHJhZ29uX2RhcmtfMDNfaGVhZF8wMSI6WzEyLDY3ODldLCJtZWxsb3dkcmFnb25fZGFya18wM19yb2NrZXRfMDJfMDEiOlsxMSw2Nzk3LDEyLDY4NTQsMTMsNjg2M10sImJvbmUyMSI6WzEyLDY5MTFdLCJib25lOCI6WzEyLDY5MzBdLCJib25lNDEiOlsxMiw2OTQyXSwiaGlwIjpbMTEsNjk2MSwxMiw2OTc0XSwibGVnX2wiOlsxMSw2OTgyLDEyLDY5OTVdLCJtZWxsb3dkcmFnb25fZGFya18wM19zY2FyZl8wMiI6WzEyLDcwMDNdLCJsZWdfciI6WzExLDcwMDksMTIsNzAyMl0sImJvbmUzIjpbMTEsNzAzMF0sIm1lbGxvd2RyYWdvbl9kYXJrXzAzX2hvcm5fMDIiOlsxMiw3MDQzXSwibWVsbG93ZHJhZ29uX2RhcmtfMDNfcm9ja2V0XzAzIjpbMTEsNzA0OSwxMiw3MDYyXSwiYm9uZTYiOlsxMiw3MDc1XSwiYm9uZTQwIjpbMTIsNzA4N10sIm1lbGxvd2RyYWdvbl9kYXJrXzAzX2hhbmRfMDFfMDEiOlsxMSw3MTA2LDEyLDcxMTJdLCJtZWxsb3dkcmFnb25fZGFya18wM190YWlsXzAxIjpbMTIsNzExOF0sImJvbmUyMCI6WzEyLDcxMzRdLCJtZWxsb3dkcmFnb25fZGFya18wM19hcm1fMDIgY29weSI6WzExLDcxNTMsMTIsNzE2MV0sImJvbmUxOSI6WzEyLDcxNzBdLCJib25lMzciOlsxMiw3MTg5XSwiYm9uZTUiOlsxMiw3MjA4XSwibWVsbG93ZHJhZ29uX2RhcmtfMDNfd2luZ18wMSI6WzEyLDcyMjBdLCJtZWxsb3dkcmFnb25fZGFya18wM19lYXJfMDEiOlsxMiw3MjM5XSwibWVsbG93ZHJhZ29uX2RhcmtfMDNfcm9ja2V0XzAzXzAxIjpbMTIsNzI0OSwxMyw3MjU3XSwiYXR0YWNrIjpbMTEsNzMwM10sImVmZmVjdF8wMyI6WzExLDczMTAsMTMsNzMxNl0sImVmZmVjdF8wMiI6WzExLDczMjIsMTIsNzMzMCwxMyw3MzM4XSwiZWZmZWN0X3JlZCI6WzExLDczNDYsMTMsNzM1Ml0sImVmZmVjdCI6WzExLDczNThdLCJidXR0b24iOlsxMyw3MzY0XSwiYXJyb3ciOlsxMyw3NDI1XSwiZWZmZWN0X2JvdHRvbV8xIjpbMTEsNzQzNSwxMyw3NDQ1XSwiZWZmZWN0X2JvdHRvbV8yIjpbMTEsNzQ1NSwxMyw3NDY3XSwiZWZmZWN0XzA0IjpbMTEsNzQ3OSwxMyw3NDg1XSwiYXJyb3cyIjpbMTMsNzQ5M10sImFycm93MyI6WzEzLDc1MDNdLCJlZmZlY3RfMDEiOlsxMyw3NTEzXSwiZWZmZWN0X2Rvd25fMSI6WzExLDc1NTIsMTMsNzU2NF0sImVmZmVjdF9kb3duXzIiOlsxMSw3NTc2LDEzLDc1ODldLCJlZmZlY3RfbGlnaHQzIjpbMTMsNzYwMl0sImVmZmVjdF9saWdodGR1c3QzIjpbMTEsNzYxMCwxMiw3NjE3LDEzLDc2MjRdLCJyb2NrZXRfMDRfMDUiOlsxMSw3NjMyXSwicm9ja2V0XzA0XzAyIjpbMTEsNzY0MF0sInJvY2tldF8wNF8wMyI6WzExLDc2NDgsMTIsNzY1Nl0sInJvY2tldF8wNF8wNCI6WzExLDc2NjQsMTIsNzY3Ml0sInJvY2tldF9saWdodCI6WzEzLDc2ODBdLCJsaWdodGluZyI6WzExLDc2ODYsMTIsNzcyNiwxMyw3NzY2XSwiYm9uZSI6WzExLDc4MDYsMTIsNzg0OF19LCJzbG90Ijp7ImVmZmVjdF8wMSI6WzIwLDc4NTYsMjEsNzg4M10sImVmZmVjdF8wMiI6WzIwLDc5MzIsMjEsNzk0MF0sImVmZmVjdF8wMyI6WzIwLDc5NDksMjEsNzk1NV0sImVmZmVjdF8wNCI6WzIwLDc5NjEsMjEsNzk2OV0sImVmZmVjdF8wNSI6WzIwLDc5NzgsMjEsNzk4NF0sImVmZmVjdF81IjpbMjAsNzk5MiwyMSw3OTk4XSwiZWZmZWN0XzYiOlsyMCw4MDA2LDIxLDgwMTJdLCJlZmZlY3RfMDciOlsyMSw4MDIwXSwiZWZmZWN0XzA0XzAxIjpbMjAsODAyOCwyMSw4MDM1XSwiZWZmZWN0X2JsdWUiOlsyMSw4MDQzXSwiZWZmZWN0X2Rvd25fMSI6WzIwLDgwNDksMjEsODA2MF0sImVmZmVjdF9kb3duXzIiOlsyMCw4MDc4LDIxLDgwOTFdLCJlZmZlY3RfZG93bl8zIjpbMjAsODExMiwyMSw4MTIxXSwiZWZmZWN0X2Rvd25fNCI6WzIwLDgxMzUsMjEsODE0Nl0sImVmZmVjdF9maXJlIjpbMjEsODE2NF0sImVmZmVjdF9saWdodDMiOlsyMCw4MTcwLDIxLDgxNzddLCJlZmZlY3RfbGlnaHRkdXN0IjpbMjEsODE4Nl0sImVmZmVjdF9saWdodGR1c3QyIjpbMjEsODE5Ml0sImVmZmVjdF9saWdodGR1c3QzIjpbMjAsODE5OCwyMSw4MjA2XSwiZWZmZWN0X2xpZ2h0aW5nIjpbMjAsODIxNF0sImVmZmVjdF9yZWQiOlsyMCw4MjU1LDIxLDgzMjhdLCJtZWxsb3dkcmFnb25fZGFya18wM19lZmZlY3RfMDgiOlsyMCw4MzM4LDIxLDgzNDRdLCJtZWxsb3dkcmFnb25fZGFya18wM19yb2NrZXRfMDEiOlsyMCw4MzUyXSwibWVsbG93ZHJhZ29uX2RhcmtfMDNfcm9ja2V0XzAyIjpbMjAsODM1OV0sIm1lbGxvd2RyYWdvbl9kYXJrXzAzX3JvY2tldF8wNCI6WzIwLDgzNjZdLCJtZWxsb3dkcmFnb25fZGFya18wM19yb2NrZXRfMDFfMDEiOlsyMCw4MzczXSwibWVsbG93ZHJhZ29uX2RhcmtfMDNfcm9ja2V0XzAxXzAyIjpbMjAsODM4MF0sIm1lbGxvd2RyYWdvbl9kYXJrXzAzX3JvY2tldF8wNF8wMiI6WzIxLDgzODZdLCJtZWxsb3dkcmFnb25fZGFya18wM19yb2NrZXRfMDRfMDMiOlsyMSw4Mzk0XSwibWVsbG93ZHJhZ29uX2RhcmtfMDNfcm9ja2V0XzA0XzA0IjpbMjEsODQwMl0sIm1lbGxvd2RyYWdvbl9kYXJrXzAzX3JvY2tldF8wNF8wNSI6WzIxLDg0MTBdLCJyb2NrZXRfbGlnaHQiOlsyMSw4NDE4XX19LHsiZHVyYXRpb24iOjYwLCJuYW1lIjoic2tpbGxfaWRsZSIsIm9mZnNldCI6WzU2NSw4NzIyLDI2Njc4XSwiYm9uZSI6eyJtZWxsb3dkcmFnb25fZGFya18wM19lZmZlY3RfbGlnaHQiOlsxMSw4NDI2LDEzLDg0NDBdLCJtZWxsb3dkcmFnb25fZGFya18wM19yb2NrZXRfMDIiOlsxMSw4NDY0LDEyLDg0NzRdLCJtZWxsb3dkcmFnb25fZGFya18wM19yb2NrZXRfMDFfMDMiOlsxMSw4NDg0LDEyLDg0OTgsMTMsODUwNl0sIm1lbGxvd2RyYWdvbl9kYXJrXzAzX3dpbmdfMDIiOlsxMiw4NTM2XSwibWVsbG93ZHJhZ29uX2RhcmtfMDNfcm9ja2V0XzAxIjpbMTEsODU1MiwxMiw4NTYyXSwibWVsbG93ZHJhZ29uX2RhcmtfMDNfYXJtXzAxIjpbMTIsODU3Ml0sIm1lbGxvd2RyYWdvbl9kYXJrXzAzX2dvZ2dsZXNfMDEiOlsxMiw4NTc4XSwiYm9uZTI0IjpbMTIsODU4NF0sIm1lbGxvd2RyYWdvbl9kYXJrXzAzX2hhbmRfMDEiOlsxMSw4NjAyLDEyLDg2MTJdLCJib25lNDIiOlsxMiw4NjIyXSwibWVsbG93ZHJhZ29uX2RhcmtfMDNfam95XzAxIjpbMTIsODY0MF0sImJvbmUzNCI6WzEyLDg2NTBdLCJib25lMzgiOlsxMiw4NjU2XSwiYm9uZTQ5IjpbMTIsODY3NCwxMyw4NjgyXSwiYm9uZTIyIjpbMTIsODcxOF0sImJvbmUzNSI6WzEyLDg3MzZdLCJib25lMTIiOlsxMiw4NzQyXSwiYm9uZTIzIjpbMTIsODc0OF0sImJvbmU5IjpbMTIsODc2Nl0sImJvbmUzOSI6WzEyLDg3NzhdLCJtZWxsb3dkcmFnb25fZGFya18wM19lZmZlY3RfbGlnaHQyIjpbMTEsODc5NiwxMiw4ODEwLDEzLDg4MThdLCJtZWxsb3dkcmFnb25fZGFya18wM19lYXJfMDIiOlsxMiw4ODQ2XSwibWVsbG93ZHJhZ29uX2RhcmtfMDNfcm9ja2V0XzAzXzAzIjpbMTIsODg1OCwxMyw4ODY2XSwibWVsbG93ZHJhZ29uX2RhcmtfMDNfaG9ybl8wMSI6WzEyLDg5MDJdLCJtZWxsb3dkcmFnb25fZGFya18wM19oZWFkXzAxIjpbMTIsODkwOF0sIm1lbGxvd2RyYWdvbl9kYXJrXzAzX3JvY2tldF8wMl8wMSI6WzExLDg5MTQsMTIsODkyOCwxMyw4OTM5XSwiYm9uZTIxIjpbMTIsODk2OV0sImJvbmU4IjpbMTIsODk4N10sImJvbmU0MSI6WzEyLDg5OTldLCJoaXAiOlsxMSw5MDE3LDEyLDkwMjddLCJsZWdfbCI6WzExLDkwMzcsMTIsOTA0N10sIm1lbGxvd2RyYWdvbl9kYXJrXzAzX3NjYXJmXzAyIjpbMTIsOTA1NF0sImxlZ19yIjpbMTEsOTA2MCwxMiw5MDcwXSwiYm9uZTMiOlsxMSw5MDc3XSwibWVsbG93ZHJhZ29uX2RhcmtfMDNfaG9ybl8wMiI6WzEyLDkwODddLCJtZWxsb3dkcmFnb25fZGFya18wM19yb2NrZXRfMDMiOlsxMSw5MDkzLDEyLDkxMDNdLCJib25lNiI6WzEyLDkxMTBdLCJib25lNDAiOlsxMiw5MTIyXSwibWVsbG93ZHJhZ29uX2RhcmtfMDNfaGFuZF8wMV8wMSI6WzExLDkxNDAsMTIsOTE0Nl0sIm1lbGxvd2RyYWdvbl9kYXJrXzAzX3RhaWxfMDEiOlsxMiw5MTUyXSwiYm9uZTIwIjpbMTIsOTE1OF0sIm1lbGxvd2RyYWdvbl9kYXJrXzAzX2FybV8wMiBjb3B5IjpbMTIsOTE3Nl0sImJvbmUxOSI6WzEyLDkxODNdLCJib25lMzciOlsxMiw5MjAxXSwiYm9uZTUiOlsxMiw5MjE5XSwibWVsbG93ZHJhZ29uX2RhcmtfMDNfd2luZ18wMSI6WzEyLDkyMzFdLCJtZWxsb3dkcmFnb25fZGFya18wM19lYXJfMDEiOlsxMiw5MjQ5XSwibWVsbG93ZHJhZ29uX2RhcmtfMDNfcm9ja2V0XzAzXzAxIjpbMTIsOTI2MSwxMyw5MjY5XSwiZWZmZWN0XzAzIjpbMTEsOTMwNSwxMyw5MzE2XSwiZWZmZWN0XzAyIjpbMTEsOTMyOSwxMyw5MzM2XSwiZWZmZWN0X3JlZCI6WzExLDkzNDQsMTMsOTM1Ml0sImVmZmVjdCI6WzExLDkzNjJdLCJidXR0b24iOlsxMyw5MzY5XSwiYXJyb3ciOlsxMyw5MzgxXSwiZWZmZWN0X2JvdHRvbV8xIjpbMTEsOTM5MywxMyw5NDAxXSwiZWZmZWN0X2JvdHRvbV8yIjpbMTEsOTQwOSwxMyw5NDE5XSwiZWZmZWN0XzA0IjpbMTEsOTQyOSwxMyw5NDM3XSwiYXJyb3cyIjpbMTMsOTQ0Nl0sImFycm93MyI6WzEzLDk0NThdLCJlZmZlY3RfZG93bl8xIjpbMTEsOTQ2NywxMyw5NDc3XSwiZWZmZWN0X2Rvd25fMiI6WzExLDk0ODcsMTMsOTUwMV0sImVmZmVjdF9saWdodDMiOlsxMyw5NTE0XSwiZWZmZWN0X2xpZ2h0ZHVzdDMiOlsxMSw5NTIyLDEyLDk1MjksMTMsOTUzNl0sImJvbmUiOlsxMSw5NTQ0LDEyLDk1NTRdLCJsaWdodGluZyI6WzExLDk1NjEsMTIsOTU3NiwxMyw5NTkxXSwicm9ja2V0XzA0XzAyIjpbMTEsOTYwNl0sInJvY2tldF8wNF8wMyI6WzExLDk2MTUsMTIsOTYyNF0sInJvY2tldF8wNF8wNCI6WzExLDk2MzEsMTIsOTY0MF0sInJvY2tldF8wNF8wNSI6WzExLDk2NDddLCJyb2NrZXRfbGlnaHQiOlsxMyw5NjU2XX0sInNsb3QiOnsiZWZmZWN0XzAxIjpbMjEsOTY2NV0sImVmZmVjdF8wMiI6WzIwLDk2NzIsMjEsOTY3OV0sImVmZmVjdF8wMyI6WzIwLDk2ODksMjEsOTcwMF0sImVmZmVjdF8wNCI6WzIwLDk3MTUsMjEsOTcyMl0sImVmZmVjdF8wNSI6WzIwLDk3MzIsMjEsOTczOV0sImVmZmVjdF81IjpbMjAsOTc0NywyMSw5NzU0XSwiZWZmZWN0XzYiOlsyMCw5NzYyLDIxLDk3NjldLCJlZmZlY3RfMDciOlsyMSw5Nzc3XSwiZWZmZWN0XzA0XzAxIjpbMjEsOTc4NV0sImVmZmVjdF9ibHVlIjpbMjEsOTc5M10sImVmZmVjdF9kb3duXzEiOlsyMCw5Nzk5LDIxLDk4MDhdLCJlZmZlY3RfZG93bl8yIjpbMjAsOTgyMiwyMSw5ODMzXSwiZWZmZWN0X2Rvd25fMyI6WzIwLDk4NTEsMjEsOTg1OF0sImVmZmVjdF9kb3duXzQiOlsyMCw5ODY5LDIxLDk4NzhdLCJlZmZlY3RfZmlyZSI6WzIxLDk4OTNdLCJlZmZlY3RfbGlnaHQzIjpbMjAsOTkwMCwyMSw5OTA3XSwiZWZmZWN0X2xpZ2h0ZHVzdCI6WzIxLDk5MTZdLCJlZmZlY3RfbGlnaHRkdXN0MiI6WzIxLDk5MjNdLCJlZmZlY3RfbGlnaHRkdXN0MyI6WzIwLDk5MzAsMjEsOTkzN10sImVmZmVjdF9saWdodGluZyI6WzIwLDk5NDcsMjEsOTk3MF0sImVmZmVjdF9yZWQiOlsyMCw5OTc3LDIxLDk5OTVdLCJtZWxsb3dkcmFnb25fZGFya18wM19lZmZlY3RfMDgiOlsyMCwxMDAwOCwyMSwxMDAxNV0sIm1lbGxvd2RyYWdvbl9kYXJrXzAzX3JvY2tldF8wMSI6WzIwLDEwMDIzXSwibWVsbG93ZHJhZ29uX2RhcmtfMDNfcm9ja2V0XzAyIjpbMjAsMTAwMzBdLCJtZWxsb3dkcmFnb25fZGFya18wM19yb2NrZXRfMDQiOlsyMSwxMDAzN10sIm1lbGxvd2RyYWdvbl9kYXJrXzAzX3JvY2tldF8wMV8wMSI6WzIwLDEwMDQ0XSwibWVsbG93ZHJhZ29uX2RhcmtfMDNfcm9ja2V0XzAxXzAyIjpbMjAsMTAwNTFdLCJtZWxsb3dkcmFnb25fZGFya18wM19yb2NrZXRfMDRfMDIiOlsyMSwxMDA1N10sIm1lbGxvd2RyYWdvbl9kYXJrXzAzX3JvY2tldF8wNF8wMyI6WzIxLDEwMDY0XSwibWVsbG93ZHJhZ29uX2RhcmtfMDNfcm9ja2V0XzA0XzA0IjpbMjEsMTAwNzFdLCJtZWxsb3dkcmFnb25fZGFya18wM19yb2NrZXRfMDRfMDUiOlsyMSwxMDA3OF0sInJvY2tldF9saWdodCI6WzIxLDEwMDg1XX19XSwiZGVmYXVsdEFjdGlvbnMiOlt7Im5hbWUiOiJhdHRhY2sifV0sImFjdGlvbnMiOlt7InR5cGUiOjEwLCJuYW1lIjoiYXR0YWNrIn0seyJ0eXBlIjoxMCwibmFtZSI6ImF0dGFjayJ9XX1dLCJvZmZzZXQiOlswLDEwMTQ0LDEwMTQ0LDM0MjAwLDQ0MzQ0LDEzNjQsNDU3MDgsNDA2ODAsODYzODgsNjEwOTIsMTQ3NDgwLDIwMTg4XSwidGV4dHVyZUF0bGFzIjpbeyJ3aWR0aCI6MTAyNCwiaGVpZ2h0IjoxMDI0LCJuYW1lIjoibWVsbG93ZHJhZ29uX2RhcmtfMDMiLCJpbWFnZVBhdGgiOiJtZWxsb3dkcmFnb25fZGFya18wM190ZXgucG5nIiwiU3ViVGV4dHVyZSI6W3sieCI6NTQ2LCJ5Ijo1NjIsIndpZHRoIjoyMjksImhlaWdodCI6MjYwLCJmcmFtZVgiOi0yMCwiZnJhbWVXaWR0aCI6MjY2LCJmcmFtZUhlaWdodCI6Mjk0LCJuYW1lIjoibWVsbG93ZHJhZ29uX2RhcmtfMDNfcm9ja2V0XzAzXzA0In0seyJ4Ijo2MDcsInkiOjEsIndpZHRoIjo0MTEsImhlaWdodCI6MTQ1LCJmcmFtZVkiOi0yMywiZnJhbWVXaWR0aCI6NDI1LCJmcmFtZUhlaWdodCI6MjE1LCJuYW1lIjoibWVsbG93ZHJhZ29uX2RhcmtfMDNfcm9ja2V0XzAzXzA1In0seyJ4Ijo4ODUsInkiOjcwMCwid2lkdGgiOjEyNSwiaGVpZ2h0Ijo5NywiZnJhbWVYIjotMSwiZnJhbWVZIjotMSwiZnJhbWVXaWR0aCI6MTI3LCJmcmFtZUhlaWdodCI6OTksIm5hbWUiOiJtZWxsb3dkcmFnb25fZGFya18wM19lZmZlY3RfbGlnaHRkdXN0In0seyJ4Ijo0MTQsInkiOjY5Niwid2lkdGgiOjEyOCwiaGVpZ2h0IjoxMjgsIm5hbWUiOiJtZWxsb3dkcmFnb25fZGFya18wM19lZmZlY3RfMDEifSx7IngiOjg0OCwieSI6ODMxLCJ3aWR0aCI6MjYsImhlaWdodCI6NjAsImZyYW1lWCI6LTYsImZyYW1lWSI6LTYsImZyYW1lV2lkdGgiOjM3LCJmcmFtZUhlaWdodCI6NzMsIm5hbWUiOiJtZWxsb3dkcmFnb25fZGFya18wM19yb2NrZXRfMDNfMDMifSx7IngiOjU3NSwieSI6OTYyLCJ3aWR0aCI6MjcsImhlaWdodCI6NjEsImZyYW1lWCI6LTUsImZyYW1lWSI6LTYsImZyYW1lV2lkdGgiOjM3LCJmcmFtZUhlaWdodCI6NzQsIm5hbWUiOiJtZWxsb3dkcmFnb25fZGFya18wM19yb2NrZXRfMDNfMDIifSx7IngiOjgxOSwieSI6ODMxLCJ3aWR0aCI6MjcsImhlaWdodCI6NjAsImZyYW1lWCI6LTUsImZyYW1lWSI6LTYsImZyYW1lV2lkdGgiOjM3LCJmcmFtZUhlaWdodCI6NzQsIm5hbWUiOiJtZWxsb3dkcmFnb25fZGFya18wM19yb2NrZXRfMDNfMDEifSx7IngiOjEsInkiOjgyNCwid2lkdGgiOjI2MCwiaGVpZ2h0IjoxNDIsImZyYW1lWCI6LTMsImZyYW1lWSI6LTQsImZyYW1lV2lkdGgiOjI2NiwiZnJhbWVIZWlnaHQiOjE1MCwibmFtZSI6Im1lbGxvd2RyYWdvbl9kYXJrXzAzX3JvY2tldF8wMyJ9LHsieCI6OTI1LCJ5Ijo0OTEsIndpZHRoIjo5OCwiaGVpZ2h0Ijo4OCwiZnJhbWVYIjotNiwiZnJhbWVZIjotOCwiZnJhbWVXaWR0aCI6MTA5LCJmcmFtZUhlaWdodCI6MTA0LCJuYW1lIjoibWVsbG93ZHJhZ29uX2RhcmtfMDNfcm9ja2V0XzAyXzAxIn0seyJ4Ijo1MTgsInkiOjk2Miwid2lkdGgiOjU1LCJoZWlnaHQiOjUzLCJmcmFtZVgiOi0zNywiZnJhbWVZIjotMzcsImZyYW1lV2lkdGgiOjEyOCwiZnJhbWVIZWlnaHQiOjEyOCwibmFtZSI6Im1lbGxvd2RyYWdvbl9kYXJrXzAzX2VmZmVjdF9saWdodCJ9LHsieCI6ODg1LCJ5Ijo4MjQsIndpZHRoIjoxMzcsImhlaWdodCI6OTYsImZyYW1lWCI6LTQsImZyYW1lWSI6LTQsImZyYW1lV2lkdGgiOjE0NCwiZnJhbWVIZWlnaHQiOjEwNCwibmFtZSI6Im1lbGxvd2RyYWdvbl9kYXJrXzAzX3JvY2tldF8wMiJ9LHsieCI6NjcyLCJ5Ijo4MzEsIndpZHRoIjoxMDksImhlaWdodCI6NjcsIm5hbWUiOiJtZWxsb3dkcmFnb25fZGFya18wM193aW5nXzAyIn0seyJ4Ijo0MDgsInkiOjU2Mywid2lkdGgiOjEzNiwiaGVpZ2h0IjoxMzEsIm5hbWUiOiJtZWxsb3dkcmFnb25fZGFya18wM193aW5nXzAxIn0seyJ4Ijo5MzYsInkiOjE0OCwid2lkdGgiOjc4LCJoZWlnaHQiOjY1LCJuYW1lIjoibWVsbG93ZHJhZ29uX2RhcmtfMDNfdGFpbF8wMSJ9LHsieCI6MSwieSI6OTk3LCJ3aWR0aCI6MzgsImhlaWdodCI6MjMsImZyYW1lWCI6LTQsImZyYW1lWSI6LTQsImZyYW1lV2lkdGgiOjQ1LCJmcmFtZUhlaWdodCI6MzAsIm5hbWUiOiJtZWxsb3dkcmFnb25fZGFya18wM19zY2FyZl8wMiJ9LHsieCI6OTIwLCJ5IjozODcsIndpZHRoIjoxMDAsImhlaWdodCI6MTAyLCJuYW1lIjoibWVsbG93ZHJhZ29uX2RhcmtfMDNfZWFyXzAyIn0seyJ4Ijo0MSwieSI6OTk4LCJ3aWR0aCI6MzUsImhlaWdodCI6MjUsImZyYW1lWCI6LTQsImZyYW1lWSI6LTQsImZyYW1lV2lkdGgiOjQzLCJmcmFtZUhlaWdodCI6MzMsIm5hbWUiOiJtZWxsb3dkcmFnb25fZGFya18wM19hcm1fMDIifSx7IngiOjMyMSwieSI6OTQyLCJ3aWR0aCI6NTQsImhlaWdodCI6NTAsIm5hbWUiOiJtZWxsb3dkcmFnb25fZGFya18wM19mb290XzAyIn0seyJ4IjozMjYsInkiOjU2Mywid2lkdGgiOjc3LCJoZWlnaHQiOjY4LCJuYW1lIjoibWVsbG93ZHJhZ29uX2RhcmtfMDNfbGVnXzAyIn0seyJ4Ijo3NzcsInkiOjcwMCwid2lkdGgiOjEwNiwiaGVpZ2h0IjoxMjksIm5hbWUiOiJtZWxsb3dkcmFnb25fZGFya18wM19ib2R5XzAxIn0seyJ4Ijo3NywieSI6Nzc1LCJ3aWR0aCI6NDYsImhlaWdodCI6NDcsImZyYW1lWCI6LTUsImZyYW1lWSI6LTQsImZyYW1lV2lkdGgiOjU0LCJmcmFtZUhlaWdodCI6NTQsIm5hbWUiOiJtZWxsb3dkcmFnb25fZGFya18wM19hcm1fMDEifSx7IngiOjUyMSwieSI6ODk2LCJ3aWR0aCI6OTQsImhlaWdodCI6NjQsIm5hbWUiOiJtZWxsb3dkcmFnb25fZGFya18wM19sZWdfMDEifSx7IngiOjEsInkiOjc3NSwid2lkdGgiOjc0LCJoZWlnaHQiOjQ3LCJmcmFtZVgiOi00LCJmcmFtZVkiOi0zLCJmcmFtZVdpZHRoIjo4MSwiZnJhbWVIZWlnaHQiOjU0LCJuYW1lIjoibWVsbG93ZHJhZ29uX2RhcmtfMDNfc2NhcmZfMDEifSx7IngiOjc4MywieSI6ODMxLCJ3aWR0aCI6MzQsImhlaWdodCI6OTAsImZyYW1lWCI6LTQsImZyYW1lWSI6LTQsImZyYW1lV2lkdGgiOjQyLCJmcmFtZUhlaWdodCI6OTcsIm5hbWUiOiJtZWxsb3dkcmFnb25fZGFya18wM19ob3JuXzAyIn0seyJ4Ijo4MDQsInkiOjM4Nywid2lkdGgiOjExNCwiaGVpZ2h0IjoxMjksImZyYW1lWCI6LTQsImZyYW1lWSI6LTExLCJmcmFtZVdpZHRoIjoxMjEsImZyYW1lSGVpZ2h0IjoxNDMsIm5hbWUiOiJtZWxsb3dkcmFnb25fZGFya18wM19oZWFkXzAxIn0seyJ4Ijo0MTQsInkiOjkyMiwid2lkdGgiOjEwMiwiaGVpZ2h0Ijo1NSwiZnJhbWVYIjotNCwiZnJhbWVZIjotNCwiZnJhbWVXaWR0aCI6MTEwLCJmcmFtZUhlaWdodCI6NjMsIm5hbWUiOiJtZWxsb3dkcmFnb25fZGFya18wM19qb3lfMDUifSx7IngiOjE3MiwieSI6ODA3LCJ3aWR0aCI6MTksImhlaWdodCI6OSwiZnJhbWVYIjotNCwiZnJhbWVZIjotNCwiZnJhbWVXaWR0aCI6MjcsImZyYW1lSGVpZ2h0IjoxNywibmFtZSI6Im1lbGxvd2RyYWdvbl9kYXJrXzAzX2pveV8wNF8wMSJ9LHsieCI6Mzc0LCJ5Ijo2MzMsIndpZHRoIjoyMCwiaGVpZ2h0Ijo3LCJmcmFtZVgiOi00LCJmcmFtZVkiOi00LCJmcmFtZVdpZHRoIjoyOCwiZnJhbWVIZWlnaHQiOjE1LCJuYW1lIjoibWVsbG93ZHJhZ29uX2RhcmtfMDNfam95XzA0In0seyJ4Ijo0MzQsInkiOjk3OSwid2lkdGgiOjQ2LCJoZWlnaHQiOjM4LCJmcmFtZVgiOi0zLCJmcmFtZVkiOi00LCJmcmFtZVdpZHRoIjo1MywiZnJhbWVIZWlnaHQiOjQ1LCJuYW1lIjoibWVsbG93ZHJhZ29uX2RhcmtfMDNfaGFuZF8wMSJ9LHsieCI6MzU0LCJ5Ijo2MzMsIndpZHRoIjoxOCwiaGVpZ2h0Ijo5LCJmcmFtZVgiOi00LCJmcmFtZVkiOi00LCJmcmFtZVdpZHRoIjoyNiwiZnJhbWVIZWlnaHQiOjE3LCJuYW1lIjoibWVsbG93ZHJhZ29uX2RhcmtfMDNfam95XzAzXzAxIn0seyJ4Ijo1MTIsInkiOjEwMTcsIndpZHRoIjoyMCwiaGVpZ2h0Ijo2LCJmcmFtZVgiOi00LCJmcmFtZVkiOi00LCJmcmFtZVdpZHRoIjoyOCwiZnJhbWVIZWlnaHQiOjE0LCJuYW1lIjoibWVsbG93ZHJhZ29uX2RhcmtfMDNfam95XzAzIn0seyJ4IjozMjYsInkiOjYzMywid2lkdGgiOjI2LCJoZWlnaHQiOjExLCJmcmFtZVgiOi00LCJmcmFtZVkiOi00LCJmcmFtZVdpZHRoIjozNCwiZnJhbWVIZWlnaHQiOjE5LCJuYW1lIjoibWVsbG93ZHJhZ29uX2RhcmtfMDNfam95XzAyIn0seyJ4Ijo0ODIsInkiOjk3OSwid2lkdGgiOjI4LCJoZWlnaHQiOjQxLCJmcmFtZVgiOi00LCJmcmFtZVkiOi00LCJmcmFtZVdpZHRoIjozNiwiZnJhbWVIZWlnaHQiOjQ5LCJuYW1lIjoibWVsbG93ZHJhZ29uX2RhcmtfMDNfam95XzAxIn0seyJ4Ijo2MTcsInkiOjg5Niwid2lkdGgiOjM4LCJoZWlnaHQiOjgyLCJmcmFtZVgiOi00LCJmcmFtZVkiOi00LCJmcmFtZVdpZHRoIjo0NSwiZnJhbWVIZWlnaHQiOjg5LCJuYW1lIjoibWVsbG93ZHJhZ29uX2RhcmtfMDNfaG9ybl8wMSJ9LHsieCI6MTkzLCJ5Ijo4MDcsIndpZHRoIjoxLCJoZWlnaHQiOjEsIm5hbWUiOiJtZWxsb3dkcmFnb25fZGFya18wM19tb3V0aF8wMSJ9LHsieCI6MTI1LCJ5Ijo3NzUsIndpZHRoIjo3MCwiaGVpZ2h0IjozMCwiZnJhbWVYIjotNywiZnJhbWVZIjotMTAsImZyYW1lV2lkdGgiOjgyLCJmcmFtZUhlaWdodCI6NDUsIm5hbWUiOiJtZWxsb3dkcmFnb25fZGFya18wM19leWVfMDIifSx7IngiOjgwNCwieSI6NTE4LCJ3aWR0aCI6NjksImhlaWdodCI6MzYsImZyYW1lWCI6LTcsImZyYW1lWSI6LTQsImZyYW1lV2lkdGgiOjgyLCJmcmFtZUhlaWdodCI6NDUsIm5hbWUiOiJtZWxsb3dkcmFnb25fZGFya18wM19leWVfMDQifSx7IngiOjkzNiwieSI6MjE1LCJ3aWR0aCI6ODIsImhlaWdodCI6NDUsIm5hbWUiOiJtZWxsb3dkcmFnb25fZGFya18wM19leWVfMDEifSx7IngiOjMyMSwieSI6OTk0LCJ3aWR0aCI6NjcsImhlaWdodCI6MjgsImZyYW1lWCI6LTksImZyYW1lWSI6LTksImZyYW1lV2lkdGgiOjgyLCJmcmFtZUhlaWdodCI6NDUsIm5hbWUiOiJtZWxsb3dkcmFnb25fZGFya18wM19leWVfMDMifSx7IngiOjgwNCwieSI6MjgzLCJ3aWR0aCI6MTQ5LCJoZWlnaHQiOjEwMiwibmFtZSI6Im1lbGxvd2RyYWdvbl9kYXJrXzAzX2Vhcl8wMSJ9LHsieCI6OTU1LCJ5IjozMjMsIndpZHRoIjo2MiwiaGVpZ2h0Ijo1MiwibmFtZSI6Im1lbGxvd2RyYWdvbl9kYXJrXzAzX2dsb3Zlc18wMSJ9LHsieCI6NTQ0LCJ5Ijo4MjQsIndpZHRoIjoxMjYsImhlaWdodCI6NzAsImZyYW1lWCI6LTMsImZyYW1lWSI6LTMsImZyYW1lV2lkdGgiOjEzMywiZnJhbWVIZWlnaHQiOjc2LCJuYW1lIjoibWVsbG93ZHJhZ29uX2RhcmtfMDNfZ29nZ2xlc18wMSJ9LHsieCI6ODE5LCJ5Ijo4OTMsIndpZHRoIjozOSwiaGVpZ2h0IjozMywiZnJhbWVYIjotMywiZnJhbWVZIjotMywiZnJhbWVXaWR0aCI6NDYsImZyYW1lSGVpZ2h0IjozOSwibmFtZSI6Im1lbGxvd2RyYWdvbl9kYXJrXzAzX2hhbmRfMDFfMDEifSx7IngiOjQxNCwieSI6ODI2LCJ3aWR0aCI6MTA1LCJoZWlnaHQiOjc0LCJmcmFtZVgiOi02LCJmcmFtZVkiOi04LCJmcmFtZVdpZHRoIjoxMTYsImZyYW1lSGVpZ2h0Ijo4OSwibmFtZSI6Im1lbGxvd2RyYWdvbl9kYXJrXzAzX3JvY2tldF8wMV8wMyJ9LHsieCI6MTk3LCJ5Ijo3ODUsIndpZHRoIjo0NSwiaGVpZ2h0IjozMSwiZnJhbWVYIjotOCwiZnJhbWVZIjotNCwiZnJhbWVXaWR0aCI6NjIsImZyYW1lSGVpZ2h0Ijo0NSwibmFtZSI6Im1lbGxvd2RyYWdvbl9kYXJrXzAzX3JvY2tldF8wMV8wMiJ9LHsieCI6MjEzLCJ5Ijo2NDcsIndpZHRoIjoxOTMsImhlaWdodCI6MTM2LCJmcmFtZVgiOi00LCJmcmFtZVkiOi00LCJmcmFtZVdpZHRoIjoyMDEsImZyYW1lSGVpZ2h0IjoxNDMsIm5hbWUiOiJtZWxsb3dkcmFnb25fZGFya18wM19yb2NrZXRfMDEifSx7IngiOjQ0LCJ5Ijo5NjgsIndpZHRoIjozNiwiaGVpZ2h0IjoyOCwiZnJhbWVYIjotNCwiZnJhbWVZIjotNCwiZnJhbWVXaWR0aCI6NDQsImZyYW1lSGVpZ2h0IjozNSwibmFtZSI6Im1lbGxvd2RyYWdvbl9kYXJrXzAzX3JvY2tldF8wMV8wMSJ9LHsieCI6MzkwLCJ5Ijo5NzksIndpZHRoIjo0MiwiaGVpZ2h0Ijo0MiwiZnJhbWVYIjotOCwiZnJhbWVZIjotMTEsImZyYW1lV2lkdGgiOjU4LCJmcmFtZUhlaWdodCI6NjMsIm5hbWUiOiJtZWxsb3dkcmFnb25fZGFya18wM19lZmZlY3RfMDgifSx7IngiOjg3NSwieSI6NTE4LCJ3aWR0aCI6NDIsImhlaWdodCI6NDIsImZyYW1lWCI6LTgsImZyYW1lWSI6LTExLCJmcmFtZVdpZHRoIjo1OCwiZnJhbWVIZWlnaHQiOjYzLCJuYW1lIjoibWVsbG93ZHJhZ29uX2RhcmtfMDNfZWZmZWN0XzA5In0seyJ4Ijo5MjUsInkiOjY3Nywid2lkdGgiOjQyLCJoZWlnaHQiOjIwLCJmcmFtZVgiOi03LCJmcmFtZVkiOi05LCJmcmFtZVdpZHRoIjo0OSwiZnJhbWVIZWlnaHQiOjM1LCJuYW1lIjoibWVsbG93ZHJhZ29uX2RhcmtfMDNfcm9ja2V0XzA0XzA1In0seyJ4Ijo5NjksInkiOjY3Nywid2lkdGgiOjQ0LCJoZWlnaHQiOjE1LCJmcmFtZVgiOi00LCJmcmFtZVkiOi05LCJmcmFtZVdpZHRoIjo1MSwiZnJhbWVIZWlnaHQiOjMzLCJuYW1lIjoibWVsbG93ZHJhZ29uX2RhcmtfMDNfcm9ja2V0XzA0XzA0In0seyJ4Ijo2MDcsInkiOjE0OCwid2lkdGgiOjMyNywiaGVpZ2h0IjoxMzMsImZyYW1lWCI6LTksImZyYW1lWSI6LTgsImZyYW1lV2lkdGgiOjM0NywiZnJhbWVIZWlnaHQiOjE3MCwibmFtZSI6Im1lbGxvd2RyYWdvbl9kYXJrXzAzX3JvY2tldF8wNCJ9LHsieCI6NTIxLCJ5Ijo4MjYsIndpZHRoIjoyMSwiaGVpZ2h0IjoyNSwiZnJhbWVYIjotMTYsImZyYW1lWSI6LTUsImZyYW1lV2lkdGgiOjQ5LCJmcmFtZUhlaWdodCI6MzUsIm5hbWUiOiJtZWxsb3dkcmFnb25fZGFya18wM19yb2NrZXRfMDRfMDYifSx7IngiOjg2MCwieSI6ODkzLCJ3aWR0aCI6MjMsImhlaWdodCI6NDEsImZyYW1lWCI6LTE3LCJmcmFtZVkiOi0xMywiZnJhbWVXaWR0aCI6NTgsImZyYW1lSGVpZ2h0Ijo3MywibmFtZSI6Im1lbGxvd2RyYWdvbl9kYXJrXzAzX3JvY2tldF8wNF8wMSJ9LHsieCI6MSwieSI6OTY4LCJ3aWR0aCI6NDEsImhlaWdodCI6MjcsImZyYW1lWCI6LTQsImZyYW1lWSI6LTksImZyYW1lV2lkdGgiOjUwLCJmcmFtZUhlaWdodCI6NDMsIm5hbWUiOiJtZWxsb3dkcmFnb25fZGFya18wM19yb2NrZXRfMDRfMDMifSx7IngiOjEyNSwieSI6ODA3LCJ3aWR0aCI6NDUsImhlaWdodCI6MTUsImZyYW1lWCI6LTIsImZyYW1lWSI6LTMsImZyYW1lV2lkdGgiOjUyLCJmcmFtZUhlaWdodCI6MjIsIm5hbWUiOiJtZWxsb3dkcmFnb25fZGFya18wM19yb2NrZXRfMDRfMDIifSx7IngiOjEsInkiOjMwNCwid2lkdGgiOjU0MywiaGVpZ2h0IjoyNTcsImZyYW1lWCI6LTE1LCJmcmFtZVkiOi0yNiwiZnJhbWVXaWR0aCI6NjA5LCJmcmFtZUhlaWdodCI6MzA4LCJuYW1lIjoibWVsbG93ZHJhZ29uX2RhcmtfMDNfcm9ja2V0XzA0XzA3In0seyJ4IjoxLCJ5IjoxLCJ3aWR0aCI6NjA0LCJoZWlnaHQiOjMwMSwiZnJhbWVYIjotMywiZnJhbWVZIjotNCwiZnJhbWVXaWR0aCI6Nzc2LCJmcmFtZUhlaWdodCI6MzA4LCJuYW1lIjoibWVsbG93ZHJhZ29uX2RhcmtfMDNfcm9ja2V0XzA0XzA4In0seyJ4Ijo1NDYsInkiOjMwNCwid2lkdGgiOjI1NiwiaGVpZ2h0IjoyNTYsIm5hbWUiOiJtZWxsb3dkcmFnb25fZGFya18wM19lZmZlY3RfMDIifSx7IngiOjc3NywieSI6NTYyLCJ3aWR0aCI6MTQ2LCJoZWlnaHQiOjEzNiwiZnJhbWVYIjotMywiZnJhbWVZIjotNSwiZnJhbWVXaWR0aCI6MTU3LCJmcmFtZUhlaWdodCI6MTU0LCJuYW1lIjoibWVsbG93ZHJhZ29uX2RhcmtfMDNfZWZmZWN0XzAzIn0seyJ4IjoyNjMsInkiOjc4NSwid2lkdGgiOjE0OSwiaGVpZ2h0IjoxNTUsIm5hbWUiOiJtZWxsb3dkcmFnb25fZGFya18wM19lZmZlY3RfMDQifSx7IngiOjk1NSwieSI6MjYyLCJ3aWR0aCI6NTgsImhlaWdodCI6NTksImZyYW1lWSI6LTIsImZyYW1lV2lkdGgiOjU4LCJmcmFtZUhlaWdodCI6NjMsIm5hbWUiOiJtZWxsb3dkcmFnb25fZGFya18wM19lZmZlY3RfMDYifSx7IngiOjM3NywieSI6OTQyLCJ3aWR0aCI6MzUsImhlaWdodCI6MjgsImZyYW1lWCI6LTEyLCJmcmFtZVkiOi0xOCwiZnJhbWVXaWR0aCI6NTgsImZyYW1lSGVpZ2h0Ijo2MywibmFtZSI6Im1lbGxvd2RyYWdvbl9kYXJrXzAzX2VmZmVjdF8wNSJ9LHsieCI6MSwieSI6NjQ3LCJ3aWR0aCI6MjEwLCJoZWlnaHQiOjEyNiwibmFtZSI6Im1lbGxvd2RyYWdvbl9kYXJrXzAzX2VmZmVjdF9maXJlIn0seyJ4Ijo5MjUsInkiOjU4MSwid2lkdGgiOjkxLCJoZWlnaHQiOjk0LCJuYW1lIjoibWVsbG93ZHJhZ29uX2RhcmtfMDNfZWZmZWN0X3JlZCJ9LHsieCI6MjYzLCJ5Ijo5NDIsIndpZHRoIjo1NiwiaGVpZ2h0Ijo1NiwiZnJhbWVYIjotMSwiZnJhbWVZIjotNCwiZnJhbWVXaWR0aCI6NTgsImZyYW1lSGVpZ2h0Ijo2MywibmFtZSI6Im1lbGxvd2RyYWdvbl9kYXJrXzAzX2VmZmVjdF8wNyJ9LHsieCI6MSwieSI6NTYzLCJ3aWR0aCI6MzIzLCJoZWlnaHQiOjgyLCJmcmFtZVgiOi0zLCJmcmFtZVkiOi0zLCJmcmFtZVdpZHRoIjozMjgsImZyYW1lSGVpZ2h0Ijo4NywibmFtZSI6Im1lbGxvd2RyYWdvbl9kYXJrXzAzX2VmZmVjdF9ibHVlIn1dfV19IEQAAAAAAAQAAwAQASsAMwA/AAIAAAABAAIAAAABAAIAAAABAAIAAAABAAIAAAABAAMAAAABAAIAAwAAAAEAAgADAAAAAQACAAMAAAABAAIAAwAAAAEAAgADAAAAAQACAAMAAAABAAIAAwAAAAEAAgACAAEAAgACAAEAAgABAAIAAQACAAEAAgABAAIAAQACAAEAAgABAAIAAQACAAIAAQACAAIAAQACAAIAAQACAAIAAQACAAIAAQACAAIAAQACAAMAAAABAAIAAwAAAAEAAgADAAAAAQACAAMAAAABAAIAAwAAAAEAAgADAAAAAQACAAMAAAABAAIAAwAAAAEAAgADAAAAAQACAAIAAAABAAIAAAABAAIAAAABAAIAAAABAAIAAAABAAIAAAABAAIAAAABAAIAAAABAAIAAAABAAIAAAABAAIAAAABAAEAAAABAAAAAQAAAAEAAAABAAAAAQAAAAEAAAABAAAAAgAAAAEAAgABAAIAAgAAAAEAAgAAAAEAAQAAAAEAAAACAAAAAQABAAEAAgABAAIAAQACAAEAAgA2AD0AnAKMAS0ABgAFAAEAAAACAAAALgACAC4AAwACACwALgAAACsALgAsAC4ABAADAC4ALwAFAC4ABQAEACoALgArAC8ALQAFAC8ABgAtACkALgAqAC8AMAAIAC8ACAAHAC8ABwAGADAACQAIACgAJwAuACcALwAuACkAKAAuACYALwAnADAACgAJADAACwAKACUALwAmADAAMQALACUAJAAvACQAIwAvACMAMAAvACIAMAAjADEADAALADEAMgAOADEADgANACIAIQAwADEADQAMACEAIAAwADIADwAOAB8AMQAwACAAHwAwAB8AHgAxAB4AHQAxADIAEAAPABwAMgAxAB0AHAAxADIAMwAQADMAEQAQABwAGwAyABsAGgAzADMANAARADQAEgARABsAMwAyABoANAAzABoAGQA0ABkANQA0ADQANQASADUAEwASABkAGAA1ABgAFwA1ABUAFAA1ADUAFAATABcAFgA1ABYAFQA1AAQAdAMjAEwAMgA9AAEAAAABAAAAAgAAAAIAAgAAAAIAAgAAAAIAAgAAAAIAAgAAAAIAAgAAAAIAAwAAAAIAAwADAAAAAgADAAMAAAACAAMAAwAAAAIAAwADAAAAAgADAAMAAAACAAMAAwAAAAIAAwAEAAAAAgADAAEABAAAAAIAAwABAAMAAgADAAEAAgADAAEAAwACAAMAAQACAAMAAQABAAEAAQABAAIAAwABAAMAAgADAAEAAwACAAMAAQADAAIAAwABAAMAAgADAAEAAwACAAMAAQAEAAAAAgADAAEAAwAAAAIAAwAEAAAAAgADAAEABAAAAAIAAwABAAQAAAACAAMAAQAEAAAAAgADAAEAAwAAAAIAAwADAAAAAgADAAIAAAADAAEAAAABAAAAAQAAAAEAAAABAAAAAQAAAAEAAAACAAAAAgABAAAAAQAAAAIAAAACAAEAAgACAAIAAwABAAMAAgADAAEAAQABABkAFwDlBIwCBQAEAAYAAwAIAAcABAADAAcABgAEAAcADAALAAMACwAJAAgAAwALAAgAAgAMAAMACwAKAAkAAgAQAAwAEQAQAAEAAQAQAAIADgANAAwADwAOAAwAEAAPAAwAAAARAAEAFQAUABIAGAAVAAAAFQASAAAAEgARAAAAFAATABIAFgAVABgAFwAWABgABABJBU0AUgBTAEMAAgAAAAEAAgAAAAEAAwAAAAEAAgACAAAAAgACAAAAAgACAAAAAgACAAAAAgABAAIAAgADAAIAAgADAAIAAwADAAAAAgADAAMAAAACAAMAAwAAAAIAAwADAAAAAgACAAMAAgACAAMAAQADAAMAAAABAAMAAwAAAAEAAwADAAAAAQACAAMAAQACAAMAAQABAAEAAQABAAEAAQACAAAAAQBpAAAA6wXlAgMAjwdBAFEAWQABAAAAAQAAAAEAAAABAAAAAQAAAAEAAAABAAAAAgAAAAEAAgAAAAEAAgAAAAEAAgAAAAEAAgAAAAEAAgAAAAEAAgAAAAEAAgAAAAEAAgAAAAEAAgAAAAEAAgAAAAEAAgAAAAEAAwAAAAEAAgADAAAAAQACAAMAAAABAAIAAwAAAAEAAgADAAAAAQACAAIAAQACAAIAAQACAAIAAQACAAIAAQACAAIAAQACAAIAAQACAAIAAQACAAIAAQACAAIAAQACAAIAAQACAAIAAQACAAIAAQACAAEAAgABAAIAAQACAAEAAgABAAIAAQACAAEAAgABAAIAAQACAAEAAgABAAIAAQACAAEAAgABAAIAAQACAAEAAgABAAIAAQACAAEAAgABAAIAAQACAAEAAgABAAIAAgABAAIAAgABAAIAAgABAAIAAgABAAIAAgABAAIAAgABAAIAAwAAAAEAAgADAAAAAQACAAMAAAABAAIAAwAAAAEAAgADAAAAAQACAAMAAAABAAIAAwAAAAEAAgADAAAAAQACAAMAAAABAAIAAwAAAAEAAgADAAAAAQACAAIAAAABAAIAAAABAAIAAAABAAIAAAABAAIAAAABAAIAAAABAAIAAAABAAIAAAABAAIAAAABAAEAAAABAAAAAQAAAAIAAQACAAIAAQACAAIAAQACAAIAAQACAAEAAgABAAIAAQACAAEAAgABAAAAAQAAAAEAAAACAAAAAQABAAEAAgABAAIAAQACAAEAAgABAAIAdwCRALEJwAVsAFQAUwBrAFIAUQBiAEkASABgAEcARgBfAGAARgBcAEIAQQBbAEAAPwAxAHYAMgAyAHYAMwB2ADUAMwAzADUANAB2ADYANQAwAHYAMQB2ADcANgAvAHYAMAAuAHYALwAtAHUAdgB2ADgANwAtAHYALgB2ADkAOABdAEUARAAsAHUALQA7ADoAdgB1ADsAdgA6ADkAdgB1ADwAOwArAHUALAB1AD0APAAqAHUAKwA+AD0AdQB0AHUAKQApAHUAKgBbAD8AdQA/AD4AdQAoAHQAKQAnAHQAKABcAEEAdQB0AFwAdQBBAEAAdQBAAFsAdQBhAGIASABeAF8ARgB0AEIAXAAmAHQAJwBDAEIAdABzAHQAJQAlAHQAJgBEAEMAdAAkAHMAJQBjAEoASQBdAEQAdABGAEUAdABFAF0AdAAjAHMAJAAiAHMAIwBeAEYAdABzAGAAdABgAF8AdABfAF4AdABHAGAAcwAhAHMAIgBhAEgAcwBIAEcAcwBiAGEAcwAgAHIAIQByAHMAIQBJAGIAcwBjAEkAcwAfAHIAIABKAGMAcwAeAHIAHwByAB4AHQBLAGQAcwBMAEsAcwByAGUAcwBlAEwAcwBkAEoAcwAcAHIAHQAbAHEAHABxAHIAHABNAGUAcgAaAHEAGwBOAE0AcgAZAHEAGgBmAE4AcgAYAHEAGQBPAGYAcgAXAHEAGABmAE8ATgBkAEsASgBQAE8AcgBnAFAAcgAWAHEAFwBlAE0ATABoAGcAcgAVAHAAFgBwAHEAFgBVAFQAcQBxAFQAcgBUAGwAcgBpAGgAcgBnAFEAUABTAFIAcgBsAFMAcgBSAGsAcgBrAGoAcgBqAGkAcgAUAHAAFQBWAFUAcQATAHAAFABtAFYAcQBoAFEAZwASAHAAEwBuAG0AcQACAAEAcAARAHAAEgBwAAEAcQABAAAAcQBvAG4AcQBZAFgAcQBaAFkAcQAAAFoAcQBYAFcAcQBXAG8AcQBqAGsAUQAFAAQAcAAEAAIAcAAQAHAAEQAPAHAAEAAGAAUAcAAOAA0AcAANAAwAcAAHAAYAcAAPAA4AcAAIAAcAcAAMAAsAcAAKAAkAcAAJAAgAcAALAAoAcAADAAIABABoAGoAUQBpAGoAaABuAFcAVgBtAG4AVgBXAG4AbwADAI0LQgBQAFgAAgAAAAEAAgAAAAEAAQAAAAEAAAABAAAAAQAAAAEAAAABAAAAAQAAAAEAAAABAAAAAQAAAAEAAAABAAAAAQAAAAEAAAABAAAAAQAAAAEAAAABAAAAAQAAAAEAAAABAAAAAQAAAAIAAAABAAIAAAABAAIAAAABAAIAAAABAAIAAAABAAIAAAABAAIAAAABAAMAAAABAAIAAwAAAAEAAgADAAAAAQACAAMAAAABAAIAAwAAAAEAAgADAAAAAQACAAMAAAABAAIAAwAAAAEAAgADAAAAAQACAAIAAQACAAIAAQACAAIAAQACAAIAAQACAAIAAQACAAIAAQACAAIAAQACAAIAAQACAAEAAgABAAIAAQACAAEAAgABAAIAAQACAAEAAgABAAIAAQACAAEAAgACAAEAAgACAAEAAgACAAEAAgACAAEAAgACAAEAAgACAAEAAgACAAEAAgACAAEAAgACAAEAAgACAAEAAgACAAEAAgACAAEAAgADAAAAAQACAAMAAAABAAIAAwAAAAEAAgADAAAAAQACAAMAAAABAAIAAwAAAAEAAgADAAAAAQACAAMAAAABAAIAAwAAAAEAAgADAAAAAQACAAMAAAABAAIAAgAAAAEAAgAAAAEAAgAAAAEAAgAAAAEAAgAAAAEAAgAAAAEAAgAAAAEAAgAAAAEAAgAAAAEAAgAAAAEAAgABAAIAAgABAAIAAgABAAIAAwAAAAEAAgADAAAAAQACAAMAAAABAAIAAwAAAAEAAgADAAAAAQACAAMAAAABAAIAAwAAAAEAAgADAAAAAQACAAMAAAABAAIAAwAAAAEAAgACAAAAAQACAAAAAQACAAAAAQACAAAAAQACAAAAAQACAAAAAQACAAAAAQACAAAAAQABAAAAAQAAAAIAAAABAAEAAQACAAEAAgABAAIAAQACADAANwBCDswHLwAHAAYALwAJAAgABwAvAAgALwAKAAkABQAvAAYABAAvAAUAKgALAAoALwAqAAoAKQAqAC8AAwAoAAQAKAAvAAQAKgAMAAsAKgAOAA0AKgANAAwAAgAoAAMAKgAPAA4AKAApAC8AAQAoAAIAJwAoAAAAKgArAA8AAAAoAAEAKAAtACkAKwAQAA8ALQAqACkAJgAnAAAALQArACoALgArAC0ALgAtACgAJwAuACgALgAsACsAKwARABAALAASABEAJAAuACcALAARACsAJQAnACYAIwAuACQAJQAkACcALgAXACwAFwAWABUAIgAfACMAGQAYAC4AGAAXAC4AIwAfAC4AFwAVACwAFQAUACwALAATABIAGgAZAC4AFAATACwAHwAaAC4AHgAcABoAHgAaAB8AIQAgACIAIAAfACIAHQAcAB4AHAAbABoAAgACD0QASQACAAAAAQACAAAAAQACAAAAAQACAAAAAQACAAAAAQACAAAAAQABAAAAAQAAAAEAAAABAAAAAgAAAAEAAgAAAAEAAgAAAAEAAgAAAAEAAgAAAAEAAgAAAAEAAgAAAAEAAgAAAAEAAgAAAAEAAgAAAAEAAgAAAAEAAgAAAAEAAgAAAAEAAgAAAAEAAgAAAAEAAQABAAEAAQABAAEAAQABAAEAAQABAAEAAQABAAIAAAABAAIAAAABAAIAAAABAAIAAAABAAIAAAABAAIAAAABAAIAAAABAAIAAAABAAIAAAABAAEAAAACAAAAAQACAAAAAQACAAAAAQACAAAAAQABAAEAAQAAADMAOQD4DwEJJgArACcACwANAAwAMAAPAA4ADQALAA4ACwAwAA4AMQAQAA8AMAAxAA8AMQARABAACgAvAAsALwAwAAsAMQASABEACQAuAAoALgAvAAoAMQAyABIAMgATABIALgAJAAgABwAuAAgABgAuAAcABQAtAAYALQAuAAYAMgAUABMALwAZADAAGAAyADEAMAAZADEAGQAYADEABAAtAAUAAwAtAAQAMgAVABQALgAbAC8AGwAaAC8AGgAZAC8AFgAVADIAFwAWADIAGAAXADIAAgAtAAMALQAdAC4AHQAcAC4AHAAbAC4AAQAtAAIAHgAdAC0AAAAtAAEAHwAeAC0ALAAtAAAAIAAfAC0AKgAsAAAAJgAhACwALAAhAC0AIQAgAC0AJgAiACEAKwAmACwAKQAsACoAJQAiACYAKAAnACwAJwArACwAKQAoACwAJAAjACIAJAAiACUAAwDEEDcAPgBOAAEAAAABAAAAAQAAAAIAAAABAAIAAAABAAIAAAABAAIAAAABAAIAAAABAAIAAAABAAMAAAABAAIAAwAAAAEAAgADAAAAAQACAAMAAAABAAIAAgABAAIAAgABAAIAAgABAAIAAgABAAIAAgABAAIAAQACAAEAAgABAAIAAQACAAMAAAABAAIAAwAAAAEAAgADAAAAAQACAAMAAAABAAIAAwAAAAEAAgADAAAAAQACAAMAAAABAAIAAwAAAAEAAgADAAAAAQACAAMAAAABAAIAAwAAAAEAAgADAAAAAQACAAIAAAABAAEAAAABAAAAAQAAAAEAAAABAAAAAQAAAAEAAAABAAAAAQAAAAEAAAABAAAAAgAAAAEAAQABAAIAAQACAAEAAgABAAIALwAyAOcRNAoqAAYABQAqAAUABAADACoABAAqAAcABgAqAAgABwACACoAAwAKAAkACAAuAAoACAAqAC4ACAABACoAAgArAC4AKgAuAAwACwAuAAsACgAAACoAAQApACoAAAAoACoAKQAuAA0ADAAuAA4ADQAnACYAKgAoACcAKgArAC0ALgAmACUAKgAlACsAKgAuAA8ADgAkACsAJQAuABAADwAkACMAKwASABEALgAtABIALgARABAALgAjACIAKwAtABMAEgAiACEAKwAsAC0AKwAhACwAKwAhACAALAAUABMALQAVABQALQAWABUALQAYABcALQAXABYALQAZABgALQAaABkALQAsABoALQAgAB8ALAAbABoALAAeAB0ALAAdABwALAAfAB4ALAAcABsALAADAKMSJAA+ADcAAgAAAAEAAgAAAAEAAgAAAAEAAgAAAAEAAgAAAAEAAgAAAAEAAgAAAAEAAgAAAAEAAgAAAAEAAgAAAAEAAgAAAAEAAgAAAAEAAgAAAAEAAgAAAAEAAgAAAAEAAgACAAEAAgACAAEAAgACAAEAAgACAAEAAgACAAEAAQACAAEAAgABAAIAAgAAAAIAAgAAAAIAAgAAAAIAAgAAAAIAAgAAAAIAAgAAAAIAAgAAAAIAAgAAAAIAAgAAAAIAAgAAAAIAAQAAAAEAAAABAAAAAQAAAAEAAAABAAAAAQAAAAEAAAACAAAAAQADAAAAAgABAAMAAAACAAEAAgAAAAIAAQACAAIAAgABAGUAcwCfExkMVQAPAA4AVQARABAADwBVABAADQBVAA4AVQASABEADABVAA0AVQATABIACwBWAFUACwBVAAwAVQAUABMAVQAVABQAGAAWABUAGAAVAFUAVgAYAFUACgBWAAsACQBWAAoAGAAXABYAGQAYAFYACABWAAkACABXAFYABwBXAAgAGgAZAFYAVwAaAFYAXQAaAFcABgBXAAcAXQAbABoAXABdAFcABQBYAAYAWABXAAYABABYAAUAAwBaAAQAWgBYAAQAWABbAFcAAgBZAAMAWQBaAAMAWwBcAFcAAQBZAAIAAABZAAEAXQAcABsAWgBbAFgAVABZAAAAUwBZAFQAXQBeABwAUgBaAFkAUwBSAFkAUgBRAFoAUQBfAFoAXwBbAFoAXgAdABwAUABfAFEATwBfAFAAXgAeAB0AXwBgAFsAYABcAFsAXgAkAB4AJAAjAB8ATgBNAF8ATQBgAF8ATgBfAE8AJAAfAB4AIwAgAB8AYQBdAFwAYABhAFwAYQApAF0ATABgAE0AJQAkAF4AIgAhACAAIwAiACAAKQAoAF0AKAAnAF0AJwBeAF0AJwAmAF4AJgAlAF4ASwBgAEwAYQAqACkASABhAGAASwBKAGAASQBIAGAASgBJAGAAYQBiACoAYgArACoASABHAGEAYgAsACsARABiAGEARwBGAGEARQBEAGEARgBFAGEAQwBiAEQAYgAtACwAYgBjAC0AYwAuAC0AQABjAGIAQgBiAEMAYwAvAC4AQQBAAGIAQgBBAGIAPwBjAEAAYwBkADAAYwAwAC8APABkAD0APQBkAGMAZAAxADAAPwA+AGMAPgA9AGMAZAAyADEAZAAzADIAOQA0AGQAOgA5AGQAPAA7AGQAZAA0ADMAOQA1ADQAOwA6AGQAOQA4ADUANwA2ADUAOAA3ADUABwAzFUAATwBXADsAXgBWAF0AAgAAAAEAAgAAAAEAAgAAAAEAAwAAAAEAAgADAAMAAAABAAMAAwAAAAEAAgADAAAAAgADAAAAAgADAAAAAgADAAAAAgADAAAAAgADAAAAAgADAAAAAgADAAAAAQADAAEAAwABAAMAAgADAAQAAgADAAQAAgADAAQAAgADAAQAAgADAAQAAgADAAQAAgADAAQAAgADAAQAAgADAAQAAwADAAAABAADAAMAAAAEAAIAAwAEAAIAAwAEAAIAAwAEAAIAAwAEAAIAAwAEAAIAAwAEAAEABAAEAAMABQAGAAQABAADAAUABgAEAAMABQAGAAQAAwAFAAYABAADAAUABgAEAAMABQAGAAQABAAFAAYAAgAEAAMABQAGAAQAAwAFAAYABAADAAUABgAEAAMABQAGAAQAAwAFAAYABAADAAUABgAEAAMABQAGAAQAAgAGAAQAAgAGAAQAAQAGAAEABgABAAYAAQAGAAEABgABAAYAAQAGAAEABgABAAYAAQAGAAEABgABAAYAAgAFAAYAAgAFAAYAAgAFAAYAAgAFAAYAAgAFAAYAAgAFAAYAAQAFAAEABQABAAUAAgABAAUAAgABAAUAAgABAAUAAgABAAUAAgABAAUAAgABAAUAAwAAAAEABQACAAAAAQACAAAAAQACAAAAAQACAAAAAQACAAAAAQACAAAAAQABAAMAAQADAAIAAwAAAAEAAAACAAAAAQABAAIAAQACAAIAAgAEAAMABQAGAAQAAQAEAAIAAQACAAIAAQAFAAEABQACAAUABgACAAYABAABAAYAWgBmAIgXhA5OABgAFwBPABQAEwBQAE8AEwAKAFQACwAHAAYACQBUAAoACQAGAFQACQAIAAcACQARABMAEgBUAAwACwBUAA0ADABTAFAAEwARAFMAEwBTAA8ADgAQAFMAEQBTAA4ADQBUAFMADQBWAE8AUABTAFYAUABWABQATwBTABAADwBTAFIAVgAFAFQABgBWABUAFABNACQAIwBWABYAFQBWABcAFgAEAFQABQBWAE4AFwADAFQABABWABgATgACAFUAAwBVAFQAAwBKAAAASwAAAFUAAQBVAAIAAQBKAFUAAABWABkAGABEAFMAVABWABoAGQBGAFQAVQBHAEYAVQBKAEgAVQBIAEcAVQBEAEMAUwBWAFkAGwBWABsAGgBFAEQAVABGAEUAVABJAEgASgBCAEEAUwBDAEIAUwBZABwAGwBBAEAAUwBZAB0AHABSAFkAVgBZAB8AHgA7AFIAUwA8ADsAUwA9ADwAUwA+AD0AUwA/AD4AUwBAAD8AUwBZAB4AHQA7AFcAUgBZACAAHwAhACAAWQBSAFgAWQAiACEAWQBXAFgAUgAjACIAWQAkAE0AWQBYACQAWQBNACMAWQBYACUAJABYACYAJQBYACcAJgA6AFcAOwA5AFcAOgAoACcAWAA4AFcAOQApACgAWAA4ADcAVwAqACkAWAArACoAWABMACsAWAAvAC4AVwA3ADYAVwBXAC4AWAAuAFEAWAAsAEwAWAAtACwAWABRAC0AWAAwAC8AVwAxADAAVwA2ADUAVwA1ADQAVwAzADIAVwAyADEAVwA0ADMAVwBMACwAKwBRAC4ALQAFAPAYOAAeACMAJAAKAAEAAAABAAAAAgABAAAAAgABAAAAAgABAAAAAgABAAAAAwABAAAAAgADAAEAAAACAAMAAQAAAAIAAwABAAAAAgADAAEAAAACAAMAAQAAAAIAAwABAAAAAgADAAEAAAACAAMAAQAAAAIAAwABAAAAAgACAAEAAgACAAEAAgACAAEAAgACAAEAAgACAAEAAgACAAEAAgACAAEAAgACAAEAAgABAAIAAQACAAEAAgABAAIAAQACAAEAAgABAAIAAQACAAEAAgABAAIAAQACAAEAAgACAAIAAwADAAQAAgADAAMABAACAAMAAwAEAAIAAwADAAQAAgADAAMABAACAAMAAwAEAAIAAwADAAQAAgADAAMABAACAAMAAwAEAAIAAwADAAQAAgADAAMABAACAAMAAwAEAAIAAwACAAIAAwABAAMAAgABAAMAAgABAAMAAgABAAMAAwAEAAEAAwAEAAQAAQAAAAMABAAEAAEAAAADAAQABAABAAAAAwAEAAQAAQAAAAMABAAEAAEAAAADAAQABAABAAAAAwAEAAQAAQAAAAMABAAEAAEAAAADAAQABAABAAAAAwAEAAQAAQAAAAMABAAEAAEAAAADAAQABAABAAAAAwADAAEAAAADAAMAAQAAAAMAAwABAAAAAwADAAEAAAADAAMAAQAAAAMAAwABAAAAAwADAAEAAAADAAMAAQAAAAMAAQAAAAMABAACAAMAAgACAAMAAgABAAIAAgABAAIAAgABAAIAAwAEAAIAAwABAAQAAQABAAIAAQAAAAEAAAABAAIAAQADAAMABAACAAMAAQACAIoAmwB4G5IRSgBJAEMASgBDAEIASwBKAEIASABHAEQAQwBJAEQASQBIAEQARgBFAEQARwBGAEQAQQBLAEIAgQBMAEEATABLAEEAgQBBAEAAPwCBAEAAPgCBAD8APQCAAD4AgACBAD4ATQBMAIEAPACAAD0AgABPAIEAOwCAADwAOgCAADsAUABPAIAAfwCAADoAfwA6ADkATwBOAIEATgBNAIEAOAB/ADkANwB/ADgANgB/ADcAfwBTAIAAUwBSAIAAUQBQAIAANQB/ADYAfgB/ADUAUgBRAIAANAB+ADUAVwBWAH4AMwB+ADQAfgBWAH8AVgBVAH8AVQBUAH8AVABTAH8AMgB+ADMAMQB+ADIAWABXAH4AMAB+ADEALwB9ADAAfQB+ADAAhgBYAH4AfQCGAH4ALgB9AC8ALQB9AC4AhgBZAFgAfAB9ACwALAB9AC0AfACGAH0AKwB8ACwAKgB8ACsAWgBZAIYAhwCGAHwAKQB8ACoAKAB8ACkAWwBaAIYAKAB7AHwAJwB7ACgAewCHAHwAhQBcAFsAhQBbAIYAhACFAIYAhwCEAIYAJgB7ACcAJQB7ACYAewCDAIcAJAB7ACUAIwB7ACQAggB7ACMAgwCEAIcAhQBdAFwAIgCCACMAegCCACIAggCDAHsAIQB6ACIAhQBeAF0AhQBmAF4AIAB6ACEAZgBlAF4AXgBlAF8AZQBgAF8AZwBmAIUAiACFAIQAgwCJAIQAHwB6ACAAZABhAGAAZQBkAGAAZABiAGEAiABpAIUAggB5AIMAeQCJAIMAiQCIAIQAGgB6AB4AaQBoAIUAaABnAIUAHgB6AB8AZABjAGIAGQAYAHoAGgAZAHoAHAAbAB0AGwAaAB0AHQAaAB4AegB5AIIAFwAWAHoAFgB5AHoAGAAXAHoAiABqAGkAeACJAHkAFQB5ABYAFQAUAHkAawBqAIgAFAATAHkAEwASAHkAEgB4AHkAeACIAIkAEgARAHgAeAB3AIgAdwBuAIgAbABrAIgAEQAQAHgAbgBtAIgAEAAPAHgAbQBsAIgADwB3AHgADgB3AA8AcQBwAHcAbwBuAHcAcABvAHcADQB3AA4AcgBxAHcADAB3AA0AdgByAHcACwB3AAwACwAKAHcACgB2AHcACQB2AAoAcwByAHYACAB2AAkAAABzAHYABgAEAHYABgB2AAcABwB2AAgAAAB0AHMABQAEAAYAAQAAAHYABAADAHYAAwACAHYAAgABAHYABwCgHToAXAA8AEsAVQBUAFsAAgAAAAEAAgAAAAEAAgAAAAEAAQAAAAEAAAABAAAAAQAAAAEAAAABAAAAAgAAAAIAAgAAAAIAAgAAAAIAAgAAAAIAAgAAAAIAAgAAAAIAAgAAAAIAAwAAAAIAAwADAAAAAgADAAMAAAACAAMAAwAAAAIAAwADAAAAAgADAAMAAAACAAMAAwAAAAIAAwADAAAAAgADAAMAAAACAAMAAgACAAMAAgACAAMAAgACAAMAAgACAAMAAgACAAMAAgACAAMAAwACAAMABAADAAIAAwAEAAMAAgADAAQAAwACAAMABAADAAIAAwAEAAMAAgADAAQAAgACAAMAAQADAAEAAwABAAMAAgADAAUAAgADAAUAAgADAAUAAgADAAUAAgADAAUAAgADAAUAAgADAAUAAgADAAUAAgADAAUAAwADAAUABgADAAMABQAGAAIABQAGAAIABQAGAAMAAwAFAAYAAwADAAUABgACAAUABgACAAUABgACAAUABgACAAUABgACAAUABgACAAUABgABAAYAAQAGAAEABgABAAYAAQAGAAEABgABAAYAAQAGAAEABgABAAYAAQAGAAEABgABAAYAAQAGAAEABgABAAYAAwAFAAYAAQADAAUABgABAAMABQAGAAEAAwAFAAYAAQADAAUABgABAAMABQAGAAEAAwAFAAYAAQADAAUABgABAAMABQAGAAEABAADAAUABgABAAQAAwAFAAYAAQAFAAMABQAGAAQAAQAFAAMABQAGAAQAAQAFAAMABQAGAAQAAQAEAAMABQAGAAEABAADAAUABgABAAMAAwAFAAEAAgAFAAEAAgAFAAEAAQABAAEAAQACAAAAAQADAAAABAABAAQAAAACAAQAAQAEAAAAAgAEAAEABAAAAAIABAABAAQAAAACAAQAAQAEAAAAAgAEAAEABAAAAAIABAABAAQAAAACAAQAAQAEAAAAAgAEAAEABAAAAAIABAABAAQAAAACAAQAAQAEAAAAAgAEAAEAAwAAAAQAAQADAAAABAABAAMAAAAEAAEAAwAAAAQAAQACAAAAAQACAAMABQABAAAAAwAAAAQAAQACAAAAAgABAAIAAgACAAMAAgADAAQAAQADAAIAAwAFAAEABQACAAUABgABAAYAAQAGAAEABAABAAQAAgAEAAEAAQABAAQAAwAFAAQAAQAEAAMABQAEAAEABAAAAAIABAABAAQAAAACAAQAAQAAAGQAZABkAAAAAAAAAAAASwBkAGQAZAAAAAAAAAAAAGQAZABkAGQAAAAAAAAAAAA5AGQAZABkAAAAAAAAAAAAZAAUAEgAZAAAAAAAAAAAAGQAMgBbAGQAAAAAAAAAAAAAADIAWwBkAAAAAAAAAAAARwBkAGQAZAAAAAAAAAAAAGQAMgBDAGQAAAAAAAAAAAAAADIAQwBkAAAAAAAAAAAASAAwAEsAZAAAAAAAAAAAAEgAMgBDAGQAAAAAAAAAAABIAGQAZABkAAAAAAAAAAAAAAC4HnFCrkeTwY/CfkLsUY7BFK6GQgAAcMGux4dCuB41wR+FiEIpXPfAKVyKQqRwfcC4Ho1CpHA9v3sUkEKkcA1Aw3WSQilch0BmZpVC7FHIQD2KmEJ7FAZBpPCcQmZmJkFIYaFCrkdFQQpXpkKF61lBuB6rQo/CZUFIYbFCUrhuQXsUt0JSuG5Bmpm8QlK4bkEKV71Cw/WIQT0KvEJI4ZxBPYq4QtejsEEAgLRCKVy/QTOzr0IpXM1BheuqQrge2UFmZqVC9ijkQYVrnkIUru1BCleaQgAA8kGk8JVCXI/2QfYoiEK4Hv1Bj8J/QmZm/EGkcHZCXI/6QSlcbUJSuPhB16NlQlyP9kGF611CuB7zQa5HVUI9Cu9BrkdLQrge6UHNzEBCAADgQR+FOUKPwtdBZmYzQo/CzUHNzCxCMzO/QVK4JULNzK5BKVwfQh+FnUG4HhpCj8KLQc3MFULD9XRBmpkSQqRwRUFcjxBCpHAdQVyPEEJSuN5AMzMSQsP1eEAK1xpCw/XIv65HIEIpXI/ASOEmQq5H8cDXoy5CXI8iwZqZNkJ7FEbBzcw+QvYoZMHXo0RCPQpzwXsUS0KamYHBAABWQvYoisEfhWJCZmaSwT0KjkKkcPlBcT0WQnE9qj8ULoNCUriCwYXrQUI9Ch/BrkdSQvYoHL9mZmFCuB4NQUjhfUJxPVpBj8KQQj0Kl0FcD6BCKVyfQa7Hr0JI4ZxB44jVPlysqDzFj/E+S+oEPQ3DBz9pAK89DAcKP0PiHj4NiQs/knlkPg5PDz/h0ZY+tvgUP0UNtj60Ahs/KJvSPgfrHz91POY+BvUlP8Ld+T5bXyw/kDEHP61uNT82AhE//n0+P9RgGj/7rkg/6J8gP6J/Uj97MSQ/81RfP/zeJj+aCGs/pN8mP+pbdj+k3yY/lN53P1uUMT+XOXU/0589P0UNbj9Lq0k/SL9lP+GXUj+i7ls/HxFbP/wdUj9ENGI/U8tGP2DlaD+wcjg/xLFuPzcaMD9nRHE/uhQnPyAMdD/BxQo/Ew94P5KR8z4KnXc/w4HgPgd8dj+i0c0+kWF1P6X3vT7QCnQ/jzauPlr1cT9Ldpw+p3lvPxDphz7W4ms/kNpkPjpdZj+U9kY+1GVhP/m9LT6oUls/pKUSPqp9Uj9rYOs9N45IPxsStz2MED4/ixqMPcJMMz9DOVE9wM8oP/LqHD3NdRo/RpT2PMZQDj/opPc8EF0AP9r+FT0c6+I+fgCSPSntrT5m2r490saRPg8L9T2e72c+PUkaPkYlNT5/+zo+vRgKPk6cXD5QU8s9sKx0PsKGpz0SiIc+KESAPbbznT56pSw9mKO3Pj1Jujxv2BY/6dR1P3lAWT1/E8o+C5gAP+8gdj0Mk2k+oYQ5Pr1Slj4dOLc+Wke1PmBZCT9lwu8+H7ogP8ZtHD/iIzo/zNE7P205Pz8GElw/fbM9P3IWfj8q/WXAxgKQwQRz9Ds602LBmQz+wRJOez93F5i/U9aswcwoljzsOCLBlE4Fwq71dT+h03RApT3DwaqaID31oI3A3vgCwgeZbD+FHQVBLam5wU0tmz2pW7e/R3fpweFAWD/98ElBc8muwdv5Hj7FuKc/98/Mwba5MT+zOItBkj6owUFlnD4AN5hA8YCxwZxQiDnZvZLAurTkwa9fAD/3QK5B6RuowfQy+j7iVAVBAkqdweVhITwa9S7A4vXEwdi7nz65NM9B5PapwQ74JD8Abz1BCOaLweqVMj2ofES/BvKnwQeZRD6+eOZB7dqswakwNj/A22ZBJuqAwS0+xT2epkw/LyKUwUPKzz0p8f5BiEaywbHEMz9ulIpBPp9uwd4CST593C1AhU+Awd/DJT1fUQxCeUG4wUImGT+1DaNBhO1awbH5uD5qZJhAaT1XweLpFTw79RlCGGrEwWLbwj5BX8BBUYhPwQA6HD8D6vJA+EEwweAtkDqOOSdCRh3RwcuhJT7WY91BWuFFwc9OVj+EDydBWBYLwX3LHD0MRvlBRNtJwaAydj99dFlBTcDlwBRcrDuAwQhCfUNWwaCmfj+62YRBzTPLwAAAgD8FUKRBPcq4wAAAgD9YzMBBH2m8wAAAgD9iYtxBveq/wAAAgD/6x+BB2NxQwAAAgD9EE9tB3cgBvgAAgD9ZXspB1dVBQAAAgD9cw7ZB+QutQAAAgD+9VJ9Beg/2QAdCsjlHxilC336SPhDpfz/x6IdB/O4ZQewvuzyGoCFCn/JjQNklej81hllB1UU3Qf7x3j1J3xVCUZnjQBghZD/sgxRBE0dRQWwhSD4SmA5CPVsQQf32TT9kKNhANl5dQTIgmz5xtgZCdxkxQT9vMj8f7YBA4ihqQYo8KT8KAtdBO5mDQZ2FrT4+fpHAj+1+QZYmpTujHl5CTtYnQGjoTz+iQrNBBICYQewvOz7gjxvBNMJ/QUXYcDwVb1hCmsilQBmQXT/nM55BO7yiQfJe9T3dSErBFaR8QaEQAT0N3lJCRXL1QG5uZD8MqIlBDKisQcb5mz3OznfBNHx5Qd3vUD0Fy01CL/8bQTpdZj+GmG9BDnW0QZEnST2qR4/BV1B1QaLRnT0O/EdCoP87QbCsZD8wNEpBCuW6QYf58jzwtKLBsPFtQWdE6T0eWkFC2ZVfQR/XXj8MDiBBsdrBQQfrfzw3dbjBDB9lQUZ8Jz4N/ThCs8qDQcqmVD97aNtAMaLIQWK+vDsortHBr+pXQXQMaD4ejS5CW02XQRqjRT8AfFRA8KHMQXzysDqqOuzB3spCQUhQjD5kNSZCquijQWDNOT9KKzU/uWHNQVJJHTlDv/7B4FsvQc7HpT7Obh1C4vqsQXEbLT+ar96/DL3KQYcWyT6tzRFCAeO0QRV0Gz8xA5bAyN3DQRh99T5Z4QRC/fq8QSVABT86Qv3Al6m7QQuYED/Mnu9BNvzCQZrO3j4eVjDBRZSxQXAIJT/bCtZBoi7GQdDttT5Y5l3B6ISlQSWvNj/j7b1B0IHHQWagkj4vdYPBP8SYQT/jSj8Pf59BDwvDQWVwVD630ZnBhqWDQSJUWT9jh4ZBTcm9QdqsGj7pP6vB8AZiQQzIZj/9M1hB2FayQV66yT3FUrrBU/IwQSgncj/oHiNB71+iQf2CXT3a5cbBLqzwQFJEfj/wLKBAd7RxQf2C3TvgEdHBYayVPgAAgD+L+RVA95xBQQAAgD93iLG+vAELQQAAgD8z1hjA5SalQAAAgD87h3zAGkLjPwAAgD8oraLAMkfBvwAAgD97ma3AX2NpwAAAgD8AE7nAo9i/wAAAgD/T8bTA3ocawbubfz/C/KjASylcwb06xzou8I/BFQLqwdAK/D7ipu1BG5VgQfD5AT9TS2S/eN1zQSgncj/bVfhAf+6OQf2CXT3HsMvB+EWEQGDleD8foLU/NIK4wf8+4zw4VOXA+xkEwgAAgD/rnYQ+9kOEvgAAgD9c4k9BM9qgvgAAAD9ff81B5G0QPQAAAD/eKwy/qkI6vgAAgD89CCNBXWqWPgAAAD/83LhByEA7PQAAAD+gW6M+ePw3vgAAgD8+sB5BHuNQPwAAgD9gzp1BqtXuPWZmcEJxPYo+16N0QuxReEAzM3NCAADgQEjha0LXoyhBcT1kQlyPWkGkcFlCheuHQY/CQkLsUbpBpHA3Qj0K0UHD9ShCPQrnQdejG0JSuPRBj8INQvYoAUIfhfVB16MHQj0Ky0GuRxFCFK6rQexRGUKuR49BXI8dQqRwWUEpXCBCw/UYQexRIkK4HrVApHAlQo/CNb/heitCKVy3wB+FK0LhegTBuB4lQs3MGMGamRxCZmYuwUjhD0JI4TLB7FEAQrgeKcGuR+tBZmb2wJqZ2UGamYHArkfFQcP1iL8pXLVBcT3KP4/Cm0HhemRArkd9QaRwtUDNzDRBSOEGQY/CtUCPwi1BhesBQHE9dkFcj6K/9iigQUjhesAAAMBBuB69wPYo7EG4HgXBSOEHQrgeBcHhehVCZmb+wLgeJkIUru/APQoyQrge5cAK1z5ChevZwLgeTEIfhcPACtdaQlyPmsAzM2ZCKVw/wArXTUIpXKFBAAA+QkjhSsDNzA9CKVxPQI/Cs0EfhStBpHBlQT0KoUFmZsZAXI/wQYXrMUCF6wVCUrievilcDEL2KKTAMzMNQkuweD+SBSw+AU18PxNJdD6tF3s/5E6ZPmPRdD/Ut7w+f01uPy7i2z7/IWU/3Cn9Pj3VUT9qGB4/MC9IP91BLD+H4Ts/OBA6P5eLMD+0jkI/c7okPzANSz8qkRQ/7C9TP2N6Aj8dOF8/TkXqPg9FaT+BJtI+n5NuPxu7tD4EHHI/ijyZPhiVdD9ma30+lnh4PzWYJj4AAIA/+mHEPQAAgD866X091Ql4P917OD1uaW0/pn7ePIF4XT9Uxr88N/1JP/mDAT2dnTw/TfOOPQOVMT9NMvI9ZeQkPymzIT7o9ho/vMtFPpn1Cj/T3mA+u37xPuJ1fT5HPcQ+N4mRPjjziz53FaI+hA1PPk/pwD5J1ww+hXzgPqTHrz38jPs+gLdAPX2RED8AAAAAQbcfPwAAAADLSis/uYjvOz90OT+4HoU8Bp5DP3C2uTxOf04/3/3xPJXUWT8zxDE9iV5mP5nwiz1HA3A/+KrVPVc+Wz/kgw4/HclNPyntzT3RdCY/HThnPkok8T5MbL4+Ksa5PgtBDj8KaII+I/g/P0gzVj5AE1E/OPMrPi8XWT8C1NQ9gSZaPwAAgD82oljAlVE1wQAAgD/G6xPAa5R+wR2sfz/wh4g7IaeYwSF2pjqGpwfCL2sGwnQpfj9mqYVAyWquwVLy6jsCc+jBj9UKwjkLez/B1wJBKCLAweSDnjznSMTBFZcNwgT/cz+Qq1JBb8fPwT4FQD0QbJnB3AAOwu2ZVT8rvLlBWZvqwauVKT6oagnBJqMMwi6QQD+4XOBBUVn1wam8fT4sB2bAY/kKwkMEJD9itQZCKGn7waK0tz5+svk/VAAGwm8SAzrgaRrC5G69waoOCT/MaBlCY9v5wUME7D4klchAvpH9wUvlbTvy2AfCuLC4wVey0z7FsSxCiYb3wYofEz/HBStBVwDuwbt+QTwDd+nBpRKzwSgsgT5eWUVC/C7uwa8INj9YhIBB5CHUwVcJFj05IrnBl42lwcWs1z1UY2JCWvPowXztST8MLLVBQBO7wRni2D0fbn/B4GCbwYzzNz0WZXhCfRjnwQaeQz/7zt1BxxCqwWaIQz6TCijBTcWVweSDnjx/OYVCdc3ewYtPMT8azPxBmsKVwVx3kz5nAsPAc2yKwUjElDtxe49CU5TPwUATCT+4/w5CxX5ywb4w6T5swZK/tIBvwWVwlDuWy3vBVTwJwZxQCDmj2ZhC0fW/wfZFoj6Z3B1CSTI7weFFHz/doFZAIfpJwYLKeD1MmyrBxyEKwVrY0z36aS1C058JwerPJj/pl/1AbLQqwY3Rej5Qu7bAGRQRwf+VhT7E7XhBbgn3wFk0PT+bUBpAth0hwazFpzft71dC1GWHP/uWOT106aVBbr+FwJlkdD/zZApBLkwWwdvcGDxI4rFB9hs6vz2bfT8pkzlB8cnhwAAAgD+UJU5BZoeHwAAAgD8yAWJBYfnKvVMiCTwSvZVB8+UsQSfafT+YCF9BxbeYQKMG0zv/DDRCVkyEQa2GRD3umYFBRwZSQTgQcj8nDE1BARkAQWjLOT0/WiJCpzV5QXfzND6H3TpBWv1VQcQlRz/WJA9BZrslQaOSej704AxC2iZiQVYroz643MNA1JFWQQmK3z5EBYJA9TZQQc4ZCT9sVfdBJD9OQSUjlz4SKNI/fKlVQd9PLT6Tj7M99DtxQdEiWz+Dyc1B3fxOQadc4T2tklbAPnFsQS/6Cj1DM2nAEoSVQSegiTrWWYdCs4DTQABXej+3IaVBLH5fQRY1mDypTf/ARPmIQbnfITtWstPAK4O3QV4R/Dz+ZHpCuNYjQY8ZeD847WlBgsp5QazFpzi9i1XBKnGiQd0HQD4th2BCaGBqQWjoTz9y1OBAoAaMQffMkjlUVKHBxynBQYKo+ze8vGDBfogLQj1Esz7F9ExCC/OIQelIJj+gOco/rvqQQffMkjmjBMrBLoLRQYKo+zfzhozB9lYcQm6LGj9AHTFCWE6PQZ/Nyj58KqfAVJ+DQWK+PDlLBQHC5xXTQazFpze/LL3BLEEqQs+DUz/YcBZC8IOPQRDMMT6YyzfBHZ9iQc2v5jgImxvCxbzOQazFJzdmGu7BXOI0Qra5cT/qOABCwjCNQbYQZD2cxITBTm0/QYKoezjCpDHCEqDIQRU6fz9IisRB6euGQVWkQjvhxrrBERoKQYKo+zf4N0/CKkO9QbD+fz8T1Z1BsO9hQazFJzdwkGHCNxWkQVj/fz9IFYJB5vM5QVj/fz+WVUBBn+cIQVj/fz93vw9Br4XLQFj/fz8oELdAmTKAQAAAgD9EuSJAME+ZPwAAgD+jWyu/j6cdwAAAgD8d2SfA5uPGwO+PZz+bP5JBGyLdwUp7wz1s1VzBKCsNwgAAgD+BGQNBvC02PgAAgD+Uo8VB1GOpPgAAAD+55S9CHbICPwAAAD+dQgc/FTLQPAAAgD8Hk4BBwqVYPgAAAD/bhABCkD2ivAAAAD/x9h2/E8cVPwAAgD9vOqpAtLECvwAAAD8PShpBbzSAPAAAAD/m1lg/Cq3qvgAAgD+PqdtA4A9uvaRwjkK4Hs7CKdycQq7HwsIfBahCAIC9wmbmtEJcD7/CXI/CQs3MwsKk8MxCKdzDwq5H0UKkcL7CrkfRQnuUq8IK18lCSOGgwhSuwEIAgJjCrse4QuxRlsJ7FLBC9qiYwjMzqkKF65vCw/WoQj0KmML2qKNCzcyTwpqZmULs0ZPCZuaQQnsUnMLNTIlCClehwnE9b0Jm5qDC7FFKQlwPocJcjzlCFK6qwjMzLEKk8LbCrkccQo/CyMKuRxxCzczbwnsUf0LNzNvCzvz6PnJQQj6sqBk/BruxPmB2Lz9KQdc+W5lIP7A4zD5PQGM/BruxPrGKdz8mAao+AACAP4ei0D4AAIA/mGkrP3R7cT9rfVE/sp1fP3dKbz9BK1A/sAN3P341Pz/ovG4/p7MzPxgmYz+uRzE/1PFwPyv7Jj8AAIA/G0wTPwAAgD9YVgI/iZhiP8H/5j6/1E8/E/KhPsR8UT8jvjM+Ne9QP8Go5D2qty4/c/R4PeIeAz8AAAAAtU+HPgAAAAAAAAAA9dbAPgAAAAB0RsQ+PiRhQaGWecF32x0/x71yQTANO0FWZU8/a18MQfDMrcAKaEI+9PgdQa3erkESFF8/Y0HaQKopAkBL5W08dHT9QB6X6kGInek9a2gmQXrHc8G3C90+rkgUQXA7HEF9eRE/Z5BNQeks8MCm8vY9hU5SQTvHjUEEIWE/H8uFQUGS5z5VGFs9uexvQVvNv0HTTXI/OZqUQaOR1kBoeR49LrBCQQAk2kHCF3Y/6Pd7QRz2H0EAAIA/Fz+FQDzZQkHjwgE7HRj3QAW51UGVfX8/tytRwIKGDUFV2Xc9Qf7BP7x2sEHDgXA/NJcXwd8DhkB0JBc+1Js8v2qpi0H18yY8c+h0wZjchkFrmlc/uaA7wY4W076amak+AVOcvhd/PUGlFHQ9TgFuwXTlM0FB8Rs/lLk0weHYwMC37h4/GjSCP5tc+0BPO7w9M9hYwVQp6EAfEZM+eZAfwTs9IMGG5lI/jDDBvxxY8UCv6xc9ZKKAwdYk3kBeaA4+Dv1HwXo/JcFN+HU/5z2XwBzcmEC5cCA98HV7wXp9UcGbVX8/ERG8wH/Es7/9vCk728aawc9IykHY2EU/453nv2l/9sBzuuw9OQmDwVjZBMGSeeQ96nh0wT3ll0GaJeE+G+gKP82qT8HvOEU+NHBgwXBEWcGfPLw+rNZOwWFfW0Gq8dI9WcbivxFNvsHe5SI9wLuCweIZw8HFcls/+N1zwTLAOUCjBlM84K9zwPyTDMI+s3w/kziKwcBFB8EXt9E6Ce+QP4OdJcJ9ln8/TGdFwdxra8EAAIA/To2ywJ/focEAAIA/nj+OQOd32cEAAIA/gh6BQRUU68HX+uI9ZAKmQT+p0sH9n2M/Kc+uQUEVdT/NzB1Ccb0Pw+xRKUJSeAzDexQvQqSwCcNI4TVC7NEBw0jhNUJSOPvCSOE1QgAA8sK4HjNCFC7pwoXrLUIAAN/C4XolQuxR18KkcB9ChevRws3MGELh+svCSOERQuH6xsJcjwpChWvBwh+FAkJxPbzChevxQVK4tcKkcOFBe5SwwoXrzUEzM6vCKVy3QVwPpsKPwqFBw3WiwvYoikHXo5/CXI9WQR+Fm8JI4RZBZmaXwj0Kz0BcD5TC7FFYQKRwkMLhepQ+KdyNwoXrIcDsUYzCXI9ewfYoiMIfhYvB7FGHwj0Kp8HXo4bC4Xq4wQCAhcJI4dLBPQqFwuF67ME9CoXCFK4LwgCAhcI9ChbCexSGwkjhH8KPQobC16Mqwh8Fh8IzMzzCzcyIwpqZRcKuR4rCcT1NwlyPi8LXo2XCpPCPwgAAbsLNzJHCw/V3wtcjlMLNzH/CXA+XwhQuhMLheprCAACIwpqZncKamYvCHwWhwh+FjsJSuKTCZmaQwsN1p8LsUZHCuJ6pwincjsJIYbDCZmaNwgrXssKamYvCCte1wo/CiMKambfCXA+FwmbmucJSuH7CZua8wuF6b8KkcMDCpHBiwqRww8KF61XChWvGwsP1ScL2KMnCmpk/wgpXy8JcjzLCPQrOwsP1JMKk8M/CAAAZwuxR0cK4Hg7CuB7SwgrXAcJ7FNPCmpnpwRQu1MIfhc/BZubWwtejuMHNzNvCSOGiwexR38IfhYXBFK7jwtejVMEAgOfC7FEgwY/C6sLsUdjAXI/uwuxRaMBcj/HC7FE4Pilc9cL2KFxAZub4wsP1wEDh+vzCCtcLQY9CAMMK1ztBzUwCwxSua0FSeATD16OMQY+CBsMpXKFBzYwIw8P1tEEp3ArD7FHGQYUrDcMpXN9BZuYRw9ej/EFm5hHDpHAOQmbmEcMzMzJCChcGw83MtMCuR4vCj8IBwexRisLhejDBrkeJwoXrAMLsUYXCheszwj0KiMKkcFXCuB6NwjMzXsL2qI7CXA+QwrgercLsUQxCmtkKw9ejGUIp3ADDPQrhQc3M5sLheoxB7FHNwtej0D+kcMHCKVx3wT2Ks8K4HgLCheuwws3MU8Jxva3CSOF4wgAArMLYDXM/ndfYPDI9eT9sIYg93lR8PyECzj0AAIA/GcpJPgAAgD9txX4+AACAP1lMnD7Th34/ufy3PuW4ez9O7tc+mC93P44G8D4483M/93UAP6ZhcD8hyAk/YKtsP+CcET+twGg/T1gaP3ZsZD9jeiI/H0tfP420LD+g4Fo/8MQ0P8uhVT82PD0/749PP5hMRT8zxEk/AvFKP+hqQz+/YE8/eSM7P5nTVT9ClTI/G0dcP588LD+hhGE//5UlP842Zz/t9R4//z5rPxHkGD+Or20/R3cAP3IzdD8Xt/E+44h1Pxzr4j5PknY/SpjZPiFZeD9JaMs+hxZ5PzSdvT6HFnk/w56mPiFZeD8DeJs+uHV3Pz7tkD6zKXc/8l6FPkT6dT/ACWU+BipzP0XYUD5F2HA/1H1APg7bbj/sFww+e/dnP18k9D1WDmU/PWHJPeVhYT9n1ac9LspcP/rygj2Dblc/MXxEPSeIUj9EbgY9fCxNP4FDqDzZWkc/Ug9RPMcRQz/RVxA8QKQ/P2AfnTzIBzU/1ZXPPL4wMT+xogY9eH8sP8dLNz1nuCk/tMh2PREZJj9Ldqw9I2chP0vl7T2h2xs/JvwSPrMpFz/P2i0+bHgSP5+ORz7wMw4/6MFdPljKCj9oy3k+24UGP+F/iz61iQM/yVmYPiNnAT/ZCKQ+dR8AP6Q2sT4TRP0+ZDu/PtPZ+T4lQM0+KlLxPqGE2T4B9uE+sTPlPq3d1j4F+vQ+/DXJPhnKAT8TRL0+ecwIP6MGsz7Zzg8/uhSnPiuHFj/esJ0+Y7QeP/W+kT7DtiU/oKaGPpZDKz+ns3M+HhsxP52FXT4SiDc/A+xDPgb1PT+inCg+RBdEPwgDDz4WpEk/3dLqPTLmTj/IzbA9OpJTP2iRbT3kSVo/AAAAANklYj8AAAAA7s5qPwAAAABxA34/8FAUPpwzEj9dUG8/ke0MP9HLcD9RpQY/oGxyPw4tsj5/pHg/TOB2PnVZdD+T4y4+4GdsP+IGHD6y9Gk/Z9VnPL8rOj9Lq2k/dAexPbfRcD+k5FU+5L1aPyJxvz4oCkQ/q7IHP5XUIT9pUho/TkX6PsUgMD9y4bA+YTc0P91eMj6kNjk/VoLFPZnwOz8AAIA/C+lpwWARO0EAAIA/lZpbweMzykAAAIA/BrNCwWqaLkAAAIA/FFa8wI1JpMAAAIA/mzHnv3dWB8EAAIA/tEgqQP6VQcEAAIA/UlHvQBmcbsHqyn8/Ev9WQV9ijcEXt1E65skCwoKiO8DqeHw/OpiWQa5JlcGRm2E8wXrjwTXhy8BNhHU/SxC1QeujmsG0sCc9m0LLweNuDMGUTWk/wJLWQSqJoMEijrU9z6CwwYvINsH92Vc/vuH0QV/rosFslSA++yGXweLnV8G37j4/Df8KQvtLpsHzH4I+a0x3wSRzfcHJqyM/RGIbQhoUp8Eep7g+jnE+wUgOj8Hzcf0+jZEvQr0lqcFfRgE/+/DywIIkpMFAwcU+WwlAQkxqqcG4Hh0/pl5/wEMZtMFAE5E+hCtSQtl+p8G4dTc/fC7dPe24w8G14EU+5QllQj/focErh04/ONaSQBjL0MFTIgk+O4t0QnNQmMHDtl0/2AoJQT4y18GInak946mBQsxaisHHnWo/v1RKQcUK2cE0gDc6Cxcjwlm9fcGTHRs9j8CLQiTlcsHaj3Q/OLKQQWFy3cGmft47pfIOwmDxj8G7fkE8wQeWQm04T8HQ1XY/RVa9QV5l4cG8XMQ8g2r0wajooMHNr2Y7DvGdQm9uNsEteHE/lA/fQfSb5cGzB1o9nnHVwY7mrsHDZCo6X1SmQlZlHcFXeGc/akIBQsaf6sE/48I9RQ21wbkrvsHF/lo/XQASQgrU6sFLAhQ+uB+VwQBDyMG0cUw/6oEgQiY/58GPNk4+0bJwwRRqzcGvJeQ+nRhZQgpKz8GB7A0/8LQkv7/518GSrqk+3ThqQjrGxcEPKCs/VBhzQDEC2cGX4mo+qsd6Qmjcu8GyRkU/9ecBQTZT2cG+EzM+FPmCQs/buMFpOlM/eFkuQYsO3cH7IuE93NKKQod1rsH52mM/JH9wQRNn3MF+xoU9jjmSQrNPosGIRm8/4h6YQQCM2cG9UpY8SWeeQgXWi8HCTHs/ME3NQQB50sGMvgI8WR6kQlukfsFe9H0/4NbmQdlFzcFivjw7B7mpQrFMasGaQn8/yUL/QVsuysGWJiU6bpWvQlfYTsEP1n8/ctsMQuD+w8EAAIA/j1IiQqA2t8FY/38/B7ItQue+rcEAAIA/9+s2Qq6qpcEAAIA/pVJUQgppisEAAIA/8FBeQoOQfsEAAIA/xTFqQkfQYsEAAIA/yE1zQlc7QsEAAIA/uDJ9QkNZHMEAAIA/yAGDQmy688AAAIA/hRuHQvksqcAAAIA/h1SKQrWENMAAAIA/e12MQhJKgb8AAIA/BUWNQsSOxT4AAIA/6XOJQv6djkAAAIA/U1yHQtUDvUAAAIA/88iEQhWQ9UAAAIA/hA2BQtbGCUEAAIA/HWF4QgliHUEAAIA/U4RpQiotNkEAAIA/y8BVQomiUkEAAIA/TdlEQlOyakEAAIA/r5g0QkNlgUEAAIA/QhglQl5fjEFSSR06pUibQpZ/6EEG2H8/xrUXQuzqlEHACYU7cHaSQsCc6EGd9H4/at8GQll0n0GB7HU8hLKJQoJ+5EGmJ3w/hQjrQeHhpUEL0gw9hiCCQvCG30GQMXc/BqPMQSIWqkE98oc9tOl2Qu/m2EERAW8/OTCxQaKkq0F2w/Y9Bs1nQkOw0UHpJmE/uS6SQSivrUGcUAg5NCaYQu7pQULF5mM+Va1XQrpmykF6/EY/iXFiQcFAsEEx68U6Zl2QQhaTOUIeFro+DwRGQpObykGskCI/hhMfQa7jukEErcA7kRmHQo86NkJPQAM/0CI0Qqpq1kEQevY+l3bDQEK90EFkXVw8UMl+Qvg+MUKu9R0/ojYkQqRf3EHLLb0+H6EhQHfX30EWMAE9ir5qQmroKULpmjk/ZRkPQhmc4kG3RXk+7lwSwIxH8kGI13U9AZpYQmvDIkK62ko/KX73QX5f50GXHBc+/HTXwG8iAUIuxdU9afRHQv08G0LufE8/iQ3TQRQK6kHpSK4938YvwfrKB0JpUio+AUs2QtGaFEKkGUs/M66tQdc970EhByU9nxt0weLMD0LwbXo+nJcmQiw2DUL76Dw/eweLQZg88UEwR488VJGawa7fFUKJJLo+cjETQklyBELc1yE/FiNBQdtZ9EHQm4o7FjbCwcKiHUJeovo+BwkCQvvN+kEXnwI/LcLuQLtZ+EHNr2Y5w0Lkwe3+JEKvzhk/BeXjQZ+d80FSYcw+rd9fQBeyAEJWtzI/tA3FQXbK6UEEkJo+/Jvzvki9A0Jk6Us/k0miQX5s30HRV1A+NTidwEl7B0LJ5V8/SCd9QZ301UGdYwA+pGgWwRfYC0LZd20/N4Q5QU/AzEH3O5Q9XKFawfveD0LHY3Y/SVTyQPOPxUEPuRk9RAWNwTVkFEJi1ns/T5VZQBYqwUG4HoU8q3SswTFtGkJioX4/xVwNv9vvvkEr+6477kzJwTv+IEL92X8/gG3zwHSOxEH3zBI6oTb4wYXuMEIAAIA/aPUnwXgvqEEAAIA/3eBawT/yiEEAAIA/LL4UwcjaXr+0cUw/Pe0vQp824MGPNk4+j54xwSvPz8G0cUw/kTc8QsJQ28GPNk4+loT/wA1l0sGvJeQ+DrZKQpgK1cGB7A0/5VOJwNX31MF+xoU9bUSYQl7hlsGIRm8/05ayQQrF1cEAAIA/8S4YQnXYvMEAAIA/ZchAQoARnMEAAIA/dFhLQtdxksEAAIA/ek+LQmajH0AAAIA/VMTNwAMIQUEAAIA/1bUeP9Hgcj8AAIA/4j2uQdR/jz4AAAA/KOMpQjY67D4AAAA/r3K8P/viWr8AAIA/3rO1QRIMKb4AAAA/tRg3QqHVvb0AAAA/0gyRv9SaOD4AAIA/UR+iQT006D4AAIA/l3Y3QnN6QD8AAIA/OgRmQgjrMz/NzJtC1yO6wh+Fm0IAgL7CrkebQnG9wsK4HptCCtfGwnE9nEKFa8vC7NGdQq7Hz8KuR59Cw3XTwgpXoUJmZtfCSGGjQpoZ28JxPaZCuB7fwhQuqUJcD+LCUrirQhQu5MKPQq5CZublwqRwsUJIYefCw3W1Qj0K6MIfBbpCuB7owlwPvkK4HujCexTDQgCA5sKk8MhC4Xrkwkhhz0LDdeHCHwXUQsN13cLDdddC7NHYwhSu2kJcj9LCmhneQoXry8LsUeFCj0LFwvYo5EIfBb/C4frmQilcuMIzM+lCH4WywlI460JI4azC7NHsQgrXp8LXo+5CZmaiwtej8EIpXJ3C9qjyQuxRmMJ7FPVC4XqUwoXr+ELs0ZHC9ij9QpqZjsIpnABDKdyKwtcjAkP2KIjCj0IEQ4/ChMLDNQZDKVyBwoVrCEOamXvCKRwKQ83MdMJcDwxDFK5twgrXDUMzM2bCuJ4PQ4/CXsLhOhFDhetWwgoXE0Phek/CPcoUQylcScLsURZDhetBwo+CF0PhejvCPQoZQ9ejM8I9ShlD4Xopwq7HGEMUriLCFG4XQ+xRHsLX4xRDhesawh/FEkPNzBnCPcoQQxSuGcLX4w5DFK4ZwgBADUNSuBnCcX0LQ1K4GcJ71AlDj8IZwo8CCEOPwhnCClcGQ4/CGcIAAAVDzcwZwgAAAkPNzBnCAMAAQzMzGsJmZvtChesbwhQu+EI9Ch3Ccb30QlK4HsIK1+1CKVwiwtej6kIUriTCrsfeQqRwLsIzM9xCheswwj0K1UJxPTjCzUzQQo/CPcLh+spCuB5Ewo9CyEJSuEfCMzPDQnE9T8IAAMFCFK5SwlI4u0LsUVzCmpm4QkjhYcKux7NCw/VswoVrqkLXI4XCPYqoQhQuiMI9CqVCheuPwlyPo0IAgJTCe5SiQpqZmMJSuJ5C9iipwhSunUIp3K3CrsecQsP1scIzM5xCzcy1wkhhA0MK1xnC7NH+QsP1GsJSOPFCzcwgwgCA50IfhSfCFK7kQlK4KcIzs+FCexQswgAA2kKuRzPCmpnXQlK4NcKux9JCw/U6wvaozUL2KEHC9qjFQs3MS8J7FL5CUrhXwmZmtkJ7FGfCHwWyQqRwc8L2KLBC16N5wo9CrkKPwn7CzUysQjMzgsLh+qZCmpmLwvaooUJSuJzCFK6gQuH6oMIp3J9Ce5SkwqTwvELs0dfCClfJQhQutMIK19hCw/WQwuH67EKF63vCw3X8QgrXWcIpHAhDuB5Ewo8CEUOPwjDCptUQPZ61mz4noAk9yhWOPtVbAz1vu4A+klz+PKzFZz4Xghw9DAJLPj9SRD25iC8+HhZqPYNpGD60PI89aof/PVluqT3+SNE9pffNPQzInj0HsfM90ZZzPR4WCj5iLT49uVMaPuELEz0exC4+eR7cPBFwSD7lRLs8fsZlPlIstzzEmX8+SkG3PFfsjz6TGAQ9ZqCiPn2uNj3pQ7c+TUqBPREZxj434LM9oRDRPv8J7j27Yds+fjoePktZ5j5790c+ZarwPtmxcT4xsfk+rHOMPqdcAT8qUqE+U+gEP9unsz4UIgg/U1zFPq62Cj/UK9U+NJ0NPxQ/5j711hA/RQ32Pg4QFD9j7gI/9u4XP93vCD/2Cx4//yENP6rUJD9VMBI/5lcrPyQLGD9UOjA/AU0cP7ADNz+AnyE/dEE9P/7xJj+gT0Q//YcsP/28ST972jE/wvpPPyJxNz8+rlU/SUs9PxNhWz8YJkM/+IhgPw9FST9FgWY/Nh9PP6Luaz9k6VM/D9FwP4vDWT+dnXQ/idJePwqAeT9382Q/clB6P0LsbD+jr3g/wD5yPx1adD8ktHU/CThsPxBdeD8yd2U/gT55PzYfXz8QWHk/bAlZP8pUeT990FM/KlJ5P7IuTj/kTnk/jNtIP0RMeT+rBEM//kh5P4WxPT+3RXk/hGQ5PxhDeT/Zzi8/2T15P33QKz8s8Xg/AwkiPxyZdz+94xw/Qbx2P8heFz85YnU/3lQMP2WNcj+YLwc/ibVwPyx96D44FWk/vTXgPj8dZz8YQ8k+T11hPw0auj63C10/Wg2pPhMPWD+MZ6A+NjxVP/EpkD6kU08/1xeJPoyhTD8CSG0+gxdFP7aEXD4fukA/lZo9PrD+Nz9EwAE+l/8gP+hq6z0+Pxw/yXa+PdYcED8Xmqs97usIP/cGnz2ifwI/KZZbPfj80D5jC0E9eTvCPuf7KT0wZLU+AFIbPdJSqT65NjQ/2T15P9SCJz+CVng/trkRP5/Icz8XKwI/pn5uPxJO+z6XxWw/gsXxPhTtaj8fLtk+u0RlPz900T4cX2M/xhbCPkpBXz/ZsbE+3V5aP+YFmD5kBlI/Ap9/PkuwSD/hXU4+nZ08PzdxMj4U7TI/x2MmPvYLLj9YVho+4BAqP7PNDT4snyU/1ILXPWbaFj93hJM95gX4Plbxhj2Kq+o+c/R4Pche3z6mYXg+LnP6PanZoz6taa4+XW3VPvZ/Dj9a8Ao/zEUsP9y6Iz9gAkc/71VDP+YFWD8G2F8/zjZnP9yAfz/i8T1B7unUQQ74/DoRjzLCV/MnQSrjfz/fyRNBSS3PQZ9x4Tni/zrC0jgMQVj/fz9Ty9VA9XHJQQAAgD++LYdAzI/DQQAAgD+OF98/jti2QQAAgD896wO/eE+oQQAAgD+lUxnApXGbQQAAgD+Y3onAbFGLQQAAgD/7qcLA3Fl3QQAAgD+BM/zAf0VPQQAAgD9wZBDB8u4pQQAAgD/KOBzBJwkLQQAAgD9aRCTBGt7aQAAAgD/u9yfByxuVQAAAgD/vMCHB/4gJQAAAgD9oLRPBBUUQvwAAgD9SFwbBcPQ8wAAAgD/4Ac3AMPiywAAAgD+b0oDA2WEKwQAAgD8Dq2+/H4c9wQAAgD9pkxdAMHhcwQAAgD/F3rlALPxtwQAAgD8YlyJB+Ct4wQAAgD//fGxBh4KBwTJafz/A9ppBlPSFwZYmJTuSXKDBGezPwTfgez/UFL1BmEiJwSbkgzygvn/BS/3EwTGZcj88J+FBQNaLwXhiVj2f1TvBq4y4wWtIZD/uLwBCTOGMwWu33T0MAwLBw7eswV3cTj+uKQ9CEk2NweuLRD5HCJbAq9agwdhHNz8RYRxC/7SMwbFtkT5wLNq/TnmVwS80Fz9BuCpCfoGMwVOW0T5/Lcc/BIyJwZIF7D6QQjhC0c2NwTVjCT8bv5ZAW0l/weqyGDs6JKXBvoC/wRCSpT4F0UVCWzKPwT5cKj/D+PtAFaBrwYyENjzxcZDBzO6twRY1WD7N21BC1GyUwbvyQT9WkCpBtRRjwQfr/zzqj3nBOZqiwUesBT57QlpCKEiiwcIvTT/6N1hBy/dsweIeiz14L0vB5c2fwQ4yiT0oT2VCsR+xwfcGTz8XWYZB8fN1wQCR/j0vqBbBtHabwf5D+jxgcXFCpkW+wV6dQz8V36FBZxJ6wck8Uj7dlcLAVWeUwdgNWzySTnpC0l/IwZ4kNT+CLrZB3Px9wbbbjj4XgmbAoJuPwVj/Zzse5IJCuezWwd3SGj/sE9FBKt+CwfiIyD6qQ4i+rniKwZxQiDm1fYhC5d3jwXqN/T4j0OpB+oGFwUImAT9FajhAkIqEwRZqvT5AdANCK3+JwU1KIT9mn8tAJDx+wV8piz4Xbw9CvzuKwalqOj8nkxNBb/JvwRdlNj4BmBxCtFKMwRNmUj8Or0ZB+qtiwS7n0j16gClCZ46MwXOiZT9boHdBrDdSwd8aWD2ZXzZClduMwap9cj/hPJRBpPBBwY8ZqDyhB0NCBDyLwYy+ej86oKtBfE4uwVXBqDuuLFBCzh6Mwdatfj8KwsRBrsYewffMkjpNkVtCSBeOwfK1fz8779pBm5YTwQAAgD/1JfFBAvoAwQAAgD8WmAFCVjnfwAAAgD807wxClXa2wAAAgD8E+BNC85BCwAAAgD+WrhVC5v5cvwAAgD/NQRJC85GQPwAAgD+UAglCr0hjQAAAgD8pSgBCqyKjQAAAgD+nNe9B0ivJQAAAgD89aN5B26bsQDSAtzk2U21CB601v2jofz99289BM3YFQYyhHDvLUGdCxcBlP7difz8FS8BBFOUVQf3ZDzxwnGFCrucZQPC/fT/+kLFBqDclQQPsozyTZVtCZSKCQPjfej+xeKFB9DU2QeXyHz3TsVVC4O6yQCoAdj/5s5JBtc1FQXpwdz0uFVFC2dDZQFGIcD9lzoZBZSNSQU9YAj7g1kZCNr0YQZ1oXz9hjVhBNyZuQWTpIz6+NEJC56IpQf8EVz+YgkFBRw14Qfa0gz6oODZCQFNQQd0kPj/6jAdBVHaGQYlBoD6Jsy9CFAZkQZTeLz/f69BAm4CLQfXWwD5bSyhC12p3Qd6THz9mPIxAZtGPQTASAj/MMBlCg7KOQQLZ+z6pIBo9eOCXQb06xzl4a7JCPEiBPxHkED/mmxFCw2yWQcAE3j7ecgTAoDeaQTZZIzy72KdCIB7hQOdvQj/X5ehBCBWxQfMCbD7cxiDB3lKgQRnKiTzlVaVChvMEQahvST8uj9tBnUW2Qd4CST6yYT3B+dygQQn+Nz2uG55C6tU8QeC5Vz9HvrVBeu3DQXwn5j235IbBn2ShQZ4knT3I7JhCbL1gQTNQWT9CeptBK9HLQYtUmD10S6LB6UCgQUcD+D2bApNCtGKEQfRsVj8QZXtBFGTUQbQfKT2zPcHBX5yeQZTeFz65x49CSVaOQeRJUj+4q1tBEy7YQeC59zw6eNHBPgCdQZhMVT7nSIlC8S6gQaNARz8gph1B49LdQfW5WjzCnvDBzi+YQXV2cj4kXIZC/M2nQR8uQT90DwJBlPzfQQTnDDzeXP7Bf7eVQcmroz6Po3xCD1e7QcKjLT9Dg11AF6TkQcAJBTvplRHCcOWNQXehuT4k8XNCOTvDQYAOIz9+bIk/9rfkQYKo+zljnxrCP7iHQURu5j5672JCOg/RQY/HDD8y1WDAdmjjQdXKLD+HrjhC15flQbZnpj6YOGPBW4rTQe31Nj8W+C9CEpDpQYgRkj41IoPBAwfQQSEHTT/70xpCa5XtQd/gSz73WqvBNGLCQTcaWD8AzA5CvyrtQeaRHz49I8HBuCa4QZTZYD9PTgRCmSnrQR8u+T2gddPBRbutQXi5eD84BrRB/5niQRe86DwskA7Cg0mDQT7Lez9eG5xBvejfQURuhjwb7BjCaRNuQQmnfT8oQYdBtYbdQdMTFjxW8iHC56ZYQfvLfj/3TGhB9gzaQZKumTsn8ynCfKpCQU9YAj7Jg0tCsHAEQZ1oXz/Y3XBBXBZhQWTpIz7J7zxCiZ46Qf8EVz8wCShB+5mAQTASAj+0YiBCyQOFQQLZ+z5KiQhAnW+TQb06xzkYeK9CJxIlQBHkED+qpwlCpQudQcAE3j7tBIfAn0SbQTZZIzzFBq1CvMSAQOdvQj/l1AJCBZejQfMCbD6iKsPAnvycQTZZIzykbKpCv4KxQOdvQj+YLfdBFHKqQfMCbD4BcgHBq7meQRnKiTyeDKNCY/EVQahvST/IvM9BUke6Qd4CST6KWFbB7MegQQn+Nz1/oqBCerIoQeC5Vz8oFsNBE+G+QXwn5j35Q3HBG/2gQQn+Nz2wlZtC1s9NQeC5Vz8eD6lB8onHQXwn5j2eD5TBrKegQUcD+D132JVCwjV0QfRsVj8FQYxBxafPQbQfKT2r77HBLOaeQZhMVT6eUIxCDFWXQaNARz9TAztBFLbaQfW5WjxXuuHBvgyaQcmroz6MMoJCPomxQcKjLT/za7dAPAziQcAJBTsElAjC4mORQXehuT7HAmxCZ23JQYAOIz+Xtoa/cuDjQYKo+zlfhSLC0luBQURu5j7Q2FlCOCPUQY/HDD+4yrfAF8beQURu5j4wAlFCWurXQY/HDD/YfP7AmfvaQdXKLD89aklC0sHcQbZnpj6K6x7Bhi7ZQdXKLD9rKEFCJXbhQbZnpj7J50DBSrbWQe31Nj/lnSZCPGfrQYgRkj6685TBSgzKQZTZYD/lofNBf9foQR8u+T1FpuXBPAajQW/Ybj/C5N1BAZTmQUw3iT1EjvjB7g6YQXi5eD82ictBZ6DkQRe86DyiQATC68KOQQAAgD+d8YM/kD+BPwAAgD/+68RBMpJkPwAAAD/JUEJCqTCSvwAAAD+1fls+MF5QPgAAgD+h4YtBQPJhvwAAAD87+v5BqXYtvwAAAD+4kcY8fgkdvwAAgD8r1WFBj9DAvgAAgD/GN9ZBNFhhvmZml0IAADvCHwWfQlyPOMIULqdCAAAzwlyPrUJSuCrCXA+yQhSuIMI9CrZC4XoTwvYouUJI4QLC7FG6QjMz6cHherpCuB7HwexRuUK4HqXBHwW2QvYohMFI4bFCXI9WwUhhrUKuRzHBXI+oQkjhEsEAAKJCcT0CwWZmmkLhegDBuB6SQo/CAcEpXIpCPQoDwXsUhEIpXA/BAAB+QrgeIcFI4XNCZmYawSlcaEJmZiLBrkdbQnsUNsHXo1FCpHBdwcP1SUJSuIbBZmZEQq5Ho8G4HkJCFK69wfYoPEKamc3B16M5Qilc6cGkcDxCcT0Cwo/CREKuRwvCmplNQpqZEMJI4U9ChesdwmZmVkIfhSXCexReQj0KKcJcj3JCuB4swjMzgEL2KC3CCteDQqRwNMI9io1Cw/U5whSui0L2KCDChWuWQhSuCsIAAJxCXI/SwVwPmEJ7FJzBKVyOQilcZ8Fcj4FCj8I1wfaokUIzM9nBj8J9QlyP4MG4nqlCw/XewRdIID+ZKhg9kfIzP0sCVD0j80g/6UiuPXR7WT8IVQo+ehllP+krSD5wX28/X5iMPp1odz9lwr8+qWp6PyKr6z6fzXo/YhAQP8jSdz80Syo/OlhvP3iXQz/bomQ/SbpWPxMKWT88FGU/k4xMP5zEcD/ImDs/dCR3Py0JKD8p0Hc/tqESP/NUdz/nOv0+vtl2P3O63D78HXI/+5HCPp5Baz+Daag+f9ltP3mvij7BxWo/3/1RPtszYz9aEiA+rhJUP//n8D1uo0E/0uO3PYKoKz9SJ6A9m1UXP06XRT3rHAs/XacRPTqS6z5t/0o92bHBPphpuz0dyaU+Vz4LPlaClT6D+hY+X9JYPsDPOD4rTSo+8IpgPu6xFD4yA6U+dY4BPkPFyD4XZfY9/IzbPrTlnD2azgY/xY8xPQMJAj/AJks+u7gdPzempz6cFiw/4UUHPwr0IT/HLjE/p+gIPw5KUD9lws8++FNjP+Z0ET+2LQI/8PnBPhni+D6rPk8/bob7PjAvID/HcCdBk3nAQQKfvz5YbhTA+lrDQelIPj8f37dAUYC4Qd9sgz4Z7OPAY9y/QdPZWT/Z7Dw/kpqoQRSWGD5WQ0XBocS0Qb4Taz9De0fAolqSQdFcpz2W3YPBIkmiQfrQdT+MrLjA91hwQd7lIj1KBZzBLcaKQUpefT901ADBhHYsQYFDKDx8HrLBd2hWQQAAgD/Z5BvBJAywQAAAgD9h9CPBtRqBPwAAgD+bWCHB/RKKwAAAgD9HkBHBWVwZwZDafD8vEtnA7wdqwQ4ySTxC3L/BzKk/wfrQdT/kOoDAOg6Twd7lIj3WUq3BfkSAwcNHbD/184a/XjepwWu3nT3edZjBQAuZwWyVYD/WlwRA1AC7wWFP+z1gtYHBnaOtweNTUD/4Y8dAacXDwdatPj4zYkPB9j66wfvoND8Sti9BX/7CwWsrlj4Za+/Aj+29wZlkDD9nKoFBjSbAwc425z7b9xPAFfK/wc78yj774KdBmG+9wfGAGj8DJiJAVsnBwdUEkT5C3MZB7DG0we58Nz9zetBAbz28wTeOOD5vrt9Bv9qnwcvbUT92bhxBrOSywUeP3z1tKPlB3MyqwW8NZD/QV05B5824wUi/fT2F1gpCaGKkwWQjcD+yPoRBVMa1wbAD5zxJ3RpCI3yWwTvHeD+utKVBMLqrwTgVKTzcSiZCNnN5wQNbfT9UbL9By9KUwZ9xYTrfIy9ClqA7wfzGfz+BntRBw2VwwQAAgD9F6uRBug0rwQAAgD+v2OxBrvbTwAAAgD/AEP1BAZqIwAAAgD8B2wJCBgKnOwAAgD81hABChFqJQAAAgD900e1BATTpQAAAgD+HrNhBcSUSQYIclDoBKSJCY5SDQUq1fz+GQNVBEF5VQWjLuTsTjRlCb8CVQcGLfj81SMZBK399QaEtZzzcvg9C0JedQaJifD+dubNBetWIQbKFoD0s+etBecGiQaLuaz/UKoFBmv+TQaqaQD6CSclB8aSjQa7YTz8Dpj1BHPKYQZtVjz70NbZBbOy0QYtUOD/6zhtBa1esQb1S5j6qFoVB6E/AQfrVDD8jpHNAhGi9QXk7sj7Nj5FBlVmAQZzhJj/2Yo1AoNl4QVDfKj8xKD1B0SAQQRBAqj4zDS/A6QAVQQAAgD+Vqw1BuGLLv9NNQj8rvztBCoMfwRXGdj6DfqHACGEYwaIL6j68zpBBgJl/wYf5Cj+DihI/EN+BwVjKcj6VQtJBKJqbwcJMQz9CpQRBDCelwQAAAD/mH3RBnkBvvgAAAD/zFNC+6SSJvgAAgD84HTZBdDKmPQAAgD89YoM+or+XvbgeQcHsUXjBZmYSwT0Kc8HheszAcT1qwdejgMAUrlfB9ij8v7gePcH2KNy+pHAdwT0KVz8zM+vApHDdP4XrqcAzMyNA7FEYwK5HUUB7FC6+heuJQAAAEECkcK1AexReQJqZ6UCPwpVAuB79QDMzy0BSuO5AzcwQQQAA2EBxPTpBheu5QLgeYUFxPYpA16OCQQAAIEAUrpVBzczMPilco0GF69G/9iisQYXrccA9Cq1BAACowMP1pEEzM7PA7FGWQT0Kz8B7FIJB16MAwT0Ka0GF6x3Bw/VYQVK4SsHsUUhBj8JxwRSuO0GPwo3BmpkpQUjhpsEpXBdBheu9wSlc/0BxPdTBhevBQArX58E9CldAuB73wc3MzD4fhQHC16NAwHE9AMKPwq3AAAD0wfYoAMEUrufBUrgawa5HycGamVHBPQqtwaRwacEK14/BcT1ywR+Fc8Fcj3bBuB7ZwexRNMEAAI7Bw/VAwT0KQ8E9Ct/ArkdBwClcjz+F65G/rkfBQMP1qD7D9RBBzczMvnE9UkGuRxHAj8KNQSGwAj/ByiE9RrYTP+/JQz0AxiM/QWV8PauVMT+8kbk9Mnc9P98yBz55dUY/bhc6PjDYTT/Qs3k+1/pSP8H/lj6Sy1c/+3S8Ps/3Wz94udg+iBFiP8jS9z7UfWg/uK8DP5hpcz8Mdgs//vF2P90kFj9bX3Q/aXQnPycxcD9iEDg/nbpqP7ubRz+ZDWI/whdWPxlzVz9SSWU/sD1LP0s8cD/ZWj8/Fk13PyzUMj9QAXg/GlEqP6qCcT8OSig/xcllP8o3Iz/tmVU/HhYaP/yMSz+Dbg8/CktEPyBj/j5Olz0/8PnhPi6QOD8Wh8M+lE0xPxn/nj76Cio/+wV7PueMID/PFDo+fEQUP3BCAT6Z9QI/6zmpPYT13z7Mf0g9J2u0PvFGZj23f5U+MiC7PcSUaD7WiwE+ATA+PoI5Wj7uJc09JTuWPjPcgD2HosA+BkdJPf3B4D5WDi09OPMrPgE1FT7mV8M+0T8BPvoKAj8DlYE+KVw3P5RN6T7TTUI//RMUP1DfSj8QdSc/7pRGP76kQT/9nzs/jPhePwAAgD+6ox5BedP9wAAAgD+wa01BLX0iwQAAgD+b7XxBS6xAwRjsfj/VnJdB46VQwSegiTuXXYTBfGXqwJVIej/v5rFBvvhUwW/YtjwmE1nB/NMLwQbYbz8at8pBD59NwZM6gT3TDSjBcH4WwUTdVz+SGeVBfSo7wVGIID7mVeDA7uEXwce6OD/YoPlBdPcpwSKJjj4gXYfAWU4WwU7R8T5V5glCZO4KwbEWBz8s8ve+nsYLwbq9hD78IhRCe9npwFxyPD++VhlA/akFwZm7ljvPGUTBosRcv+DWnT16QSBCZZvAwC7FXT8J8bVAWYIDwWDqZz1i+xnBYcI1wGACtzyMeyhCWwC8wAEwVj+2IvVAqPwMwXFaED7PgwfBY4yRwJNXZztWdTNC0PbMwIkMQz95oyBBeXAkweAtcD4OwvHALg3mwGL4MD/9B0RBkQIhwe0Nnj4cnLbAtsQGwdPeCD9k13BBlo8BwQtB7j7W0xLAkMYKwfFjnD7YtYxB4b68wGDNMT/x2Yc/2zUJwVN5+z0wkJ5BCa1hwC6QYD8KS4lAZmsCwQTKpjyugaxBtjkgvwjJej8VNu9AFUbgwAAAgD+adC5B8AOwwAAAgD9am1lB5RZdwAAAgD+ynnhBUJOmvwAAgD/DboJBtPuhPyQLmDnMJz1Co7SWQRe3UToz2KlBaatHQUG3fz8HLnhB1FhWQAqdVzuWkTVCtuSLQWVwFDwl1JdBBSs+QVLVfD+nRFZBfhCKQBNm2jwjrylC3Tl/QZKWij2igXpBEv83Qa7YZz9nNSlBjcfDQMO2xT3elR5C9Dd+QSBeNz4Rn1BBFL9GQVBwOT+5HBJBKNEHQXRBXT4YERRCOZWDQfVKiT70bCxBAv1dQYEJBD9/ywRBELgwQQfO2T5IWgZCo2iPQVABkD5+eAFBc8CDQQoulj7OnftAEQxsQaZhGD9hm/VBCY6aQYKQbD6XRbxAzleWQajjMT6h9fNAXZmPQRB1Pz847tpB1WqkQZfFJD5ozExAjP+oQZS8uj1wseBAIqGrQWGJXz9zWrxBg96xQc6luD19LmA+1mPAQVcJFj1uC9JAYNXMQVIncD+LTp1BEhG7QQX6RD12UUDAxvfTQWUZYjyNubNAZVDsQZuseT8AvndBGXbAQQ5PrzwApNXAO9XkQQqdVzvec4NAxvoFQo82fj9ZAi9BKd69QWwm3zsEsTDB8ULvQazFJznBmsY/PRIVQkq1fz+1+9RA8am1QYIclDrrlXbBXrLzQQAAgD/wUBdACE6nQQAAgD8FRxA/I5mTQQAAgD9Za4K+81VsQQAAgD8q25e+2A0/QQAAgD8GjTM+K+exQAAAgD/hCAVA5AuVPwAAgD8C35xAXwYfwAAAgD+kOeVACJijwAAAgD+cqAm9YsUOQQAAgD+bo/hA2tzMPQAAgD/MhYlBlFPQvQAAAD8E2wFCgb81vwAAAD+J2+c+LQ0RvwAAgD/sduBA0CfqvAAAAD8BaDNBF4pfvQAAAD9pgjW+2kGDvAAAgD+6zp9ASuGqvgAAgD/GvjFB5+oVPzMzR0E9CjDCrkeLQQAAJcK4Hq1BFK4Wwo/CwUHhegbCexTSQXE94sF7FNJBexSowfYoxkGF60XBexS+QXE9AsHsUbJBXI+awAAAmkFSuJ6+w/WAQdejEECkcFFBw/WIQClcA0HsUbhAMzNzQM3MzEDD9ag/SOHSQFK4/r9I4dJAheupwJqZ4UD2KBTBrkfhQDMzX8FmZt5A7FGawWZm3kCambPBzczUQOxRyMHherxAAADewexRiED2KPDBAAAAQAAA/sGamRm/MzMEwo/CdcA9CgXCexTmwJqZBMKF6y3Bj8IDwhSub8FSuADCw/WWwXE99sHD9bDBSOHkwQAAysFmZs7BpHDhwSlctcEK1/fBPQqXwUjhBcKkcHHB4XoLwgrXL8EfhRHCZmbmwEjhFcLsUWjAuB4ewpqZGT6PwibCH4V7QHsULsLNzARB9igxwj0Kt0C4HufBw/UYwQAAsMGF66/BZmaAwR+Fe8GkcCHB7FGIwHE9Cj98m0Y/Vd4OPac/Wz9Eaa89qtRsP4RHGz5qh3c/5X5nPgAAgD+c+aU+AACAP9Rg6j4Zynk/BOIdPwiUdT8QzDE/aXRvPz1hQT/U1GI/5pZWP5nTVT+3tGI/rTRJP1g5bD/Y8DQ/ICRzP5KWIj8bKnY/gUMYP/cGdz+ifwo//wR3P9V4+T4fLnk/Y5fYPigseT+il7E+x7p4P948hT7QuHg/v/FVPoBIdz8+0Co+lbdzP/fH+z39E2w/9E+wPdxjYT9hpm09fCxVP1d4Fz2S6EU/zywJPT4iNj9HdxA9UtUkP8DsHj1jfxE/uFhRPZJc/j4Zc5c9D9bfPlZl3z2wVcI+KnQePq3dpj6JmFI+f2qMPqTCiD5BDmo+tTeoPrKdTz6FX8o+tygzPuXV6T4o1R4+cr8DP69f8D2iehM/uAGfPdI1Iz+EuzM9z2Y1PzD18zyTqSo/4C2gPros1j7OGeE+qbxdPraEDD8L76I+soUoP7QfAT8vhlo/H/R8P34dmcECEj1BRs5CPONDKML8hSnC24V2P1xHucGSD79AzJcXPaoaEcIQ7TnCfuNrPyBCz8E0wca+096gPT+l78HzQ0XCtDxfP0de1MEOacvAkQoDPjX5v8E6JkjCUMdLPz3ozsGiglfBIuBQPkYAh8Gyz0XCFqQpP/KXrsEK4azBhbasPjHgCsHgGjbCIF7nPsCvdcEOp/PBSFAMP7K1gj5guBzC9Zy0Phf9PcEShwrC3rAlP5dNj0AABw/CMj2RPlc6BsEFFhbCv2A3P4tM7UBzPwHClWVIPu5UHsAlkyPC8+VNP4DnLUG6jNPBjnURPuNbHUAsISjC9aFbP7o1QUG/N6zBcJnTPcIp30B1cSrCKoxlP6B1S0ECKojBNNdpPc8qVEEMOibC5WFxP2v7O0EGhSvBPgXAPMBulEHhSh/CLv95P2NqIUEJ5azArMUnPCJ+q0HIoRrCQmB9PztpD0FSTCDA1zTvO3V5GEIzAVZA7yB+Pyqd5UCaA50/JJe/Pu0PDkLYDdRAxjMgP5zTvECb96ZARYE+P4d//0FOdiBB1/qCPn1kcEBVpBpBnUtxPx343EEs919BuDtrPbCPjz++dG5B7gh/P95ctkE54JRBVWp2O/Kc4b/HYqdBAACAP8FxnUHxiahBAACAPwR4hUEp8LRBAACAP+Q6TUFu4LtB98wSOnPqV0Lt2IDB/dl/P/ItDUF8OLtBSKeuO9ziWUIUvEPBCqJ+P1d6oEAyYLRBCty6PByCWEIXQ/zAeCh6P5JhhT/f7qVBRpR2PfgAUkIcfoDAFJZwP5ecAsAgKo9B5zUWPitVSUJUujQ93nFaP5fSo8BKmWdBdQKqPhBCP0I38pBAHv4qP1WqB8HpRClB4pILP301M0LRaAdB7djoPkhtMsG5Cs1A7So8PzO3JUK7MDVB1qiHPlUXS8HKuxBALT5lP0oKFUL1+VlBVwnWPa32VsEKPBzAu2F7P1fxAUJtfXVBp7OTPIvRVsEQgfDAAACAP95m20E26oVBAACAP0RirkHRX4tBAACAP/E1hkHQEYdBAACAPxuLNUFTX4JBAACAP97nz0DWlHZBAACAP4xyrT+LwHtBAACAPwx8gsB+bIBBAACAP2A7FcH0A4BB5x1/P3NeasGC+mZBn3FhO1h+MsJPahfC4Ll3P338TMCl6q+/ARhPOh8hZ0E3gw3CoRABPbNA5cGjBdXBATB2P8bgjUFwixm/wqMNPdTJ0kC2Sn/BBHN0O6Yj6cEszrXAAAAAP+rVC0LeVba+AAAAP0gl/D4yph8+AACAP4zkNEHwRgI+AAAAPzq99kGqJye+AAAAPyznXr+xmQQ/exSkQdejwcLXo7JBzcy+wuF6uEGambjCzcy+QXE9s8IUrsNB9qitwsP1ykHNTKjCj8LTQRSuo8JmZuBBzUyfwsP17kH2qJvC4XoAQo9CmMJxPQpCw3WVwh+FEUIfBZPCPQoZQsP1kMKuRyJCSGGPwrgeJ0LDdYzCXI8pQlK4h8IzMylCj0KCwq5HJ0K4HnjChesiQuF6bcLsUR1C16Nnwh+FFUKuR2HCH4UMQnE9W8J7FAJCZmZVwlK47kEzM1PCw/XYQXsUWMJSuLxBzcxYwgAAoEF7FFfCFK6HQfYoVMJI4VZBPQpPwoXrMUEUrkrC7FEAQbgeRMJSuLZArkc/wsP1WECF6zrC7FG4PoXrOcIfhWu/rkc/wsP1aL/hekrCCteDv7geVsIfhau/uB5fwh+FG8DNzGnCexSGwLgeccJmZs7AMzN3wrgeCcEK13vCuB4xwXsUfMJSuGLBZmZ4whSuicHsUXPCZmaewZqZbsKuR7PBH4Vpwq5Hx8GF62PC16PcwQrXXcIUru3B4XpYwlK4/sFI4VPCuB4Iwo/CTsJI4RDCFK5KwqRwF8IzM0jCcT0fwlyPRMJcjyTCw/VIwsP1JsIUrlHCmpkiwrgeXcJSuB3CCtdmwrgeGMI9CnHC7FERwnE9e8KuRwrCUriCwsP1AsLs0YfC7FH2wUhhjcLNzOTBcb2SwjMz18FSOJfCMzPHwSlcm8K4HrnB4XqfwsP1qMFIYaPCKVyZwa7HpsIfhYfBPYqqwkjhasHsUa7CpHA5weH6scKamRHBHwW1wj0K18AzM7fCmpmBwB8FucIAAMC/Kdy6wo/C1T/sUbzCw/WIQGZmvcIUrv9ASGG+wo/CIUGaGb/CPQpDQezRv8JmZmJB4XrAwmZmfkE9CsHCexSSQa7HwcJ7FBVCw3WBwgAA7EHheovCrke9QexRlcLNzKhBZualwlK4lkFm5rbCFK6JQY/Cr8K4HjFBAAChwgrX20B7FJPCheuJQEhhhsJmZsY/XI9pws3MBEFxPbTCmpkJwNcjr8J7FEbBXA+jwoXrtcFSuJTCPQrrwSlchcKPwg3Cj8Jowrx0Oz+XkA89GM9APyS5fD368kI/4Nv0PRNERT8qjC0+NQxHP9f6Yj4PuUk/iQyLPuHuTD8MH6E+vJFRPwcItj4Y7FY/CHfHPkSGXT8wu9c+EapkP3oZ5T5sBGo/0LjwPqiMbz+Amvo+tVR2P5AUAT9H5nk/Gw0IP2iuez8TYRM/fm97P4NpID8mAXo/xTgvPwTKdj8E/zs/Ka5yP0D2Qj8O+Gw/QYJKP5JcZj+Lw1E/za9eP8e6WD+A1FY/l1ZbP6PMTj9EhlU/XHJEP3qlVD826jk/hqxWP6D9MD8oJ1o/WaMmP0I+YD/92R8/MndlP4e/Fj9ATW0/0/YPP/Qacz8fLgk/41N4P9BEAD90e3k/LgT5Pq0Xcz99Bfk+ArxlP5xQ+D6Sy1c/e4j2PgYNTT/WHPA+eEVAP9/D5T6fjjc/ho/YPl5LMD9eEcw+wcUqPwVuvT5jeio/GTmrPtjTLj+eXpk+mus0PzI4ij4vhjo/srp1PvGdQD8AdFg+d0pHP80GOT7Bi04/3QcgPjnuVD+NCwc+3nFaPzuq2j2giWA/XD2nPYF4ZT9CsoA9B19oP034JT0kuWw/QlvOPD1+Zz8cQpU8wAldP087/DyuZE8/SkE3PffHQz/v/ng91ZU3P9B+pD3OcCs/Ke3NPfs/Hz+Cyvg9gA4TP7A9Ez4dyQU/vvYsPgwH8j5q9kA+RIvcPviIWD5wzsg+JUBtPk0QtT4KaII+A32iPpHVjT55O5I+L/qaPoJWgD6BQ6g+2XxcPmJnuj5jfzk+CwzJPjp6HD7k99Y+fZYHPn2u5j4UXOw9R6z1Pm2QyT15HgQ/WrutPebLCz/b3Jg9Ja8WPw1Uhj1c5hw/W5lwPRUAIz9wCFU99MMoP3h/PD384y0/j6omPejZND+62go9cqdsP09YIj9T0FU/NV4KP0+vRD+PwuU+Iy09P9uFlj73kjY/66gKPjvCMT8/HU8+mrYfP1X2rT4TYRM/93XwPqHbCz9pjBY/3LoDP6qaQD+7mxc/mwMkPlji8T5A2VQ+ob61PpMYpD5+AHI+WYboPi3PIz6N7hg/taa5PVGDQT/sF+w+ReLkQUzdg0C78gk/U7FjwMvswEB/+wI/iHfSQcqIu0BkBvo+9yKvwMS5d0BpHSU/GKKyQRO8t0Dfw7U+iFy1wBgb2L3vIE4/wrOWQSmXukBEbiY+YP7AwGgPZcCMLQQ9Q9u6wMA5s8BVavY5tuvjQdFYZkHxY3Q/pVh0Qb9atUCbyTc9Sr/EwGO05MAKndc8TmzNQVoAREFTs3c/YN07Qf3YvEC9Osc7jRnVwEVdKsHfbPM9S2m3QeHqKUG8kWE/LI0JQfGAz0AP7p4+ihWeQcktF0FRiDA/QiiuQLby9UBHrA0/7NOEQW5CDUEipuQ+RRAqQGy+FEFaKkc/oldRQbQgCkH4U2M+F2D5vRJxN0H1LWs/XTgZQXYYDkEai6Y9A2MmwA9cX0GhoXc/KMzaQDMjDkF32wU93yGVwCU6fEECvH0/b2aFQMQAEkGm1RA8MFnQwBKejUGynX8/tE+cP/ylHkEbTMM6b10DwSrloUEAAIA/OKeGvzDnE0EAAIA/j45VwJu35kAAAIA/Ea6kwNYPikCPpX8/W+LZwPdgQz+SkbM6sjwxQFY6N8Ihdn4/IgXxwORsMMCmm8Q7BALLQMbDNcKLGnw/BRnjwKvqp8BdM3k8Om8JQe0dMcIahnc/AdDFwCsaBMHekwc9yvgyQfUDKsIGTHA/HMicwHZDNsErNXs9NaxcQbRcIcLIXmc/Nl1NwASca8GBBMU93rmDQWHpFsJRMV4/ILFPv2JQicF+NQc+/ZWQQXfWCsJCQ08/cSE3QHZajsFa8EI+JJWMQYEi+MGc+S0/ocrUQN6KoMF4C6Q+stiUQb/E1cHEXwM/yTMhQTchuMFivjw5UrW5wVQvJsFCJvk+eyGjQZ6NtMF7vbs+MYhLQf0jz8EXt9E4y+m4wWyxZMFlGSI/Y7yyQUd2mcFDBFw++dx3QQNz7cFI/kg/vQDJQZp0dsFubgw+fweJQWOwAcK941w/rf7ZQV5QUMG9b3w9OZ6ZQYIjEcJcOHA/aX/yQachHsH3deA88AumQeSZHMKp+3g//lECQplW8cAfuiA8MzqzQemXJ8JwfH0/ldQKQumrpMBo6J86VPzKQSQUMcJkr38/IlEQQtUGzb8AAIA/vrMLQvlP0D7T2Uk62ZzsQahvI8KcUIg5ab+/QUtjH8KCqHs4EaDOQPH8H8Katn8/SoX8QShVsT+9Osc5wNX9QVCxF8JV3g47OQixQS/SEsKWJiU6SCJrQJyZFsKhLX8/MfPgQUfCI0DN6TI8VnunQXuECMIuVlQ7HB/YP517DsJbX3w/Rz/MQbB8bkBtkEk9kTmiQdCt9MHCUXI8DebqvSn/AcIKnW8/Pbm1QWJJv0C6ZvI9DCWnQS3F28G/fR09GisTvy7f6sH92Vc/GiepQTDDC0FiEFg+Y/KxQZfEwsEr+649/Bixvo2yz8HaGzQ/YfigQdS3P0Ep0Jc+MIS9QSGNrcGrPhc+mLMGPsvVt8H3zJI5/bczQhSD9ECYNA4/JdibQVTzbkG+pLE+QDrSQWiJn8EjLYU+fk3+P1W1o8GAK8k+GViiQXyfj0GwVaI+c0jxQZiGlsHcRuM+pqCoQNXXkMGpwXQ+/fCzQX3AqkGg4GI+zNwIQrLIkMFzuiQ/G6MNQaeYgMFVMAo+x7nIQZdQxEH3AQg+dvIWQna3jMGH/kk/LgZAQae1ZsFh/Z89jl/bQQDR2UG5GW4961slQmtMicEDPmc/MRR0QV8DTcGU+x09zvDuQU9B70F5WKg806gzQpORh8E9D3Y/nmuUQf6lNsH4qpU8x7gBQqyiAUL9vCk71P9CQgruhcFkzH0/j8qwQRMRH8HDR8Q7DsoMQuxJDEJXeH8/Zm7IQcXQDcERAQc7vDoWQnCbFEJx5n8/zZHeQf149MC9Osc5KMIeQsgxHUIAAIA/Vhr2QWCazsAAAIA/Z8oFQrBcosAAAIA/rUMNQgxqe8AAAIA/bdUWQl23LMAAAIA/h48WQnvWCr8AAIA/lcgPQnAk3D8AAIA/dSQBQjFSNUAAAIA/0prnQc5GX0AAAIA/n9/KQbTdgUAAAIA/7E2sQf6bikAAAIA/H16NQa50kUAAAIA/EwFcQdQWlkAbTMM6glonQmQHuT+ynX8/xCoYQaSQnEAzMxM+G+YWQvo8MkCLMls/qPClQLYAmUCbrLE+ybEJQv2Gf0ALKSc/N9vVP0MmmkD7Ihk/5V/3QbEzmkC7uM0+tvTzv1WljUCpalI/Bm/dQch9uUC9UjY+oD6pwBR8iEB6jXU/R+bBQWB1z0DnHSc9bzIMwfXQcEBY/38/KU6oQUqG3kBY/38/6GGLQbWY7UBY/38/ZU5cQUdb/EDfFcE8PrUWQvida0Cp9nk/TYcUQQUo90Ab2Ao+BRYJQu2In0BSSV0/e2W0QOl99EDvrI0+L8r4QQIluUDhKDk/IncZQJK75UBkBvo+0uHcQdiRyUB/+wI/5zODv5mlykDjNjI/6yLCQUJC20DrkJs+7IKKwNB9skB96GI/XaOhQdD54EDYtug9vH0CwSiKhkC2EGQ6okz6QTtOgcFmFHs/2v2GQSFI40DMKJY80D80wXqYQECrsm88wnT1QXNlOMGOQHw/hzxDQeej20AwnkE9HnbzQSKTDcF15XM/2jsYQaxr2kAz4dc96ZHxQVoNx8AyA2U/KAncQLt92UCbj0s+z7LvQcjNb8BxG00/v4qMQJFA2EATSZQ+0+LtQXeIxb/P2jU/3lcLQO2R1kDecco+UF7rQQCNtj9pxho/osZOv6QA1EAAAIA/watSvt10yT4AAIA/LZQ1QXCTND4AAAA/pLOmQVoDmz8AAAA/yThVP2QxRj8AAIA/Srk6Qashtz4AAAA/o1C1QXEQvj4AAAA/eByTvkFHRr4AAIA/oVFLP5hnIr4AAIA/i0lMQaWEIz8AAAA/6yS3QaIPYL4AAAA/tcOqP5FEKj4mjVE8WiLpQLCPz8Gc3O86CJNewTTcAcKOQHw/wqQdQT8yfT8AAIA/AwmrQf+plz+MuWs/7IdPQbWjDz9eLqI9pR2iQJIFKEEAAAA/RCjTQeYyUb4AAAA/G4SgPmn3Fb4AAIA/33JyQZJ20j4AAAA/ECT3Qe9IB74AAAA/clmPvtv7f75Jun4/SEdGQdiN2z5/h6I7Ug+zQTnMJEIAAIA/9F3LQex9r72Pwn5CzUycwlK4fkIK15XCUrh+Qq5HjsIK14BCpPCIwgCAgkLD9YPCw3WFQsN1gMLXI4lCj8J7wjMzjUJSuHTChWuPQuF6bsJI4ZBCPQpjwmbmkEJ7FFnCM7OQQuF6T8LD9Y9CUrhAwuF6jkJ7FDbCPQqPQkjhJcIUro5CrkcVwvaojkKkcAXCPQqPQuxR8MGFa49Cw/XMwT0Kj0IzM63BUriLQpqZKcFcD4pCj8LlwB8FiEJxPVrAw3WFQuxRuL2F63hCKVzHQLgecEJ7FApBPQplQoXrMUGamVlC7FFYQTMzTkJ7FHpBZmY/Qh+Fj0HD9TFC4XqaQfYoH0K4HqFBPQoQQlyPokFI4QNCrkejQeF67EFmZqBB9ijOQT0KmUFxPZ5Bj8KLQcP1gkGamYNBhetNQXE9bkHsURRBMzNPQZqZwUBmZipBhetRQJqZBUFI4Xo/Zma+QIXrkb+PwkVAuB6NwHsUTsDXo7DAw/XIwIXr+cDhelTBexQKwTMzh8FxPQ7BrkelwcP1CMHsUcbBAAAAwUjh4sGF6+HAUrj6wdejuMAfhQnC4XqMwFyPFMIfhQvAexQhwgAAAD+F6yzCUrg+QOF6NsIK18NA7FE/wqRwFUFSuEbCPQpDQVK4S8LD9WRBuB5TwhSuhUEpXFzC7FGaQQrXZMJxPa5B7FFtwvYowkH2KHbCSOHWQQAAf8IUru1BXI+Dwj0KA0JxPYfCUrgNQjMzisJmZhhCexSOwhSuHkIzM5HCCtcjQnG9lsIfhSdCPYqbwjMzK0Kux6PCCtdnQs3Mo8LheoBCzcyjwqRwLcAfhWu+heu1QZqZkUF7FIFCSOE6QNejjEK4Hl3Bj8KNQnE9jsGkcNXAH4UfwdejGUKamXXBpHBAQsP1FMJSuGlC4Xp4wlK4bkJI4ZDC4XpVQq5HocBxPYJAH4XhwT0KI0FcjxrB16MbQj0Kd0DWHGA/tYkTPS4cYD/BVok9LhxgP5/I0z1YVmI/CTgEPknXZD/Duxw+nUtpP+P8LT4F3W4/GLI6PqT8dD8480s+O1N4P7thWz5ljXo/c4V3PmWNej+WBIg+9kV6P8zRkz7hKHk/7PqlPrfudj8OFbM+XcR3P3wPxz5+NXc/8nvbPn41dz+4Ae8+tcN3P4pZ/z7sUXg/+5EKP7XDdz8/UhQ/g8ByP++PLz/qPnA/0/Y3PxsvbT8PRUE//khpP1BwST80uls/3gJZP7cLVT956V4/7rFMP2cKZT+2EEQ/AvFqP35vOz9KKXA/rUwwP5HVdT+OIyY/VDV5P5XxFz9PQHs//YcMP060ez8/VwM/ou57P8YW8j77BXs/lkPbPq3AeD9qE7c+uap0P2N6oj4XK3I/flKNPnZPbj8VOm8+L4tpP+FASD5A3mM/vtkmPvkxXj+rBAs+tkpYP+XQ4j3IQVE/FOiTPV66QT9UHXI9pTE6P85wAz1z9Cg/Z+22POYFID/zWZ48ZccWPz0nvTy3lww//Yf0PCTRAz/YRyc9w/X4PiyfZT2Y+uk+uTaUPRRc3D6kqsk9ke3MPlchBT4OZ74+5DEjPtmZsj5aDUk+orSnPo4GcD66oJ4+mziJPnJtmD4HCJY+ilmPPm+BpD78AIQ+kxi0Ptogcz7aIMM+HT1ePiAp0j5PdUg+9b7hPuOqMj5lAfM+FLMePsmwAj+kiAw+IsMKP+IG/D0k1hI/pOTVPT+RFz+eB7c9XHcbP4+NgD28Px4/cLEiPcQIIT8AAAAA4dFOPwAAAAAhyGE/AAAAAA74vD3fFUk/uOTIPl97dj95r2I/9dZQPwcldD8Cnyc/U9B1Px7cHT8Rxzo9HhsxP/fHEz8c0yM/+Q8xP8PT2z6jO1A/ysNCPvMCVD+CObo9G/VAP2NFPT+vXzA+sDgEPyE8ej4j2zE/QE0VP/4rUz8AAIA/JgCmQef9OEAAAIA/UT2GQSIBaEAK1yM8YWaRQnkQCUD8b30/CC9CQZ/4j0DguRc+KuWLQu3Mh0A4EFo/aHEQQfLQwEBznaY+UeSGQu+5y0CfsCw/biXFQAPe80Dqsvg++zWEQstfDkE8pQM/Gk6LQEF/HUEPCxU/s+6CQlojOkEMzdU+k2tMQDlvRkFyM1w5sEtOwrWwUEK9+ys/mr2AQmrubEFrmqc+hi7AP1jYdEFblFk6fshSwkEHREJhiTc/uU98QmOUhkGiKJA+5xAivng3iEEErcA6RcNTwm6BOkK5jUY/12ZwQhEDmEEgKWI+fS1gwF2ulEGTV2c7DOJPwiZELEJdilM//t1kQlVioUGqZSs+XuXRwKlimUF1yM071MhJwnxpIUJJul4/lItZQmxmqUEEc/Q9VH0YwZjXnEGfqy08921Dwnw4F0Ll1Wk/HbxHQsi3s0EJOIQ9gWJiwSMIoEFRTrQ85Lc4wrQVCEKMEG4/lgM6QonDtkHgLRA9wrOMwRGunUFjtA49RvAuwrqu/EHshm0/kr4nQnt0yEFlcBQ8PPyzwV7sp0EWMIE9lComwpwS2EHusWQ/WicUQg5A1kGz74o6IBrdwb/UrUFUOtg9kyUbwsXctEHVIVc/58IBQjfq5EEMdiM+1FURwlF3kkHS40c/GWzlQewM80EabmA+5vgJwtlMaUF0BzE/Ox29QYekAkLI750+tcr/wSCIGkFihBg/3JCXQZMoCULt9c4+wo3qwbCurkDjNno+d1urQMoLFkKfcUE/2JmlwXMHscCSrhk+9SeAP0qRGEK0k1k/XoKNwXvSC8EDeIs9wDR2wBDcGkKwj24/jRNkwRNYQ8GpE9A8bbUEwVsbG0K7fnk/FA0twdR4cMEAAIA/4aEBwIACmcEAAIA/8FvsP1UIo8EAAIA/pJrMQLQGq8EAAIA/pbwvQf/KscEAAIA/7SJ2QSYWtsEAAIA/9qWmQSvtt8EAAIA/MaLKQWZEs8EAAIA/VZz3QdVMo8EAAIA/drAMQsI3ksEAAIA/AyIaQtcAhMEAAIA/WxMoQisZYMEAAIA/K0o2QtOyKsEYeH4/KT9MQtJvpcD9n8M7APXZQGtjdMI4Mo87KdzOwdfjFEIQ6Xc/vY9YQkug+r+C5948BgEhQdA9aMIV4/w8KdzxwQoXDUI+rmU/h+9jQsXA8j8JUJM9b9dRQdV5WcJanoc9FO4KwtdjA0IDYEw/ss5uQlo6x0CKqwo+2ouAQT/JSMKnItU9rgcbwq7H70Hwoi8/cyN3QrZlK0FM4FY+7yqTQRRUN8LSHQQ+SOEowq7H2EFKKRg/LIN9Qpq9bkHlm40+EMKhQe3eJsLfbBM+SGE0wq7HwEEzpwM/OsyAQtmXl0Hb+a4+mLGrQYMCF8IcfCE+4fo+whQupEGModw+beGBQuLtukEXn9I+7fixQRF9BcI4LRg+e1RPwvYoSkH04I4+izWBQlz5AEJBghI/0jezQRTrw8GWsgw+SOFUwsP1DEGsyl4+qbJ/QkYFEUIIICU/bI+vQcqSo8GamZk9e1Rgwo/CdT1Dys89D2R4QhgdNULd0lI/1fWkQQphNcEgDDw9FG5kwkjhjsC5iG89IAdzQmPhRkJjRWU/MjecQQV42sBuF5o84bplwtejEsE0hc48SuJqQu7fV0LLuXQ/DtWNQSo9HsCpMLY66EJfQt0FaUJApH8/zQlxQdb9+z8AAIA/BkVHQdj1tECWJiU682nNwMJ+dcIP1n8/FfAbQVaDB0EstzQ89q8SwJwsdcJ8LH0/rZrTQG2CMkHwp8Y8FLPGP//pc8IZynk/FCxiQICwV0H3zJI5FC5EwsO1BsKeB3c9v8zGQAF+b8Lde3A/FwEuv7IefEHdXlI7rsc2wo+CFcIktOU9cE8uQaiSaMJSSZ056AcTwqZRhcLMYmI/0meqwM2pjEFiodY7SGEqwsN1IcLbxCk+tyZtQfmEYcL0N6E6Tf4EwslUgMLzjlM/S+EWwbEMl0EwL0A8FK4awo+CLMLhXW4+C8mWQXsRV8LDKl47s3XuwQFHc8JRiEA/Gchiwc/jnEEbEnc8e5QKwo/CNcK3C50+1vOzQT6TS8K9APs7m1LWwZEqZcLjpSs/R3WWwVcmn0EdIJg89qj4wY8CPMKm1cA+SSzKQUiuQMJsJl88OMTEwX5RWMJDVhc/S4u1wfKtnUESvYw8w3XjwY9CRcJpb+A+qD3jQZ9KOsIDz708B6quwcKcT8JMcQU/+sHQwSHUpEF+dGo8w3XLwVzPUMKzJAA/ds8AQs11M8KhhBk9+IWTwbn0RcLCL+U+L4bwwZfarkGEuzM89qixwfZoW8I/Og0/R3QPQotwK8J+dGo9WtVzwUc9O8J4nMI+fYcIwoZgtkEKndc7j8KYwY8CZsIaixY/Ku4dQjDWI8LdQaw9AfRAwQv3MMLzdqQ+sGQYwt1MvkHn41o7Urh/wVwPccKMFR0/89IsQsRmHMLF/vI9z00MwR7GJsLRXIc+F3UowpkHx0EhdqY6hetLwSkcfMLxSx0/cOc7QpCAFMLZlCs+zpGuwGcXHMI66V0+KPg4wotQz0GCqHs5hesSwUghg8INphk/JKJKQqwPC8IFqGk+yl0TwAP3D8I9fi8+7z5Kwt3U1EEh6g4/ktpYQpZWAMJqh58+p7YpPw2uAsItPgU+7/5bwuXB10FvZP4+ILJkQklq7cGrss8++EtGQLfb7cFansc9aD5rwsIl2UECt84+EaxyQj/e28EEOQg/PirDQCk118FZUYM9loN7woGo3kHzjqM+8NV8QtUc08FHWiI/bA0GQQ+qysEDzz09pwGDwnun5UEyclY+vQuGQvN20cFWK0M/0kRBQWEcw8G37uY8MPmIwtu7+EHT9g8+hXiMQg3f0cEbElc/FdhzQViCvsEX8Z08WbONwmASBUK4HsU9z+KWQhCw2MFHyWM/4hykQc8WvcGZZGQ8y1aUwv56FULDZCo6ewilQi8XGMFJon8/CkHAQd5+oMDT2Uk680y2wtuq50EAAIA/7N7LQQ29LEA4LRg+e9RGwuH6gkH04I4+NDOBQqGN30FBghI/kUexQS9C5sEYeH4/fSxBQjU/+cD9n8M7pr95QH08fsKpE9A8HOVMweGNFkK7fnk/vYHSwDedh8HjNno+Q94UQTQuEkKfcUE/03y5wXIkFMBihBg/eIliQWlmDULt9c4+DeXRwX6k0j+amZk9SKFawuxRhkBDys8985h7QuPnI0Ld0lI/5nWpQYHQesEAAIA/16PYP4/CIcAAAIA/x/7QQY5XAr4AAAA/hipvQnPcgT4AAAA/cKchvkPBCj4AAIA/xu9MQZYXN78AAIA/G3ooP8JPtL8AAIA/oGd3vwvnnr86dYU+e1QGwlK4kkD27p8+4QgzQl3w8UExmdo+WHceQJYfy8EAAIA/TvOuQbnKCsAUrnBCMzM4woXrcEJmZj/CrkdxQvYoSsJcj3FCMzNTwilcckKkcF7C4Xp0QlK4Z8LsUXxCrkduwhSugkIK13HCM7OGQqRwccIKV4tCKVxwwuH6j0LsUW/CFK6TQtejbcK4HphCZmZtwgCAnUKPwmzC1yOiQilcbMIUrqZCAABtwnuUqkI9Cm7C4fqtQrgeb8Ip3LFCZmZxwgrXtkLXo3XCKdy6QkjhecIAAL5CmhmAwq5HwUJcD4PCZmbDQpqZhcIpXMZCrseIwgAAyUJcj4zC16PLQlwPkMJxPc5C4fqSwoVr0UIKV5TCw/XVQgCAk8IKV9lCmpmRwj0K3UJxvY7C1yPhQkhhi8JxveRCrkeIwnE96kI9ioPCrkfvQmZmfsJxvfNCj8J2wuF690KuR3DC9qj7QvYoacKF6/9Chetgwq5HAkMAAFjCM3MEQ5qZT8LXowZDuB5HwsP1CENmZj3CXM8KQ1yPNMJczwxDw/UqwuH6D0MfhRvCAIARQ3sUE8KuRxNDexQJwsM1FUOkcPvBXE8WQ65H6cE9ChhDUrjSwZpZGUMzM73BUrgaQ9ejpsEULhxD16OOwT1KHUPD9XjBw3UeQwrXS8GFax9DUrgewexRIEPsUdjA1yMhQ5qZacBxfSFDSOG6vykcIkPhepQ/uN4iQ+F6ZEAzsyNDexTeQM3MJEPXoyxBhWslQxSuY0E9CiZDheuNQQqXJkMAAKpBM3MmQ3sUwkEKFyZDw/XUQexRJEMK191BpDAiQz0K20EAwCBDcT3SQXH9H0MAAMZBUrgeQ2ZmtkGuhx1DexSkQQoXHEO4HpFBXI8aQ0jhekGk8BhD16NQQXH9FkOuRyVBM/MUQ1K49kB71BJDFK6nQLjeEEPsUUhAAMAOQ+F6VD89ygxDCteDv5oZC0OamTnAUrgIQ3sUrsCPQgZDcT36wD2KA0OPwiHBZqYAQ83MOMEAgPlCCtdHwWbm80IK10vBrkftQgAATMEAAOdCuB45waRw40LhehjBexTiQilc18Azs99CH4V7wPao3UIUrse/UrjWQmZm5r72qNJCFK5Hv6Twz0IpXB/AM7PMQmZmrsCuR8dC9igIwVK4w0LXoyjBw/W+QqRwUcEpXLhCMzODwWbmsUJI4ZjBH4WrQh+FrcE9CqZCuB7Hwdejn0L2KNzBCteXQrge8cF7FJBCCtfzwXsUiELXowLCuB6CQqRwD8KamXtC9igdwq5HdEKkcCrCAABxQo/CMMJmZg5DcT0jwoXrgkJI4UnCHwWZQsP1SsJm5rNCZmZKws3MwkKkcGPCUrjWQsP1e8Ls0exCexRVwgqXAUNxPS7CPQoLQ6RwEMIUbhFDZmbGwdfjGEN7FBrB7NEbQ1yPQr4AgB9DUrgyQexR2EJcj2bCzczcQuxRNMIfhd9CcT0DwuxR3kIzM53B9qgAQ8P12MGPwvFC7FEiwgpXtUIK1wDCzUzBQq5HLsL9vCk8pMePPjPEMTxgAoc+pN8+PE2hcz7T2Uk8nYVdPqn2aTxeLkI+fcucPEF9Kz4r9hc9MIEbPvNxbT08vRI+2XycPQDGEz5lNsg9Ol0WPvLv8z1z9Bg+zF0LPoMXHT5LPCA+NJ0dPluUOT6qKx8+InFPPg03ID4U0GQ+NqsePi80dz47GRw+pI2DPkCHGT6xv4w++doTPnJtmD7OjQk+at6hPgd8/j0iVKk+CYrfPcQIsT6TqcI9eQG2Pu/mqT2+9rw+8fSKPfUtwz4zp0s9LGXJPt6TBz2ojM8+UkmdPBEB1z7yQU88irDhPni5iDzGouk+mxvTPGFU8j7sTCE9QwT8PnReYz1oPwI/sP6PPYC3CD9bQr49UaUOP1ys6D0m5BM/qBgHPrZKGD/Q1RY+cy4dPztTKD5VMCI/A2A8PoenJz9FR1I+qcEsP0m6Zj4t7DE/N2x7PnBfNz/pmok+Pbg7P9dplD7BbkA/FCKgPovgRz/o9rI+xXJLP85TvT7opE8/xHzJPuQsVD9NZ9c+dsNWP6J/4j5Gzlo/F0jwPvPlXT/idf0+vR1hP6eWBT/jjWQ/ie8MP3QkZz+zexI/UORpP+5fGT+mJ2w/KEQgP7NBbj9Y/yc/djJwP9WVLz/nAHE/vvY0P811cj/eWTs/nzx0P+I7QT9iLXY/LXhJP0zDeD/v4VI/izd6P9RIWz/Jq3s/odtjP772fD/Pa2w/26J8PwnEcz/3x3s/h4p5P32Wdz/3O3w/6pVyP6Fnez/XNG8/ibV4P8dobT8F+nQ/qWpqP701cD9RoGc/H51qP/c7ZD/EzmQ/f6RgP/vLXj/o2Vw/B19YP4FDWD9WvFE/U3lTP2FPSz8HfE4/8UtFP5/lST9+HUA/U+hEPziEOj9EUUA/XvQ1P49TPD8sZTE/kL02P6UsKz/L8zA/8l4lP6yQKj+sxR8/98cjP5Y+HD8xmRo/AfYZP/MCFD/BVhk/WDkMP3FVGT+h1gQ/9zscP3+kAD+tNCE/yhX+PiQLKD98fvg+nOEuP1ey8z5PrzQ/+FPjPhhgNz9Nvtk+Gos2P9Vb0z4TZjI/98fLPsgkKz+4Ab8+wa0jPxKgtj5jtB4/FXSrPt17GD9+45s+PGYQPyS5jD6Lwwk/FXR7Pgx2Az8wnmE+6UP3Pkp7Qz5iZ+o+Q+IePtuK3T47jfQ9odvbPq00qT3iO9E+xHdiPbSTwT4xthA9GM+wPkG3lzwLmKA+WDk0PGnjmD6mJ0Q/foypPu3TcT3NWHQ+OGckPhDMcT7vcpE+eSNzPv2HtD6VDjY+2IHjPnmS9D2Euws/2T1ZPhAGJj+LGpw+Pj88PwGHwD49REs/Osz3Pt7IXD9q9iA/eqpjPyQLOD8BTWw/jsxTP0pB5z4smi4+EMzxPj6zlD4uHPg+h6LQPrtE9T4+eQg/HNMjP71v7D6QiBE//aSqPvHXlD53hNM+JQaxPhb7mz74pX4/pdW1wL33oED3r6w7v/32wOM+hULRXH8/zvGywK34MUB/hyI7Z1wfwZOphUJO7n8/vpyuwPKyFL+cUIg55/VUwc1IhkIAAIA/cjKrwLzuWcAAAIA/pW6iwC5P3cAAAIA/4JmMwED7HMEAAIA/gAb3v4+DPcEAAIA/QRJnP4ABT8EAAIA/f4JaQHi7TMH4jX8/sfrJQEAER8ErweI62BNLwRN8xsEYeH4/a1oTQTyAQcH9n8M7QTYpweBptsEu4ns/kUs4QWrZOME8pYM8+sUQwfnmp8Fma3U/n69kQdxYN8EpPyk9vC3cwIoHmsFKJGk/RDuNQe/HM8Fv2LY9PjuKwACGiMGto1I/l2ykQRl3McGtbjU+EkcFwOV0c8Hf/TE/ciK7QS1bNMHzApw+ZSOaPtmdWsE7qhI/3abOQWRKOcFG09k+ODkcQKI7R8FF9dY6uXiNwbddp0F87ek+eavfQYV1PsGQiAk/P9uKQIgGN8E+BcA7aUmCwTlImkEAHaY+sRvzQT+YScEnoCk/QH/WQPe0KMFa2FM8pHFuwbFbiUHjGTQ+NQoGQo50XsH3AUg/AMEfQReRG8GDbi89O01WwTVGYkFn7bY9LyAQQpZhc8EA41E/f5pMQf83FMFa9bk9/HZFwX0POEG7uA09gQcYQiViicEvNE8/yLV4QVV5GsHYux8+YxJCwVekC0EHCOY7jUcgQkkSmMEmjUE//FySQR5KHsGJmHI+4FA8wY+sv0BlGWI7Yp8lQvGypMHWizE/oHqiQSfBJcHRIps+k6k8wTIEe0Cz7wo6mBMtQnd/tME66R0/+t+3QVdBLcHF5sM+2cQ6wSjPmj/2fw4/Dc7NQbh4O8HF/uI+CzQ/wQpV1L8lXQM/4uPiQXZ0R8EYQ/k+MdJBwWGbjMDU8fg+9hD2QeUNT8FuhgM/8vpAwdfI2sAVqfA+qWwDQqq2RsHOqgc/05oxwXJfDMHiAeU+dTULQm2fJMFnfg0/WZsJwXpvI8E2H9c+5BQPQtkTAcFlcBQ/Ox7HwOfnKsHB4sA+9CQSQkHkp8BzhR8/LGRTwKYlLcGCqPs4Td+EwdZFwsBDc50+GUAVQjqnAcBIpy4//9YaPLMtLsHYRyc8s41hwTKzA8H3AWg+csAXQtt2YD+Nlz4/WaI+QNDxLcGq1Ow89ck8wQrKIcEJ+eA9QpEbQvQGqkBApFc/YYfwQL+OLcFyv0M9GpUEwY3AT8EJ/jc9vxEfQmgIFkF5dW4/UcY6Qec6LcHYKsE8VDmiwIjgecFKRk48ATMiQuJnT0H8jHs/ZH91QcEYLcGMoZw7jxEPwE6Yj8ErweI6v8QkQi3Pf0H4jX8/Q32TQam0LMEAAIA/J/GuQfe7LMEAAIA/A4TMQTYFKcEAAIA/XKPsQT8vJcFpAH8/SmMFQoRhIcFf73472qGpwb2AGcBpxno//ZgUQkyIHcHnHac88p6MwRhKZMBWSHE/wU4lQhinFsEmcGs9YYZYwaBKlsAcsVY/BIQzQtEFDcHvOCU+Gx0gwZP9rcDElDg/LOlCQohyAsEo1Y4+J+DFwFlox8Dl1ek+aH5bQpeq4cBmFAs/zll8vcCj7sDrHKM+MR9oQufiyMA7cC4/bjhKQNSS/MDJPDI+GgF3QoP7qsAmcFM/xdneQPkrBsFyp3Q9vMeDQkGfhsDhtHA/FLUzQRCBDcGkpXI8A46JQv0kPMB/9ns/gh5mQayNC8FVanY69gi8wV1/k8CCqPs5fWuRQn2F1L/ovH4/QRWUQWWLD8GJKZE7I+WbwUrhssD7Ong/qfuxQd1YDcGXi/g8DI58wbDbw8Ai4Gg/AFDRQTL8CsGx+bg9KXo+weGH1cCsxSc3TRmnQq3uREBrt00/WqfyQXiECMEVHUk+zNf4wL5t6MCsxSc3c+SsQqnBikA50S4/D/QFQkK+BsGfWaI+cdCUwLzt9sC+9gQ/xCUVQgraAMHkD/Y+l9hYvwp+AMGbILo+/tgjQjGC7sAL7yI/JBE4QImFAcHvIFY+FugzQujL0sAdd0o/C2PfQDqo/sB/MLA9h45DQrUztcBI+Wk/v+0vQQrW98BGtvM8zQpOQsZVmMCmYXg/ScVbQSlf6sAhdqY7Ww9bQgDPecBssn4/37mIQdDt4cAAAIA/4v6hQRZj4cAAAIA/hp7EQRHE18AAAIA/fqPsQfuN0sAAAIA/qKQHQmEUwMAAAIA/4EwZQom/rMAAAIA/sNkqQj7AlsAAAIA/Cvc4QvEvWcAAAIA/IaZDQlkFBMAAAIA/4TlGQtmg7z4AAIA/c01BQoifN0AAAIA/Kd05QnoxhUAAAIA/E2sxQu1qj0AAAIA/fDEmQgztp0AAAIA/33gZQlg6uUAAAIA/5PwLQmQS00AAAIA//t/7Qf4970AXt9E68+V5QnwtU0EtlX8/BMndQaFRBkGsxSc3y+9LQgzQZsLfNz48r1ppQiEWXEFT6Hw/CAW+QUbfGkH67es5Mrg/QuJvW8J1HwA92/5YQjJuZ0GynXc/8NWeQZKwMUHtDb46XQE0QuirT8KYo8c9QxxJQhGZdUEctmU/ztWAQb7ySkHDZKo74RUpQnqaQ8J1sD4+ojA7QjUqgkFma00/w4BNQbxcY0Foyzk8zdkfQiKOOMJTs5c+Cw4sQm0MikHCFy4/Lb0UQSGpfUGsqME8McYVQgyYLMIofsw+xzwfQkGXkkEQdQ8/+anKQFDNi0FFniQ9k8cNQuyzIcKZgfo+1gITQiO0mEEE4uU+gItdQCgslkGZ2Hw905AFQg0lGMLDuxQ/lTQCQo/AoUE1DJ8+GDnxviIQpUFd4d09juz0QTK+CsIHQrI6IqKNQt8A80H8GCM/tdXjQW1CrEFvgUQ+kc+HwGA0tUE+ri0+jWfgQfwW+sFoBQY8k76EQls580FkzB0/WtTCQQR8uUG9UtY9OyYAwcoYyEFvnoo+xRrNQTc63MHEX5M8UdJ5QhIE+0HHnQo/QYaoQYg1zEHk2lA9dj8twRo130Fivrw4Z9dzQvkfd8GuZMc+b3PCQS2/vcEmqrc87e5nQimVBkIp0Mc+8uCNQdAy6kHmP6Q8DAFXwU27AEIXt1E6GdZrQsaOLcHnABE/5wa+QejflcGVSKI8/HdcQuW2DkLwM44+p/58QUHdAEJV3g48iORswautDUKWJqU6bC5oQsSJ7sAYQzE/2hC/QZ+Qc8FQjRc8mNdPQuxpGUK+vCA++qpdQaxxD0IUXCw7YqqAwYJrHUKgw1Q/aiDDQV/dMcGMoRw7A7lHQuMWKEJhiYc9/fBUQdMSIEKCqPs5+RF+wRAsLkLGUG4/h8fSQbkO7cCsxac4UZFHQiGgNUIFi8M8zDBoQey5LEIa3Xk/N0HpQXatsMArpPw7HpqJQWRQNkIQBn4/lPECQvjEo8C9Osc5fLWcQd8mQkJx5n8/mJQRQn2fgsAAAIA/OvodQjkfTMAAAIA/+6klQjR3cD9YcwA6ZoZJQrIAeEI7338/f00lQu6LYECPNg47ichCQhhob0KsxSc34IuFQj4yh0HSb38/1qwdQqTWrkAhdiY8xcg6QkSNYEKsxac3fJeqwTY3WUJblFk6KR17QuMGkkEjLX0/sQIQQk4B/kCHbQs9tVYtQvIoUUIRAYc6sb2twcLWRELgufc787JpQndrp0HkFHU/6IgCQuF2PEEId2c9C4IkQhnzRkKfqy07KrCvwexfN0LPvYc8UyleQrdvtUGmm2w/7CrzQXviZEEx68U97bEYQnAeOkLKVME7ZEizwesGJkKcUAg9L4tPQkx2yEFHOF0/bdzcQSpCjUGmuCo+3E4IQvt0KULja08896C5wZ/fDkJGzoI9DmM8Qqo740FnuEE/wyvAQSMoskHYKoE+U4DwQR/MG0J3vp88XwnDwbSl9EG+pLE91z4sQnda/kG5NiQ/ZlipQUmb1UHPMbA+EMfQQQHKDkIr3sg86ejMwVjTzEHuJc09YcccQgSnDEIa+gc/U8KTQQV/+EEE5+w+lJi1QXNk/UE8TtE8H3TPwUjGokHri8Q9BqYKQhpgF0Iv3dQ+tOluQa/ZC0Ll1Rk/lsaVQQzg4kE4Fak82RrZwc38dEG1VJ49oNr1QWrbJEJnLJo+BcZCQUtgHUIvbkM/7ehdQQtpyEExJRI8GmbowXkjHEEOLTI9KUzVQWnLNULRkTw+kZcYQTBeMkL5FFg/n1sQQQ+/xEGWJiU7EqUCwrzKz0A7cM48NzvLQXabSEI9RAM+RpkbQefTRUL0T2g/G1CBQLCsrkHlRDs80tWuQQhrWkKEEqY9Nsz0QAAKW0IcCHE/98mvPvN4jkFv2LY7vSiKQa1SZkI3jlg9MsuEQPHUa0KTxng/cfQUwGwNWEGz74o6YkZJQZv9bUKtad48CktxPpqzeEIIrHw/m8WSwKNnFUGsxSc5gYoBQeMgdELsNFI8eANmwMLugUIn2n0/GSSzwElj60BTIgk8VZWtwHx2hELElDg/qThPQgtp88Ao1Y4+q6hHwDoz28AAAIA/UrZ3P4w15r7/CX4/h4NsQYpvMb+P/ME5+uC2P3UOIUIuOe4738+AwehiPEIAAAA/86T8QY66zr4AAAA/HKm7Ps7tY70AAIA/TDpIQd1fLb8AAAA/I4fYQblHOT8AAAA/2G/5PvRak77zcXU/+QuXQcQbWbtN1ig9yzfsQCHhPcEAAIA/bI8VQlE6Kj4AAAA/9K5RQtpp0r4AAAA/Sya0PU5Vwr4AAIA/eJGCQQluRr8AAAA/fMMVQtbBpL0AAAA/Nn45PzcEWr4AAIA/y0RRQR3Nub0AAIA/vwvgQeMXAr4AAIA/laZdvo7ZRr4AAIA/E7N7Qb5Vb74AAAA/Jw35QWBTPz8AAAA/QXMYPygSET8AAIA/GhOIQfi2Qb+c+XU+DVpHQrF3hEFr1OM+7Hx5QDXbgkGJ6i09/SwnQh+elsGHbYs+U+SfQBJHqsF90Cs/aiz8QTAIIUE+Pww9YGF4wT8riEHDDTg+gFC8QaaXQsE8Mes9SZAnwSdbGMFjnL8+10sBQvi2tEHeyLw9IZBMwSGOlkFenUM+eHLaQZi71kEYYK8+uOOUQM0B1UGHilE+CZUfQnEMB0FIp04+wCrfP2gVQEFZNM0+/9RpQQMriEGiXUU+JvwlwV71p0FnE2cTZxNnE2cTZxNnE2cTZxNnE2cTZxNvE28TZxNnE28TbxNnE2cTdxN3E2cTZxN3E3cTZxNnE3cTdxNnE2cTZxN/E38TZxNnE2cTdxN3E2cTZxN3E3cTZxNnE4cTdxNnE2cThxNnE2cTZxN3E3cTZxNnE2cTjxOPE5cTZxNnE3cTdxNnE3cTdxNnE3cTdxNnE3cTZxNnE2cTZxNnE2cTZxNnE2cTZxNnE2cTZxNnE2cTZxNnE28TbxNnE2cTbxNvE2cTZxN3E3cTZxNnE3cTdxNnE2cTdxN3E2cTZxNnE38TfxNnE2cTZxN3E3cTZxNnE3cTdxNnE2cTZxNnE2cTZxNnE2cTZxNnE3cTdxNnE3cTdxNnE3cTdxNnE3cTdxNnE3cTdxNnE3cTdxNnE3cTdxNnE3cTZxNnE2cTZxNnE2cTZxNnE2cTZxNnE2cTZxNnE2cTdxN3E2cTZxNnE28TbxNnE2cTbxNvE2cTZxNvE2cTZxNvE28TZxNnE28TbxNnE2cTdxN3E2cTZxN3E3cTZxNnE3cTdxNnE2cTdxN3E2cTZxN3E3cTZxNnE3cTdxNnE2cTdxN3E2cTZxNnE38TfxNnE2cTfxN/E2cTZxNnE3cTdxNnE2cTdxN3E2cTZxN3E2cTZxN3E3cTZxNnE3cTdxNnE2cTdxN3E2cTZxN3E2cTZxN3E2cTZxNnE3cTdxNnE2cTZxNnE3cTdxNnE3cTZxN3E3cTZxN3E3cTdxNnE3cTdxNnE3cTdxNnE3cTdxNnE3cTdxNnE3cTdxOfE3cTZxN3E3cTZxN3E3cTZxN3E3cTZxN3E3cTZxN3E3cTZxN3E3cTZxN3E3cTZxN3E3cTZxN3E3cTdxNnE3cTZxNnE2cTZxNnE2cTZxNnE2cTZxNnE2cTZxNnE2cTZxNnE28TbxNnE2cTbxNvE2cTZxN3E3cTZxNnE3cTdxNnE2cTdxN3E2cTZxNnE38TfxNnE2cTZxN3E3cTZxNnE3cTdxNnE2cTZxNnE2cTZxNnE2cTZxNnE3cTdxNnE3cTdxNnE3cTdxNnE3cTdxNnE3cTdxNnE3cTdxNnE3cTdxNnE3cTZxNnE2cTZxNnE2cTdxN3E2cTZxN3E3cTZxNnE3cTdxNnE2cTdxN3E2cTZxN3E3cTZxNnE3cTdxNnE2cTdxN3E2cTZxN3E3cTZxNnE3cTdxNnE2cTdxN3E2cTZxN3E3cTZxN3E6cTpxOvE2cTZxOnE6cTrxN3E3cTZxN3E3cTZxN3E3cTZxN3E3cTZxN3E3cTZxNnE2cTZxNvE28TZxNnE28TbxNnE2cTbxNvE2cTZxN3E3cTZxNnE3cTdxNnE2cTdxN3E2cTZxN3E3cTZxNnE2cTfxN/E2cTZxN/E38TZxNnE2cTdxN3E2cTZxN3E3cTZxNnE3cTdxNnE2cTZxN3E3cTZxNnE2cTdxN3E2cTtxN3E3cTtxNnE3cTdxNnE3cTdxNnE3cTdxNnE3cTdxNnE3cTdxNnE3cTdxNnE2cTdxNnE78TvxOvE3cTZxN3E3cTZxN3E3cTZxN3E3cTZxNnE78TvxOvE3cTZxNnE3cTZxNnE3cTZxNnE3cTZxNnE3cTZxNnE3cTZxNnE2cTbxNvE2cTZxNvE28TZxNnE3cTdxNnE2cTdxN3E2cTZxN3E3cTZxN3E2cTZxN/E38TZxN3E2cTZxN3E3cTZxNnE3cTdxNnE3cTZxN3E2cTvxO/E2cTZxN3E2cTdxNnE3cTdxNnE3cTZxN3E2cTvxPHE2cTtxN3E3cTtxNnE2cTdxNnE3cTZxN3E2cTdxNnE3cTZxN3E2cTZxN3EwAAgD8AAIA/H4U7QB+FO0CkcP0/pHD9PwrXQ0AK10NAexTuP3sU7j8AAIA/AACAP6Rw/T+kcP0/CtdDQArXQ0B7FO4/exTuPwAAgD8AAIA/H4U7QB+FO0CkcP0/pHD9PwrXQ0AK10NAexTuP3sU7j8AAIA/AACAPwAAAAAAAAAAPQpdwuF6fMFSuE1Cw/UowUjhFELD9SjBAAAAAAAAAAAAAAAAAAAAAI9Vzr4AAAAAj1XOvgAAAAAAAAAAAAAAAAAAgD8AAIA/XI9CP9ejcD/D9Yg/9ihcPxSuRz9SuF4/AACAPwAAgD9cj0I/16NwP8P1iD/2KFw/FK5HP1K4Xj+amTlA16NwPylcL0D2KFw/w/WIP1K4Xj/2KLw/AACAPxSuRz9SuF4/AACAPwAAgD8AAAAAAAAAAP5C4j0AAAAAuQJhvgAAAAB5EnW/AAAAACzPEL8AAAAAAAAAAAAAAAAAAAAAAAAAAOxRPcIAAAAAFC5HQwAAAABmJiZDAAAAAAAAAAAAAAAAAAAAAAAAAAAlvIK+AAAAACW8gr4AAAAAAAAAAAAAAAAAAIA/AACAPwAAgD8AAIA/MzOTPzMzkz8zM5M/MzOTPwAAgD8AAIA/mQ1pPQAAAABhwdo8AAAAAEZEEz4AAAAA+wRBvQAAAADqurw9AAAAAGHB2jwAAAAAAAAAAAAAAADl3Qq/AAAAAOXdCr8AAAAA6SckvwAAAABSOAa+AAAAADixDz4AAAAAAAAAAAAAAAAAAAAAAAAAAK5H4UBxPXpAKVyHwPYoXL8pXIfA9ihcvwAAAAAAAAAARJvTvQAAAAD1lj89AAAAADX6jjwAAAAANfqOPAAAAABEm9O9AAAAAAAAAAAAAAAAD4udPgAAAAB1Uy8/AAAAAEdMWD8AAAAA3965PQAAAACWVui9AAAAAAAAAAAAAAAA8lievQAAAACLeuW+AAAAAPUhEz8AAAAA9SETPwAAAADyWJ69AAAAAMK4sj0AAAAAAAAAAAAAAADXo3DBuB7FwNejCsI9CmPBAAAAAAAAAADXo3DBuB7FwNejCsI9CmPBAAAAAAAAAADXo3DBuB7FwNejCsI9CmPBAAAAAAAAAADXo3DBuB7FwAAAAAAAAAAAAACAPwAAgD/sUbg/AACAPzMzsz8AAIA/AACAPwAAgD/sUbg/AACAPzMzsz8AAIA/AACAPwAAgD/sUbg/AACAPzMzsz8AAIA/AACAPwAAgD/sUbg/AACAPwAAgD8AAIA/AAAAAAAAAAAaV3U/AAAAAKcfyD8AAAAAUIDQPwAAAAA4NbI/AAAAAIwdqT8AAAAAAAAAAAAAAAAAAIA/AACAPz0Ktz8AAIA/PQq3Px+Fqz+F61E/cT2qP6RwvT8zM3M/AACAPwAAgD89Crc/AACAPz0Ktz8fhas/hetRP3E9qj+kcL0/MzNzPwAAgD8AAIA/PQq3PwAAgD89Crc/H4WrPwAAgD8AAIA/PQq3PwAAgD89Crc/H4WrP4XrUT9xPao/pHC9PzMzcz8AAIA/AACAPwAAAAAAAAAAAAAAAAAAAABI4Zq/MzMjwQAAAAAAAAAAAAAAAAAAAAD1D5+9AAAAAF6R+r0AAAAAJ+4rvgAAAAAAAAAAAAAAAAAAAAAAAAAAgtq6vgAAAAByJwK/AAAAALU3I78AAAAAHJeAPgAAAADnfJs+AAAAAAAAAAAAAAAAwriyPQAAAADM6/U8AAAAAAAAAAAAAAAA+n2gvgAAAAD6faC+AAAAAEdG3L4AAAAAL/u9vgAAAABuRh2+AAAAAAAAAAAAAAAAjarFvQAAAAAWE1g+AAAAAIt0ab8AAAAAbtM5vwAAAACit8I+AAAAAI2qxb0AAAAAAAAAAAAAAACLhJQ+AAAAAKAeLj8AAAAAJ+R8PwAAAAAo+qM+AAAAADtokL0AAAAAAAAAAAAAAAAAAIA/AACAPx+FO0AfhTtApHD9P6Rw/T8K10NACtdDQHsU7j97FO4/AACAPwAAgD+kcP0/pHD9PwrXQ0AK10NAexTuP3sU7j8AAIA/AACAPx+FO0AfhTtApHD9P6Rw/T8K10NACtdDQHsU7j97FO4/AACAPwAAgD8AAAAAAAAAAFeOFz8AAAAADviEvgAAAAB5JZ6/AAAAAADicr4AAAAANfqOJQAAAAAAAIA/AACAP5qZGT8AAIA/SOGaPwAAgD+amZk/pHA9P/YovD89Cpc/AACAPwAAgD+amRk/AACAP0jhmj8AAIA/mpmZP6RwPT/2KLw/PQqXPwAAgD8AAIA/mpkZPwAAgD9I4Zo/AACAPwAAgD8AAIA/mpkZPwAAgD9I4Zo/AACAP5qZmT+kcD0/9ii8Pz0Klz8AAIA/AACAP7fcL70AAAAA18d4PAAAAACBwAG+AAAAAFeOF70AAAAA18d4PAAAAAAAAIA/AACAP1yPQj/Xo3A/w/WIP/YoXD8Urkc/UrhePwAAgD8AAIA/XI9CP9ejcD/D9Yg/9ihcPxSuRz9SuF4/AACAPwAAgD9cj0I/16NwP8P1iD/2KFw/FK5HP1K4Xj8AAIA/AACAP1yPQj/Xo3A/w/WIP/YoXD8Urkc/UrhePwAAgD8AAIA/XI9CP9ejcD/D9Yg/9ihcPxSuRz9SuF4/AACAPwAAgD8Urkc/UrhePwAAgD8AAIA/AAAAAAAAAADpHfW+AAAAAJqqML8AAAAA4iJXvwAAAABIakS+AAAAAJVIJz4AAAAAAAAAAAAAAADF6JK9AAAAAK+tfr4AAAAAWkdhvwAAAABRGpq/AAAAAFvaeT4AAAAAxeiSvQAAAAAAAAAAAAAAAM+sJT4AAAAAAhJTPgAAAADG9tM+AAAAAO6JrT4AAAAASglVPgAAAAAAAAAAAAAAAAAAgD8AAIA/XI9CP9ejcD/D9Yg/9ihcPxSuRz9SuF4/AACAPwAAgD9cj0I/16NwP8P1iD/2KFw/FK5HP1K4Xj9cj0I/16NwP8P1iD/2KFw/FK5HP1K4Xj8AAIA/AACAPxSuRz9SuF4/AACAPwAAgD8AAAAAAAAAAI/C68E9CtFBcT0bQpqZWT9xPRJCcT2CwAAAAAAAAAAAAAAAAAAAAAAmRey9AAAAAN5XGb4AAAAA3lcZvgAAAAAAAAAAAAAAAAAAAAAAAAAAXI+MwXsUpkFxPUFCj8J1PuF6cUIpXFvBAAAAAAAAAAAAAAAAAAAAADvvMD4AAAAAAAAAAAAAAADKVhS/AAAAAAAAAAAAAAAAnvTJPgAAAAAAAAAAAAAAAM3MtMHsUeJBAAAUQuxRqEBxPUFCUri+PwAAAAAAAAAAAAAAAAAAAAA77zA+AAAAAAAAAAAAAAAAylYUvwAAAAAAAAAAAAAAAL5Ycj0AAAAAAAAAAAAAAABcj4zBexSmQXE9QUKPwnU+4XpxQilcW8EAAAAAAAAAAAAAAAAAAAAAO+8wPgAAAAAAAAAAAAAAAOZy7L4AAAAAAAAAAAAAAAB5IqA9AAAAAMPG870AAAAAZR1oPwAAAAAzzHc/AAAAANSJ174AAAAAeSKgPQAAAAAAAAAAAAAAABlReT4AAAAAURbnPgAAAADcMzE/AAAAAC7jTbwAAAAATL6MvgAAAAAAAAAAAAAAAB+Faz9mZma/V44XvQAAAADCuLI9AAAAAAAAAAAAAAAAm7YovwAAAABRjMi/AAAAAFTN578AAAAAnwm8vwAAAAAdGm6/AAAAADX6jiUAAAAAAAAAAAAAAAAAAAAAAAAAAFyP4kBSuA5BAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAA1rk3vQAAAAAAAAAAAAAAAAAAAAAAAAAA4zRLvgAAAABXjpc8AAAAACMTwz4AAAAAfGBBPwAAAADXTFA/AAAAAAAAAAAAAAAAAAAAAAAAAAA7aJA+AAAAAGuPnD0AAAAA0MQVvwAAAAACEIq/AAAAAKegbL8AAAAAAAAAAAAAAAB5IqA9AAAAAHkiILsAAAAAbkadPwAAAACmj60/AAAAAMvdtL4AAAAAeSKgPQAAAAAAAAAAAAAAAOGVur4AAAAABlqjPQAAAADdNXo/AAAAAMeQnT8AAAAA6KADPwAAAAAAAAAAAAAAAAAAAAAAAAAAzhtWvgAAAADs5CA/AAAAADNC2T8AAAAACBGkPgAAAAA1+o6lAAAAAAAAgD8AAIA/Uri+PwAAgD8fhWs/j8K1P6RwvT8fhWs/CteDP4XrkT8AAIA/AACAP1K4vj8AAIA/H4VrP4/CtT+kcL0/H4VrPwrXgz+F65E/AACAPwAAgD9SuL4/AACAPx+Faz+PwrU/AACAPwAAgD9SuL4/AACAPx+Faz+PwrU/pHC9Px+Faz8K14M/heuRPwAAgD8AAIA/AAAAAAAAAAC43gTDmpmDQQAAgD8AAIA/w/XIP8P1yD+F66FAheuhQAAAAAAAAAAAe9R6w4/CT8IAAIA/AACAP83MrD/NzKw/AAAAAAAAAAAAAAAAAAAAAAAAAABSuO5AAAAAAHsUJkEAAIA/AACAPwAAgD8AAIA/7FGYP+xRmD/2KJw/9iicPwAAAAAAAAAAAAAAAAAAAAAAAAAAAACkQQAAAABxPQJCAAAAAAAAAAAAAAAAcT0CQgAAgD8AAIA/AACAPwAAgD8Urqc/FK6nP/YovD/2KLw/AACAPwAAgD/2KLw/9ii8PwAAAAAAAAAAAAAAAAAAAAAAAAAAuB6FvwAAgD8AAIA/j8KVP4/ClT+ambk/zcyMPwAAAAAAAAAAAAAAAAAAAAAAAAAAPQqxQQAAAAAAAOxBAAAAAAAAAAAAAAAAAADsQQAAgD8AAIA/AACAPwAAgD8AAIA/rkdhPwAAgD+amVk/AACAPwAAgD8AAIA/mplZPwAAAAAAAAAAAAAAAOH6kUIAAAAAAAAAAAAAAAAfhXxCAAAAAOH6kUIAAAAAAAAAAAAAAADh+pFCAAAAAAAAAAAAAIA/AACAP8P1qD8AAIA/AACAPwAAgD+4HqU/AACAP8P1qD8AAIA/AACAPwAAgD/D9ag/AACAPwAAgD8AAIA/AAAAAAAAAADNzIy/zcwMQAAAgD8AAIA/j8LVQI/C1UAAAIA/AACAPwAAgD8AAIA/4XoEQB+Fyz8AAAAAAAAAAAiKgz0AAAAAAAAAAAAAAACZDWk9AAAAAMK4MiUAAAAAcpL/PQAAAACZDWk9AAAAAAAAAAAAAAAAcgtfPQAAAAAAAAAAAAAAAPJYnr0AAAAANfoOJQAAAACzhh6+AAAAAPJYnr0AAAAAH4VrP2ZmZr8AAAAAAAAAAB+F6z8Urue/H4VrP2ZmZr9Xjhe9AAAAAMK4siQAAAAA2OmXvQAAAABXjhe9AAAAAAAAAAAAAAAAVnYnPgAAAAAAAAAAAAAAAESb070AAAAA3TV6pQAAAAAYyI++AAAAAESb070AAAAA18d4PAAAAACIw+Q8AAAAAMK4sqQAAAAA18d4PAAAAAAAAAAAAAAAADJDDr4AAAAAAAAAAAAAAAAAAAAAAAAAAMb2Uz4AAAAAAAAAAAAAAABhwdo8AAAAAMK4sqMAAAAAtTNwPQAAAABhwdo8AAAAALfcL70AAAAAfNkgJQAAAAA4OLC9AAAAALfcL70AAAAAvlhyPQAAAABjgoolAAAAAD+08j0AAAAAvlhyPQAAAACe9Mk+AAAAAJ+FGb4AAAAAagKAPwAAAACe9Mk+AAAAAAAAAAAAAAAA4ZW6vgAAAAAGWqM9AAAAAN01ej8AAAAAx5CdPwAAAADooAM/AAAAAAAAAAAAAAAAAAAAAAAAAAD+QuI9AAAAALkCYb4AAAAAeRJ1vwAAAAAszxC/AAAAAAAAAAAAAAAAwriyPQAAAAAAAAAAAAAAAMK4Mj4AAAAAwriyPQAAAAAAAAAAAAAAAHE9LEK4HiFCAAAAAAAAAAAAAIA/AACAP3E9ij9xPYo/AACAPwAAgD8AAIA/AACAPx+FO0AfhTtApHD9P6Rw/T8K10NACtdDQHsU7j97FO4/AACAPwAAgD8fhTtAH4U7QKRw/T+kcP0/CtdDQArXQ0B7FO4/exTuPwAAgD8AAIA/H4U7QB+FO0CkcP0/pHD9PwrXQ0AK10NAexTuP3sU7j8AAIA/AACAPx+FO0AfhTtApHD9P6Rw/T8K10NACtdDQHsU7j97FO4/AACAPwAAgD8AAAAAAAAAANp++T0AAAAA6kHdvQAAAABw824+AAAAAFKnNr4AAAAA5nCjPgAAAADCMRI+AAAAAAAAAAAAAAAA2n75PQAAAADqQd29AAAAAHDzbj4AAAAAUqc2vgAAAADmcKM+AAAAAMIxEj4AAAAAcPNuPgAAAABSpza+AAAAAOZwoz4AAAAAAAAAAAAAAAAAAAAAAAAAANejcMG4HsXA16MKwj0KY8EAAAAAAAAAANejcMG4HsXA16MKwj0KY8EAAAAAAAAAANejcMG4HsXA16MKwj0KY8EAAAAAAAAAANejcMG4HsXA16MKwj0KY8EAAAAAAAAAANejcMG4HsXA16MKwj0KY8EAAAAAAAAAANejcMG4HsXA16MKwj0KY8Gambm/7FE4v9ejcMG4HsXA16MKwj0KY8EAAAAAAAAAAAAAgD8AAIA/7FG4PwAAgD8zM7M/AACAPwAAgD8AAIA/7FG4PwAAgD8zM7M/AACAPwAAgD8AAIA/7FG4PwAAgD8zM7M/AACAPwAAgD8AAIA/7FG4PwAAgD8zM7M/AACAPwAAgD8AAIA/7FG4PwAAgD8zM7M/AACAPwAAgD8AAIA/7FG4PwAAgD8zM7M/AACAPwAAgD8AAIA/7FG4PwAAgD8zM7M/AACAPwAAgD8AAIA/AACAPwAAgD9cj0I/16NwP8P1iD/2KFw/FK5HP1K4Xj8AAIA/AACAP1yPQj/Xo3A/w/WIP/YoXD8Urkc/UrhePwAAgD8AAIA/XI9CP9ejcD/D9Yg/9ihcPxSuRz9SuF4/AACAPwAAgD9cj0I/16NwP8P1iD/2KFw/FK5HP1K4Xj8AAIA/AACAP1yPQj/Xo3A/w/WIP/YoXD8Urkc/UrhePwAAgD8AAIA/FK5HP1K4Xj8AAIA/AACAPwAAAAAAAAAASOG8wXsU3sAAAAAAAAAAAAAAgD8AAIA/H4U7QB+FO0CkcP0/pHD9PwrXQ0AK10NAexTuP3sU7j8AAIA/AACAPx+FO0AfhTtApHD9P6Rw/T8K10NACtdDQHsU7j97FO4/AACAPwAAgD8fhTtAH4U7QKRw/T+kcP0/CtdDQArXQ0B7FO4/exTuPwAAgD8AAIA/H4U7QB+FO0CkcP0/pHD9PwrXQ0AK10NAexTuP3sU7j8AAIA/AACAPwAAgD8AAIA/XI9CP9ejcD/D9Yg/9ihcPxSuRz9SuF4/AACAPwAAgD9cj0I/16NwP8P1iD/2KFw/FK5HP1K4Xj8AAIA/AACAP1yPQj/Xo3A/w/WIP/YoXD8Urkc/UrhePwAAgD8AAIA/XI9CP9ejcD/D9Yg/9ihcPxSuRz9SuF4/AACAPwAAgD9cj0I/16NwP8P1iD/2KFw/FK5HP1K4Xj8AAIA/AACAPxSuRz9SuF4/AACAPwAAgD8AAIA/AACAP1yPQj/Xo3A/w/WIP/YoXD8Urkc/UrhePwAAgD8AAIA/XI9CP9ejcD/D9Yg/9ihcPxSuRz9SuF4/AACAPwAAgD9cj0I/16NwP8P1iD/2KFw/FK5HP1K4Xj8AAIA/AACAP1yPQj/Xo3A/w/WIP/YoXD8Urkc/UrhePwAAgD8AAIA/XI9CP9ejcD/D9Yg/9ihcPxSuRz9SuF4/AACAPwAAgD8Urkc/UrhePwAAgD8AAIA/AAAAAAAAAACF60FB4XrsQM3MDEDNzKxBzcxMQOF69EAAAAAAAAAAAAAAAAAAAAAANNjvvQAAAACnoGy9AAAAAEyyFL4AAAAAAAAAAAAAAAAAAIA/AACAPz0Ktz8AAIA/PQq3Px+Fqz+F61E/cT2qP6RwvT8zM3M/AACAPwAAgD89Crc/AACAPz0Ktz8fhas/hetRP3E9qj+kcL0/MzNzPwAAgD8AAIA/PQq3PwAAgD89Crc/H4WrP4XrUT9xPao/pHC9PzMzcz8AAIA/AACAPz0Ktz8AAIA/PQq3Px+Fqz+F61E/cT2qP6RwvT8zM3M/AACAPwAAgD89Crc/AACAPz0Ktz8fhas/hetRP3E9qj+kcL0/MzNzPwAAgD8AAIA/PQq3PwAAgD89Crc/H4WrP4XrUT9xPao/pHC9PzMzcz8AAIA/AACAPwAAgD8AAIA/Uri+PwAAgD8fhWs/j8K1P6RwvT8fhWs/CteDP4XrkT8AAIA/AACAP1K4vj8AAIA/H4VrP4/CtT+kcL0/H4VrPwrXgz+F65E/AACAPwAAgD9SuL4/AACAPx+Faz+PwrU/pHC9Px+Faz8K14M/heuRPwAAgD8AAIA/Uri+PwAAgD8fhWs/j8K1P6RwvT8fhWs/CteDP4XrkT8AAIA/AACAP1K4vj8AAIA/H4VrP4/CtT+kcL0/H4VrPwrXgz+F65E/AACAPwAAgD9SuL4/AACAPx+Faz+PwrU/pHC9Px+Faz8K14M/heuRPwAAgD8AAIA/AACAPwAAgD+amRk/AACAP0jhmj8AAIA/mpmZP6RwPT/2KLw/PQqXPwAAgD8AAIA/mpkZPwAAgD9I4Zo/AACAP5qZmT+kcD0/9ii8Pz0Klz8AAIA/AACAP5qZGT8AAIA/SOGaPwAAgD+amZk/pHA9P/YovD89Cpc/AACAPwAAgD+amRk/AACAP0jhmj8AAIA/mpmZP6RwPT/2KLw/PQqXPwAAgD8AAIA/mpkZPwAAgD9I4Zo/AACAP5qZmT+kcD0/9ii8Pz0Klz8AAIA/AACAP5qZGT8AAIA/SOGaPwAAgD+amZk/pHA9P/YovD89Cpc/AACAPwAAgD8AAAAAAAAAAK5HLUEfhQdBj8IVwLgey0HXo5A/hesVQQAAAAAAAAAAAAAAAAAAAAA4ODC+AAAAALU9Hz4AAAAATLIUvgAAAAAAAAAAAAAAAAAAAAAAAAAAhetBQeF67EDNzAxAzcysQc3MTEDhevRAAAAAAAAAAAAAAAAAAAAAADg4ML4AAAAAtT0fPgAAAABMshS+AAAAAAAAAAAAAAAAwriyPQAAAAAAAAAAAAAAAMK4Mj4AAAAAwriyPQAAAADCuLI9AAAAAAAAAAAAAAAAwrgyPgAAAADCuLI9AAAAAAAAAAAAAAAAD4udPgAAAAB1Uy8/AAAAAEdMWD8AAAAA3965PQAAAACWVui9AAAAAAAAAAAAAAAAAAAAAAAAAADPrCU+AAAAAAISUz4AAAAAxvbTPgAAAADuia0+AAAAAEoJVT4AAAAAAAAAAAAAAAAAAAAAAAAAABlReT4AAAAAURbnPgAAAADcMzE/AAAAAC7jTbwAAAAATL6MvgAAAAAAAAAAAAAAAAAAAAAAAAAAi4SUPgAAAACgHi4/AAAAACfkfD8AAAAAKPqjPgAAAAA7aJC9AAAAAAAAAAAAAAAAAAAAAAAAAAAaV3U/AAAAAKcfyD8AAAAAUIDQPwAAAAA4NbI/AAAAAIwdqT8AAAAAAAAAAAAAAAAAAAAAAAAAADtokD4AAAAAa4+cPQAAAADQxBW/AAAAAAIQir8AAAAAp6BsvwAAAAAAAAAAAAAAAAAAAAAAAAAA5d0KvwAAAADl3Qq/AAAAAOknJL8AAAAAUjgGvgAAAAA4sQ8+AAAAAAAAAAAAAAAAAAAAAAAAAAD6faC+AAAAAPp9oL4AAAAAR0bcvgAAAAAv+72+AAAAAG5GHb4AAAAAAAAAAAAAAAAAAAAAAAAAAILaur4AAAAAcicCvwAAAAC1NyO/AAAAAByXgD4AAAAA53ybPgAAAAAAAAAAAAAAAAAAAAAAAAAA6R31vgAAAACaqjC/AAAAAOIiV78AAAAASGpEvgAAAACVSCc+AAAAAAAAAAAAAAAAAAAAAAAAAACbtii/AAAAAFGMyL8AAAAAVM3nvwAAAACfCby/AAAAAB0abr8AAAAANfqOJQAAAAAAAAAAAAAAAOM0S74AAAAAV46XPAAAAAAjE8M+AAAAAHxgQT8AAAAA10xQPwAAAAAAAAAAAAAAAHkioD0AAAAAUHdWJQAAAAA2gS8+AAAAAHkioD0AAAAAeSKgPQAAAABQd1YlAAAAADaBLz4AAAAAeSKgPQAAAACNqsW9AAAAADX6jiMAAAAA2fdYvgAAAACNqsW9AAAAAMXokr0AAAAAkgqGJQAAAAC+YiG+AAAAAMXokr0AAAAAzOv1PAAAAADCuLIjAAAAAICeYj0AAAAAzOv1PAAAAAAAAAAAAAAAAClcv8BSuKhBAAAAAAAAAAAAAAAAAAAAAAbhwzwAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAHE9AkIAAAAAAAAAAAAAAABxPQJCAACAPwAAgD8AAIA/AACAP/YovD/2KLw/AACAPwAAgD/2KLw/9ii8PwAAAAAAAAAAAAAAAAAAAAAAAAAAexQmQQAAgD8AAIA/AACAPwAAgD/2KJw/9iicPwAAAAAAAAAAAAAAAAAAAAAAAAAAAADsQQAAAAAAAAAAAAAAAAAA7EEAAIA/AACAPwAAgD8AAIA/AACAP5qZWT8AAIA/AACAPwAAgD+amVk/AAAAAAAAAAAAAAAA4fqRQgAAAAAAAAAAAAAAAOH6kUIAAAAAAAAAAAAAAADh+pFCAACAPwAAgD/D9ag/AACAPwAAgD8AAIA/w/WoPwAAgD8AAIA/AACAP8P1qD8AAIA/AAAAAAAAAAAAAAAAAAAAAD0KLUKuR59BPQotQq5Hn0EAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAVjDc+AAAAABWMNz4AAAAAAAAAAAAAAAAAAIA/AACAPx+FO0AfhTtApHD9P6Rw/T8K10NACtdDQHsU7j97FO4/AACAPwAAgD8fhTtAH4U7QKRw/T+kcP0/CtdDQArXQ0B7FO4/exTuPwAAgD8AAIA/H4U7QB+FO0CkcP0/pHD9PwrXQ0AK10NAexTuP3sU7j8AAIA/AACAPx+FO0AfhTtAH4U7QB+FO0DsUYhAmplpQJqZqUCPwvU/AACAPwAAgD9SuN4/UrjePwrXQ0AK10NAexTuP3sU7j8AAIA/AACAPx+FO0AfhTtApHD9P6Rw/T8K10NACtdDQHsU7j97FO4/AACAPwAAgD8fhTtAH4U7QKRw/T+kcP0/CtdDQArXQ0B7FO4/exTuPwAAgD8AAIA/AAAAAAAAAABI4bzBexTewAAAAAAAAAAAAAAAAAAAAAApXBjCKVwYwkjhvMF7FN7AAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAsd1evgAAAACx3V6+AAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAACMTw74AAAAAAAAAAAAAAAAAAIA/AACAP1yPQj/Xo3A/w/WIP/YoXD8Urkc/UrhePwAAgD8AAIA/XI9CP9ejcD/D9Yg/9ihcPxSuRz9SuF4/AACAPwAAgD9cj0I/16NwP8P1iD/2KFw/FK5HP1K4Xj8AAIA/AACAP1yPQj/Xo3A/w/WIP/YoXD8Urkc/UrhePwAAgD8AAIA/XI9CP9ejcD/D9Yg/9ihcP8P1iD/2KFw/7FF4P/YoXD8AAIA/AACAPz0KF0Bcj4I/pHAtQLgeRT9cj0I/16NwP8P1iD/2KFw/FK5HP1K4Xj8AAIA/AACAP1yPQj/Xo3A/w/WIP/YoXD8Urkc/UrhePwAAgD8AAIA/XI9CP9ejcD/D9Yg/9ihcPxSuRz9SuF4/AACAPwAAgD8Urkc/UrhePwAAgD8AAIA/AAAAAAAAAAD+QuI9AAAAALkCYb4AAAAAeRJ1vwAAAAAszxC/AAAAAP5C4j0AAAAAuQJhvgAAAAB5EnW/AAAAACzPEL8AAAAA/kLiPQAAAAC5AmG+AAAAAHkSdb8AAAAALM8QvwAAAAC5AmG+AAAAAHkSdb8AAAAALM8QvwAAAAAAAAAAAAAAALkCYb4AAAAAeRJ1vwAAAAAszxC/AAAAAP5C4j0AAAAAuQJhvgAAAAB5EnW/AAAAACzPEL8AAAAAAAAAAAAAAAAAAAAAAAAAAAAAk8LheupBcb2mQgAA4kGF601BSOEsQqRwCcLsUThCH4VvwUjhQUIUrkHCCtdLQlyPHcIfhelBexRiwilcD0EzMxvCrkcdwUjhisJmZtrBKVxJwnsULsIAgJLCcT1qwsP1S8LD9ZDCw/WTwjOzqsJxPajCKVzNwh/llkMK1/7CH4Wsw9fjAMR7lI9CmpnAwuH6E0PD9aDBpPCfQqRwCcIAAAAAAAAAAAAAAAAAAAAAsWK2vgAAAACQYUa+AAAAAH7/0b4AAAAAfv/RvgAAAAB1Vfi+AAAAAHVV+L4AAAAAs4jnvgAAAABEpQK+AAAAAKTnoj4AAAAApOeiPgAAAAAdmck9AAAAAB2ZyT0AAAAAAAAAAAAAAAAAAIA/AACAPwAAgD8AAIA/SOEaQB+FKz8AAIA/AACAP5kNaT0AAAAAYcHaPAAAAAB5IqC6AAAAAGjYmz0AAAAAW1NZPAAAAAADKkM+AAAAAFimB74AAAAA98YfPgAAAAB3eeC9AAAAAFI4Bj4AAAAAYcHaPAAAAAAAAAAAAAAAAAAAAAAAAAAAzcwMwArXozzNzAzACtejPOxRCMAK16M87FEIwArXozwAAAAAAAAAAAAAgD8AAIA/AACAPwAAgD+F6xE/AACAPwAAgD8AAIA/hesRPwAAgD8AAIA/AACAPwAAgD8AAIA/hesRPwAAgD8AAIA/AACAP4XrET8AAIA/AACAPwAAgD8AAIA/AACAP4XrET8AAIA/AACAPwAAgD+F6xE/AACAPwAAgD8AAIA/AAAAAAAAAADl3Qq/AAAAAOXdCr8AAAAA6SckvwAAAABSOAa+AAAAADixDz4AAAAA5d0KvwAAAADl3Qq/AAAAAOknJL8AAAAAUjgGvgAAAAA4sQ8+AAAAAOXdCr8AAAAA5d0KvwAAAADpJyS/AAAAAFI4Br4AAAAAOLEPPgAAAADl3Qq/AAAAAOknJL8AAAAAUjgGvgAAAAA4sQ8+AAAAAAAAAAAAAAAA5d0KvwAAAADpJyS/AAAAAFI4Br4AAAAAOLEPPgAAAADl3Qq/AAAAAOXdCr8AAAAA6SckvwAAAABSOAa+AAAAADixDz4AAAAAAAAAAAAAAAAAAAAAAAAAANejqEAAAMA/H4WzwHsUzkCamUlAw/VIQOF6FMHhetxAmplJQMP1SEDhehTB4XrcQJqZSUDD9UhA4XoUweF63ECamUlAw/VIQOF6FMHhetxAuB6lQHE9wkC4HqVAcT3CQClcv0BmZr5AKVy/QGZmvkA9CkfACtcDQD0KR8AK1wNAKVy/QGZmvkCuR9nA7FE4PxSud0GPwvW+AAAAAAAAAABEm9O9AAAAAESb070AAAAAW1NZPAAAAAB5IiC+AAAAAOVkKz4AAAAAeSIgvgAAAADlZCs+AAAAAHkiIL4AAAAA5WQrPgAAAAB5IiC+AAAAAOVkKz4AAAAANfqOOwAAAAAEseO9AAAAAASx470AAAAATUf2PQAAAABNR/Y9AAAAAASx470AAAAABLHjvQAAAACqV+29AAAAAP9aUr4AAAAARJvTvQAAAAAAAAAAAAAAAA+LnT4AAAAAdVMvPwAAAABHTFg/AAAAAN/euT0AAAAAllbovQAAAAAPi50+AAAAAHVTLz8AAAAAR0xYPwAAAADf3rk9AAAAAJZW6L0AAAAAD4udPgAAAAB1Uy8/AAAAAEdMWD8AAAAA3965PQAAAACWVui9AAAAAHVTLz8AAAAAR0xYPwAAAADf3rk9AAAAAJZW6L0AAAAAAAAAAAAAAAB1Uy8/AAAAAEdMWD8AAAAA3965PQAAAACWVui9AAAAAA+LnT4AAAAAdVMvPwAAAABHTFg/AAAAAN/euT0AAAAAllbovQAAAAAAAAAAAAAAAPJYnr0AAAAAiWCsvgAAAABYnNi+AAAAAFpFmD4AAAAAwJIBvgAAAABca0k+AAAAAMCSAb4AAAAAXGtJPgAAAADAkgG+AAAAAFxrST4AAAAAwJIBvgAAAABca0k+AAAAACxEvb4AAAAAVmz4vQAAAABmL1y+AAAAAOB9Sr4AAAAAwisWPwAAAADCKxY/AAAAAFZs+L0AAAAAZi9cvgAAAAB0wt8+AAAAAGuF7b4AAAAA8lievQAAAADCuLI9AAAAAHVfJz8AAAAADe5VPwAAAACE/iK+AAAAAG5GnbwAAAAATLTdvgAAAAD9tUU/AAAAAMK4sj0AAAAAAAAAAAAAAADXo3DBuB7FwNejCsI9CmPBAAAAAAAAAADXo3DBuB7FwNejCsI9CmPBAAAAAAAAAADXo3DBuB7FwNejCsI9CmPBAAAAAAAAAADXo3DBuB7FwNejCsI9CmPBAAAAAAAAAADXo3DBuB7FwNejCsI9CmPBAAAAAAAAAADXo3DBuB7FwNejcMG4HsXAMzPRwSlcK8EAAAAAAAAAAJqZub/sUTi/16NwwbgexcDXowrCPQpjwQAAAAAAAAAA16NwwbgexcDXowrCPQpjwQAAAAAAAAAA16NwwbgexcDXowrCPQpjwQAAAAAAAAAA16NwwbgexcDXowrCPQpjwQAAAAAAAAAA16NwwbgexcDXowrCPQpjwQAAAAAAAAAA16NwwbgexcDXowrCPQpjwQAAAAAAAAAA16NwwbgexcDXowrCPQpjwZqZub/sUTi/16NwwbgexcDXowrCPQpjwQAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAALkMkL4AAAAAAAAAAAAAAAAAAIA/AACAP+xRuD8AAIA/MzOzPwAAgD8AAIA/AACAP+xRuD8AAIA/MzOzPwAAgD8AAIA/AACAP+xRuD8AAIA/MzOzPwAAgD8AAIA/AACAP+xRuD8AAIA/MzOzPwAAgD8AAIA/AACAP+xRuD8AAIA/MzOzPwAAgD8AAIA/AACAP+xRuD8AAIA/7FG4PwAAgD+PwrU/AACAPwAAgD8AAIA/AACAPwAAgD/sUbg/AACAPzMzsz8AAIA/AACAPwAAgD/sUbg/AACAPzMzsz8AAIA/AACAPwAAgD/sUbg/AACAPzMzsz8AAIA/AACAPwAAgD/sUbg/AACAPzMzsz8AAIA/AACAPwAAgD/sUbg/AACAPzMzsz8AAIA/AACAPwAAgD/sUbg/AACAPzMzsz8AAIA/AACAPwAAgD/sUbg/AACAPzMzsz8AAIA/AACAPwAAgD/sUbg/AACAPzMzsz8AAIA/AACAPwAAgD8AAAAAAAAAABpXdT8AAAAApx/IPwAAAABQgNA/AAAAADg1sj8AAAAAjB2pPwAAAAAaV3U/AAAAAKcfyD8AAAAAUIDQPwAAAAA4NbI/AAAAAIwdqT8AAAAAGld1PwAAAACnH8g/AAAAAFCA0D8AAAAAODWyPwAAAACMHak/AAAAAKcfyD8AAAAAUIDQPwAAAAA4NbI/AAAAAIwdqT8AAAAAAAAAAAAAAACnH8g/AAAAAFCA0D8AAAAAODWyPwAAAACMHak/AAAAABpXdT8AAAAApx/IPwAAAABQgNA/AAAAADg1sj8AAAAAjB2pPwAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAA7XmE+AAAAADteYT4AAAAAAAAAAAAAAAAAAIA/AACAPz0Ktz8AAIA/PQq3Px+Fqz+F61E/cT2qP6RwvT8zM3M/AACAPwAAgD89Crc/AACAPz0Ktz8fhas/hetRP3E9qj+kcL0/MzNzPwAAgD8AAIA/PQq3PwAAgD89Crc/H4WrP4XrUT9xPao/pHC9PzMzcz8AAIA/AACAPz0Ktz8AAIA/PQq3Px+Fqz+F61E/cT2qP6RwvT8zM3M/AACAPwAAgD89Crc/AACAPz0Ktz8fhas/hetRP3E9qj+kcL0/MzNzPwAAgD8AAIA/PQq3PwAAgD89Crc/H4WrP4XrUT9xPao/pHC9PzMzcz8AAIA/AACAPz0Ktz8AAIA/PQq3Px+Fqz+F61E/cT2qP6RwvT8zM3M/AACAPwAAgD89Crc/AACAPz0Ktz8fhas/AACAPwAAgD89Crc/AACAPz0Ktz8fhas/hetRP3E9qj+kcL0/MzNzPwAAgD8AAIA/PQq3PwAAgD89Crc/H4WrP4XrUT9xPao/pHC9PzMzcz8AAIA/AACAPz0Ktz8AAIA/PQq3Px+Fqz+F61E/cT2qP6RwvT8zM3M/AACAPwAAgD89Crc/AACAPz0Ktz8fhas/hetRP3E9qj+kcL0/MzNzPwAAgD8AAIA/PQq3PwAAgD89Crc/H4WrP4XrUT9xPao/pHC9PzMzcz8AAIA/AACAPz0Ktz8AAIA/PQq3Px+Fqz+F61E/cT2qP6RwvT8zM3M/AACAPwAAgD89Crc/AACAPz0Ktz8fhas/hetRP3E9qj+kcL0/MzNzPwAAgD8AAIA/AAAAAAAAAADBD/O9AAAAAFTNZ74AAAAAbs29PQAAAABuzb09AAAAAODs+j0AAAAAfM/xPgAAAAAAAAAAAAAAAAAAAAAAAAAAgtq6vgAAAAByJwK/AAAAALU3I78AAAAAHJeAPgAAAADnfJs+AAAAAILaur4AAAAAcicCvwAAAAC1NyO/AAAAAByXgD4AAAAA53ybPgAAAACC2rq+AAAAAHInAr8AAAAAtTcjvwAAAAAcl4A+AAAAAOd8mz4AAAAAcicCvwAAAAC1NyO/AAAAAByXgD4AAAAA53ybPgAAAAAAAAAAAAAAAHInAr8AAAAAtTcjvwAAAAAcl4A+AAAAAOd8mz4AAAAAgtq6vgAAAAByJwK/AAAAALU3I78AAAAAHJeAPgAAAADnfJs+AAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAACMTw74AAAAA3+qxvgAAAAAAAAAAAAAAAMK4sj0AAAAA7X01PwAAAACjV4g/AAAAAK0YHb4AAAAAUHdWPAAAAAAmRWy+AAAAAPAoPj8AAAAAwriyPQAAAADM6/U8AAAAAAAAAAAAAAAA+n2gvgAAAAD6faC+AAAAAEdG3L4AAAAAL/u9vgAAAABuRh2+AAAAAPp9oL4AAAAA+n2gvgAAAABHRty+AAAAAC/7vb4AAAAAbkYdvgAAAAD6faC+AAAAAPp9oL4AAAAAR0bcvgAAAAAv+72+AAAAAG5GHb4AAAAA+n2gvgAAAABHRty+AAAAAC/7vb4AAAAAbkYdvgAAAAAAAAAAAAAAAPp9oL4AAAAAR0bcvgAAAAAv+72+AAAAAG5GHb4AAAAA+n2gvgAAAAD6faC+AAAAAEdG3L4AAAAAL/u9vgAAAABuRh2+AAAAAAAAAAAAAAAAjarFvQAAAAAqpSw+AAAAAG7NPb4AAAAAtkkXvwAAAACY9Xi/AAAAACBQyr0AAAAAWbRIPgAAAAB25se+AAAAAHXaT78AAAAAeSKgPQAAAADdxIA+AAAAAORMu7wAAAAAmhlhvwAAAADdxIC+AAAAAI2qxb0AAAAAAAAAAAAAAACLhJQ+AAAAAKAeLj8AAAAAJ+R8PwAAAAAo+qM+AAAAADtokL0AAAAAi4SUPgAAAACgHi4/AAAAACfkfD8AAAAAKPqjPgAAAAA7aJC9AAAAAIuElD4AAAAAoB4uPwAAAAAn5Hw/AAAAACj6oz4AAAAAO2iQvQAAAACgHi4/AAAAACfkfD8AAAAAKPqjPgAAAAA7aJC9AAAAAAAAAAAAAAAAoB4uPwAAAAAn5Hw/AAAAACj6oz4AAAAAO2iQvQAAAACLhJQ+AAAAAKAeLj8AAAAAJ+R8PwAAAAAo+qM+AAAAADtokL0AAAAAAAAAAAAAAAAAAIA/AACAPx+FO0AfhTtApHD9P6Rw/T8K10NACtdDQHsU7j97FO4/AACAPwAAgD8fhTtAH4U7QKRw/T+kcP0/CtdDQArXQ0B7FO4/exTuPwAAgD8AAIA/H4U7QB+FO0CkcP0/pHD9PwrXQ0AK10NAexTuP3sU7j8AAIA/AACAPx+FO0AfhTtApHD9P6Rw/T8K10NACtdDQHsU7j97FO4/AACAPwAAgD8fhTtAH4U7QKRw/T+kcP0/CtdDQArXQ0B7FO4/exTuP6Rw/T+kcP0/CtdDQArXQ0B7FO4/exTuPwAAgD8AAIA/H4U7QB+FO0CkcP0/pHD9PwrXQ0AK10NAexTuP3sU7j8AAIA/AACAPx+FO0AfhTtApHD9P6Rw/T8K10NACtdDQHsU7j97FO4/AACAPwAAgD8fhTtAH4U7QKRw/T+kcP0/CtdDQArXQ0B7FO4/exTuPwAAgD8AAIA/H4U7QB+FO0CkcP0/pHD9PwrXQ0AK10NAexTuP3sU7j8AAIA/AACAPwAAAAAAAAAA4ZU6PgAAAACcVbk+AAAAANHcBT4AAAAA4QRrvgAAAABgteK+AAAAAGuFbT4AAAAA4Q6aPQAAAAAXpvC+AAAAAL/1Ob8AAAAA3LgIvgAAAABttU0+AAAAACOO674AAAAAAX+6vgAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAA7XmE+AAAAADteYT4AAAAAAAAAAAAAAAAAAIA/AACAP5qZGT8AAIA/SOGaPwAAgD+amZk/pHA9P/YovD89Cpc/AACAPwAAgD+amRk/AACAP0jhmj8AAIA/mpmZP6RwPT/2KLw/PQqXPwAAgD8AAIA/mpkZPwAAgD9I4Zo/AACAP5qZmT+kcD0/9ii8Pz0Klz8AAIA/AACAP5qZGT8AAIA/SOGaPwAAgD+amZk/pHA9P/YovD89Cpc/AACAPwAAgD+amRk/AACAP0jhmj8AAIA/mpmZP6RwPT/2KLw/PQqXPwAAgD8AAIA/mpkZPwAAgD9I4Zo/AACAP5qZmT+kcD0/9ii8Pz0Klz8AAIA/AACAP5qZGT8AAIA/SOGaPwAAgD+amZk/pHA9P/YovD89Cpc/AACAPwAAgD+amRk/AACAP0jhmj8AAIA/AACAPwAAgD+amRk/AACAP0jhmj8AAIA/mpmZP6RwPT/2KLw/PQqXPwAAgD8AAIA/mpkZPwAAgD9I4Zo/AACAP5qZmT+kcD0/9ii8Pz0Klz8AAIA/AACAP5qZGT8AAIA/SOGaPwAAgD+amZk/pHA9P/YovD89Cpc/AACAPwAAgD+amRk/AACAP0jhmj8AAIA/mpmZP6RwPT/2KLw/PQqXPwAAgD8AAIA/mpkZPwAAgD9I4Zo/AACAP5qZmT+kcD0/9ii8Pz0Klz8AAIA/AACAP5qZGT8AAIA/SOGaPwAAgD+amZk/pHA9P/YovD89Cpc/AACAPwAAgD+amRk/AACAP0jhmj8AAIA/mpmZP6RwPT/2KLw/PQqXPwAAgD8AAIA/t9wvvQAAAADXx3g8AAAAAN5XmT4AAAAASfsTPgAAAADjo3u9AAAAAOOje70AAAAA18d4PAAAAACNL50+AAAAAIUKmz4AAAAA18d4PAAAAAAAAIA/AACAP1yPQj/Xo3A/w/WIP/YoXD8Urkc/UrhePwAAgD8AAIA/XI9CP9ejcD/D9Yg/9ihcPxSuRz9SuF4/AACAPwAAgD9cj0I/16NwP8P1iD/2KFw/FK5HP1K4Xj8AAIA/AACAP1yPQj/Xo3A/w/WIP/YoXD8Urkc/UrhePwAAgD8AAIA/XI9CP9ejcD/D9Yg/9ihcPxSuRz9SuF4/AACAPwAAgD8Urkc/UrhePwAAgD8AAIA/XI9CP9ejcD/D9Yg/9ihcPxSuRz9SuF4/AACAPwAAgD9cj0I/16NwPxSuRz9SuF4/AACAPwAAgD8Urkc/UrhePwAAgD8AAIA/XI9CP9ejcD/D9Yg/9ihcPxSuRz9SuF4/AACAPwAAgD9cj0I/16NwP8P1iD/2KFw/FK5HP1K4Xj8AAIA/AACAP1yPQj/Xo3A/w/WIP/YoXD8Urkc/UrhePwAAgD8AAIA/XI9CP9ejcD/D9Yg/9ihcPxSuRz9SuF4/AACAPwAAgD9cj0I/16NwP8P1iD/2KFw/FK5HP1K4Xj8AAIA/AACAPxSuRz9SuF4/AACAPwAAgD8AAAAAAAAAAOkd9b4AAAAAmqowvwAAAADiIle/AAAAAEhqRL4AAAAAlUgnPgAAAADpHfW+AAAAAJqqML8AAAAA4iJXvwAAAABIakS+AAAAAJVIJz4AAAAA6R31vgAAAACaqjC/AAAAAOIiV78AAAAASGpEvgAAAACVSCc+AAAAAJqqML8AAAAA4iJXvwAAAABIakS+AAAAAJVIJz4AAAAAAAAAAAAAAACaqjC/AAAAAOIiV78AAAAASGpEvgAAAACVSCc+AAAAAOkd9b4AAAAAmqowvwAAAADiIle/AAAAAEhqRL4AAAAAlUgnPgAAAAAAAAAAAAAAAMXokr0AAAAAVmz4PQAAAADAkoG+AAAAAJDgIb8AAAAATtJJvwAAAAAfyam9AAAAAHfyvz0AAAAAFO2mvgAAAAACkS6/AAAAAPA0tj4AAAAAT2kVPwAAAADoily+AAAAAHxaRb8AAAAAxfSKvgAAAADF6JK9AAAAAAAAAAAAAAAAz6wlPgAAAAACElM+AAAAAMb20z4AAAAA7omtPgAAAABKCVU+AAAAAM+sJT4AAAAAAhJTPgAAAADG9tM+AAAAAO6JrT4AAAAASglVPgAAAADPrCU+AAAAAAISUz4AAAAAxvbTPgAAAADuia0+AAAAAEoJVT4AAAAAAhJTPgAAAADG9tM+AAAAAO6JrT4AAAAASglVPgAAAAAAAAAAAAAAAAISUz4AAAAAxvbTPgAAAADuia0+AAAAAEoJVT4AAAAAz6wlPgAAAAACElM+AAAAAMb20z4AAAAA7omtPgAAAABKCVU+AAAAAAAAAAAAAAAAAACAPwAAgD9cj0I/16NwP8P1iD/2KFw/FK5HP1K4Xj8AAIA/AACAP1yPQj/Xo3A/w/WIP/YoXD8Urkc/UrhePwAAgD8AAIA/XI9CP9ejcD/D9Yg/9ihcPxSuRz9SuF4/AACAPwAAgD9cj0I/16NwP8P1iD/2KFw/FK5HP1K4Xj8AAIA/AACAP1yPQj/Xo3A/w/WIP/YoXD8Urkc/UrhePwAAgD8AAIA/FK5HP1K4Xj8AAIA/AACAP1yPQj/Xo3A/w/WIP/YoXD8Urkc/UrhePwAAgD8AAIA/XI9CP9ejcD8Urkc/UrhePwAAgD8AAIA/FK5HP1K4Xj8AAIA/AACAP1yPQj/Xo3A/w/WIP/YoXD8Urkc/UrhePwAAgD8AAIA/XI9CP9ejcD/D9Yg/9ihcPxSuRz9SuF4/AACAPwAAgD9cj0I/16NwP8P1iD/2KFw/FK5HP1K4Xj8AAIA/AACAP1yPQj/Xo3A/w/WIP/YoXD8Urkc/UrhePwAAgD8AAIA/XI9CP9ejcD/D9Yg/9ihcPxSuRz9SuF4/AACAPwAAgD8Urkc/UrhePwAAgD8AAIA/AAAAAAAAAACamY9BFK43wnE9psGuR1vChetzwoXrKUG4HhTC9qiAQmZm5MEzM2PA9ijkwY/CSUGamePBpHBdwM3M4sHD9RBBhevhwfYoLMHNzODB7FGYvx+F38GPwofBexTewcP1nsFcj9zBw/Xewc3M2sFI4ZTBmpnXwZqZIcLXo9bB16O2wR+F1cEfhTLCpHDTwcP1JsKF613BrkehQvYo5MEK1wJDhetdwdfjA0MAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAACvPIW+AAAAAK88hb4AAAAAkgoGvgAAAADk0ZK+AAAAAOTRkr4AAAAAxn10vgAAAACD5rK+AAAAANWhR74AAAAA4Q6avgAAAAAAAAAAAAAAAAAAAAAAAAAAPQq5QcP1P8I9CmdApHAswuxREsLXo7JBexRKwXsUmELNzITAZmYCQQrXg8Bcj8JBmpmBwArXA0HNzHzA9iimQY/CdcDXo3A/zcxswPYoKEFcj2LA7FGowD0KV8BcjwLBSOFKwK5HgcHNzDzAzczcwDMzI8AfheXBH4UbwIXrMcFcjxLAFK4DwoXrAcD2KPDB7FEoQTOzuEIK14PAXI8OQ+xRKEGamQ9DAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAArzyFvgAAAACvPIW+AAAAAJIKBr4AAAAA5NGSvgAAAADk0ZK+AAAAAMZ9dL4AAAAAg+ayvgAAAADVoUe+AAAAAOEOmr4AAAAAAAAAAAAAAACe9Mk+AAAAAI2qRT8AAAAAuOrwvQAAAACbPck+AAAAACH5Cb0AAAAASGRIPwAAAAAnXpE/AAAAABYTWD4AAAAAoBp7PwAAAAC33C8+AAAAALOOYz8AAAAAnvTJPgAAAAAAAAAAAAAAAD0KuUHD9T/CPQpnQKRwLMLsURLC16OyQXsUSsF7FJhCzcyEwGZmAkEK14PAXI/CQZqZgcAK1wNBzcx8wPYopkGPwnXA16NwP83MbMD2KChBXI9iwOxRqMA9ClfAXI8CwUjhSsCuR4HBzcw8wM3M3MAzMyPAH4XlwR+FG8CF6zHBXI8SwBSuA8KF6wHA9ijwwexRKEEzs7hCCteDwFyPDkPsUShBmpkPQwAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAK88hb4AAAAArzyFvgAAAACSCga+AAAAAOTRkr4AAAAA5NGSvgAAAADGfXS+AAAAAIPmsr4AAAAA1aFHvgAAAADhDpq+AAAAAAAAAAAAAAAAAAAAAAAAAAA9Co/BexR+QAAAAAAAAAAAvlhyPQAAAAAAAAAAAAAAAD0KuUHD9T/CPQpnQKRwLMLsURLC16OyQXsUSsF7FJhCzcyEwGZmAkEK14PAXI/CQZqZgcAK1wNBzcx8wPYopkGPwnXA16NwP83MbMD2KChBXI9iwOxRqMA9ClfAXI8CwUjhSsCuR4HBzcw8wM3M3MAzMyPAH4XlwR+FG8CF6zHBXI8SwBSuA8KF6wHA9ijwwexRKEEzs7hCCteDwFyPDkPsUShBmpkPQwAAAAAAAAAAAAAAAAAAAAAdHqG+AAAAAK88hb4AAAAArzyFvgAAAACSCga+AAAAAOTRkr4AAAAA5NGSvgAAAADGfXS+AAAAAIPmsr4AAAAA1aFHvgAAAADhDpq+AAAAAAAAAAAAAAAAexQuvoXrsb95IqA9AAAAAN/qsb4AAAAAz6L2PQAAAAAt5wA/AAAAAFkzJD8AAAAA8k5vvgAAAACEecu+AAAAAHIL3z4AAAAAFx9QPwAAAABvXo2+AAAAAE1H9r4AAAAA328JvgAAAAAi9VY/AAAAAILOwj0AAAAAeSKgPQAAAAAAAAAAAAAAABlReT4AAAAAURbnPgAAAADcMzE/AAAAAC7jTbwAAAAATL6MvgAAAAAZUXk+AAAAAFEW5z4AAAAA3DMxPwAAAAAu4028AAAAAEy+jL4AAAAAGVF5PgAAAABRFuc+AAAAANwzMT8AAAAALuNNvAAAAABMvoy+AAAAAFEW5z4AAAAA3DMxPwAAAAAu4028AAAAAEy+jL4AAAAAAAAAAAAAAABRFuc+AAAAANwzMT8AAAAALuNNvAAAAABMvoy+AAAAABlReT4AAAAAURbnPgAAAADcMzE/AAAAAC7jTbwAAAAATL6MvgAAAAAAAAAAAAAAAB+Faz9mZma/V44XvQAAAADCuLI9AAAAAOVkK74AAAAAzPftvgAAAAC1M/A8AAAAAF38GL4AAAAAtbjHPgAAAAA1dbe+AAAAAMK4sj0AAAAAAAAAAAAAAACbtii/AAAAAFGMyL8AAAAAVM3nvwAAAACfCby/AAAAAB0abr8AAAAAm7YovwAAAABRjMi/AAAAAFTN578AAAAAnwm8vwAAAAAdGm6/AAAAAJu2KL8AAAAAUYzIvwAAAABUzee/AAAAAJ8JvL8AAAAAHRpuvwAAAABRjMi/AAAAAFTN578AAAAAnwm8vwAAAAAdGm6/AAAAADX6jiUAAAAAUYzIvwAAAABUzee/AAAAAJ8JvL8AAAAAHRpuvwAAAACbtii/AAAAAFGMyL8AAAAAVM3nvwAAAACfCby/AAAAAB0abr8AAAAANfqOJQAAAAAAAAAAAAAAAORMu74AAAAAAAAAAAAAAAAAAAAAAAAAAOM0S74AAAAAV46XPAAAAAAjE8M+AAAAAHxgQT8AAAAA10xQPwAAAADjNEu+AAAAAFeOlzwAAAAAIxPDPgAAAAB8YEE/AAAAANdMUD8AAAAA4zRLvgAAAABXjpc8AAAAACMTwz4AAAAAfGBBPwAAAADXTFA/AAAAAFeOlzwAAAAAIxPDPgAAAAB8YEE/AAAAANdMUD8AAAAAAAAAAAAAAABXjpc8AAAAACMTwz4AAAAAfGBBPwAAAADXTFA/AAAAAOM0S74AAAAAV46XPAAAAAAjE8M+AAAAAHxgQT8AAAAA10xQPwAAAAAAAAAAAAAAAAAAAAAAAAAAO2iQPgAAAABrj5w9AAAAANDEFb8AAAAAAhCKvwAAAACnoGy/AAAAADtokD4AAAAAa4+cPQAAAADQxBW/AAAAAAIQir8AAAAAp6BsvwAAAAA7aJA+AAAAAGuPnD0AAAAA0MQVvwAAAAACEIq/AAAAAKegbL8AAAAAa4+cPQAAAADQxBW/AAAAAAIQir8AAAAAp6BsvwAAAAAAAAAAAAAAAGuPnD0AAAAA0MQVvwAAAAACEIq/AAAAAKegbL8AAAAAO2iQPgAAAABrj5w9AAAAANDEFb8AAAAAAhCKvwAAAACnoGy/AAAAAAAAAAAAAAAAeSKgPQAAAAAOdXa+AAAAAFghsD4AAAAAKyxNPwAAAAAG4UM/AAAAALQlL70AAAAAYtlKvgAAAACWz0c/AAAAAHXhgD8AAAAArIfNvgAAAADg/CW/AAAAAPPt/7wAAAAArjOLPwAAAAD/WtI+AAAAAHkioD0AAAAAAAAAAAAAAADhlbq+AAAAAAZaoz0AAAAA3TV6PwAAAADHkJ0/AAAAAOigAz8AAAAA4ZW6vgAAAAAGWqM9AAAAAN01ej8AAAAAx5CdPwAAAADooAM/AAAAAOGVur4AAAAABlqjPQAAAADdNXo/AAAAAMeQnT8AAAAA6KADPwAAAAAGWqM9AAAAAN01ej8AAAAAx5CdPwAAAADooAM/AAAAAAAAAAAAAAAABlqjPQAAAADdNXo/AAAAAMeQnT8AAAAA6KADPwAAAADhlbq+AAAAAAZaoz0AAAAA3TV6PwAAAADHkJ0/AAAAAOigAz8AAAAAAAAAAAAAAAAAAAAAAAAAAITyqr4AAAAA7fjdvgAAAAA3j/C9AAAAAPpz8T4AAAAAxn30PgAAAACiMmu+AAAAAF2Dub0AAAAAVNeWPgAAAAAF04I9AAAAABUFl74AAAAAJ20HvwAAAAAYvBc+AAAAACdnCz4AAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAO15hPgAAAAA7XmE+AAAAAAAAAAAAAAAAAACAPwAAgD9SuL4/AACAPx+Faz+PwrU/pHC9Px+Faz8K14M/heuRPwAAgD8AAIA/Uri+PwAAgD8fhWs/j8K1P6RwvT8fhWs/CteDP4XrkT8AAIA/AACAP1K4vj8AAIA/H4VrP4/CtT+kcL0/H4VrPwrXgz+F65E/AACAPwAAgD9SuL4/AACAPx+Faz+PwrU/pHC9Px+Faz8K14M/heuRPwAAgD8AAIA/Uri+PwAAgD8fhWs/j8K1P6RwvT8fhWs/CteDP4XrkT8AAIA/AACAP1K4vj8AAIA/H4VrP4/CtT+kcL0/H4VrPwrXgz+F65E/AACAPwAAgD9SuL4/AACAPx+Faz+PwrU/pHC9Px+Faz8K14M/heuRPwAAgD8AAIA/Uri+PwAAgD8fhWs/j8K1PwAAgD8AAIA/Uri+PwAAgD8fhWs/j8K1P6RwvT8fhWs/CteDP4XrkT8AAIA/AACAP1K4vj8AAIA/H4VrP4/CtT+kcL0/H4VrPwrXgz+F65E/AACAPwAAgD9SuL4/AACAPx+Faz+PwrU/pHC9Px+Faz8K14M/heuRPwAAgD8AAIA/Uri+PwAAgD8fhWs/j8K1P6RwvT8fhWs/CteDP4XrkT8AAIA/AACAP1K4vj8AAIA/H4VrP4/CtT+kcL0/H4VrPwrXgz+F65E/AACAPwAAgD9SuL4/AACAPx+Faz+PwrU/pHC9Px+Faz8K14M/heuRPwAAgD8AAIA/Uri+PwAAgD8fhWs/j8K1P6RwvT8fhWs/CteDP4XrkT8AAIA/AACAPwAAAAAAAAAAAAAAAAAAAAAAAAAAexQmQQAAAAAAAAAAAAAAAHsUJkEAAAAAAAAAAAAAAAAAAAAAAAAAAHsUJkEAAAAAAAAAAAAAgD8AAIA/AACAPwAAgD/2KJw/9iicPwAAgD8AAIA/9iicP/YonD8AAIA/AACAPwAAgD8AAIA/9iicP/YonD8AAIA/AACAPwAAAAAAAAAAAAAAAAAAAAAAAAAAcT0CQgAAAAAAAAAAAAAAAHE9AkIAAAAAAAAAAAAAAAAAAAAAAAAAAHE9AkIAAAAAAAAAAAAAAAAAAAAAAAAAAHE9AkIAAAAAAAAAAAAAAABxPQJCAAAAAAAAAAAAAIA/AACAPwAAgD8AAIA/9ii8P/YovD8AAIA/AACAP/YovD/2KLw/AACAPwAAgD8AAIA/AACAP/YovD/2KLw/AACAPwAAgD8AAIA/AACAP/YovD/2KLw/AACAPwAAgD/2KLw/9ii8PwAAgD8AAIA/AAAAAAAAAAAAAAAAAAAAAAAAAAAAAOxBAAAAAAAAAAAAAAAAAAAAAAAAAAAAAOxBAAAAAAAAAAAzM4PASOG2QkjhesDsUcRC7FEIwClcjEIAAAAAAADsQQAAgD8AAIA/AACAPwAAgD8AAIA/mplZPwAAgD8AAIA/AACAPwAAgD8AAIA/mplZPwAAgD8AAIA/AACAPwAAgD8AAIA/mplZPwAAAAAAAAAAAAAAAOH6kUIAAAAAAAAAAAAAAADh+pFCAAAAAAAAAAAAAAAA4fqRQgAAAAAAAAAAAAAAAOH6kUIAAAAAAAAAAAAAAAAAAAAAAAAAAOH6kUIAAAAAAAAAAAAAAADh+pFCrkdBwLgef0IK10PAw/XVQsP16L9xvd5CAAAAAAAAAAAAAIA/AACAP8P1qD8AAIA/AACAPwAAgD/D9ag/AACAPwAAgD8AAIA/w/WoPwAAgD8AAIA/AACAP8P1qD8AAIA/AACAPwAAgD8AAIA/AACAP8P1qD8AAIA/AACAPwAAgD/D9ag/AACAPwAAgD8AAIA/AACAPwAAgD/D9ag/AACAPwAAgD8AAIA/AAAAAAAAAAB7tOnDmtkJwwCgxcOkcD3B4drcw4/CycH1FRvAAAAAADYMA8AAAAAAAACAPwAAgD8AAIA/AACAP8P16D/D9eg/mpk5QJqZOUAAAAAAAAAAADOzlUKuRwVBM7OVQq5HBUH26DBDrkcFQQAAAAAAAAAAlUinvAAAAAAAAIA/AACAP6RwHUCuR4E/w/VYQEjhOj9mZnZAPQrXPgAAgD8AAIA/H4U7QB+FO0CkcP0/pHD9PwrXQ0AK10NAexTuP3sU7j8AAIA/AACAPx+FO0AfhTtApHD9P6Rw/T8K10NACtdDQHsU7j97FO4/AACAPwAAgD8fhTtAH4U7QKRw/T+kcP0/CtdDQArXQ0B7FO4/exTuPwAAgD8AAIA/H4U7QB+FO0CkcP0/pHD9PwrXQ0AK10NAexTuP3sU7j8AAIA/AACAPwAAAAAAAAAA2n75PQAAAADqQd29AAAAAHDzbj4AAAAAUqc2vgAAAADmcKM+AAAAAMIxEj4AAAAAAAAAAAAAAADafvk9AAAAAOpB3b0AAAAAcPNuPgAAAABSpza+AAAAAOZwoz4AAAAAwjESPgAAAABw824+AAAAAFKnNr4AAAAA5nCjPgAAAAAAAAAAAAAAAAAAAAAAAAAASOG8wXsU3sAAAAAAAAAAAAAAgD8AAIA/XI9CP9ejcD/D9Yg/9ihcPxSuRz9SuF4/AACAPwAAgD9cj0I/16NwP8P1iD/2KFw/FK5HP1K4Xj8AAIA/AACAP1yPQj/Xo3A/w/WIP/YoXD8Urkc/UrhePwAAgD8AAIA/XI9CP9ejcD/D9Yg/9ihcPxSuRz9SuF4/AACAPwAAgD9cj0I/16NwP8P1iD/2KFw/FK5HP1K4Xj8AAIA/AACAPxSuRz9SuF4/AACAPwAAgD8AAAAAAAAAAP5C4j0AAAAAuQJhvgAAAAB5EnW/AAAAACzPEL8AAAAAAAAAAAAAAAAAAAAAAAAAAHE9LEK4HiFCAAAAAAAAAAAAAIA/AACAP3E9ij9xPYo/AACAPwAAgD+ZDWk9AAAAAMK4MiUAAAAAcpL/PQAAAACZDWk9AAAAAGHB2jwAAAAAwriyowAAAAC1M3A9AAAAAGHB2jwAAAAArkdhPwAAgD8AAAAAAAAAAOXdCr8AAAAA5d0KvwAAAADpJyS/AAAAAFI4Br4AAAAAOLEPPgAAAAAAAAAAAAAAABYTWL4AAAAAu6HxvQAAAAAYyI++AAAAABYTWL4AAAAAAAAAAAAAAAAPi50+AAAAAHVTLz8AAAAAR0xYPwAAAADf3rk9AAAAAJZW6L0AAAAAAAAAAAAAAADyWJ69AAAAADX6DiUAAAAAs4YevgAAAADyWJ69AAAAALUz8LsAAAAAcgtfPQAAAAC1M/C7AAAAAMK4sj0AAAAAAAAAAAAAAADCuDI+AAAAAMK4sj0AAAAAAAAAAAAAAADXo3DBuB7FwNejCsI9CmPBAAAAAAAAAADXo3DBuB7FwNejCsI9CmPBAAAAAAAAAADXo3DBuB7FwNejCsI9CmPBAAAAAAAAAADXo3DBuB7FwNejCsI9CmPBAAAAAAAAAADXo3DBuB7FwNejCsI9CmPBAAAAAAAAAADXo3DBuB7FwNejCsI9CmPBmpm5v+xROL/Xo3DBuB7FwNejCsI9CmPBAAAAAAAAAAAAAIA/AACAP+xRuD8AAIA/MzOzPwAAgD8AAIA/AACAP+xRuD8AAIA/MzOzPwAAgD8AAIA/AACAP+xRuD8AAIA/MzOzPwAAgD8AAIA/AACAP+xRuD8AAIA/MzOzPwAAgD8AAIA/AACAP+xRuD8AAIA/MzOzPwAAgD8AAIA/AACAP+xRuD8AAIA/MzOzPwAAgD8AAIA/AACAP+xRuD8AAIA/MzOzPwAAgD8AAIA/AACAPwAAAAAAAAAAGld1PwAAAACnH8g/AAAAAFCA0D8AAAAAODWyPwAAAACMHak/AAAAAAAAAAAAAAAAAACAPwAAgD89Crc/AACAPz0Ktz8fhas/hetRP3E9qj+kcL0/MzNzPwAAgD8AAIA/PQq3PwAAgD89Crc/H4WrP4XrUT9xPao/pHC9PzMzcz8AAIA/AACAPz0Ktz8AAIA/PQq3Px+Fqz+F61E/cT2qP6RwvT8zM3M/AACAPwAAgD89Crc/AACAPz0Ktz8fhas/hetRP3E9qj+kcL0/MzNzPwAAgD8AAIA/PQq3PwAAgD89Crc/H4WrP4XrUT9xPao/pHC9PzMzcz8AAIA/AACAPz0Ktz8AAIA/PQq3Px+Fqz+F61E/cT2qP6RwvT8zM3M/AACAPwAAgD9FInS+AAAAAFXl170AAAAARSJ0vgAAAAAAAAAAAAAAAILaur4AAAAAcicCvwAAAAC1NyO/AAAAAByXgD4AAAAA53ybPgAAAAAAAAAAAAAAAMK4sj0AAAAAAAAAAAAAAADCuDI+AAAAAMK4sj0AAAAAzOv1PAAAAADCuLIjAAAAAICeYj0AAAAAzOv1PAAAAAAAAAAAAAAAAPp9oL4AAAAA+n2gvgAAAABHRty+AAAAAC/7vb4AAAAAbkYdvgAAAAAAAAAAAAAAAI2qxb0AAAAANfqOIwAAAADZ91i+AAAAAI2qxb0AAAAAAAAAAAAAAACLhJQ+AAAAAKAeLj8AAAAAJ+R8PwAAAAAo+qM+AAAAADtokL0AAAAAAAAAAAAAAAAAAIA/AACAPx+FO0AfhTtApHD9P6Rw/T8K10NACtdDQHsU7j97FO4/AACAPwAAgD8fhTtAH4U7QKRw/T+kcP0/CtdDQArXQ0B7FO4/exTuPwAAgD8AAIA/H4U7QB+FO0CkcP0/pHD9PwrXQ0AK10NAexTuP3sU7j8AAIA/AACAPx+FO0AfhTtApHD9P6Rw/T8K10NACtdDQHsU7j97FO4/AACAPwAAgD8AAAAAAAAAAMb2Uz4AAAAAAAAAAAAAAAAAAIA/AACAP5qZGT8AAIA/SOGaPwAAgD+amZk/pHA9P/YovD89Cpc/AACAPwAAgD+amRk/AACAP0jhmj8AAIA/mpmZP6RwPT/2KLw/PQqXPwAAgD8AAIA/mpkZPwAAgD9I4Zo/AACAP5qZmT+kcD0/9ii8Pz0Klz8AAIA/AACAP5qZGT8AAIA/SOGaPwAAgD+amZk/pHA9P/YovD89Cpc/AACAPwAAgD+amRk/AACAP0jhmj8AAIA/mpmZP6RwPT/2KLw/PQqXPwAAgD8AAIA/mpkZPwAAgD9I4Zo/AACAP5qZmT+kcD0/9ii8Pz0Klz8AAIA/AACAP7fcL70AAAAAfNkgJQAAAAA4OLC9AAAAALfcL70AAAAA18d4PAAAAACIw+Q8AAAAAMK4sqQAAAAA18d4PAAAAAAAAIA/AACAP1yPQj/Xo3A/w/WIP/YoXD8Urkc/UrhePwAAgD8AAIA/XI9CP9ejcD/D9Yg/9ihcPxSuRz9SuF4/AACAPwAAgD9cj0I/16NwP8P1iD/2KFw/FK5HP1K4Xj8AAIA/AACAP1yPQj/Xo3A/w/WIP/YoXD8Urkc/UrhePwAAgD8AAIA/XI9CP9ejcD/D9Yg/9ihcPxSuRz9SuF4/AACAPwAAgD8Urkc/UrhePwAAgD8AAIA/AAAAAAAAAADpHfW+AAAAAJqqML8AAAAA4iJXvwAAAABIakS+AAAAAJVIJz4AAAAAAAAAAAAAAADF6JK9AAAAAJIKhiUAAAAAvmIhvgAAAADF6JK9AAAAAAAAAAAAAAAAz6wlPgAAAAACElM+AAAAAMb20z4AAAAA7omtPgAAAABKCVU+AAAAAAAAAAAAAAAAAAAAAAAAAAApXL/AUrioQQAAAAAAAAAAAAAAAAAAAAAG4cM8AAAAAAAAAAAAAAAAAAAAAAAAAACF60FB4XrsQAAAAADsUZJBzcxMQOF69EAAAAAAAAAAAAAAAAAAAAAAODgwvgAAAAA4ODC+AAAAAEyyFL4AAAAAAAAAAAAAAACe9Mk+AAAAAJ+FGb4AAAAAagKAPwAAAACe9Mk+AAAAAAAAAAAAAAAArkctQR+FB0GuR5HA16OwQdejkD+F6xVBAAAAAAAAAAAAAAAAAAAAADg4ML4AAAAAODgwvgAAAABMshS+AAAAAAAAAAAAAAAAj8IhwQAAAACkcHHBAAAAAI/CIcEAAAAAAACAPwAAgD8AAIA/w/WoPwAAgD8AAIA/vlhyPQAAAABjgoolAAAAAD+08j0AAAAAvlhyPQAAAAAAAAAAAAAAAIXrQUHheuxAAAAAAOxRkkHNzExA4Xr0QAAAAAAAAAAAAAAAAAAAAAA02O+9AAAAAKegbL0AAAAATLIUvgAAAAAAAAAAAAAAAHkioD0AAAAAUHdWJQAAAAA2gS8+AAAAAHkioD0AAAAAAAAAAAAAAAAZUXk+AAAAAFEW5z4AAAAA3DMxPwAAAAAu4028AAAAAEy+jL4AAAAAAAAAAAAAAAAfhWs/ZmZmvwAAAAAAAAAAH4XrPxSu578fhWs/ZmZmv1eOF70AAAAAwriyJAAAAADY6Ze9AAAAAFeOF70AAAAAwriyPQAAAAAAAAAAAAAAAMK4Mj4AAAAAwriyPQAAAAAAAAAAAAAAAJu2KL8AAAAAUYzIvwAAAABUzee/AAAAAJ8JvL8AAAAAHRpuvwAAAAA1+o4lAAAAAAAAAAAAAAAAVnYnPgAAAAAAAAAAAAAAAAAAAAAAAAAA4zRLvgAAAABXjpc8AAAAACMTwz4AAAAAfGBBPwAAAADXTFA/AAAAAAAAAAAAAAAAAAAAAAAAAAA7aJA+AAAAAGuPnD0AAAAA0MQVvwAAAAACEIq/AAAAAKegbL8AAAAAAAAAAAAAAAB5IqA9AAAAAFB3ViUAAAAANoEvPgAAAAB5IqA9AAAAAAAAAAAAAAAA4ZW6vgAAAAAGWqM9AAAAAN01ej8AAAAAx5CdPwAAAADooAM/AAAAAAAAAAAAAAAAAAAAAAAAAAAyQw6+AAAAAAAAAAAAAAAAAACAPwAAgD9SuL4/AACAPx+Faz+PwrU/pHC9Px+Faz8K14M/heuRPwAAgD8AAIA/Uri+PwAAgD8fhWs/j8K1P6RwvT8fhWs/CteDP4XrkT8AAIA/AACAP1K4vj8AAIA/H4VrP4/CtT+kcL0/H4VrPwrXgz+F65E/AACAPwAAgD9SuL4/AACAPx+Faz+PwrU/pHC9Px+Faz8K14M/heuRPwAAgD8AAIA/Uri+PwAAgD8fhWs/j8K1P6RwvT8fhWs/CteDP4XrkT8AAIA/AACAP1K4vj8AAIA/H4VrP4/CtT+kcL0/H4VrPwrXgz+F65E/AACAPwAAgD8AAAAAAAAAAAAAAAAAAAAAAAAAAHsUJkEAAIA/AACAPwAAgD8AAIA/9iicP/YonD8AAAAAAAAAAAAAAAAAAAAAAAAAAHE9AkIAAAAAAAAAAAAAAABxPQJCAACAPwAAgD8AAIA/AACAP/YovD/2KLw/AACAPwAAgD/2KLw/9ii8PwAAAAAAAAAAAAAAAAAAAAAAAAAAAADsQQAAAAAAAAAAAAAAAAAA7EEAAIA/AACAPwAAgD8AAIA/AACAP5qZWT8AAIA/AACAPwAAgD+amVk/AAAAAAAAAAAAAAAA4fqRQgAAAAAAAAAAAAAAAOH6kUIAAAAAAAAAAAAAAADh+pFCAACAPwAAgD/D9ag/AACAPwAAgD8AAIA/w/WoPwAAgD8AAIA/AACAP8P1qD8AAIA/XI+TQuxR3kF7FJ1CMzMGQuzRhUJcjw9C7FGdQqRwA0Kux5RC16PwQR8FmkKF6zFCAICQQj0K4UG4HptCw/XkQUjhgkIK19lBpHCNQmZm/EEAgIZCKVwGQq5HkUJcjxZCexSdQjMzBkLs0YVCXI8PQuxRnUKkcANCrseUQtej8EEfBZpChesxQgCAkEI9CuFBuB6bQsP15EFI4YJCCtfZQaRwjUJmZvxBAICGQilcBkKuR5FCXI8WQnsUnUIzMwZC7NGFQlyPD0LsUZ1CpHADQq7HlELXo/BBHwWaQoXrMUIAgJBCPQrhQbgem0LD9eRBSOGCQgrX2UGkcI1CZmb8QQCAhkIpXAZCrkeRQlyPFkJcj5NC7FHeQc3M80JmZllCZmboQbgeF0IAAAAAAAAAAHsU7j97FO4/exTuP3sU7j/sUbg/7FG4PwAAgD8AAIA/H4WRwQAA8EGuRznBUriYQQAAAAAAAAAANNjvPQAAAADboJg9AAAAAHzZIKUAAAAAKdybQlyPzkEp3JtCXI/OQSlcpULXo/xBuB6OQhSuB0K4Ho5CFK4HQpqZpUK4HvdBexSdQkjh4EHsUaJCAAAqQuxRokIAACpCrseYQq5H0UGux5hCrkfRQYVro0IzM9VBFC6LQgAAykFxvZVC16PsQa7HjkLD9fxBe5SZQhSuDkJ7lJlCFK4OQilcpULXo/xBKVylQtej/EG4Ho5CFK4HQpqZpUK4HvdBexSdQkjh4EF7FJ1CSOHgQexRokIAACpC7FGiQgAAKkKux5hCrkfRQYVro0IzM9VBFC6LQgAAykFxvZVC16PsQa7HjkLD9fxBrseOQsP1/EF7lJlCFK4OQilcpULXo/xBuB6OQhSuB0K4Ho5CFK4HQpqZpUK4HvdBexSdQkjh4EHsUaJCAAAqQuxRokIAACpCrseYQq5H0UGux5hCrkfRQYVro0IzM9VBFC6LQgAAykFxvZVC16PsQXG9lULXo+xBrseOQsP1/EGux45Cw/X8QXuUmUIUrg5CKdybQlyPzkEK1yhDUjiJQrgecUJ7FDZCAAAAAAAAAAAvjA2+AAAAAC+MDb4AAAAA3TV6pQAAAAAUrkc/UrheP1yPQj/Xo3A/w/WIP/YoXD/D9Yg/9ihcPxSuRz9SuF4/FK5HP1K4Xj8AAIA/AACAPwAAgD8AAIA/XI9CP9ejcD9cj0I/16NwP8P1iD/2KFw/w/WIP/YoXD8Urkc/UrhePxSuRz9SuF4/AACAPwAAgD8AAIA/AACAP1yPQj/Xo3A/XI9CP9ejcD/D9Yg/9ihcP8P1iD/2KFw/FK5HP1K4Xj8Urkc/UrheP1yPQj/Xo3A/XI9CP9ejcD/D9Yg/9ihcP8P1iD/2KFw/FK5HP1K4Xj8Urkc/UrhePwAAgD8AAIA/AACAPwAAgD9cj0I/16NwP1yPQj/Xo3A/w/WIP/YoXD/D9Yg/9ihcPxSuRz9SuF4/FK5HP1K4Xj8AAIA/AACAPwAAgD8AAIA/XI9CP9ejcD9cj0I/16NwP8P1iD/2KFw/w/WIP/YoXD8Urkc/UrhePxSuRz9SuF4/w/WIP/YoXD/D9Yg/9ihcP1yPQj/Xo3A/XI9CP9ejcD8Urkc/UrhePxSuRz9SuF4/ZmbmP3sUbj8AAIA/AACAPwAAAAAAAAAA/kLiPQAAAAC5AmG+AAAAAHkSdb8AAAAALM8QvwAAAAAAAAAAAAAAAP2tAD0AAAAA/kLiPQAAAAC5AmG+AAAAAHkSdb8AAAAALM8QvwAAAAAAAAAAAAAAAHtUb0MUrmNCAIB/QwrXfEIAAAAAAAAAAIE9c74AAAAAu6FxvgAAAAA1+o6lAAAAAJkNaT0AAAAAYcHaPAAAAAAAAAAAAAAAAOXdCr8AAAAA5d0KvwAAAADpJyS/AAAAAFI4Br4AAAAAOLEPPgAAAAAAAAAAAAAAAP2tAL0AAAAA5d0KvwAAAADl3Qq/AAAAAOknJL8AAAAAUjgGvgAAAAA4sQ8+AAAAAAAAAAAAAAAA16MUwYXrkT/XoxTBheuRP+xR2MDhepS/7FHYwOF6lL/D9eDACtejPsP14MAK16M+16MMwaRwvb6uR/nA16Owv9ejFMGF65E/rkfJQD0K50AAAAAAAAAAAOvI/T0AAAAAj9qlPQAAAACwVj4+AAAAALZVjz4AAAAA7fjdPgAAAAB85Zg+AAAAAOEOmj4AAAAAkxjHPgAAAAC2VY8+AAAAAELugT4AAAAAeRhxPgAAAADOG1Y+AAAAALBWPj4AAAAAvLlhPgAAAABV444+AAAAAOB9Sj4AAAAAj9qlPQAAAABXjhc+AAAAAA8GRj4AAAAAQMxiPgAAAADryP09AAAAAD8t0j0AAAAA4QRrPgAAAADKxUQ+AAAAAJolWT4AAAAAJB87PgAAAADryP09AAAAAHtSgL0AAAAARJvTvQAAAAAAAAAAAAAAAA+LnT4AAAAAdVMvPwAAAABHTFg/AAAAAN/euT0AAAAAllbovQAAAAAAAAAAAAAAAP2tAD0AAAAAD4udPgAAAAB1Uy8/AAAAAEdMWD8AAAAA3965PQAAAACWVui9AAAAAAAAAAAAAAAAmQsgPwAAAAAEuxI/AAAAADaHKz8AAAAA76EdPwAAAADhlTo/AAAAAJkLID8AAAAABLsSPwAAAAA2hys/AAAAAO+hHT8AAAAA4ZU6PwAAAACZCyA/AAAAAAS7Ej8AAAAANocrPwAAAADvoR0/AAAAAOGVOj8AAAAAmQsgPwAAAAAEuxI/AAAAADaHKz8AAAAA76EdPwAAAADhlTo/AAAAAJkLID8AAAAABLsSPwAAAAA2hys/AAAAAO+hHT8AAAAA4ZU6PwAAAADQPz4/AAAAAJkLID8AAAAA0LrmvgAAAADyWJ69AAAAAMK4sj0AAAAA9h1gvgAAAAC5DBA+AAAAAIlaMD8AAAAA0MbePgAAAADCuLI9AAAAAPYdYL4AAAAAuQwQPgAAAACJWjA/AAAAANDG3j4AAAAAwriyPQAAAAAAAAAAAAAAABpXdT8AAAAApx/IPwAAAABQgNA/AAAAADg1sj8AAAAAjB2pPwAAAAAAAAAAAAAAAP2tAD0AAAAAGld1PwAAAACnH8g/AAAAAFCA0D8AAAAAODWyPwAAAACMHak/AAAAAAAAAAAAAAAA83AOPgAAAADzcA4+AAAAADX6jiMAAAAAAACAPwAAgD89Crc/AACAPz0Ktz8fhas/hetRP3E9qj+kcL0/MzNzPwAAgD8AAIA/PQq3PwAAgD89Crc/H4WrP4XrUT9xPao/pHC9PzMzcz8AAIA/AACAPz0Ktz8AAIA/PQq3Px+Fqz+F61E/cT2qP6RwvT8zM3M/AACAPwAAgD89Crc/AACAPz0Ktz8fhas/hetRP3E9qj+kcL0/MzNzPwAAgD8AAIA/PQq3PwAAgD89Crc/H4WrP4XrUT9xPao/pHC9PzMzcz8AAIA/AACAPz0Ktz8AAIA/PQq3Px+Fqz+F61E/cT2qP6RwvT8zM3M/AACAPwAAgD89Crc/H4WrP4XrUT9xPao/pHC9PzMzcz8AAIA/AACAPz0Ktz8AAIA/PQq3Px+Fqz+F61E/cT2qPz0Ktz8AAIA/PQq3Px+Fqz8AAIA/AACAPwAAAAAAAAAAuhrRPQAAAAAAAAAAAAAAAAAAAAAAAAAAgtq6vgAAAAByJwK/AAAAALU3I78AAAAAHJeAPgAAAADnfJs+AAAAAAAAAAAAAAAA/a0AvQAAAACC2rq+AAAAAHInAr8AAAAAtTcjvwAAAAAcl4A+AAAAAOd8mz4AAAAAAAAAAAAAAADCuLI9AAAAAB44Wr4AAAAAWJxYvQAAAAB2ax8/AAAAALdnAz8AAAAAwriyPQAAAAAeOFq+AAAAAFicWL0AAAAAdmsfPwAAAAC3ZwM/AAAAAMK4sj0AAAAAzOv1PAAAAAAAAAAAAAAAAPp9oL4AAAAA+n2gvgAAAABHRty+AAAAAC/7vb4AAAAAbkYdvgAAAAAAAAAAAAAAAP2tAL0AAAAA+n2gvgAAAAD6faC+AAAAAEdG3L4AAAAAL/u9vgAAAABuRh2+AAAAAAAAAAAAAAAAjarFvQAAAAC7oXE+AAAAANn3WL4AAAAAM1FPvQAAAADafvk9AAAAAI2qxb0AAAAAAAAAAAAAAACLhJQ+AAAAAKAeLj8AAAAAJ+R8PwAAAAAo+qM+AAAAADtokL0AAAAAAAAAAAAAAAD9rQA9AAAAAIuElD4AAAAAoB4uPwAAAAAn5Hw/AAAAACj6oz4AAAAAO2iQvQAAAAAAAAAAAAAAAOF6SEGF60HA4XpIQYXrQcAK15dB7FE4P3E9DkFmZt5ASOGWQY/C9TxI4ZZBj8L1PHE9XkEfhYu/cT1eQR+Fi7/NzKpBCtc3QTMzM0EfhQvAMzMzQR+FC8BI4YJBCtdjwEjhgkEK12PA7FGQQMP1KL8pXC9BZmbGP1yPBkGkcJVAXI8GQaRwlUB7FG5BMzPTQHsUbkEzM9NACteXQexROD8K15dB7FE4P3E9DkFmZt5ASOGWQY/C9TxxPV5BH4WLv83MqkEK1zdBMzMzQR+FC8AzMzNBH4ULwEjhgkEK12PA7FGQQMP1KL8pXC9BZmbGPylcL0FmZsY/XI8GQaRwlUB7FG5BMzPTQArXl0HsUTg/cT0OQWZm3kBI4ZZBj8L1PHE9XkEfhYu/cT1eQR+Fi7/NzKpBCtc3Qc3MqkEK1zdBMzMzQR+FC8AzMzNBH4ULwEjhgkEK12PA7FGQQMP1KL8pXC9BZmbGPylcL0FmZsY/XI8GQaRwlUBcjwZBpHCVQHsUbkEzM9NA4XpIQYXrQcAzs55CZmb+QI/CscEpXGdBAAAAAAAAAADOJQW/AAAAAM4lBb8AAAAAW1PZvgAAAABQd1YlAAAAAAAAgD8AAIA/AACAPwAAgD8fhTtAH4U7QB+FO0AfhTtApHD9P6Rw/T+kcP0/pHD9PwrXQ0AK10NACtdDQArXQ0B7FO4/exTuP3sU7j97FO4/AACAPwAAgD8AAIA/AACAPx+FO0AfhTtAH4U7QB+FO0CkcP0/pHD9P6Rw/T+kcP0/CtdDQArXQ0AK10NACtdDQHsU7j97FO4/exTuP3sU7j8AAIA/AACAPwAAgD8AAIA/H4U7QB+FO0AfhTtAH4U7QKRw/T+kcP0/pHD9P6Rw/T8K10NACtdDQArXQ0AK10NAexTuP3sU7j8AAIA/AACAPx+FO0AfhTtAH4U7QB+FO0CkcP0/pHD9P6Rw/T+kcP0/CtdDQArXQ0AK10NACtdDQHsU7j97FO4/exTuP3sU7j8AAIA/AACAPwAAgD8AAIA/exTuP3sU7j97FO4/exTuPwrXQ0AK10NACtdDQArXQ0AAAIA/AACAPwAAAAAAAAAAxvZTPgAAAAAAAAAAAAAAAMb2Uz4AAAAAAAAAAAAAAADzcA4+AAAAAPNwDj4AAAAANfqOIwAAAAAAAIA/AACAP5qZGT8AAIA/SOGaPwAAgD+amZk/pHA9P/YovD89Cpc/AACAPwAAgD+amRk/AACAP0jhmj8AAIA/mpmZP6RwPT/2KLw/PQqXPwAAgD8AAIA/mpkZPwAAgD9I4Zo/AACAP5qZmT+kcD0/9ii8Pz0Klz8AAIA/AACAP5qZGT8AAIA/SOGaPwAAgD+amZk/pHA9P/YovD89Cpc/AACAPwAAgD+amRk/AACAP0jhmj8AAIA/mpmZP6RwPT/2KLw/PQqXPwAAgD8AAIA/mpkZPwAAgD9I4Zo/AACAP5qZmT+kcD0/9ii8Pz0Klz8AAIA/AACAP0jhmj8AAIA/mpmZP6RwPT/2KLw/PQqXPwAAgD8AAIA/mpkZPwAAgD9I4Zo/AACAP5qZmT+kcD0/mpkZPwAAgD9I4Zo/AACAPwAAgD8AAIA/t9wvvQAAAADXx3g8AAAAAORMu7wAAAAA18d4PAAAAAB7FLRB4XocwXsUtEHhehzBj8LnQcP1wMCPwudBw/XAwD0Kl0Fcj0I+PQqXQVyPQj5SuOZBPQrXwMP1vkFI4frA16P6QRSul0DXo/pBFK6XQB+FqUFI4Q7BUrjSQbgeJcEK12dBpHDtwB+Fp0FmZqbAuB6TQbgeBcBI4cZBmpkZvkjhxkGamRm+j8LnQcP1wMCPwudBw/XAwD0Kl0Fcj0I+UrjmQT0K18DD9b5BSOH6wMP1vkFI4frA16P6QRSul0AfhalBSOEOwVK40kG4HiXBCtdnQaRw7cAfhadBZmamwLgek0G4HgXAuB6TQbgeBcBI4cZBmpkZvo/C50HD9cDAj8LnQcP1wMA9CpdBXI9CPj0Kl0Fcj0I+UrjmQT0K18DD9b5BSOH6wNej+kEUrpdA16P6QRSul0AfhalBSOEOwR+FqUFI4Q7BUrjSQbgeJcEK12dBpHDtwB+Fp0FmZqbAH4WnQWZmpsC4HpNBuB4FwLgek0G4HgXASOHGQZqZGb57FLRB4XocwVyPq0I9CmdArkeJwdejMEEAAAAAAAAAAFtXDL8AAAAAW1cMvwAAAABYkOC+AAAAADX6jqQAAAAAAACAPwAAgD8AAIA/AACAP1yPQj/Xo3A/XI9CP9ejcD/D9Yg/9ihcP8P1iD/2KFw/FK5HP1K4Xj8Urkc/UrhePwAAgD8AAIA/AACAPwAAgD9cj0I/16NwP8P1iD/2KFw/w/WIP/YoXD8Urkc/UrhePxSuRz9SuF4/AACAPwAAgD8AAIA/AACAPxSuRz9SuF4/FK5HP1K4Xj8AAIA/AACAPwAAgD8AAIA/XI9CP9ejcD/D9Yg/9ihcP8P1iD/2KFw/FK5HP1K4Xj8Urkc/UrhePwAAgD8AAIA/AACAPwAAgD9cj0I/16NwP1yPQj/Xo3A/w/WIP/YoXD/D9Yg/9ihcPxSuRz9SuF4/FK5HP1K4Xj8AAIA/AACAPwAAgD8AAIA/FK5HP1K4Xj8Urkc/UrhePwAAgD8AAIA/AACAPwAAgD8Urkc/UrhePxSuRz9SuF4/AACAPwAAgD8AAAAAAAAAAOkd9b4AAAAAmqowvwAAAADiIle/AAAAAEhqRL4AAAAAlUgnPgAAAAAAAAAAAAAAAP2tAL0AAAAA6R31vgAAAACaqjC/AAAAAOIiV78AAAAASGpEvgAAAACVSCc+AAAAAAAAAAAAAAAAxeiSvQAAAADAAbI9AAAAAPR+T74AAAAAxeiSvQAAAAA1+o4lAAAAAIJVY70AAAAAxeiSvQAAAAAAAAAAAAAAAM+sJT4AAAAAAhJTPgAAAADG9tM+AAAAAO6JrT4AAAAASglVPgAAAAAAAAAAAAAAAP2tAD0AAAAAz6wlPgAAAAACElM+AAAAAMb20z4AAAAA7omtPgAAAABKCVU+AAAAAAAAAAAAAAAASOE2wgrXwz/sURzCuB5tQexRacKF67FAAABEwj0KgcHhem3CzczMvTMzMcKuR+E9FK5JwoXrYcEAAAAAAAAAAJZgF74AAAAAlmAXvgAAAAA1+g6kAAAAAPYopMFcj4pAexRewcP1jEEfhQTCj8IFQWZmvsGuR1XBFK4IwvYoLEDNzJjBcT06QI/CycG4HjXBAAAAAAAAAAD0fk++AAAAAPR+T74AAAAANfqOJQAAAACe9Mk+AAAAAK5HlcEUroNB9ihAwQAA7kF7FPrBheujQR+Fr8GamZm/cT0Bwq5HbUGF64nB16NwQUjhusHNzEw/AAAAAAAAAAD0fk++AAAAAPR+T74AAAAANfqOJQAAAAAAAAAAAAAAAM3MQEEK1yO/SOE2wfYoHD9I4TbB9igcPwAAAAAAAAAAPQoLQQAAAAA9CgtBAAAAAAAAAAAAAAAAvlhyPQAAAAD2KKTBXI+KQHsUXsHD9YxBH4UEwo/CBUFmZr7BrkdVwRSuCML2KCxAzcyYwXE9OkCPwsnBuB41wQAAAAAAAAAA9H5PvgAAAACHtSO+AAAAAJvCoL4AAAAAj1MFvgAAAACPUwW+AAAAADz7qL4AAAAA9H5PvgAAAAA1+o4lAAAAAHkioD0AAAAAUHdWJQAAAAA2gS8+AAAAAHkioD0AAAAAUHdWJQAAAAA2gS8+AAAAAHkioD0AAAAAAAAAAAAAAAAZUXk+AAAAAFEW5z4AAAAA3DMxPwAAAAAu4028AAAAAEy+jL4AAAAAAAAAAAAAAAD9rQA9AAAAABlReT4AAAAAURbnPgAAAADcMzE/AAAAAC7jTbwAAAAATL6MvgAAAAAAAAAAAAAAAB+Faz9mZma/V44XvQAAAADCuLI9AAAAAGA6Oj4AAAAAJ+R8PgAAAACp0Ey+AAAAABYdB78AAAAAwriyPQAAAABgOjo+AAAAACfkfD4AAAAAqdBMvgAAAAAWHQe/AAAAAMK4sj0AAAAAAAAAAAAAAACbtii/AAAAAFGMyL8AAAAAVM3nvwAAAACfCby/AAAAAB0abr8AAAAANfqOJQAAAAD9rQC9AAAAAJu2KL8AAAAAUYzIvwAAAABUzee/AAAAAJ8JvL8AAAAAHRpuvwAAAAA1+o4lAAAAAAAAAAAAAAAA16PgQOF6FEAAAAAAAAAAAL5umb4AAAAAE9W2vgAAAAC+bpm+AAAAADX6jiUAAAAAAAAAAAAAAADjNEu+AAAAAFeOlzwAAAAAIxPDPgAAAAB8YEE/AAAAANdMUD8AAAAAAAAAAAAAAAD9rQC9AAAAAOM0S74AAAAAV46XPAAAAAAjE8M+AAAAAHxgQT8AAAAA10xQPwAAAAAAAAAAAAAAAAAAAAAAAAAAO2iQPgAAAABrj5w9AAAAANDEFb8AAAAAAhCKvwAAAACnoGy/AAAAAAAAAAAAAAAA/a0APQAAAAA7aJA+AAAAAGuPnD0AAAAA0MQVvwAAAAACEIq/AAAAAKegbL8AAAAAAAAAAAAAAAB5IqA9AAAAAFB3ViUAAAAANoEvPgAAAAB5IqA9AAAAAFB3ViUAAAAANoEvPgAAAAB5IqA9AAAAAAAAAAAAAAAA4ZW6vgAAAAAGWqM9AAAAAN01ej8AAAAAx5CdPwAAAADooAM/AAAAAAAAAAAAAAAA/a0AvQAAAADhlbq+AAAAAAZaoz0AAAAA3TV6PwAAAADHkJ0/AAAAAOigAz8AAAAAAAAAAAAAAAAAAAAAAAAAAO+hnb4AAAAAhQxkvgAAAAAyQw6+AAAAAAAAAAAAAAAA83AOPgAAAADzcA4+AAAAADX6jiMAAAAAAACAPwAAgD9SuL4/AACAPx+Faz+PwrU/pHC9Px+Faz8K14M/heuRPwAAgD8AAIA/Uri+PwAAgD8fhWs/j8K1P6RwvT8fhWs/CteDP4XrkT8AAIA/AACAP1K4vj8AAIA/H4VrP4/CtT+kcL0/H4VrPwrXgz+F65E/AACAPwAAgD9SuL4/AACAPx+Faz+PwrU/pHC9Px+Faz8K14M/heuRPwAAgD8AAIA/Uri+PwAAgD8fhWs/j8K1P6RwvT8fhWs/CteDP4XrkT8AAIA/AACAP1K4vj8AAIA/H4VrP4/CtT+kcL0/H4VrPwrXgz+F65E/AACAPwAAgD8fhWs/j8K1P6RwvT8fhWs/CteDP4XrkT8AAIA/AACAP1K4vj8AAIA/H4VrP4/CtT+kcL0/H4VrP1K4vj8AAIA/H4VrP4/CtT8AAIA/AACAPwAAAAAAAAAAcT2jQoXrU0JczzFDFK4cQs3MDD/NzAw/H4UXQQAAAAAAAPhAAAAAAAAA+EAK14dBAAAAAAAAAAAAAAAAAAAAANnlZD8AAAAAexTuP3sU7j/2KBw/9igcP65HAUCuRwFAUvgmQylc5UEpXA9AKVwPQI+CZsN7FAPC16OQP9ejkD/NzKw/zcysPzMzkz8zM5M/16OQP9ejkD/Xo5A/16OQP83MrD/NzKw/MzOTPzMzkz/Xo5A/16OQP9ejkD/Xo5A/zcysP83MrD8zM5M/MzOTP9ejkD/Xo5A/16OQP9ejkD/NzKw/zcysPzMzkz8zM5M/16OQP9ejkD/Xo5A/16OQP83MrD/NzKw/MzOTPzMzkz/Xo5A/16OQP9ejkD/Xo5A/zcysP83MrD8zM5M/MzOTP9ejkD/Xo5A/16OQP9ejkD/NzKw/zcysPzMzkz8zM5M/16OQP9ejkD/Xo5A/16OQP83MrD/NzKw/MzOTPzMzkz/Xo5A/16OQP9ejkD/Xo5A/zcysP83MrD8zM5M/MzOTP9ejkD/Xo5A/16OQP9ejkD/NzKw/zcysPzMzkz8zM5M/16OQP9ejkD/Xo5A/16OQP83MrD/NzKw/MzOTPzMzkz/Xo5A/16OQP9ejkD/Xo5A/zcysP83MrD8zM5M/MzOTP9ejkD/Xo5A/16OQP9ejkD/NzKw/zcysPzMzkz8zM5M/16OQP9ejkD8AAIA/AACAPwAAgD8AAIA/heuxP4XrsT8AAIA/AACAP9ejkD/Xo5A/AACAPwAAgD8AAIA/AACAP4XrsT+F67E/AACAPwAAgD8AAAAAAAAAAAAAAAAAAAAAAAAAAHsUJkEAAAAAAAAAAAAAAAB7FCZBAACAPwAAgD8AAIA/AACAP/YonD/2KJw/AACAPwAAgD/2KJw/9iicPwAAAAAAAAAAAAAAAAAAAAAAAAAAcT0CQgAAAAAAAAAAAAAAAHE9AkIAAAAAAAAAAAAAAABxPQJCAACAPwAAgD8AAIA/AACAP/YovD/2KLw/AACAPwAAgD/2KLw/9ii8PwAAgD8AAIA/9ii8P/YovD/Xo5A/16OQv2ZmZj9mZmY/CtfDPwrXwz+PwgVAj8IFQNejkD/Xo5A/AACAPwAAgD8AAIA/AACAP4XrsT+F67E/AACAPwAAgD/Xo5A/16OQPwAAgD8AAIA/AACAPwAAgD+F67E/heuxPwAAgD8AAIA/AACAPwAAgD8AAIA/AACAP6RwnT+kcJ0/AACAPwAAgD8AAIA/AACAP6RwnT+kcJ0/AACAPwAAgD8AAIA/AACAP6RwnT+kcJ0/AACAPwAAgD8AAIA/AACAP6RwnT+kcJ0/AACAPwAAgD8AAIA/AACAP6RwnT+kcJ0/AACAPwAAgD8AAIA/AACAP6RwnT+kcJ0/AACAPwAAgD8AAIA/AACAP6RwnT+kcJ0/AACAPwAAgD8AAIA/AACAP6RwnT+kcJ0/AACAPwAAgD8AAIA/AACAP6RwnT+kcJ0/AACAPwAAgD8AAIA/AACAP6RwnT+kcJ0/AACAPwAAgD8AAIA/AACAP6RwnT+kcJ0/AACAPwAAgD8AAAAAAAAAAAAAAAAAAAAAAAAAAAAA7EEAAAAAAAAAAAAAAAAAAOxBAAAAAAAAAAAAAAAAAADsQQAAgD8AAIA/AACAPwAAgD8AAIA/mplZPwAAgD8AAIA/AACAP5qZWT8AAIA/AACAPwAAgD+amVk/AAAAAAAAAAAAAAAA4fqRQgAAAAAAAAAAAAAAAOH6kUIAAAAAAAAAAAAAAADh+pFCAAAAAAAAAAAAAAAA4fqRQgAAgD8AAIA/w/WoPwAAgD8AAIA/AACAP8P1qD8AAIA/AACAPwAAgD/D9ag/AACAPwAAgD8AAIA/w/WoPwAAgD8AAERBAABEQQAAREEAAERBAACAPwAAgD8K1+O/ZmYkQjMz+8AfhR9CgT1zvwAAAAAU8yK/AAAAADMzU0AzM1NAFK7nPxSu5z/D9RhAw/UYQD0KN0E9CmfAPQo3QT0KZ8AAAAAAAAAAANejUMD2KCxA16NQwPYoLEAAAAAAAAAAAGZmdkApXF/AZmZ2QClcX8AAAAAAAAAAAN01er0AAAAA3TV6vQAAAAAAAAAAAAAAAKRwfT+uR4FApHB9P65HgUAAAAAAAAAAANa5Nz0AAAAA1rk3PQAAAACSCgYlAAAAAFK4XkBSuF5A9mgWw4XrMcEAACXDClfUwvZoFsOF6zHBAAAlwwpX1ML2aBbDhesxwQAAJcMKV9TC9mgWw4XrMcEAACXDClfUwvZoFsOF6zHBAAAlwwpX1ML2aBbDhesxwQAAJcMKV9TC9mgWw4XrMcEAACXDClfUwvZoFsOF6zHBAAAlwwpX1ML2aBbDhesxwQAAJcMKV9TC9mgWw4XrMcEAACXDClfUwvZoFsOF6zHBAAAlwwpX1ML2aBbDhesxwQAAJcMKV9TC9mgWw4XrMcEAACXDClfUwvZoFsOF6zHBAAAlwwpX1ML2aBbDhesxwQAAJcMKV9TC9mgWw4XrMcEAACXDClfUwvZoFsOF6zHBAAAlwwpX1ML2aBbDhesxwTx20T0AAAAAWB4ywAAAAAA8dtE9AAAAAFgeMsAAAAAAPHbRPQAAAABYHjLAAAAAADx20T0AAAAAWB4ywAAAAAA8dtE9AAAAAFgeMsAAAAAAPHbRPQAAAABYHjLAAAAAADx20T0AAAAAWB4ywAAAAAA8dtE9AAAAAFgeMsAAAAAAPHbRPQAAAABYHjLAAAAAADx20T0AAAAAWB4ywAAAAAA8dtE9AAAAAFgeMsAAAAAAPHbRPQAAAABYHjLAAAAAADx20T0AAAAAWB4ywAAAAAA8dtE9AAAAAFgeMsAAAAAAPHbRPQAAAABYHjLAAAAAADx20T0AAAAAWB4ywAAAAAA8dtE9AAAAAFgeMsAAAAAAPHbRPQAAAAAzMxNAMzMTQArXI0AK1yNAMzMTQDMzE0AK1yNACtcjQDMzE0AzMxNACtcjQArXI0AzMxNAMzMTQArXI0AK1yNAMzMTQDMzE0AK1yNACtcjQDMzE0AzMxNACtcjQArXI0AzMxNAMzMTQArXI0AK1yNAMzMTQDMzE0AK1yNACtcjQDMzE0AzMxNACtcjQArXI0AzMxNAMzMTQArXI0AK1yNAMzMTQDMzE0AK1yNACtcjQDMzE0AzMxNACtcjQArXI0AzMxNAMzMTQArXI0AK1yNAMzMTQDMzE0AK1yNACtcjQDMzE0AzMxNACtcjQArXI0AzMxNAMzMTQArXI0AK1yNAMzMTQDMzE0AK1yNACtcjQDMzE0AzMxNAUvgOw49CG0MAAAnDcb0fQwDAE8OPwiRDzQwJwz0KH0MK1w3DmlkdQ/boB8NSuCpD12MQwzPzG0OaGQvDFC4bQ8M1F8MUrhxDXA8Rw9ejH0PD9RPDpHAiQx/FDcMpHCVDAAAJw3G9H0MAwBPDj8IkQ80MCcM9Ch9DCtcNw5pZHUP26AfDUrgqQ9djEMMz8xtDmhkLwxQuG0PDNRfDFK4cQ1wPEcPXox9Dw/UTw6RwIkMfxQ3DKRwlQwAACcNxvR9DAMATw4/CJEPNDAnDPQofQwrXDcOaWR1D9ugHw1K4KkPXYxDDM/MbQ5oZC8MULhtDwzUXwxSuHENcDxHD16MfQ8P1E8OkcCJDH8UNwykcJUNS+A7Dj0IbQ1K4s8JxPSxDexQ5w49CL0MvjA2+AAAAAC+MDb4AAAAAfGDBvQAAAAAAAAAAAAAAAAAAAAAAAAAAXI+TQuxR3kFcj5NC7FHeQQAAjEIUri1CAACMQhSuLUIfhZZCpHCtQR+FlkKkcK1BXI+TQuxR3kEAAIA/AACAPx+FO0AfhTtApHD9P6Rw/T8K10NACtdDQHsU7j97FO4/AACAPwAAgD8fhTtAH4U7QKRw/T+kcP0/CtdDQArXQ0AAAIA/AACAPx+FO0AfhTtApHD9P6Rw/T8K10NACtdDQHsU7j97FO4/AACAPwAAgD8fhTtAH4U7QKRw/T+kcP0/CtdDQArXQ0B7FO4/exTuPwAAAAAAAAAAUriMQYXrBEKFa93CKVz9wWZmk0KkcP0/H4WRwQAA8EEAAAAAAAAAAAAAAAAAAAAAPiuJvgAAAACjYIK+AAAAADTY7z0AAAAAAAAAAAAAAAAAAAAAAAAAACncm0Jcj85BKdybQlyPzkHsUZdCcT00QuxRl0JxPTRCPQqhQoXri0E9CqFCheuLQSncm0Jcj85BAAAAAAAAAAAAAAAAAAAAAC+MDb4AAAAAAACAPwAAgD9cj0I/16NwP8P1iD/2KFw/FK5HP1K4Xj8AAIA/AACAP1yPQj/Xo3A/w/WIP/YoXD8Urkc/UrhePwAAgD8AAIA/XI9CP9ejcD+uRyFA9ihcP1K4TkAAAIA/XI9CP9ejcD/D9Yg/9ihcPxSuRz9SuF4/FK5HP1K4Xj8AAIA/AACAP1yPQj/Xo3A/w/WIP/YoXD8Urkc/UrhePxSuRz9SuF4/AACAPwAAgD9cj0I/16NwP8P1iD/2KFw/FK5HP1K4Xj8AAAAAAAAAAP5C4j0AAAAAuQJhvgAAAAB5EnW/AAAAACzPEL8AAAAAAAAAAAAAAAD+QuI9AAAAALkCYb4AAAAAeRJ1vwAAAAAszxC/AAAAAAAAAAAAAAAAAAAAAAAAAAApXBxCMzMkQh9FDsNSuDLBpLCqQx+FGEJ7VG9DFK5jQgAAAAAAAAAAAAAAAAAAAACBPXO+AAAAAHOe974AAAAAgT1zvgAAAACZDWk9AAAAAGHB2jwAAAAAAAAAAAAAAADl3Qq/AAAAAOXdCr8AAAAA6SckvwAAAABSOAa+AAAAADixDz4AAAAAAAAAAAAAAADl3Qq/AAAAAOXdCr8AAAAA6SckvwAAAABSOAa+AAAAADixDz4AAAAAAAAAAAAAAAAAAAAAAAAAABSul8CuR2E/pHDdwOF6hEBcjxrBSOE6QNejFMGF65E/RJvTvQAAAABEm9O9AAAAABNmBj0AAAAA+dRgPgAAAADryP09AAAAAAAAAAAAAAAAD4udPgAAAAB1Uy8/AAAAAEdMWD8AAAAA3965PQAAAACWVui9AAAAAAAAAAAAAAAAD4udPgAAAAB1Uy8/AAAAAEdMWD8AAAAA3965PQAAAACWVui9AAAAAAAAAAAAAAAA8lievQAAAAAG4cM+AAAAAIpidb4AAAAAbkwZPwAAAACZCyA/AAAAAMK4sj0AAAAAAAAAAAAAAAAaV3U/AAAAAKcfyD8AAAAAUIDQPwAAAAA4NbI/AAAAAIwdqT8AAAAAAAAAAAAAAAAaV3U/AAAAAKcfyD8AAAAAUIDQPwAAAAA4NbI/AAAAAIwdqT8AAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAA83AOPgAAAAAAAIA/AACAPz0Ktz8AAIA/PQq3Px+Fqz+F61E/cT2qP6RwvT8zM3M/AACAPwAAgD89Crc/AACAPz0Ktz8fhas/hetRP3E9qj+kcL0/MzNzPwAAgD8AAIA/PQq3PwAAgD89Crc/H4WrP4XrUT9xPao/pHC9PzMzcz8AAIA/AACAPz0Ktz8AAIA/PQq3Px+Fqz+F61E/cT2qP6RwvT8zM3M/AACAPwAAgD89Crc/AACAPz0Ktz8fhas/hetRP3E9qj+kcL0/MzNzPwAAgD8AAIA/PQq3PwAAgD89Crc/H4WrP4XrUT9xPao/pHC9PzMzcz8AAIA/AACAPwAAAAAAAAAAgtq6vgAAAAByJwK/AAAAALU3I78AAAAAHJeAPgAAAADnfJs+AAAAAAAAAAAAAAAAgtq6vgAAAAByJwK/AAAAALU3I78AAAAAHJeAPgAAAADnfJs+AAAAAAAAAAAAAAAAwriyPQAAAADM6/U8AAAAAAAAAAAAAAAA+n2gvgAAAAD6faC+AAAAAEdG3L4AAAAAL/u9vgAAAABuRh2+AAAAAAAAAAAAAAAA+n2gvgAAAAD6faC+AAAAAEdG3L4AAAAAL/u9vgAAAABuRh2+AAAAAAAAAAAAAAAAjarFvQAAAAAlN6s+AAAAAMABsr0AAAAASXBAvwAAAAA/vqG+AAAAAAXTAj0AAAAAjarFvQAAAAAAAAAAAAAAAIuElD4AAAAAoB4uPwAAAAAn5Hw/AAAAACj6oz4AAAAAO2iQvQAAAAAAAAAAAAAAAIuElD4AAAAAoB4uPwAAAAAn5Hw/AAAAACj6oz4AAAAAO2iQvQAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAADhekhBhetBwOF6SEGF60HAuB5xQdejkkG4HnFB16OSQYXrYUH2KOzAhethQfYo7MDhekhBhetBwAAAAAAAAAAAAAAAAAAAAADOJQW/AAAAAAAAgD8AAIA/H4U7QB+FO0CkcP0/pHD9PwrXQ0AK10NAexTuP3sU7j8AAIA/AACAPx+FO0AfhTtApHD9P6Rw/T8K10NACtdDQHsU7j97FO4/AACAPwAAgD8fhTtAH4U7QB+FO0AfhTtApHD9P6Rw/T8K10NACtdDQHsU7j97FO4/AACAPwAAgD8fhTtAH4U7QB+FO0AfhTtApHD9P6Rw/T8K10NACtdDQHsU7j97FO4/AACAPwAAgD8AAAAAAAAAADPKLj4AAAAAtKqGPgAAAAAQr4W9AAAAAKCpgb4AAAAA53wbPgAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAADzcA4+AAAAAAAAgD8AAIA/mpkZPwAAgD9I4Zo/AACAP5qZmT+kcD0/9ii8Pz0Klz8AAIA/AACAP5qZGT8AAIA/SOGaPwAAgD+amZk/pHA9P/YovD89Cpc/AACAPwAAgD+amRk/AACAP0jhmj8AAIA/mpmZP6RwPT/2KLw/PQqXPwAAgD8AAIA/mpkZPwAAgD9I4Zo/AACAP5qZmT+kcD0/9ii8Pz0Klz8AAIA/AACAP5qZGT8AAIA/SOGaPwAAgD+amZk/pHA9P/YovD89Cpc/AACAPwAAgD+amRk/AACAP0jhmj8AAIA/mpmZP6RwPT/2KLw/PQqXPwAAgD8AAIA/t9wvvQAAAADXx3g8AAAAAAAAAAAAAAAAAAAAAAAAAAB7FLRB4XocwXsUtEHhehzB4XrIQbgeOUHheshBuB45Qc3MwEF7FGLBzczAQXsUYsF7FLRB4XocwQAAAAAAAAAAAAAAAAAAAADTAre5AAAAAOiK3L4AAAAA6IrcvgAAAABbVwy/AAAAAAAAgD8AAIA/XI9CP9ejcD/D9Yg/9ihcPxSuRz9SuF4/AACAPwAAgD9cj0I/16NwP8P1iD/2KFw/FK5HP1K4Xj8AAIA/AACAP1yPQj/Xo3A/w/U4QPYoXD+PwjVAUrhePwAAgD8AAIA/XI9CP9ejcD/D9Yg/9ihcP8P1iD/2KFw/FK5HP1K4Xj8AAIA/AACAP1yPQj/Xo3A/w/WIP/YoXD/D9Yg/9ihcPxSuRz9SuF4/AACAPwAAgD8Urkc/UrhePwAAgD8AAIA/AAAAAAAAAADpHfW+AAAAAJqqML8AAAAA4iJXvwAAAABIakS+AAAAAJVIJz4AAAAAAAAAAAAAAADpHfW+AAAAAJqqML8AAAAA4iJXvwAAAABIakS+AAAAAJVIJz4AAAAAAAAAAAAAAADF6JK9AAAAAKCdiT0AAAAA76GdvgAAAACNnk2/AAAAAPfGn74AAAAAPIAAvgAAAADF6JK9AAAAAAAAAAAAAAAAz6wlPgAAAAACElM+AAAAAMb20z4AAAAA7omtPgAAAABKCVU+AAAAAAAAAAAAAAAAz6wlPgAAAAACElM+AAAAAMb20z4AAAAA7omtPgAAAABKCVU+AAAAAAAAAAAAAAAAAAAAAAAAAAApXAbCCtcNQgrXicJSuCrBexSAwnE9EcJI4TbCCtfDPwAAAAAAAAAAAAAAAAAAAAD0fk++AAAAAPR+T74AAAAAlmAXvgAAAAAAAAAAAAAAAHE9BsE9ChlCSOEuwgrX+8ApXBvCexQGwvYopMFcj4pAAAAAAAAAAAD0fk++AAAAAJ70yT4AAAAAAAAAAAAAAADD9dDAXI9JQqRwJ8IAAIhASOETwj0Kq8GuR5XBFK6DQQAAAAAAAAAA9H5PvgAAAAAAAAAAAAAAAOxRUEEAAAAA9igQQQAAAAD2KGTBAAAAAAAAAAAAAAAAvlhyPQAAAAAAAAAAAAAAAHE9BsE9ChlCSOEuwgrX+8ApXBvCexQGwvYopMFcj4pAAAAAAAAAAAD0fk++AAAAAHkioD0AAAAAq2PlvgAAAACCVWM9AAAAAP9SDT8AAAAAMrI+PgAAAACuMI29AAAAAHkioD0AAAAAAAAAAAAAAAAZUXk+AAAAAFEW5z4AAAAA3DMxPwAAAAAu4028AAAAAEy+jL4AAAAAAAAAAAAAAAAZUXk+AAAAAFEW5z4AAAAA3DMxPwAAAAAu4028AAAAAEy+jL4AAAAAAAAAAAAAAAAfhWs/ZmZmv1eOF70AAAAAwriyPQAAAAAAAAAAAAAAAJu2KL8AAAAAUYzIvwAAAABUzee/AAAAAJ8JvL8AAAAAHRpuvwAAAAA1+o4lAAAAAJu2KL8AAAAAUYzIvwAAAABUzee/AAAAAJ8JvL8AAAAAHRpuvwAAAAA1+o4lAAAAAAAAAAAAAAAAvm6ZvgAAAAAAAAAAAAAAAOM0S74AAAAAV46XPAAAAAAjE8M+AAAAAHxgQT8AAAAA10xQPwAAAAAAAAAAAAAAAOM0S74AAAAAV46XPAAAAAAjE8M+AAAAAHxgQT8AAAAA10xQPwAAAAAAAAAAAAAAAAAAAAAAAAAAO2iQPgAAAABrj5w9AAAAANDEFb8AAAAAAhCKvwAAAACnoGy/AAAAAAAAAAAAAAAAO2iQPgAAAABrj5w9AAAAANDEFb8AAAAAAhCKvwAAAACnoGy/AAAAAAAAAAAAAAAAeSKgPQAAAAA2g/i+AAAAAEHk0j4AAAAAaNRoPwAAAAACi7I+AAAAABYdB74AAAAAeSKgPQAAAAAAAAAAAAAAAOGVur4AAAAABlqjPQAAAADdNXo/AAAAAMeQnT8AAAAA6KADPwAAAAAAAAAAAAAAAOGVur4AAAAABlqjPQAAAADdNXo/AAAAAMeQnT8AAAAA6KADPwAAAAAAAAAAAAAAAAAAAAAAAAAAQu6BvgAAAAA8+6i+AAAAAAvIJD4AAAAASQeMPgAAAAD2Jw++AAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAPNwDj4AAAAAAACAPwAAgD9SuL4/AACAPx+Faz+PwrU/pHC9Px+Faz8K14M/heuRPwAAgD8AAIA/Uri+PwAAgD8fhWs/j8K1P6RwvT8fhWs/CteDP4XrkT8AAIA/AACAP1K4vj8AAIA/H4VrP4/CtT+kcL0/H4VrPwrXgz+F65E/AACAPwAAgD9SuL4/AACAPx+Faz+PwrU/pHC9Px+Faz8K14M/heuRPwAAgD8AAIA/Uri+PwAAgD8fhWs/j8K1P6RwvT8fhWs/CteDP4XrkT8AAIA/AACAP1K4vj8AAIA/H4VrP4/CtT+kcL0/H4VrPwrXgz+F65E/AACAPwAAgD8AAAAAAAAAAFzPMUMUrhxCXM8xQxSuHEJczzFDzcyoQVzPMUPNzKhBXM8xQxSuHEIAAIA/AACAP65HIUCuRyFAzcwMP83MDD+uRyFArkchQK5HIUCuRyFAzcwMP83MDD+uRyFArkchQM3MDD/NzAw/AAAAAAAAAAAfhRdBAAAAAAAAgD8AAIA/j8KVP4/ClT97FO4/exTuPwAAAAAAAAAAAAAAAAAAAABS+CZDKVzlQQAAgD8AAIA/cT3KP3E9yj8AANBAAADQQGZmZj9mZmY/KVwPQClcD0AAAAAAAAAAAI+CZsN7FAPCAACAPwAAgD8AAIA/AACAP+xRuD/sUbg/AACAPwAAgD8AAIA/AACAP3E9yj9xPco/16OQP9ejkD8AAIA/AACAPwAAgD8AAIA/7FG4P+xRuD8AAIA/AACAPwAAgD8AAIA/cT3KP3E9yj/Xo5A/16OQPwAAAAAAAAAAAAAAAAAAAAAAAAAAexQmQQAAgD8AAIA/AACAPwAAgD/2KJw/9iicPwAAAAAAAAAAAAAAAAAAAAAAAAAAcT0CQgAAAAAAAAAAAAAAAHE9AkIAAIA/AACAPwAAgD8AAIA/9ii8P/YovD8AAIA/AACAP/YovD/2KLw/AAAAAAAAAAAAAAAAAAAAANejkD/Xo5C/AACAPwAAgD9xPQpAcT0KQHE9CkBxPQpAZmZmP2ZmZj8AAIA/AACAPwAAgD8AAIA/7FG4P+xRuD8AAIA/AACAPwAAgD8AAIA/cT3KP3E9yj/Xo5A/16OQPwAAgD8AAIA/AACAPwAAgD9xPco/cT3KP9ejkD/Xo5A/AAAAAAAAAAAAAKDBAAAAAAAAoMEAAOxBAACgwQAAAAAAAKDBAADsQQAAgD8AAIA/AACAPwAAgD8AAIA/mplZPwAAgD8AAIA/AACAP5qZWT8AAAAAAAAAAAAAoMEfhUNCAAAAAOH6kUIAAAAAAAAAAAAAoMHNzJBCAACgweH6kUIAAAAAAAAAAAAAAADh+pFCAACgweH6kUIAAIA/AACAPwAAgD8AAIA/w/WoPwAAgD8AAIA/AACAPwAAgD8AAIA/w/WoPwAAgD8AAIA/AACAP8P1qD8AAIA/AACAPwAAgD89Cu9APQrvQAAAREEAAERBAAAAAAAAAAAK1+O/ZmYkQgAAAAAAAAAAgT1zvwAAAAAAAIA/AACAPylcD0ApXA9AMzNTQDMzU0AAAAAAAAAAAFL4DsOPQhtDZqYMw3F9LkP2aA7DXI8SQ1L4DsOPQhtDAAAAAAAAAAAvjA2+AAAAAAAAAAAAAAAA9mgWw4XrMcEAACXDClfUwvZoFsOF6zHBAAAlwwpX1ML2aBbDhesxwQAAJcMKV9TC9mgWw4XrMcEAACXDClfUwvZoFsOF6zHBAAAAAAAAAAA8dtE9AAAAAFgeMsAAAAAAPHbRPQAAAABYHjLAAAAAADx20T0AAAAAWB4ywAAAAAA8dtE9AAAAAFgeMsAAAAAAPHbRPQAAAAAAAIA/AACAPzMzE0AzMxNACtcjQArXI0AzMxNAMzMTQArXI0AK1yNAMzMTQDMzE0AK1yNACtcjQDMzE0AzMxNACtcjQArXI0AzMxNAMzMTQAAAAAAAAAAAAAAAAAAAAABI4XpAmpm5QNejUMD2KCxAAAAAAAAAAAAAAAAAAAAAAFyPGkEfhas/ZmZ2QClcX8AAAAAAAAAAAN01er0AAAAAAAAAAAAAAAAAAAAAAAAAAHE9ikAAAJBApHB9P65HgUAAAAAAAAAAANa5Nz0AAAAAAAAAAAAAAAAAAAAAAAAAAOF6GEEUridAPQo3QT0KZ8AAAIA/AACAPwAAgD8AAIA/XI/iP1yP4j9SuF5AUrheQAAAAAAAABkAAQAAAAAAAAABAAMAAQAGAAEACAABAAwAAQAOAAEAEQABABMAAQAWAAEAGAABABoAAQAdAAEAHwABACEAAQAjAAAAAAACABYANQlcDiMSKBWpF80ZpRtFHbIe9R8UIRMi9iK+I24kCCWNJf4lXSaoJt8mAycVAAIABAAsCCcQ8xeWHxgAAQAeAAIABgDwCq8TmRrpH8MjLyYjAAAAAAACABYANQlcDiMSKBWpF80ZpRtFHbIe9R8UIRMi9iK+I24kCCWNJf4lXSaoJt8mAycVAAIACgC9A3AHGQu3Dk0S1xVaGdQcRSCvIx4AAgAGAPAKrxOZGukfwyMvJiMAAAAAAAEAAwABAAUAAQAIAAEACwABAA4AAQAQAAEAEwACAAQAbBKpHLgi/yUWAAEAGAACAAQAihLVHN0iDyYbAAEAHgABACAAAQAjAAAAAAABABEAAQAUAAEAFgABABsAAQAfAAAAAAACABYAVAnaDuYSGha9GPIa1xx3Ht4fGCEoIhQj4COQJCclpSUOJmMmpSbWJvgmCicVAAIABABtCsIT0htcIhgAAgAHAE0FigquD7YUmBlPHs8iHgACAAYAkAg/EBkXDB34IYwlIwAAAAAAAgAWAFQJ2g7mEhoWvRjyGtccdx7eHxghKCIUI+AjkCQnJaUlDiZjJqUm1ib4JgonFQACAAoA3QSGCfQNJhIYFsMZIR0tIN4iLiUeAAIABgCQCD8QGRcMHfghjCUjAAAAAAACABYAVAnaDuYSGha9GPIa1xx3Ht4fGCEoIhQj4COQJCclpSUOJmMmpSbWJvgmCicVAAIABABtCsIT0htcIhgAAgAHAE0FigquD7YUmBlPHs8iHgACAAYAkAg/EBkXDB34IYwlIwAAAAAAAAAAAAIAFADWAa0DhgVfBzoJFQvxDM4OrBCJEmgURhYmGAQa4hvAHZ8feyFYIzUlEwACAAUAcAbkDF4T4hlyIBcAAgAGAIoFHQu2EFMW7RuDIRwAAgAIAEsEnAj0DE4RrBUIGmQevSIjAAAAAAABABEAAAAUAAEAFgABABkAAQAbAAEAHwAAAAAAAgAUAB8BWgKuAxoFnAYzCN4JmgtoDUgPNBEyEzsVUBdzGaAb2B0YIGIitSQTAAIABQAzDuIXqB5EIw4mFwAAAB4AAgAGAJUIgBCYF7EdjCLUJSMAAAAAAAIAFAAfAVoCrgMaBZwGMwjeCZoLaA1IDzQRMhM7FVAXcxmgG9gdGCBiIrUkEwACAAUAMw7iF6geRCMOJhcAAAAeAAIABgCVCIAQmBexHYwi1CUjAAAAAAABABEAAQAUAAEAFgABABkAAQAbAAEAHwAAAAAAAgAUAOIBxAOmBYcHZwlICykNCA/oEMYSpBSAFl0YNxoRHOodwR+XIWsjPyUTAAIABQAzDuIXqB5EIw4mFwAAAB4AAgAGAPIIEBE0GDYe4SLyJSMAAAAAAAAAAAACAAUAcwFsBXcLQhOHHAQAAgAGAP4JNhIEGZAe4yLcJQkAAAALAAIABAAPAp0H9A+RGg4AAgAEAHcNwheIH9kkEQAAABMAAgAEAA8CnQf0D5EaFgACAAUAeAuhFPEbliF4JRoAAAAcAAIABAAPAp0H9A+RGh8AAgAFAHgLoRTxG5YheCUjAAAAAAACAAUAcwFsBXcLQhOHHAQAAgAGAP4JNhIEGZAe4yLcJQkAAAALAAIABAAPAp0H9A+RGg4AAgAEAHcNwheIH9kkEQAAABMAAgAEAA8CnQf0D5EaFgACAAUAeAuhFPEbliF4JRoAAAAcAAIABAAPAp0H9A+RGh8AAgAFAHgLoRTxG5YheCUjAAAAAAABABEAAQAUAAEAFgABABkAAQAbAAEAHwAAAAAAAQACAAEABAABAAYAAQAIAAEACgABAAwAAQAOAAEAEAABABIAAQAUAAEAFQABABcAAQAZAAEAGwABAB0AAQAfAAEAIQABACMAAAAAAAIAFwAfAHkABgHDAasCugPtBEAGsQc/CecKpwx+DmkQZxJ4FJkWzBgLG1odtx8fIpIkFgACAAcAUAWWCsoP4BTNGYQe9iIcAAIACADfAesFBwumEGoWCRwlITElIwAAAAAAAgAUACkAnABSAUMCaQO+BEAG6Qe2CaMLsQ3aDx0SeBToFm8ZCByyHmwhOCQTAAIABAANENca0iHEJRYAAgAHAFAFlgrKD+AUzRmEHvYiHAACAAgA3wHrBQcLphBqFgkcJSExJSMAAAAAAAEAEQABABQAAQAWAAEAGQABABsAAQAfAAAAAAAAAAAAAAAAAAEAEQAAABQAAQAWAAEAGQABABsAAQAfAAAAAAACABQA3wG+A54FfQddCTwLGw37DtkQtxKUFHEWThgpGgUc3x24H5AhZiM8JRMAAgAEADAIORATGLMfFgACAAQA0wgzEREZYSAZAAIABQAtCL8PqhbjHGAiHQACAAcASgIfBxgNhxP4GfEfxiQjAAAAAAABABEAAQAUAAEAFgABABkAAQAbAAEAHwAAAAAAAQADAAEABgABAAgAAQAMAAEADgABABEAAQATAAEAFgABABgAAQAaAAEAHQABAB8AAQAhAAEAIwAAAAAAAgAUACkAnABSAUMCaQO+BEAG6Qe2CaMLsQ3aDx0SeBToFm8ZCByyHmwhOCQTAAIABADjB8QPmxdiHxYAAgAEAG8IlhBxGPIfGQACAAUAvAcUD/gVUxwPIh0AAgAHAEoCHwcYDYcT+BnxH8YkIwAAAAAAAQACAAEABAABAAYAAQAIAAEACgABAAwAAQAOAAEAEAABABIAAQAUAAEAFQABABcAAQAZAAEAGwABAB0AAQAfAAEAIQABACMAAAAAAAAAAAACABcAowFGA+oEjgYxCNQJeAsbDb4OYRADEqYTSBXpFooYKRrKG2kdBh+jIEAi3CN3JRYAAgAEAFwO7hh2IEAlGQACAAsAtwRQCcENAxIOFtUZTh1mIAsjIiWKJiMAAAAAAAEAAgABAAMAAQAFAAEABgABAAgAAQAJAAEACwABAA0AAQAOAAEAEAABABEAAQATAAEAFQABABYAAQAYAAEAGgABABsAAQAcAAEAHgABACAAAQAhAAEAIwAAAAAAAQARAAEAFAABABYAAQAZAAEAGwABAB8AAAAAAAIAFADfAb4DngV9B10JPAsbDfsO2RC3EpQUcRZOGCkaBRzfHbgfkCFmIzwlEwACAAQAMAg5EBMYsx8WAAIABADTCDMRERlhIBkAAgAFAC0Ivw+qFuMcYCIdAAIABwBKAh8HGA2HE/gZ8R/GJCMAAAAAAAEAEQABABQAAQAWAAEAGQABABsAAQAfAAAAAAABAAMAAQAFAAEACAABAAsAAQAOAAEAEAABABMAAQAWAAEAGAABABsAAQAeAAEAIAABACMAAAAAAAIAFAAlAI4ANQEWAisDcATiBX0HPgkkCysNUA+UEfITahb8GKMbYh4zIRgkEwACAAQAvQz/FggfrSQWAAIABwCoB5sO3RRuGjsfJSPsJRwAAgAIAN8B6wUHC6YQahYJHCUhMSUjAAAAAAACABQAJQCOADUBFgIrA3AE4gV9Bz4JJAsrDVAPlBHyE2oW/BijG2IeMyEYJBMAAgAEAL0M/xYIH60kFgACAAcAqAebDt0Ubho7HyUj7CUcAAIACADfAesFBwumEGoWCRwlITElIwAAAAAAAgAUACcAlQBEASwCSgOXBBEGswd6CWQLbQ2VD9gRNBSqFjUZ1RuJHlEhKCQTAAIABAA0Db8XvR8IJRYAAgAHADsK2RHqF9sc2yD7IygmHAACAAgA3wHrBQcLphBqFgkcJSExJSMAAAAAAAIAFAAnAJUARAEsAkoDlwQRBrMHeglkC20NlQ/YETQUqhY1GdUbiR5RISgkEwACAAQANA2/F70fCCUWAAIABwA7CtkR6hfbHNsg+yMoJhwAAgAIAN8B6wUHC6YQahYJHCUhMSUjAAAAAAAAAAAAAgAUACcAlQBEASwCSgOXBBEGswd6CWQLbQ2VD9gRNBSqFjUZ1RuJHlEhKCQTAAIABACIDRIY6R8SJRYAAgAHADsK2RHqF9sc2yD7IygmHAACAAgA3wHrBQcLphBqFgkcJSExJSMAAAAAAAIAFAAnAJUARAEsAkoDlwQRBrMHeglkC20NlQ/YETQUqhY1GdUbiR5RISgkEwACAAQAiA0SGOkfEiUWAAIABwA7CtkR6hfbHNsg+yMoJhwAAgAIAN8B6wUHC6YQahYJHCUhMSUjAAAAAAAAAAAAAgAUACcAlQBEASwCSgOXBBEGswd6CWQLbQ2VD9gRNBSqFjUZ1RuJHlEhKCQTAAIABAA0D+QZJSGCJRYAAgAHADsK2RHqF9sc2yD7IygmHAACAAgA3wHrBQcLphBqFgkcJSExJSMAAAAAAAIAFAAnAJUARAEsAkoDlwQRBrMHeglkC20NlQ/YETQUqhY1GdUbiR5RISgkEwACAAQANA/kGSUhgiUWAAIABwA7CtkR6hfbHNsg+yMoJhwAAgAIAN8B6wUHC6YQahYJHCUhMSUjAAAAAAACABQA3wG+A54FfQddCTwLGw37DtkQtxKUFHEWThgpGgUc3x24H5AhZiM8JRMAAgAEADAIORATGLMfFgACAAQA0wgzEREZYSAZAAIABQAtCL8PqhbjHGAiHQACAAcASgIfBxgNhxP4GfEfxiQjAAAAAAABABEAAQAUAAEAFgABABkAAQAbAAEAHwAAAAAAAAAAAAAAAAAAAAAAAQARAAEAFAABABYAAQAZAAEAGwABAB8AAAAAAAAADQACAAsAMgNvBrUJAQ1REKIT8hY9GoMdvyDvIxcAAgANAA4EBAjgC5wPNBOfFtkZ2RySH/whBiSfJa0mIwAAAAAAAAANAAIACwAyA28GtQkBDVEQohPyFj0agx2/IO8jFwACAA0ADgQECOALnA80E58W2RnZHJIf/CEGJJ8lrSYjAAAAAAABABEAAQAUAAEAFgABABkAAQAbAAEAHwAAAAAAAQARAAEAFAABABYAAQAZAAEAGwABAB8AAAAAAAIAFADfAb4DngV9B10JPAsbDfsO2RC3EpQUcRZOGCkaBRzfHbgfkCFmIzwlEwACAAQAMAg5EBMYsx8WAAIABADTCDMRERlhIBkAAgAFAC0Ivw+qFuMcYCIdAAIABwBKAh8HGA2HE/gZ8R/GJCMAAAAAAAEAEQABABQAAQAWAAEAGQABABsAAQAfAAAAAAACABQAKQCcAFIBQwJpA74EQAbpB7YJowuxDdoPHRJ4FOgWbxkIHLIebCE4JBMAAgAEAOMHxA+bF2IfFgACAAQAbwiWEHEY8h8ZAAIABQC8BxQP+BVTHA8iHQACAAcASgIfBxgNhxP4GfEfxiQjAAAAAAABAAIAAQAEAAEABgABAAgAAQAKAAEADAABAA4AAQAQAAEAEgABABQAAQAVAAEAFwABABkAAQAbAAEAHQABAB8AAQAhAAEAIwAAAAAAAAAZAAAAAAAAABkAAgAJAE4HsgxPEXMVPxnBHPwf7SJ5JSEAAAAAAAAAGQAAAAAAAAAZAAAAAAAAAAoAAgAMAEIDdQacCbYMxg/MEscVuhilG4oeZyE+JBUAAgAPAAgE1wdvC9YODRIUFewXlhoNHVEfXiEtI7Yk7SXAJiMAAAAAAAAACgACAAwAQgN1BpwJtgzGD8wSxxW6GKUbih5nIT4kFQACAA8ACATXB28L1g4NEhQV7BeWGg0dUR9eIS0jtiTtJcAmIwAAAAAAAAACAAIADQDUA3oH9QpGDnEReBRaFxkarxwgH2YhfiNjJQ4AAgAEAKIMQheLHwklEQAAABMAAgARAHYDxAbrCfEM1Q+YEjkVuxcaGlccbx5dIB8iriMDJRImyiYjAAAAAAAAAAIAAgANANQDegf1CkYOcRF4FFoXGRqvHCAfZiF+I2MlDgACAAQAogxCF4sfCSURAAAAEwACABEAdgPEBusJ8QzVD5gSORW7FxoaVxxvHl0gHyKuIwMlEibKJiMAAAAAAAAAGQACAAgAAQeFDHAR9xUyGiUeyiH/JCAAAAAAAAAAGQACAAgAAQeFDHAR9xUyGiUeyiH/JCAAAAAAAAAAAwACAAwAaAajCxMQ6BNBFzQa0hwjHzAh/yKSJO0lDgACAAQACg26F90fJCURAAAAEgACABIAWwXWCbQNFREVFMMWKhlUG0YdBx+YIP8hOyNPJDkl+CWMJuwmIwAAAAAAAAADAAIADABoBqMLExDoE0EXNBrSHCMfMCH/IpIk7SUOAAIABAAKDboX3R8kJREAAAASAAIAEgBbBdYJtA0VERUUwxYqGVQbRh0HH5gg/yE7I08kOSX4JYwm7CYjAAAAAAACAAgA8AfADqEUshkCHpYhZCROJgcAAAAJAAIABgB+By8ONRSmGZMeCSMOAAIABgA8CWURdBhTHuEi7CUTAAAAFAACAAsAEQZ4C0wQoRR/GPEb+R6WIcQjeCWfJh4AAAAjAAAAAAACAAgA8AfADqEUshkCHpYhZCROJgcAAAAJAAIABgB+By8ONRSmGZMeCSMOAAIABgA8CWURdBhTHuEi7CUTAAAAFAACAAsAEQZ4C0wQoRR/GPEb+R6WIcQjeCWfJh4AAAAjAAAAAAAAABkAAAAAAAAAGQAAAAAAAAAZAAIACgArBg8LXQ9JE+4WWBqKHYUgPyOcJSIAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAABEA//8SAAAAIwD//wAAAQADAAIAAwCMCIcThB4FAAAADQACAAUAtgMHC4cTCRxaIxEAAQASAAIABQAbBSMMhxPtGvUhFgAAAB4AAgAGAN8CwAjSDz4XUB4xJCMAAAAAAAAABwD//wkAAAATAP//FAAAAB4A//8AAAIAAwCMCIcThB4CAAAABQACAAMAHweHE/EfBwABAAkAAgACACMM7RoKAAAADgACAAYA3wLACNIPPhdQHjEkEwABABQAAgADAIwIhxOEHhYAAAAZAAIABgDfAsAI0g8+F1AeMSQeAAAAAAAAACMA//8AAAEAAgACAAkAlAJ0BrEKFA+HE/wXXxycIHwkCgAAABgAAgAMAPoAQQNJBskJlA2HEYkVfBlHHccgzyMWJiMAAAAAAAAAEQD//xMAAAAjAP//AAABAAIAAgAHAJAHZg6VFBoa7h7tItYlCAAAAAsAAgAHAEoCHwcYDYcT+BnxH8YkEQABABMAAgAGAHsH7g3zE6IZ9x7KIxgAAAAbAAIACQCOAQAFbAldDocTsxikHRAigiUjAAAAAAAAACAA//8AAAEAGQABABwAAgAFAP8LbBW9HCgisyUgAAAAAAAAAB0A//8AAAEAGQAAAAAAAAAAAAAAAAAAACIA//8AAAEAGQAAAB0AAgAGAHcJnRGMGEgexyLaJSIAAAAAAAAAAAAAAAAAAAAhAP//AAABABkAAAAbAAIABwBXBzgOjxRFGjcfNyP8JSEAAAAAAAAAAAD//xYAAAAAAAAAAAAAAAkA//8LAAAAEQD//xMAAAAaAP//HAAAAAAAAQAEAAIABgD+CTYSBBmQHuMi3CUJAAEACwABAA4AAgAEAHcNwheIH9kkEQABABMAAQAWAAIABQB4C6EU8RuWIXglGgABABwAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAgAfAC8AqwBkAUoCVgOCBMYFHweKCAUKigsYDa4OSRDoEYcTKBXHFmIY+BmGGwsdhh7xH0ohjiK6I8YkrCVlJuEmHgACAB8ALwCrAGQBSgJWA4IExgUfB4oIBQqKCxgNrg5JEOgRhxMoFccWYhj4GYYbCx2GHvEfSiGOIrojxiSsJWUm4SY8AAAAAAACAA8ATAOTBtIJAw0kEDITJhb8GK0bMx6EIJYiXCTEJbUmDgABACwAAgARAE0AGwFNAs8DkQWJB64J+AtiDuUQgBMuFugYsRuDHlohNCQ8AAAAAAACAB8ALwCrAGQBSgJWA4IExgUfB4oIBQqKCxgNrg5JEOgRhxMoFccWYhj4GYYbCx2GHvEfSiGOIrojxiSsJWUm4SYeAAIAHwAvAKsAZAFKAlYDggTGBR8HiggFCooLGA2uDkkQ6BGHEygVxxZiGPgZhhsLHYYe8R9KIY4iuiPGJKwlZSbhJjwAAAAAAAIAEAAQAxwGJAkiDBUP+BHIFH8XGxqWHOceCCHxIpIk3SW8Jg8AAQAtAAIAEABUADMBfgIfBAgGKQh6CvUMkQ9IEhgV+xfuGuwd9CAAJDwAAAAAAAIAEAAQAxwGJAkiDBUP+BHIFH8XGxqWHOceCCHxIpIk3SW8Jg8AAQAtAAIAEABUADMBfgIfBAgGKQh6CvUMkQ9IEhgV+xfuGuwd9CAAJDwAAAAAAAIAEAAQAxwGJAkiDBUP+BHIFH8XGxqWHOceCCHxIpIk3SW8Jg8AAQAtAAIAEABUADMBfgIfBAgGKQh6CvUMkQ9IEhgV+xfuGuwd9CAAJDwAAAAAAAIAHwAvAKsAZAFKAlYDggTGBR8HiggFCooLGA2uDkkQ6BGHEygVxxZiGPgZhhsLHYYe8R9KIY4iuiPGJKwlZSbhJh4AAgAfAC8AqwBkAUoCVgOCBMYFHweKCAUKigsYDa4OSRDoEYcTKBXHFmIY+BmGGwsdhh7xH0ohjiK6I8YkrCVlJuEmPAAAAAAAAgANAO0DygeUC0IP0RI6FnYZfRxDH7wh2iOGJaUmDAACAB8ALwCrAGQBSgJWA4IExgUfB4oIBQqKCxgNrg5JEOgRhxMoFccWYhj4GYYbCx2GHvEfSiGOIrojxiSsJWUm4SYqAAIAEwBFAPwADAJhA+8EqwaPCJMKsAzlDi0RgxPlFVIYxBo8HbQfLCKhJDwAAAAAAAIADwBMA5MG0gkDDSQQMhMmFvwYrRszHoQgliJcJMQltSYOAAIAHwAvAKsAZAFKAlYDggTGBR8HiggFCooLGA2uDkkQ6BGHEygVxxZiGPgZhhsLHYYe8R9KIY4iuiPGJKwlZSbhJiwAAQA8AAAAAAACAB8ALwCrAGQBSgJWA4IExgUfB4oIBQqKCxgNrg5JEOgRhxMoFccWYhj4GYYbCx2GHvEfSiGOIrojxiSsJWUm4SYeAAIAHwAvAKsAZAFKAlYDggTGBR8HiggFCooLGA2uDkkQ6BGHEygVxxZiGPgZhhsLHYYe8R9KIY4iuiPGJKwlZSbhJjwAAAAAAAIAHwAvAKsAZAFKAlYDggTGBR8HiggFCooLGA2uDkkQ6BGHEygVxxZiGPgZhhsLHYYe8R9KIY4iuiPGJKwlZSbhJh4AAgAfAC8AqwBkAUoCVgOCBMYFHweKCAUKigsYDa4OSRDoEYcTKBXHFmIY+BmGGwsdhh7xH0ohjiK6I8YkrCVlJuEmPAAAAAAAAgAPAEwDkwbSCQMNJBAyEyYW/BitGzMehCCWIlwkxCW1Jg4AAQAsAAIAEQBNABsBTQLPA5EFiQeuCfgLYg7lEIATLhboGLEbgx5aITQkPAAAAAAAAgAQABADHAYkCSIMFQ/4EcgUfxcbGpYc5x4IIfEikiTdJbwmDwABAC0AAgAQAFQAMwF+Ah8ECAYpCHoK9QyRD0gSGBX7F+4a7B30IAAkPAAAAAAAAgAQABADHAYkCSIMFQ/4EcgUfxcbGpYc5x4IIfEikiTdJbwmDwACAB8ALwCrAGQBSgJWA4IExgUfB4oIBQqKCxgNrg5JEOgRhxMoFccWYhj4GYYbCx2GHvEfSiGOIrojxiSsJWUm4SYtAAIAEABUADMBfgIfBAgGKQh6CvUMkQ9IEhgV+xfuGuwd9CAAJDwAAAAAAAIAEQDQAqIFcgg+CwQOvxBsEwcWjhj7Gkodcx9wITYjvCTxJcImEAABAC4AAgAPAFkASAGrAmwEeQbFCEcL9A3HELkTyBbsGSMdZiC3IzwAAAAAAAEACwABAA8AAQATAAEAFwABABsAAQAoAAAAAAABAAsAAQAPAAEAEwABABsAAQAoAAAAAAACABAAEAMcBiQJIgwVD/gRyBR/FxsalhznHggh8SKSJN0lvCYPAAEALQACABAAVAAzAX4CHwQIBikIegr1DJEPSBIYFfsX7hrsHfQgACQ8AAAAAAACAB8ALwCrAGQBSgJWA4IExgUfB4oIBQqKCxgNrg5JEOgRhxMoFccWYhj4GYYbCx2GHvEfSiGOIrojxiSsJWUm4SYeAAIAHwAvAKsAZAFKAlYDggTGBR8HiggFCooLGA2uDkkQ6BGHEygVxxZiGPgZhhsLHYYe8R9KIY4iuiPGJKwlZSbhJjwAAAAAAAIAHwAvAKsAZAFKAlYDggTGBR8HiggFCooLGA2uDkkQ6BGHEygVxxZiGPgZhhsLHYYe8R9KIY4iuiPGJKwlZSbhJh4AAgAfAC8AqwBkAUoCVgOCBMYFHweKCAUKigsYDa4OSRDoEYcTKBXHFmIY+BmGGwsdhh7xH0ohjiK6I8YkrCVlJuEmPAAAAAAAAQAFAAEACAABAAoAAQAOAAEAEAABABUAAQAYAAEAGgABAB4AAQAgAAEAJQABACgAAQAqAAEALgABADAAAQAyAAEANQABADcAAQA5AAEAPAAAAAAAAQADAAEABwABAAwAAQAPAAEAEgABABcAAQAaAAEAHQABACEAAQAmAAEAKQABACwAAQAwAAEAMwABADYAAQA5AAEAPAAAAAAAAgAFAHMBbAV3C0IThxwEAAIABgD+CTYSBBmQHuMi3CUJAAAACwACAAQADwKdB/QPkRoOAAIABAB3DcIXiB/ZJBEAAAATAAIABAAPAp0H9A+RGhYAAgAFAHgLoRTxG5YheCUaAAAAHAACAAQADwKdB/QPkRofAAIABgD+CTYSBBmQHuMi3CUkAAAAJQACAAQADwKdB/QPkRooAAIABAB3DcIXiB/ZJCsAAAAtAAIABAAPAp0H9A+RGjAAAgAFAHgLoRTxG5YheCU0AAAANQACAAQADwKdB/QPkRo4AAIABAB3DcIXiB/ZJDsAAAA8AAAAAAACAAUAcwFsBXcLQhOHHAQAAgAGAP4JNhIEGZAe4yLcJQkAAAALAAIABAAPAp0H9A+RGg4AAgAEAHcNwheIH9kkEQAAABMAAgAEAA8CnQf0D5EaFgACAAUAeAuhFPEbliF4JRoAAAAcAAIABAAPAp0H9A+RGh8AAgAGAP4JNhIEGZAe4yLcJSQAAAAlAAIABAAPAp0H9A+RGigAAgAEAHcNwheIH9kkKwAAAC0AAgAEAA8CnQf0D5EaMAACAAUAeAuhFPEbliF4JTQAAAA1AAIABAAPAp0H9A+RGjgAAgAEAHcNwheIH9kkOwAAADwAAAAAAAEAAwABAAUAAQAIAAEACwABAA4AAQAQAAEAEwABABYAAQAZAAEAGwABAB4AAQAhAAEAJAABACYAAQApAAEALAABAC8AAQAxAAEANAABADcAAQA5AAEAPAAAAAAAAgAfAC8AqwBkAUoCVgOCBMYFHweKCAUKigsYDa4OSRDoEYcTKBXHFmIY+BmGGwsdhh7xH0ohjiK6I8YkrCVlJuEmHgACAB8ALwCrAGQBSgJWA4IExgUfB4oIBQqKCxgNrg5JEOgRhxMoFccWYhj4GYYbCx2GHvEfSiGOIrojxiSsJWUm4SY8AAAAAAABAAUAAQAIAAEACgABAA4AAQAQAAEAFQABABgAAQAaAAEAHgABACAAAQAlAAEAKAABACoAAQAuAAEAMAABADIAAQA1AAEANwABADkAAQA8AAAAAAABAAMAAQAFAAEACAABAAsAAQAOAAEAEAABABMAAQAWAAEAGQABABsAAQAeAAEAIQABACQAAQAmAAEAKQABACwAAQAvAAEAMQABADQAAQA3AAEAOQABADwAAAAAAAEAAwABAAUAAQAIAAEACwABAA4AAQAQAAEAEwABABYAAQAZAAEAGwABAB4AAQAhAAEAJAABACYAAQApAAEALAABAC8AAQAxAAEANAABADcAAQA5AAEAPAAAAAAAAgALAHAApgGFA/QF4Ag6DPYPCBRnGAwd8SEKAAIAFQC0AXcDRwUjBwYJ8AreDNAOwhC0EqMUkBZ1GFQaKBzyHawfViHrImokzSUeAAIAEQBqAQEDvgSbBpUIqArODAgPURGnEwcWbhjcGkwdwB8zIqMkLgACAA8AjwMNB3cKyQ0BERwUExfhGYMc8R4jIRIjsCTxJcQmPAAAAAAAAgALAHAApgGFA/QF4Ag6DPYPCBRnGAwd8SEKAAIAFQC0AXcDRwUjBwYJ8AreDNAOwhC0EqMUkBZ1GFQaKBzyHawfViHrImokzSUeAAIAEQBqAQEDvgSbBpUIqArODAgPURGnEwcWbhjcGkwdwB8zIqMkLgACAA8AjwMNB3cKyQ0BERwUExfhGYMc8R4jIRIjsCTxJcQmPAAAAAAAAQACAAEABAABAAYAAQAIAAEACgABAAwAAQAOAAEAEAABABIAAQAUAAEAFgABABgAAQAaAAEAHAABAB4AAQAgAAEAIgABACQAAQAmAAEAKAABACoAAQAsAAEALgABADAAAQAyAAEANAABADYAAQA4AAEAOgABADwAAAAAAAEAAgABAAQAAQAGAAEACAABAAoAAQAMAAEADgABABAAAQASAAEAFAABABYAAQAYAAEAGgABABwAAQAeAAEAIAABACIAAQAkAAEAJgABACgAAQAqAAEALAABAC4AAQAwAAEAMgABADQAAQA2AAEAOAABADoAAQA8AAAAAAABAAIAAQAEAAEABgABAAgAAQAKAAEADAABAA4AAQAQAAEAEgABABQAAQAWAAEAGAABABoAAQAcAAEAHgABACAAAQAiAAEAJAABACYAAQAoAAEAKgABACwAAQAuAAEAMAABADIAAQA0AAEANgABADgAAQA6AAEAPAAAAAAAAgALAHAApgGFA/QF4Ag6DPYPCBRnGAwd8SEKAAIAFQC0AXcDRwUjBwYJ8AreDNAOwhC0EqMUkBZ1GFQaKBzyHawfViHrImokzSUeAAIAEQBqAQEDvgSbBpUIqArODAgPURGnEwcWbhjcGkwdwB8zIqMkLgACAA8AjwMNB3cKyQ0BERwUExfhGYMc8R4jIRIjsCTxJcQmPAAAAAAAAgALAHAApgGFA/QF4Ag6DPYPCBRnGAwd8SEKAAIAFQC0AXcDRwUjBwYJ8AreDNAOwhC0EqMUkBZ1GFQaKBzyHawfViHrImokzSUeAAIAEQBqAQEDvgSbBpUIqArODAgPURGnEwcWbhjcGkwdwB8zIqMkLgACAA8AjwMNB3cKyQ0BERwUExfhGYMc8R4jIRIjsCTxJcQmPAAAAAAAAgALAHAApgGFA/QF4Ag6DPYPCBRnGAwd8SEKAAIAFQC0AXcDRwUjBwYJ8AreDNAOwhC0EqMUkBZ1GFQaKBzyHawfViHrImokzSUeAAIAEQBqAQEDvgSbBpUIqArODAgPURGnEwcWbhjcGkwdwB8zIqMkLgACAA8AjwMNB3cKyQ0BERwUExfhGYMc8R4jIRIjsCTxJcQmPAAAAAAAAgALAHAApgGFA/QF4Ag6DPYPCBRnGAwd8SEKAAIAFQC0AXcDRwUjBwYJ8AreDNAOwhC0EqMUkBZ1GFQaKBzyHawfViHrImokzSUeAAIAEQBqAQEDvgSbBpUIqArODAgPURGnEwcWbhjcGkwdwB8zIqMkLgACAA8AjwMNB3cKyQ0BERwUExfhGYMc8R4jIRIjsCTxJcQmPAAAAAAAAgAUAHoC9QRrB9sJRgypDgMRUBOQFcEX3RnjG9Idox9SIdoiNSRbJUAm2CYTAAIAHwAvAKsAZAFKAlYDggTGBR8HiggFCooLGA2uDkkQ6BGHEygVxxZiGPgZhhsLHYYe8R9KIY4iuiPGJKwlZSbhJjEAAgAMAIsA9AH9A4EGYwmRDPoPkxNQFygbFh8PIzwAAAAAAAIAEgC+AnkFMAjiCooNJxC2EjcVoxf5GTQcTx5GIBEiqiMFJRYmzCYRAAIAHwAvAKsAZAFKAlYDggTGBR8HiggFCooLGA2uDkkQ6BGHEygVxxZiGPgZhhsLHYYe8R9KIY4iuiPGJKwlZSbhJi8AAgAOAGoAggEcAxwFbQcACsoMvg/XEg0WWRm4HCQgmCM8AAAAAAABAAsAAQAPAAEAEwABABcAAQAbAAEAKAAAAAAAAQALAAEADwABABMAAQAXAAEAGwABACgAAAAAAAEACwABAA8AAQATAAEAFwABABsAAQAoAAAAAAABAAsAAQAPAAEAEwABABcAAQAbAAEAKAAAAAAAAQALAAEADwABABMAAQAXAAEAGwABACgAAAAAAAEACwABAA8AAQATAAEAFwABABsAAQAoAAAAAAABAAsAAAAPAAEAEwABABcAAQAbAAEAKAAAAAAAAQALAAAADwABABMAAQAXAAEAGwABACgAAAAAAAEACwABAA8AAQATAAEAFwABABsAAQAoAAAAAAABAAsAAQAPAAEAEwABABcAAQAbAAEAKAAAAAAAAQALAAEADwABABMAAQAXAAEAGwABACgAAAAAAAEACwABAA8AAQATAAEAFwABABsAAQAoAAAAAAACABIAxwKLBUgIAAusDU4Q4RJhFc4XIxpcHHQeZiAsIr8jFCUeJs8mEQACAB8AGQBhAM8AXwENAtYCtAOoBK8FxwbtByEJYQqtCwMNYg7JDzgRrRIqFKwVMxe+GEwa3htyHQkfoyA9ItgjdCUvAAIADgDBAI4CAAXfBwcLXQ7MEUQVsxgJHDEfECKCJE8mPAAAAAAAAgAPAEwDkwbSCQMNJBAyEyYW/BitGzMehCCWIlwkxCW1Jg4AAgAfAC8AqwBkAUoCVgOCBMYFHweKCAUKigsYDa4OSRDoEYcTKBXHFmIY+BmGGwsdhh7xH0ohjiK6I8YkrCVlJuEmLAACABEATQAbAU0CzwORBYkHrgn4C2IO5RCAEy4W6BixG4MeWiE0JDwAAAAAAAIAEgDHAosFSAgAC6wNThDhEmEVzhcjGlwcdB5mICwivyMUJR4mzyYRAAIAHwAvAKsAZAFKAlYDggTGBR8HiggFCooLGA2uDkkQ6BGHEygVxxZiGPgZhhsLHYYe8R9KIY4iuiPGJKwlZSbhJi8AAgAOAG0AiwEsAzIFiQcgCusM4Q/6Ei4WdxnQHDYgoiM8AAAAAAACAA8ATAOTBtIJAw0kEDITJhb8GK0bMx6EIJYiXCTEJbUmDgACAB8ALwCrAGQBSgJWA4IExgUfB4oIBQqKCxgNrg5JEOgRhxMoFccWYhj4GYYbCx2GHvEfSiGOIrojxiSsJWUm4SYsAAIAEQBNABsBTQLPA5EFiQeuCfgLYg7lEIATLhboGLEbgx5aITQkPAAAAAAAAgARANACogVyCD4LBA6/EGwTBxaOGPsaSh1zH3AhNiO8JPElwiYQAAEALgACAA8AWQBIAasCbAR5BsUIRwv0DccQuRPIFuwZIx1mILcjPAAAAAAAAgAfAC8AqwBkAUoCVgOCBMYFHweKCAUKigsYDa4OSRDoEYcTKBXHFmIY+BmGGwsdhh7xH0ohjiK6I8YkrCVlJuEmHgACAB8ALwCrAGQBSgJWA4IExgUfB4oIBQqKCxgNrg5JEOgRhxMoFccWYhj4GYYbCx2GHvEfSiGOIrojxiSsJWUm4SY8AAAAAAACAB8ALwCrAGQBSgJWA4IExgUfB4oIBQqKCxgNrg5JEOgRhxMoFccWYhj4GYYbCx2GHvEfSiGOIrojxiSsJWUm4SYeAAIAHwAvAKsAZAFKAlYDggTGBR8HiggFCooLGA2uDkkQ6BGHEygVxxZiGPgZhhsLHYYe8R9KIY4iuiPGJKwlZSbhJjwAAAAAAAAAAwACABoAUwKVBMQG4gjxCvEM4Q7EEJgSXRQTFrsXVBndGlccwR0YH10gjiGqIq4jmCRmJRImlybwJhwAAAAeAAIAHAAfAiAECQbgB6cJYAsODbIOSxDbEWIT4RRYFsUXKxmIGtwbJx1nHp0fxyDlIfMi8SPaJKolWSbaJjkAAAAAAAAAAwACABoAUwKVBMQG4gjxCvEM4Q7EEJgSXRQTFrsXVBndGlccwR0YH10gjiGqIq4jmCRmJRImlybwJhwAAAAeAAIAHAAfAiAECQbgB6cJYAsODbIOSxDbEWIT4RRYFsUXKxmIGtwbJx1nHp0fxyDlIfMi8SPaJKolWSbaJjkAAAAAAAAAEAACACoAnwEvA7QELQadBwMJXwqxC/wMPw55D60Q2hH+EhwUMhVDFkwXTxhMGUIaMRsZHPoc1R2pHnYfOyD4IK0hWiIAI5sjLiS2JDQlpSUKJmImqibgJgMnOQAAAAAAAAAQAAIAKgCfAS8DtAQtBp0HAwlfCrEL/Aw/DnkPrRDaEf4SHBQyFUMWTBdPGEwZQhoxGxkc+hzVHakedh87IPggrSFaIgAjmyMuJLYkNCWlJQomYiaqJuAmAyc5AAAAAAAAAAUAAgAZAAEEgwegCm0N9g9HEmgUXxYtGNoZaBvZHC0eaB+KIJUhiiJoIzEk5CSAJQYmcybGJvwmHQAAAB4AAgAfACQDxAUXCC0KGwzlDZIPKBGqEhgUdhXGFgcYPBllGoMblRyfHZ0ekR97IFshMSL8IrwjbyQVJawlMSafJu8mPAAAAAAAAAAFAAIAGQABBIMHoAptDfYPRxJoFF8WLRjaGWgb2RwtHmgfiiCVIYoiaCMxJOQkgCUGJnMmxib8Jh0AAAAeAAIAHwAkA8QFFwgtChsM5Q2SDygRqhIYFHYVxhYHGDwZZRqDG5Ucnx2dHpEfeyBbITEi/CK8I28kFSWsJTEmnybvJjwAAAAAAAIADAChBa8KOw9ZExAXZxpkHQcgTiI0JLAlryYLAAAADgACABEAIATwB3gLwA7MEaEUQheyGfEbAh7kH5YhFiNkJHglTibcJh4AAAAgAAIAEQD3A3QHoAqPDU0Q4hJTFaMX1hnsG+Qdvh96IREjfiS3JaQmMAAAAAAAAgAMAKEFrwo7D1kTEBdnGmQdByBOIjQksCWvJgsAAAAOAAIAEQAgBPAHeAvADswRoRRCF7IZ8RsCHuQfliEWI2QkeCVOJtwmHgAAACAAAgARAPcDdAegCo8NTRDiElMVoxfWGewb5B2+H3ohESN+JLclpCYwAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAdAP//HgAAADwA//8AAAEABQACAAUAGwUjDIcT7Rr1IQkAAAAWAAIACADfAesFBwumEGoWCRwlITElHQABAB4AAgAIAPoCYAcjDA0RAxbtGrAfFiQlAAAAMgACAAsAIAG2Ax8HBws2D4cT2hcJHPEfWiPwJTwAAAAAAAAACwD//w4AAAAeAP//IAAAADAA//8AAAIABAB0BhQP/BecIAMAAAAIAAIABAAABV0OsxgQIgsAAQAOAAIABAB0BhQP/BecIBEAAAAXAAIACADfAesFBwumEGoWCRwlITElHgABACAAAgAEAHQGFA/8F5wgIwAAACkAAgAIAN8B6wUHC6YQahYJHCUhMSUwAAAAAAAAADkA//8AAAEACQACAAgA3wHrBQcLphBqFgkcJSExJRAAAQAnAAIAEwByAI4BHgMABR8HbAnYC10O7hCHEyIWsxg4G6Qd8R8QIvIjgiWeJjkAAAAAAAAAHAD//x4AAAA5AP//AAABAAMAAgALACABtgMfBwcLNg+HE9oXCRzxH1oj8CUNAAAAEgACAAsAIAG2Ax8HBws2D4cT2hcJHPEfWiPwJRwAAQAeAAIACgD3BEwJXQ1CEQIVoBgcHG8fiyJPJScAAAAsAAIADgDBAI4CAAXfBwcLXQ7MEUQVsxgJHDEfECKCJE8mOQAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAACQD//wsAAAARAP//EwAAABoA//8cAAAAJAD//yUAAAArAP//LQAAADQA//81AAAAOwD//zwAAAAAAAEABAACAAYA/gk2EgQZkB7jItwlCQABAAsAAQAOAAIABAB3DcIXiB/ZJBEAAQATAAEAFgACAAUAeAuhFPEbliF4JRoAAQAcAAEAHwACAAYA/gk2EgQZkB7jItwlJAABACUAAQAoAAIABAB3DcIXiB/ZJCsAAQAtAAEAMAACAAUAeAuhFPEbliF4JTQAAQA1AAEAOAACAAQAdw3CF4gf2SQ7AAEAPAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAABADoAAgADADYQNBwJJDwAAgAFALkMiBbYHfQiBCZAAAAAbAAAAAAAAQA6AAIAAwA2EDQcCSQ8AAIABQC5DIgW2B30IgQmQAAAAGwAAAAAAAEABQABAAgAAQAKAAEADgABABAAAQAVAAEAGAABABoAAQAeAAEAIAABACUAAQAoAAEAKgABAC4AAQAwAAEAMgAAADoAAgADADYQNBwJJDwAAgAFALkMiBbYHfQiBCZAAAAAbAACAAcAsgC6AgQGfQoXEL8WbR5yAAIAAgBMDGIZcwABAHcAAQB5AAEAfgABAIEAAQCDAAEAhwABAIkAAQCLAAEAjgABAJAAAQCSAAEAlQAAAAAAAgAaADQAvACHAYcCsAP9BGUG5gd6CR4LzgyJDksQFBLgE6wVdxc+GQIbvhxuHhMgpyEqI5Uk5CUZAAIAHgAyALYAeAFqAoQDvgQSBnwH9wiBChUMtQ1aDwQRsRJfFAwWthdbGfsajxwZHpQf/iBSIowjpiSYJVom3iY2AAIAEQCKAN8BtgPrBWIIBwvMDaYQhxNqFkQZCRyuHiUhWiMxJYYmRgACAA8AVwOmBusJIw1IEFgTTRYjGdIbVB6gIK0ibCTMJbgmVAACACQAJACDABIByAGdAo0DkgSrBdMGCghLCZYK6QtDDaIOBxBsEdQSPBSkFQkXbhjNGScbehzFHQYfPSBlIX4igyNzJEgl/iWNJuwmdwACAB8ALwCrAGQBSgJWA4IExgUfB4oIBQqKCxgNrg5JEOgRhxMoFccWYhj4GYYbCx2GHvEfSiGOIrojxiSsJWUm4SaVAAAAAAACADcADQAwAGcAsAAJAW8B4gFgAucCeAMSBLMEWwUJBr0Gdgc0CPYIvAmGClMLIwz2DMoNog56D1MQLxEMEugSxxOlFIMVYBY9FxsY9RjQGaoaghtXHCsd+x3KHpUfXCAgIeEhmyJRIwMkrSRSJe8lhCY2AAIAEQCKAN8BtgPrBWIIBwvMDaYQhxNqFkQZCRyuHiUhWiMxJYYmRgACADIADQEYAiUDMAQ5BUQGTAdTCFoJXQpiC2QMZA1jDl8PWRBREUcSOxMrFBkVBRbtFtIXtBiRGWsaQhsTHOAcqR1sHiof4x+WIEIh5yGGIh0jrCMzJLEkJSWPJe4lQiaJJsIm7CYHJ3cAAgAfAC8AqwBkAUoCVgOCBMYFHweKCAUKigsYDa4OSRDoEYcTKBXHFmIY+BmGGwsdhh7xH0ohjiK6I8YkrCVlJuEmlQAAAAAAAQA6AAIAAwDiBnMQCBs8AAAAawAAAAAAAQADAAEABQABAAgAAQALAAEADgABABAAAQATAAEAFgABABkAAQAbAAEAHgABACEAAQAkAAEAJgABACkAAQAsAAEALwABADEAAAA6AAIAAwDiBnMQCBs8AAAAawABAG0AAQBvAAEAcgABAHQAAQB3AAEAegABAH0AAQB/AAEAggABAIUAAQCIAAEAigABAI0AAQCQAAEAkgABAJUAAAAAAAEAEQABABUAAQAZAAEAIQABAC4AAQAwAAEAMwABADgAAQA9AAEAQAABAEQAAQBMAAEAVAABAFgAAQBfAAEAaAABAHEAAQB0AAEAfAABAIEAAQCEAAEAhwABAI0AAQCVAAAAAAACAA4AqwlcEGYVWxmEHBMfIyHOIiAkJyXtJXom1CYDJw0AAgAGAPMEIwqNDykV9xrvIBIAAgAEAFMH7g7JFtceFQACAAUANwaIDPgShxk5IBkAAgAGAGoF4ApjEPUVlxtKIR4AAgAFAFIGtgwqE7QZVSAiAAIAAwD9ChEVYh4kAAIAAwDyCb0Tbh0mAAIAAwDyCb0Tbh0oAAIAAwD7Cd8Tlx0qAAIAAwD6CdsTkh0sAAIAAwD1CdcTkR0uAAIAAwD1CdcTkR0wAAIAAwAeCvgTmx0yAAIACQDgA74HnwuCD2cTThc4GyYfGSM6AAIAAwAkB4gQWhs8AAAAawACAAUADxGdGRgf0yJgJW8AAgAEAE8QBxu+IYIlcgACAAUApAkVEokZ5B/IJHYAAgAgANQBogNpBSsH5wiZCkcM6w2IDx0RqRIsFKQVFBd4GNEZHxthHJUduh7TH9wg1SG8IpIjVSQDJZslGyaDJtAm/yaVAAAAAAACAA4AqwlcEGYVWxmEHBMfIyHOIiAkJyXtJXom1CYDJw0AAgAGAPMEIwqNDykV9xrvIBIAAgAEAFMH7g7JFtceFQACAAoAYAPIBjgKsQ0zEb8UUxjyG5wfUCMeAAIABQBSBrYMKhO0GVUgIgACABEAiAICBW8H0QknDHEOsRDnEhEVMxdLGVsbYh1gH1chRyMuJTIAAgAJAOADvgefC4IPZxNOFzgbJh8ZIzoAAgADACQHiBBaGzwAAABrAAIABQAPEZ0ZGB/TImAlbwACAAQATxAHG74hgiVyAAIABQCkCRUSiRnkH8gkdgACACAA1AGiA2kFKwfnCJkKRwzrDYgPHRGpEiwUpBUUF3gY0RkfG2EclR26HtMf3CDVIbwikiNVJAMlmyUbJoMm0Cb/JpUAAAAAAAIAOwDZAlwFnwerCYwLRg3fDlwQvxELE0IUZhV6Fn0XchhbGTYaBRvKG4QcNh3cHXseEx+hHykgqiAjIZchBCJsIs4iKSOBI9MjICRoJKwk7CQnJV8lkiXBJe0lFiY6JlwmeiaVJq0mwibUJuQm8Sb7JgMnCScNJw8nOgACAAMAJAeIEFobPAAAAGsAAAAAAAAAAAACABAARgKOBNcGIglwC70NChBaEqgU9xZGGZQb4x0wIHwixyQPAAIABgCEBQsLlxApFsIbYyEUAAIAWgB8APgAdAHwAWsC5wJiA94DWQTTBE4FyAVDBr4GOAexByoIpAgeCZcJDwqHCgALeQvwC2gM3wxWDc0NQw66Di8PpA8aEI8QBBF4EewRXxLTEkUTuBMrFJsUDhV+Fe4VXxbOFj0XrBcaGIgY9hhiGc8ZOxqmGhAbexvkG04cthweHYUd7R1THrkeHh+CH+YfSCCqIA0hbSHOIS0ijCLpIkcjoyP/I1kktCQMJWUlvCUTJmgmvCZtAAEAbwABAHEAAQB0AAEAdwABAHwAAQCVAAAAAAAAAB4AAAAfAAIAAwCOERcdQyQhAAAAIwAAAI0AAACVAAAAAAAAAAYAAgADALcCdQq4FggAAAAJAAIAAwCOERcdQyQLAAIABAAiEE4aHSFhJQ4AAAAcAAIAAwC3AnUKuBYeAAAAHwACAAMAjhEXHUMkIQAAACMAAACGAAIAAwC3AnUKuBaIAAAAiQACAAMABw5KGP0giwAAAI0AAAAAAAEAEQAAABUAAQAZAAEAHQABACEAAQAuAAAAMAABADMAAQA1AAEAOAABAD0AAABAAAEARAABAEgAAQBMAAEAVAABAFgAAQBbAAEAXwABAGgAAQBxAAEAdAABAHgAAQB8AAEAgQAAAIQAAQCHAAEAigABAI0AAQCVAAAAAAACAA4AOADbAOMBSwMPBSkHlglSDFgPqBI9FhQaLB5/Ig0AAgAEAJMHQQ8NF/seEAACAAYATwW9CkMQ3xWMG0ghFQACAAQASA8bGmIhoSUYAAIABADJCY8Tjhy+IxsAAgAEAEgPGxpiIaElHgACAAQAyQmPE44cviMhAAIABABIDxsaYiGhJSQAAgAEAMkJjxOOHL4jJwACAAQASA8bGmIhoSUqAAIACQDCA44HYgs9DyMTEBcFGwEfBCMyAAIAAwCoCW0TQB00AAAANgAAADkAAgAEAN8Htw+HF1EfPAAAAFcAAgADANIMsxhgIlkAAgAWAEwCkwTYBhkJUwuGDbIP0hHoE/IV7BfWGa8bch0fH7EgJSJ2I6AkmyVfJuAmbgACAAUAlgYnDbATLxqlIHIAAgAkAKsBUAPxBIwGIQivCTgLugw0DqkPFRF7EtkTLhV8FsEX/BgtGlUbchyFHYweiB94IFshMCL3IrEjWiT0JHwl8iVVJqUm4CYEJ5UAAAAAAAIADgA4ANsA4wFLAw8FKQeWCVIMWA+oEj0WFBosHn8iDQACAAQAkwdBDw0X+x4QAAIABgBPBb0KQxDfFYwbSCEVAAIABABIDxsaYiGhJRgAAgAEAMkJjxOOHL4jGwACAAQASA8bGmIhoSUeAAIABADJCY8Tjhy+IyEAAgAEAEgPGxpiIaElJAACAAQAyQmPE44cviMnAAIABABIDxsaYiGhJSoAAgAJAMIDjgdiCz0PIxMQFwUbAR8EIzIAAgADAKgJbRNAHTQAAAA5AAIABADfB7cPhxdRHzwAAABOAAIACgAeBRQK2w5nE64XoxsyH0QiuyRrJlcAAgADANIMsxhgIlkAAgAWAEwCkwTYBhkJUwuGDbIP0hHoE/IV7BfWGa8bch0fH7EgJSJ2I6AkmyVfJuAmbgACAAUAlgYnDbATLxqlIHIAAgAkAKsBUAPxBIwGIQivCTgLugw0DqkPFRF7EtkTLhV8FsEX/BgtGlUbchyFHYweiB94IFshMCL3IrEjWiT0JHwl8iVVJqUm4CYEJ5UAAAAAAAEAEQABABUAAQAZAAEAHQABACEAAQAuAAEAMAABADMAAQA1AAEAOAABAD0AAQBAAAEARAABAEgAAQBMAAEAVAABAFgAAQBbAAEAXwABAGgAAQBxAAEAdAABAHgAAQB8AAEAgQABAIQAAQCHAAEAigABAI0AAQCVAAAAAAACAAcA2ASuCYkOZxNIGC4dGyIGAAIACABMBJoI6Qw6EYwV5RlCHqYiDQACAAQAvgd/D0kXIh8QAAIABgCEBQsLlxApFsIbYyEVAAIABABIDxsaYiGhJRgAAgAEANQK5RSmHTwkGwACAAQASA8bGmIhoSUeAAIABADUCuUUph08JCEAAgAEAEgPGxpiIaElJAACAAQA1ArlFKYdPCQnAAIABABIDxsaYiGhJSoAAgAJAPUD5AfPC7kPnhODF2YbSB8rIzIAAgADAJ8JYhM5HTQAAgADAL8JfRM/HTYAAgAEANEHmw9mFzYfOQACAAQA8wfPD5gXVx88AAAATgACAAoAJwUjCu0OehPCF7MbPh9OIsEkbSZXAAIAAwC/CX0TPx1ZAAIAFgBMApME2AYZCVMLhg2yD9IR6BPyFewX1hmvG3IdHx+xICUidiOgJJslXybgJm4AAgAFAJgGLw3AE0QatyByAAIAJAC+AXgDKgXTBngIEwqmCzMNtg4zEKYRDxNwFMgVFRdaGJMZwRrlG/0cCh4KH/4f5SC/IYoiSCP1I5QkIyWhJQ4maSawJuUmBSeVAAAAAAACABUAwgGFA0gFDQfTCJoKYAwnDu8PuBGAE0oVEhfaGKMaaxwzHvofwSGGI0wlFAACAA4AowJFBeQHgQoeDbkPUhLrFIMXGhqyHEgf4CF4JCEAAgAOAKECQgXkB4YKJg3GD2YSBBWgFzka0RxlH/chhiQuAAIAQACsAFYBAgKtAlcDAQSqBFQF/AWlBkwH8weaCEIJ5wmMCjIL1gt7DB4NwQ1kDgYPpg9HEOgQiBEnEsUSYxMAFJ0UOBXUFW8WCBehFzoY0hhpGf8ZlBopG70bUBziHHQdBR6VHiMfsh8/IMsgViHhIWoi8iJ6IwAkhSQKJY0lDyaQJm0AAgAFAJgGLw3AE0QatyBxAAIABgDCBXMLExGmFiocoiF2AAIAIAAHAgME9AXdB7kJigtSDQ0PvBBfEvYTfhX7FmoYyRkdG18ckx24HswfziDBIaEibyMqJNIkZiXlJU4moibfJgMnlQAAAAAAAgAFAHMBbAV3C0IThxwEAAIABgD+CTYSBBmQHuMi3CUJAAAACwACAAQADwKdB/QPkRoOAAIABAB3DcIXiB/ZJBEAAAATAAIABAAPAp0H9A+RGhYAAgAFAHgLoRTxG5YheCUaAAAAHAACAAQADwKdB/QPkRofAAIABgD+CTYSBBmQHuMi3CUkAAAAJQACAAQADwKdB/QPkRooAAIABAB3DcIXiB/ZJCsAAAAtAAIABAAPAp0H9A+RGjAAAAA6AAIAAwCrC+YV9h48AAAAUQABAFIAAgAEAA8CnQf0D5EaVQACAAQAdw3CF4gf2SRYAAAAWQACAAUAcwFsBXcLQhOHHF0AAgAGAP4JNhIEGZAe4yLcJWIAAABkAAIABAAPAp0H9A+RGmcAAgAEAHcNwheIH9kkagAAAGwAAgAEAA8CnQf0D5EabwACAAUAeAuhFPEbliF4JXMAAAB1AAIABAAPAp0H9A+RGngAAgAGAP4JNhIEGZAe4yLcJX0AAAB+AAIABAAPAp0H9A+RGoEAAgAEAHcNwheIH9kkhAAAAIYAAgAEAA8CnQf0D5EaiQACAAUAeAuhFPEbliF4JY0AAACOAAIABAAPAp0H9A+RGpEAAgAEAHcNwheIH9kklAAAAJUAAAAAAAIAPQAEAA8AIQA6AFoAgQCuAOIAHAFcAaMB7gFAApkC9QJZA8EDLgShBBkFlQUYBp4GKge6B04I5wiFCScKzQp3CycM2QyQDUsOCg/MD5IQXREqEvwS0BOoFIMVZBZFFywYFRkCGvAa4xvZHNEdzR7MH80g0SHZIuIj7iT+JTwAAABRAAEAUgAAAAAAAgAFAHMBbAV3C0IThxwEAAIABgD+CTYSBBmQHuMi3CUJAAAACwACAAQADwKdB/QPkRoOAAIABAB3DcIXiB/ZJBEAAAATAAIABAAPAp0H9A+RGhYAAgAFAHgLoRTxG5YheCUaAAAAHAACAAQADwKdB/QPkRofAAIABgD+CTYSBBmQHuMi3CUkAAAAJQACAAQADwKdB/QPkRooAAIABAB3DcIXiB/ZJCsAAAAtAAIABAAPAp0H9A+RGjAAAAA6AAIAAwCrC+YV9h48AAAAUQABAFIAAgAEAA8CnQf0D5EaVQACAAQAdw3CF4gf2SRYAAAAWQACAAUAcwFsBXcLQhOHHF0AAgAGAP4JNhIEGZAe4yLcJWIAAABkAAIABAAPAp0H9A+RGmcAAgAEAHcNwheIH9kkagAAAGwAAgAEAA8CnQf0D5EabwACAAUAeAuhFPEbliF4JXMAAAB1AAIABAAPAp0H9A+RGngAAgAGAP4JNhIEGZAe4yLcJX0AAAB+AAIABAAPAp0H9A+RGoEAAgAEAHcNwheIH9kkhAAAAIYAAgAEAA8CnQf0D5EaiQACAAUAeAuhFPEbliF4JY0AAACOAAIABAAPAp0H9A+RGpEAAgAEAHcNwheIH9kklAAAAJUAAAAAAAEAEQABABUAAQAZAAEAHQABACEAAQAuAAEAMAABADMAAQA1AAEAOAABAD0AAQBAAAEARAABAEgAAQBMAAEAVAABAFgAAQBbAAEAXwABAGgAAQBxAAEAdAABAHgAAQB8AAEAgQABAIQAAQCHAAEAigABAI0AAQCVAAAAAAACAAoAQgK3BYQJeA2AEZAVmBmMHVkhziQJAAEACwABAJMAAQCVAAAAAAACAAQAdAYUD/wXnCADAAEABQABAAcAAQAJAAEACwABAA0AAQAPAAEAEQABABMAAQAVAAEAFwABABkAAQAbAAEAHQABAB8AAQAhAAEAIwABACUAAQAnAAEAKQABACsAAQAtAAEALwABADEAAQAzAAEANQABADcAAQA5AAEAOwABAD0AAQA+AAEAQAABAEIAAQBEAAEARgABAEgAAQBKAAEASwABAE0AAQBPAAEAUQABAFMAAQBVAAEAVgABAFgAAQBaAAEAXAABAF4AAQBgAAEAYgABAGkAAQBrAAEAbQABAG8AAQBxAAEAcwABAHUAAQB3AAEAeQABAHsAAQB9AAEAfwABAIEAAQCDAAIAAwDfD8UZtCGFAAEAhwABAIkAAQCLAAEAjQABAI8AAQCRAAEAkwABAJUAAAAAAAIAEQAtAK4AfgGWAvEDigVeB2cJpAsQDqkQbhNbFm4ZpRz8H3cjEAACABUAfgEEA5EEJwbEB2kJFAvHDIAOQBAHEtMTphV+F10ZQhssHRsfECELIwslJAACABUAswFoAyAF2AaUCFIKEQzTDZYPXBEiE+sUthaBGE8aHhztHb4fkSFlIzolOAAAAFAAAgAgAI4BGwOoBDUGwQdNCdUKXAzgDWEP3BBVEsgTNhWeFv8XWRmqGvIbMR1jHoofpCCuIakikSNkJCIlxyVOJrYm+CZvAAIABAC+B38PSRciH3IAAgAkAG0B2QJEBK4FFwd9COIJRQumDAMOXQ+1EAcSVhOgFOQVJBdeGJAZuxrfG/wcDh4YHxYgCiHwIcoilSNQJPokkCUSJnsmyyb+JpUAAAAAAAEAEQABABUAAQAZAAEAHQABACEAAQAuAAEAMAABADMAAQA1AAEAOAABAD0AAQBAAAEARAABAEgAAQBMAAEAVAABAFgAAQBbAAEAXwABAGgAAQBxAAEAdAABAHgAAQB8AAEAgQABAIQAAQCHAAEAigABAI0AAQCVAAAAAAAAADoAAgADACoEeg2BGTwAAABrAAIACADfAesFBwumEGoWCRwlITElcgAAAAAAAgAVAMIBhQNIBQ0H0wiaCmAMJw7vD7gRgBNKFRIX2hijGmscMx76H8EhhiNMJRQAAgAOAKMCRQXkB4EKHg25D1IS6xSDFxoashxIH+AheCQhAAIADgChAkIF5AeGCiYNxg9mEgQVoBc5GtEcZR/3IYYkLgACAEAArABWAQICrQJXAwEEqgRUBfwFpQZMB/MHmghCCecJjAoyC9YLewweDcENZA4GD6YPRxDoEIgRJxLFEmMTABSdFDgV1BVvFggXoRc6GNIYaRn/GZQaKRu9G1Ac4hx0HQUelR4jH7IfPyDLIFYh4SFqIvIieiMAJIUkCiWNJQ8mkCZtAAIABQCYBi8NwBNEGrcgcQACAAYAwgVzCxMRphYqHKIhdgACACAABwIDBPQF3Qe5CYoLUg0ND7wQXxL2E34V+xZqGMkZHRtfHJMduB7MH84gwSGhIm8jKiTSJGYl5SVOJqIm3yYDJ5UAAAAAAAAAAAABABEAAAAVAAEAGQABAB0AAQAhAAEALgAAADAAAQAzAAEANQABADgAAQA9AAAAQAABAEQAAQBIAAEATAABAFQAAQBYAAEAWwABAF8AAQBoAAEAcQABAHQAAQB4AAEAfAABAIEAAACEAAEAhwABAIoAAQCNAAEAlQAAAAAAAgAJAN8DwwerC5UPgBNtF1kbQx8rIwgAAgAHANQEqgmCDl4TQRgpHRgiDgACAAcA2AS4CZwOhBNtGFQdNCIUAAIABwDXBLYJmQ6AE2gYTx0yIhoAAgAHANQEsQmWDnwTZRhNHTIiIAACAAcA1ASxCZYOfBNlGE0dMiImAAIASABxAp4ElgZgCAMKigv1DEoOhw+yEM8R2hLXE8gUrRWHFlUXHBjZGI4ZOhrfGn8bFhynHDMduB05HrQeKh+bHwcgbyDTIDMhjSHlIToiiiLXIiEjZyOqI+ojJyRhJJkkzST/JC4lWyWFJa0l0iX1JRYmNCZRJmsmgyaZJq0mvybPJt0m6ib0Jv0mBCcJJw0nDydtAAIABADmB7sPhxdNH3AAAgAEAOYHuw+HF00fcwACAAQA7wfYD7IXcx92AAIABADuB9UPrxdvH3kAAgAFALkGWQ3iE1cauiB9AAIABgDsBcALehEUF48c4yGCAAIAFABfA50GtwmvDIYPNhLAFCYXZRl8G2odLh/IIDYieCOLJG8lJCamJvUmlQAAAAAAAQARAAEAFQABABkAAQAdAAEAIQABAC4AAQAwAAEAMwABADUAAQA4AAEAPQABAEAAAQBEAAEASAABAEwAAQBUAAEAWAABAFsAAQBfAAEAaAABAHEAAQB0AAEAeAABAHwAAQCBAAEAhAABAIcAAQCKAAEAjQABAJUAAAAAAAEABQABAAgAAQAKAAEADgABABAAAQAVAAEAGAABABoAAQAeAAEAIAABACUAAQAoAAEAKgABAC4AAQAwAAEAMgABADUAAQA3AAEAOQABADwAAQBBAAEARAABAEYAAQBKAAEATQABAE8AAQBRAAEAVAABAFkAAQBcAAEAXgABAGIAAQBpAAEAbgABAHEAAQBzAAEAdwABAHkAAQB+AAEAgQABAIMAAQCHAAEAiQABAIsAAQCOAAEAkAABAJIAAQCVAAAAAAACAAkAgwD6AUwEZgc0C6oPuhRXGnYgCAACAAcAbgT8CKoNehJqF38ctiEOAAIABwCKBCwJ5g26EqcXrxzSIRQAAgAHAKgEXgkkDvkS4RfcHOwhGgACAAcAqQRmCTcOFxMHGAEdBCIgAAIABwDCBIwJXA41ExkYCR0FIiYAAgBIAHECngSWBmAIAwqKC/UMSg6HD7IQzxHaEtcTyBStFYcWVRccGNkYjhk6Gt8afxsWHKccMx24HTketB4qH5sfByBvINMgMyGNIeUhOiKKItciISNnI6oj6iMnJGEkmSTNJP8kLiVbJYUlrSXSJfUlFiY0JlEmayaDJpkmrSa/Js8m3SbqJvQm/SYEJwknDScPJ20AAgAEAOYHuw+HF00fcAACAAQA5Ae5D4MXSB9zAAIABADhB7QPgBdIH3YAAgAEAOEHtA+AF0gfeQACAAUAtgZTDdsTUBq2IH0AAgAGAN8FogtMEdwWVxy9IYIAAgAUACMDLgYiCfoLtg5YEdoTPhaAGKEanRx1HiYgriEJIzckNCUAJpUm8SaVAAAAAAACAAoAQgK3BYQJeA2AEZAVmBmMHVkhziQJAAEACwABAJMAAQCVAAAAAAACAAQAdAYUD/wXnCADAAEABQABAAcAAQAJAAEACwABAA0AAQAPAAEAEQABABMAAQAVAAEAFwABABkAAQAbAAEAHQABAB8AAQAhAAEAIwABACUAAQAnAAEAKQABACsAAQAtAAEALwABADEAAQAzAAEANQABADcAAQA5AAEAOwABAD0AAgACALEEBhI+AAEAQAABAEIAAQBEAAEARgABAEgAAQBKAAEASwABAE0AAQBPAAEAUQABAFMAAQBVAAIAAgCxBAYSVgABAFgAAQBaAAEAXAABAF4AAQBgAAEAYgABAGkAAQBrAAEAbQABAG8AAQBxAAEAcwABAHUAAQB3AAEAeQABAHsAAQB9AAEAfwABAIEAAQCDAAIAAwDfD8UZtCGFAAEAhwABAIkAAQCLAAEAjQABAI8AAQCRAAEAkwABAJUAAAAAAAAAAAACABEAJgJNBHYGoAjMCvgMJQ9TEYATrhXcFwsaOBxlHpIgvSLnJBAAAgAVAMsBlgNhBSwH+AjDCo0MWA4iEOwRtRN9FUQXCxnRGpUcWB4aINkhmCNUJSQAAgAXALYBawMeBc0GewgnCtELeQ0eD8IQZBIEFKMVPxfaGHUaDRyjHTkfzSBeIvAjgSU6AAAAUgACAB4AcAHfAkoEsgUZB3wI3Ak6C5UM7Q1BD5MQ4hEtE3YUuhX9FjsYdRmtGuAbER09HmYfiyCrIcci4CP0JAQmbwACAAQAwweVD20XQx9yAAIADQAlAzwGRQlBDC4PDBLdFKAXVhr9HJcfIiKgJH4AAgAYAMMCcQULCI4K/AxSD5ERtxPFFbkXlBlUG/kcgB7rHzkhZyJ2I2MkMCXaJV8mwSb8JpUAAAAAAAEAAwABAAUAAQAIAAEACwABAA4AAQAQAAEAEwABABYAAQAZAAEAGwABAB4AAQAhAAEAJAABACYAAQApAAEALAABAC8AAQAxAAEANAABADcAAQA5AAEAPAABAD8AAQBBAAEARAABAEcAAQBKAAEATAABAE8AAQBRAAEAVAABAFcAAQBZAAEAXAABAF8AAQBiAAEAaQABAGwAAQBvAAEAcgABAHQAAQB3AAEAegABAH0AAQB/AAEAggABAIUAAQCIAAEAigABAI0AAQCQAAEAkgABAJUAAAAAAAEAEQABABUAAQAZAAEAHQABACEAAQAuAAEAMAABADMAAQA1AAEAOAABAD0AAQBAAAEARAABAEgAAQBMAAEAVAABAFgAAQBbAAEAXwABAGgAAQBxAAEAdAABAHgAAQB8AAEAgQABAIQAAQCHAAEAigABAI0AAQCVAAAAAAACAAkA3wPDB6sLlQ+AE20XWRtDHysjCAACAAcA1ASqCYIOXhNBGCkdGCIOAAIABwDYBLgJnA6EE20YVB00IhQAAgAHANcEtgmZDoATaBhPHTIiGgACAAcA1ASxCZYOfBNlGE0dMiIgAAIABwDUBLEJlg58E2UYTR0yIiYAAgBIAHECngSWBmAIAwqKC/UMSg6HD7IQzxHaEtcTyBStFYcWVRccGNkYjhk6Gt8afxsWHKccMx24HTketB4qH5sfByBvINMgMyGNIeUhOiKKItciISNnI6oj6iMnJGEkmSTNJP8kLiVbJYUlrSXSJfUlFiY0JlEmayaDJpkmrSa/Js8m3SbqJvQm/SYEJwknDScPJ20AAgAEAOYHuw+HF00fcAACAAQA5ge7D4cXTR9zAAIABADvB9gPshdzH3YAAgAEAO4H1Q+vF28feQACAAUAuQZZDeITVxq6IH0AAgAGAOwFwAt6ERQXjxzjIYIAAgAUAF8DnQa3Ca8Mhg82EsAUJhdlGXwbah0uH8ggNiJ4I4skbyUkJqYm9SaVAAAAAAABABEAAQAVAAEAGQABAB0AAQAhAAEALgABADAAAQAzAAEANQABADgAAQA9AAEAQAABAEQAAQBIAAEATAABAFQAAQBYAAEAWwABAF8AAQBoAAEAcQABAHQAAQB4AAEAfAABAIEAAQCEAAEAhwABAIoAAQCNAAEAlQAAAAAAAQADAAEABQABAAgAAQALAAEADgABABAAAQATAAEAFgABABkAAQAbAAEAHgABACEAAQAkAAEAJgABACkAAQAsAAEALwABADEAAQA0AAEANwABADkAAQA8AAEAPwABAEEAAQBEAAEARwABAEoAAQBMAAEATwABAFEAAQBUAAEAVwABAFkAAQBcAAEAXwABAGIAAQBpAAEAbAABAG8AAQByAAEAdAABAHcAAQB6AAEAfQABAH8AAQCCAAEAhQABAIgAAQCKAAEAjQABAJAAAQCSAAEAlQAAAAAAAgAMAPoAQQNJBskJlA2HEYkVfBlHHccgzyMWJgsAAQAVAAIACAAHB4EMZhHrFSUaGh7AIfskHAABACQAAgAPANYG7QpCDi4R0hNDFooYrRqyHJoeaCAaIq0jHCVWJjIAAgADAD8D7wplFjQAAgADALYH6hBqGzYAAgADAKQICRItHDgAAgADAPsIdhJ6HDoAAgADAB4JoxKaHDwAAgADAEEJ0RK7HD4AAgADADkJ2BLOHEAAAgADAEkJ2BK/HEIAAgADAC0JsxKhHEQAAgAEAP4GUQ4JFj8eRwACABwASQGTAt4DKgV2BsQHEgliCrILBQ1XDqsP/xBWEq0TBhVgFrwXGBl2GtYbOB2aHgAgZiHNIjckoyViAAIACQC4A3gHQgsUD/IS3BbSGtge6yJqAAIABwB2BAQJrA1zEl4XbBymIXAAAgAEALMR1BscIsAlcwABAHoAAQCDAAIAEwDZBbQK0A5bEnAVIRiAGpUcah4HIG8hqSK4I54kXSX5JXImySb+JpUAAAAAAAIADAD6AEEDSQbJCZQNhxGJFXwZRx3HIM8jFiYLAAEAFQACAAgABweBDGYR6xUlGhoewCH7JBwAAQAkAAIADwDWBu0KQg4uEdITQxaKGK0ashyaHmggGiKtIxwlViYyAAIAOQAFABQALQBNAHYApgDdABsBYAGqAfoBUAKsAgwDcgPdA0wEwQQ6BbkFOwbCBk0H3QdxCAsJqAlJCu8KmgtIDPsMsw1wDjEP9g/BEJIRZhI/Ex8UAxXtFd4W0xfPGNIZ3BrsGwMdIx5MH34guCH8IkwkpyVqAAIABwB2BAQJrA1zEl4XbBymIXAAAgAEALMR1BscIsAlcwABAHoAAQCDAAIAEwDZBbQK0A5bEnAVIRiAGpUcah4HIG8hqSK4I54kXSX5JXImySb+JpUAAAAAAAIADAD6AEEDSQbJCZQNhxGJFXwZRx3HIM8jFiYLAAEAFQACAAgABweBDGYR6xUlGhoewCH7JBwAAQAkAAIADwDWBu0KQg4uEdITQxaKGK0ashyaHmggGiKtIxwlViYyAAIAAwA/A+8KZRY0AAIAAwC2B+oQahs2AAIAAwCkCAkSLRw4AAIAAwD7CHYSehw6AAIAAwAeCaMSmhw8AAIAAwBBCdESuxw+AAIAAwA5CdgSzhxAAAIAAwBJCdgSvxxCAAIAAwAtCbMSoRxEAAIABAD+BlEOCRY/HkcAAgAcAEkBkwLeAyoFdgbEBxIJYgqyCwUNVw6rD/8QVhKtEwYVYBa8FxgZdhrWGzgdmh4AIGYhzSI3JKMlYgACAAkAuAN4B0ILFA/yEtwW0hrYHusiagACAAcAdgQECawNcxJeF2wcpiFwAAIABACzEdQbHCLAJXMAAQB6AAEAgwACABMA2QW0CtAOWxJwFSEYgBqVHGoeByBvIakiuCOeJF0l+SVyJskm/iaVAAAAAAACAAwA+gBBA0kGyQmUDYcRiRV8GUcdxyDPIxYmCwABABUAAgAIAAcHgQxmEesVJRoaHsAh+yQcAAEAJAACAA8A1gbtCkIOLhHSE0MWihitGrIcmh5oIBoirSMcJVYmMgACADkABQAUAC0ATQB2AKYA3QAbAWABqgH6AVACrAIMA3ID3QNMBMEEOgW5BTsGwgZNB90HcQgLCagJSQrvCpoLSAz7DLMNcA4xD/YPwRCSEWYSPxMfFAMV7RXeFtMXzxjSGdwa7BsDHSMeTB9+ILgh/CJMJKclagACAAcAdgQECawNcxJeF2wcpiFwAAIABACzEdQbHCLAJXMAAQB6AAEAgwACABMA2QW0CtAOWxJwFSEYgBqVHGoeByBvIakiuCOeJF0l+SVyJskm/iaVAAAAAAACAAoAhwMNB5QKHQ6lETAVvBhLHN4fdSMJAAIABQB0BusMZxPqGXYgDQACAAgATASaCOkMOhGMFeUZQh6mIhQAAgAbAGcBzwI3BJ4FBwduCNYJPQumDA4OdQ/cEEMSqhMQFXYW3BdAGaUaCRxtHc8eMiCTIfMiUySzJS4AAgBAAKwAVgEBAqwCVgP/A6cEUQX4BZ8GRQfsB5EIOAncCX8KIwvHC2kMCw2sDU4O7w6ODy0QzRBrEQkSpRJBE90TeRQTFa4VRxbgFngXEBioGD4Z0xloGv0akRskHLYcSB3aHWoe+h6JHxggpSAyIb4hSiLVIl8j6CNwJPkkgCUGJosmbQACAAUAmAYvDcATRBq3IHEAAgAEAOQHuQ+DF0gfdAACAAQA7gfVD68Xbx93AAIABgDIBYMLMBHLFlEcviF8AAIACgADBPEHywuODzoTzRZGGqQd5iALJIUAAgARAOgDpQczC5IOvxG7FIQXFhp0HJgehCA1Iqgj3CTPJYAm7CaVAAAAAAACAAwA+gBBA0kGyQmUDYcRiRV8GUcdxyDPIxYmCwABABUAAgAIAAcHgQxmEesVJRoaHsAh+yQcAAEAJAACAA8A1gbtCkIOLhHSE0MWihitGrIcmh5oIBoirSMcJVYmMgACAAMAPwPvCmUWNAACAAMAtgfqEGobNgACAAMApAgJEi0cOAACAAMA+wh2EnocOgACAAMAHgmjEpocPAACAAMAQQnRErscPgACAAMAOQnYEs4cQAACAAMASQnYEr8cQgACAAMALQmzEqEcRAACAAQA/gZRDgkWPx5HAAIAHABJAZMC3gMqBXYGxAcSCWIKsgsFDVcOqw//EFYSrRMGFWAWvBcYGXYa1hs4HZoeACBmIc0iNySjJWIAAgAJALgDeAdCCxQP8hLcFtIa2B7rImoAAgAHAHYEBAmsDXMSXhdsHKYhcAACAAQAsxHUGxwiwCVzAAEAegABAIMAAgATANkFtArQDlsScBUhGIAalRxqHgcgbyGpIrgjniRdJfklcibJJv4mlQAAAAAAAgAMAPoAQQNJBskJlA2HEYkVfBlHHccgzyMWJgsAAQAVAAIACAAHB4EMZhHrFSUaGh7AIfskHAABACQAAgAPANYG7QpCDi4R0hNDFooYrRqyHJoeaCAaIq0jHCVWJjIAAgA5AAUAFAAtAE0AdgCmAN0AGwFgAaoB+gFQAqwCDANyA90DTATBBDoFuQU7BsIGTQfdB3EICwmoCUkK7wqaC0gM+wyzDXAOMQ/2D8EQkhFmEj8THxQDFe0V3hbTF88Y0hncGuwbAx0jHkwffiC4IfwiTCSnJWoAAgAHAHYEBAmsDXMSXhdsHKYhcAACAAQAsxHUGxwiwCVzAAEAegABAIMAAgATANkFtArQDlsScBUhGIAalRxqHgcgbyGpIrgjniRdJfklcibJJv4mlQAAAAAAAgAJAHIAwAHhA8sGdQrZDu4TrBkPIAgAAAAfAAAAAAAAAAAAAgAMAMcAqAI+BUsIqQs6D+oSpBZWGu0dUiFqJAsAAgALACEE/we5C1gP4BJRFqoZ5hwAIOgieSUVAAIACAAHB4EMZhHrFSUaGh7AIfskHAABACQAAgAPANYG7QpCDi4R0hNDFooYrRqyHJoeaCAaIq0jHCVWJjIAAgADAD8D7wplFjQAAgADALYH6hBqGzYAAgADAKQICRItHDgAAgADAPsIdhJ6HDoAAgADAB4JoxKaHDwAAgADAEEJ0RK7HD4AAgADADkJ2BLOHEAAAgADAEkJ2BK/HEIAAgADAC0JsxKhHEQAAgAEAP4GUQ4JFj8eRwACABwASQGTAt4DKgV2BsQHEgliCrILBQ1XDqsP/xBWEq0TBhVgFrwXGBl2GtYbOB2aHgAgZiHNIjckoyViAAIACQC4A3gHQgsUD/IS3BbSGtge6yJqAAIABwB2BAQJrA1zEl4XbBymIXAAAgAEALMR1BscIsAlcwABAHoAAQCDAAIAEwDZBbQK0A5bEnAVIRiAGpUcah4HIG8hqSK4I54kXSX5JXImySb+JpUAAAAAAAIADADHAKgCPgVLCKkLOg/qEqQWVhrtHVIhaiQLAAIACwAhBP8HuQtYD+ASURaqGeYcACDoInklFQACAAgABweBDGYR6xUlGhoewCH7JBwAAQAkAAIADwDWBu0KQg4uEdITQxaKGK0ashyaHmggGiKtIxwlViYyAAIAOQAFABQALQBNAHYApgDdABsBYAGqAfoBUAKsAgwDcgPdA0wEwQQ6BbkFOwbCBk0H3QdxCAsJqAlJCu8KmgtIDPsMsw1wDjEP9g/BEJIRZhI/Ex8UAxXtFd4W0xfPGNIZ3BrsGwMdIx5MH34guCH8IkwkpyVqAAIABwB2BAQJrA1zEl4XbBymIXAAAgAEALMR1BscIsAlcwABAHoAAQCDAAIAEwDZBbQK0A5bEnAVIRiAGpUcah4HIG8hqSK4I54kXSX5JXImySb+JpUAAAAAAAAAAAACAAkA3wPDB6sLlQ+AE20XWRtDHysjCAACAAcA1ASqCYIOXhNBGCkdGCIOAAIABwDYBLgJnA6EE20YVB00IhQAAgAHANcEtgmZDoATaBhPHTIiGgACAAcA1ASxCZYOfBNlGE0dMiIgAAIABwDUBLEJlg58E2UYTR0yIiYAAgBIAHECngSWBmAIAwqKC/UMSg6HD7IQzxHaEtcTyBStFYcWVRccGNkYjhk6Gt8afxsWHKccMx24HTketB4qH5sfByBvINMgMyGNIeUhOiKKItciISNnI6oj6iMnJGEkmSTNJP8kLiVbJYUlrSXSJfUlFiY0JlEmayaDJpkmrSa/Js8m3SbqJvQm/SYEJwknDScPJ20AAgAEAOYHuw+HF00fcAACAAQA5ge7D4cXTR9zAAIABADvB9gPshdzH3YAAgAEAO4H1Q+vF28feQACAAUAuQZZDeITVxq6IH0AAgAGAOwFwAt6ERQXjxzjIYIAAgAUAF8DnQa3Ca8Mhg82EsAUJhdlGXwbah0uH8ggNiJ4I4skbyUkJqYm9SaVAAAAAAABABEAAQAVAAEAGQABAB0AAQAhAAEALgABADAAAQAzAAEANQABADgAAQA9AAEAQAABAEQAAQBIAAEATAABAFQAAQBYAAEAWwABAF8AAQBoAAEAcQABAHQAAQB4AAEAfAABAIEAAQCEAAEAhwABAIoAAQCNAAEAlQAAAAAAAAAAAAAAAAACABUAwgGFA0gFDQfTCJoKYAwnDu8PuBGAE0oVEhfaGKMaaxwzHvofwSGGI0wlFAACAA4AowJFBeQHgQoeDbkPUhLrFIMXGhqyHEgf4CF4JCEAAgAOAKECQgXkB4YKJg3GD2YSBBWgFzka0RxlH/chhiQuAAIAQACsAFYBAgKtAlcDAQSqBFQF/AWlBkwH8weaCEIJ5wmMCjIL1gt7DB4NwQ1kDgYPpg9HEOgQiBEnEsUSYxMAFJ0UOBXUFW8WCBehFzoY0hhpGf8ZlBopG70bUBziHHQdBR6VHiMfsh8/IMsgViHhIWoi8iJ6IwAkhSQKJY0lDyaQJm0AAgAFAJgGLw3AE0QatyBxAAIABgDCBXMLExGmFiocoiF2AAIAIAAHAgME9AXdB7kJigtSDQ0PvBBfEvYTfhX7FmoYyRkdG18ckx24HswfziDBIaEibyMqJNIkZiXlJU4moibfJgMnlQAAAAAAAQARAAEAFQABABkAAQAdAAEAIQABAC4AAQAwAAEAMwABADUAAQA4AAEAPQABAEAAAQBEAAEASAABAEwAAQBUAAEAWAABAFsAAQBfAAEAaAABAHEAAQB0AAEAeAABAHwAAQCBAAEAhAABAIcAAQCKAAEAjQABAJUAAAAAAAIAPQAGABcAMgBXAIUAvAD7AEIBkQHmAUICpAINA3oD7gNnBOYEaQXwBXwGDAeiBzoI1gh1CRkKvwppCxcMxwx6DTAO6A6jD2EQIRHkEagSbxM4FAMVzxWeFm8XQRgWGewZwxqbG3YcUh0vHgwf7B/MIK8hkyJ3I1wkQiUoJjwAAgBaAIUADAGSARgCnwInA68DNwTABEkF0wVcBuQGbwf5B4IIDAmXCR8Kqgo0C70LRwzQDFoN4w1sDvUOfQ8GEI0QFRGbESISqBIuE7QTOBS9FD8VwhVFFsYWRxfHF0YYwxhBGb0ZOBqzGiwboxsbHJAcBB13HegdWR7HHjMfnh8IIHAg1iA6IZsh+yFYIrMiDCNiI7UjBiRTJJ4k5iQqJWslqCXhJRYmRyZzJpomvSbZJvEmAicMJ5UAAAAAAAEAEQABABUAAQAZAAEAHQABACEAAQAuAAEAMAABADMAAQA1AAEAOAABAD0AAQBAAAEARAABAEgAAQBMAAEAVAABAFgAAQBbAAEAXwABAGgAAQBxAAEAdAABAHgAAQB8AAEAgQABAIQAAQCHAAEAigABAI0AAQCVAAAAAAABABEAAQAVAAEAGQABAB0AAQAhAAEALgABADAAAQAzAAEANQABADgAAQA9AAEAQAABAEQAAQBIAAEATAABAFQAAQBYAAEAWwABAF8AAQBoAAEAcQABAHQAAQB4AAEAfAABAIEAAQCEAAEAhwABAIoAAQCNAAEAlQAAAAAAAgAJAN8DwwerC5UPgBNtF1kbQx8rIwgAAgAHANQEqgmCDl4TQRgpHRgiDgACAAcA2AS4CZwOhBNtGFQdNCIUAAIABwDXBLYJmQ6AE2gYTx0yIhoAAgAHANQEsQmWDnwTZRhNHTIiIAACAAcA1ASxCZYOfBNlGE0dMiImAAIASABxAp4ElgZgCAMKigv1DEoOhw+yEM8R2hLXE8gUrRWHFlUXHBjZGI4ZOhrfGn8bFhynHDMduB05HrQeKh+bHwcgbyDTIDMhjSHlIToiiiLXIiEjZyOqI+ojJyRhJJkkzST/JC4lWyWFJa0l0iX1JRYmNCZRJmsmgyaZJq0mvybPJt0m6ib0Jv0mBCcJJw0nDydtAAIABADmB7sPhxdNH3AAAgAEAOYHuw+HF00fcwACAAQA7wfYD7IXcx92AAIABADuB9UPrxdvH3kAAgAFALkGWQ3iE1cauiB9AAIABgDsBcALehEUF48c4yGCAAIAFABfA50GtwmvDIYPNhLAFCYXZRl8G2odLh/IIDYieCOLJG8lJCamJvUmlQAAAAAAAQARAAEAFQABABkAAQAdAAEAIQABAC4AAQAwAAEAMwABADUAAQA4AAEAPQABAEAAAQBEAAEASAABAEwAAQBUAAEAWAABAFsAAQBfAAEAaAABAHEAAQB0AAEAeAABAHwAAQCBAAEAhAABAIcAAQCKAAEAjQABAJUAAAAAAAIACQCDAPoBTARmBzQLqg+6FFcadiAIAAIABwBuBPwIqg16EmoXfxy2IQ4AAgAHAIoELAnmDboSpxevHNIhFAACAAcAqAReCSQO+RLhF9wc7CEaAAIABwCpBGYJNw4XEwcYAR0EIiAAAgAHAMIEjAlcDjUTGRgJHQUiJgACAEgAcQKeBJYGYAgDCooL9QxKDocPshDPEdoS1xPIFK0VhxZVFxwY2RiOGToa3xp/GxYcpxwzHbgdOR60Hiofmx8HIG8g0yAzIY0h5SE6Iooi1yIhI2cjqiPqIyckYSSZJM0k/yQuJVslhSWtJdIl9SUWJjQmUSZrJoMmmSatJr8mzybdJuom9Cb9JgQnCScNJw8nbQACAAQA5ge7D4cXTR9wAAIABADkB7kPgxdIH3MAAgAEAOEHtA+AF0gfdgACAAQA4Qe0D4AXSB95AAIABQC2BlMN2xNQGrYgfQACAAYA3wWiC0wR3BZXHL0hggACABQAIwMuBiIJ+gu2DlgR2hM+FoAYoRqdHHUeJiCuIQkjNyQ0JQAmlSbxJpUAAAAAAAEACQABAAsAAQCTAAEAlQAAAAAAAQADAAEABQABAAcAAQAJAAEACwABAA0AAQAPAAEAEQABABMAAQAVAAEAFwABABkAAQAbAAEAHQABAB8AAQAhAAEAIwABACUAAQAnAAEAKQABACsAAQAtAAEALwABADEAAQAzAAEANQABADcAAQA5AAEAOwABAD0AAQA+AAEAQAABAEIAAQBEAAEARgABAEgAAQBKAAEASwABAE0AAQBPAAEAUQABAFMAAQBVAAEAVgABAFgAAQBaAAEAXAABAF4AAQBgAAEAYgABAGkAAQBrAAEAbQABAG8AAQBxAAEAcwABAHUAAQB3AAEAeQABAHsAAQB9AAEAfwABAIEAAQCDAAIAAwDfD8UZtCGFAAEAhwABAIkAAQCLAAEAjQABAI8AAQCRAAEAkwABAJUAAAAAAAAAEAACACoAnwEvA7QELQadBwMJXwqxC/wMPw55D60Q2hH+EhwUMhVDFkwXTxhMGUIaMRsZHPoc1R2pHnYfOyD4IK0hWiIAI5sjLiS2JDQlpSUKJmImqibgJgMnOQAAADwAAQBRAAAAVAAAAGkAAgAqAJ8BLwO0BC0GnQcDCV8KsQv8DD8OeQ+tENoR/hIcFDIVQxZMF08YTBlCGjEbGRz6HNUdqR52Hzsg+CCtIVoiACObIy4ktiQ0JaUlCiZiJqom4CYDJ5IAAACVAAAAAAAAABAAAgAqAJ8BLwO0BC0GnQcDCV8KsQv8DD8OeQ+tENoR/hIcFDIVQxZMF08YTBlCGjEbGRz6HNUdqR52Hzsg+CCtIVoiACObIy4ktiQ0JaUlCiZiJqom4CYDJzkAAAA8AAEAUQAAAFQAAABpAAIAKgCfAS8DtAQtBp0HAwlfCrEL/Aw/DnkPrRDaEf4SHBQyFUMWTBdPGEwZQhoxGxkc+hzVHakedh87IPggrSFaIgAjmyMuJLYkNCWlJQomYiaqJuAmAyeSAAAAlQAAAAAAAAADAAIAGgBTApUExAbiCPEK8QzhDsQQmBJdFBMWuxdUGd0aVxzBHRgfXSCOIaoiriOYJGYlEiaXJvAmHAAAAB4AAgAcACsCRgRRBk4IPQofDPMNuw92ESYTxxRdFuYXYhnRGjEcgx3GHvofHSEtIisjEiTiJJklMSanJvQmOQAAADwAAAA/AAIAEwAfAx4G/Qi/C2YO8xBlE7wV+hcaGiAcBh7OH3Ah7SI+JFwlPibXJlEAAABUAAAAVwACAB8A+AHjA8AFkAdXCRELwgxmDgEQkhEXE5UUBRZsF8gYGhphG50czB3uHgQgCyEEIu0ixSOLJDsl1iVWJrgm+SZ1AAAAdwACABwAKwJGBFEGTgg9Ch8M8w27D3YRJhPHFF0W5hdiGdEaMRyDHcYe+h8dIS0iKyMSJOIkmSUxJqcm9CaSAAEAlQAAAAAAAAADAAIAGgBTApUExAbiCPEK8QzhDsQQmBJdFBMWuxdUGd0aVxzBHRgfXSCOIaoiriOYJGYlEiaXJvAmHAAAAB4AAgAcACsCRgRRBk4IPQofDPMNuw92ESYTxxRdFuYXYhnRGjEcgx3GHvofHSEtIisjEiTiJJklMSanJvQmOQAAADwAAAA/AAIAEwAfAx4G/Qi/C2YO8xBlE7wV+hcaGiAcBh7OH3Ah7SI+JFwlPibXJlEAAABUAAAAVwACAB8A+AHjA8AFkAdXCRELwgxmDgEQkhEXE5UUBRZsF8gYGhphG50czB3uHgQgCyEEIu0ixSOLJDsl1iVWJrgm+SZ1AAAAdwACABwAKwJGBFEGTgg9Ch8M8w27D3YRJhPHFF0W5hdiGdEaMRyDHcYe+h8dIS0iKyMSJOIkmSUxJqcm9CaSAAEAlQAAAAAAAAAFAAIAGQABBIMHoAptDfYPRxJoFF8WLRjaGWgb2RwtHmgfiiCVIYoiaCMxJOQkgCUGJnMmxib8Jh0AAAAeAAAAWQACAB4AZwNuBigJpgvuDQoQ/hHQE4AVFheRGPYZRBt8HKEdsx61H6UghSFVIhQjxiNnJPkkeyXuJU8mnybbJgIndgAAAHcAAgADANcOQRkUIXkAAgAHAAkGpgvmENUVfRrlHhQjfwACAAsAegSsCJoMShDDEwYXGhoBHb4fUyLDJIkAAgANAOUEfQnGDcARbRXLGNoblh78IAcjsyT3JcYmlQAAAAAAAAAFAAIAGQABBIMHoAptDfYPRxJoFF8WLRjaGWgb2RwtHmgfiiCVIYoiaCMxJOQkgCUGJnMmxib8Jh0AAAAeAAAAWQACAB4AZwNuBigJpgvuDQoQ/hHQE4AVFheRGPYZRBt8HKEdsx61H6UghSFVIhQjxiNnJPkkeyXuJU8mnybbJgIndgAAAHcAAgATAH8DsAaeCVMM1w4xEWQTdxVpF0EZ/hqkHDIerR8UIWkiqyPdJP8liQACAA0A5QR9CcYNwBFtFcsY2huWHvwgByOzJPclxiaVAAAAAAACAAwAoQWvCjsPWRMQF2caZB0HIE4iNCSwJa8mCwAAAA4AAgARACAE8Ad4C8AOzBGhFEIXshnxGwIe5B+WIRYjZCR4JU4m3CYeAAAAIAACABEAIATwB3gLwA7MEaEUQheyGfEbAh7kH5YhFiNkJHglTibcJjAAAAA8AAIADAChBa8KOw9ZExAXZxpkHQcgTiI0JLAlryZHAAAASgAAAFQAAgAMAKEFrwo7D1kTEBdnGmQdByBOIjQksCWvJl8AAABiAAIAFgBCA1EGMgnqC3kO5BAuE1YVXRdIGRYbxhxZHtAfKSFlIoIjfiRXJQsmlSbvJncAAAB5AAIABwCABxMO4hP/GHkdUyGLJH8AAgALAJMFvwqHD+sT7ReHG7cedyG+I34lpCaJAAAAlQAAAAAAAgAMAKEFrwo7D1kTEBdnGmQdByBOIjQksCWvJgsAAAAOAAIAEQAgBPAHeAvADswRoRRCF7IZ8RsCHuQfliEWI2QkeCVOJtwmHgAAACAAAgARACAE8Ad4C8AOzBGhFEIXshnxGwIe5B+WIRYjZCR4JU4m3CYwAAAAPAACAAwAoQWvCjsPWRMQF2caZB0HIE4iNCSwJa8mRwAAAEoAAABUAAIADAChBa8KOw9ZExAXZxpkHQcgTiI0JLAlryZfAAAAYgACABYAQgNRBjIJ6gt5DuQQLhNWFV0XSBkWG8YcWR7QHykhZSKCI34kVyULJpUm7yZ3AAAAeQACAAcAgAcTDuIT/xh5HVMhiyR/AAIACwCTBb8Khw/rE+0Xhxu3HnchviN+JaQmiQAAAJUAAAAAAAAAbgABAHAAAgANACQF1gkhDhASqBXtGOIbiB7fIOUikiTgJb0mfAAAAAAAAABuAAAAAAAAAG4AAQBwAAIADQAkBdYJIQ4QEqgV7RjiG4ge3yDlIpIk4CW9JnwAAAAAAAAAPAABAD4AAgADAFUVaiCpJUAAAAAAAAAAPAAAAAAAAAA8AAEAPgACAAMAVRVqIKklQAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAABAAP//AAABADwAAAA+AAIAAwBVFWogqSVAAAAAAAAAAB0A//8eAAAAPAD//0EAAABUAP//WQAAAHYA//93AAAAlQD//wAAAQAFAAIABQAbBSMMhxPtGvUhCQAAABYAAgAIAN8B6wUHC6YQahYJHCUhMSUdAAEAHgACAAgA+gJgByMMDREDFu0asB8WJCUAAAAyAAIACwAgAbYDHwcHCzYPhxPaFwkc8R9aI/AlPAABAEEAAgAFABsFIwyHE+0a9SFFAAEAVAABAFkAAgAFABsFIwyHE+0a9SFdAAAAbwACAAgA3wHrBQcLphBqFgkcJSExJXYAAQB3AAIACAD6AmAHIwwNEQMW7RqwHxYkfgAAAIsAAgALACABtgMfBwcLNg+HE9oXCRzxH1oj8CWVAAAAAAAAAAsA//8OAAAAHgD//yAAAAAwAP//PAAAAEcA//9KAAAAXwD//2IAAAB3AP//eQAAAIkA//8AAAIABAB0BhQP/BecIAMAAAAIAAIABAAABV0OsxgQIgsAAQAOAAIABAB0BhQP/BecIBEAAAAXAAIACADfAesFBwumEGoWCRwlITElHgABACAAAgAEAHQGFA/8F5wgIwAAACkAAgAIAN8B6wUHC6YQahYJHCUhMSUwAAEAPAACAAQAdAYUD/wXnCA/AAAARAACAAQAAAVdDrMYECJHAAEAVAACAAQAdAYUD/wXnCBXAAAAXAACAAQAAAVdDrMYECJfAAEAYgACAAkAlAJ0BrEKFA+HE/wXXxycIHwkagAAAHAAAgAIAN8B6wUHC6YQahYJHCUhMSV3AAEAeQACAAQAdAYUD/wXnCB8AAAAggACAAgA3wHrBQcLphBqFgkcJSExJYkAAAAAAAAAOQD//zwAAABRAP//VAAAAJIA//8AAAEACQACAAgA3wHrBQcLphBqFgkcJSExJRAAAQAnAAIAEwByAI4BHgMABR8HbAnYC10O7hCHEyIWsxg4G6Qd8R8QIvIjgiWeJjkAAQBdAAIADQDaAN8ClwXACDQM0g+HEz4X3BpQHnkhMSQ2JmkAAACAAAIAEwByAI4BHgMABR8HbAnYC10O7hCHEyIWsxg4G6Qd8R8QIvIjgiWeJpIAAAAAAAAAHAD//x4AAAA5AP//PAAAAFEA//9UAAAAdQD//3cAAACSAP//AAABAAMAAgALACABtgMfBwcLNg+HE9oXCRzxH1oj8CUNAAAAEgACAAsAIAG2Ax8HBws2D4cT2hcJHPEfWiPwJRwAAQAeAAIACgD3BEwJXQ1CEQIVoBgcHG8fiyJPJScAAAAsAAIADgDBAI4CAAXfBwcLXQ7MEUQVsxgJHDEfECKCJE8mOQABAD8AAgALACABtgMfBwcLNg+HE9oXCRzxH1oj8CVJAAEAUQABAFcAAgALACABtgMfBwcLNg+HE9oXCRzxH1oj8CVhAAAAawACAAsAIAG2Ax8HBws2D4cT2hcJHPEfWiPwJXUAAQB3AAIACgD3BEwJXQ1CEQIVoBgcHG8fiyJPJYAAAACFAAIADgDBAI4CAAXfBwcLXQ7MEUQVsxgJHDEfECKCJE8mkgAAAAAAAAAAAAAAQAD//2wAAAAAAAEAPAABAEAAAQBsAAIABwCQBQsLbRCzFc4aqx8YJHIAAAAAAAAAAAAAAD0A//8AAAEAPQABAGsAAAAAAAAAAAAAAHwA//8AAAEAbgAAAHIAAgALACABtgMfBwcLNg+HE9oXCRzxH1oj8CV8AAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAJAAIACwADAB8AAgAhAAAAcAABAH4AAwCJAAIAiwAAAAAA//9vAAAAjgD//wAAAAA9AP//awAAAAAAAQA9AAEAawABAHIAAAAAAAAAAAAAAD0A//9rAAAAAAABAD0AAQBrAAIACADzBNYJpg5gE/0XdhyzIIokcgAAAAAAAAAJAP//CwAAABEA//8TAAAAGgD//xwAAAAkAP//JQAAACsA//8tAAAAPQD//1EAAABYAP//WQAAAGIA//9kAAAAagD//2wAAABzAP//dQAAAH0A//9+AAAAhAD//4YAAACNAP//jgAAAJQA//+VAAAAAAABAAQAAgAGAP4JNhIEGZAe4yLcJQkAAQALAAEADgACAAQAdw3CF4gf2SQRAAEAEwABABYAAgAFAHgLoRTxG5YheCUaAAEAHAABAB8AAgAGAP4JNhIEGZAe4yLcJSQAAQAlAAEAKAACAAQAdw3CF4gf2SQrAAEALQABADoAAgADAKEKnRQQHjwAAAA9AAEASwAAAFEAAQBVAAIABAB3DcIXiB/ZJFgAAQBZAAEAXQACAAYA/gk2EgQZkB7jItwlYgABAGQAAQBnAAIABAB3DcIXiB/ZJGoAAQBsAAEAbwACAAUAeAuhFPEbliF4JXMAAQB1AAEAeAACAAYA/gk2EgQZkB7jItwlfQABAH4AAQCBAAIABAB3DcIXiB/ZJIQAAQCGAAEAiQACAAUAeAuhFPEbliF4JY0AAQCOAAEAkQACAAQAdw3CF4gf2SSUAAEAlQAAAAAAAAA9AP//awAAAAAAAQA9AAEAawACAAgA8wTWCaYOYBP9F3YcsyCKJHIAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAQAFAAEACAABAAoAAQAOAAEAEAABABUAAQAYAAEAGgABAB4AAQAgAAEAJQABACgAAQAqAAEALgABADAAAQAyAAEANQABADcAAQA5AAEAPAAAAAAAAQADAAEABwABAAwAAQAPAAEAEgABABcAAQAaAAEAHQABACEAAQAmAAEAKQABACwAAQAwAAEAMwABADYAAQA5AAEAPAAAAAAAAgAfAC8AqwBkAUoCVgOCBMYFHweKCAUKigsYDa4OSRDoEYcTKBXHFmIY+BmGGwsdhh7xH0ohjiK6I8YkrCVlJuEmHgACAB8ALwCrAGQBSgJWA4IExgUfB4oIBQqKCxgNrg5JEOgRhxMoFccWYhj4GYYbCx2GHvEfSiGOIrojxiSsJWUm4SY8AAAAAAABAAMAAQAFAAEACAABAAsAAQAOAAEAEAABABMAAQAWAAEAGQABABsAAQAeAAEAIQABACQAAQAmAAEAKQABACwAAQAvAAEAMQABADQAAQA3AAEAOQABADwAAAAAAAEACwABAA8AAQATAAEAGwABACgAAAAAAAIAHwAvAKsAZAFKAlYDggTGBR8HiggFCooLGA2uDkkQ6BGHEygVxxZiGPgZhhsLHYYe8R9KIY4iuiPGJKwlZSbhJh4AAgAfAC8AqwBkAUoCVgOCBMYFHweKCAUKigsYDa4OSRDoEYcTKBXHFmIY+BmGGwsdhh7xH0ohjiK6I8YkrCVlJuEmPAAAAAAAAgAfAC8AqwBkAUoCVgOCBMYFHweKCAUKigsYDa4OSRDoEYcTKBXHFmIY+BmGGwsdhh7xH0ohjiK6I8YkrCVlJuEmHgACAB8ALwCrAGQBSgJWA4IExgUfB4oIBQqKCxgNrg5JEOgRhxMoFccWYhj4GYYbCx2GHvEfSiGOIrojxiSsJWUm4SY8AAAAAAACAA8ATAOTBtIJAw0kEDITJhb8GK0bMx6EIJYiXCTEJbUmDgABACwAAgARAE0AGwFNAs8DkQWJB64J+AtiDuUQgBMuFugYsRuDHlohNCQ8AAAAAAACAA8ATAOTBtIJAw0kEDITJhb8GK0bMx6EIJYiXCTEJbUmDgABACwAAgARAE0AGwFNAs8DkQWJB64J+AtiDuUQgBMuFugYsRuDHlohNCQ8AAAAAAAAAAAAAQALAAAADwABABMAAQAXAAEAGwABACgAAAAAAAIADQDtA8oHlAtCD9ESOhZ2GX0cQx+8IdojhiWlJgwAAgAfAC8AqwBkAUoCVgOCBMYFHweKCAUKigsYDa4OSRDoEYcTKBXHFmIY+BmGGwsdhh7xH0ohjiK6I8YkrCVlJuEmKgACABMARQD8AAwCYQPvBKsGjwiTCrAM5Q4tEYMT5RVSGMQaPB20HywioSQ8AAAAAAABAAsAAQAPAAEAEwABABcAAQAbAAEAKAAAAAAAAgAQABADHAYkCSIMFQ/4EcgUfxcbGpYc5x4IIfEikiTdJbwmDwABAC0AAgAQAFQAMwF+Ah8ECAYpCHoK9QyRD0gSGBX7F+4a7B30IAAkPAAAAAAAAgAfAC8AqwBkAUoCVgOCBMYFHweKCAUKigsYDa4OSRDoEYcTKBXHFmIY+BmGGwsdhh7xH0ohjiK6I8YkrCVlJuEmHgACAB8ALwCrAGQBSgJWA4IExgUfB4oIBQqKCxgNrg5JEOgRhxMoFccWYhj4GYYbCx2GHvEfSiGOIrojxiSsJWUm4SY8AAAAAAACABIAvgJ5BTAI4gqKDScQthI3FaMX+Rk0HE8eRiARIqojBSUWJswmEQACAB8ALwCrAGQBSgJWA4IExgUfB4oIBQqKCxgNrg5JEOgRhxMoFccWYhj4GYYbCx2GHvEfSiGOIrojxiSsJWUm4SYvAAIADgBqAIIBHAMcBW0HAArKDL4P1xINFlkZuBwkIJgjPAAAAAAAAgAFAHMBbAV3C0IThxwEAAIABgD+CTYSBBmQHuMi3CUJAAAACwACAAQADwKdB/QPkRoOAAIABAB3DcIXiB/ZJBEAAAATAAIABAAPAp0H9A+RGhYAAgAFAHgLoRTxG5YheCUaAAAAHAACAAQADwKdB/QPkRofAAIABgD+CTYSBBmQHuMi3CUkAAAAJQACAAQADwKdB/QPkRooAAIABAB3DcIXiB/ZJCsAAAAtAAIABAAPAp0H9A+RGjAAAgAFAHgLoRTxG5YheCU0AAAANQACAAQADwKdB/QPkRo4AAIABAB3DcIXiB/ZJDsAAAA8AAAAAAACAAUAcwFsBXcLQhOHHAQAAgAGAP4JNhIEGZAe4yLcJQkAAAALAAIABAAPAp0H9A+RGg4AAgAEAHcNwheIH9kkEQAAABMAAgAEAA8CnQf0D5EaFgACAAUAeAuhFPEbliF4JRoAAAAcAAIABAAPAp0H9A+RGh8AAgAGAP4JNhIEGZAe4yLcJSQAAAAlAAIABAAPAp0H9A+RGigAAgAEAHcNwheIH9kkKwAAAC0AAgAEAA8CnQf0D5EaMAACAAUAeAuhFPEbliF4JTQAAAA1AAIABAAPAp0H9A+RGjgAAgAEAHcNwheIH9kkOwAAADwAAAAAAAEACwABAA8AAQATAAEAFwABABsAAQAoAAAAAAABAAIAAQAEAAEABgABAAgAAQAKAAEADAABAA4AAQAQAAEAEgABABQAAQAWAAEAGAABABoAAQAcAAEAHgABACAAAQAiAAEAJAABACYAAQAoAAEAKgABACwAAQAuAAEAMAABADIAAQA0AAEANgABADgAAQA6AAEAPAAAAAAAAgAfAC8AqwBkAUoCVgOCBMYFHweKCAUKigsYDa4OSRDoEYcTKBXHFmIY+BmGGwsdhh7xH0ohjiK6I8YkrCVlJuEmHgACAB8ALwCrAGQBSgJWA4IExgUfB4oIBQqKCxgNrg5JEOgRhxMoFccWYhj4GYYbCx2GHvEfSiGOIrojxiSsJWUm4SY8AAAAAAABAAsAAQAPAAEAEwABABcAAQAbAAEAKAAAAAAAAgAUAHoC9QRrB9sJRgypDgMRUBOQFcEX3RnjG9Idox9SIdoiNSRbJUAm2CYTAAIAHwAvAKsAZAFKAlYDggTGBR8HiggFCooLGA2uDkkQ6BGHEygVxxZiGPgZhhsLHYYe8R9KIY4iuiPGJKwlZSbhJjEAAgAMAIsA9AH9A4EGYwmRDPoPkxNQFygbFh8PIzwAAAAAAAIAEQDQAqIFcgg+CwQOvxBsEwcWjhj7Gkodcx9wITYjvCTxJcImEAABAC4AAgAPAFkASAGrAmwEeQbFCEcL9A3HELkTyBbsGSMdZiC3IzwAAAAAAAEACwAAAA8AAQATAAEAFwABABsAAQAoAAAAAAACABIAxwKLBUgIAAusDU4Q4RJhFc4XIxpcHHQeZiAsIr8jFCUeJs8mEQACAB8ALwCrAGQBSgJWA4IExgUfB4oIBQqKCxgNrg5JEOgRhxMoFccWYhj4GYYbCx2GHvEfSiGOIrojxiSsJWUm4SYvAAIADgBtAIsBLAMyBYkHIArrDOEP+hIuFncZ0Bw2IKIjPAAAAAAAAQALAAEADwABABMAAQAXAAEAGwABACgAAAAAAAEABQABAAgAAQAKAAEADgABABAAAQAVAAEAGAABABoAAQAeAAEAIAABACUAAQAoAAEAKgABAC4AAQAwAAEAMgABADUAAQA3AAEAOQABADwAAAAAAAIAHwAvAKsAZAFKAlYDggTGBR8HiggFCooLGA2uDkkQ6BGHEygVxxZiGPgZhhsLHYYe8R9KIY4iuiPGJKwlZSbhJh4AAgAfAC8AqwBkAUoCVgOCBMYFHweKCAUKigsYDa4OSRDoEYcTKBXHFmIY+BmGGwsdhh7xH0ohjiK6I8YkrCVlJuEmPAAAAAAAAQACAAEABAABAAYAAQAIAAEACgABAAwAAQAOAAEAEAABABIAAQAUAAEAFgABABgAAQAaAAEAHAABAB4AAQAgAAEAIgABACQAAQAmAAEAKAABACoAAQAsAAEALgABADAAAQAyAAEANAABADYAAQA4AAEAOgABADwAAAAAAAIAEAAQAxwGJAkiDBUP+BHIFH8XGxqWHOceCCHxIpIk3SW8Jg8AAQAtAAIAEABUADMBfgIfBAgGKQh6CvUMkQ9IEhgV+xfuGuwd9CAAJDwAAAAAAAIADwBMA5MG0gkDDSQQMhMmFvwYrRszHoQgliJcJMQltSYOAAIAHwAvAKsAZAFKAlYDggTGBR8HiggFCooLGA2uDkkQ6BGHEygVxxZiGPgZhhsLHYYe8R9KIY4iuiPGJKwlZSbhJiwAAQA8AAAAAAABAAMAAQAFAAEACAABAAsAAQAOAAEAEAABABMAAQAWAAEAGQABABsAAQAeAAEAIQABACQAAQAmAAEAKQABACwAAQAvAAEAMQABADQAAQA3AAEAOQABADwAAAAAAAEACwABAA8AAQATAAEAFwABABsAAQAoAAAAAAACAA8ATAOTBtIJAw0kEDITJhb8GK0bMx6EIJYiXCTEJbUmDgACAB8ALwCrAGQBSgJWA4IExgUfB4oIBQqKCxgNrg5JEOgRhxMoFccWYhj4GYYbCx2GHvEfSiGOIrojxiSsJWUm4SYsAAIAEQBNABsBTQLPA5EFiQeuCfgLYg7lEIATLhboGLEbgx5aITQkPAAAAAAAAQALAAEADwABABMAAQAXAAEAGwABACgAAAAAAAIAHwAvAKsAZAFKAlYDggTGBR8HiggFCooLGA2uDkkQ6BGHEygVxxZiGPgZhhsLHYYe8R9KIY4iuiPGJKwlZSbhJh4AAgAfAC8AqwBkAUoCVgOCBMYFHweKCAUKigsYDa4OSRDoEYcTKBXHFmIY+BmGGwsdhh7xH0ohjiK6I8YkrCVlJuEmPAAAAAAAAgAfAC8AqwBkAUoCVgOCBMYFHweKCAUKigsYDa4OSRDoEYcTKBXHFmIY+BmGGwsdhh7xH0ohjiK6I8YkrCVlJuEmHgACAB8ALwCrAGQBSgJWA4IExgUfB4oIBQqKCxgNrg5JEOgRhxMoFccWYhj4GYYbCx2GHvEfSiGOIrojxiSsJWUm4SY8AAAAAAACAAsAIAG2Ax8HBws2D4cT2hcJHPEfWiPwJQoAAgAVALQBdwNHBSMHBgnwCt4M0A7CELQSoxSQFnUYVBooHPIdrB9WIesiaiTNJR4AAgARAIoA3wG2A+sFYggHC8wNphCHE2oWRBkJHK4eJSFaIzElhiYuAAIADwCPAw0HdwrJDQERHBQTF+EZgxzxHiMhEiOwJPElxCY8AAAAAAACAAsAIAG2Ax8HBws2D4cT2hcJHPEfWiPwJQoAAgAVALQBdwNHBSMHBgnwCt4M0A7CELQSoxSQFnUYVBooHPIdrB9WIesiaiTNJR4AAgARAIoA3wG2A+sFYggHC8wNphCHE2oWRBkJHK4eJSFaIzElhiYuAAIADwCPAw0HdwrJDQERHBQTF+EZgxzxHiMhEiOwJPElxCY8AAAAAAACABEA0AKiBXIIPgsEDr8QbBMHFo4Y+xpKHXMfcCE2I7wk8SXCJhAAAQAuAAIADwBZAEgBqwJsBHkGxQhHC/QNxxC5E8gW7BkjHWYgtyM8AAAAAAACAAsAIAG2Ax8HBws2D4cT2hcJHPEfWiPwJQoAAgAVALQBdwNHBSMHBgnwCt4M0A7CELQSoxSQFnUYVBooHPIdrB9WIesiaiTNJR4AAgARAIoA3wG2A+sFYggHC8wNphCHE2oWRBkJHK4eJSFaIzElhiYuAAIADwCPAw0HdwrJDQERHBQTF+EZgxzxHiMhEiOwJPElxCY8AAAAAAACAAsAIAG2Ax8HBws2D4cT2hcJHPEfWiPwJQoAAgAVALQBdwNHBSMHBgnwCt4M0A7CELQSoxSQFnUYVBooHPIdrB9WIesiaiTNJR4AAgARAIoA3wG2A+sFYggHC8wNphCHE2oWRBkJHK4eJSFaIzElhiYuAAIADwCPAw0HdwrJDQERHBQTF+EZgxzxHiMhEiOwJPElxCY8AAAAAAACAB8ALwCrAGQBSgJWA4IExgUfB4oIBQqKCxgNrg5JEOgRhxMoFccWYhj4GYYbCx2GHvEfSiGOIrojxiSsJWUm4SYeAAIAHwAvAKsAZAFKAlYDggTGBR8HiggFCooLGA2uDkkQ6BGHEygVxxZiGPgZhhsLHYYe8R9KIY4iuiPGJKwlZSbhJjwAAAAAAAIAHwAvAKsAZAFKAlYDggTGBR8HiggFCooLGA2uDkkQ6BGHEygVxxZiGPgZhhsLHYYe8R9KIY4iuiPGJKwlZSbhJh4AAgAfAC8AqwBkAUoCVgOCBMYFHweKCAUKigsYDa4OSRDoEYcTKBXHFmIY+BmGGwsdhh7xH0ohjiK6I8YkrCVlJuEmPAAAAAAAAgAQABADHAYkCSIMFQ/4EcgUfxcbGpYc5x4IIfEikiTdJbwmDwACAB8ALwCrAGQBSgJWA4IExgUfB4oIBQqKCxgNrg5JEOgRhxMoFccWYhj4GYYbCx2GHvEfSiGOIrojxiSsJWUm4SYtAAIAEABUADMBfgIfBAgGKQh6CvUMkQ9IEhgV+xfuGuwd9CAAJDwAAAAAAAIACwC7AJICLAVOCNULnw+YE6gXvBu7H40jCgACABUAtAF3A0cFIwcGCfAK3gzQDsIQtBKjFJAWdRhUGigc8h2sH1Yh6yJqJM0lHgACABEAfgFJA08FggfZCUgMyQ5YEekTexYEGX0b4h0oIEUiLCTNJS4AAgAPAI8DDQd3CskNAREcFBMX4RmDHPEeIyESI7Ak8SXEJjwAAAAAAAIACwC7AJICLAVOCNULnw+YE6gXvBu7H40jCgACABUAtAF3A0cFIwcGCfAK3gzQDsIQtBKjFJAWdRhUGigc8h2sH1Yh6yJqJM0lHgACABEAfgFJA08FggfZCUgMyQ5YEekTexYEGX0b4h0oIEUiLCTNJS4AAgAPAI8DDQd3CskNAREcFBMX4RmDHPEeIyESI7Ak8SXEJjwAAAAAAAIAEgDHAosFSAgAC6wNThDhEmEVzhcjGlwcdB5mICwivyMUJR4mzyYRAAIAHwAZAGEAzwBfAQ0C1gK0A6gErwXHBu0HIQlhCq0LAw1iDskPOBGtEioUrBUzF74YTBreG3IdCR+jID0i2CN0JS8AAgAOAMEAjgIABd8HBwtdDswRRBWzGAkcMR8QIoIkTyY8AAAAAAABAAsAAQAPAAEAEwABABcAAQAbAAEAKAAAAAAAAgAQABADHAYkCSIMFQ/4EcgUfxcbGpYc5x4IIfEikiTdJbwmDwABAC0AAgAQAFQAMwF+Ah8ECAYpCHoK9QyRD0gSGBX7F+4a7B30IAAkPAAAAAAAAgAQABADHAYkCSIMFQ/4EcgUfxcbGpYc5x4IIfEikiTdJbwmDwABAC0AAgAQAFQAMwF+Ah8ECAYpCHoK9QyRD0gSGBX7F+4a7B30IAAkPAAAAAAAAgAQABADHAYkCSIMFQ/4EcgUfxcbGpYc5x4IIfEikiTdJbwmDwABAC0AAgAQAFQAMwF+Ah8ECAYpCHoK9QyRD0gSGBX7F+4a7B30IAAkPAAAAAAAAQALAAEADwABABMAAQAXAAEAGwABACgAAAAAAAIAHwAvAKsAZAFKAlYDggTGBR8HiggFCooLGA2uDkkQ6BGHEygVxxZiGPgZhhsLHYYe8R9KIY4iuiPGJKwlZSbhJh4AAgAfAC8AqwBkAUoCVgOCBMYFHweKCAUKigsYDa4OSRDoEYcTKBXHFmIY+BmGGwsdhh7xH0ohjiK6I8YkrCVlJuEmPAAAAAAAAQALAAEADwABABMAAQAXAAEAGwABACgAAAAAAAEACwABAA8AAQATAAEAFwABABsAAQAoAAAAAAACAA8ATAOTBtIJAw0kEDITJhb8GK0bMx6EIJYiXCTEJbUmDgACAB8ALwCrAGQBSgJWA4IExgUfB4oIBQqKCxgNrg5JEOgRhxMoFccWYhj4GYYbCx2GHvEfSiGOIrojxiSsJWUm4SYsAAIAEQBNABsBTQLPA5EFiQeuCfgLYg7lEIATLhboGLEbgx5aITQkPAAAAAAAAQALAAEADwABABMAAQAXAAEAGwABACgAAAAAAAIAHwAvAKsAZAFKAlYDggTGBR8HiggFCooLGA2uDkkQ6BGHEygVxxZiGPgZhhsLHYYe8R9KIY4iuiPGJKwlZSbhJh4AAgAfAC8AqwBkAUoCVgOCBMYFHweKCAUKigsYDa4OSRDoEYcTKBXHFmIY+BmGGwsdhh7xH0ohjiK6I8YkrCVlJuEmPAAAAAAAAQACAAEABAABAAYAAQAIAAEACgABAAwAAQAOAAEAEAABABIAAQAUAAEAFgABABgAAQAaAAEAHAABAB4AAQAgAAEAIgABACQAAQAmAAEAKAABACoAAQAsAAEALgABADAAAQAyAAEANAABADYAAQA4AAEAOgABADwAAAAAAAAAEAACACoAnwEvA7QELQadBwMJXwqxC/wMPw55D60Q2hH+EhwUMhVDFkwXTxhMGUIaMRsZHPoc1R2pHnYfOyD4IK0hWiIAI5sjLiS2JDQlpSUKJmImqibgJgMnOQAAAAAAAAAQAAIAKgCfAS8DtAQtBp0HAwlfCrEL/Aw/DnkPrRDaEf4SHBQyFUMWTBdPGEwZQhoxGxkc+hzVHakedh87IPggrSFaIgAjmyMuJLYkNCWlJQomYiaqJuAmAyc5AAAAAAAAAAMAAgAaAFMClQTEBuII8QrxDOEOxBCYEl0UExa7F1QZ3RpXHMEdGB9dII4hqiKuI5gkZiUSJpcm8CYcAAAAHgACABwAHwIgBAkG4AenCWALDg2yDksQ2xFiE+EUWBbFFysZiBrcGycdZx6dH8cg5SHzIvEj2iSqJVkm2iY5AAAAAAAAAAMAAgAaAFMClQTEBuII8QrxDOEOxBCYEl0UExa7F1QZ3RpXHMEdGB9dII4hqiKuI5gkZiUSJpcm8CYcAAAAHgACABwAHwIgBAkG4AenCWALDg2yDksQ2xFiE+EUWBbFFysZiBrcGycdZx6dH8cg5SHzIvEj2iSqJVkm2iY5AAAAAAAAAAUAAgAZAAEEgwegCm0N9g9HEmgUXxYtGNoZaBvZHC0eaB+KIJUhiiJoIzEk5CSAJQYmcybGJvwmHQAAAB4AAgAfACQDxAUXCC0KGwzlDZIPKBGqEhgUdhXGFgcYPBllGoMblRyfHZ0ekR97IFshMSL8IrwjbyQVJawlMSafJu8mPAAAAAAAAAAFAAIAGQABBIMHoAptDfYPRxJoFF8WLRjaGWgb2RwtHmgfiiCVIYoiaCMxJOQkgCUGJnMmxib8Jh0AAAAeAAIAHwAkA8QFFwgtChsM5Q2SDygRqhIYFHYVxhYHGDwZZRqDG5Ucnx2dHpEfeyBbITEi/CK8I28kFSWsJTEmnybvJjwAAAAAAAIADAChBa8KOw9ZExAXZxpkHQcgTiI0JLAlryYLAAAADgACABEAIATwB3gLwA7MEaEUQheyGfEbAh7kH5YhFiNkJHglTibcJh4AAAAgAAIAEQD3A3QHoAqPDU0Q4hJTFaMX1hnsG+Qdvh96IREjfiS3JaQmMAAAAAAAAgAMAKEFrwo7D1kTEBdnGmQdByBOIjQksCWvJgsAAAAOAAIAEQAgBPAHeAvADswRoRRCF7IZ8RsCHuQfliEWI2QkeCVOJtwmHgAAACAAAgARAPcDdAegCo8NTRDiElMVoxfWGewb5B2+H3ohESN+JLclpCYwAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAdAP//HgAAADwA//8AAAEABQACAAUAGwUjDIcT7Rr1IQkAAAAWAAIACADfAesFBwumEGoWCRwlITElHQABAB4AAgAIAPoCYAcjDA0RAxbtGrAfFiQlAAAAMgACAAsAIAG2Ax8HBws2D4cT2hcJHPEfWiPwJTwAAAAAAAAACwD//w4AAAAeAP//IAAAADAA//8AAAIABAB0BhQP/BecIAMAAAAIAAIABAAABV0OsxgQIgsAAQAOAAIABAB0BhQP/BecIBEAAAAXAAIACADfAesFBwumEGoWCRwlITElHgABACAAAgAEAHQGFA/8F5wgIwAAACkAAgAIAN8B6wUHC6YQahYJHCUhMSUwAAAAAAAAADkA//8AAAEACQACAAgA3wHrBQcLphBqFgkcJSExJRAAAQAnAAIAEwByAI4BHgMABR8HbAnYC10O7hCHEyIWsxg4G6Qd8R8QIvIjgiWeJjkAAAAAAAAAHAD//x4AAAA5AP//AAABAAMAAgALACABtgMfBwcLNg+HE9oXCRzxH1oj8CUNAAAAEgACAAsAIAG2Ax8HBws2D4cT2hcJHPEfWiPwJRwAAQAeAAIACgD3BEwJXQ1CEQIVoBgcHG8fiyJPJScAAAAsAAIADgDBAI4CAAXfBwcLXQ7MEUQVsxgJHDEfECKCJE8mOQAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAACQD//wsAAAARAP//EwAAABoA//8cAAAAJAD//yUAAAArAP//LQAAADQA//81AAAAOwD//zwAAAAAAAEABAACAAYA/gk2EgQZkB7jItwlCQABAAsAAQAOAAIABAB3DcIXiB/ZJBEAAQATAAEAFgACAAUAeAuhFPEbliF4JRoAAQAcAAEAHwACAAYA/gk2EgQZkB7jItwlJAABACUAAQAoAAIABAB3DcIXiB/ZJCsAAQAtAAEAMAACAAUAeAuhFPEbliF4JTQAAQA1AAEAOAACAAQAdw3CF4gf2SQ7AAEAPAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAQABAAEAAAAAAAIABgDlDBIWtxxuIZskciYFAAEABwABAAkAAQALAAEADQABAA8AAQARAAEAEwABABQAAQAWAAEAGAABABoAAQAcAAEAHgABACAAAQAiAAEAJAABACYAAQAoAAEAKQABACsAAQAtAAEALgABADAAAQAyAAEANAABADYAAQA4AAEAOgABADwAAQA9AAEAPwABAEEAAQBDAAIAAwB0C6IVyB5FAAIAAgCuDb4aRgAAAEcAAAAAAAIARgB/AewCTgSkBe8GLAhfCYkKpwu+DMkNzQ7KD70QqBGOEmsTQxQSFdsVnhZaFxEYwxhuGRQathpSG+gbehwHHY4dEh6THg0fhB/3H2Ug0CA2IZkh+CFTIqoi/iJOI5sj5SMrJG0krCToJCElVyWJJbkl5SUOJjQmVyZ3JpQmribEJtgm6Sb3JgInCicOJ0UAAgACAK4NvhpGAAAARwAAAAAAAABHAAIACACYCUsRfRdwHFMgRiNbJaAmTgAAAAAAAABHAAIACACYCUsRfRdwHFMgRiNbJaAmTgAAAAAAAgAEAO4MnBXWHPMiAwABAAUAAQAHAAEACAABAAkAAQALAAEADQABAA4AAQAPAAEAEAABABEAAQATAAEAFAABABYAAQAYAAEAGQABABoAAQAbAAEAHAABAB4AAQAgAAEAIQABACIAAQAjAAEAJAABACYAAQAoAAEAKQABACsAAQAsAAEALQABAC4AAQAwAAEAMQABADIAAQA0AAEANgABADcAAQA4AAEAOQABADoAAQA8AAEAPQABAD4AAQA/AAEAQAABAEEAAQBDAAIAAwB0C6IVyB5FAAIAAgCuDb4aRgAAAEcAAAAAAAIARwBhAZUCrAOtBKAFhwZjBzYIAQnICYYKQQv3C6gMVw0ADqgOSw/rD4sQJhG/EVcS7BJ/ExAUnhQsFbgVQhbLFlIX1xdaGNwYXRneGVwa2BpUG80bRxy+HDQdqR0cHo8e/x5vH90fSiC1ICAhhyHvIVQityIZI3oj1yMzJI4k5CQ5JYol1yUhJmUmoibXJv4mRgAAAEcAAAAAAAIABADuDJwV1hzzIgMAAQAFAAEABwABAAgAAQAJAAEACwABAA0AAQAOAAEADwABABAAAQARAAEAEwABABQAAQAWAAEAGAABABkAAQAaAAEAGwABABwAAQAeAAEAIAABACEAAQAiAAEAIwABACQAAQAmAAEAKAABACkAAQArAAEALAABAC0AAQAuAAEAMAABADEAAQAyAAEANAABADYAAQA3AAEAOAABADkAAQA6AAEAPAABAD0AAQA+AAEAPwABAEAAAQBBAAEAQwACAAMAdAuiFcgeRQACAAIArg2+GkYAAABHAAAAAAABAAMAAQAGAAEACQABAA8AAQAWAAEAJQABACgAAQArAAEALgABADQAAQA7AAAAAAAAAEcAAgAIAJEJIhE1Fxkc+x/8IiwljiZOAAAAAAAAAEcAAgAIAJEJIhE1Fxkc+x/8IiwljiZOAAAAAAAAAAAAAAAAAAEAAwAAAAYAAQAJAAEADAABAA8AAQAWAAEAJQABACgAAAArAAEALgABADEAAQA0AAEAOwAAAAAAAgAUAJYCEQVwB7gJ6gsIDhMQDBL0E84VmRdWGQcbrBxGHtQfWSHUIkYkryUTAAIABQAOB9wNcBTRGgUhFwACABUA9gOPB9gK2w2bECETcRWRF4MZSxvsHGgewh/7IBciFiP6I8UkeCUVJpwmKwACAAUADgfcDXAU0RoFIS8AAgAJADIICA+6FHYZWx2CIAAj5SQ8JjcAAgAFAA4H3A1wFNEaBSE7AAIABADZD6UatCG8JT4AAQBDAAEASAABAE4AAAAAAAIAAwBzDLUWch8CAAIAAwAlCgAUnx0EAAIAAwAfCvgTmR0GAAIABQAOB9wNcBTRGgUhCgACAAQAmhE8HKEiBiYNAAIAAwAwCg4UqR0PAAIAAwAlCgAUnx0RAAIAAwAfCvgTmR0TAAIABQAOB9wNcBTRGgUhFwACAAMA5RHsHIsjGQACAAMAMAoOFKkdGwACAAMAJQoAFJ8dHQACAAMAHwr4E5kdHwACAAUADgfcDXAU0RoFISMAAgADAMQU3R9qJSUAAgADADAKDhSpHScAAgADACUKABSfHSkAAgADAB8K+BOZHSsAAgAFAA4H3A1wFNEaBSEvAAIAAwACElsdBSQxAAIAAwAwCg4UqR0zAAIAAwAlCgAUnx01AAIAAwAfCvgTmR03AAIABQAOB9wNcBTRGgUhOwACAAQA2Q+lGrQhvCU+AAEAQwABAEgAAQBOAAAAAAABAAMAAQAGAAEACQABAAwAAQAPAAEAFgABACUAAQAoAAEAKwABAC4AAQAxAAEANAABADsAAAAAAAIAAwAwCg4UqR0CAAIAAwAlCgAUnx0EAAIAAwAfCvgTmR0GAAIABQAOB9wNcBTRGgUhCgACAAQAmhE8HKEiBiYNAAIAAwAwCg4UqR0PAAIAAwAlCgAUnx0RAAIAAwAfCvgTmR0TAAIABQAOB9wNcBTRGgUhFwACAAMAxBTdH2olGQACAAMAMAoOFKkdGwACAAMAJQoAFJ8dHQACAAMAHwr4E5kdHwACAAUADgfcDXAU0RoFISMAAgADAMQU3R9qJSUAAgADADAKDhSpHScAAgADACUKABSfHSkAAgADAB8K+BOZHSsAAgAFAA4H3A1wFNEaBSEvAAIAAwDEFN0faiUxAAIAAwAwCg4UqR0zAAIAAwAlCgAUnx01AAIAAwAfCvgTmR03AAIABQAOB9wNcBTRGgUhOwACAAQAmhE8HKEiBiY+AAEAQwABAEgAAQBOAAAAAAABAAcAAQAPAAEAFgABAB4AAQAmAAEALQABADUAAQA8AAEARAABAE4AAAAAAAEAAwABAAYAAQAJAAEADAABAA8AAQAWAAEAJQABACgAAQArAAEALgABADEAAQA0AAEAOwAAAAAAAQBMAAEATgAAAAAAAQACAAEABAABAAYAAQAIAAEACgABAAwAAQAOAAEAEAABABIAAQAUAAEAFgABABgAAQAaAAEAHAABAB4AAQAgAAEAIgABACQAAQAmAAEAKAABACoAAQAsAAEALgABADAAAQAyAAEANAABADYAAQA4AAEAOgABADwAAQA9AAEAPwABAEEAAQBDAAEARAABAEYAAQBIAAEASgABAEwAAQBOAAAAAAABAAoAAQBDAAAAAAABAAMAAQAGAAEACQABAAwAAQAPAAEAFgABACUAAQAoAAEAKwABAC4AAQAxAAEANAABADsAAAAAAAEABwABAA8AAQAWAAEAHgABACYAAQAtAAEANQABADwAAQBEAAEATgAAAAAAAAAAAAEAAwAAAAYAAQAJAAEADAABAA8AAQAWAAEAJQABACgAAAArAAEALgABADEAAQA0AAEAOwAAAAAAAgAMAA8EFAgIDOcPqBNCF6ka0x2vICsjKiWKJgsAAgAVAF8AUQGnAkkEIgYmCEsKhgzUDioRhxPmFTwYihrFHOoe7iDHImkkvyWxJh8AAgAUADkA1QC/AeoCSQTWBYkHXAlMC1UNcw+iEeETLhaEGOUaSx26HyoinCQyAAIAFQBfAFEBpwJJBCIGJghLCoYM1A4qEYcT5hU8GIoaxRzqHu4gxyJpJL8lsSZGAAIACQDpACwDVQYgCmIO+hLQF9Ac6yFOAAAAAAABAAMAAQAGAAEACQABAAwAAQAPAAEAFgABACUAAQAoAAEAKwABAC4AAQAxAAEANAABADsAAAAAAAIAAwAOFEkfLyUCAAEABQABAAcAAQAJAAEACgABAAsAAQAMAAEADQABAA8AAQAQAAEAEQABABIAAQATAAEAFAABABYAAQAXAAEAGAABABkAAQAaAAEAGwABABwAAQAeAAEAIAABACIAAQAkAAEAJQABACYAAQAoAAEAKQABACoAAQArAAEALQABAC4AAQAwAAEAMgABADQAAQA1AAEANgABADcAAQA4AAEAOQABADoAAQA8AAIAAgDgCAYWPQABAD4AAQA/AAEAQAABAEEAAQBDAAIAAwB0C6IVyB5FAAIAAgCuDb4aRgAAAEcAAAAAAAIARgB/AewCTgSkBe8GLAhfCYkKpwu+DMkNzQ7KD70QqBGOEmsTQxQSFdsVnhZaFxEYwxhuGRQathpSG+gbehwHHY4dEh6THg0fhB/3H2Ug0CA2IZkh+CFTIqoi/iJOI5sj5SMrJG0krCToJCElVyWJJbkl5SUOJjQmVyZ3JpQmribEJtgm6Sb3JgInCicOJ0UAAgACAK4NvhpGAAAARwAAAAAAAgAGAOUMEha3HG4hmyRyJgUAAQAHAAEACQABAAoAAQALAAEADAABAA8AAQAQAAEAEQABABIAAQATAAEAFAABABYAAQAXAAEAGAABABkAAQAaAAEAGwABABwAAQAeAAEAJAABACUAAQAmAAEAKAABACkAAQAqAAEALQABAC4AAQAwAAEAMgABADQAAQA1AAEANgABADcAAQA4AAEAOQABADoAAQA8AAIAAgDgCAYWPQABAD4AAQA/AAEAQAABAEEAAQBDAAAAAAACABQAaABtAd8CnwSaBsAIBwtkDdIPSxLFFD4XrBkJHFAediBxIjEkoyWoJhMAAgAVAF8AUQGnAkkEIgYmCEsKhgzUDioRhxPmFTwYihrFHOoe7iDHImkkvyWxJicAAgAUAGgAbQHfAp8EmgbACAcLZA3SD0sSxRQ+F6wZCRxQHnYgcSIxJKMlqCY6AAIAFQBfAFEBpwJJBCIGJghLCoYM1A4qEYcT5hU8GIoaxRzqHu4gxyJpJL8lsSZOAAAAAAABAEwAAQBOAAAAAAABAAIAAQAEAAEABgABAAgAAQAKAAEADAABAA4AAQAQAAEAEgABABQAAQAWAAEAGAABABoAAQAcAAEAHgABACAAAQAiAAEAJAABACYAAQAoAAEAKgABACwAAQAuAAEAMAABADIAAQA0AAEANgABADgAAQA6AAEAPAACAAIAsQQGEj0AAQA/AAEAQQABAEMAAQBEAAEARgABAEgAAQBKAAEATAABAE4AAAAAAAAAAAABAAoAAQBDAAAAAAACAAQA7BCOGy8i3CUDAAEABQABAAYAAQAHAAEACAABAAkAAQALAAEADQABAA4AAQAPAAEAEQABABMAAQAUAAEAFgABABgAAQAZAAEAGgABABsAAQAcAAEAHgABACAAAQAhAAEAIgABACQAAQAmAAEAKAABACkAAQArAAEALAABAC0AAQAuAAEALwABADAAAQAxAAEAMgABADQAAQA2AAEANwABADgAAQA5AAEAOgABADwAAQA9AAEAPgABAD8AAQBAAAAAQQABAEMAAgADAHQLohXIHkUAAgACAK4NvhpGAAAARwAAAAAAAgBGAH8B7AJOBKQF7wYsCF8JiQqnC74MyQ3NDsoPvRCoEY4SaxNDFBIV2xWeFloXERjDGG4ZFBq2GlIb6Bt6HAcdjh0SHpMeDR+EH/cfZSDQIDYhmSH4IVMiqiL+Ik4jmyPlIyskbSSsJOgkISVXJYkluSXlJQ4mNCZXJncmlCauJsQm2CbpJvcmAicKJw4nRQACAAIArg2+GkYAAABHAAAAAAACAAYA5QwSFrccbiGbJHImBQABAAYAAQAHAAEACAABAAkAAQALAAEADQABAA4AAQAPAAEAEQABABMAAQAUAAEAFgABABgAAQAZAAEAGgABABsAAQAcAAEAHgABACIAAQAkAAEAJgABACgAAQApAAEAKwABACwAAQAuAAEALwABADAAAQAxAAEAMgABADQAAQA2AAEANwABADgAAQA5AAEAOgABADwAAQA9AAEAPgABAD8AAQBAAAAAAAABAAMAAQAGAAEACQABAAwAAQAPAAEAFgABACUAAQAoAAEAKwABAC4AAQAxAAEANAABADsAAAAAAAIACgDJBIYJJw6lEu8W9RqiHt4hgSRYJgkAAgAUAGgAbQHfAp8EmgbACAcLZA3SD0sSxRQ+F6wZCRxQHnYgcSIxJKMlqCYcAAIADACPAP8BEASaBoIJswwdELQTbxdDGykfGiMnAAIACgDJBIYJJw6lEu8W9RqiHt4hgSRYJjAAAgAUAGgAbQHfAp8EmgbACAcLZA3SD0sSxRQ+F6wZCRxQHnYgcSIxJKMlqCZDAAIADACPAP8BEASaBoIJswwdELQTbxdDGykfGiNOAAAAAAABAAMAAQAGAAEACQABAAwAAQAPAAEAFgABACUAAQAoAAEAKwABAC4AAQAxAAEANAABADsAAAAAAAEACQABABUAAQAeAAEAJwABADMAAQBDAAIADADOBeMKZA9vExMXWRpJHeQfKiIVJJslpyZOAAAAAAABAEMAAgAMAM4F4wpkD28TExdZGkkd5B8qIhUkmyWnJk4AAAAAAAEACQABABUAAQAeAAEAJwABADMAAQBDAAIADADOBeMKZA9vExMXWRpJHeQfKiIVJJslpyZOAAAAAAABAEMAAgAMAM4F4wpkD28TExdZGkkd5B8qIhUkmyWnJk4AAAAAAAAAAAABAAkAAQAVAAEAHgABACcAAQAzAAEAQwACAAwAzgXjCmQPbxMTF1kaSR3kHyoiFSSbJacmTgAAAAAAAQBDAAIADADOBeMKZA9vExMXWRpJHeQfKiIVJJslpyZOAAAAAAABAAYAAQAJAAAAKQABADIAAQA3AAAAQwABAE4AAAAAAAAAAAABAAkAAQAVAAEAHgABACcAAQAzAAEAQwACAAwAzgXjCmQPbxMTF1kaSR3kHyoiFSSbJacmTgAAAAAAAQAJAAEAFQABAB4AAQAnAAEAMwABAEMAAgAMAM4F4wpkD28TExdZGkkd5B8qIhUkmyWnJk4AAAAAAAIADAAPBBQICAznD6gTQhepGtMdryArIyoliiYLAAIAFQA1AMQAmwGvAvUDZgX7Bq8IfwpmDGIObxCMErYU6hYpGXAbvB0NIGMiuSQfAAIACQCOAQAFbAldDocTsxikHRAigiUnAAIADAAPBBQICAznD6gTQhepGtMdryArIyoliiYyAAIAFQA1AMQAmwGvAvUDZgX7Bq8IfwpmDGIObxCMErYU6hYpGXAbvB0NIGMiuSRGAAIACQCOAQAFbAldDocTsxikHRAigiVOAAAAAAABAAMAAQAGAAEACQABAAwAAQAPAAEAFgABACUAAQAoAAEAKwABAC4AAQAxAAEANAABADsAAAAAAAAAAAAAAAAAAQAHAAEADwABABYAAQAeAAEAJgABAC0AAQA1AAEAPAABAEQAAQBOAAAAAAABAAMAAQAGAAEACQABAAwAAQAPAAEAFgABACUAAQAoAAEAKwABAC4AAQAxAAEANAABADsAAAAAAAEACgABAEMAAAAAAAEACgABAEMAAQBOAAAAAAABAAMAAQAGAAEACQABAAwAAQAPAAEAFgABACUAAQAoAAEAKwABAC4AAQAxAAEANAABADsAAAAAAAEAAwABAAYAAQAJAAEADAABAA8AAQAWAAEAJQABACgAAQArAAEALgABADEAAQA0AAEAOwAAAAAAAgAKAMkEhgknDqUS7xb1GqIe3iGBJFgmCQACABQAaABtAd8CnwSaBsAIBwtkDdIPSxLFFD4XrBkJHFAediBxIjEkoyWoJhwAAgAMAI8A/wEQBJoGggmzDB0QtBNvF0MbKR8aIycAAgAKAMkEhgknDqUS7xb1GqIe3iGBJFgmMAACABQAaABtAd8CnwSaBsAIBwtkDdIPSxLFFD4XrBkJHFAediBxIjEkoyWoJkMAAgAMAI8A/wEQBJoGggmzDB0QtBNvF0MbKR8aI04AAAAAAAEAAwABAAYAAQAJAAEADAABAA8AAQAWAAEAJQABACgAAQArAAEALgABADEAAQA0AAEAOwAAAAAAAgAUAGgAbQHfAp8EmgbACAcLZA3SD0sSxRQ+F6wZCRxQHnYgcSIxJKMlqCYTAAIAFQBfAFEBpwJJBCIGJghLCoYM1A4qEYcT5hU8GIoaxRzqHu4gxyJpJL8lsSYnAAIAFABoAG0B3wKfBJoGwAgHC2QN0g9LEsUUPhesGQkcUB52IHEiMSSjJagmOgACABUAXwBRAacCSQQiBiYISwqGDNQOKhGHE+YVPBiKGsUc6h7uIMciaSS/JbEmTgAAAAAAAQBMAAEATgAAAAAAAQACAAEABAABAAYAAQAIAAEACgABAAwAAQAOAAEAEAABABIAAQAUAAEAFgABABgAAQAaAAEAHAABAB4AAQAgAAEAIgABACQAAQAmAAEAKAABACoAAQAsAAEALgABADAAAQAyAAEANAABADYAAQA4AAEAOgABADwAAQA9AAEAPwABAEEAAQBDAAEARAABAEYAAQBIAAEASgABAEwAAQBOAAAAAAAAAAEAAAAAAAAAAAAAAAAAAABDAAIACAAnDmkWAxz/H9gi1CQfJtcmSgAAAAAAAABDAAIACAAnDmkWAxz/H9gi1CQfJtcmSgAAAAAAAABDAAIACAAnDmkWAxz/H9gi1CQfJtcmSgAAAAAAAAAAAAAAAAAAAAAAAQABAAEAAwABAAQAAAAFAAEABgABAAgAAQAJAAAACgABAAsAAQANAAEADgAAAA8AAQAQAAEAEgABABMAAAAUAAEAFQABABcAAQAYAAAAGQABABoAAQAcAAEAHQAAAB4AAQAfAAEAIQABACIAAAAjAAEAJAABACYAAQAnAAAAKAABACkAAQArAAEALAAAAC0AAQAuAAEAMAABADEAAAAyAAEAMwABADUAAQA2AAAANwABADgAAQA6AAEAOwAAADwAAQA9AAEAPwABAEAAAQBCAAAARQACAAQAng4OGXMgNCVIAAAATgAAAAAAAABDAAAARQACAAQAng4OGXMgNCVIAAAATgAAAAAAAAAQAAIAKgCfAS8DtAQtBp0HAwlfCrEL/Aw/DnkPrRDaEf4SHBQyFUMWTBdPGEwZQhoxGxkc+hzVHakedh87IPggrSFaIgAjmyMuJLYkNCWlJQomYiaqJuAmAyc5AAAAPwACABAA/wOyByYLZA5wEU4U/xaHGeIbFB4YIOshiiPrJAUmxiZOAAAAAAAAABAAAgAqAJ8BLwO0BC0GnQcDCV8KsQv8DD8OeQ+tENoR/hIcFDIVQxZMF08YTBlCGjEbGRz6HNUdqR52Hzsg+CCtIVoiACObIy4ktiQ0JaUlCiZiJqom4CYDJzkAAAA/AAIAEAD/A7IHJgtkDnARThT/FocZ4hsUHhgg6yGKI+skBSbGJk4AAAAAAAAAAwACABoAUwKVBMQG4gjxCvEM4Q7EEJgSXRQTFrsXVBndGlccwR0YH10gjiGqIq4jmCRmJRImlybwJhwAAAAeAAIAHAArAkYEUQZOCD0KHwzzDbsPdhEmE8cUXRbmF2IZ0RoxHIMdxh76Hx0hLSIrIxIk4iSZJTEmpyb0JjkAAAA7AAIAFADmApYFIQiQCuYMKA9XEXUTgxWBF24ZSxsXHc8edCD/IW4juiTXJa8mTgAAAAAAAAADAAIAGgBTApUExAbiCPEK8QzhDsQQmBJdFBMWuxdUGd0aVxzBHRgfXSCOIaoiriOYJGYlEiaXJvAmHAAAAB4AAgAcACsCRgRRBk4IPQofDPMNuw92ESYTxxRdFuYXYhnRGjEcgx3GHvofHSEtIisjEiTiJJklMSanJvQmOQAAADsAAgAUAOYClgUhCJAK5gwoD1cRdRODFYEXbhlLGxcdzx50IP8hbiO6JNclryZOAAAAAAAAAAAAAABDAAIACgDVB/8MRhEQFX0YpBuOHj0hqyPEJUwAAAAAAAAAQwAAAEUAAgAEAJ4ODhlzIDQlSAAAAE4AAAAAAAAAQwAAAEUAAgAEAJ4ODhlzIDQlSAAAAE4AAAAAAAAAAQABAAMAAQAFAAAABwABAAkAAQALAAAADQABAA8AAQARAAAAEwABABUAAQAXAAAAGQABABsAAQAdAAAAHwABACEAAQAjAAAAJQABACcAAQApAAAAKwABAC0AAQAvAAAAMQABADMAAQA1AAAANwABADkAAQA7AAAAPQABAD8AAQBBAAAAAAAAAAUAAgAZAAEEgwegCm0N9g9HEmgUXxYtGNoZaBvZHC0eaB+KIJUhiiJoIzEk5CSAJQYmcybGJvwmHQAAAB4AAgAfAE4DQAbqCFoLlw2oD5QRXhMKFZoWERhyGb4a9hsaHS0eLx8gIAIh1SGYIk4j9SONJBclkiX+JVompSbeJgMnPAAAAD4AAgARADcFRgm3DMEPgBIDFVYXfxmDG2UdJh/HIEgipyPfJOklsyZOAAAAAAAAAAUAAgAZAAEEgwegCm0N9g9HEmgUXxYtGNoZaBvZHC0eaB+KIJUhiiJoIzEk5CSAJQYmcybGJvwmHQAAAB4AAgAfAE4DQAbqCFoLlw2oD5QRXhMKFZoWERhyGb4a9hsaHS0eLx8gIAIh1SGYIk4j9SONJBclkiX+JVompSbeJgMnPAAAAD4AAgARADcFRgm3DMEPgBIDFVYXfxmDG2UdJh/HIEgipyPfJOklsyZOAAAAAAACAAwAoQWvCjsPWRMQF2caZB0HIE4iNCSwJa8mCwAAAA4AAgARACAE8Ad4C8AOzBGhFEIXshnxGwIe5B+WIRYjZCR4JU4m3CYeAAAAIAACABEAIATwB3gLwA7MEaEUQheyGfEbAh7kH5YhFiNkJHglTibcJjAAAAAyAAIAGQDQAlsFtgfrCQIM/g3jD7URdRMkFcQWUxjWGUsbsRwKHlMfjyC6IdQi2yPLJKElVCbYJkoAAAAAAAIADAChBa8KOw9ZExAXZxpkHQcgTiI0JLAlryYLAAAADgACABEAIATwB3gLwA7MEaEUQheyGfEbAh7kH5YhFiNkJHglTibcJh4AAAAgAAIAEQAgBPAHeAvADswRoRRCF7IZ8RsCHuQfliEWI2QkeCVOJtwmMAAAADIAAgAZANACWwW2B+sJAgz+DeMPtRF1EyQVxBZTGNYZSxuxHAoeUx+PILoh1CLbI8skoSVUJtgmSgAAAAAAAABDAAIACgAUChwReBayGhge1CAEI7Yk9iXDJkwAAAAAAAAAQwAAAAAAAABDAAAAAAAAAEMAAgAKAKAHtgz5EMEUNBhlG1oeFSGSI7klTAAAAAAAAABDAAIABADUET0chiLyJUYAAAAAAAAAQwACAAQA1BE9HIYi8iVGAAAAAAAAAEMAAgAEANQRPRyGIvIlRgAAAAAAAABDAAIABADUET0chiLyJUYAAAAAAAAAQwACAAQA1BE9HIYi8iVGAAAAAAAAAEMAAgAEANQRPRyGIvIlRgAAAAAAAAAAAAAAAgAAAAQAAAAGAAAACAAAAAoAAAAMAAAADgAAABAAAAASAAAAFAAAABYAAAAYAAAAGgAAABwAAAAeAAAAIAAAACIAAAAkAAAAJgAAACgAAAAqAAAALAAAAC4AAAAwAAAAMgAAADQAAAA2AAAAOAAAADoAAAA8AAAAPgAAAEAAAABCAAAARAAAAAAAAAACAAAABAAAAAYAAAAIAAAACgAAAAwAAAAOAAAAEAAAABIAAAAUAAAAFgAAABgAAAAaAAAAHAAAAB4AAAAgAAAAIgAAACQAAAAmAAAAKAAAACoAAAAsAAAALgAAADAAAAAyAAAANAAAADYAAAA4AAAAOgAAADwAAAA+AAAAQAAAAEIAAABEAAAAAAAAAAIAAAAEAAAABgAAAAgAAAAKAAAADAAAAA4AAAAQAAAAEgAAABQAAAAWAAAAGAAAABoAAAAcAAAAHgAAACAAAAAiAAAAJAAAACYAAAAoAAAAKgAAACwAAAAuAAAAMAAAADIAAAA0AAAANgAAADgAAAA6AAAAPAAAAD4AAABAAAAAQgAAAEQAAAAAAAIABgDlDBIWtxxuIZskciYFAAEABwABAAkAAQALAAEADQABAA8AAQARAAEAEwABABQAAQAWAAEAGAABABoAAQAcAAEAHgABACAAAQAiAAEAJAABACYAAQAoAAEAKQABACsAAQAtAAEALgABADAAAQAyAAEANAABADYAAQA4AAEAOgABADwAAQA9AAEAPwABAEEAAQBDAAIAAwAUEnYdYSRFAAIAAgDjHO0kRgAAAAAAAgBEAIgBAQNuBMwFHgdhCJ0JywryCwsNHg4mDyYQHhENEvYS1xOvFIEVTRYRF88XiBg7GecZjxowG8wbYxz1HIIdCh6NHgsfhh/7H20g2iBDIaghCSJmIr8iFSNmI7Qj/iNFJIgkxyQEJT0lciWkJdMl/yUnJkwmbiaMJqgmwCbVJucm9iYBJwknDidDAAIAAwAUEnYdYSRFAAAAAAAAAAUA//8GAAAACwD//wwAAAARAP//EgAAABcA//8YAAAAHQD//x4AAAAjAP//JAAAACkA//8qAAAALwD//zAAAAA1AP//NgAAADsA//88AAAAQQD//wAAAQABAAAAAwABAAUAAQAGAAEABwAAAAkAAQALAAEADAABAA0AAAAPAAEAEQABABIAAQATAAAAFQABABcAAQAYAAEAGQAAABsAAQAdAAEAHgABAB8AAAAhAAEAIwABACQAAQAlAAAAJwABACkAAQAqAAEAKwAAAC0AAQAvAAEAMAABADEAAAAzAAEANQABADYAAQA3AAAAOQABADsAAQA8AAEAPQAAAD8AAQBBAAAAAAD//0MAAABKAP//AAABAEMAAQBFAAIABgCJCBoQ1hbAHLchbSVKAAAAAAD//wAAAAAAAP//QwAAAEwA//8AAAEAQwABAEcAAgAGAO8ONBhjHociKiWdJkwAAAAAAAAAAAABAEUAAgAEAJ4ODhlzIDQlSAAAAAAAAAAAAAEARQACAAQAng4OGXMgNCVIAAAAAAAAAAAAAQBFAAIABACeDg4ZcyA0JUgAAAAAAAEARQACAAQAng4OGXMgNCVIAAAAAAAAAEcA//8AAAEARwABAE4AAAAAAAAAAAAAAB0A//8eAAAAPAD//z4AAABOAP//AAABAAUAAgAFABsFIwyHE+0a9SEJAAAAFgACAAgA3wHrBQcLphBqFgkcJSExJR0AAQAeAAIACAD6AmAHIwwNEQMW7RqwHxYkJQAAADIAAgALACABtgMfBwcLNg+HE9oXCRzxH1oj8CU8AAEAPgACAAUAGwUjDIcT7Rr1IUIAAABJAAIABgDfAsAI0g8+F1AeMSROAAAAAAAAAAsA//8OAAAAHgD//yAAAAAwAP//MgAAAEoA//8AAAIABAB0BhQP/BecIAMAAAAIAAIABAAABV0OsxgQIgsAAQAOAAIABAB0BhQP/BecIBEAAAAXAAIACADfAesFBwumEGoWCRwlITElHgABACAAAgAEAHQGFA/8F5wgIwAAACkAAgAIAN8B6wUHC6YQahYJHCUhMSUwAAEAMgACAAcAfwOMCPgNhxMYGYQekSM4AAAAQQACAAoAUQFJBCYIhgwqEeYVihrqHscivyVKAAAAAAAAADkA//8/AAAATgD//wAAAQAJAAIACADfAesFBwumEGoWCRwlITElEAABACcAAgATAHIAjgEeAwAFHwdsCdgLXQ7uEIcTIhazGDgbpB3xHxAi8iOCJZ4mOQABADwAAgAEAAAFXQ6zGBAiPwABAEcAAgAIAN8B6wUHC6YQahYJHCUhMSVOAAAAAAAAABwA//8eAAAAOQD//zsAAABOAP//AAABAAMAAgALACABtgMfBwcLNg+HE9oXCRzxH1oj8CUNAAAAEgACAAsAIAG2Ax8HBws2D4cT2hcJHPEfWiPwJRwAAQAeAAIACgD3BEwJXQ1CEQIVoBgcHG8fiyJPJScAAAAsAAIADgDBAI4CAAXfBwcLXQ7MEUQVsxgJHDEfECKCJE8mOQABADsAAgAHAKIGXgy7EdUWrxs7IFQkQQAAAEUAAgAKAFEBSQQmCIYMKhHmFYoa6h7HIr8lTgAAAAAAAAAAAAAATAD//wAAAQBDAAAARgACAAcA+AxAFSkbiR/FIhElhCZMAAAAAAAAAAAAAAAAAP//QwAAAEwA//8AAAEARgACAAcA3wmbEdgX6hz7IBkkNyZMAAAAAAAAAAEAAQADAAAABQABAAcAAAAJAAEACwAAAA0AAQAPAAAAEQABABMAAAAVAAEAFwAAABkAAQAbAAAAHQABAB8AAAAhAAEAIwAAACUAAQAnAAAAKQABACsAAAAtAAEALwAAADEAAQAzAAAANQABADcAAAA5AAEAOwAAAD0AAQA/AAAAQQABAEMAAABFAP//AAAAAAEA//8CAAAAAwD//wQAAAAFAP//BgAAAAcA//8IAAAACQD//woAAAALAP//DAAAAA0A//8OAAAADwD//xAAAAARAP//EgAAABMA//8UAAAAFQD//xYAAAAXAP//GAAAABkA//8aAAAAGwD//xwAAAAdAP//HgAAAB8A//8gAAAAIQD//yIAAAAjAP//JAAAACUA//8mAAAAJwD//ygAAAApAP//KgAAACsA//8sAAAALQD//y4AAAAvAP//MAAAADEA//8yAAAAMwD//zQAAAA1AP//NgAAADcA//84AAAAOQD//zoAAAA7AP//PAAAAD0A//8+AAAAPwD//0AAAABBAP//QgAAAEMA//8AAAEAAQABAEIAAQBDAAIABACeDSAWJB0OI0YAAAAAAAEAAAABAEUAAgAEAJ4ODhlzIDQlSAAAAAAA//9HAAAAAAD//0cAAAAAAAAARwD//wAA//9OAAAAAAD//wAAAQBGAAEARwAAAAAAAQBGAAEARwAAAAAAAQBGAAEARwAAAAAAAQBDAAEARgAAAAAAAQBDAAIABAA1D2UX9R1nI0YAAAAAAAEAGgABAB4AAQAjAAEAJgABAC4AAQAzAAEAOAABADwAAAAAAAEABQABAAgAAQAKAAEADgABABAAAQAVAAEAGAABABoAAQAeAAEAIwABACYAAQAoAAEALAABAC4AAQAzAAEANgABADgAAQA8AAAAAAACAAwAAQT6B+gLwA99ExYXfxqtHY8gEyMcJYUmCwACABAANQE4A4AF6wdvCv8MmQ84EtgUdxcRGqEcJR+QIdgj2yUaAAIABAAHFzUguySsJh0AAAAeAAAAAAACAAwAAQT6B+gLwA99ExYXfxqtHY8gEyMcJYUmCwACABAANQE4A4AF6wdvCv8MmQ84EtgUdxcRGqEcJR+QIdgj2yUaAAIABAAHFzUguySsJh0AAAAeAAAAAAABABsAAQAeAAEAJgABACcAAQAxAAEAMwABADkAAQA8AAAAAAABABsAAQAeAAAAAAABAAMAAQAFAAEACAABAAsAAQAOAAEAEAABABMAAQAWAAEAGQABABsAAQAeAAEAIQABACMAAQAmAAEAJwABACkAAQAsAAEALgABADEAAQAzAAEANAABADcAAQA5AAEAPAAAAAAAAQAFAAEACQABAA0AAQAVAAEAHgABACEAAQAkAAEAJwABAC0AAQA0AAAAAAACAAwA+gBBA0kGyQmUDYcRiRV8GUcdxyDPIxYmCwACABAANQE4A4AF6wdvCv8MmQ84EtgUdxcRGqEcJR+QIdgj2yUaAAIABAAHFzUguySsJh0AAAAeAAAAAAACAAwA+gBBA0kGyQmUDYcRiRV8GUcdxyDPIxYmCwACABAANQE4A4AF6wdvCv8MmQ84EtgUdxcRGqEcJR+QIdgj2yUaAAIABAAHFzUguySsJh0AAAAeAAAAAAAAAAAAAAAAAAEABQAAAAkAAQANAAEAEQABABUAAQAeAAEAIQAAACQAAQAnAAEAKgABAC0AAQA0AAAAAAACAAwA+gBBA0kGyQmUDYcRiRV8GUcdxyDPIxYmCwACAA0AsAMZB14Khw2dEJ8TjhZqGTAc3B5pIcYj1iUXAAIACAA8Dj4WshueH3wiiyTyJccmHgACAB8AHgS1B+IKuA1FEJMSqxSTFlAY5hlaG7Ac6B0FHwkg+CDPIZQiRCPkI3Mk8SRhJcIlFSZcJpYmxCbmJv4mDCc8AAAAAAACAAwA+gBBA0kGyQmUDYcRiRV8GUcdxyDPIxYmCwACAA0AsAMZB14Khw2dEJ8TjhZqGTAc3B5pIcYj1iUXAAIACAA8Dj4WshueH3wiiyTyJccmHgACAB8AHgS1B+IKuA1FEJMSqxSTFlAY5hlaG7Ac6B0FHwkg+CDPIZQiRCPkI3Mk8SRhJcIlFSZcJpYmxCbmJv4mDCc8AAAAAAABAAUAAQAJAAEADQABABEAAQAVAAEAHgABACEAAQAkAAEAJwABACoAAQAtAAEANAAAAAAAAgAMAAEE+gfoC8APfRMWF38arR2PIBMjHCWFJgsAAQAXAAIACAA8Dj4WshueH3wiiyTyJccmHgACAB8AHgS1B+IKuA1FEJMSqxSTFlAY5hlaG7Ac6B0FHwkg+CDPIZQiRCPkI3Mk8SRhJcIlFSZcJpYmxCbmJv4mDCc8AAAAAAAAAAAAAQAFAAEACQABAA0AAQARAAEAFQABAB4AAQAhAAEAJAABACcAAQAqAAEALQABADQAAAAAAAIACQCUAnQGsQoUD4cT/BdfHJwgfCQIAAEACgAAAAAAAgADAIwIhxOEHgIAAQAEAAEABgABAAgAAQAKAAEADAABAA4AAQAQAAEAEgABABQAAQAWAAEAGAABABoAAQAcAAEAHgABACAAAQAiAAEAJAABACYAAQAoAAEAKgABACwAAQAuAAEAMAABADIAAQA0AAEANgABADgAAQA6AAEAPAAAAAAAAQAFAAEACQABAA0AAQARAAEAFQABAB4AAQAhAAEAJAABACcAAQAqAAEALQABADQAAAAAAAAAAAAAAAAAAQAFAAAACQABAA0AAQARAAEAFQABAB4AAQAhAAAAJAABACcAAQAqAAEALQABADQAAAAAAAIABwDUBLAJkg55E2EYSR0uIgYAAgAFAHYG+AyAEwsakiAKAAIABgClBUEL1hBmFvQbgSEPAAIABwDvBN4JzQ65E54Yex1MIhUAAgAKAL0DbwcXC7QOSRLUFVYZzxxBIK0jHgACAB8A7wHYA7kFkgdiCSsL6wygDk0Q8RGJExYVmRYPGHkZ1RokHGUdlh64H8ggyCG1Io8jVCQEJZ0lHiaFJtEmACc8AAAAAAABAAUAAQAJAAEADQABABEAAQAVAAEAHgABACEAAQAkAAEAJwABACoAAQAtAAEANAAAAAAAAQAaAAEAHgABACUAAQAnAAEAMgABADMAAQA5AAEAPAAAAAAAAQAaAAEAHgAAAAAAAQAFAAEACAABAAoAAQAOAAEAEAABABUAAQAYAAEAGgABAB4AAQAgAAEAJQABACcAAQAoAAEAKgABAC4AAQAwAAEAMgABADMAAQA1AAEANwABADkAAQA8AAAAAAACAAcA1AAmA8EGdwsqEbkXCx8GAAIABQDUBfcLZBIRGfYfCgACAAYAHAVoCt4PehU6GxchDwACAAcAkQQ9CQMO4BLRF9Yc7CEVAAIACgB4A/UGeAoADowRGxWwGEUc3R92Ix4AAgAfAKYBTAPwBJMGMwjQCWoLAQ2UDiIQrBEvE60UIhaRF/gYVRqpG/EcLh5fH4AgkiGTIoAjWiQaJcIlTCa1JvgmPAAAAAAAAgAJAJQCdAaxChQPhxP8F18cnCB8JAgAAQAKAAAAAAACAAMAjAiHE4QeAgABAAQAAQAGAAEACAABAAoAAQAMAAEADgABABAAAQASAAEAFAABABYAAQAYAAEAGgABABwAAQAeAAEAIAABACIAAQAkAAEAJgABACgAAQAqAAEALAABAC4AAQAwAAEAMgABADQAAQA2AAEAOAABADoAAQA8AAAAAAAAAAAAAAAAAAEAGwABAB4AAQAmAAEAJwABADEAAQAzAAEAOQABADwAAAAAAAEAGQABABsAAQAeAAEAOQABADwAAAAAAAEAAwABAAUAAQAIAAEACwABAA4AAQAQAAEAEwABABYAAQAZAAEAGwABAB4AAQAhAAEAJAABACYAAQAnAAEAKQABACwAAQAvAAEAMQABADMAAQA0AAEANwABADkAAQA8AAAAAAABAAUAAQAJAAEADQABABEAAQAVAAEAHgABACEAAQAkAAEAJwABACoAAQAtAAEANAAAAAAAAgAHANQEsAmSDnkTYRhJHS4iBgACAAUAdgb4DIATCxqSIAoAAgAGAKUFQQvWEGYW9BuBIQ8AAgAHAO8E3gnNDrkTnhh7HUwiFQACAAoAvQNvBxcLtA5JEtQVVhnPHEEgrSMeAAIAHwDvAdgDuQWSB2IJKwvrDKAOTRDxEYkTFhWZFg8YeRnVGiQcZR2WHrgfyCDIIbUijyNUJAQlnSUeJoUm0SYAJzwAAAAAAAEABQABAAkAAQANAAEAEQABABUAAQAeAAEAIQABACQAAQAnAAEAKgABAC0AAQA0AAAAAAACAAsAIAG2Ax8HBws2D4cT2hcJHPEfWiPwJQoAAgAMAHkAqAFYA24F2geVCpwN7xCOFIQY2hynIRUAAgANAJoBLAQLBxIKLg1YEIcTuBbiGf4cBSDkInYlIQACABwABAUXCYgMgg8dEm4UfxZbGAgajhvvHC8eUh9cIEwhJiLrIpwjOiTIJEQlsSUOJl0mnSbPJvMmCSc8AAAAAAACAAsAIAG2Ax8HBws2D4cT2hcJHPEfWiPwJQoAAgAMAHkAqAFYA24F2geVCpwN7xCOFIQY2hynIRUAAgANAJoBLAQLBxIKLg1YEIcTuBbiGf4cBSDkInYlIQACABwABAUXCYgMgg8dEm4UfxZbGAgajhvvHC8eUh9cIEwhJiLrIpwjOiTIJEQlsSUOJl0mnSbPJvMmCSc8AAAAAAACAAsAIAG2Ax8HBws2D4cT2hcJHPEfWiPwJQoAAgAMAHkAqAFYA24F2geVCpwN7xCOFIQY2hynIRUAAgANANoA3wKXBcAINAzSD4cTPhfcGlAeeSExJDYmIQACABwABAUXCYgMgg8dEm4UfxZbGAgajhvvHC8eUh9cIEwhJiLrIpwjOiTIJEQlsSUOJl0mnSbPJvMmCSc8AAAAAAACAAsAIAG2Ax8HBws2D4cT2hcJHPEfWiPwJQoAAAAAAAAAAAACAAsAIAG2Ax8HBws2D4cT2hcJHPEfWiPwJQoAAgAMAHkAqAFYA24F2geVCpwN7xCOFIQY2hynIRUAAgANANoA3wKXBcAINAzSD4cTPhfcGlAeeSExJDYmIQACABwABAUXCYgMgg8dEm4UfxZbGAgajhvvHC8eUh9cIEwhJiLrIpwjOiTIJEQlsSUOJl0mnSbPJvMmCSc8AAAAAAACAAsAIAG2Ax8HBws2D4cT2hcJHPEfWiPwJQoAAAAAAAIAEwAtAK0AdgF/AsADNQXYBqUImAquDOUOOBGnEzAWzRiCG0seJyEUJBIAAgAMAL8CjQVqCFMLRw5HEU8UYBd3GpYduiDkIx0AAgAEAL4Hfw9JFyIfIAACAB0AwgGEA0UFAwe+CHUKKQzZDYYPLBHKEmQU9BV8F/wYcRraGzYdhR7EH/QgECIYIwgk3ySaJTQmqib1JjwAAAAAAAAAAAACAAsAIAG2Ax8HBws2D4cT2hcJHPEfWiPwJQoAAgAMAHkAqAFYA24F2geVCpwN7xCOFIQY2hynIRUAAgANANoA3wKXBcAINAzSD4cTPhfcGlAeeSExJDYmIQACABwABAUXCYgMgg8dEm4UfxZbGAgajhvvHC8eUh9cIEwhJiLrIpwjOiTIJEQlsSUOJl0mnSbPJvMmCSc8AAAAAAACAAsAIAG2Ax8HBws2D4cT2hcJHPEfWiPwJQoAAAAAAAIABwDUBLAJkg55E2EYSR0uIgYAAgAFAHYG+AyAEwsakiAKAAIABgClBUEL1hBmFvQbgSEPAAIABwDvBN4JzQ65E54Yex1MIhUAAgAKAL0DbwcXC7QOSRLUFVYZzxxBIK0jHgACAB8A7wHYA7kFkgdiCSsL6wygDk0Q8RGJExYVmRYPGHkZ1RokHGUdlh64H8ggyCG1Io8jVCQEJZ0lHiaFJtEmACc8AAAAAAABAAUAAQAJAAEADQABABEAAQAVAAEAHgABACEAAQAkAAEAJwABACoAAQAtAAEANAAAAAAAAAAAAAAAAAAAAAAAAQAFAAEACQABAA0AAQARAAEAFQABAB4AAQAhAAEAJAABACcAAQAqAAEALQABADQAAAAAAAIAHQA1AMEAjgGOArYDAAVlBt8HbAkHC6wMXQ4REMwRhxNEFf8WsxhkGgkcpB0xH6sgECJaI4IkgiVPJtsmHAAAAAAAAQAFAAEACQABAA0AAQARAAEAFQABAB4AAQAhAAEAJAABACcAAQAqAAEALQABADQAAAAAAAEABQABAAkAAQANAAEAEQABABUAAQAeAAEAIQABACQAAQAnAAEAKgABAC0AAQA0AAAAAAACAAcA1ASwCZIOeRNhGEkdLiIGAAIABQB2BvgMgBMLGpIgCgACAAYApQVBC9YQZhb0G4EhDwACAAcA7wTeCc0OuROeGHsdTCIVAAIACgC9A28HFwu0DkkS1BVWGc8cQSCtIx4AAgAfAO8B2AO5BZIHYgkrC+sMoA5NEPERiRMWFZkWDxh5GdUaJBxlHZYeuB/IIMghtSKPI1QkBCWdJR4mhSbRJgAnPAAAAAAAAQAFAAEACQABAA0AAQARAAEAFQABAB4AAQAhAAEAJAABACcAAQAqAAEALQABADQAAAAAAAIABwDUACYDwQZ3CyoRuRcLHwYAAgAFANQF9wtkEhEZ9h8KAAIABgAcBWgK3g96FTobFyEPAAIABwCRBD0JAw7gEtEX1hzsIRUAAgAKAHgD9QZ4CgAOjBEbFbAYRRzdH3YjHgACAB8ApgFMA/AEkwYzCNAJagsBDZQOIhCsES8TrRQiFpEX+BhVGqkb8RwuHl8fgCCSIZMigCNaJBolwiVMJrUm+CY8AAAAAAABAAgAAQAKAAAAAAABAAIAAQAEAAEABgABAAgAAQAKAAEADAABAA4AAQAQAAEAEgABABQAAQAWAAEAGAABABoAAQAcAAEAHgABACAAAQAiAAEAJAABACYAAQAoAAEAKgABACwAAQAuAAEAMAABADIAAQA0AAEANgABADgAAQA6AAEAPAAAAAAAAAAoAAIACACNB0ANNRKxFtMaoR4bIiMlLwACAAQASA8bGmIhoSUyAAEANgACAAcAJApdEvcYJx4TItYkfyY8AAAAAAAAACgAAgAHAFQIjA7wE8sYPR1FIcokLgAAAC8AAgAEAEgPGxpiIaElMgABADUAAAA2AAIABwAkCl0S9xgnHhMi1iR/JjwAAAAAAAAAHgAAAAAAAAAeAAIACwAZCdsPJhVpGd4csB/6IcsjMiU1JtYmKAAAAAAAAAAnAAAALAAAAAAAAAAeAAIACgBlCa8QchYIG6gefiGoIzslSSbhJicAAAAsAAIAEQCZBNQIswxDEIITeBYoGZYbxB2zH2gh4iIjJCsl+yWTJvAmPAAAAAAAAAAeAAAAAAAAACYAAQAoAAEAKwAAADgAAQA5AAEAOwAAAAAAAAAhAAEAIwABACYAAAA1AAEANgABADgAAAAAAAAAEAACACoAnwEvA7QELQadBwMJXwqxC/wMPw55D60Q2hH+EhwUMhVDFkwXTxhMGUIaMRsZHPoc1R2pHnYfOyD4IK0hWiIAI5sjLiS2JDQlpSUKJmImqibgJgMnOQAAAAAAAAAQAAIAKgCfAS8DtAQtBp0HAwlfCrEL/Aw/DnkPrRDaEf4SHBQyFUMWTBdPGEwZQhoxGxkc+hzVHakedh87IPggrSFaIgAjmyMuJLYkNCWlJQomYiaqJuAmAyc5AAAAAAAAAAMAAgAaAFMClQTEBuII8QrxDOEOxBCYEl0UExa7F1QZ3RpXHMEdGB9dII4hqiKuI5gkZiUSJpcm8CYcAAAAHgACABwAKwJGBFEGTgg9Ch8M8w27D3YRJhPHFF0W5hdiGdEaMRyDHcYe+h8dIS0iKyMSJOIkmSUxJqcm9CY5AAAAAAAAAAMAAgAaAFMClQTEBuII8QrxDOEOxBCYEl0UExa7F1QZ3RpXHMEdGB9dII4hqiKuI5gkZiUSJpcm8CYcAAAAHgACABwAKwJGBFEGTgg9Ch8M8w27D3YRJhPHFF0W5hdiGdEaMRyDHcYe+h8dIS0iKyMSJOIkmSUxJqcm9CY5AAAAAAAAAB4AAgADALQNThl8IiAAAAAAAAAAHgACAAMAtA1OGXwiIAAAACIAAAAAAAAAHwABACEAAQAkAAAAMwABADQAAQA2AAAAAAAAADAAAQAxAAEAMwAAAAAAAQAFAAIAGQABBIMHoAptDfYPRxJoFF8WLRjaGWgb2RwtHmgfiiCVIYoiaCMxJOQkgCUGJnMmxib8Jh0AAAAeAAIAHwBOA0AG6ghaC5cNqA+UEV4TChWaFhEYchm+GvYbGh0tHi8fICACIdUhmCJOI/UjjSQXJZIl/iVaJqUm3iYDJzwAAAAAAAEABQACABkAAQSDB6AKbQ32D0cSaBRfFi0Y2hloG9kcLR5oH4oglSGKImgjMSTkJIAlBiZzJsYm/CYdAAAAHgACAB8ATgNABuoIWguXDagPlBFeEwoVmhYRGHIZvhr2GxodLR4vHyAgAiHVIZgiTiP1I40kFyWSJf4lWialJt4mAyc8AAAAAAACAAYAowgLEGwW5RuDIEMkBQACAAcAJgh2D+0VhBspIMQjKiYLAAAADgACABAAQgQwCM4LKg9FEicV0hdKGo4cnx6AIC4ipiPnJOolpyYdAAIAAgAmFXEiHgAAACAAAgARACAE8Ad4C8AOzBGhFEIXshnxGwIe5B+WIRYjZCR4JU4m3CYwAAAAPAAAAAAAAgAGAKMICxBsFuUbgyBDJAUAAgAHACYIdg/tFYQbKSDEIyomCwAAAA4AAgAQAEIEMAjOCyoPRRInFdIXShqOHJ8egCAuIqYj5yTqJacmHQACAAIAJhVxIh4AAAAgAAIAEQAgBPAHeAvADswRoRRCF7IZ8RsCHuQfliEWI2QkeCVOJtwmMAAAAAAAAAAeAAIABgBBCXMRiBhpHvQi8yUjAAAAAAAAAB8AAAAAAAAAHwAAAAAAAAAfAAIACQDyCb0R3BemHFEgDiP8JDom4SYnAAAAAAAAAB4AAQAnAAEAMwABADwAAAAAAAAAHgAAAAAAAAArAAAALQAAAC8AAAAxAAAAMwAAADUAAAA3AAAAOQAAADsAAAAAAAAAKwAAAC0AAAAvAAAAMQAAADMAAAA1AAAANwAAADkAAAA7AAAAAAAAACsAAAAtAAAALwAAADEAAAAzAAAANQAAADcAAAA5AAAAOwAAAAAAAAAlAAEAJwABACoAAAAAAAAAJQABACcAAQApAAAAAAAAACUAAAAAAAAAJQABACcAAQApAAAAAAAAACUAAAAAAAAAJQABACcAAQApAAAAAAAAACUAAgAGAEgL6hOhGswfnSMaJioAAQA8AAAAAAABADwAAAAAAAAAKAD//wAAAQAeAAAAIgACAAcAgwc0DigUZxnyHcgh2yQoAAEAPAAAAAAAAAAuAP//LwAAADUA//82AAAAPAD//wAAAQAoAAEAKwABAC4AAQAvAAEAMgABADUAAQA2AAEAOQABADwAAAAAAAAAIgD//wAAAQAeAAAAIAACAAMAHweHE/EfIgABADwAAAAAAAEANgAAAAAAAQAhAAIABgDrCJ0QVRckHfQhgiUmAAAAAAABADQAAAAAAAEAHwACAAYA6widEFUXJB30IYIlJAAAAAAAAQAxAAAAAAABAB0AAgAGAOsInRBVFyQd9CGCJSIAAAAAAAEAJgACAAYA6widEFUXJB30IYIlKwAAAAAAAQAlAAIABgARCHoPPhZLHHIhVSUqAAAAAAAAAAAAAAAdAP//HgAAADwA//8AAAEABQACAAUAGwUjDIcT7Rr1IQkAAAAWAAIACADfAesFBwumEGoWCRwlITElHQABAB4AAgAIAPoCYAcjDA0RAxbtGrAfFiQlAAAAMgACAAsAIAG2Ax8HBws2D4cT2hcJHPEfWiPwJTwAAAAAAAAACwD//w4AAAAeAP//IAAAADAA//8AAAIABAB0BhQP/BecIAMAAAAIAAIABAAABV0OsxgQIgsAAQAOAAIABAB0BhQP/BecIBEAAAAXAAIACADfAesFBwumEGoWCRwlITElHgABACAAAgAEAHQGFA/8F5wgIwAAACkAAgAIAN8B6wUHC6YQahYJHCUhMSUwAAEAPAAAAAAAAAA5AP//AAABAAkAAgAIAN8B6wUHC6YQahYJHCUhMSUQAAEAJwACABMAcgCOAR4DAAUfB2wJ2AtdDu4QhxMiFrMYOBukHfEfECLyI4IlniY5AAEAPAAAAAAAAAAcAP//HgAAADkA//8AAAEAAwACAAsAIAG2Ax8HBws2D4cT2hcJHPEfWiPwJQ0AAAASAAIACwAgAbYDHwcHCzYPhxPaFwkc8R9aI/AlHAABAB4AAgAKAPcETAldDUIRAhWgGBwcbx+LIk8lJwAAACwAAgAOAMEAjgIABd8HBwtdDswRRBWzGAkcMR8QIoIkTyY5AAEAPAAAAAAAAQA8AAAAAAAAACMA//8AAAEAHgAAAB8AAgAFABoOmBdOHvwi7yUjAAAAAAABADwAAAAAAAEAPAAAAAAAAAAnAP//AAABAB8AAAAjAAIABQCDD0EZtR/fI0ImJwABADwAAAAAAAEALAAAAC0AAQAuAAAALwABADAAAAAxAAEAMgAAADMAAQA0AAAANQABADYAAAA3AAEAOAAAADkAAQA6AAAAOwABADwAAAAAAAEAKwAAAAAAAAAnAP//LAAAADAA//8xAAAAMwD//zQAAAA2AP//NwAAADgA//85AAAAOgD//zsAAAAAAAEAHgABACIAAgAGAOEJYRJ+GTAfbSMbJicAAQAsAAEAMAABADsAAQA8AAAAAAAAADkAAQAAAAEAJgACAAYA6widEFUXJB30IYIlKwAAAAAAAAAeAP//AAAAAB4A//8AAAEAHgAAAAAAAAAeAP//AAD//wAAAQAlAAAAAAABACUAAAAAAAEAJQAAAAAAAQAlAAAAAAABACUAAgAGACwKhBJbGd0eFSPwJSoAAAAAAGQAAAACAAAAAAAAAAMAZAAAAA8AAgAAAAcACQALAA0ADwARABMAFQAXABkAGwAdAB8AIQAjAGQAAAAFAAIAHgAlAD4ARQBHAFAAZAAAAAQAAgAoAFIAawB4AIEAZAAAAA4AAgAwAIMAhQCHAIkAiwCNAI8AkQCYAJoAoQCjAKUApwBkAAAABgACAEwAqQCrAK0ArwCxALMAZAAAAAUAAgBYALUAzgDVAN8A6ABkAAAABAACAGIA6gADARABGQFkAAAABQACAGoAGwE0ATsBRQFOAWQAAAABAAIAdABQAWQAAAAFAAIAdgBSAWkBcQF6AYUBZAAAAAcAAgCAAIcBiQGLAY0BjwGRAZMBZAAAAAUAAgCOAJUBrAG0AbYBvwFkAAAABQACAJgAwQHYAeAB4gHrAWQAAAAHAAIAogDtAe8B8QHzAfUB9wH5AWQAAAAFAAIAsAD7ARICGgIcAiUCZAAAAAEAAgC6ACcCZAAAAAwAAgC8ACkCMQI6AjwCQwJKAkwCUwJbAl0CZAJsAmQAAAAMAAIA1ABuAnYCfwKBAogCjwKRApgCoAKiAqkCsQJkAAAABwACAOwAswK1ArcCuQK7Ar0CvwJkAAAAEwACAPoAwQLDAsUCxwLJAssCzQLPAtEC0wLVAtcC2QLbAt0C3wLhAuMC5QJkAAAABAACACAB5wIBAwsDFgNkAAAABQACACgBGAMvAzYDQANLA2QAAAAHAAIAMgFNA08DUQNTA1UDVwNZA2QAAAABAAIAQAFbA2QAAAABAAIAQgFdA2QAAAAHAAIARAFfA2EDYwNlA2cDaQNrA2QAAAAGAAIAUgFtA4QDiwOSA5oDpANkAAAABwACAF4BpgOoA6oDrAOuA7ADsgNkAAAADwACAGwBtAO2A7gDugO8A74DwAPCA8QDxgPIA8oDzAPOA9ADZAAAAAYAAgCKAdID6QPwA/cD/wMJBGQAAAATAAIAlgELBA0EDwQRBBMEFQQXBBkEGwQdBB8EIQQjBCUEJwQpBCsELQQvBGQAAAABAAIAvAExBGQAAAAEAAIAvgEzBE0EVARiBGQAAAAXAAIAxgFkBGYEaARqBGwEbgRwBHIEdAR2BHgEegR8BH4EgASCBIQEhgSIBIoEjASOBJAEZAAAAAcAAgD0AZIElASWBJgEmgScBJ4EZAAAAAYAAgACAqAEtwS+BMUEzQTXBGQAAAAHAAIADgLZBNsE3QTfBOEE4wTlBGQAAAAOAAIAHALnBOkE6wTtBO8E8QTzBPUE9wT5BPsE/QT/BAEFZAAAAAUAAgA4AgMFGgUhBSsFNgVkAAAABQACAEICOAVPBVYFYAVrBWQAAAAFAAIATAJtBYQFiwWVBaAFZAAAAAUAAgBWAqIFuQXABcoF1QVkAAAAAQACAGAC1wVkAAAABQACAGIC2QXwBfcFAQYMBmQAAAAFAAIAbAIOBiUGLAY2BkEGZAAAAAEAAgB2AkMGZAAAAAUAAgB4AkUGXAZjBm0GeAZkAAAABQACAIICegaRBpgGogatBmQAAAAGAAIAjAKvBsYGzQbUBtwG5gZkAAAABwACAJgC6AbqBuwG7gbwBvIG9AZkAAAAAQACAKYC9gZkAAAAAQACAKgC+AZkAAAAAQACAKoC+gZkAAAABwACAKwC/Ab+BgAHAgcEBwYHCAdkAAAABAACALoCCgcMBxoHKgdkAAAABAACAMICLAcuBzwHTAdkAAAABwACAMoCTgdQB1IHVAdWB1gHWgdkAAAABwACANgCXAdeB2AHYgdkB2YHaAdkAAAABgACAOYCageBB4gHjweXB6EHZAAAAAcAAgDyAqMHpQenB6kHqwetB68HZAAAAAYAAgAAA7EHyAfPB9YH3gfoB2QAAAATAAIADAPqB+wH7gfwB/IH9Af2B/gH+gf8B/4HAAgCCAQIBggICAoIDAgOCGQAAAACAAIAMgMQCBIIZAAAAAMAAgA2AxQIFggiCGQAAAACAAIAPAMkCCYIZAAAAAIAAgBAAygIKghkAAAABAACAEQDLAguCD0ITwhkAAAABAACAEwDUQhTCGIIdAhkAAAABgACAFQDdgh4CIgIjwiRCKUIZAAAAAYAAgBgA6cIqQi5CMAIwgjWCGQAAAADAAIAbAPYCNoI5QhkAAAAAwACAHID5wjpCPQIZAAAAAYAAgB4A/YI+AgHCQ4JEAklCWQAAAAGAAIAhAMnCSkJOAk/CUEJVglkAAAACAACAJADWAljCWUJbgl3CXkJhwmJCWQAAAAIAAIAoAOLCZYJmAmhCaoJrAm6CbwJZAAAAAIAAgCwA74JwAlkAAAAAgACALQDwgnECWQAAAADAAIAuAPGCcgJ1QlkAAAAAQABAAAA1wlkAAAAAQABAAEA2QlkAAAAAQABAAIA2wlkAAAAAQABAAMA3QlkAAAAAQABAAQA3wlkAAAAAQABAAUA4QlkAAAAAQABAAYA4wlkAAAAAQABAAcA5QlkAAAAAQABAAgA5wlkAAAAAQABAAkA6QlkAAAABAAAAAAA6wntCe8J8QlkAAAACQABAAoA8wn1CfsJ/QkFCgcKDwoRChoKZAAAAAYAAAAAABwKHgogCiIKJAomCmQAAAAMAAEAEwAoCi4KMAo2CjgKPQo/CkgKSgpQClIKWwpkAAAAAgAAAAAAXQpfCmQAAAAFAAEAHwBhCmMKbwpxCoAKZAAAAAQAAAAAAIIKhAqGCogKZAAAAAkAAQAkAIoKjAqWCpgKogqkCq0Krwq7CmQAAAACAAAAAAC9Cr8KZAAAAAQAAQAtAMEKwwrFCs0KZAAAAAIAAAAAAM8K0QpkAAAAAgABADEA0wrVCmQAAAABAAEAMwDXCmQAAAABAAEANADZCmQAAAACAAAAAADbCt0KZAAAAAQAAQA1AN8K4QrjCuwKZAAAAAEAAAAAAO4KZAAAAAEAAQA5APAKZAAAAAIAAAAAAPIK9ApkAAAABAABADoA9gr4CvoKBAtkAAAAAQABAD4ABgtkAAAAAgAAAAAACAsKC2QAAAABAAEAPwAMC2QAAAAHAAAAAAAOCxALEgsUCxYLGAsaC2QAAAAKAAEAQAAcCx4LJwspCysLMgs0CzYLPgtAC2QAAAABAAEASgBCC2QAAAABAAEASwBEC2QAAAABAAEATABGC2QAAAABAAEATQBIC2QAAAABAAEATgBKC2QAAAADAAIAAAAAACIARABkAAAABAACAAYARgBYAFoAbgBkAAAAAwACAA4AcACSALQAZAAAAAQAAgAUALYAyQDLAN4AZAAAAAQAAgAcAOAA8wD1AAgBZAAAAAQAAgAkAAoBHQEfATIBZAAAAAMAAgAsADQBVgF4AWQAAAAEAAIAMgB6AYoBrAHCAWQAAAAEAAIAOgDEAdYB+AH6AWQAAAADAAIAQgD8AR4CQAJkAAAAAwACAEgAQgJkAoYCZAAAAAQAAgBOAIgCmgKcArACZAAAAAQAAgBWALICxQLHAtoCZAAAAAQAAgBeANwC7wIRAyQDZAAAAAQAAgBmACYDOgM8A04DZAAAAAcAAgBuAFADUgNUA1YDWANaA1wDZAAAAAYAAgB8AF4DYANiA2QDZgNoA2QAAAAEAAIAiABqA30DfwOSA2QAAAADAAIAkACUA7YD2ANkAAAAAwACAJYA2gP8Ax4EZAAAABUAAgCcACAEIgQkBCYEKAQqBCwELgQwBDIENAQ2BDgEOgQ8BD4EQARCBEQERgRIBGQAAAASAAIAxgBKBEwETgRQBFIEVARWBFgEWgRcBF4EYARiBGQEZgRoBGoEbARkAAAAFgACAOoAbgR2BH8EgQSIBI8EkQSYBKAEogSpBLIEtAS7BMIExATLBNME1QTcBOME5QRkAAAAFgACABYB5wTvBPgE+gQBBQgFCgURBRkFGwUiBSsFLQU0BTsFPQVEBUwFTgVVBVwFXgVkAAAAFwACAEIBYAViBWQFZgVoBWoFbAVuBXAFcgV0BXYFeAV6BXwFfgWABYIFhAWGBYgFigWMBWQAAAADAAIAcAGOBbAF0gVkAAAAFQACAHYB1AXWBdgF2gXcBd4F4AXiBeQF5gXoBeoF7AXuBfAF8gX0BfYF+AX6BfwFZAAAABcAAgCgAf4FAAYCBgQGBgYIBgoGDAYOBhAGEgYUBhYGGAYaBhwGHgYgBiIGJAYmBigGKgZkAAAAFwACAM4BLAYuBjAGMgY0BjYGOAY6BjwGPgZABkIGRAZGBkgGSgZMBk4GUAZSBlQGVgZYBmQAAAAFAAIA/AFaBmgGgAaUBqYGZAAAAAUAAgAGAqgGtgbOBuIG9AZkAAAAHwACABAC9gb4BvoG/Ab+BgAHAgcEBwYHCAcKBwwHDgcQBxIHFAcWBxgHGgccBx4HIAciByQHJgcoByoHLAcuBzAHMgdkAAAAHwACAE4CNAc2BzgHOgc8Bz4HQAdCB0QHRgdIB0oHTAdOB1AHUgdUB1YHWAdaB1wHXgdgB2IHZAdmB2gHagdsB24HcAdkAAAAHwACAIwCcgd0B3YHeAd6B3wHfgeAB4IHhAeGB4gHigeMB44HkAeSB5QHlgeYB5oHnAeeB6AHogekB6YHqAeqB6wHrgdkAAAABQACAMoCsAe+B9YH6gf8B2QAAAAFAAIA1AL+BwwIJAg4CEoIZAAAAAUAAgDeAkwIWghyCIYImAhkAAAABQACAOgCmgioCMAI1AjmCGQAAAAEAAIA8gLoCP8IIQkwCWQAAAAEAAIA+gIyCUcJaQl6CWQAAAAHAAIAAgN8CX4JgAmCCYQJhgmICWQAAAAHAAIAEAOKCYwJjgmQCZIJlAmWCWQAAAAHAAIAHgOYCZoJnAmeCaAJogmkCWQAAAAHAAIALAOmCagJqgmsCa4JsAmyCWQAAAAHAAIAOgO0CbYJuAm6CbwJvgnACWQAAAAHAAIASAPCCcQJxgnICcoJzAnOCWQAAAAHAAIAVgPQCdIJ1AnWCdgJ2gncCWQAAAAHAAIAZAPeCeAJ4gnkCeYJ6AnqCWQAAAAHAAIAcgPsCe4J8AnyCfQJ9gn4CWQAAAAHAAIAgAP6CfwJ/gkACgIKBAoGCmQAAAAHAAIAjgMICgoKDAoOChAKEgoUCmQAAAAHAAIAnAMWChgKGgocCh4KIAoiCmQAAAAEAAIAqgMkCjkKWwpsCmQAAAAEAAIAsgNuCoAKogq2CmQAAAAEAAIAugO4Cs0K7woAC2QAAAAEAAIAwgMCCxQLNgtKC2QAAAAEAAIAygNMC2ALYgt0C2QAAAADAAIA0gN2C5gLugtkAAAAAwACANgDvAveCwAMZAAAAAUAAgDeAwIMBAwhDCMMQgxkAAAABQACAOgDRAxGDGMMZQyEDGQAAAADAAIA8gOGDIgMtQxkAAAAAwACAPgDtwy5DOYMZAAAAAUAAgD+A+gM6gwGDQgNKg1kAAAABQACAAgELA0uDUoNTA1uDWQAAAAGAAIAEgRwDX8NgQ2VDZcNqw1kAAAABgACAB4ErQ28Db4N0g3UDegNZAAAAAEAAQAAAOoNZAAAAAEAAQABAOwNZAAAAAEAAQACAO4NZAAAAAEAAQADAPANZAAAAAEAAAAAAPINZAAAAAEAAQAEAPQNZAAAAAEAAAAAAPYNZAAAAAEAAQAFAPgNZAAAAAEAAAAAAPoNZAAAAAEAAQAGAPwNZAAAAAEAAQAHAP4NZAAAAAEAAQAIAAAOZAAAAAEAAQAJAAIOZAAAAAQAAAAAAAQOBg4IDgoOZAAAAAkAAQAKAAwODg4WDhgOIw4lDjAOMg5ADmQAAAAGAAAAAABCDkQORg5IDkoOTA5kAAAADAABABMATg5VDlcOXg5gDmcOaQ50DnYOfQ5/DooOZAAAAAIAAAAAAIwOjg5kAAAABQABAB8AkA6SDp0Onw61DmQAAAAEAAAAAAC3DrkOuw69DmQAAAAJAAEAJAC/DsEOzw7RDt8O4Q7uDvAOAQ9kAAAAAQABAC0AAw9kAAAAAQABAC4ABQ9kAAAAAQABAC8ABw9kAAAAAQABADAACQ9kAAAAAQABADEACw9kAAAAAQAAAAAADQ9kAAAAAQABADIADw9kAAAAAQABADMAEQ9kAAAAAQABADQAEw9kAAAAAQABADUAFQ9kAAAADwAAAAAAFw8ZDxsPHQ8fDyEPIw8lDycPKQ8rDy0PLw8xDzMPZAAAABYAAQA2ADUPNw9AD0IPRA9LD00PTw9XD1kPWw9kD2YPaA9vD3EPcw97D30Pfw+GD4gPZAAAAAEAAQBMAIoPZAAAAAEAAQBNAIwPZAAAAAEAAQBOAI4PZAAAAAEAAQBPAJAPZAAAAAEAAQBQAJIPZAAAAAUAAgAAAAAAAgAIABAAEgBkAAAABQACAAoAFAAWABwAJAAmAGQAAAAjAAIAFAAoACoALAAuADAAMgA0ADYAOAA6ADwAPgBAAEIARABGAEgASgBQAFgAWgBkAGkAawBtAG8AcQBzAHUAdwB5AHsAfQB/AIEAZAAAAAcAAgBaAIMAoADBANUA5wAOATABZAAAAAUAAgBoADIBbAGAAbUB1wFkAAAABAACAHIA2QHbAeEB4wFkAAAAJgACAHoA5QHnAekB6wHtAe8B8QHzAfUB9wH5AfsB/QH/AQECAwIFAgcCCQILAhECEwIVAhcCGQIbAh0CHwIhAiMCJQInAikCKwItAi8CMQIzAmQAAAAZAAIAxgA1AjcCOQI7Aj0CPwJBAkMCRQJHAkkCSwJNAk8CUQJTAlUCVwJZAlsCXQJfAmECYwJlAmQAAAAWAAIA+ABnAngCgQKIApACmQKhAqcCrQKzArkCvwLFAssC0QLdAuMC5QLtAvQC/AIfA2QAAAAOAAIAJAEhAzIDOwNCA08DVwNrA3cDfQN/A4cDjgOWA7kDZAAAAAQAAgBAAbsD+QP/AwEEZAAAAAEAAgBIAQMEZAAAAAoAAgBKAQUEGAQhBH4EgASCBIQEhgSIBIoEZAAAAAcAAgBeAYwEjgSQBJYEmASaBJwEZAAAABAAAgBsAZ4EoASmBKgErgS1BLcEvQS/BMUExwTJBM8E0QTXBNkEZAAAAB8AAgCMAdsE3QTfBOEE4wTlBOcE6QTrBO0E7wTxBPME9QT3BPkE+wT9BP8EAQUDBQUFBwUJBQsFDQUPBREFEwUVBRcFZAAAABUAAgDKARkFKgUxBToFQQVIBU8FVgVdBWQFawV3BX0FfwWBBYgFigWQBakFsQXYBWQAAAAVAAIA9AHaBesF8gX7BQIGCQYQBhcGHgYlBiwGOAY+BkAGRwZJBlYGXAZ1Bn0GpAZkAAAAHwACAB4CpgaoBqoGrAauBrAGsga0BrYGuAa6BrwGvgbABsIGxAbGBsgGygbMBs4G0AbSBtQG1gbYBtoG3AbeBuAG4gZkAAAAFwACAFwC5AbuBvkGAAcJBxAHFwceByUHLAczBzoHRgdMB1IHWQdgB2IHbwd1B44Hlge9B2QAAAAIAAIAigK/B9cH6Af5BzwIRAhNCHAIZAAAAC0AAgCaAnIIegiDCIUIjAiTCJUInAikCKYIrQi2CLgIvwjGCMgIzwjRCNcI2QjbCOII6QjrCPMI/Aj+CAUJDAkOCRUJHQkfCSYJLwkxCTgJPwlBCUgJUAlSCVkJYAliCWQAAAAEAAIA9AJkCaQJpgmoCWQAAAAtAAIA/AKqCbIJuwm9CcQJywnNCdQJ3AneCeUJ7gnwCfcJ/gkACgcKCQoPChEKEwoaCiEKIworCjQKNgo9CkQKRgpNClUKVwpeCmcKaQpwCncKeQqACogKigqRCpgKmgpkAAAAHwACAFYDnAqeCqAKogqkCqYKqAqqCqwKrgqwCrIKtAq2CrgKugq8Cr4KwArCCsQKxgrICsoKzArOCtAK0grUCtYK2ApkAAAABQACAJQD2grnCukK6wrtCmQAAABKAAIAngPvCvYK+Ar6CvwK/goACwILBAsGCwgLCgsMCw4LEAsSCxQLFgsYCxoLHAseCyALIgskCyYLKAsqCywLLgswCzILNAs2CzgLOgs8Cz4LQAtCC0QLRgtIC0oLTAtOC1ALUgtUC1YLWAtaC1wLXgtgC2ILZAtmC2gLagtsC24LcAtyC3QLegt8C34LgAuCC4QLhguIC4oLZAAAAAgAAgAyBIwLoAu4C9AL0gv1C/wLIwxkAAAAHwACAEIEJQwnDCkMKwwtDC8MMQwzDDUMNww5DDsMPQw/DEEMQwxFDEcMSQxLDE0MTwxRDFMMVQxXDFkMWwxdDF8MYQxkAAAABQACAIAEYwxlDGsMbQx4DGQAAAAIAAIAigR6DJIMowy0DPcM/wwIDSsNZAAAAAEAAgCaBC0NZAAAAB8AAgCcBC8NMQ0zDTUNNw05DTsNPQ0/DUENQw1FDUcNSQ1LDU0NTw1RDVMNVQ1XDVkNWw1dDV8NYQ1jDWUNZw1pDWsNZAAAAA8AAgDaBG0NeQ2DDY0Nlw2hDasN9g39DQQOCw4SDhoOIw46DmQAAAAfAAIA+AQ8Dj4OQA5CDkQORg5IDkoOTA5ODlAOUg5UDlYOWA5aDlwOXg5gDmIOZA5mDmgOag5sDm4OcA5yDnQOdg54DmQAAAAxAAIANgV6DnwOfg6ADoIOhA6GDogOig6MDo4OkA6SDpQOlg6YDpoOnA6eDqAOog6kDqYOqA6qDqwOrg6wDrIOtA62DrgOug68Dr4OwA7CDsQOxg7IDsoOzA7ODtAO0g7UDtYO2A7aDmQAAAAPAAIAmAXcDugO8g78DgYPEA8aD2UPbA9zD3oPgQ+JD5IPqQ9kAAAABQACALYFqw+4D7oPvA++D2QAAABKAAIAwAXAD8cPyQ/LD80Pzw/RD9MP1Q/XD9kP2w/dD98P4Q/jD+UP5w/pD+sP7Q/vD/EP8w/1D/cP+Q/7D/0P/w8BEAYQCBAKEAwQDhAQEBIQFBAWEBgQGhAcEB4QIxAlECcQKRArEC0QLxAxEDMQNRA3EDkQOxA9ED8QQRBDEEUQRxBJEEsQURBTEFUQVxBZEFsQXRBfEGEQZAAAAAEAAgBUBmMQZAAAAAkAAgBWBmUQeRCREKsQrRDOENUQ5RAAEWQAAAA2AAIAaAYCEQQRBhEIEQoRDBEOERAREhEUERYRGBEaERwRHhEgESIRJBEmESgRKhEsES4RMBEyETQRNhE4EToRPBE+EUARQhFEEUYRSBFKEUwRThFQEVIRVBFWEVgRWhFcEV4RYBFiEWQRZhFoEWoRbBFkAAAAHwACANQGbhFwEXIRdBF2EXgRehF8EX4RgBGCEYQRhhGIEYoRjBGOEZARkhGUEZYRmBGaEZwRnhGgEaIRpBGmEagRqhFkAAAADwACABIHrBG4EcIRzBHWEeAR6hE1EjwSQxJKElESWRJiEnkSZAAAAB8AAgAwB3sSfRJ/EoESgxKFEocSiRKLEo0SjxKREpMSlRKXEpkSmxKdEp8SoRKjEqUSpxKpEqsSrRKvErESsxK1ErcSZAAAADYAAgBuB7kSuxK9Er8SwRLDEsUSxxLJEssSzRLPEtES0xLVEtcS2RLbEt0S3xLhEuMS5RLnEukS6xLtEu8S8RLzEvUS9xL5EvsS/RL/EgETAxMFEwcTCRMLEw0TDxMRExMTFRMXExkTGxMdEx8TIRMjE2QAAAAXAAIA2gclEzQTNhNBE0MTVRNbE2ETZxNtE3MTeRN/E4UTixOSE7ETvRPHE84T0BPSE+gTZAAAAAwAAgAICOoT+RP7EwYUCBQaFFYUYBRnFGkUaxSBFGQAAAAXAAIAIAiDFJIUlBSfFKEUsxS5FL8UxRTLFNEU1xTdFOMU6RTwFA8VGxUlFSwVLhUwFUYVZAAAAAwAAgBOCEgVVxVZFWQVZhV4FbQVvhXFFccVyRXfFWQAAAAMAAIAZgjhFe4V9hUBFh8WYhZqFnEWeBaBFo4WohZkAAAAFwACAH4IpBazFrUWwBbCFtQW2hbgFuYW7BbyFvgW/hYEFwoXERcwFzwXRhdNF08XURdnF2QAAAAMAAIArAhpF3gXeheFF4cXmRfVF98X5hfoF+oXABhkAAAAAwACAMQIAhgOGBAYZAAAAAEAAgDKCBIYZAAAABcAAgDMCBQYIxgxGDwYPhhQGFYYXBhiGGgYbhh0GHoYgBiGGI0YrBi4GMIYyRjLGM0Y4xhkAAAADAACAPoI5Rj0GAIZDRkPGSEZXRlnGW4ZcBlyGYgZZAAAAAEAAgASCYoZZAAAAA8AAgAUCYwZmBmiGawZthnAGcoZFRocGiMaKhoxGjkaQhpZGmQAAAAfAAIAMglbGl0aXxphGmMaZRpnGmkaaxptGm8acRpzGnUadxp5GnsafRp/GoEagxqFGocaiRqLGo0ajxqRGpMalRqXGmQAAAABAAIAcAmZGmQAAAABAAIAcgmbGmQAAAAIAAIAdAmdGrUaxhrXGhobIhsrG04bZAAAAB8AAgCECVAbUhtUG1YbWBtaG1wbXhtgG2IbZBtmG2gbahtsG24bcBtyG3Qbdht4G3obfBt+G4AbghuEG4YbiBuKG4wbZAAAAAMAAgDCCY4bzhsrHGQAAAAfAAIAyAktHC8cMRwzHDUcNxw5HDscPRw/HEEcQxxFHEccSRxLHE0cTxxRHFMcVRxXHFkcWxxdHF8cYRxjHGUcZxxpHGQAAAAfAAIABgprHG0cbxxxHHMcdRx3HHkcexx9HH8cgRyDHIUchxyJHIscjRyPHJEckxyVHJccmRybHJ0cnxyhHKMcpRynHGQAAAAPAAIARAqpHLUcvxzJHNMc3RznHDIdOR1AHUcdTh1WHV8ddh1kAAAAHwACAGIKeB16HXwdfh2AHYIdhB2GHYgdih2MHY4dkB2SHZQdlh2YHZodnB2eHaAdoh2kHaYdqB2qHawdrh2wHbIdtB1kAAAADwACAKAKth3CHcwd1h3gHeod9B0/HkYeTR5UHlseYx5sHoMeZAAAAAUAAgC+CoUehx6JHosejR5kAAAASgACAMgKjx6RHpMelR6XHpkemx6dHp8eoR6jHqUepx6pHqserR6vHrEesx61HrceuR67Hr0evx7BHsMexR7HHskeyx7NHs8e0R7THtUe1x7ZHtse3R7fHuEe4x7lHuce6R7rHu0e7x7xHvMe9R73Hvke+x79Hv8eAR8DHwUfBx8JHwsfDR8PHxUfFx8ZHxsfHR8fHyEfIx8lH2QAAAAJAAIAXAsnHykfVh9YH1ofXB9eH4sfjR9kAAAACQACAG4Ljx+RH74fwB/CH8Qfxh/zH/UfZAAAAA4AAgCAC/cf+R8WIBggNyA5IDsgUSBTIFUgdyB5IJggmiBkAAAADgACAJwLnCCeILsgvSDcIN4g4CD2IPgg+iAcIR4hPSE/IWQAAAALAAIAuAtBIUMhXyFhIWMhhCGGIYwhliGkIbQhZAAAAAkAAgDOC7YhuCHUIdYh2CH5IfshESIhImQAAAARAAIA4AsjIjIiNCJIIkoiXiJgIm8icSJzIoIihCKdIp8iqSK3IrkiZAAAABEAAgACDLsiyiLMIuAi4iL2IvgiByMJIwsjGiMcIzUjNyNBI08jUSNkAAAABAACACQMUyNVI1cjZyNkAAAAAgACACwMaSNrI2QAAAAEAAIAMAxtI28jcSOBI2QAAAAEAAIAOAyDI4UjhyONI2QAAAACAAIAQAyPI5EjZAAAAAQAAgBEDJMjlSOXI50jZAAAAAEAAQAAAJ8jZAAAAAEAAQABAKEjZAAAAAEAAQACAKMjZAAAAAEAAQADAKUjZAAAAAEAAQAEAKcjZAAAAAEAAQAFAKkjZAAAAAEAAQAGAKsjZAAAAAEAAQAHAK0jZAAAAAEAAQAIAK8jZAAAAAIAAAAAALEjsyNkAAAABAABAAkAtSO3I7kjvyNkAAAACgAAAAAAwSPDI8UjxyPJI8sjzSPPI9Ej0yNkAAAAFAABAA0A1SPXI98j4SPsI+4j+SP7IwkkCyQTJBUkFyQfJCEkLCQuJDkkOyRJJGQAAAAOAAAAAABLJE0kTyRRJFMkVSRXJFkkWyRdJF8kYSRjJGUkZAAAABwAAQAhAGckbiRwJHckeSSAJIIkjSSPJJYkmCSjJKUkrCSuJLUktyS+JMAkxyTJJNUk1yTiJOQk6yTtJPgkZAAAAAYAAAAAAPok/CT+JAAlAiUEJWQAAAAJAAEAPQAGJQglEyUVJSslLSU9JT8lVSVkAAAACgAAAAAAVyVZJVslXSVfJWElYyVlJWclaSVkAAAAFAABAEYAayVtJXslfSWLJY0lmiWcJa0lryW9Jb8lwSXPJdEl3yXhJe4l8CUBJmQAAAABAAEAWgADJmQAAAADAAAAAAAFJgcmCSZkAAAABQABAFsACyYNJg8mESYbJmQAAAABAAEAYAAdJmQAAAACAAAAAAAfJiEmZAAAAAMAAQBhACMmJSYnJmQAAAABAAEAZAApJmQAAAACAAAAAAArJi0mZAAAAAQAAQBlAC8mMSYzJkEmZAAAAAEAAAAAAEMmZAAAAAEAAQBpAEUmZAAAAAEAAQBqAEcmZAAAAAEAAQBrAEkmZAAAAAkAAAAAAEsmTSZPJlEmUyZVJlcmWSZbJmQAAAADAAAAAABdJl8mYSZkAAAAAwAAAAAAYyZlJmcmZAAAAAQAAQBsAGkmayZtJm8mZAAAAAEAAQBwAHEmZAAAAAMAAAAAAHMmdSZ3JmQAAAAEAAEAcQB5JnsmfSaIJmQAAAAdAAAAAACKJowmjiaQJpImlCaWJpgmmiacJp4moCaiJqQmpiaoJqomrCauJrAmsia0JrYmuCa6JrwmvibAJsImZAAAAC0AAQB1AMQmxibPJtEm0ybaJtwm3ibmJugm6ibzJvUm9yb+JgAnAicIJwonDCcOJxAnFycZJxsnJCcmJygnLycxJzMnOyc9Jz8nSCdKJ0wnUydVJ1cnXydhJ2MnaidsJ2QAAAADAAAAAABuJ3AncidkAAAABAABAKIAdCd2J3gngydkAAAAAQABAKYAhSdkAAAAAQABAKcAhydkAAAAAQABAKgAiSdkAAAAAQABAKkAiydkAAAAAQABAKoAjSdkAAAAFQACAAAAAAACAAQABgAIAAoADAAOABAAEgAUABYAGAAaABwAHgAgACIAJAAmACgAZAAAABIAAgAqACoALAAuADAAMgA0ADYAOAA6ADwAPgBAAEIARABGAEgASgBMAGQAAAADAAIATgBOAHAAkgBkAAAAFwACAFQAlACWAJgAmgCcAJ4AoACiAKQApgCoAKoArACuALAAsgC0ALYAuAC6ALwAvgDAAGQAAAAGAAIAggDCAMQAxgDIAMoAzABkAAAAAwACAI4AzgDwABIBZAAAAAMAAgCUABQBNgFYAWQAAAAEAAIAmgBaAWwBbgGCAWQAAAAEAAIAogCEAZYBmAGsAWQAAAABAAIAqgCuAWQAAAAHAAIArACwAbIBtAG2AbgBugG8AWQAAAAEAAIAugC+Ac4B8AEGAmQAAAAHAAIAwgAIAgoCDAIOAhACEgIUAmQAAAAEAAIA0AAWAikCKwI+AmQAAAADAAIA2ABAAmIChAJkAAAABAACAN4AhgKbAr0CzgJkAAAAFgACAOYA0ALYAuEC4wLqAvEC8wL6AgIDBAMLAxQDFgMdAyQDJgMtAzUDNwM+A0UDRwNkAAAAFgACABIBSQNRA1oDXANjA2oDbANzA3sDfQOEA40DjwOWA50DnwOmA64DsAO3A74DwANkAAAABwACAD4BwgPEA8YDyAPKA8wDzgNkAAAAHwACAEwB0APSA9QD1gPYA9oD3APeA+AD4gPkA+YD6APqA+wD7gPwA/ID9AP2A/gD+gP8A/4DAAQCBAQEBgQIBAoEDARkAAAAAwACAIoBDgQwBFIEZAAAAAcAAgCQAVQEVgRYBFoEXAReBGAEZAAAAAQAAgCeAWIEeQSbBKoEZAAAAAQAAgCmAawEwATCBNQEZAAAAAcAAgCuAdYE2ATaBNwE3gTgBOIEZAAAAAQAAgC8AeQE+QQbBSwFZAAAAAcAAgDEAS4FMAUyBTQFNgU4BToFZAAAABUAAgDSATwFPgVABUIFRAVGBUgFSgVMBU4FUAVSBVQFVgVYBVoFXAVeBWAFYgVkBWQAAAADAAIA/AFmBYgFqgVkAAAAHwACAAICrAWuBbAFsgW0BbYFuAW6BbwFvgXABcIFxAXGBcgFygXMBc4F0AXSBdQF1gXYBdoF3AXeBeAF4gXkBeYF6AVkAAAABAACAEAC6gX9Bf8FEgZkAAAABAACAEgCFAYmBkgGSgZkAAAAFwACAFACTAZOBlAGUgZUBlYGWAZaBlwGXgZgBmIGZAZmBmgGagZsBm4GcAZyBnQGdgZ4BmQAAAAHAAIAfgJ6BnwGfgaABoIGhAaGBmQAAAAEAAIAjAKIBpoGvAbQBmQAAAAHAAIAlALSBtQG1gbYBtoG3AbeBmQAAAADAAIAogLgBgIHJAdkAAAAAwACAKgCJgdIB2oHZAAAAAUAAgCuAmwHegeSB6YHuAdkAAAABQACALgCugfIB+AH9AcGCGQAAAAEAAIAwgIICBwIHggwCGQAAAAFAAIAygIyCEAIWAhsCH4IZAAAAAUAAgDUAoAIjgimCLoIzAhkAAAAAwACAN4CzgjwCBIJZAAAAAMAAgDkAhQJNglYCWQAAAAEAAIA6gJaCW0JjwmiCWQAAAAFAAIA8gKkCbIJygneCfAJZAAAAAUAAgD8AvIJAAoYCiwKPgpkAAAABAACAAYDQApVCncKiApkAAAABwACAA4DigqMCo4KkAqSCpQKlgpkAAAABAACABwDmAqrCq0KwApkAAAABAACACQDwgrVCtcK6gpkAAAABAACACwD7Ar/CgELFAtkAAAABwACADQDFgsYCxoLHAseCyALIgtkAAAAAwACAEIDJAtGC2gLZAAAAAcAAgBIA2oLbAtuC3ALcgt0C3YLZAAAAAcAAgBWA3gLegt8C34LgAuCC4QLZAAAAAQAAgBkA4YLmAu6C84LZAAAAAcAAgBsA9AL0gvUC9YL2AvaC9wLZAAAAAMAAgB6A94LAAwiDGQAAAAfAAIAgAMkDCYMKAwqDCwMLgwwDDIMNAw2DDgMOgw8DD4MQAxCDEQMRgxIDEoMTAxODFAMUgxUDFYMWAxaDFwMXgxgDGQAAAADAAIAvgNiDGQMkQxkAAAAAwACAMQDkwyVDMIMZAAAAAUAAgDKA8QMxgzjDOUMBA1kAAAABQACANQDBg0IDSUNJw1GDWQAAAAFAAIA3gNIDUoNZg1oDYoNZAAAAAUAAgDoA4wNjg2qDawNzg1kAAAABgACAPID0A3fDeEN9Q33DQsOZAAAAAYAAgD+Aw0OHA4eDjIONA5IDmQAAAABAAEAAABKDmQAAAABAAEAAQBMDmQAAAABAAEAAgBODmQAAAABAAEAAwBQDmQAAAABAAAAAABSDmQAAAABAAEABABUDmQAAAABAAAAAABWDmQAAAABAAEABQBYDmQAAAABAAAAAABaDmQAAAABAAEABgBcDmQAAAABAAEABwBeDmQAAAABAAEACABgDmQAAAABAAEACQBiDmQAAAAEAAAAAABkDmYOaA5qDmQAAAAJAAEACgBsDm4Odg54DoMOhQ6QDpIOoA5kAAAABgAAAAAAog6kDqYOqA6qDqwOZAAAAAwAAQATAK4OtQ63Dr4OwA7HDskO1A7WDt0O3w7qDmQAAAACAAAAAADsDu4OZAAAAAUAAQAfAPAO8g79Dv8OFQ9kAAAABAAAAAAAFw8ZDxsPHQ9kAAAACQABACQAHw8hDy8PMQ8/D0EPTg9QD2EPZAAAAAEAAQAtAGMPZAAAAAEAAQAuAGUPZAAAAAEAAQAvAGcPZAAAAAEAAQAwAGkPZAAAAAEAAQAxAGsPZAAAAAEAAAAAAG0PZAAAAAEAAQAyAG8PZAAAAAEAAQAzAHEPZAAAAAEAAQA0AHMPZAAAAAEAAQA1AHUPZAAAAA8AAAAAAHcPeQ97D30Pfw+BD4MPhQ+HD4kPiw+ND48PkQ+TD2QAAAAWAAEANgCVD5cPoA+iD6QPqw+tD68Ptw+5D7sPxA/GD8gPzw/RD9MP2w/dD98P5g/oD2QAAAABAAEATADqD2QAAAABAAEATQDsD2QAAAABAAEATgDuD2QAAAABAAEATwDwD2QAAAABAAEAUADyD2QAAAACAAAAAAAAAAMAZAAAACYAAgAAAAcAEAASABQAFgAYABoAHAAeACAAIgAkACYAKAAqACwALgAwADIANAA2ADgAOgA8AD4AQABCAEQARgBIAEoATABOAFAAUgBYAF0AXwBkAAAABAACAEwAYQCqAK8AsQBkAAAAAwACAFQAswC1AMAAZAAAAAMAAgBaAMIAxADPAGQAAAA0AAIAYADRANgA2gDcAN4A4ADiAOQA5gDoAOoA7ADuAPAA8gD0APYA+AD6APwA/gAAAQIBBAEGAQgBCgEMAQ4BEAESARQBFgEYARoBHAEeASABIgEkASYBKAEqASwBLgEwATIBNAE2ATwBQQFDAWQAAAADAAIAyABFAY8BkQFkAAAANAACAM4AkwGaAZwBngGgAaIBpAGmAagBqgGsAa4BsAGyAbQBtgG4AboBvAG+AcABwgHEAcYByAHKAcwBzgHQAdIB1AHWAdgB2gHcAd4B4AHiAeQB5gHoAeoB7AHuAfAB8gH0AfYB+AH+AQMCBQJkAAAADAACADYBBwIJAgsCDQIPAhECEwIVAhcCGQIbAh0CZAAAAAMAAgBOAR8CIQIsAmQAAAADAAIAVAEuAjACOwJkAAAAAQACAFoBPQJkAAAAAQACAFwBPwJkAAAADgACAF4BQQJDAkUCRwJJAksCTQJPAlECUwJVAlcCWQJbAmQAAAALAAIAegFdAnQCfAKUApwCqAKwArcCuQK7Ar0CZAAAAB0AAgCQAb8CxQLLAtEC2QLgAuYC7ALyAvoCAAMGAwwDEgMaAyADJgMsAzIDOgNAA0YDTANSA1oDYQNjA2UDZwNkAAAADgACAMoBaQNrA20DbwNxA3MDdQN3A3kDewN9A38DgQODA2QAAAAdAAIA5gGFA4sDkQOXA58DpgOsA7IDuAPAA8YDzAPSA9gD4APmA+wD8gP4AwAEBgQMBBIEGAQgBCcEKQQrBC0EZAAAAAsAAgAgAi8EMQQzBDUENwQ5BDsEPQQ/BEEEQwRkAAAADgACADYCRQRHBEkESwRNBE8EUQRTBFUEVwRZBFsEXQRfBGQAAAADAAIAUgJhBGMEZQRkAAAAKQACAFgCZwRpBGsEbQRvBHEEcwR1BHcEeQR7BH0EfwSBBIMEhQSHBIkEiwSNBI8EkQSTBJUElwSZBJsEnQSfBKEEowSlBKcEqQSrBK0ErwSxBLMEtQS3BGQAAAADAAIAqgK5BLsEvQRkAAAADgACALACvwTBBMMExQTHBMkEywTNBM8E0QTTBNUE1wTZBGQAAAALAAIAzALbBN0E3wThBOME5QTnBOkE6wTtBO8EZAAAAAEAAgDiAvEEZAAAAA4AAgDkAvME9QT3BPkE+wT9BP8EAQUDBQUFBwUJBQsFDQVkAAAABgACAAADDwUeBTYFTQVlBXEFZAAAAA4AAgAMA3MFdQV3BXkFewV9BX8FgQWDBYUFhwWJBYsFjQVkAAAANQACACgDjwWVBZcFmQWbBZ0FnwWhBaMFpQWnBakFqwWtBa8FsQWzBbUFtwW5BbsFvQW/BcEFwwXFBccFyQXLBc0FzwXRBdMF1QXXBdkF2wXdBd8F4QXjBeUF5wXpBe4F8AXyBfQF9gX4Bf4FAwYFBmQAAAAEAAIAkgMHBlAGVQZXBmQAAAAtAAIAmgNZBmIGZAZmBmgGagZsBm4GcAZyBnQGdgZ4BnoGfAZ+BoAGggaEBoYGiAaKBowGjgaQBpIGlAaWBpgGmgacBp4GoAaiBqQGpgaoBqoGrAaxBrMGtQa3BrkGuwZkAAAABQACAPQDvQbUBuwGAwcbB2QAAAADAAIA/gMdBx8HIQdkAAAAKQACAAQEIwclBycHKQcrBy0HLwcxBzMHNQc3BzkHOwc9Bz8HQQdDB0UHRwdJB0sHTQdPB1EHUwdVB1cHWQdbB10HXwdkB2YHaAdqB2wHbgdwB3IHdAd2B2QAAAABAAIAVgR4B2QAAAADAAIAWAR6B3wHfgdkAAAANAACAF4EgAeHB4kHiweNB48HkQeTB5UHlweZB5sHnQefB6EHowelB6cHqQerB60HrwexB7MHtQe3B7kHuwe9B78HwQfDB8UHxwfJB8sHzQfPB9EH0wfVB9cH2QfbB90H3wfhB+MH5QfrB/AH8gdkAAAABAACAMYE9Ac9CEIIRAhkAAAAKwACAM4ERghPCFEIUwhVCFcIWQhbCF0IXwhhCGMIZQhnCGkIawhtCG8IcQhzCHUIdwh5CHsIfQh/CIEIgwiFCIcIiQiLCI0IjwiRCJMIlQiXCJkImwidCJ8IoQhkAAAADgACACQFowilCKcIqQirCK0IrwixCLMItQi3CLkIuwi9CGQAAAAHAAIAQAW/CMwI4wjyCP8IFgklCWQAAAAOAAIATgUnCSkJKwktCS8JMQkzCTUJNwk5CTsJPQk/CUEJZAAAAAgAAgBqBUMJRQlHCUkJSwlNCU8JXglkAAAAAwACAHoFYAliCXEJZAAAAAgAAgCABXMJdQl3CXkJewl9CX8JjglkAAAAAwACAJAFkAmSCaEJZAAAAAEAAgCWBaMJZAAAAAgAAgCYBaUJpwmpCasJrQmvCbEJwAlkAAAAAwACAKgFwgnECdMJZAAAAAgAAgCuBdUJ1wnZCdsJ3QnfCeEJ4wlkAAAAAQACAL4F5QlkAAAACAACAMAF5wnpCesJ7QnvCfEJ8wkCCmQAAAAIAAIA0AUECgYKCAoKCgwKDgoQCh8KZAAAAAcAAgDgBSEKMApIClQKYwp7CocKZAAAAA4AAgDuBYkKiwqNCo8KkQqTCpUKlwqZCpsKnQqfCqEKowpkAAAAAQACAAoGpQpkAAAAAQACAAwGpwpkAAAACwACAA4GqQqrCq0KrwqxCrMKtQq3CrkKuwq9CmQAAAAOAAIAJAa/CsEKwwrFCscKyQrLCs0KzwrRCtMK1QrXCtkKZAAAAAMAAgBABtsK3QrfCmQAAAAEAAIARgbhCuMK5QrnCmQAAAAOAAIATgbpCusK7QrvCvEK8wr1CvcK+Qr7Cv0K/woBCwMLZAAAAA4AAgBqBgULBwsJCwsLDQsPCxELEwsVCxcLGQsbCx0LHwtkAAAABwACAIYGIQsuC0ULVAthC3gLhwtkAAAADgACAJQGiQuLC40LjwuRC5MLlQuXC5kLmwudC58LoQujC2QAAAAFAAIAsAalC7wL1AvrCwMMZAAAAAMAAgC6BgUMBwwJDGQAAAApAAIAwAYLDA0MDwwRDBMMFQwXDBkMGwwdDB8MIQwjDCUMJwwpDCsMLQwvDDEMMww1DDcMOQw7DD0MPwxBDEMMRQxHDEkMSwxNDE8MUQxTDFUMVwxZDFsMZAAAAAIAAgASB10MXwxkAAAAAQACABYHYQxkAAAAAQACABgHYwxkAAAAAwACABoHZQxnDHIMZAAAAAMAAgAgB3QMdgyBDGQAAAADAAIAJgeDDIUMkAxkAAAAAQACACwHkgxkAAAAAQACAC4HlAxkAAAAAQACADAHlgxkAAAAOAACADIHmAyaDJwMngygDKIMpAymDKgMqgysDK4MsAyyDLQMtgy4DLoMvAy+DMAMwgzEDMYMyAzKDMwMzgzQDNIM1AzWDNgM2gzcDN4M4AziDOQM5gzoDOoM7AzuDPAM8gz0DPYM+Az6DPwM/gwADQINCQ0LDWQAAAAFAAIAogcNDQ8NEQ0YDRoNZAAAAAUAAgCsBxwNHg1LDU0NYA1kAAAABQACALYHYg1kDZENkw2mDWQAAAAHAAIAwAeoDaoNxw3JDegN6g0BDmQAAAAHAAIAzgcDDgUOIg4kDkMORQ5cDmQAAAABAAIA3AdeDmQAAAADAAIA3gdgDmIObw5kAAAABQACAOQHcQ5zDnUOfA5+DmQAAAAFAAIA7geADoIOhA6LDo0OZAAAACIAAgD4B48OkQ6TDpUOlw6ZDpsOnQ6fDqEOow6lDqcOqQ6rDq0Orw6xDrMOtQ63DrkOuw69Dr8OwQ7DDsUOxw7JDssOzQ7PDtEOZAAAAAcAAgA8CNMO1Q7xDvMOFQ8XDysPZAAAAAcAAgBKCC0PLw9LD00Pbw9xD4UPZAAAAAgAAgBYCIcPlg+YD6wPrg/CD8QP4A9kAAAACAACAGgI4g/xD/MPBxAJEB0QHxA7EGQAAAADAAIAeAg9ED8QTBBkAAAAAgACAH4IThBQEGQAAAACAAIAgghSEFQQZAAAAAMAAgCGCFYQWBBlEGQAAAADAAIAjAhnEGkQcBBkAAAAAwACAJIIchB0EHsQZAAAAAMAAgCYCH0QfxCGEGQAAAADAAIAngiIEIoQkRBkAAAAAwACAKQIkxCVEJwQZAAAAAMAAgCqCJ4QoBCnEGQAAAABAAIAsAipEGQAAAAjAAIAsgirEK0QrxCxELMQtRC3ELkQuxC9EL8QwRDDEMUQxxDJEMsQzRDPENEQ0xDVENcQ2RDbEN0Q3xDhEOMQ5RDnEOkQ6xDtEO8QZAAAACMAAgD4CPEQ8xD1EPcQ+RD7EP0Q/xABEQMRBREHEQkRCxENEQ8RERETERURFxEZERsRHREfESERIxElEScRKRErES0RLxExETMRNRFkAAAAIwACAD4JNxE5ETsRPRE/EUERQxFFEUcRSRFLEU0RTxFREVMRVRFXEVkRWxFdEV8RYRFjEWURZxFpEWsRbRFvEXERcxF1EXcReRF7EWQAAAAlAAIAhAl9EYYRiBGKEYwRjhGQEZIRlBGWEZgRmhGcEZ4RoBGiEaQRphGoEaoRrBGuEbARshG0EbYRuBG6EbwRvhHAEcIRxBHGEcgRzhHTEWQAAAADAAIAzgnVERwSIhJkAAAAFgAAAAAAJBImEigSKhIsEi4SMBIyEjQSNhI4EjoSPBI+EkASQhJEEkYSSBJKEkwSThJkAAAALAABAAAAUBJSElQSVhJYEloSXBJeEmASYhJkEmYSaBJqEmwSbhJwEnISdBJ2EngSehJ8En4SgBKCEoQShhKIEooSjBKOEpASkhKUEpYSmBKaEpwSnhKgEqISpBKmEmQAAAADAAAAAACoEqoSrBJkAAAABAABACwArhKwErISuxJkAAAAAQAAAAAAvRJkAAAAAQABADAAvxJkAAAAAwAAAAAAwRLDEsUSZAAAAAQAAQAxAMcSyRLLEtQSZAAAAAEAAAAAANYSZAAAAAMAAQA1ANgS2hLhEmQAAAABAAAAAADjEmQAAAADAAEAOADlEucS7hJkAAAAAQAAAAAA8BJkAAAAAwABADsA8hL0EvsSZAAAAAMAAQA+AP0S/xIGE2QAAAACAAAAAAAIEwoTZAAAAAMAAQBBAAwTDhMQE2QAAAABAAEARAASE2QAAAAGAAAAAAAUExYTGBMaExwTHhNkAAAADQABAEUAIBMiEyoTLBM3EzkTRBNGE1QTVhNeE2ATaRNkAAAACAAAAAAAaxNtE28TcRNzE3UTdxN5E2QAAAAQAAEAUgB7E4IThBOLE40TlBOWE6EToxOqE6wTtxO5E8MTxRPSE2QAAAAEAAAAAADUE9YT2BPaE2QAAAAJAAEAYgDcE94T6RPrEwEUAxQKFAwUFxRkAAAABgAAAAAAGRQbFB0UHxQhFCMUZAAAAA0AAQBrACUUJxQ1FDcURRRHFFQUVhRnFGkUcxR1FIIUZAAAAAEAAQB4AIQUZAAAAAIAAAAAAIYUiBRkAAAABAABAHkAihSMFI4UmBRkAAAAAQABAH0AmhRkAAAAAQABAH4AnBRkAAAAAwAAAAAAnhSgFKIUZAAAAAMAAQB/AKQUphSwFGQAAAAkAAAAAACyFLQUthS4FLoUvBS+FMAUwhTEFMYUyBTKFMwUzhTQFNIU1BTWFNgU2hTcFN4U4BTiFOQU5hToFOoU7BTuFPAU8hT0FPYU+BRkAAAARAAAAAAA+hT8FP4UABUCFQQVBhUIFQoVDBUOFRAVEhUUFRYVGBUaFRwVHhUgFSIVJBUmFSgVKhUsFS4VMBUyFTQVNhU4FToVPBU+FUAVQhVEFUYVSBVKFUwVThVQFVIVVBVWFVgVWhVcFV4VYBViFWQVZhVoFWoVbBVuFXAVchV0FXYVeBV6FXwVfhWAFWQAAAAFAAEAggCCFYQVhhWIFY8VZAAAAAEAAAAAAJEVZAAAAAMAAQCHAJMVlRWcFWQAAAACAAAAAACeFaAVZAAAAAIAAAAAAKIVpBVkAAAAAgAAAAAAphWoFWQAAAACAAAAAACqFawVZAAAAAEAAAAAAK4VZAAAAAMAAQCKALAVshW0FWQAAAADAAEAjQC2FbgVuhVkAAAAAwABAJAAvBW+FcAVZAAAAAMAAQCTAMIVxBXGFWQAAAADAAEAlgDIFcoV0RVkAAAACQACAAAAAAACAAQABgAIAAoADAAOABAAZAAAABMAAgASABIAFAAWABgAGgAcAB4AIAAiACQAJgAoACoALAAuADAAMgA0ADYAZAAAAAUAAgA4ADgARwBaAGEAYwBkAAAABQACAEIAZQB0AIcAjgCQAGQAAAAJAAIATACSAJQAlgCYAJoAnACeAKAAogBkAAAAAwACAF4ApACmAKgAZAAAABkAAgBkAKoArACuALAAsgC0ALYAuAC6ALwAvgDAAMIAxADGAMgAygDMAM4A0ADSANQA1gDYANoAZAAAAAsAAgCWANwA3gDgAOIA5ADmAOgA6gDsAO4A8ABkAAAABQACAKwA8gABARQBGwEdAWQAAAAFAAIAtgAfAS4BQQFIAUoBZAAAAAEAAgDAAEwBZAAAAAEAAgDCAE4BZAAAAA0AAgDEAFABUgFUAVYBWAFaAVwBXgFgAWIBZAFmAWgBZAAAAAUAAgDeAGoBeQGJAZQBtgFkAAAABQACAOgAuAHHAdcB4gEEAmQAAAANAAIA8gAGAggCCgIMAg4CEAISAhQCFgIYAhoCHAIeAmQAAAAFAAIADAEgAi8CMQI8Al4CZAAAAAEAAgAWAWACZAAAAA0AAgAYAWICZAJmAmgCagJsAm4CcAJyAnQCdgJ4AnoCZAAAAAMAAgAyAXwCiAKKAmQAAAAfAAIAOAGMApIClAKWApgCmgKcAp4CoAKiAqQCpgKoAqoCrAKuArACsgK0ArYCuAK6ArwCvgLAAsICxALGAsgCygLMAmQAAAANAAIAdgHOAtAC0gLUAtYC2ALaAtwC3gLgAuIC5ALmAmQAAAABAAIAkAHoAmQAAAABAAIAkgHqAmQAAAANAAIAlAHsAu4C8ALyAvQC9gL4AvoC/AL+AgADAgMEA2QAAAAHAAIArgEGAxADGAMhAysDOANaA2QAAAANAAIAvAFcA14DYANiA2QDZgNoA2oDbANuA3ADcgN0A2QAAAAJAAIA1gF2A3gDegN8A34DgAOCA4QDhgNkAAAAAwACAOgBiAOKA4wDZAAAABcAAgDuAY4DkAOSA5QDlgOYA5oDnAOeA6ADogOkA6YDqAOqA6wDrgOwA7IDtAO2A7gDugNkAAAABwACABwCvAPGA84D1wPhA+4DEARkAAAAAwACACoCEgQeBCAEZAAAAB8AAgAwAiIEKAQqBCwELgQwBDIENAQ2BDgEOgQ8BD4EQARCBEQERgRIBEoETAROBFAEUgRUBFYEWARaBFwEXgRgBGIEZAAAAAEAAgBuAmQEZAAAAAEAAgBwAmYEZAAAAAkAAgByAmgEagRsBG4EcARyBHQEdgR4BGQAAAAGAAIAhAJ6BHwEfgSABIIEhARkAAAAGQACAJAChgSIBIoEjASOBJAEkgSUBJYEmASaBJwEngSgBKIEpASmBKgEqgSsBK4EsASyBLQEtgRkAAAADQACAMICuAS6BLwEvgTABMIExATGBMgEygTMBM4E0ARkAAAABwACANwC0gTcBOQE7QT3BAQFJgVkAAAADQACAOoCKAUqBSwFLgUwBTIFNAU2BTgFOgU8BT4FQAVkAAAABQACAAQDQgVQBV8FbwWOBWQAAAAFAAIADgOQBZ4FrQW9BdwFZAAAAAUAAgAYA94F7AX7BQsGKgZkAAAAAgACACIDLAY6BmQAAAABAAIAJgM8BmQAAAAFAAIAKAM+BkwGWwZrBooGZAAAAAIAAgAyA4wGmgZkAAAABQACADYDnAayBsEGyAboBmQAAAABAAIAQAPqBmQAAAAFAAIAQgPsBvoGCQcZBzgHZAAAAAIAAgBMAzoHSAdkAAAABwACAFADSgdUB1wHZQdvB3wHngdkAAAADQACAF4DoAeiB6QHpgeoB6oHrAeuB7AHsge0B7YHuAdkAAAAAQACAHgDugdkAAAAAQACAHoDvAdkAAAAAQACAHwDvgdkAAAADQACAH4DwAfCB8QHxgfIB8oHzAfOB9AH0gfUB9YH2AdkAAAAAgACAJgD2gf6B2QAAAANAAIAnAP8B/4HAAgCCAQIBggICAoIDAgOCBAIEggUCGQAAAANAAIAtgMWCBgIGggcCB4IIAgiCCQIJggoCCoILAguCGQAAAAHAAIA0AMwCDoIQghLCFUIYgiECGQAAAANAAIA3gOGCIgIigiMCI4IkAiSCJQIlgiYCJoInAieCGQAAAAHAAIA+AOgCKoIsgi7CMUI0gj0CGQAAAADAAIABgT2CPgI+ghkAAAAHwACAAwE/Aj+CAAJAgkECQYJCAkKCQwJDgkQCRIJFAkWCRgJGgkcCR4JIAkiCSQJJgkoCSoJLAkuCTAJMgk0CTYJOAlkAAAABgACAEoEOgk8CUcJTglQCVoJZAAAAAgAAgBWBFwJXgloCWoJcQlzCXUJfwlkAAAAAgACAGYEgQmDCWQAAAADAAIAagSFCYcJlQlkAAAAAwACAHAElwmZCZsJZAAAAAUAAgB2BJ0JnwmsCa4JwglkAAAAAgACAIAExAnGCWQAAAAHAAIAhATICcoJzAnOCdAJ0gnUCWQAAAAHAAIAkgTWCdgJ2gncCd4J4AniCWQAAAADAAIAoATkCeYJEwpkAAAAAwACAKYEFQoXCkQKZAAAAAUAAgCsBEYKSAplCmcKhgpkAAAABQACALYEiAqKCqcKqQrICmQAAAADAAIAwATKCswK0gpkAAAABAACAMYE1ArWCtwK3gpkAAAABwACAM4E4AriCuQK5groCuoK7ApkAAAABAACANwE7grwCvIK9ApkAAAABQACAOQE9gr4ChQLFgs4C2QAAAAFAAIA7gQ6CzwLWAtaC3wLZAAAAAkAAgD4BH4LhwuRC5MLpgurC60LwQvDC2QAAAAIAAIACgXFC84L2AvaC+0L8gv0CwgMZAAAAAMAAgAaBQoMDAwVDGQAAAACAAIAIAUXDBkMZAAAAAIAAgAkBRsMHQxkAAAAAwACACgFHwwhDC0MZAAAAAUAAgAuBS8MMQwzDDUMNwxkAAAAAgACADgFOQw7DGQAAAAKAAIAPAU9DD8MQQxDDEUMRwxJDEsMTQxPDGQAAAAKAAIAUAVRDFMMVQxXDFkMWwxdDF8MYQxjDGQAAAAKAAIAZAVlDGcMaQxrDG0MbwxxDHMMdQx3DGQAAAAEAAIAeAV5DHsMfQx/DGQAAAAEAAIAgAWBDIMMhQyHDGQAAAACAAIAiAWJDIsMZAAAAAQAAgCMBY0MjwyRDJMMZAAAAAIAAgCUBZUMlwxkAAAABAACAJgFmQybDJ0MnwxkAAAABAACAKAFoQyjDKwMrgxkAAAAAgABAAAAsAyyDGQAAAACAAAAAAC0DLYMZAAAAAUAAQACALgMugy8DMYMyAxkAAAABgAAAAAAygzMDM4M0AzSDNQMZAAAAAoAAQAHANYM2AzaDNwM3gzgDOIM5AzmDOgMZAAAAAIAAAAAAOoM7AxkAAAABQABABEA7gzwDPIM+Az6DGQAAAACAAAAAAD8DP4MZAAAAAMAAQAWAAANAg0LDWQAAAACAAAAAAANDQ8NZAAAAAMAAQAZABENEw0cDWQAAAACAAAAAAAeDSANZAAAAAMAAQAcACINJA0tDWQAAAADAAEAHwAvDTENOg1kAAAAAwABACIAPA0+DUcNZAAAAAEAAQAlAEkNZAAAAAQAAAAAAEsNTQ1PDVENZAAAAAkAAQAmAFMNVQ1dDV8Nag1sDXcNeQ2HDWQAAAAGAAAAAACJDYsNjQ2PDZENkw1kAAAADQABAC8AlQ2cDZ4NpQ2nDa4NsA27Db0NxA3GDdEN0w1kAAAAAgAAAAAA1Q3XDWQAAAAGAAEAPADZDdsN5g3oDf4NAA5kAAAABAAAAAAAAg4EDgYOCA5kAAAACgABAEIACg4MDhoOHA4qDiwOOQ47DkwOTg5kAAAAAgABAEwAUA5SDmQAAAACAAAAAABUDlYOZAAAAAQAAQBOAFgOWg5cDmQOZAAAAAIAAQBSAGYOaA5kAAAAAgABAFQAag5sDmQAAAACAAAAAABuDnAOZAAAAAUAAQBWAHIOdA52Dn4OgA5kAAAAEgAAAAAAgg6EDoYOiA6KDowOjg6QDpIOlA6WDpgOmg6cDp4OoA6iDqQOZAAAAAIAAQBbAKYOqA5kAAAADQAAAAAAqg6sDq4OsA6yDrQOtg64DroOvA6+DsAOwg5kAAAACAABAF0AxA7GDsgO0Q7TDtUO1w7ZDmQAAAACAAAAAADbDt0OZAAAAAMAAQBlAN8O4Q7qDmQAAAACAAAAAADsDu4OZAAAAAIAAAAAAPAO8g5kAAAAAgABAGgA9A72DmQAAAACAAAAAAD4DvoOZAAAAAEAAAAAAPwOZAAAAAIAAQBqAP4OAA9kAAAAAgABAGwAAg8ED2QAAAACAAEAbgAGDwgPZAAAAAIAAQBwAAoPDA9kAAAAAwABAHIADg8QDxkPAAA=","textureAtlases":["iVBORw0KGgoAAAANSUhEUgAABAAAAAQACAYAAAB/HSuDAAWwD0lEQVR4Aez9b6j3X5ffB80DmQcTUz/51zZkogkNdUwKBkpES/NnJE4pI41YbcJgSFvLndqxBW24MxppjAnxHrEUE24iWCExkYkUzE39A5bAWIglepM8UOeGQYreDcwDx1sfxMEHmZnL/fpe5/Wd91ln7c/n8z3ne851neu3N+zrvdbaa6+99tpr78/+fM/3nOv7vm+VFYEVgRWBFYEVgRWBFYEVgRWBFYEVgRWBFYEVgRWBFYEVgRWBFYEVgRWBLyAC3/8wh4pfwNTWFFYEVgRWBL6YCHhGfzETWhNZEVgRWBFYEVgRWBFYEVgReP0IeIlMhK4VT1Ln9T1bI6wIrAisCKwI1Ah4Dqdcmee2bcrlF64IrAisCKwIrAisCKwIrAh8BSPgpTAxL44pJzy2KTdklVe+cEVgRWBFYEXgfhHozlplHSJTjhdJ38+rZWlFYEVgRWBFYEVgRWBFYEXgs45AvQTmJdG2M6iOk6288oUrAisCKwIrAs+LQD1X4ZVJi45ge8fXNnUWrgisCKwIrAisCKwIrAisCHzBEfDC6GUwMdtmNKHJti84VGtqKwIrAisCnzQCeT7jiGevtDiT007RzkfuKa/8CNNO0vSr/MzWWb1Z/yVfEVgRWBFYEVgRWBFYEVgROIiAF64OkZ2tDDOzkW3Qq6wIrAisCKwIPC8CnrP0lvacrrIZn/3QoSj7yJ37N/tIV9RSlcvbfk+stit/z7GWrRWBFYEVgRWBFYEVgRWBdxMBL0UdIntpJRDafjdBWY6uCKwIrAh8xhHIcxk3PWNTvkdnn0p3PLKjog+dXtemrGLXf09m/9RRlpg0uvLZb9HnIrBidy5OS2tFYEVgRWBFYEXgs4wAD/LXqEzWS4L2Uwa9yorAisCKwIrA+Qh4ltazNeXSWJXew9SrntCPUnEmuyg//JN9cvzs29Hqpi1pbdZ+tb3qyWu78vZfuB8B47avtVpXBFYEVgRWBFYEVgQ+ywj4IO8Q2az+wGizznQ6OUFAvsqKwIrAisCKwO0R8PzsztcjGaPt6diuV+oqh7dkm7JEddXr+GxLGjvqp82Ozn630I5hn+SlE6XV71CdROj3XJgnpWInU+fSYf2zIrAisCKwIrAisCLw+Uagu8jMZL70z3DWj9l7OVDn843I8mxFYEVgReDzioDn5nOR2XR9lYvoZKl9aFOmXu2TcnWfg9rpMMeUfs4Yt/bBlxyv8tqrcvhPXarfnT/qdG3KjnSO2rWzcEVgRWBFYEVgRWBF4I0jwEPaB3Wi8sTZC38nz34dzTSRr7IisCKwIvCeIvCpzq3uHH2OjFg7h0Rt2S6/h66bOsnfYsf+on0Tk1ZPtE3+U2PnD7LPsWSsqn+0UapO8h39sdfHf9NGyhe9IrAisCKwIrAisCLwiSKQD+fuQY6se8E/K5vZTPknmvoadkVgRWBF4K4R4Fx7jZLn5WvR+H0v250tnhnYFyu9N7b2RHQte/2O2tKXI93ntONj7adM/++NjEfZw2xLuvajrWvvZLVv8tBZ7J+yRa8IrAisCKwIrAisCLxRBOoDXh48+5J/pJc2pZke9CorAisCKwKfYwTyrMK/PK+Srr7XfrX9LK+dM9idwUf98EOdpJXdE/VPm/DSYOVt6/zqZOofoX5UTB+6Nu3O/LT9FnQeidCvWfDPoq/wym9B+5/pU3XShxxf+cIVgRWBFYEVgRWBFYFXikA+lPNhDl0vQZXfhk7W2u5FSaz269jD3CorAisCKwKfXQQ8q3TMswxeumK22e8saitteL7SJu3ZmnyltfUpsPqyx+/5ZxxEdKXF7L83zj3bHBOb0mew+iyfCP3cgg+URGnlR36qJ3b6e22OZ78jXfXRW2VFYEVgRWBFYEVgReAVI+DDueLeJWkb/ljRkxZnfesYyQ8zq6wIrAisCHyyCHAeUTyXPnK/wmd76nXybK92bFMu77gznJ2rR/KZvVvkjIG+Y1VaW+plu33OoHaei2fGeCudozm47onQFvq/pOT42El+j57pzuR7tmyz7xGinzoP7IIVgRWBFYEVgRWBFYF7RSAftj6oxe6StI2B9yp9bO/6I9O+OEQXGbjKisCKwPMjwJ5a5XwEMl7deaRMPXlGqDLb9jD7Jb3XZ3aO7sm3Ybxrd5zuHLatonaUJy+tPXl0pcXqU+XVAx3rVkwbnyO9N58x7Uc5BU+hD0X8yD391/bESsN/TpVZpI/JS9sOv8qKwIrAisCKwIrAisAdItBdBmYXp22Md2ud2erGZTrrYU8UVlkReFkE6j6q/Musf9m982xipsk/l36JndkZWuXbGISKHKRWHfkz81BXtI/8GdSPGXY2HKfDMaVH69H1P5LhCzrikX7q3tJnZreb155suHop6sBAU8SP3OPYqP+e0XktXBFYEVgRWBFYEVgRuEME8uJQLwjdxWUbY95a8+JUbeaYTCf9gV9lRWBF4LYIdHuok2l1r02dLxmZvzFImjlXue1HyDl3pKP9I716Zm6jY5XBI69Vufq0S4t1/CqXvxWrL0d8Z7/6tsd3/ZV187atYurqc9WRtz3RtrO4N6fXasO3tK2vKeto9cRO56Wy4dqjfSefdpGtsiKwIrAisCKwIrAi8III5INV2gd84jbGaOuv+lW/6u+nrWKjn/akHTNxdF1lRWBF4EQE2DddUX4G1ensfBVkzN8YSD8HPdPAo/7qoqe+qEwdcIua8qRT54jOfvqKrBs7dc/SR+NnOzYrry/6NsOZP2mvo2f9Uk6/ys9sdXJlaeMsPZvvPeRHPuQYt+hmv3vSYxke7c/koVdZEVgRWBFYEVgRWBG4IQI8pCn1YV0f+tvQeVTzZR86a9UtfLWdYw/V64MeepUVga9iBNyXe3OvOvKifeGVSVdEV5k0SLHvR+7L+tc5O8fEbKt0PcNmPP1sS1rZWdyGnXtWxsXemfHVA2vVTtVJee1zhq9+1fgnn7rV9p4f2a+jqy149bq2KuvGtv8ZdI6pq2wP0addrLpp79703rj6oV+J+qHOHo6pPTqr4FdZEVgRWBFYEVgRWBG4IQLdg9aHsbgNe09qvvDP6K7fkGlX7HwYaqusCHzlI8DeoFT8KP34b7Ylbb9OZluHMxnyL6UQk4yL/B56Xr0lbsPPZ1fOZfsnrWzgbC57Y9In2yufbfei00/XKGW3+KBu9sfP5NW5l//ar1jHnPF1zvLirB/yMzp7/W9ty/GkxTO21D3CMbVHBf1VVgRWBFYEVgRWBFYETkTAh6YP2/qA3oaNR3X2sj+T1/4PfB3H8Ufz9WIOvcqKwIrA4wjknrWl2z9Vr+pku20idm13jLfGbvxOdotf9k+E3qv1rLqF34btW/TRpc+za/ei79lc7DqW+Owxi93WTvqlP8rEHTsZQ9cqZdLt2MWuuon0S176jL2X6jhW4syf1HlLWn+c69mx99bqyIZ9QXST7+ih8khHHlxlRWBFYEVgRWBFYEXgIQLdQzQfytvQe1Tz4pb0r/21v+kH4cVsqzYe+Bxn9nAfqqusCHxlI8D+pFRUlvtXmWjbHl/bah/aKY7/kXudfx2jYh0tfaxtZ3lt3IL1vILfHuqMpt22RGn7V2zbZ2dqys/Qw6c63i6PzexT+Wzr6Kq/5yP9bW9sERcq6yYtbkN2a7UveNRX3Sd6OT9pEbs780lb1Qd5x70VsX1rnyN9babfyo763qu927Njqu2LP7qrrAisCKwIrAisCKwIlAjUh2l9SG9D/1q9yCTywt/V1IFOO0HneOnLUHmTlw7GWWVF4HOLwN7FdbZPjuTMMXWO6NQ3PvaRvwdi06L9I0x96LRh2wyPbHfteU5tw7A89KvXepbeg+/89pxO++glP6PTXuqk/Kyt7A8dNoj7NqrxT0T+0qr9PTtPdKq/6bNtO75Ve5XXF+RdtX2Gnb1OZv9uDPVFdNWTFpXfitk/ae2wL5Pu9mmVjS7XM08aXGVFYEVgRWBFYEXgKx0BHpgUH5w+YMEtqxcZsXvprzJ1xbT3QOd40PohDtEqKwJfqQi4J5m0dMVZm/vmNbEbGxlFPz9y83/Vq36mjdo24x0lbSpLnPU/I89zahtGn5yPQ4b8Varnp8g5K72HqZd07YPfVXYLn/2T1gayTm57fW4kj479HzDXQvpiv+jdUzYdxznMUJ9sl78DZg5Ki7O5n2lHp6szmylP+52NKsu+M7r2kd/bt983iu3S4CorAisCKwIrAisCX/kI+IAUfbCCW1YvL2Je0I5o+4hp94F2XP0AKeJHbv27IvBlRqDLc2UiM5cG36rWcWe8/tBO0deP3GNeXXUSK5260mlf2ayfutmesuwPnWeRdOI2dF5SsXWqP+clup6bIGdt8h2tTj2X1bVd/girD+prp87H9jOojeqrvDbqGMGfiid2os+2Q5+yV/vr51ms/Z/JP8vXnbG0B1q3Hf0zbdpEd2YzdfZs2j+x7t+z/HBnlRWBFYEVgRWBFYGvZgR4WFJ8aOaDdRvya82LjZcz8Qd/8Ad/G3RF28Hsn3Yf6BxXX8ShssqKwBcTgdxzTEo+6ZQ58dwPtifa/hxk/z2nX/bRf2TSiR+lLx8nx5zROW76M9N3/nkOJb0Ng4eVM+6M3q06np31PK3nqnpi6kvb9hLE/65/J5/5qD+JPj9S5jjPiVnXp9qD7/SeI9P2GdT+PcfX5h3Q3N/CFrLkb6Vr/8qfsadfFWf7usrHFB6dt/CrrAisCKwIrAisCHxlIsCDkVIfkD5Yt9F2rXmhycsZNJe2rtqmftpoLj2OC1afhmiVFYEvOgLuxzpJ5e4J2qvMtjOY++yITnvdvsz2Ga2/tCc9038LeZ1LF4dtOGulXbrF5jy76HnmHfXfa9fGHnLG2i6d6BmcMvXvic7jyGb6I53PEGX6qz3t34r0p492OrzVpvpHttXL8aWz7V60/hzZ29E7zPcj26/c3u3XW86N4d71jgG9yorAisCKwIrAisBXKgI8NCk+PPPBug35peZlKS9m0Hlpq/QP/dAP/SPU7JO2tP+AObb+iENllRWBLyYCue9yUimXpl06EXqv5n6CRrfKXsqnzT1fbm3T31v7ndWfzXuLGEHfpXrmPdee/cV8KZYW1UnM83em18mVidhMOsfIuaVc2n7grNbnB7z9sJNjSM/ktlfUnxmir02x2pjxnc3UPbKX7drK/i+ltS9iT1osY7BPtlm1j1j1ZvKql/wNfWZ7+OwZgN4qKwIrAisCKwIrAl+5CNQHZT5QtxGNS+WBbK0Xt+7ClrLf+3t/7w9Ts5+2mgd9jl99+8otzprwVyICXkJvwU4390vuo7ek04ezdPWPfso6G7RVufpibU/e/uqC21H1rBJTv5PZvtemzgyzL3St+WLs+YpOyuVtF9NW1c82afud0bUP85IW004+Jzo6dXPctNvErl1Px0/UpuNkW9LNGJsy9KBF5Ueovpj6ykBrHSN1sq3Ktatc3bSrzi2oPe1U3nHO2uz6H/R1nXMfVzr3fUePIa5niTS4yorAisCKwIrAisAXHQEeihQfjvkA3Yb8UvMh72UJ7C5tKeMn/1//+tf/+O/8nb/zd2U/aG06RqA+6JM+DpVVVgS+mAiY15nnypik8qT3ZLa5f56L2xiQvmDWTkb7bBz92cNZ3yrXBnJpUL2k1UlUb4bM41o9m44w+8xobNAmzvT25Ed+1LM1+eyrPGW30HluH/VzzlVPH/I5MaPVTaz2kn+IIWu8ZU0d6LRX6aqbfNqsNHrKpCvafgZzXO3M+qUuOvJJKztC+8zGsv3IDu3q7tnq2uzbtU1ks33NuXCmDrWLHrjKisCKwIrAisCKwBcfgfpw9EG6jZlfaj7o87JUL2287CPzK//QP/ZjP/aHv/GNb/ykutk/7TrWA+pD9W00r7Ii8EVFwBxnUtCUKpvxykX3zT1wG37cWrtx8a2Tv0T2EpvMibEToS81z6QzdParNP2RpR15dY/QvvaTBzlL5fNcndHq3hPTh2q38xkd/fOZ0CE6yBPtV8dJPuLpGm/VD+3MUB/TbqVjnIt9efSkwcrbplxMXWVg1uyrTpWl/q10+qDdxDP20kb1MW1Jq1PR9hPoOu+dJ54XidC1DtH1DIZeZUVgRWBFYEVgReCLjAAPQIoPwnyIbkN+qT7488JUL22+9Ff889/85l/62te+9uP09UKnHe368He8gfqhX+JoWmVF4F1HoO45JlNl5vst6J7Zw22MRbvY6dI2rc1eneoOO539KqN/+iSfstrnOTx2d6tzy3OJsyr5pLFnnz3b6tS+e32yLftBe36K2a6sQ/uq7xjyb4HpV32G5PMh6ewDveenc6pon2prj6dPNx62tZfjKKs408++6ojVRvJndNS/Rbf2oW9W24+wjpk2kq52bFMufyMenQ1HZ+oYbpUVgRWBFYEVgRWBLzsC9WGYD89tTP160eGh7GWpXtzqSz88Ovz0/1vf+tZP8/v/2Uc7eblirKj6Uf0bKqusCHwRESC3KTXHn8O7X2a4jXG6in7KK399wfVS3mGxkfakq1/In4w1ZOp3qH61VXn6qtvZaWV1XnlGSVedMc41PpWGr5X+6klXneRTx7H1peLZdvVE/RGVd3hGp+tXZfqez4SkbZ+h9miXFjN+Sds+s9nJ7ZOozZTdQtsfpF+idGevm2un18n27Hb6yuj33L7aEJ9jx/FPonu+ngczvjtnx1CPzmP4VVYEVgRWBFYEVgS+uAjwEKT4MPRhuQ3ZpfoAzwtSXtaguw8AkP2Vn/qpv8o3AKp+2tK+4z2gfuiXOJpXWRF41xHIPcdEkjfPb0X3S8Vt2LfSJl3RflX+6ANA9+oMd+w/sTt09/zp9JXpayJt8uo9Qfweele5vPOxDT7PKGn1Eu0DIk++yrKfumLtl3z205dE2uWTrrK0I53j6K9tr4X65XNB/gzqk7ryYp1PnZP9jlB76ElXrLZre/KdX/YXU7/S+lvlb83rR8Vb/Tjb37hh3zgpO0DPgz3sztlh9tGZDL/KisCKwIrAisCKwBcTgfrwywflNmb56PLvA9tL296LPy//P/qjP/pP/cx3vvOzfAsg+0BrC/TiwHhR9aX6OFRWWRF41xGoOX3EsxfQcU/cgttDP7Cr2OrkF5l7s0P3rpg6ezZrG/2QiZUu+umvcdgedLLt0dmlb2nb8Wx7LqbNBz+2Tjaz3+mmHWn759kpnW1J13bbxLSdtO2vhfrVYT4fkkZXf+wnLzqHDtURtSEid4yUqf9SxCdsVN86u+kH7fpTsetbZY6LfEbXPnt89WHG79mgbdYPede3xm2Hz3PAM2IPOVtrHaL1IQBBWGVFYEVgRWBF4MuLAA89ig8/H5LbkF2qD+J8WOfLfP3JP3/pXxk/+f+b3/7230ZGH+T2TXuO4ZgPqC/6Jo7mVVYE3mUEMoehKcpm6D64Fbdh+6hic1fHvSnmvq00OsjU7ZDxkFdUV3/UkX8OavMs6lPqH80ndaW10/msTqJ6yKS1kTL71Ljv+aiufWfouLbn+Hsy2xxnzxd1xewjzfOho5WJ2qio386nYtXX3lms/Y94/Uk9fUpZpWf+ZHzQqf1mfI5Z6VmflDtW+lV9ybak007SqVNtpV5HO4eT6Dk3O0M5e2mbncGj6VJoX2VFYEVgRWBFYEXgXUege9j5gNzGzC7Vh68Pax7UVl/0RV70/QCA3/n/7ne/+3f86//q2Dcf+I7hmA+oL9XP0bzKisC7jUDN544392/BbUQEffDFlT2JHfcm6BlwBrNfpavd2l75yXwO51rtyN86vv1egjmHzk62S6MnDdqvi79tiamX8rSlPMexXURHWrRfouOlbEaja5v9xHw2KKtoX/0BJ/VRntgPrDbP8mnjteiZLz4/s925zHyZxOX6QRzts77azvGS7vzJdulqXzmoDRFZ1U9+Np+J3PUH92p3DiOj2PaRW/+uCKwIfHYRcLN+do4th1YEPsMIuF98uPlw3Iavl+pD14e1D2jQF3rRl38/AODF/+e/971f5Ov/6oBpQ7uO47gPqD/6J47mVVYE3l0EMn+hKcoSzfsZbqPfzZU9Rj/xjA33JeheTWQvw1dMnUqnzTO0PqN7xmf1xTNjpM5z+zHPtJN053e2J61uypKu8ZRHp/qebWljRmd//UjZrJ/jzHDWT7n9umeDbYn2Sx/1s8oGzz7asto/bd5KayNRGynraPSqvPaVr7i316rN5HP+0LYlrUysYyeffrhutCtP3TO0NrK/fiTqbzefKpvws3OVM5g2sKtDfJGDq6wIrAh84giwSSniR+5XeOWi7QtXBFYEnj7kfDBuIziX6oPXB3g+pPOlPl/+pfndf7/+n7ppQ7uO47gPqD/s36yDXWVF4N1EoD5/Mpcrbc5X3MZsn1XdWx1iE7m2k7bNfu5VMPfwjE79jk670h3q2y3Y2ZnJ8G3Wtie332xutmOj+r5n90xbHTP71HXLto7e8/NWv6tfHV99SB1zKWUdXW1UP4N3H20hu778Yqez38nwrcrtX/25lZ/ZrfLOh9SZjZtzT1p9ZfJg2u1o12qGtc+e73tt6RO0voKVz7agyYFt1ETzIrGexTN+mFplRWBF4FNEgE1JEaVnm1W5euAqKwJf9QjUfZEPwm0E53pJ8kGeD/p8ofeFX6Tta1/72o9/GIVvAaQudNrRtg95xo2qT/oKrrIi8N4ikPk7o831Drcx4Zure+oe6D4F6/5NfkbbL+3gF/wZ/87Of2aL/l2b/nRtZ2XaEOmXtHbqHJQ/B7E/G+esvTM+Vp9ncUxftLuH1Ud1yR/pI0wbnZ8hc09tIXuSD914Z+elXmL6N6MZ0z7d+M+R1bGcs/LKI0/ZzKdcG+luv+uzOvDSqa9etlca3vjov5g+Q+c8bDtA86Li7Iwe5q4/iIBeZUVgReCNIsCmzJKbFLntezjrk3YXvSLwVYhA7gVoH4LboC/VB60Pah/e+ULvS3/Fb33rWz+dX/+n3X7a8VLgQ755gOtT9XW4uMqKwGcfAfLWIl1zGd48r7iNtra6N29F95p7+mx/9cHcv8+h0xY0Poh7/hgLdKTFvX7qV530gzb5qjfj9dl+M7Q/vkqDR75X/ewLnePZdtRHPfvKi/rUIToz+9qrmGd8bXPMKj/L219f9U++IHtrq1UbMzzjy6yvcseUn+GZsfZ0sGt7jsH48KJt+lXltmur4pk9bx9sSYO1r23miag8Ub9m6Hxol27QPKhnbeW/f/Tt6hBf3zWgV1kRWBF4wwi4KRkSmpJou1jb5e0jD66yIvBViYD57z7xAbiNAFzq7OHtizxYX/zh+a//ePn36//q2C8vAT7gfag79gPqkz7q82heZUXgzSLw0rzL/E3a/O5wG7N7Ut0nHeZegt7TUfcWPfvk/j2i2fOdjrZm4+O7Os7DeMBXWp1bUPsz3LOVfs/6K+/s4H8nv0Wm/fSl9p+N0/U1ph1q1zZ5Me1V2vVPuf1A5GLqHNFpA9q56mNg7q8t5Be62tnjZ75mH+zrTx3LNtuz39F899qxk+1pN2n9QZa0OrP5aZu1hE50fUV1O1uzftmns5Pt2tVnY5rzkT6JmR/SeU7P6GF+lRWBFYHXjgAbkOJGTFrZWbSvqG34VVYEvioRyP3iQw/cqD5cffD6UAZ9kffFviJf+8+v/9tuv3wp0L7jOf7A9Cl9HU2rrAi8SQR8Nph/DKrsjAPqJmpLzDyX3obxa3VvdOj+uRcyxszW7PLumVDPiBmf9rs5VR+qjrFRDi+tbW0or6heh1V3j6e/7WkLWbbB63eifXMOqWt7h9V+6uQY0tkOnf3VCbw+C0J2jXO1pb2MATQ5oCxpZaC2UnaWtm/6uEO3c6r62rwVq50jPu2fnW/V0wbyjlYG4k/yHV3tVz73tDQ6rq1Y+yVvP3VF7diefTpa/2dxds6z9ge5OeHZm+gZnTi6XZ8ByFdZEVgReKUI5AaT7jZjym6hcVt96VeayjK7IvDZRMCcF33obcPDS/Xh6oPXh3K+xPtin8h//cdP/uvX/9HJvtrTvuM5/kB90kdxNK2yIvDJI0A+7hXzVT1583qG2zB6re6Liu6b56AXbnFmw3YRPeha8wM92irfyRyzzkv+qF29ivYTazs8bRWrrOt3RrY3rv1ZX+hc50qrO0P9re3aTnkny3ZodaofM772h3fuFVn/Kks+bSGXTx3lKVMPnPn5EnnaP6In47jHt9qePqftnN9zaGwZq7R7hrZfN27d83t82nHczmaVVZu0I0usfbQ/Q+JOW41/w7tWid8/9PbqaL4UdFZZEVgReKUI5CZkiOTvQWvzldxfZlcEPqsI1D3jQ28bXl5/SuDD1gdzvsDnS3/S/vG/f+ev//W/xYcB2WZ/7flwZxwf4Iz/UPUJTH8Hu8qKwKtHgJyrRdlz0BzOvO7obQx6qe4J0f3YYe6pPZq+tkunPdqUqzdDX/S7fW0fdeTFHNP5gcjFmU7qJ5360tmu3TOyqnOG1/c9XdaWdtc4scqrHfum/OyYXV/tpA9naftWNO6sM7RYafXEzg4y2mubfNd21v9b9BgP/UTpAzvu723oJQ3/qDon0bicRfslGh8x2yrtOMilK7p3Z1j15fdsomOOzOwq117FOpfkiTN8jXfDsz7bqK5Tomd34lC93kugV1kRWBG4cwTccJiFpih7LXSMy2DrnxWBLywCdR/lg24bc735A4B80f8rP/VTf9Wv/+fLP3T3ouDDvHlIp1+517+w5VjT+cwi4P7QLfmag51cHfrO2jOvk95Gn2vNSyy0+yTRi/Fbo/t4hvgze/GnLecg7RzrvJWjB02MOp3U06Z9sm3Wt8q7tXBssfZxnE6eMvvnGDM6+z2XTtva2PGBnNyOKna0oU0x4y89W3fb7QvmunXyWbu6R74/px3bJ/vlnp7RW2dL/0HjchbtW/W1lTjTrX3hXTfwqNb+Z8c5spvtdQx4x9nDjDd6yRe6W7PvHzpdHeLrOQ+9yorAisAdI8Cmo3Sbr8q6jZuyqp+8YyRCr7Ii8CVGIHPfPbKNiV6qD1Iftj6AvfDXF3t5/vjfd7/73b/j1/+Vi/bXHugYzUNZv9LXL3Et1pw+jwiQZxZzDr7KU2Zbh9pINKcTt2HwUXX/ie4RMfdPR7vPfAkXU1edlHV09rXPWezs5RykQeYqn/Pu5LYn2neG6toun1jXQR4d6cTse5bO/mfos3Y7vTP2Jzrk5/ZQzVX5Fuv4xrlDdJXXfi/lH3xufXxoc26n5nXCXo5VbTtGRfqoe+3v3I3NczBjO+t/Roe+7F9tdHs5z4bUpc/eXFL3yK5nTaenb6JjVhyxvn4LgDZ5afhS63rlGd7Ro/sqKwIrAveMgBsNm9AUZRXdsMilZ1j7znjHA1dZEfhSIpD5nntkGxO8VB6MPlR98PogBn2hB/npv98A+PrXv/7H+el/9/V/dLWhTcfwge34D6hv6e9oWmVF4NUjQM5Zav4lL42utJgyc7niNpQeVfeC6B4B3TcdurfuhYxxiy3PhK5P52/OK+k8e2oM5M8gNju9OlbqlLVgrR6tDTz6VZ42juja94g/srfXnv6idzTWaM/83E7oX3X2/KBtL+5Hfc+266/68g3mPF3nRNuv82ts2KbuLUhf9bXz6JstGa+X0uy/W2yon9jt4So7M0btk3x3dnQy++yNZw4kjpg/irFtyJvq+oCe6RVH0/XdBHqVFYEVgTtHoG665HOT3kqnHWlch6aIH7n174rAlxEBc11032xjetcHpA9XH7Y+iL3oJ/oBAC/+s6//3/EDgLUvv4w8/JxmYU65J/BNurbtyWu/1HWfgduseikF3YOg+1B0P84w9+eRju25R5WJ2SadYyRNH3Xsj9/Q+g/m/Dq6xiJ5aGJYZXs8Y3TtzVrsrlGjf8qPrt8tsuq7fZXDJ237ATrXmp/JS2/DlvrQbdUHcBbz1IHGVpUpdxz5Tk+ZuhPUd+eTuD30USZf0fZbETvZp9q9zr/bCyk7s3dyn6X+jE770tUGfN3DqWO/DlMvac+HWzD7d2MhMx+OcKzJk3V4kLFWtIF5jnf0UFllRWBF4F4RyE2GzeSl8zB9Ca29Gd5rTsvOisDnEAHynAK6b7ZBX6oPTB+sPmx9QOdFH9qX/x/7sR/7w3z1f/b1/3wh0KZjOKY+DNQvMPflYFdZEXiVCOS+YIDkzUHl8qnTtamX+bwNxSfVPZDo/nC/JLofK9b9eQtfbSV/ix11sz90+i/tHCvWOCT/Eppxav9uPZ4rm9lGfovN1K82bUt52rY9ZQ2dOblHb9FXvZQ9odOvs3SM8cheN5e0Sb/USXpi0zmAjpWyjlZPtG+ne0aGHfUuNnNO5mjdEzPevQSqk7Kkaa989pnR2ce9LGab/SumjnQ9Hzg3qqzj6Z9j17HkM6ZH9FiPyzoEuj6JnueJo8sqKwIrAq8Rgdxolc6N+VK62oaniB+59e+KwPuOQM1z9802pnWpPCh9gPqg9oHLQ9fLvegHAH/+m9/8S/z0n/8CUJmorg9z7TqOD2d9GKhf1d/RtMqKwN0i4PmeWHOua8OBTl77mseJ2+j7pLoH2BO5B+HdL7kP3UuJ7rN7YO71pNN27u+kUyf9g865uP/FjIFxUGZMkj9Ld7a6NRiyXCdo1kkZ9GHFpzN699B55ljO5yVIHLI//JO6tz6d/pGszlf7R/1Ke/r9HHob9s724zzY08XW9Sf/zifRvVEx99Fz6Wpzxp+1b3/8lwZn/T0bPC88Z5Tv4cxmjpt0xnSPZj0eal23erZXfnRbZUVgReAeEXBzYUs6sW5O+W3o71X1Okz7lR5mV1kRePcRIK8p5rf7YBuy60XEB6cPWR/EPqhFL/0gL/57X/+nj3a06zg+kPHhoeqXfoqjeZUVgVeJQO4NBtjjs83cnKG5DG61mvuie0J0r7h3Et2HR5j7VNo+lVc+Q/Szotfx9k9/nQvo/ETnLxInaXSkO0zdrr3K6hoMvq5Nrllt25r+uzLGp49+3Nq/6muvyk/ydW6VJ4+r7Cy/nfThxXrPiCVzYNycS+Wz7TVpxwWf5IVzA90fFXMvnaHZh1Wv2pzxtZ+2RNrpK6ad2lc+zwVozguxOzuqvrz2Eme+6FfGN2nWoqnmQXe+D/Unzwlkq6wIrAi8MALdhlPmpkzcxnjwidAzPvtKa18c3dcGJwirfBERMK9F834bs7teRHxQ+lD1YeuDWfTlgT/+93d/4Rd+6ed+7uf+Hr8KYHuiNrQJOg4PYcaPql/6mTjUVlkRuFsEyC1K5ljKbBOzrfaRN38Tt2HgSfUC6l4Qc5+4dxJzbx3R3Qt6ypKe2XKvp+4enXbS75yXcwWNw1tgsw6sE2uT66UM+aPanFeP2mf6zq22vxJf/a9z63jzF+zab5VtD3bAW2uOdWvfPf20ew/6lljt+XV5/n7fiJN5IuY+gc49dIZm/3V61e6Mr307e+lX0rUvfJ4H0nleQCMX1TnCOlY3H2KKPGMrDRL/UjNHcn8kPbpc3xOgV1kRWBF4YQTYYJTcaNC5IaW3Ib+12rdiHU9+DLHKisC7jgC5TKn7aBuy68XDB6cPVB+8+ZD2hQDZX/mpn/qr/PR/9tf/80GuTdBxmgeve9K9p9/4vsqKwL0ikPlljiXaznjSZ9EcTtyGnWv14uk+EHOPQLv/wNyDld57Ia9t9HUPz1Cd2hee//KT2rVVv+CdQ87N+RqHirQjE7O9k2X7jM74FzrXCfq6Tp8xrc/6WnnkziVRPZGclgblzXVl8rYrz75naPyyol/pzoY6z0HH6Ox2MufZtaUs9TImqTOjmQdt1/nMcha5ewXMPeT5UGXK9/Zd2tyjO9tnZHVsebE7JzqZ+mCeJSnP+c586+ZobDP2uSYPa5Rr6JpXHKqrrAisCNwjAnVzyedGTHobg95S8+BNO9KOJzKnpOFXWRF4bxEwh0FzfRv0pfoQ9EHpg9QHbfdw5iXgu9/97t/Jr//7QpH62tCmYzimPgzULzD9HewqKwJ3iwC5lSVz7aV05jD0ltWcF90LoPsj0b2T+wnafda9hL+2zA8AznwIoP8ic8s5G4czSD/0RGntaSPbleUaPNB1bVy3R+vV9HtWO35gS5zYrT7VsfTxCOmXtvb0zXd0oEXle7inuzfmc9uY1631zFjdvO1nm3zFWXzQO+r7aC7makXzG8yzATr3lW0pg1Yupr0Zje5sPO2k7TqmbcpBzi0x6ZTVc67j02bS2lSmn+JsrhnvJr9yvbu1Hl0u6wyusiKwIvCCCLDBKIluutyI0tvQfWnVVqJjJo6hVlkReLcRyD1lrm9jNpfqQ7A+9H2Y5oPYl49vfOMbP8nL/95f/8+Hcn0QO6Y+DNSv3Hf6PZpXWRG4WwRqjt2DN3/FbXh7qeZ6Yl5I3RuJ3d5jP732C35n35d+2qTrBwB5RiTtPHJuzr3GA562KldftF0++yhTxzU4QNaMtRKhrzVtQWfbA/1kzRudR/Ym7e34ZQzHei3s9gJjpdyxUyZddVNum/2fg8SRfmKlb7Wpf0dY7R7p2177yeN/W8030HwWcx9J1z1WefVA7RyhutlXGvtJO94M8zy4ldYm/aTFlGnXNlE/xW7eGe9mTVwv0DVNHOJVVgRWBO4RgdxY0rkBpbcx2JPqw9kNjY6yRh9b2NBmomODFPmP3Pp3ReB9RcD8Bc3zbdCXyh7xweiD0gco6MNV5EXAP/535uv/2NCu4zT7Ur/SV+hVVgTuHQHzKrHm3S28uStuw+Fr9XmU+8x9ALo3RPee+03sXs67l/J8SZdWr9rIF3npxErDW6st/Ux0Ls4t5y2d8ZGmLWl1z6J9E3NNztDZF3qnD+u+7VX7ixNd8+ct0Tx3THho5R0etXd9OpljfgrEn+fMI33tbGS79qsMfpvVmnfkPPtHdC/5XHWPdahuxdk+2huHNsfQnvwM8yyQRlf6VnQc+s3sqCPqtz6Ddf4Z87Iu3drVXB5dVlkRWBF4aQTYWJTcYHUDbqO9rbmJKz3r8yCvY+T40kN1lRWBdxkBcxg017dB3/T7/z6s+YN//OT/1q//++B1bzJ+VP1KX6FXWRG4ZwRqft3Kk6fZx7xN3IbOdW+Z72K9fObF1EtrvdzWl235fEFH5st5h7aLR31Tr7Nnf/Song9izsU51rnDZ1ykO+z67sk6G8hYmzO163+m357OifEzj16bJo8ZI/N5JtuTZ/9h7mJPzLYZPZun+rP2l8i1/Rx03NpX+RFuIzht7XIOGXnuHqqY+0y66sjv7ZdsUx/Epnzal57h3ku6Z0RiPUMqzzjalM7+0jN/nIOY84U29mVturWs6z66rLIisCLwkgjUTSVfN+A2BnlU3bhnsPYNvo7j+CCl8h+l698Vgc87Apm30Ob5NujrS4oPQx+OPkR9qCb6x/9e4ev/+Ka/g7xeJKG/9MK8KRU/Ste/94pAxtdcuxXdQxW34eS15vPI/VXR/SZ2+86LMFjr7MX8SI6d1Ek+6ZkO8uqLZ4RzAJ2X6Pwrr1zM2EErvwW1QR9pMNeoo1M39ZPu+s1k9tPuTO9BXnNqxm9Df9Z2Vk7eo3tr/qf+6L7b33Yx+1Y6fan0mTlpL3WRpS117oE5jmNUWfLb8IWqTP6KNVfgu5xn/9T9Vfddbc89B93ZVaZuYtqvdO596Gy3rSLnR8rkRdqSTt2ztH4wD+icD7TzBd2frsFYJ9fF9Urs8md0WWVFYEXgORFgQ1HqxspNB71lzU17C502gs6xqh/6N9RXWRF4NxEwb81nc3wbM7j5AwAu/v7xP34NYPaA9sGbD10ftu5Txn+o+gTqp34P0RdTnFPOUZpJSicqT4Re5XkRyNju0ZmTZ+ltuHSp5jho3ov1EirvXgHzgssem9V8QX8Ojd2jflVHPn2ql3X3P3NzXs4TNBZg5W3LGBpHUZ1E7Yi2VTvyrlWibYm0w6tXaXWrnvrK1cv+qfNAn8m1bdIP+Zn+VYd9gMz9IK2e8ltxmLzatG8nsy1RH6pMn8Rs/1R0+iLd4TYmrxx6t5ov5DG0+Ux+H9Vuz9V9ob3Ezq57eQ/zvEo95PDZnjRnSMfP5OrWduUV0xfoOr+cu/EWm/Vx7cCaa0O0yorAisBLIlA3VW446K1WN2simxpezLakq63B1/GqP8kP9VVWBD77CGTOmt/b8PpS3Q8+CH1A+uCsD1T/+F9+/b/qwNs/H7qOwZiO/4D6lb5Cfymlm5fzO4P2Nx72kV94WwSMZ4fm4hFuY8iqg+z6oVrdW+S/+6ti7hdo91RedKGz8uIOf/QCf4/2HCd9SFqfcy7MU77OWd5zIbGLXbZXWluJVQdeu/UMks/2SrO23fpWPW2d0dVmwZpXld+KvnzVSx6d5Ctd90K20wZfdfb4oX4te3rvtS3jc4beRjRuqplXmcuZ45VmryFzz8mrV+3A0yaql5i2ZnS399X1PqBOh5wjyEXp5Gs/28RZH/0Ac17QxiNjLb2zXq535u5QX2VFYEXgJRFgQ1HcWG40cRtt1+pGTXRDV0ydpNNe0I4H6os4RBcZuMqKwOcegdxTmdfbcPz6suJ+8QHpQzMfujxo+aN/d/7r//ihX+4xfR5N77LkPJxLYm3f4wlA7WtQlMsv3I+AcUZLuqK52OE2+llru/LrnuI5U/dV7i9p0P0m1n3H3qt178Wev9OR7fKibdiEFpXvYfVDXp+dQ4c556SNU6LP6ZRVOm3M6NpHuyJrKp04k6fOc2j8yX6M09TMr679rAw76moTXhp0Dyib8cq/amhcjFXySRvnu2HmSebxLNeV595T9lJMm9LseWlwxiv3jOiQc0S5Z4qIfK9dvURtpX81BhnTjHXSY3/kerree3tgdFllRWBF4JYIdBvKzSZuw+C15iaFzs08o2sf+LT5QDue2PmGbJUVgc89Apm75vM2nL5U94P7xQekD00fomD+8b9X+Pp/+vke95Y+Ow/yospsewlqV9vwq5yPwFHs3SPiNkwnDT+TXdpme8q9Bbq/Zpj7DjovttC+tEv7wl5f8JWDe22pd4au/lR/5Wfzy1hw9iQP7XmUqDyx9tvj05ZrdE/Efmcvx006dR9y6pI/g858g1be4VF71weZY3SYe8T2lH0O9JjC9YOL5/iz13+vjbGMCbg91KSVncVp38yRzB3zHJl0Yrfvsv0srR30pTvM/Q6tjnIRuTTIOSLmmTKTdfLslzS6+iF28864Jm3sH9bXtXTta84NtevzHnqVFYEVgRsiwIai5MZysz05IN2cYm7cM7T9xDHuVmqOnT6ln6PLKisCn3UEMnfN6W14fKnmv3vGB6QPTB6iPkj94398A+DPf/Obf8m2ivbVFqh9xnPsB9Sn9NM9NlTeTdF/HJZ+LcwxpMFV9iNgXu2ti/kobsNkV20Xrzq5p3IPuC9A5Mkn7X7LfZUX26S7l3Vf9Ct2urfIGBf9HF86fZ3ROUdp45Bxei6NzTP28ixyrW5B+qOvHVGZONNT3/ZJfpFP5Bb4GtW87bDuD3Sq7LX454z1nD63+u8YoPUe64It7SSt7NG3UzJ3oGd7xf1VUf2UK6s420/ZV7qeWcrBPA8qb5vnyD1Qm6K+1PnJ15i6L/NMiDViXVz/WQ4NlVVWBFYEbolAt5ncaE8Oxtyc3QZmc3tAdu11kw9Ht1JzbOjq3xBdZdCrrAh8rhEwd83pbTh6qe4j94gPRR+aPEShufj7x//4AOBrX/vaj/uATbQfqC1tO5ZjP6A+6SNIET9yn++/nd8pq7Tz3cPap+PfU4w+p9UjlpQuprM12Yb+6Wqem/fuA9D9kbQyMPeSdHcp9kU8X+B94UcmPcPsdwvd+ZIyfZ5hzhXa2Mxo2zustrQh0idpbbguouu1h+jSnn2kX4I55i059gJdcpxcnuU6cvaG6D6pvPJbMG3M6Fvs3ao7ptXu+zN29BekbrdW1vpsn9TNHIHOfDOnK3Z7Y0+W/dVTNuOVg7P9jnyvnbMDncRKJ68usqOaPumrc6qYMZXOuMe6uf5dzgy1d3NvwddVVgQ+mwiwoSi5sdxs25Bfa25MNiub2U27x1c9dNNWjvFAOz6YfiU9mlZZEfhsI5C5aj5vw9tLnV0ofGCKvPDz4k/5me9852d9KOdDFlr9fMC6N91rjj1Qf9JH6M+9pL/4qs8pT9p5PgfTzoxOHz732H1K/4gfpYvjbG22oX+6muPuq9wH7o0Z1r0Ef3TJ7V7eeem35ocBne4tMnxBf+bTzN86r9n8q9zYVfmtvHYSPZO8A4i5fknbnv1eSqf9oxw7q4uetpJWVnCW893+UEafjlZWUf0cC53k1VGeNmxTP9veinZsccs4ujYpS/rEOjyyV/tqX8y8y5yGdm8krayiOjNMfXVSBl339i28d4jZeXJWXs8kzyF9SZ+Zx6waV+OcGGtiDtTcGyrXewD0KisCKwI3RKBuKHg32zboa82NCe1B4gY+2uDqiWkvx3mg9QGsPg7RVQa9yorA5xSBmq/m8jacvH610H0AunfyoQnNV/4/vv5/+MCvAiDzAStmH+2A2nefMfZD1Z/q52j+LAt+WqSr7/LO7R6ozUT8gKeIH7n17ywCGb9Kz9ZpG8ZoAw+rOQ6a97kXco8k7R5K3LsAe+nNF/jup/1+ECCmfqUZr8qStz1xz8falnPLuXc0MevkVXbGprZyHaBdH9eqWzt1ZqgdcabXyXO8pMkzeNE2edBqW0XbT2DmPXsCvu6NyquTfZVpo7bdynd2lFV/3oJP/zfjmuukTLRNfoauXbbbNxG6y6Oa1/DsE7HumeTVEbt+tGW7/XPvSbPnod370rbP+NrP/rdiZx+ZPic6LzFjm3GPdckc6HJuqK6yIrAi8JwIsKEobqzcbNuQXyub08qmZQNzwQHl3dQd5kaX1p4bP8cbdPqif4lD5VKcg/zCFYFPGQHz0Vw1j7fh1E0fAPBTfz8A4NsAPEjzoT57sNb9xbhR9Uf/9HeofJal+pm8tHO6N2q/Q4NF2yrzCBifLobdem3D1E01nyPQ3fPIvZL7J2kvvciOLsb5gg7ti35F26r+WR4/0E2sNPxezTlK750jGaeqZ/8Z2lf0HgAv7dmU6JqlTNp+e4gu7fZJ1LY5Qpv0a+JBDnd5X/cHOsg63beQ5djpm37Znm3PpY/m8+g8yHXLOCOXrzq2pbyju/6ZT9B7uWjuH2Fnwz7ZpkzMvce+h+/2v3Kx07mHTPvgrOq7mPPL2OZ6uA4DMzdm+TXUVlkRWBG4NQJ1Q+Vm24axa83N6UPUC87RoXhmw2M/xxt0+gKdvg72ykOv8mkiwJpQEnOdKp26l45f4D8558zhbcz19AcAPJz9/f/Z1/99oILdHnPPMu5D1Z/0EfpzLfqJf9KJzqfDbfS5pXY2kOV40kN8lUOvMo+AMas4i/c2TNEGnqrmOZgXSvdE7pN6SWWf5SX2zKW4vsDz4u+zUOw+DMh+jJN8pWftZ/zrdOq8kyc+8MYp26SxCS0q71A7ousA5vrMaPWyn/TeXaOzl7khjZ70DPd06jgzG+QvbQ95nDntuZII/Skqe+xoXPZu1en2c5V1PHa0J1bb8FuMCf2ozmL+UjnjVBt1veXNSTBzvaORsVdsE+0rIpcWuz2mrNvrnQz9Tv4SmTb1ZYY5V+aU1VhmzMtaZ250+YSMIn7k1r8rAisChxFw07ixcrNto/e1ukHdsCAbmZ9McnmRz83d0dkfWrtgjvdApz/6mDjU1sYnCG9UiD0l1yBp22Y400X/Syg1Ppm/25jgo8uFeyH3iRcAXiD+7i/8wi/xDQB+FQB5PmB9qKqvDW26rxgzqv7kOujzUPssiv4kVn/hnUvFbbRZaZPew9Sr9uC78fVvNK8ziCBMinGqMezivA0buRbwu9U8T3QPuCfcK7l/oPPym7y0mHo86+Dzhb2+7MujA52Y/fboOkbnQ8rUT7SdedRKW5VVPvtL20+sfeCNt+g6iK5Pom0vxbRZc2KPz7aksSeftjtavYqRw13OK2N/QIvKwe2hVpk87dKJykFrbU85dLbfSuu7SH9oq/ayXVkifjypxBV5jW+uUW17Kd+tszmaz15z/TmoPVCb1U7uM/de7klozhNlSStLPGpP3RmdPs3oOo+cq7QxzrWK9c+8MI8Sh+oqKwIrAs+JQG4k6Nxs2+Cv1c3pZhXZ+N/4xjd+EnRDe4jJd2h/UNtgjvlAp0/VX/mhui7hBOEVCjGmGGtRWUXbRdvhpcWq81Hj/f7rfERzdxtTutTMdfdA7g/3jr//z7cAeFgjZ4/VB6r62tCm4zjuQH0B9U8cok9e8IWiTzPMeSS9jb4vrdjDRtqF7nwZ4oscXGU/Al38kNU4G/9ttN1UzXfQPQCyL9wzs0sqci+50qLyRPbjXvUDgIq1DzarbI9XX1/UTXnK1BOdE7hX1T+LnS1jLno+JeY6uVbZvkfXc6/T1X7mRtK2V0wdaXSSPtMH/ZLHNd9ne6DqsRf29sZeW91HR7rZDr1X9WtP58wcq53q85V3DcBuDVwnMfWT/r5xviTf0dW+fOaa+T1DdGdtVT7Trfur25fue5B2cY/u7BzJ8AWd6pNzUS4vOreMnfEUXQPWJqq5RR51dYjXc5ggrLIicGsE2FAUN5abDdysbkzQzQqymUG+BfD1r3/9j+fmZuPDi9kGnXagHcMxC6Zf+ioO1XUAEIQ7l5obmK8y1+A5WO3d2f03Nef8nRN85uw2+Es1z3Mv1b3BQ/Rvfvvbfzt/+u+DtGL2zT3lOI47MP3RX/BzKfqEP9IVcw7S29A/rMQDPfGgj7YTqy/yw9R1X0Cv8jgCxqnDjG/S2zBxUzXfQfZB7gv3jJfTRC+8KZO2rWJetqXzJ/2++NtWEXsp2+NtSx+yr3Rt3+OZH+3OU8w+Z2n7djaNu5hr4lmVMmh0U9bxaa+2Z1/HEM0Nc6XK4W2boX0qVn3yF1nJ48zxI/pM/mPjjN5zdI78u2c7/j2ZS41p8jX+HZ/60mOc64s/fZDbV51OjixzS9pcfA3MvYV991jdm54BM0SftsRq44h37ET9Ozt3Y5Zo7EXXgHWKnCA3uufHEK9nL0FYZUXgORHoNpUH+zYMXqqbMg/LeiDyLQA+CHBzeyjAQytPdNOLjuO4gfokVr+H6vWAgF7l+REgtpSMceWz7aV02pYG30PJWOFvxsJcBTerOZ57KfcENA/rn//e936RDwDcU+6nxOznHgIdwzEfUH/SR/0fKp+s6A8OSFfU94rb6NNWYkCbsehw1vdBXseCr34N0UUGrjKPQI0bfBdfZdtov6nm+roX3B+5Z6C9uJ7F7nI8u2zfIvdCbp/kk67ttom0Q8snVlo95y5/FnMs+mCnorbBGnvXpMOqe5bHFrpp0xzo0FyxTR5Eljx5mLx91JNPHehJ/prfR3hT7k/GureNI59vadc3+8hfsMZS3ljvITlQ2+2fWHX2eG2aX2fz8l56uZ/qPvVsOIP2rXtYeYeOTZt0Ys4RefJJGztxFm/X6Ps+nv/mh9g9R5CtsiKwIvCMCLh5cmO52bZh71rdmLlx3cwgBwT/VRkIn5sfWhmYNe05BphjP9D6JabP0kN1lTtEgHhSEo3xDF2XxJluJ8/xLoN/pv/gO6XDnFfGYRv6l5o5nrnvnkDGSz8v/3z9n/1U95L7yT6gttK+Yw5MX9LH0fRJylHs9DH9TnobXrc153+Wntka8hwTWr8qjqZrPkCv8isRqLGSr7GF30YVoW+qrrd7wf3R7Z+8xELPLrjIa/UCXS/dfgugypPH1h6fbTN6ZkO5/mZ/ZWeRvtpLO9LVzl4Mjb/rkWjbEe69XNg37UKbBx2SK8jNmVvQfjO72NrJ3S7vld2U7ztjTO04z+x74G/a0s8ZomubdO0vn3rKHn3Yoq9gF2tkrrOoXvJJ255oO1hpZRXNucQzOZr60PTJftLKE3PPuQ8r7p1B7mft0Fd6hjm+NLrSYp2XfI1bxr2jXfPv+5VngXnic0McKpcCv8qKwIrAMyLgZkp0w23D3rW6MXPT1s3NrwH4B8s8ABKrPnzag3YcMMd/oPUNTJ+hKSn7KFn/no1AF8OMZ6VzLc7S1YY8PkJTUvZR8nn8q396o58zzJhso9OlZn5n7rs3kLGP+ACAD9SQ5x6CVldMO9p3vAfUl+rraH7TYgyrHx2vzxW34fGT6ryfi53NIatjw1dfh+iau9CrPI5AjVfyNb7b6LpX1X+ik+ue+8E9IuZe8vJ6BmcX5HoB3+OxYXvSezLbEvf66if6qad8D7NP7ZvjS1dbXRy784q1UJ7rId3ZQWY7WPlsc61F8iFpePJFzNw5Q2d+VTrtnshl8nia0wf96XtTPTM3bKK3Yxt/GVe/E5HfXB1v5l+NsTxrWmllou0VbQdvqZlnSe/lY+pVOnOdtuSl6z7LveleTOw+BOhsHMkYHx396FCf67zgu7iyDsjreuTaRw5lbuVzA5oifuTWvysCKwI3RcANlJvLTbcNS9fqBs2NWzc4m56XlqOvLdfDIW06DpjjP9D6Jqbf0kN1lWdGgBhSEo2raOxfgtrq8KMHn++/+rwXpxqbbShfauZ35n3uJR66fJDGgxx5PlxTDzptpG3He0D90XdxNL9JYTxKjltltulrxW30b2vOu6OJEfKKVXdiv/qhn4mj6yo7EchYJV1jK78NW9Dg6ep65p6o+6XuJy617K/ucotsdknmwk1bXrwrbbuY7SlLOnU6uurCK5MW7S+fWOeGLu32OYOdvRrHPLvqc7+uhbrY2FuTqiefmOue+bBHmz9ncM+Obdg5kb835/kJm0/2zJk5dToHY93V9xzfGL4UMw+eS5NX9jXHMkeR1byXzzb7JqYd+4jsL+jcZ7fu0dzH9k177ntlldeXijkv25wXPLQxm60h7bTlupd883kA5nMDepUVgRWBO0Sgbiw33TZsX6ubNDezGzyRA8RfBfBA6DD7eBBo27HE9GPQ+idW/5Mf6qscRMDDNOPW0cb7JYhd+3dj4GrKD1x/k2b8oehX0soqOkdwy2pOg+a7mHui7plsk7afqO0cb9DpS/o5mi5zAl+7dOOmTDp9TXobDj6pzrdDYzLDrg+yZpz0A1pfQYr4kVv/dhHImCVdY7uNzsjArFVW+Yuua1rX3P2SWPeXvJfZDr0kV/SSjTwv0Morqlflt/DaqL4kn/ZS3tFVd4+3rdrpYmZcj7Dre1aGbXS7MVzzmhPw5kviTK5OZ6eTqV/yOHP6TWj9qHg0z9TPOSBP/oFu92OjtyGrNuRzzBpT1jFl8rP1re3q7aH5g4602Mn28pN+tV1biVUn+bq/3Hd72P30H31sidqtvHIRX5JO32Z0zs1Y57pBI1eWa24eRN6QV9R8ZiQ9mlZZEVgReG4E2EyU3FRuukeHuhvVjetGdpMnHv0qAIcE+qJ907bjNYfCNvxNH7sDwjmBq5yLQJcL5kWN9z14bXd4zuO308rYMGry1f8am23oX2vmdeb73n5yf1TM/mk3xxu0/lQ/R9OrF8dkoFtips/g1tWcr3TG4yxtX7Eba8jSH+dUcaitshOBGi/4jKtrXXF70AOt6shf0DUUaw7U/ZOX1aRnl1svw4lexpHlhVp5ojrqZdtzaO2lPylLm1VHXh37yR+h+toBu7gRV+QZ30p3/ZBpU5zpVXnazzWv+XDEk0fonMkn9Bgr9e0XefsoX2dy+mVb5bOto3NcafFoztluH9Gx4KU7VP8M2j910wfoXENjnDJ1sl+2z/IBHdrUTb0juubcWR676Ipdv9xT0N1e7F70O1nXF5ljZLuyiviorPNXWY2ZcQVzbSqda28+DKzPhnx+jObrfQJ6lRWBFYFnRiA3FnRuvG3wl5qb1A2cGxyaAwDkQJh9hTkPidpfu2KOqR+B6Sd0nQc8RfzIrX8zAsami52yGufkt2HsTM0+STtGIv7BU8SP3Nv+69iJ0Hs15wa91Zo5bZ6LdT/s8fYB02YZL/2pfg/VVysZMwapYyefPlZ6G32f1JyvdMbjVlobYjNm9Sv9H+qfNE8Z/z2UjJl0jav8NiZEhQezVp1se/RHxGZ5sLevfD55qa3oRRjsLtJVnrz6eek+S3eX+/Sl0p3dMzpdvz1ZtSlf42ZcwdqWPP3htZOoPPU72jEc0/Wu+cB+rzL5ro/nAzq2g9lHWt2Su49yddaWfaFnentybYD69FxMW0nPxk+dMzR2qp6+Gt+M9y00OYC+uXAWyauZbpdzncxc7tpSlnqZ79Czvcd5YJ3p3Cp3vOpDx6f/SRuzbo1cU5D1FuvaR1551vu8EIfKeuYShFVWBF4aATYVxc3lpnt0+cpN6kaumzw3P4cPHwJwOCjvsNrQtpjjDh+3UtNX/e9wdFtlJwI1BzKGGWPpbdiyPsqTkNOebfatmGNVepj4pCXjgiPVv+TrvLah/6RmPpvjiXU/VD51odNeM176lL4O1VcvZ2KX/iW9De/amvOVrjGRJ3bQFW1P1BbYjJ2+QWcspYd4XUoIwk4xVmCNqfw22rIqB5GLlYa/1FxL6Vxrc6Lurfp8yottdwnOCzPPu6pTZV7I7We7cjBf9KXF1LOvthxbnSq3Xbl6Z7H6oJ3EHAM645f3gCpPvtroePQ7+2mnrqVrXfOg8uolqkMudbmjLPXMO3PyVsz+0LP+6u2hflVkjtV355262IavY3Q+VR35rr9tiY6LTFqfnoM1D+Cx08mRkUOitLqZX3u0uSnu6WZbzfVub7oPQWunN5PZv7YzdsrkE9M//IZP/40T6Fqxhkm7pmKuPXTkVJ77+dyQHqqrrAisCDw3AmwkihtKzI23jfZrdbO6eXNzu8nzEOBXAagp62j7imkf2nHTlwc6fYV2DuIQXS/lyFZ5GgFj1WGNL/w2qgh9pqZ+Z7OOPcxe1w36UxTzpfrW8d2ctuH0o2oeJ2auk//dnprti9wb2KzjDV6/qs+j6VUK41AS69jy+lZxG/3bmnGDztglfRRH27NPtd34kH46h5zn6LLKTgQyZtAZT+ltyLtqe+ITPfdAXcvkc83dV2J9NuXlVtpLMJdlabDy2Za0l2z7yCd6SRdtqzzytC2tvu0VO73sI+14ovKKaU9aNG5n0D63oHbtI1/X0jWuez/le7R5M9OxHTQPJ7n8JG+rXubrS+n0a+Z7ytGHT0wbt/qTfaW1AQ8tphxZ+sV6wotJ51pnH3WyfUabNyJ60meRHETXXBS7/lW39qt7rOOP9mXtc6u+/fEV2vmIOa8a17oOrn1F11yMvZBnfX12DLXrHQN6lRWBFYFnRiAvsW603HzbsHupbtLcxHWj50HAAfGNb3zjJzk8Ut7R1U6O4bigvgSmr9DOoeJoWqVEgBhREo1bjSv89sLa2dxbM/0aw755MQ76kLz0bD7b8PZJzTyWzjxPOvdDypPWxol9ob/iawczx5FOvCluxDLnCp1xkM6YzWh0aUu0fx2jrGH6nHNJ+rXj+p7tEydKxitjCr2NKkJbUy9l0tf8oE9dR3nXuaK5Up9LecH10pvopbhi6iSdetBd9ZIOZu10tecY8iLypFMPedY6VvqReklrX5n2K2YcO7rqn+G1g25HI8v1dI1F9788qH7KpFMfPeVi5hT5Rh5Oapff15w9yl9z+Qzqkz4+F7Uj3jK2fRLpn/weveez65VY9bMtaXPmHlhzUN48Zgxljlfb5N1LILLkod2Xla56yWeflJ+l0zdp5yEa2xp/eNc3aWWZS2W/eObn80J6qK6yIrAicI8IuKkS3XyPHlZuVjcvWDe8B4HIIcOHABwUyETbxWqnHhaODY5Jb6Wmv9A5F2iKso/c+tcIGJeKNabb6HCvWm3XseEp4kfu7f7VH32QT6xzkN9Gpyc181c691HSNfcrj642xGZM/QHTb+jXKNpNrOPCp19Jb6PtSXV+iRkr6e78OCOzv5jjNP6kvzm3ofrJcpWx30PJeM3yYBsTqdWYI4e2PelHL1Do5DpKu8YVyROfQ4lebkUvv17M5b1Iyx8h+tqwr5gv4tK0Ja0umGPJ255tlVanouOA2Vb5bHMudQzipswYKquoXkXGQSbWdnht2eZYuZZ7Z0HqVbrrp062ZU6Rb5GnNV8f5e0sV83Zio6DPOnklad/96K17XjpH23K1evwjA7+0hck3hVzDaQr2ifl5Aa8OdKhOZVtysRsgzb3Zqi+/Wd6ua+k3XsVbT/C2k++60fbrL36zJwyttDE3Oraw0t3aA6VPeO5X58b8kN9lRWBFYF7RMBNJbr5Hj2s3Kh5gLvZxXogwHOgfO1rX/vxbDs6PLpDI8cfk95KTZ+hnUviEK/yEAHjAist1lg+yoOhv2XNdYGmrWLqP9B1DMdOHKqfpOADJX2Rrn7Lb0O/rTU+8t3DMGXdHqDd/sa4GVefQP0Wh+hVi+N0mH4lvQ2PntScJ3TGRtpzZ4ZeSsROT1ui4zY+pc/d/EaXVZoIGCuapMGMp/Q25LXSpkw9UfkFXbsZusZi5kM+n6C9tIP18gvPBTqx0+lkexdvL98zzL4z251cWfZPuo5nG3LblFXENjLHqGj8jGdt7/g9e+p39upYuaa51kmnTqVTD9r2Koc3p8i9yFfzM3NY2RUzX7Ejr83nYOcj/iPfm0fXz/Fpk66Izynb0029Snfj6+8M6ZNtlaeN3BDNnUTz6iyaa2f19/TqnoJ374lV52hfqq+eqLyi7aA1ddJ/41Zj3q1dt74pM9fLnvF8z+fFUFllRWBF4F4RYHNZcqO5+Z48tNysuYFz0+eBIM1hwd8C4DDxALatYtqCznGgHR8cjm+lpt85H+eZMuf9VceMiXTG8UkOGPNci45Wb4J1DMcWWZek4d+iOOYMq9/T+Axnpz+JJF41t8/wNc6MUWr6181hqN+9MA7F8ZJWBqZv0tuQP6l1nl1s6lkBz3ki1rNFvuuX9nPs4ps+i85tqF3mDq7yOALEiGKsEo1j4jZ0rSmf0epeMddPOtcXOnNgljNecutFn+dYXoblxWxL2nawq166RXSSzj5p9zl02kqa8ZI/S+ODup0/NYadzktljuG6ud8Tj84G+qa+tPkCL13RHDPnIo+vuTmT2UfU1nOx+uY8jpB+Z+Z45Bd21NEX+Q7VV7fikd9du2spqmN+JNbco01Z0sqeg2fsuIdE93/uy6RTT7rDro96zAW6jpV91HHexs6Yul7w0qxz0t26m+9g7A3P+nxWSA+1VVYEVgTuGQE2F8VN5gYUt9F2qW7Y3MxuctFDIZGDgw8BODiUJ60M1I6YY0Hrgz4V1GfQ+SQO8SojAsaEYEiDGT/orauuwRns+g9ZHSd9SHqovmlhbEr6AF39ld9G25O6F5eaz2f5arMZV5/EOofR5VXLLHaz+G3Dmye1zrOLj2dDYp4hRzT96lmT4+hD45+xBd86vmPId1eMEY5LixlL6O2hStf25NV9hK5bxVxb6cwdafPGZ5MXXdELsMjFuaOVzdDLt5iX76Rtrzize0auLXXlxbz4I6u8eiA2Ol7bILFLfo9Om+jJ7/WhzTFcJ9H1PEL1xZm+eVLRnDLvHvL4UW6mTL1EbVTsxkKmXtLIqv5sLsx11qYN2qVB7Tt2h6nf0drQnjaqrmN3PrpOYqeDLNulE4/yqrYf5aPtM6z24NGt1T03w6rf8V1fZTN92q2pU/02hsadtYOuawjv+lbM3M+98UBz1vucAFdZEVgReKUI5EaTbi9buWnd0HXTeyhU5EDxVwE4QGp78tWmY4npx4jJVmr67nw6fKVwvhuzXUwydtBbrRn7s3S18cDXsao/Q+3yEADfotTx5aufbVyGg+1P/DNG5u8tmP2lGaup1U/9F0eXVynYpzhOxerX6fjVONVzAT7PjVvpas/xjDM45rVFzbk4z9H8pnnKeO+lECOKsUrMWEpvQ1d6huqA15prBs1aKnNdWe+kXX/yBjrzx0uumJdgnmXy0qLyI0Q/qxfvDlPvzDj6nNj5U+1WHl+qrOOxnfJurJmMfrW/MuWzvp085wyda5p01UsevexrnlQkl5CZU8158exnQo6FP8nPaP2p7Tlv6ZyvtG0Vtec8Z5h60kdYfWZs+iTqj366NpVHzzbpjkfW5c5MZj6a41Wva1e3on2rvPLuvYrqzeS2g6kDLZ866tkuVh397mLuGrtm8pknnsWJeX4Pup73+ewYzausCKwI3DsCuclml7NtDHqpuXlzc7vhPbg9sEUPDQ8gD+dEdcW0CZ3jpR/6FtgdJDm3ofqVv7DftO7GNuN+K62NgrlWuUbSQ/1S9Ff+NdAxHFtMH6G3WvdikXl7Kz2zW8cffPVR38Wh8qqFcSiOl1h924bek1rnWmNVzwPPiQ49byp2umk3x9Sf4mvOJefo/If6KiUCxqbGK2PZ0duwU+XI2up6JbKe8Lmu0Lnm5AR8zQ1yB5k55AVY5IIsfSva10u2z0Uv36LtiYxl/zquvoK0VVQ/+6ft9CPlZ+g9vxw3UZv2kxeVJ2b/js75d3SuZ9deZTUn5DN/pDPvyNHkK13zUV5bXT7ujZ39Km0/kTlC17kqV69i2u38zfaX0HVcfRX1u+OVgdLqJ3a5Y96B5lzKkq79s+0edN2HngfKbxnDvvapNuSrnvqg880YGmORNYfOtTdPwLoHyjme53w+J4baV/6uTgxWWRF4tQjkhpPODbmNka/VjZybOze9B0KHHCAcNBwotO8dKPUwYYwcUz/A9O+BTv+hnZc4RFcZ9FetGIfEGrNtBOVaM95Je7hXTB3ptPdA1zHTn6Hypod/ji1d/YPfsjq3xMzTl9BpEzrHLXT6qe8VR5dXKXWc5NOvJ7Eb3mzUOs8aszxfoGdnS54ne3Ttj030kTt2+qSfD+iccp7Qq8wjYHwyZsbxFtzGEKfyqK6jPGg+ZR7UvKr54yX4FsRGp++lOi/ZXsArooMsdTub+kubdKLy7Js2K13HrO3y2IPWbtLK9lA79kte2V7/ri3nfZbGTuqSG/LmSeaIOWRe5XmxR6tv/4qOtYe1T/L0g09MW86pQ/SQJ2Zf6Byr0u4tsbYf8XUs/eh81c8jnVnfzJuac/LoSL8FuudExoSuVfkZn2rfajttZZu2M04Zy7pWubauP9jthXGGc45b8/zP54P0UF1lRWBF4LUicHQ528bA1+qGZnNbc/PXg8GDWuRA4aDxMPEAT0wbaRvaMevhkj4+0HmwQHugJA7xV650642sxmsbsmt13RNzLSqdetJp74GuY+baSA/VN/kgoMal+rY9+HxF5yXWGLyE12ZiHf+BTz+NWeJQe9VS45Zjp2/QW9acG3SNV937eS5Ie47cip43nEX+atLsfEmfB51zyrmOpjfJU8Z5TyVjVOmM5Vl6G5O/VvIGfpZLNa/O5NQst/IyXGnyD5loe+WVg16yvYSTi7WmjnTagN7LfXXVkQe1l8j4e3y2SWsrbe/R9Ms+yUvv9e/ajLPz3MOj/rTb33PCnAAzhzizzL16ftXcy/a0IZ1jOD6Y8j1aO2CnlzY7mj5V3tnJce5B1zGqD/fiXde6/ubxSzD3jXRF7SuHl65oG/Ku2p4IbU17M7rqyos1TrkOdc3Mg8zx3Bt5Zgddz/x8Pgy1VVYEVgReKwJsNkpuOuncmNvQudbuYefmF+vhAJ+HhwdMyqS7vtoV85DRHzD9fKBzHtDOD6RU/Cj98v/NOEhnrLYRgmvNGEvnGsxodRPT7gOd4+rLW69LjiudfkFf4yGd85rFQDm5C13R9oppG9oxC1Yf9V0c6tcch75nYQyL4yVW37ahfK11fnX+7nWxngueFx3mRY92eXXh+aOk3/rWt34axLbjgPqij+n3oHNeOd+Mx1BbJSJgbGq84DOeZ+lt9LtW1ynRNayY6yxdcwveXMn8qRfimlddH/t3fX0OJtbLunzqQFd7OXZH62vtB19tz8asevZN7Oxnu76Ltmnb/tmuLDHj6nxplz6D2uts1f7miDmT50TNsRlvn7ShXbGOK1/b5Stiu8rktfVc1A5Y5+C4KT9Daytt45/8Lb66/hW14Xonmmfm3x7O9oVyMCu2bJOu7codV/3U62j19/A5/YgNNhONl+tiPF0j19D1Nv/zPM7z+oHOs757Lgy1VVYEVgReOwLd5Sw35zYcuFY3tZscdOODeShAe1hU9KCrcvhqox4wjJPj6xOYvj7QORfo7rAxBqP5iy/OtcYh47SNKFxrxhc6Y39E175p94HOcatP+jpUX7U4juOnT9Bb1jqnGgPz8yzW/tV+jh109VHfK44ur1pq7By/+rcNL64151jnT9ys9SzozgsuKMi9qMyQi82f/+Y3/9J3v/vdv/Mz3/nOz/qTf8dwTP3Rx/R70Dkv52oMRvMqJQLGJjHjlvE8S29jjCc/9Xe9QNewomuc6PpXzFyrOVXbzL/EpGt/+Ly8+zxElnTqJN3ZS59mdO2HzfTFsSvm2EnbN+1qcybL/kmn/hnaOaJbY21bh9q2T/KpTz7A17wwd8wteOmKqSud6Bg57h5dfTnLV5vGrMrh9UmsOo5Z59Hx6KZ8RmtTrGPKd34rcx3F7KMsMXMvaXM/ZUnbLtomLyoHlYG11nb5qief7dB7lT5H+sREG5U2XsYSZI3Eur7mf57FnNVR6xmfz4J8Rowuq6wIrAi8VgRys9VNmJt0Gw5cqxvbjQ7moe4BXjEPEGgOFg4nsLbJVxs5DnT6oF9g+vtA53zqXDMOQ/0rUWoMMj7QW9aMbcb8LJ390+4DnWOnX6P51X56je0sOS50+nRTPGqO7vGz+GW8Jvm8NT7WOcC/VtF2NyayjN82+Ec155cxqLGq+99zIdELyh5yzvyVn/qpv/pzP/dzf+/DKLz8I9OO4+T4+qWvMYecW53/UFulROAoV2q+ZHxn9DbGuHwAILpOousHuq5JK2Ptoc2BRPOjw73nlvrqJGaeeun2gp68tBd4+cS0JV3HlgfP+sGYe+PqA/agHTtpZaJ9KlYb6s8w55NzqvLksZW6lU/dPdrcMHcqmnPKu3wz10Rs7o3ZtdlHfzqkX9XrbN0qq2M5V+fT8fRJ+Uw3bXd+uW60JV152qxpRxlY8xDevE9Urr77Quza7V/b5G3v0HHE1Mn+Hb3Xx7YOMy4dnTGEznXKtTX/PYM5m5uaZ3o+P4fqo+Jz45FwMSsCKwL3i4CbLDdiblDoLaub281eH3L1cKiHR/IeYimrdLVXHyTph76B6fMDnfPK+UoPta9MYc4U556xebTmGdOMteveYdVLG83a1LH1SdTPi8Ov9M9ePLYx5rXmXOo8a26e4TN+2ssxmnjhy1HMnM9QfdUPURzHtQKrb9uQXWvOzfkag4xX7vt6JsB3F5Uq4yf8fM3/57/3vV/kxd/yjW984yfTZo6lD/qmvzmHQTvHnLexGM2rRASMESJjpCzRmB7hNuw8qq6R6NqJrmlF1l1ZzQF584Tckq6IbpUlX/My+e5CflaWdvRPdPzkq758Hc+XjipPnr7waaPKks++HZ262qzInJA5t4p7bUd9qy34XFfzQTRvzmA937SR9p/jX/qoTWVpO2naZ/WMnuOAZ+Y+07F/2kt65mOVd2ueeYN+8tKZg+Z7YrZL0w6dKK288l1fdGq1/1l9+6sv1vHVS7m6xmIPjTdrk7Rrxfp6zoKewWA5p+u57tk/1FZZEVgReMsIsPkobsLEulG3oXepublz0+ch78EgemjM0ANq1o5cW2KOd8MBxBxybjnnSg/VL7IwT0qdb8ZlG+3XOlvz2fojr2ty8GBgrBy/+jaaX73UMdOfbYx+rcZjNv+am2f4tHUiVviS/kFX/+VH06sU7FMcJzF924bOtRo7MOdcY+Q+B7tzYe/CQtvsxZ8PAPj6P2dOteuY+qJ/+pzzGLRzzHkbk9G8yiQCNV7JG9Mj3Ibta3V9RNcNdC2P0LUHU1d5zRX5rh2Z7aL5Ci8tchmH9lKe6KVdzDb7aUd0zETbZph2cyxoa+pI79nLNvWPMPvMaGOY87uFxu4t+qnreouZK9DIq0zePhXTPvQt/mGLPmlTPhG6q3Us7XW6OUbSR/PO+UvbJ+10dOdHJ3MeYK3oVxl85mLmuPmfstStdOrbln1tzzZodURl6lVeO1U/5fZRR0yb0M6/i0vKjLVrAy+da5lnrudwnNGz89yzf6he7hHgKisCKwJvEIG6+eTrZt2GL9fq5gZz0+dh4AEBeoBU5JBBJnJh52CqesmnXegcEzr9ST/T/wc65+i8xaHyxR9GzJXinDMe0Js145jxha7xT17d2bpoPzB90K/EofqqJcdKX7Yx6rXO4pFzhzY/K1Y9eeMl5jg5ftDpI3T6D52l8tn2Elq7OXb1axsDXGrOyXmCxgCsezz3v+dFXlCkvdTUF/+/+wu/8EtUf/IP8qsA9kv7jq0/+qjfzuMBnWfOPeMx1FaJCBgnRNIdGtc93IaNR9U1Al030fWsmO117VPXtporyUOrl1h14H3mmYOg+QvOqhd927Nf2jpDVxvyomOJyJOGz/Ernz5kG/RezX6VNpbIpc8ia7Kna7trd6SrHkiuiNK2V145uDdGtp2dr7bpe2S/s3nUJ+06Fsgca3VvgbXNPmmjo3O8jId05gey5J1flcl3OUh+1zrT6+TK6j6p8hyDNvVF9WeoXtqptHbVrbaMwyxOxhjs1sY1dG1db8/hOJ/zHO/O+6G6yorAisBbRoCNSOk2ZG5Y6C2rG9wNPzvgPTTyIKm0hw9yaP4atzKx9oHXdj2EOIzSL31N/x/oOscah6F2jQ30l1bqfOGNyTboazWGYMa2W3cfBom1T9rLcQbt+GD6N9gLD75myTHTl20Meqnpe84r5wud+Vlp22sf+LSZYzl+YPpX48U8KM7nI3f/f7VfMX3bxrDX6pxynhmHGqu69zkTauVig4yLjl/154Wfn/L/O3/9r/8t/uAfL/z8zj+Vr/6njRzD8dMnfNXvnMugnWed/2haZScCxgsV6TNovMVt9L9U10fM/ILO9YQ+aq/68OaGmHlTn0mpA1114clBMfOxXtTzIt9d5unrHkg70t0YtmVfx3UMUfkM00barfSsfyevfeGNYdLKwC7OrkNF+9nHduWJs/HUse8taN+KjiXW9hnv2LbDSz8HZ/07ObLcL7m3kHf7jz5na/rfjU878TJmidKpoy55B93ln7KjPUB7p6PMdnnsSmdb0qmjH2dQG9nfsbK/80/s4mPcu3Xq1tuzF/RcHuhZDXZn/BCvsiKwIvAWEWADUtyISSvLDQu9Zc1NXg96D4V6YHiQJHL4yHsQwXNg5YcAyFLXPmCO49hi+qbPOY8Hus7VGCQO1S+yMEeKc81YbEN+rcYvY9o91I19h9lXe2COM+j0Qb8Sh8qrlhxLX7Yx4rWm786pzjfzco+mH+3ZX5tgjpU+PND6J6bv0kP1WpC9RtGuY+qPuI1BL9X55Bxz7hmr3OeeAZ4TiVxs4Hmp54/7Uf/mt7/9t+G7y48XobQBnePph77pr/47n4HO0bmLo2mVJgIZH+mzaKwTtzHGtbo+oGs2Q9a2a6trLg+aF4ld3mS7dOpVOnPR/BTrpd6cFtXDBrQonbalbUuErrWOUXnHmtmtcvXrOMnbp0PihrzGD944vwQ7uzmmPs30qrz6UtuTn83rFh3How909n0t2jHdJ3t7Sp3ZXtLWDM/MyziK9Ml1k66YOXgrXfdF118dMKu6tsMnbfsM1RVneimvc4c3TjVPZmvhWuZ6e/7GmexZzRkPnWf9YFdZEVgReMsIuAEZUzrRDStuQ+9a3eBibn4PhO5wr4dKHjbdYcRXePkQIPU6G8jygEof0jf9BXM+D7RzFTMeQ+USp0ToL6HkPKGdP7hZM3YZU+iM9xHtOtEvbTrOA6YP6d9ovq4D9GuVHFNftjHYtep7xiLn7jxrbiqvmH2h065j5fhB6x+YfksP8VUO/RrFsRLTr20MeqnOBXSOOfeMS7fX6znBhQYZyFnBSz8/5ffXiPLC09HVXo6pL/qnv87BOQ3MuWYMRtMqJyOQcdujM9bQW62uj+i67aG64EzPPBDND/DsPs/8kiYHoWsu1nz1cg9a0VFe9eWr3SOefujY/wxq075H/J5Nx06ENl4zzPV4Cd3Zdz4ddvrPkTlH8VYbe3k4s2WcZu23yLHl3pjtIeTqqK8PR4gvqdP5ZuxyndDr5KlT6b38PNvmvnSvJo+NlEtrW135e2Kda8YmY5qxTtr1E3Ot8xyNc9kzu57rQ2WVFYEVgbeIAJuP4iZMWhnoZhW3IXtUc5Pn5vdAEPPQyINFOg+eSntI8RM8LvN5iNs/MceC1gcwfUzf67wG75zFjIv0UPuiCvOiOD/nDm7WjFvGM+M8o1kn1pC19AMdbWjXcR4wfdCvxKF28Re8d8lxoPVlG/Sl6jPoPHLumYvkcfJ7dNrQLuh4jh+ob2L1XX50ucYL2b2LNh0P1Kdt0NfqXHJ+zjtjk3sb2vOgohcjLkxnX/rtgy3otJnj6o/+6bNziHk5VzBjMNhVdiJQ8wbVjN8ebcy30edJdY0quoai7fJ7aB6I5scM0att5BeyzDPpzENz01z1hcAXhUR1Eu2fWO3PePdE2pvJqvzMeNVu5fVL2/KgsaponGvMXStRPbDqZht0juHY6UvSqQutfpV3/C26Xf8q0/eKVQ8+59y1K6s+OnfbtUNMj/YQ7ehZ7XuE6a/jdpi+dbSyW7HLR2zU/K187l3acu92bbV/5avftutLtmdbyqGJnVjjyFogq2vimom51p6l5Tz2nF7PxhGYVVYEPocIzC5WuVmlt+HwtbrJxTwAPBTEPDzqASPvAVQPJ3kOMH6ix0FJn9TXRmKOqR9g+qnvYM7tgXbe9cAiZpSM3UfJ+/035yKd89/G1C41Y5axzBhD++Bg3Xjh53ex/f1rZLO1cJwHTB/0C6SIH7nX+dcx049tDHWpxqKLQ+YfNHM2P41N1ZGvsdS+4zl+YPoHrd+JQ3yN2UyOznNL2pROv7Zh+FKdh/MCc87GwTgZN9DzIJHYUr1Eyd+Cac+zxXH1Rx/123k4rwd0zsZAHM2r7ESAOFGM11k03uA2q67VHrKutku71onmAUhuyJsnZ9H8Es27mos1j83zGVb9ylf7R7z90YOuaLuY9tRPWe0vb/8Os7/x6rCLfa7P3pqpJ2Irx0gfOjp1K40+MnHWvqdT+8z49DvjMdNHrt6ezpk27RDD3DMz2liL9E9ae6K+isil0z/jnAh9z5q5Ld3lbsrYs1bksz1c5drXf3lR+a1IzOiTsZM25qBrktitqecnGGdxntF5rg+VVVYEVgTeKgK5+aApVZabVXobeo9qbvR6EOQhAZ0HiYdLogfQ3uGFPj815kOAPPSQ2z9t5pj1AEt/nUed3+Cdu1jjZPyG6rsvziXn6LzBzWq8wIwj60z8eXD5ws/XsPnDa/weth/emBvZF1q7jvOA6UP6Jj3UXq04Bph+bIO/VH12Ls6ty3m/vZI5Ck1uipmzaUv7jgfqwwOmf9Dpe0cPlScfBqQM+tbCOJQcL/3aRtulOg/nlXPNGGSsurOBc4BKznU/9a+XKHn7JWIf3nFybH3ST/12Hs7rAZ1zxsHYDJVVJhEwXjRXOmW2icZb3Ibyk+paVWQtkYldu+udaC6A5gdY+WyTNrfgpSuah+Zl5qr0Xj6ro53MbWUiY1c6ZbZpI9FxZjjrqxyc2Usd6RqnyhtjkLVwPcSU255oe9rJMfRjhurSLi0qs69yMduRydt+C1b/5bEBXW0pE2s7/Bl/6J/xzD0zo1O/0tjL2vlle20zzul3yjo652m/quc4VS7f7QX3qtjpHMnSvvQe6qeIbs5PeZUZT7GuSbeOnpvd2Ttkns2g5/YgV1kRWBF46wiwASluxMTcqNLb0H1U3exiPRDywPAQEfPQSToPp71DjRdJ/op36tQDTLuOCaZP1V/nAZa5GgMxY5X06HaJJ/geS84F2vmK25BdqrHKGBJbXvp94fe/WAP5yT8PvbNr4DgP6Phg+jjYV493jqcf2xj3WmssMscy98hVf+XB3KyY+rNYOV6Tp/ikj2L6Lz3UpnGsOuqCe4V+FPuL+gFuVudQ84fYZQxqfHK/Qx9dlvKiNaOrjTqGPuiX66vvzsW5PWDO21iIQ2WVGyLQxU2ZmPFOehvjXKtr9Rx0vUFyQDQfzI9b0fxKJAfhay6eyfkun1PW2ezG6mRd37Td0fahTRqUFztZtmXfjFVH5xq4PqJt8NDKO9429Oo46U/Sxk192qQTq1xeW6l7C62vzjN57CjvbNomdjrKqt2U02bs3Ce5f5JGT94+FbWnXzm2MsfvMGNre8qMuYiOdKdnu7bksw+5u1d9HonqVl55Yo5TaX3Sb/lb0JiyDtC5Hq7V7AzN83bQ+dyH9rwGV1kRWBF44wi4ARlWOjEvT9Lb0H1U6+b3UBDzwPAQ8VAB62HkYVUPsxnPIel/3YWt1Ku24XPs9E1/wZxTne/gjYWYMUt6qL7bwjwozse5ittou1RjlfHjAfXz3/veL+b/q84asVb1IeIaZH9tgo7zgI4P6lviEL9ayXH0YxujXWr67FycW+YcNHHgA5IuP81RMftqT/s5pn4E6mNiziHp0e1JPKsM3kLfvWJ7jpF+bKPzpToH5+QcQede45R7PC9DMzovUtLirA9j0OZY6YN+6au+Oxfn9oA574yH9FBb5SACNVbwlER1wIw59NZV1+tWdL0TzQVz41Z0v2eeVdpcFM3PWQ5Xec1p7XTI2CnXF2S1Tb063lne/iB9EpO2LfX1JVFfQdfB9RFncts7tE/ad9z0CTrl6qsjX7H2U1/UZu13xOM3OvqfqDwx6eyLPKt21JdPzDjW/ZJ80vZBJi2mbej0p9LGs8rh99psz7hro+vXyaqNs3vhjJ5+zVBfZ9jFbSYz3sY/1wl6dnY25209kz2vh+r1HIdeZUVgReANI+BGrFg37DZ8elTr5s/DgQMjD3AOEmQeKGJ3SHmgzg64Kudliq+W+7XqbO/sO7Y+dYdbzq3Oe/AZmxo3eIryj9z7+lffxZwv9GbNOLn+PMT4mj8fAICsT421MRftC6ZNx3nA9EPfxKHy6sWx9GMbI16qPuc8nJv5Ri5C89P/vQ8AMmftm/HLMRxXPwrqp6j/ezhMPMpddCn2+cj1/1Zd+4D6AG5W/XdONWbMO+MBzf72ouRel0/Ml3zpDpVlX2hti+mH66K/+u98nN8D5twzJqP5VFzRW+VXIrCXZzXXMvbbMPGosl7IRNvlXc8Zuu7mAWhunEFyKvXkM9ekzcOK5mrN3z0eG/aDZozEpGubPDq17o1Z2+irD12b7bbVseSNT0Xj6prkGh3R9K062gPrWPoCGp+qs8fXfsmn7aRn9vQv/T1Dp73UTzm0bUkrSzR+uUekO0R/JtcWmGNIVx+fyxt3+8uLyo9QfTCruXwL2j/7KEvc84k40W68Kl/bUg/a+Ls+3Xno2Vkwz1/ofP5JD/EqKwIrAm8VATceSEkeum5a+K3WPAQ8GBI9NMR6qHQHFgca8jzYKs1BWGX8KgBfOa9t2qpjpS/6B6b/Ob8y9xqfGr+M6+j67kr679xyztuY0aVmjIwdseXXMvi6P+uU8e1o+4lp03EeMH3QL3GoXPIYfI3iOKB+bIO+VH12DjlPc40cNDbEp+bkjLd/2nQcx9WPgvqZmPO4lR7mrzGm76zYpv0cfxudLlXfnUvOzzlnTMglL0G5/5V16Mt9YtJdH2U5BnT6on/67Byck3N8wJy/MUkcao/OYHlwlXkEap5lTKEz7tsDD95cXdeKrrt5AJobe3ikR67RP3MOuuZk8uStfNLKErv2tC9dERudrNp2D3WIbpVXmXyHyGpNn6CtrkGuj7FXho6yTp81tl27ifgC3/mkPDH7VrraOOJrf3PGeZxF7HS6ynOcTk8ZcarV+OVemclSjh35tOlYYvomnWui7FasNuS1U3nliehYuz1Hm3sh6dRNWluJOd6MNlYietJ7mHF3PVgTzsET52iev9D1fIZfZUVgReATRaDbkHXTwm+1zi5CHA5nDm0OndlhlYfbHl0PRv6qPLXKu3Hy0Ns75Jxnnf/ga5y6WHrAiaPbuyjdXHK+25jFpRof0LUHiW+N64zPftDadIzA9EEfR/P1pRT6tYrjpQ/bGOxS9dm5OFfzLHPQ//0gZdDkepXBayNj6jiOC+pLwfRX2rmcwWHuGt/UR25BTklMXccFN6u+O5caM+ZrPIhN3dfKkHe1vujDdzL6Kq928vzRl1wTfXYOzqlZj4xBxkZ6hGUav9RB76taiAMlsdLGCsyYS28PcvCmmmubtGtvLoDu1dy70rbLH2HmHXTm5FmavD6r242nTBvpR9K01z0kv9emf6K6jncG9VHMuObaJI3O0Xpku7bxp86781H9RPvaX1Se2NlUljahc75J3zpf+u7ZS9vQGZ8cC5q9IbpPZlj1Oh4ZNX2ocXgt3nXZs9/puF5n0T0g2q/yjiVWvzJGHV3j6Foa48Rcs+bZlueoz3jPW9CzOM9m6dG8yorAisBbRYCNR0l0M4K5cd3M25Bfa15+oPNwgM6DQ7oeQPWwgvcgS4TO6iEoZhuXeP/CfMqhu/HSJ/0Ecz4514zBA52xyhjW2A71d1Wq/zUvtjGbS834ZNxmedDFOWOe9hzjATPW0LN4j6a7l4xH+rGNkS5fH677wHmaY+Yfecuvq/grAJmnuQfUF7Wj3ZMxu/g3fEyf9+ga044f5q6xh64lY2X/HHMbHS7VtTZvnJtzNR7u34wVNLGcVV/oEyudfGenjudagPqoz916OM/AjAO08elwND86o+WNL/wq+zE0rjXuyW8jiKerOZtY8zdzAtpc6dB2sdPJvJOuufkSHpv0T9tJZ1vK7Wd7+sB+kk86ZbM91+nbr0N9ErsY1jVJXv1cg6Rt137FzqeUpT5y+dSptDpibU876uinmHOc0akrfQt2dn32uy9uxbSZfVMOXf00DhW7WKFD/8Ta7568PnTr+BzZGd9qfGa8sUyssXYdPPcmZ2aeqx3teSwOM6usCKwIvHUE3IAV66bdhmOPqgeA6MEAcmiIeYDMDp7uELvloPSiINKXr1bz1+a7Fyxt57jpW/qc83KuNRYPfMasxnOoPLnEI3sPpc4l57mNCVyr8QEzbl0uZIzNl+yTtnKMQef46dtousYY+jVKjqcf2xjoUvXZeTjHzC1zjr9TsZefeRmwj6g97TseqA/61KB+n8Gc74weQ1zjjg5lpuuY29C5VP11Ds4JZJ7OWcy4QLvnwaz1pR4+ZZWnb7anLekcW3/A2Xo4N9D5BhqLxFncOvkwdY2zNPhVK8RmVrq4ZbxvobcxyKPqurrOXQ6bxxXJmSqDr9XcEjPvoMlJseanvO2J0rU/ctukZ2jf2u647Bvo3D/KlKvb8dl2ltYX45VYY7vH04/27C/tGIln/UOv9oPf65/60urLi/oo7s3R+aUO/eS10aE6M2Qv0JbPpEq7X45QO7OxOv+Mx1msNuiHLPGsrVv1zAnXtENspvzMGPqPrvMjhtJgxrTy2ZZr5Hnn+fdwLp49S+uZPLo/eo7Br7IisCLwyhFwIzKMtFg38zZ0rjUPAOg8HKDz4Eg6Dx7ovUMsD7uOzosE7R3PV6z5JkD9o4DduOlb+pxzy3lnPB7oGjNjWXGov6uC/xTnkfPchvxaMz4ZN+mMK7Tyimkn7T/QOb4+JQ61VysZC/3YxmiXqt/Ox/maW5l3fEDFH0ecfUBFTqMvSpvL2NR+xlIfQP1qUN/PYsb3DD2GvOSLSJ8caxv8pervLGb1nKhngS8XHeYLvS/8e4gN+1R7ddxcS9f3GeuRMan0mTijQ0ndj5Kv5r/GI2OSNO3EWawxP8Nvo/+jWnPYXAYzJ15Cm2N1P3gumI95XijrMPVm9FE/27v+yO5R2Ydn7egPmPGCnsXeteraqw35HCfp9LPzO3Wh0Rezr3TVP+L1T+zmtDffTj9l2E2+o7Uvujc6RAe5uonYhncM2+QrOufEo3jRnvozWr3EM7Y7fcaofV3vzAd05Kv+jE//0UlemrhB1/h1vDFPrOsYZ+HR2ZnPqEoPM6usCKwIvHUE6kbsLkbbcOpRzUMgDwfpPEw8bDyAKnaHmQdfInStPmRF2pPmMs8HAHzVGrr2r2OnbzkH5wXm3GtcBp+HYI3taL5e1KHfS6nzyDluYxLXmrHJmEETzzOyF8SYeOLra5aMhXHYxoCX6vydpzlkXplv5CEfTvkBQM3LjqcvHxZQtQc6hmPW+OGT/jXoHM5izj/pYfoa+5Qn7RibftR44bvzcY7GDOziwn7var7o0578Ea1+Zzd90Dd9PbMezr2gsdnDjGWlh7kn8U8Z9JdWiMGZUmOVvPFGBi0mnbJt6Dyp5jGY+zBp8/q5mDlm3n0qZA84dtLKxNwrr0k7npixku7inuuTZ0+nqx3RsRLrHDk/qkx+r586YOrNaH1KrHNwfs65tu/x2J21ay/RfZD74iyddhgzeWhlM38yBknX2NGGLHWSxr587bvXzz5nsLN7Rqbtzg9lorpixs14pixpY1/XrjkDPUf3MM/dYeLR8wp+lRWBFYE3ioCbkeGkxbqJt6FzrfUw8JAQ8wCR9vBJnB10PvTyIbhH50M2afvwwsSLFi9cysBu/PQPWv9B5wcag4zLA11jZ0wTh+q7KfhNSf+hc57b4K/V2IAZM+kaS+Vi9odO24POcaGrX/AU8SN3n3+1CaYf2+Cf/P6/uWNOZb6Rp3woRV7yTYDMyxlNn5/5znd+lm8AaPNMjhpPfLyh5vw6mhjcUtPG1Q99c+1rzJhfxi1jQzy66ss9bdK3on2r/RwfOn1zTZxDzXPn2uT0NR4jphmnGX0U92HmujbQX9VCnCiJs9gRa9uSVgbmemyDf1Jzjc3pipkfR7R9U888q3sjc7Gja7+9/lW3s1dldT+4Vzo9ddVJRH/Ga8v+8mL6nTFL2piewewHnfZr/PS5+q9c1Ff1KnZzc6zE6gt89VfeuSYvLVYd5UdoPzDzX5p94pmnbA/TnjQ+QB/5ku01PsTZ+EmnTvaVznb7iNpKnbM09qsudrta9Z7DOx/RuHaITsrrWpVzL89Ez03Rs7PyyCniR279uyKwIvDmEXCTJtZNvQ2vrjUPhDwooD1gEuuB5QHaHXYp80Hog7Mil/OUJV9pf9rKfxGYfaBzTH3T55xHzjVjkLF5oDN+GddKD/V3Uarf8DnHbfDXmrHJmJ2hsy902n2gc1zo9G2wr/pQybH0YxtjXqq+O09zx1zKPPv617/+x/n9//wAwJytaI7yQQEfGtCuLW07Fuj4oD6J+jpB5nSZS0Hn2mHGZEZnv6t9fQL12Xk4L+cJ1n0LTyyy8qIPf+sLf6evnbQPXf1IH/XbeTgvMedcYnyNy4M8YzajZ/FWPky96f5gvM+9GJsZEutZG/Jci23wT2qucea2OZDofhWzLWnzCSTHRPOtIjmJrGLVSz51pWs78udUz7Bb+tqnYmcj/cxYdbRxpU26Q9s7G46HL9DVp3pGJI+uc6r9Ot6xOux8S1nOy/mkLOlsl9YWeklnP+ma9/LdHkFGe7apD2pTrP5UX+QrdjFThi507ZNydW/BtGe/KpO3PZEcSP6I1t/US5ljicZ0hujRlushnev1QOd5eHR2eq6Ortd7GjJL0soWrgisCNw5Am60RGhq3dDbkF2rB4GYh4gHTGIeStLdQ06ZD8Z8YO7RXshnaF9+asqvAvDCVX/n2rET9RXM+eR8jQGYMRp0jaGxFYfK9QCEfg9F38U6x21M4lozNtAZtxld+zRxxX6Oqy+JQ+VVCmNQHEs/tiG7/vQ/52rekEOZW9B8EEUuUvxQau9FkxdU8pcPstLWmTwl3idje5kL85lU59yhcRE7nUd29cl8MF6g88q5upfBGiv4W17+OQ+6l/5O1o2VvqSP+p1zcX6i8wYncX4Up6HTxTJlxrzD0f161tBuSVrZl4jO09g4x+Slz2LGfhsGn9RcY2nXH0SW/C105lbulaTNwxlWG7Vv5bGTeT6jz+rN+ndy9lon7+ZW53U2rnvrUW2ejY1+17NCeTcnZbO5Ie/8YZ7Iz853T7dr62Q5ljnOXpAGu70xk2U/6LTv/PCj+qJsD2fxPNMHna6/Mm3M1sb2PbSvNhOzn3opq/RMp8Zzj8+1mK3Xg9yzkLMT+uwZqt7ossqKwIrAW0fADVjRDQ1uWfNQqAd0PYTg8xCT5gEH7YOuQx+QifkQheZSfiSrOv7RtZ//3vd+0T+k5hjVD/0Vc355cGZMMlaDzjgeHYxD/bMt5Iclc6XObxtK15pxkc64VVqdxLQXdI6b/gyV9kUH+T1KjgWtH9ugr5ce52W+mD+ZX+Tc3/z2t//2x9f/+QcAvniib+764VXacwzHFPVFzNh2NPM4WZ37LfjItuPrG6jfzifn2O114yN2L+/KfOHvsMrsU9FxxPQpfdV/5wPmPJ174h3iXvMz+WH+0d7INmjKWfyo/WX8W+NwC5+5v41wPKm5vkd05scebS5lbt2bJn+1KW1Og5nr0NmWdNXr+NSX7vRSph6on4kZP+Twom2sB/Teuqgr5hjQ6Uf6dwuNDfS1lXQ3P3xJP/StovNC7lyrzr14x0rs9kPI2DvsFxH6WtNO+si8O155xqXSXSxTB7vySSsD04brZXu2KUtftZky9JTb5wx2Y+31yzGhM757dK5J0K5Znn+3nJupO8yusiKwIvDWEWATUhKhc1O70bchv9Q8LOqhUg8gD8jEvQcjl2naE/OCPaO5jNMmHtG+ePG71Fzwc8zqX/qe88u5Z0yMU2CNZx5+GfvR5bMv6a/zyPltYwaPasYmaeOXskpXWw98jqcPiUPt7kX7GJbWj23ILlX/nZv5Yg5lbpF3fhuFDwG+9a1v/bR568uliBx9/17A7IMrx3FcUX8q6u8eOrcDNBZ7SIxoB68fljC2fumv8wCNGTHIamzE+qKefH25h68V/aqXNqAdKzF90lcw5+C8QOcq1tgbnxPYxdrcPMJh/tG5L3/Uz3b1wfdamItF2vndinUttmH4Ua3rfJbv8kRZojmmLHPNtg7VB7v2Tpa5fQ8690vuoUrXsTrfnE+eK8o6PFqHrk+OW32qfJ1bbd/jHQcfoDtfUnY0lxqTyqets3Q3Zs39wnd75fpcUDftdr5kbGiXfw529qtN1ulW29pI+zmvjL+27SMPZv/aXtts7+TI6vgz3nUoWNcu+TNn5jDXPneQr7IisCLwxhHoNm1u6kcHcx4W9YDJAwu6Pth8ENaHevJcpuHzUn2G5kKunnRF28H83Ws+DEA3/Ui6ziPnmTHI2Iw13EqtMa1xZ9mVQX+ORf8q1rltw/lrzbhAdw+hToZu2nmg61jVl6F2fcBA37PkWOnHNga5vtCaE+aJ+ZM5BW0O+jcA+Fo/eTir/rqAv/+f+axtxwIdv6L+JdY1mvHM86BmXJJ+0s8x0g99dR7OC8z51hj5cl5f2OXzxb6++Hc8/eyjjcQ6fvqWPjuPuh45Z2hjkXgQZ+OZMZbOPK30MHs9Z2Zt6hxh9k9d6PdScg4vpY0/uN1Sc91vpWe5pFx78i/FukczxyuNbpXt8eydvXbb9EG8dU7GZIaune0z+44v4h+0fh5h7SdfcTY+cn1MrP7T1smyj7Rjwaf9mdx+oGM06J7IPZL0Vvto13HPoHFDF9o+VZ5t6lRUx74VHaPK7ae9nId0h+rfGxkLm92YnaysQ67RHn10dg6z13sZupQZfmxd/77bCLiwbzmBowQ8046/n8L3t4yTYxkP5ywP5kbfBn+teWDkQVUPwe7BlxfjSnOBRuZFOmllFbmEIxPP0KnLT1zr16+rX/I5nzrXjIPxyZgFnXGFzphLD/FnnYP4SdFfsM5rG7JH1bjcgtXGA1/HSj+kh+rdijZBirx+bEN2qc7NfDBPzB1zydzma/zkIJWXej+Iqi+X8OjyKyv5TYHcD2nb8UT9SNTHI3ROFZ3zczHt6YP+6TfovHKu7vOMU76cS/sC373gP0emXTHHr/7pN+h8nJ/ovBMzLtInYmwuVjRXXwOHW9dzKu2nHPpzLvidRT7ncytd1wB+u2clL7Rnjogzue0g+SZK1/bMyaTJXXhzuKK5nojOHp9t0O4ZMdvrePD6l3SdHzo5R9tTZuwSs90+jid2Pu3J6Ddrr22OkVh9qnz6L506yJJPmnGSP6LTlmMFdnthT7aNvtf94tg59xlNPGdtR/KzfXPNsGk/cTYO86DN+YARo+taqDOzM5Nr3/6OU3nlFdOXQu+tVbbNzshh7tEzouORrfIOI8CiUxJvSYSPvW//d2+86s+t/Mx/5bd7+/n2mMUxN/b1MB7T2KgeHvUwysMROh/aPtTzUpw0l2f4xHqhPuK5jKMzw2zTFi8BfqWaFyt/r5r29E8655TzrbEwRsasYI2vuZU4ulxfNKE/hzLLF+R1TtuQPanG5Qx2/R9kOVbGLP0bqncp2seYNJg+bINv94U5Yt6YR+YfL5K+RPJtAH7CD59y+C5Pu3zWvui4ov5UrPnb8bM1Y+631rTlWOmT/joP0Jg5b+NmvHwprzh70Sfe7HdiTuVDGD6AofJrQVTOhlqR800N+mAj/Ugf03fnA+Y8oZ1/YsYn6YM4Z04mnXn7WvRw7dE9AP69FWOj3/CURHX20NijI524DfknrZlTz6HJ1ZrHHd/lu7LcE2fozn7umY6ezQ3drs11oU0aTN3s242Jn528k92imz5Ip49naPvdC3fGzHy/ld60m34a9y6O95QxZrXXydDJ9Uva/um/tHNLtC0RG/J79tQRsSvdYY57QM/Wbe/sy7Zh/np2QlvQWeUdRsCFy0VOmimlTuXP6tbQpM09G9n2Urr6Lt/Zta36/bnzzkX/5evG34bCpeaB4qEEcvhlrQ/0vAwnzYW5Xu7zEj2juXTTditmH237R9X4ACD/KGD6KV3nlXPOeGScjF3BGmNjX3F0e7KnkH3Kgo+U6mud0zZ0ntSMTUd3fUJWx6g+6Nvoco0b9K1Fu/STTtSPbbRfqnMxD8wNc8YcynzPl0doX16V+0EAyIspOcrfDFBu/pvLYI4D7fiJ+raHzqOi86xoHI4w+6VtfdHPnEfOz9iIxiyRl374fPnnZZ297os+L/bsd3/9gtjeWlgL7Lke6WddC+cFOlcx4yCdcar0TozNy4qZu29JD1dftA/p/9bF+DAuNEXZrVjXYcZvY4ysqac8ZdDKj9B+6p3uS945Ts1B81Q0l/ewy330c2909MymY4vVx7O8czyDaZNx4R2/w9SXtl/2ta1i6tp2xs/QOb3e0Web0fgwa3uQm28V2TvI3EPSVW97sHNF5y1mnJElb7xS1ulUPXUcQ77qpd092v5pD7rOLfmqe4anf7Vb++UYJ+i6HnW95M/gGO5S0K2lk1WdxX8GEXChcsFxK+Uzfq9PtiVdbZ1tS73Xoqtv8nvjofM5FXy1dH7nAbANxWvNgyUPv3xA1wd4XuSlvRx7YUYufRbz5Uf6VmQsLu/8VM/LPy8GyPS1Ys4v5w2dMclYZQyDzjhDd2vhWtk21K77DvpTFf1JrPOB3/aqMdrTeWjTVh0jx4emiB+52/+1f7Utnz5sw/yjT9zNAXPDfDGPMr99iRV9kQSTpp2fOJOj3d8JSJvQjpWoHxX1cw+dU6Jrl0gs9mrqpq0cW//S95yfsUo0XqIv/v6Enw9P2Ncvedn3fOgQ+4ydfnbr4NzAnDN0xiPpjJn0TowzNytt/p7F2h/+TN+hdt2D6L+H0vmprENkL6ldbJ8j24YfXT1jq+t3KDMHxcxV6ZrbHe8eSMz9obz2dQxRP0Tk0mdxEsMnscAeumft3lPvhI+s+ROfh8xcuLQ5B3XlReXPQMcB2RvimX2SfaG3rDWOrr1rnZht0vZXT945J79Ha+8IOxs5n0rrB3LpzkaVVTvP5I39NvpLu2aVVz7DYWJ69tNnlXcUgbrIuO4i1rZb+Wqr8tqbyW2vaMK+FKvdI776ucfT9qmL88EPaTFjt432a/UAygOwPqDzIZ6X+ErXy/IZnks/eomVzheDqptj2A8ZLwr5csCFHnn1GT7n111SMjbGC8w4Bp2xlnYdKo5u17WSBt+y4BMlUT/1P3Ebuo+qsRBtr7zywLQL7bgVR9Ol6KP8EWoHPenEOv429C4V36mufe4J88VcqjmY+QqdL/6+0CInR3n55KfYtQ982p3lrj7oU4fpe6Wdn+i8O6yxqTraAB0n/dHXnFedt/FJ9Cf97OH8Hxa6F/d7yviAJn2Vdh5gzg/aeSdmXKRr7OSNccGap5XPnE666p3hs/8ePVy8nhnQn2thDpQOZ7K9eWcb8ZSXTjyK9zb6H+nUdscTa7u8tsFT1RwUzdVE8rrymetn6bSRtGO/BCfzzbicisfEzs19mQu2xB27+Ih9fa1Y2+Bfq9axzbezWPs/8fPMGu/lBm1nbHQxqv3O2jqxhk/m6fj2FZV3eEan9KvxrvzZdUu9McT13IRe5Z1GgEWldJgLfm/aMXPcM2PU5H1N/ow/VSfnlXND/tbF8Rm3+glfY7cN2aVyyFjzoM2HeL3g5uU3aS7HXOb5SZ2/i8uLTf1dXC7xVL5mSxs66PuSVF8ItFvRF6SKXtKRMw4vBP7Orxf69Fu6zjNjAJ3xMWai8SxY496tjbLR9dHayYNvVfSlYp0H/PaCav/Obh2buSN7TrFftSlfx9/GIJfquuaamw/miXkDmnPmaOZwvsgil4cm78lN9kz2STptJ53jJ61/M3QeiTlPaWNwBu0jpm39SB9zHjlXaOMDEh/27Own/XzAR+VDAX+P33OFfl2lncrZMLPrhwi040f6K53zcY5izl/a2FTs4mseFqz5+tq8+yRxuHTdj8jfW8m56H9ibX8pX9dIe1V+hrfvEXa2trFQVNvkW6w5WXO2483zPez6Kcsxh58Xv1J2hrZfQee8h5fxSr+ZDDtd20ze6Srb8+lMG7mgnjbvgdo8yrUz7doCp75160tudPIqq3Ztr/KOV/cMlv7Oa3uQV175vbGLo2NXPLM+qTOmcinIKGLSKbsorX8+/wi4yC6k/GthHafys3FrAu/x2zDa1b0+Z9tm/lV5nZc8+JZFvxhTWqxz3obOpeah54O4PsC91IJ56YXmMswFmZ9kcqnmEv7c38HlEs9Xobn0+1KAfelE5XtIG7bwyxcseGqdh3zOFTpjYXzEjB20MS1YYw/vunQ4mp+0I3uLgj+Uzq9uHtvQfW7t7HXjKhtDXfwC94r6e9iNvQ2jl5rr6lpnHpgj5oz7wFzMPGVvwINdJS/Jz2zL/tDY7arjph+V1tcOc07QzrVixmNGZ5+0m+PqW86lztU4EBdf/H0ZBzlbOGOIGR8ccu64p0H63Vrphy1s8qEA9v1gAMRe+gztXBJzrtAZB+mMU9I1ruZiwS5v30K2t5doo4gfuc/v3+qfvJhzUAa+Vj27bi8Z/+wY6m1jvk9qzc3M2z2anN9rr3blOx+Q2X6ETX/ndxaJwVndM3rYs57RT51c/5TPaMfp0D61TXnFHPsldLUrX/248M9Y3zPfrGjH+r6HvBK7sWlrqnM4QvqiA+5V7ezpZJv6FW9dp+HWpdCPYv+P3K+c67YrX/hOIpALKj3DmkxH/MzOc+RHY9G+lZqypKtex58ZL3X25jTcul6A0HvLkuN1PuYcnsTIAy8f1F5WwXqp9cLLRZ3LNxdmLuV5Sb8HzSWci3l9QeDyPZPZlpd1dZXhP75zqXcuiXW+GYvuQmP8xLHw26TWdYDv1kvZaH6UU66zSPu9Stp0/Iqd/0/yaTi07VT1O1t1PHnmCJ1F/gxqB+zG3Yb8UXUtuz2R+WHemFuiOSf6UgsvLZKH7CN50b6J2t9DfZph+i99lOPEwZhUzBhJpz3HSH/S/5yf8SEe7H/PET8Y9JtCZ1/wz34gYMwr0t+1wbf0WzrnBe18xYxF0sYqsca25uUD3+Xwc2Xm/dn+uZekh1tP9ieyz7XgN0WstLztidCfuqZ/nS977WfWeRsG2lrzEz7z9wzd2UA2GxO57bO+2V7s5HyJlbxxkz9C9Z+DR7Zr+5kx7KOufOIW8015pWd62q44zE73AG2U7FPH6/ht9JlW112dnfWe2rDvGXQ8x2n61Dk43yrv+Opjp6MMXWj7VLk8iA+i/iSO5ktBRhGlk78orH/ebwRcTLDSysRMoufS2nou7o27jTncuzJetbnnQ7adneMY4hp76Ncu+EWp/qXvj+adB10+vPOi6kUW5ILL5ZuflB39Hq5fzeXDAXT5SdpeRYeav7MPzU8B60uCl/FEaS7m0qKXdZF5eNmvF/gzl/iMFXTGUXqsw9bUuhbwdb1m/FC96kqD9y6zPELe+W9OidvQq9W2WX/ks3lXf4bqo7LXL9u6sbdh6VpdOzDXuNsPmTfmlblH3lnNsxn6Mpvt9IXXRqJj5Jgdnf51dO5r6JwjdM6/0jU+2Z52coz0If3NuXm2cGZQ+XDx1pd+43mExBedxFwD4y/qZ/qec0o6593F1viKGb/MwczNQne5fEZ2zfVir8r3bOWeqvQw+66L82ES0onKE6H3Sva/B81Y2KFU3JN1Y7POyF3vpJWBmzXzU7rmL3yeEerNUNt7OOuLvOmXvkN3c0/Zrfr2HaYvRb7Dals+dZWJ2dbRqSd9T+zGREYRpSuf8mpnz8dtdLxXdRztVV75c1BbInNMOnnlr401zvLDtWtJGTRF3KNrG/wqn3kE6mLLJ947KdP2LfTMj23EmEo7OK0+BCru9TnRNvNLeZ3jMHndULS9RXGc6kvy+vskjvlQ9SGeF3hoL7NchHnx9wUd9MWen9ZxWefr++jw0p5fz/Wi7QXbyzSoDB1/4ubXcbGHbT8E4PKdfZPONum8rFeaC7vj5+Vd2nmLNS7GKzHjaS6OJNhKzfWodK7bjCavsk0efEnBpiXtV7r6XPltGEEm1vaOr2MkP0xd55u0OspE5WI33jaUH9Vcu1zTXHdzATRPwMytzEnzSzTXz6B9qj1489u2HL/S+pf+Sud8oHOu0hmLI9o+ovYdT1/SR+fA3mevc6ZwhsAbJ88P8J4V+9p2LBG/oPVPTN+lc37Szl00JhW7mGYu1jwNvsvrmSxzHZ3k9+jOnvsqcZi8Pvug30thDhTxI/eYz7Y6Z/XPYPa9lca+ftjXMWfy2q4N+x+ha7+Njk9q5uitdGcvZNP8ZBz0xOizFVrfj+b4nPYx1LVkf4TwlJTfQuP3Lfqp65xfgmkvaecE1oIeJfVnsiPftmHnbNWW+vJn0X5H2Nmrc53x9rW98imHpl2ZaJ/EbJMWh4mLDfBMod+s7LXN+iz5J4qAi1UTQV7MROrobfg/q51+lTnOGax95WfjX+S3PnCq/s78ZuPqV8WjOY6hbtqM6D+n4Ael+lP93YbOtWZcvIjWCyoXX3/iz0/wedGH56uxXJ5p9yJ8hOqCt1Qv/V0fxlQurR/IpTvkss4ln5cNL+6JXt7FGhtjlpgxhc54F7quTfJ1HTt+mLuuNzQFvZcWbXRjIks/70HPxmEetnV0ytRL7HzbRqcnNdcs1zLX2xwAM0cyr8xD0RdIXypnOHsJtb/2OmR85elLR+M38vQfOueWc5bOmHQ0esjVB9Nmjpd+6TdnCWeLf/+ji5Mx8ix4LmI7bXVjKdO/xPTfWIo5zxpX4pHxkTZuGdfMx50zhPwml7s8V2auqyt/C2qrYu61pIdL774wH8uMtv0W1FYidFbsZXvaT/mMVr9rtw2k/ajWNd9Gn0e15qq8ejv5+8jOg77j0QYN3lq1AR7N72z7MHVdE2n6Sj+QV51sOzvGS/Vy3rfS3dh1bs5xT17bZnE48m8bho50zrTXec36MF6OmTR9qp3PlR+uXnNQ2jWQB1f5wiKQCcnUkpeeJT/yrdQqqzz6e/Yccw9n/asvV96Hy71xzOU6xg4987fOcZi4bkLaXqtou46ffPV5G85ca8bRC6gXUy6wXMy5lPMTeC7Ns4tuvRR3PJdo5B3mBfs5tHbTdtKdP8wPOciFn7nKI7Pmi8zeJd74iRlb6Ix7oesaVT7Xs6OHuUf7XR58bnEc+ktXrH4+h6829/g9X7LfzI9tGHhU6xq5dqD7AMwcMC/EzK0ud32Z7NAX0a6tyrCNrBtjJkvfktb3xJxjzl06YyNNW42V+trLMaDTD/zm2z6cMey/Omf4jJF0h8j2qra6vt24yrrY5hygnVedqzGoaIwSjamYuVnztvBdvpvntEm/FOs4ueekx3DXZx/0l1CY2z2L9io6hrG0XflZzH7aom9Hd7rqiXXd75VT2unsp2wbvh/V1E/aOdR5DpPXeKROpase/JmS46GfdiufbS+lnTt2oMWUKzsaCz8t6M6KbdpDT5m0bYn6dA/UrraST9r2DrfhbJXTV5l2Phc0tonQZwpzWOUdR8AFNBmZSpXZZgJX3Eafl9Zqs/L6ULHqybf+5GWoo7007WHXr5OdiIm+Jtb5yQ9zlwJ/r1JtyTtmYvoIvWV1/hk3LqVcevmpOMil1gtsveDmxbdeipPHjnx3ob6XjDEcS3TcPWQeXPi7DwGce2Je3KUzhtLGV8zYN3Rdq8rnunb0MHm9aEBT0LulpH43RpVVH8/y1c49+NnY2wjAk+qaiK4Z6JqKufa5B2pOZR77AnmEt7yQYh97iTlm0rkXqp/yOZecI7RzTzQ2e7FCP23lGI4rst/4AMA5Oa8uZl2cfOFHv2s/I+/GQqYvGVNofBedB5jzTDpjIW2MMrbQGVfzUuxy+EDGfniS98q0m2jbDtY91u3b0f3dFeaRpfLZdis9s6U8UbobY9ZW5fDWPTv2E9G1X8W67ru5NexspXb9U8Z48GK2QW8P7Xt09qn+w1P2sPZJ/Uvn+Ec7IXpE2i4+ahyM8kTorjKvTn5G9py+1dfkGXNWalv6R5/kZ7T+5lpK06e2p53US3ml1au2Um5b7fspeOPN2BR9+Mitfz+bCOQC4ZQLdRbtcxa1q758Yk1q+O1ONW1149wqa/3KC0rSeVl6Lp32Kn0Qo25uGXdoirKP3P3+Tfs5juOJ1c9tKF+rczZ+XEK5vOYLgJdWMS+30l6A80JcaS/NHSK7d2X8Olb1Cf+ROQ8u/ryQpIw2555YL+/1Am9MjXFirkFD1zWrvGs7w2HyRXmHXUqHszGRVz8rv9f3JW11nOS34dejmusA7TqJdV1zzc0TMfOpy998kexeNGcvrZ3uGVnnQ8r0133hPMScK3SNxRm+2tA26Pgg8/FDRn1EBj2b6yxee3LaZu2MY1s3pr7on5jzqHTON+kaly6W5qCYuVrzOHjynRwXoac1be7ROzZyf0HP9u5oWuUziQBrdFRm66i8rvtRvnX6nQz7nXwm24p+5fW3w9H10XMNHcoMs+2i+Mx/qv20m23QtRKHKrsnn75AU7Cf5YhP3Urb954+39OWeXbWJvOrusqcO+2Uih+lH/+tbUf8nj37pv1Fv2IEDDg4qwyfekf8zE4nr7Y6HRM7cRsdp/UFFwJs5ji30q1PnT9ejmbIxYo2caZX5d1YyMa8Wt+a+XZrgMyStLJb0P4ifaHlpcVuDbahf63OOWNRL6Z5cc0LbdL1Elx5Ls7IEr1M3ws7+ymrNHxW58MLQfchAO0ZC+kar1neGWsx12FCd+uXMtd5hsPso9yAv7XMbH9qecaho7cx0SfV2IuZ99B1LV1j0PwQM3fMrczlvZdZXzoTobMevZzmCyvjykunL9D6qJ7+Ox8x50w84Gtculipk/21KTpm9S15/dtD44aO9Aw7nZTNxsEn2tK3pJ1LIvOEd76JGRdpY5aYOWmegl0+T2Tsh8PcT9szurMzZHW/1bNgqFzPHehV3k8Eci3xOnnpuv7mWyevsrQBbXvKld2K2uhwtgLqOtfEvT6ztrNyxqU4fsdn22vRH714+b/pf2ettr/WfN7KLnN0Ts43x+7a1RPtb789ubrqLPwEEXARXLDkcafjU/eIntmYyffs1cNzG0baOnv4z+QzO0Nex7yFf+JbN35ejqS5PO1dSPNyJW3fDrtxb5hzXZPR9XrIQ9+zMBaljilf478N3UfVuWYcjJHoZVXMS23SXnzzQlxpL9DIpY/QS7h4pE972peuvsgzh6Th+ckkf/cAec4R2jgkGquKGVdo451Y12TC17VM3vXucJi7nkvQZwu2LNKJ3VhvIct5d/Q2nG5rxhy6rk1du1zfmgPw5ozY5eXs5VJ5vrRC7/H0sd3+R1h9Iq+p+izW+eXca1z2+OwHXe06nlj9g2dOYp1fnb+8qH7ySdOefNL2ragvna/Oo8M6d/gaH/ka08zNzNtZbu/J6U972qn07GxSb2I/91+390e3VV4QAWL6lsXxRMbu1pV1R57rv0drw37ye1h19+xXXe3qP2ihrRZlou1pR9lroON2qA+vga8xF23WuSgHX2Mujqf9ireMad9ZH9ot6sB3Pqgnps5en7Rr34WfIAIumAuSvAuYbZ8DXQ/LbTj6pPpwfw529h5kdewz/KFveSGSrpem5/LYo692xS4uzby7+XU5MLpeDwhzCNmZon5i0tiAr7X6tg2da835OWdjkbH0kirWiy2XX2TdJRgZF+eK3WU6ZVzC4cWuLWUzuo478zHlzo/fT+Z/O6BNmWgsKmbcpDO20hl76VybCV3XM/m69jN+mH52SZsYSf616ZxrR2/Dn7YaX9E1SHStxFxX11zMXJGu+VdfIivPi6cvn9Id0k950tlXeR1DHt+g+VYLOa2v+i46PzDnD21cZqhO7Zc2HUfUj0T81F/979D5Z5sykTbpitmWNiqtL+mjNPOAdj4zzBh0sTV2GdvMTfMWJMfFWb538rQhnWNUWp3Exm7dh3kGDPVVvpAI5LpWuuaAfNW7B69t8YzNXAL098pR+17fW9v0nX4drS+23RNv9fUe+um/cxZtq7xy0LazWPt8tPAx1p0N2yuetZP97JOy59BpJ+nn2Fp9boxABhxaXvo1EVefY9+DMXEbth7VfKhXul4E4KuOfLUbfI5/ht71r/MpL0v3ortxnKsYc0yf6xxnaze6X/MI+rkF+5TZOMirT/BbVucE5txrPPcu9V5uufxCzy7BXpS9PM+QC7htHZ0y9Y4Qn9BJnPmZc4DmpYnqPCvW2MjXGMJnjKEz/tK5Pgd0t77Kal4MU9e8sw3Z2UKfWtKO7cruhc5nD7fh2LQaV7GuAXxdK9cQrOstn/mTuVVzsb5QwvsyKg3/0pq26pj8xN//yaP6l/NwbmLGAZo4iTVmtmUf7STmeNLVJ3jmINb5vJTP+GOr8tW+fnR+InMeidjkw5ace9IZJ+ka08xV8xfcy/dsUzf7SqftPVp9Me0/0Lk3u30/1FZ5ZxFgHWvp1vatZeTa3pj4bHv1/yxP/7csOZ50YqXhb6nMRRv3ntetdlM/56CPtle0vfNfXduSlwazqjtDdWlPeqavHN2zZaY7k5+1u/TuHAEXBPzcqwdkPpS34fe1+iBP3LsA1LbsB522C50+7NFX3+xfx6g+1IuSvJdTL1Qz9LJqv4p1PPjqk74G1jnOcmV0uR7I6MyKbYnapE8nt736Ar/VmnPKOdd41DjmRVY6L7+V9pI8u0CnnMs3fGLStS37Vho/lM18qnJ55iXtf4HoXCvW+MjXOMJnnKVzHZKu69Xw3TorMxcqDjOPcgf+bDHnUv+MfftV3RnvHGa4DQd2a8ZR2ngn1jVy7cC6zuZDRXMssb5EVv6lL/x7/XMsPrz67ne/+3f4Jov7KP2sc6lzznhAE68Oqx58tVXHSj+S1s+cx3NoX+wrPscW/ulX+sqc4HNuvPj//Pe+94ucGzUGydeY1VzMPDWHxaP8t139xLR7hs6+2g3MPdrt56G6yjuOQJ7dTKNb489NdibcdV7O7Uzf19KpPt3C1zVwPtp4LZ+fY7fzaU+WbdKg9EvnmnbqfPbaqu7iv4AIuOBgVqaWfKXzQXgLXe08l69jbsPfRzUf5NJnLgBVx75iHSf46lPlH/lHP22CdVz4eknKy2i9UJ3lq034buz0LeboHOrcunUc3a45BN0V+tWiLLGzr6z6Ar/VmvPJ+dZ41DjmJVaaCzB0XoST9pKcl+ekvVyfwZlO2uto/EGefh3RzIk+jOlcZ1jjJF/jmbFOOtcj6bpuDd+ttzJzInGYePTwhD9bsEMRP3K/wivP8c7S+jzDbQy2WzNu0hlj6bom8K4XOFvjmi/mU+Zb5id0rflC2r3I8xN75Ldi2vKn/n/3F37hl/7mt7/9tx0z/ZTOOdV5Z0xuoasdxkCWY0nrR2LGEHmN4Ut4Y1FxZtPx079KMxdkfOBCzD+MwrcunHeNhzlWY5p5aa6C5rK4tw/QoV1dMe1JMx50RdtFbWi7jJ/71b0+VJ6cEchWed8RcH1vRWZNH8qtfc/qazsR2uL48p8S05eOVgZK4698ovKK2Y+2z7F0PnayW3zP/jP6FntL9ysYARMnEbrW+vBL/ha62r2F78bZhq/Xmg9waB/sifUSUPnUrfZyrKA7v5ThGzR4qdVmjgeNP7XWC9RL+GobPn2o/ul3oHMTZ2s4ulzzSBrMkn2Rw1OUJ60MdOzEbcgf1ZxLzrHGoMazXmRnl/q9y31enp9z0ad/7Zc2O9oLeqI+3oLOt4uDshoz+BrXmluuQa5LpesaNnyuedKZHx09TD27YC+L9pHZlmh7Yvra0duwtVtrrOSNa2Jdi7perqM4yw/yzHyqOTd7mcyXTuis3Qs/Miu60onKtcVPoH/mO9/5WV5C+ek/uulP9bXOz3mLNT7Ez5yubfD0E7UB1nGqH/J1b6fvz6GJy3P61T74h0w/ReaFnG9Z+PJv7JFnDCpd41dzM/PWnAbZD2K3N1JXOm0lXceEp11UVzvNeLlnc19Dr/J+I5DrJ90hMuXMVlq5fG1LXlrdRO2o0yEyiv0+cu/v3zrXnI/0WXxPs69zqr537Xuy2n/xKwKHEagJBT+r+dC7Jz0bbybvxt6G39fqg1v0gZ7YXQJSlrrS2gNzvEJ3/iG7+ied9hxDTF+4NMHXy5M8lyzoetlKuboVcxxoxxfTR/0OrHOdrZny0fXRAws5pUP77GEd/0Vx7mLcxVRZXvC5HMMnemGu6KUatKIjvYfqJVb78ulPpdP3Gc08bZN27h3W3II/yq8uzzLnDvbaNnKH2uUBssydwbZ5hvw5xZy1b441o2d+tnk7DG+11tjIG8eKNf51jbp1dK1d+0RzK3EvX30Z9WVd5CU9aV/wkUmfQV5C+fo5L6C8jPIT6c6f9Bc651RjUGN0xNf+2L41hvqH79CJ3XzOyIglehVTNrOTPuibiD2+ZUHMa9n7+yE1TvAZW3I189fcFru9gMz2xLSj3boXOj77pb0ydu7jbq8P9VW+gAh4xot1SsrFrp22WtFTJg0elRwn6aN+n2P7zP8qlxeZy4z+HOd5i085r6N+qTujj2ys9hWBSwRIICsCaTEfeK9BO84e7o27DZ+vNR/c+UCH7h76M5n62ki70DlmQ+vv1a/UqbYcwzGrT3lRgu4uU16oEqtetSNfx0t/0tecwwPtPMXZGg7168F9pEM7ZaaH3PEStyF/VNN36JxXnbOxEGvs4PPFodJckJF5UU7kog0/u3CfkWf/tL1H60/19RbeeSd2sUFm7BJrnOFzHSpd10y+rm3DZy5I7+WQeTZMXXMT+paiffpoT1mi/nS4jb7T6vxnWOMH38U81wS6ruEsJ/byay+v88UT2sqLPT+1t5550a86+VN/X0L5FoBjOLb7qs4h51rjMMvjLn5dHOmf9qWrD8nXONKm758CHT99hCbufMuCD12IN1/750MYKi//rJNzYd70yfVGh8rfC7AfNqjYJp7mc8139giyuleqnv0Tu/3QybIPdNou4+Y+zn0OvcqXFQHXl1nl+ia9N2P1RHXhU1Z59b50zBg4105G20xuvy8JnavYzT/bvqS5r7m8cgRMHLDSysB80N2brvZz3KT3xt2Gj9eaD+z6MO8e+EeyaiPt57hB4+vVnwf6iSzt1DGqT7dcPLvLbCerNuFz3OqT/jZzY651fXLtOnp0eZRz8p1uJ6vjPYnvMPjkJ0N1Tjlf6BqTGjcutMq81ItcdL3w1kuzF+J7XOSxrR3pOh68vuyhvt+KxIA+xqLDGssaa/i6HpU35yqytge15kfNodH9Sf4hu6Vgk5JYx4GvviS/jfa21jlXvsYq+S7WdT26NXNdzYcujzLXjvKal3Bf/njh46fGvDTyAvlzP/dzf4+XSH5qj4z2+pI/43mBpL8v/iIvlLMPAPRV/52jOItHjVvlu37uDW2DxlJaPxLTR/e4suRvoesHIfLikS39Q5/4+gcW4WnLOSatPn1YW6sfAHTIBwDYMJdrzudeoQ2+6sDbX5zth06uzL5pP8cfdO5j9/0QX88D6FW+nAiwxs8t9hWrnZm86sHfotv1f28y5yum/50s279kus698l/y3Nfc7hgBEwfsaj7oKr2NPmdr7XsP/snYPrB9gIs+2BO5zMFXTB1obYiOAe7Mn/k98U9Z2tAuWMc+c+Gsl1AuUVU249N+HTv9Sn+dQ2Bdyy6PkFFskxZru3oV61jbMPCkpr/QOZca54yB9CxeecmV9iLsZTnxlgv82Ut52mQs+Rw3afyE1997InHCXhcvYynW/IJ3Ler6JF/XUr5b95DVPIGvuVT5oXJY6GORTkybnQ/Itll1bh1mTDq6iy8y4y/WtdrLh8yjjs4XSPKXl7juZT9/Vzx/eowuL4P06174lYNUflKctnz5B7GDD1nTv+p/zrvGBD7jBa0sdZWnDDptS9fxO15/aXNfK3sJvuRsIe58SMPLvD45pw6NhW3yicZWNHczr+seYM8gc+/UdvjsD63dRMaEr5g6acdxHDfQ/Z173rNgqK3yziNwy1pWXXlxFoqj9lm/L1GesUj6S5zr2TmtOJyN1NI7HQGTCtyrPuAqbqNfVi+1R0ifauslfPrw6KcB+QDPB7u0F48ZqiemPS8E4JjPIx/O8Nk/7TqWWH3LC5Q0lyzos2i/xBzHscX0L/0u8+zWcC+vRvfdvJv17cbZii+P8gCfcw7Qzk3M+UNnbJL2Qtvh7DLvRX7v8u7lPNGXGPoprza03Y1dZfqMHFqstHq3IDFCP2MlXWNrzCu6LnWtks/8q3TNgeBrztTcGqqXXOwQWVeqjY6v48Jvs1rnk3zGoNLEEVmNp3yNv+tSsVvvmkPw5iM5WX+670/2uxd0fmLPNwB4ifSlvnvhT1nq8XKP/XzhT5oxjz4AwPecU51zjYl8F8PZOeE+qLaTTx/26Lrf35pnjfnAhXVjXdJX5gOf80ra2FWssTRPxczv3APQ7h3p2g6f/bUpMjZ09UFePVFbOY4+PKB7vNv/Q2WVdxoB1rMrM3mneyS7p62jsT7H9q/6/J+7Jituz43c6vckAiYTWKsPt4rb0KXuXmgfdNDLap9q8zl82n300ueDG/RhnugD/wizD3Ta3bkUpF/ON2WnfK2+1YsUPBcuMS9fe3RnB1mOl/O+Yc51DWs+dfz3jdLJq6zalp/G1fVJ/7t8yHlDG4uM0yyeXoDzYizty8bs0u5LPdhV+qXOzA7jOZZjJ+K7vHTOhzZ56Yq27yHxoj3jJl1jDJ85VmnXqa6dvGvb4cinRznxwJsviTXHbuGH2UcfGtS+OY5059dF1s0DmfM9who/+C7mrkdit6auP/nHSzU/pefFnZdBfhLMy3z3kp8v5NC+9NOfF8ia5/myn3S++PvT52q78mc+AGBeWevcMy4vpatt+Bxb2n1NbIgB8yXmxpuXb391gthblWebMtaJmBvHGnfHyvHQpzI2/RifD1yQ1fOlm5uyWdy6fKx5m3ne7Ymx5y7PTlA69bJ/tT3bE9Wv7Jf2HMexH9C9DeYZMNhVvqIRIA9mZa9t1mfJVwSIwMqdlQd3jUA+sCqdD7akt+HBvWrafQ79yA8f0GA+uPOBfvYSkJeC7J92czzoM3FRz75pL8epfnaXKi5cyL143YL2q3ZvmXcz324Na149h+/sIpuuP/HN2ELX+NYYM/caj8p3MfYi36GX+4pcwJF1F/NOlrrVljzjQ3d+IMN3sdKzeSm3n6h8hjVu8Jlb0t2apMx1q2uZvHspseZG8F0udTk5ulwfuLRTErs+yDr725C3NX1OOudXaeKDLONUaeObWNeEtUNW19A1BnmRrC/aRzwv4ryk8uLIC+Ys120Du8pLKC+0Zz5o0CfGZDxtu5fcI93+qPOf8cSDqi3HwU8rL8/1AxN/gu7LuS/wvFxb+aCEX4vwbyI4n5cgccMu4zmOiNw6G9MPVJy3SHyguziZTzXX5DMfoWveZq7nfoDOPSRfdbK/e4RxGL+OPeNnPjlW+vFAu+frmTCaV1kRWBFYEVgRWBH4/CLAA4tSH1zwPtQStyG/V8UuttL+LfQTP3xA5yUgH+azB76Xg4rqpw3otO+Y4MN8nvhV5dknbeU4jg16eRK7i9dzZdpMzLHTJ31N/+vcBt+tYZdfZ2WdPWRb1vQJWl/FnAd0zrGLsfEgrtBdfOuFWB70JaHi7GXIF5UjrPbkHTN9SBr/4W9BdbVjDLQjX9F4GcPEGnd416OuUeVZS2SuacWaA/CZI0HPcupsTs70OruP8lQfOl+7vM05Ovcal8p3Mc41SLquHbzrDfLSevYllBdG9HkZNi8Tu9zuXvyR8SLPC+rZsdVj/Pry757Tl5wfNPq+wM/8Sbm6e5j60ur7AQFz5Kfss8oHB1n9AAH0Q4QOaccm4zB3aONzC9Kvxsr86PKGvEKe+SXd5WTN28x16LpH2Dt1T1edtJH28Yv1Bztfqiz7pk3Hcx8/oPs+z4XRtMqKwIrAisCKwIrA5xUBHlSWfGgl7UNN3EaH16qOcRaf+OGDGfSBnQ9x6PqQh/eCUrHqpi3tgznuUXzQRSf7aCvtV1+rb/DdBSxlXNzgK6ZO0nUM559+6WvOu5nzbA0zt87SM1uP1j/jCZ1+Quccamz3coD4zGKdca2XZC6ayHzhSOxegqqMF4Yq6/i0K+241afkMy/MAdpTXvUZnxeYKrefdjqc5ZY5JtZ1mvGuaV3n5GtONHlKDs3y62x+ojezgf0ntfoln75LM3/oWRxSTgzhjWVijT9rtJfXrjE5xU+MeWn0J8n+NJmXfaovlOiRH+bhHtZc9gUZxAYvsGnbMc4gfvrim+OkP86vy90aq5fy3X5ImT6kT2fonM8R/ZwPAIg/61F9Sd+T3otT5qJ05q60eQ+6L8S6l5Ajs11MG9oVmQsfupBj0PqC79KJ9kubjlP8yTMgz46htspXMAI/QM6YS7/hN/zmf/y3/tYf+qf/4R/6oX/hP/47/hNft/6nf/c/9q9nRY7OVzBea8orAisCnyACPKwo+dCCzgea9PYgBx/VfBjTNuNrvwde+2eRsdEFr9UHcz6sfYCDHsbi3oXFNnVBLgxctLCVYziumD51tHpg2pn5qi9iXrrwh8sMiBwfRejklSdCZ3UMMOeevulzzqOZZ7eWNceO+M7Gk3Vn7PRF/8T0HTrnBZ1zTpq4wGd8pDOuxllkLaDBrPkyUmlf+GeoPi826KTdSutHh/ivXDoxafTkpck1XgDxg3E7W/TJagwzttB1HZJ3nerazXjWmjbXXMy8gG7ydHuQzXLtOXJtPsHqD7y+djibb5Vn7Cpd4y6fayTtOousNy+CvJCTg643a08e0s6LPy+Y5kPNx8qby4nYovJy5gcOZ172ZzrYcK9oG8wxnYtzF41PYo2pPDrQqZs0NuG13aGxTtS3eyHrxNf8Z/Hq5MTQNdWPzn/n6Dxz/tDGKrHm79m92+3huqdyH+U4jA9PDvgrD+QI/utb9Tf7a9fxHs4N93ieE/lcG2qrfOkRICd4wedl/gf/ld/yv/p9/6Pf/eEf+V/+o79E/TX/tx/6sFd/4G/8hkv73/f/+U9++F3/wX/+Azw2vvSYrfmtCKwIfJoI8ICi5IOq0vlAg9666gPZh+IMu74TWR2345/4kuP6oM6Htw94sV5SZjz6tHGB4nLKZUG7jpNjQ0/mdfU59bUBahfUT8dP/7yEefnm8sZLGZc12s5cJFNPe2KOlX7oX/rsXJo5d+uGrObZHj+zcY0l4+pD+lXjWWPqvHKu0sQB2nhU3IuvF+b60gOfLx9J+2JSX1Tk0YXmJYy1Jg+1142DDB9FL+8i88k5HPH2Exmfl0JeEKDxr9qrMTOexlh0HfbQtTP/jrDmAbw5Ijb5mjk1y7sjedp4RDtuYudnl7ez+RIz2vZiZ5wr1vXJ9XOdyR/OFfJulkvo0ta1K7O9Yu4BzrKX/NSffVFL/cYC+coYVMZznhmLGidiq0w6MWOv3h7mWB3tOtAmnajPtyKx5wxh3uxZPrAhDrNvcxBL2nKczl9ke/PN+Eh3+Vz3Qu4T6IP9en0GoJu2cizHB3nxN1+IA/PMdunsr930LfzKsyGfaUNllS8wAt9PjvDTel7Wfdk/+8L/q//ar/5g/Qf+4q+7vPT7AQAfFvAhAB8mfIFxW1NaEVgR+EwiwIOKkg8s6XygQW9dzYfhGRob6HW2hqyOWfntod8Tf3JsH9T58PaBDu5dWGobFycuCFyYaEubjgPm+JO5XXxPPWhtpN09X7mocJHj90LrT3S4sNGWl7YzdL3Y1RjoT/qo3zmfZt51/eDNryPs+p5ad3xLX6Gdg1jnCF/j0PHEE3kXV3IF+d6LTr70sFZUX/DlK/rC7YXVddZWHS/96PzMOTiXitnPtpThk/7wosUe8VsB6HfVGNfYuyZn0fWsa1x5czQx8xW6ydnLPn2Qz3Iw5an/hK7jwac/SVf/O54YIT+KVY2xfLcuyjIvyCHPGPIx1/6INv/Qkwazkru+jJI79Swzt+6JjMFYjKtfztkYGKfEo1jTjn7FtAHNGKLjncXqp/2UJ0KfqcQgzx7Xg/OFuPOBiXYdL9H5IZMWZzHrchpZ7gPo3DcPe/HJ3lKeunV/5XjpE36SC+YXNHNNHWltpI+OqQ8D80zIZ9toWuVLiABr/ht/8w/9iD/l96V/9tN9XuKp+aLPy35X0UGXDwGofgjArwR8CbFbc1gR+AwjcPkQz2/u/Od+6z/z7/2eH/nhv8y5/xn6eleXeEBR8kGVdD7MoLeu+hC8FTtbRVbH1wfxkT85fj6kfXD7IAe9oFSslxh4Xmi4NHYv//XSkj6UuTzylbbU1V99Bau/XEy4hPPSxeVs77LMyxj+crGj3y01L3c1HsQLv9JPfXc+zby7dUSWudbRs37TWOoLmD5CZzxnOeB8awyS34ulLxT5kpO0L+si65mX7/rSD0/+cQn3kprIy5m2wBxLes9f2pjbGZzZyQ8B8M1vBZB/+I8f2jeOdd/Juy51rc7ydc2Tz9yQNmfFJnef5NotOtpNdOyK6WtHEwPkZ2LhPjWuiawBvGshukauM2vnS6AvRra9FM1NxiC3yZnM69eg/RWG+uLvvI1Dxkr6TMw7HfufQcc/i9Vv+6VcGry1skbEijMGWvuJzAu+zo9YIOti0uU2srofcs9An9139kt7OWb6hJxzM/OP+TKn1INOG9p2rOKbz618pg2VVd55BLZ86d974T/7ss+HAOqC8tjm1wD8EIC29TcB3nn2LPc/mwhwfvOh2o/+gT/wv/6jf+CP/bL1n//9/80PWWnnw77PxvFXcoQHFSUfWD7EEreh86j6AHwuYo++1e5z+PTBB3Q+tPOBXi8seYmR5mLgBRjkAqWNtOtYYPqwN7fUg6YvPnlJy8sTND7hDy+DRy//eXnmcs0Lmi+H2p8h49SqX1wGeanjMtjNP+fUrF/mkXTmW6VTR1rc0n6O61qkf9CuG8h8aq1zrjzxQjaLm3JfbBKJfa28+BxV4m3+5ZpWmgsrtnJMafyC1r/EnI90xdTfo+uHAProhwHkIfMxlxmnrkHyrlNiruEZuuaAvDkiZv4knTl2K512pB0vUZ9myDxpOzNfdYgjdMZT2riDXWWNyVXWkw8RXUd49Pdy4EybuSg6Fjl8y7mmX2eR/OPsZLzcG/qcsTBWonF9CWLraE0cD1+g06d708wbm2fQtao+6G+HXaxmOY4894S0+wY8u/+yj3bAHLvzjdzIXIJnXqmbNrTteMU/n1P5TBsqq3ziCGwvHP/7/aq/L//1p/u+xHc/3fflfk+HNitj5DcBkJOTL5zD6r4i8JWNAC/z/8I/8cd++r/xB//U9aU/X/6h8wOApB++hcOZ/sUUJ5MPKmkfYuI2Zn2tPpR9AL4E027QjMt4FZG1VR98OOeDPx/k3YUFGRcckEtRXoD5STsXx7QB7YUgx9MHcOan8tTVV8fAtjSYPuMnL3y8jOclPS8wlc6vZ+fLohfgGaJLLLic+1MSXuScu2gMnJNzLGguVTTnEquO/FZsXr9JoQ/GUt9mcTSm9WJb+bwkd3HygpzoS4ZI/mQlrvBgrcQ3v5Za17LjWR/6OV4iPsN3vitjznt0tqtXkTzpfFPmpdr45p5zLfbQfZCYazujzYOKmS/S5m/FmnOVr/qV135i9UeeeUDP5tPJiRvyvfgRd9qNfyJrST6yhrwsu2YiuYV+XXP5bEva9g4zR6HdD/W80YfnYrc3qj8Zi4xhF2tluV7KjjBtv5TGZ9dTzHncShOTs30cr85hNn/z2ZiJuR+Srvun7rc93r5pz/H0o/rJvMkTc4znJTmZemlD245V/PFZlc+zobLKp4oAL+5+VZ/f1YfnL/IPf7ZbfKKPL+hnsXvxp69yMWXarh8CoEse3uLz0l0R+KpHIF/8efk/+gBg9kEAvx7wJcaSBxUlH1g+xMRttD+qPvwSeTDCzzB1k662d3j8eeQHfNry4Qz60M4Heb208PBXxiU0X3a5EHAhtT3taDvHSz86P5WlHrQ2tAnmWI4velHjkoJ/Zz8I4CXen8ryksmHCPSn8oIm7U/k0EHuCyvx4aKIb+mr/ue8nGuguVQx8w66tie/hb123dOvMzE0lqIXYfBsrS8z8sSr1vrCL89LFuux96sdXlA7ZF1Zr+6DgNk8mLNtM9r2M0j+dL4ho438Nc6g+fwSZI3pn5jrnnTmhrS5m5h5/Fw67SXtuB2mr0d0ztn40Ue6w4w960lumnfdiz/rRl6Ro5kf9JWv2LXNcsd9IuZe4dyZ+YRfZwr7wbPLMcD0J2NSY1bXINeMtuSla5+Or+Mc8fioTtJHspzbS2nHmmE3z1mMiBV7Qsz9Ufdbnvdn6OyvXdcGrH4yH2TkCbluXnFepW7a0K5jFb98XtXn2lBb5VNEgK/u+zKdyIcCt3y1Hl1fzs8iL+1WX/LlQe1Ii8r1118HoJ28/BRxXGOuCLynCPCBHT/x/+/+8//GB1/868t//pS/0t0HATwH3lMM9nzlAUWpD6ruJWwbepfKQw/ahx/IA1H04dhh9qm09gvyMN1GFaGf1LTluPnAzgd5d4HhQsgDv75I8yJMm33SjvYdD0w/Oj9TlrppQ7tgjqcPYl7ouDjf8o0ALzkz5CWUCzhz7y6c+qWv6b/zyrkG7eWoojlY5ZXfwtY1B3N8fdJH0JiJGbuknS94VH2RyBeLpFkT+HypgfaFP/EeLzuuJZdY8tbx9Wk2H+af85afyWZ2lJOH+pKITxlraNZDdG0SbevWsJNlX+jMAWnzo2LmUKXN6SOs/ZKv4yWvb3vofOoc9+TqGkfWiBd+1oKX63zhybVKevYBQJcfjJNVHWXmSKL5KeZ+YY/kT2bTryM6X/739oK+GSuxrgXrhSzXrdK1vdqY8Y75Fuh8b0H8Qr/zbzanGhv53BOVrvsrz/pC81zYupo20r7jg53PzI19YV6xP8hT9bO/dh2r+OEzy2eaONRWeesIsEb81N/fqedF2q/u89/0/dFf/1Mf/jO/+k/8qeEX67Rb+ENhvpifxXyhh04eG5XvZPVDgPXfA+4u02pcEfi+3/e7f/9/5yf/pb/wgZd/696HAL7si/XDAHnOky8pvB56PqRAH2DiNmSPqg8+0QfiGaQPevYV6xhneftrVx98YOfDvrvAcDmsP/XnEsAFkgtA9tGWtkHHSz+gj/xPfW2AadvxwPRjdnnjEu3L5JnLvZedRPrxklDHyPH1S1/Tf+e1M3/z6lbcqk3Hcnz9AfUx/Yau84LPF5Ij2hcV9KQr+sJRX2bypR+aOD/3BSfXrKOxi318O5oT7cah4pm+VYe9U33yQp3xdz3qGsmji//yt2DuGXOhYuZL0ubTSzFtVrr60vGz+aJLmzjTI360sT58wMka8OEeSH6wTlTlszPD8yDXOfMk13RG09c+aQe62z/uHfYJPs58q3kGjz79tJH2c+z0NWNY16Ku3RkeG+pVe2d51xh96fTzFpq53qJ/pDubg3PukP2EvNtXnuWJ9bw/y2sjx0l/0nfniYx8yTwjh+hHW/bXruMUv3yu5Z0KepW3jcDGS8B//f/5536ZygcA/MT/D/2bf/Hy0v+Hf8uf/P/9xD/w7374H2z/wYc/86v+vQ//xH/4r/1vH34tYOol7d0L+9GHAWdf/Pfs5IcAfIDxG3/Nb/omeTl1djWsCHxFI8BP/Xn53/sAwG8C+GJfMT8ISJqz/0sKa31IwfsAE7chu1YfeqIPw1vQvok5xi102kgffGB3D3se+lyIeFmuP/XnAomMy4CXA1Fb2gYdM/0463/20Q6Y9h0T1A/RC2x3uebSzkX41q+U86KgPe3Xy6M+pZ/6n3PaiYO5dQtuaS/HcWz90b8as5yPdL4QzGhfohPzpaLSvngkcpnMyk/K87JJ3t27sPaMgx+zuSEnFrZ3dMrU20Pi0X2wwfzJXWMPypvTFemDvSp/Dp95kbR5M0Pz6wjpj87MDvIct9LMCZlzkxaVn0XWiDOOHOA8IA+IZbd2yGlHD/08FzkTXDP6Sr8E0wfGrrXunbP7hQ8zyBn7p90cM+eR8axrsreWz22rY9ybz/ns0e4/dKTFWb89X/fiMds7eY4nnWd90DwvtlHrcwPZtWonx0zf6hyYKzKQZ6bnMHmvbvbXruPk2IPWt3q3Gk2rvEUE+En9f/V/929+8OUf/Jf/6b/w4c/84Hc+/Bu/+v91rb78I7/U8UHAD//qv/A/ffjL308+tGG9f82f+XW/5Is6L/bw1H/yX/0nf4FvFNSXfT8wqPK0IV3RvsrrhwB/4i/+yQ9HH1q8RbzXGCsCn0kEfiBf/usHAPWbALzY+3JfsX4gIM8z4jOZ613c8JDLh5UPMHEbI12rDz3Rh+GtaP/EHOcsnf3TBx/YPsB9wLOAXA73fqrEZbO7CGlL26Bjph/38h37jpn+Mwf8q7VecL3Uc5E580EAl2diU+3WWKRPxsI4gCdiYW6dRfIPXfBSHcNx9SNjRpysdU41VskTN3hfHpJW1qEvHYn50g/NWuTLlZfN10S/DZBzlCYu0DNU7xbEFvEhn3Je7qtcC9dnhoxLzMDUwQb8DFO30pm/lc48uhddx6i8/iGXfgkSE1/kZ/s510CaGEODrB/5yteiOSvhq578rZjjQDte7qncQ9D4cvQhAGecH3TYP206luPrd8Y612a2/pw5tFWc6SvHtrSoLMe9N838sJnzvJXe88m5dOj53KFneEXP+AZnz4vLM0H9tOe46Vs3F2NE/nhmkffIsy+0Nh3HcR8wfcx71Whe5TUjwMswP+Xnp/2+/PNBAD/pzxd/6csHALz8jxf/S334gIAPA/iDX3yQMPz1jnxx/Tf++h/8P/Cizwv/n/zX/rUPf/rP/OkPf/ZP/I8vlReOr//R//6Hn/iJn7i088HAmRd/X/RFX/g75FcY/HUG5sq3HF4zpsv2isB7iABnMS/4/uRf9KVfzF8DuOVbAH4AcMvfDHkPccsHlHQ+wB69dI0JXX/vmoD7IHwu+gAVsX+20mfPHx/a+bDnwscDvr6Y+MAX0ekuSNrSds7bOejX0TzUs1/a0r7ouGD1y0tsYl50pY/mzU+j0VG/XpKxn2Prkz6CzsE5OcdJLGqe7fFbteEYjqkf+pW+Qh/Fh/nmy8ItNC8b6PvSUZGXF2Lb/VTcnHtt5OWIlzl8yzVOmhjBH2H2Sdp+2mCsnDM+IMv1kE6EzkrsePnDbsqTZmz4GaZu0uZLh+bUrYgt+nQ2U6YfyKRfisSXFxdf2rGXMYHeq64dOq6tuZ1tezbqmPLZR1uOIdZ9x3ysfggw2yvkiLpg2tK+4+pLxjvXpltzz5qK6Hayzsa9ZOnrWZq5qiud8+9o9Tvcm0uNR/Ke3R3Wcz7408+HtOu41dduPsjID+8HIDGpfbXpOOHjNuj00zsVuMqdI8B68fvw/JE/MH9Czkvy5af+4+XeF/6v/5b/95VWdv0QYLz0QysH+VCAXxXAPt8KIA/4YODP/nP/sw9/4Sf+5x/+8r/+1x7Vb/73/q0PVNqsfEhQPxDwxf7MC7+6Il//z/8ekHmTh3cO7TK3IvCeIvAD/61/7s//X33pT/TFv6IfBPiTf17wpUVf+pP/PT/yw3/5PQVmz1cfSvmQgs4H2Db4a/WBJ/ogTOSQhK+YOtLYgdYeyHhijt3R2Q9auyDjU33Q82DnBejoa9e0c9HcuwxpO8dLXzpfh4y4brVmv7TnGDkH5pJ+eYlNzItupbkUz2LgT1ntkzahc1xo45p+6n/OCbrOOfjMtT36Udy073igfuhX+ptzcX5iviTcQvuCkS8clfbFfxbz2YvMa8r59gFrzVyNAfGBrpgydc9gtcMLvN964MUUG6wPerlOlbYd5OWu9kV+tp4Zz9x5LazzO8tnHLp50E7uESO/7WEfxzBO9pefoWs/a0+5Y5zB7Add86nuwW5PkQd1j/Cyxn5TP+3UMdIHfc419yxJ9IzxzKFNWlQmdvK0eZbGN3TFvX45j9ei98Z3zh16bs8wnguPzvsH+d7z4cmz1THSj/S7xoY8UMb5SH6RU+RK9oPWpmMUv9PPvFsNtVXuGQHWjJf+rP6EnBd3X+jri3/lfdn/L/5H/tsffvTX/Ysf/pVf+7958mHARWd8SPBf+9V/rn35rx8GdDwfDvCNAb49kC//M9qX/or1Q4Bf++PbLz/8P+X3DO+ytSLwHiKwzV7+/SBg9vLffQMgX/b9ACDxS/qvAPPhlHQ+wLaRAdfqAw/0IZjow1Hs2lIGnTahc7wZrV7tm7Z9aPNQ5wWEhzkv97PqhZJ2LpFeDEUvB6C2HS/9aHx+cjlJneyrPdAxxBxfn8S80CZdL77wXIy54OSvBPDSkC+E9ktb0I4Hpj/6mP7nvHK+D7QxyVyb0Vvtr23Hc3x9Sj9zDs5LdM75srBHkxe0J/rCUdGfVpJP5tZr4VFO13HR90WRWBgjaRG5dGKlk88+2gWJDy9ujM2LKnFEzlqJuW6VRp89bK7aL8c4Q9uv2u948+m5iE36ajtpZR0aj4roKpMmrsST2PghXrVpH7DSymbo2tZ2x3estKss0XZlaY8xaq37MPcXe4v5Zl77oVbtB5+2c1x9AV1jzxLRM+Y5iI29frY71muhc3sp7vm3N0/aPLM7rOd78Lc8J9S9PC8cJ/2q/nfxQIf8IrfIMfIl+6U9xwh/GdvnWN6poFe5cwRYi3z59xsAf+iP/cv/X17+/QDAn+rz4v+v/n0/9+in/LT9kV//Fz7849//+z/8g3//P/iBl2nqf+qHfvcv82EAHwrwPwXwoQDfCPgTv/1/8ein/rMX/U7+b//Fn/7wv/+3v/3hz/34v/WBXyOoL/a38M6VDzyg/+F/6Ld9+NK+nnzndFnmvsAI1N/596U/sX4AIF+/BZAv/9Ki3xD40j4AICXyQeXDS9xG+7X6wAPzQQjNQ3IPq37yaZfx4HPcGZ390qd8YHO584IMclHkA4GsyPgpLQ98XlC4AOTlcHZBdA7px8zXIX90QUm97K9NMOeRl5XqW15qob2058W30vxxMD8E8MUhdapN+Bw3/Uk/9T/nBJ3zLbS5NsMt9dOuYzm+PulnziHnBt29KCDjRUPMl46zNLlDPP2Jd76kPJfGFrlJ5QWYyss0OWtOMyZrClppQw99+7Pm5Di+gLTjMzGp8YI3brfQ6qY9Zew7fSbOrlVF9JEl0he/X/ohgH6l/Tr+jCfHaKs40z+S5/zQlZ/RtLMmrBnrz3oSD/KzjpW2sg25bdK3YvUv7R/R3VjmmXi0P8kF85j9QTxqH22JOW766LkBepaAnsGeM/dA7d5qy37p3xFd54N+zvUMfTTG3jzyrO7oPNcn9OyZMJNfnxU5XvqY85nNnzzxzCVPsk/acoziu77lvQp6lTtHgPjze/B+CMDLMDwv7bys+yFA90GAHwqg+9v+Q7/j8gJN3/x6PT+Z94/88cL+X/mzf+qX+R3/7uW+k/ET/yrnAwBk/+w/+0fa/wKwfgiQ3w6obfkhAL7z9wnuHOJlbkXgs42A/9Vfvux3tC/8ib78i/minz/xr/SX9gFAfUj58BK3sfrX6gPPhyAPxrxISeeDtT484e0vahfM8fZodbOv9kDHxRcvfvpX0XYuilwk62V6bz6MpQ87/hpP8RpT+tgfzDnkPJhP+jGbg3NJ9AJc0f8Fgct0bYNPG4wH77jpi7EG0/+cF/QN8WnjNIuV4+OT/umvc8j51RcF+LMv+DM98oYXb160eUm9V+EFD7vYz1r96OaUc4ZGRz/9UICXKMbgZZK2XPdKy4O1EudsN+5HmOs1o7HhevLhAbElzsTgyP6t7TMf7iXPuTgnMduq36yNH+gwd9aNioy4H/mXth2vYh2z44/GuaW92q85Bd/ltTJzgQ+xlCWmvTqWfp45x/JMg67nWvJV97m8Z6mInaTTLvKjyjyPdG5pz/ErnfGo9M4zYCttPgNuxasdx07/6hxz/ZP2BwLkSfZJW9qf+F3vVkNtlTtH4Af4HXhejPla/H/2b/2Ry+/s80f//KN+/EG/7oMAZPyE/z/2m/+jl5d8X/xB/8getB8uiIxRX+pv4f0WwJ/+L33zw+//R3/0w+/7fT98/ZCBl/29F/76AUD+KgA+86sF61sAd86wZe6zjAB/k6N72Z/J8uU/aT8AAPkQwA8CxPoBADzPic8yKM9wiocUxYdVfdhuo+1afeCBPBS5gPOg5ALGS4oX8rxs5AOzo9MmNOOJOfaMzv5pPx/a+WD34ncLZn/t5lj6MPGxxhR+q1UbYNp2PDF9qXOol1wuwMgS81IMzcu/L362VTvydbz0Rf/Sd+icF3Sdd/CzOD2Kl/Ycx3H1RR/12fk7t3xBgK4v0rfyvpjd8yf++eEBLzmMUWv6WecE73z3ED399wOBMx8EGNMOM+4dzfogd52OsOrisx+ygPif4zBfeOctnZj6SeubMvkjH2ft2NGGNm9B+rLOnK+ZE9B8aMPenY19Vq6P+rmH2dbZdw/uYe1X4+G6JXb5be6SAzx7Uif7Suc46YO+eo6Ani2JnjuiZ1tF22eYNl9Cz/zUZs5nj2b+tFec9dF+h7M5I/ecT1pZg92z4Kxs0176k/7WuZkDIu3sLfadcbGPdtK24z2gfnqnEkfzKq8QgR/gpZcPAvhp/k/8wF++/NX/ywcA41sA3QcB/PSfDwl++2//HZev4c9e/m/9AKD7iX/34YDfAuDvFPyLP/KnP/BhAC8cf/Cf+S9/sPIy77cP/GCgQz4E8OWfl5P/wj/1ox9+46/5Td8kX18h1svkisBnEYEzX/3PDwPypR+aF37RDwHyAwBf/LsPAr6kD9l8OIk+vMRtrPa15kOPCxcvJzwouWTxoPThmMhBBC9mG3TazLGOaPqhk/2htc94Vh/sYF7+ztDZV3s5lxy/8dk4VtyqbtpxDmKOm/5088mLbtJehG/B7E+s4DNm6Uv6qN9izg26zJ3YZDwqn23X9da249ZY6HvON18SoPMlGpqXySNUh7znZdmvIdcXtHvwXEAZhzGzVr/rvJgzspw7NDERjY+IHLu8TDHu3gcB2hC1cYRdDmU+zWjsZl9iYdz9+rdj45N+SYvoVNp+b4HO4exYrIXzzHzipZe1msXrVjn+2EdaVL6HeQ6coTtbNSauU2LNc3i+xUQ+oDfL+bSdY+urZwjouZJYz6+zPDbUTVpZhznuc+huDjm/59IzX7o5pKyc7Y/O8mjzzK/PyY73rgJ27dcx0o/0v4uBuQDSzv4it1I3bWg75uC4+pR+Qq/yyhHgv+3jK7r8oT5/Z//6QcD4JgDfBrDyIQAv3/5kv/7kf/YtAP5bwe6l/haZ3wLgbwHwkuL/GCAi538a4AXF/1aQ/0mA/1HA/3qQDwj4tQT+3sGP/q4/9Mv0/T/99Hcuf2OADxaIA7n7yiFf5lcE3jwCZ7/6nx8AQNcPAeTrhwHdS78fCIBf2q8BsIA+rHx4idtou1YfejwIuUhxwORDEVpZxaoHrz2RsaBzzDO0/cEcBx+s+YDPS+AenX28GDgvx3HsiZ/GscMt+2hH1D7oHMT0q/M/L7xJc0mGz0t10rZln6TrWOmHvonpv3MCaadfzv2BJkZb1MpfX/6xo33Hw6b+pc/Or7485Es0L9m+SOSLdqXpgy4vyN2LWb6kQaPDCyo/XeeFmg/MrLzc7X2AQJ/u5R+f0vc6L+db8Whta8wYR1/xA3upk/ReG3q5LtK3Yo4HTfyMtz8Nr3Oe8fS3TToR+lNW1pTccH6J5B6+3xq/19DP/f8cuvpUY+4aVcwXffO/6sBXezme/np+gJ4pYp5br0kz3i329e8IuznRJ+c8o49s077nc5zjeabP6O75WGXeUTqsutdx9LHOZzZv8oI2coccSr20od1mnvpS/Ryqq7xBBL6fn9D5x/uuHwD4bYAH5FcA+ON+/AS9fgiQL//SIP+t4P/kB//9F38AwIcFfgvAl/6XIC833/72t3/p//7/+O6Hn/3Zf//D3/gb/+6HP/iP/Usf+JsA5OwbxPxuQ7B2fINhVtf/dnC3UL9LQ5zH9cX+LO8Lf6I//a9YPwSoPHeJdxnAcLo+oOB9eInbkF2rDz0wH4bQLEyHVS/5tAedY91Cp520nw9vL3wV81KYdNVLWzmGYzf+GsM9vMaW/toCcwzp9CH9S7+TrhdgLzUV8/KcbV3/tA+dfqR/+iw6N/SxC9/EjHgQL/BJ1YY2HU8f9E2/c16+KIC+QPOSy4sWL5BUXnh5sZzVsy/+/IQWu9jh5bmrfOCAXr7cQesHfeoHEPXln3nkvJgvfM4b+mhNjVeH2MNXYoNP8J3eTMaa0ObadMj6dfJO5jjMi/UwfnzYQrzr3G/hsa2+tOPdC7E/s01blxd+kOT8iAs2uvi8hcz9NkP3ZYe1T/W3xtn1qNjleepUOzlO+qCPnimiZ02H3dlUZV2/58jwx35JK0vU9xky11lbJ+/0c7xK1xhMeM/3vedibevuKimr+ptjp491jq69SF4knXz2TZuO84DpR/oHvcobRoD9zk/C+TbA9W8ClA8BkNc/Ipi/DiDN7/2jy7cG/oe//v94tw8A+CbAS178sy8fKvDyz4cA/NDh//J//pnL7zPzIQD5+oahf9ZQ7Dt85Q8y/kPf/yO7lX35rEFWp3cfgef+9D8/JMgPAJI++hAgvwXwe37kh//yew+mD6X6oMqH2P+fvf8Btm+r6jvR3KquazUl7aINrVaL0ZiSqyT1tIgWGm+45BFs+74iXUX8Ezq0gnI1gN0a6avh2hHE8CdKtWJfIIolIh2U2wSCth3/INpC2veuWFaCPumEIryk6Y6WnepKSLpKuOfNz777s/me8Ztr77X32eff78xVNc8Y89+YY4651jrrO+afPbVObkL+44PPf4r78lVWtnMIn/LUxX/m0vzwg+efRI/WctaHKhuabXZ0TjvO8diWPOgqpEz4bC/1gE898wMXvn4A1zgfy6TN0Vpe+aTLQ1OHql/qrr0sQ9/s81KqbZSrLHVQL3UXEAAWDIBmZ7ePvW8feQLlBO89B0CCV0Es9dNpkDLkdV5U8D8HiLTFWSm2pB86Nmjfe6cnO8dCvkcZO9IdQ+O1bK8NdEgnCkAZ/eZs4f1wLIpO+8qyjhRdAf3cD/QFBxD3AbwrR9LxUu1S49ovafLaOmmVMRdHzlzwWVxKU05trzfWS+3cq5vys93U1XeK7ynfNdL6jvL9NUdr+bm48s9C53TOPp2VR79eO3P9Kulz//+2pdfvkl3xlDVl+2nbaoe8B7bxWS/lZTuNTx1S35Y1rou2AM/6rpUAnOzPKoBcCcCKAJb6f9PbfvrkOW96xQb84wBgCwHAe58l/72ybgMgL4H8WXhk4gBIJ4ArAZrtp4u2/9L2ONCNn10U+POTjPI9yuqApbJHudvKAo95xau/bbVtJgH9PjyAn/IV+BOvDgDiCfrrKgDeL9fZuvkPKvn8Jza1Dp4K+c8v/ynuw6cM+drOOo4utC+F7wblQFOX+k89PwCX8LV+yrbNjk5pw138Lf1Rbu0LbVd9sg/5oZt876OYD2pBSNLK17opFz7bh6/6pb3ks38d23XtQTnrKce2aFe91DcBQ4J/AHaCRsH3WSjAEwAHUBOoQ41DM6ADdbLNCv6tm/IS/FcHQPZXftdYko/dltC0K7oBtAnwWT95x2SO1nsn43N11Fd9aL/aEuCM3bSDNB0DyZt/HhQ9q1zaRj+cRegq0McRQH90rlDPfkrtf7WPz0DacC7NMsiofJWbZSyb1GfwEJpyeu3a50q1S9q1liFeZWZ7qa/vE98vSX0/kSZ/KE0ZyS+Vl3odytvXJXRbGwt13vW/r+bnd8i+fJU1qWP2I/vNPUA874Uen3VSlvKDpg6pfysyrsuwAEvGV4cD+ssAsQqAbQCcA6ADQAroB+wT/AUBf02AbQPs0e+B+n3T2AZwzFUAOA+Q2XUCXEHQzLMEmJ+b9X/ypzxl5QjQISDFKfD4xz/hKy/jfhptXp4FOOPjta//rpNXPPCGMzkBqgNA8C9NR0AF/ekQeMrdX/Gay7PG2VvmHxRX/qOCz39i8FOG/AcIn/8cl/C1vvFs4xBeOdLUpf5Tzw/BXXzWTZm2A+3oW224LT7V+ikbPtuFT52q/vWj1w/h3geyaX5QE0/efKhykzet6pD6wVf9s3+173PxrKM826F9dVFnwUGCrWMDfwA84BMgl0A9eQAdgTT5qkcF/1k/+XQA0C+DfU2qHSrVTtLeeJJneo8qk/444668XbTeK9viVZbtVopDJZ0p8NoUG2GXpTRteJ58b+xqvzKuLUiTT5p2JD3j58H77PWoz2eP9sqnftkn+LTBPnyVk22kDqljvmPm3kMXlY4utpW8aZWm7nM8fZ3LW5pe2+3Et/2vq3n12+Os8ZQ/pW7Zvxxz+bwnkiefuOVSTspf89l+9qVljystwKwv+735qIfHxi1/Wocselb+TpaWsxVgdQBgOAA4H+Ab/vjrTzkA2BIAyCcP8K8jAHr/5/6fq8MFOaCvB/aX/gqAdQHrBOqdZea/1q1OAM4H8PAy7L229Vnteqb6q3Fv41Jn+AX5UvONSxnTpgDP27huiAW+5fkveAgHwKtf/eozOwDmnAAJ/uV1AkANOgL4v3CdzZ//pOTznxj8lCH/Acr7z3EXtXylKb/wtl/pKZ2sk3JTF154Bj4E4fODcI63jlSZ2Y5tB632WxK/pT/ZBrxtS9Wp15f68Wt8nw/obWWVJ632S93g1Tlp9i9s17UD+ZZXhm3YNrqoM8ANsOzSasBgBYjHiAP+AZ8J0pMX+JMm+AcwZ9sCVfOtI1XeHPgX2CZY1Q6VaqOkjuESirxazjZqei/OWJHumC2hPTm2KaXv1a7YmPFhZQY2pIy2EnwnNT/Tsrz5Z6HUnQv0xTz7lRQ7EO/Z4xC7LrF9r4zPXaU+l1DyMt7ja/1sq9dH+5826fG9uik72029fL9At72PrlLeLl2zT2fhF/R5yf84yviNcZ5UXabUu/Y/x34pnzJS9pq33V4/W5FxaQGe0dx77yF8pBH4Sb9j/tQWYPHeT//WR38SsDgAAPuPfcdjN04AeM4O4OcEX/IpD55832N/bvNTgt/5H3z0hNUErBoQxAPeDZkmv40y+8/J/cdeBYA+HgroagDa+cuf9pHf59cRcHpwkjmrI3g3Oi4XQXmG6qy/oF4q6If20swfBwJexIhdjTZ4ZwD+DduW/TOTvy2/5lHeIOiXuipA4J8UJ8DtuAog/5HBTzXkP0L5bf9Es4x80io/4j1d1El6Sr+Umzrlh1/y+XEIn3nJp6xsI3RFj6qvcT94jFd6qg/KzHbgUwf41A8++9L7ECat99G8JM26c3Kz7Z4dq+7Es3/2uUeznHLse7YLYAPwsaQaYF2XhifwPoRPebvAv8BdYE8chwR7vG0bHV32neUq+KfunANA0CjtjeXcmB2aThtL6+b4HMpnW7Zd+4l9GHdtm1QnC2US4GOzjMvPpZu/jWZd+R4lrYbap4ynDZJfYtP6blhSp5bxeavU53Eb7b27LJ/yapvZz0P4lJftwNs+NN8vvfdPpPHenlqo7++lcesuoZQ5l5D97fF7tLur3/7fO5Q2VVZOg1005adOU6u4CbWveQ/Ae19Uarmsn3LXfLab+rTscaUFAG4st+eQPcG/B+5BcQIAwr/8sQ+8rNXDrme6AJwAydVPA/JTgDoBGs/hfvyknk4AflrPA/8ohxPgmz7lFSc4EAisJEA3Z90rwAd8k5ZUvpYlfl6rAJCdTgAOBXzwz3343+LE0AmAI4C+4QzARue9OoBl+zhjBPDbwH3NMy5Fxhd8/p864dk8080xKl8LCzzz3mf9uOB/tQqg7eMHyLMapwL6Q+I6AAT8leIQSPBPHEcgZ2zwnXEtjNhRMv9Ryec/MviphvxHCM9DWNMyvi2/yo546oEONU7aLaG26z9vKP/YdwUGs5ZJGSm/037qKK9dk5qX9Ja+ID/bg09den3Kj95tH80JLpbyyLNsT3a23bMjdk39a9+IV5vWMtZ3jGhHXQBUcyAwAeEhPMA9wfu2Zf+C/6SAepwT2TarB0jPkHXk58A/QDRBpGOT1DHTRhdF673QizuGldayPZ2zj9iAOPaq2yu0Nw4b8nC4bAPw55WHjo6XNMcu+ewb/LYxrLYynjYlLePbeOvvquNz2KP1ma3xWqfqkzrA98Z/V1rKqPKz/dStvnsinu/py+Knpg9t9yhpWwP93FVmj/xtNsj/c7v41uROgE+ZuWtOfuo3tcqbkOMNn/fCNj7rpbzgs82qVys2Li2AA8Cf19MJsFoR8P2f/gnAOACV5fcA8K/61Hf8PMC01cWmB12sJmCfObP3m20AOAJasB0+5Gl7A/5bHuUB/X/hU792Rb/7z75uVR4nwMv/8oOrZfvM3v/iL/3SqQCoJ72GngNAJwBUp8KxKDIB/q4CgL77Bz686hf2sF/0E0cAlHAODoE7cTC4p18HgFRQXyn5plkW+uVPecrJp3zVp64Ccg+6KUal62SBOzn875QDoG0DOBb4x2GQDoAE//KAf1cFcAaI6dd9FYAv1foPK/+ZwU8Z8p9h8vwD9Z9q0iyTfMosfG2/F0enW3RDTrZR/6nXj8Fd8ayfcou+6lL1rHbNeC3b7UvtDzqkTvC1D/nxWz+gE1BUoLEk7oe3coxLa9tVt6p72nQXn3WVW/sHwBP0HYsCHJlFVp7LygXo2yjgnvw6+4+jYhfwV+6cA2AXaHRMelS71fHKeK/etrSsO8c7blLKySet9bPd3n2qLbBpOmocMymOAG1/XmB/l1x07TkBev2ae86wR7VR2jL5tGvylpFm3jY+n0P5Xc9uL9+60tometWQ90Hla9naL9uRpk6d9/ncO7333r5KaeoNPWbY1sf8v7aNbyptgBzlllyWq9S6mQ5PSF2nFj8VctzlvScqNV9aZa3j2Z46JG3FxoVt2cf7ot9/7SM6AAD+nMQP8GY5/gb8rwG6gB1HAEAeGftakveAgHc1+78G/h7wJ6Ut9vqjA8Af8OmsP1sB+PD/0Zf8g5PX3P0Lt4TXvvhXVnk/+fJf3wB/HQPvfe+vnRCYkSewHJ+4jgIpwB9g4QxmzxHAaoJe+lyaTgC+X2jzoR/87RNWAgD+sQmz6ATirAig7wT46hA4xP6MV876C+QF9nO0gn90FPQn/cz/6DNP0Gvfe2KUvz4WwAGY4F/+WA4AnzloLzj7Tx7PP88Q9FXf9vaTb3vWo9tpro81b9U0/1HJ5z80+KkG/yEeSqu8ddy2avvb4lt1q//QidcPzbl4rZt97ehfddSWc7SWN35Lf2gr24avutU+1I/h+rFMXHAxBzxqunWs15NZ260f4ehZda99m4tbz77alnqgF+AKwMwMfYJ2AeA+1FnjnFVGpqBegL6Eok+27dkBOgGQ0ZO7BPzT5zpWc2OkzSrFhqYlb9pZqWO2D61tOs7S2medADhbGLu0d+V7jgBtDTjfxZsP7ZU/1AmwdCyrbYjvY9tDyvr8JZ17Vjvvx817rdZJefBVt15fd6VVGdlGbb+jq+/i240yBvQJuiTs6v/c/zbSuSp9NPX0X8ucTt0dy3rwNaTuU8u/JdT7wDj3inylHTnZDnzq0aIbG8Df1OtOQBrA3/AX3v8NJwL/PGjPGflcpu9MPXk4CZihRh7P+FKDrg6da7PFzN7nvn7ArjPh5AF6AaUE0zkPgDo/+Mf/3yvwDIDO8GOf/aETwspZ0ZwIlDPoLHjgi35mtWrAXxDYrA742Z9brR4AnJPmSoDerGSCkzknQc9BgEwCebTx41/5r05+8hl/tKLw9KWmETdg8+oQYO/zri0Ddcl/BfWCf50CSTNvDvzrCCB/n3th6T0zyl0NC9Tl/zoAfAaOQfPZqryz/zy7b/7bv3mCk4+gE4BVAOtVSlfDYHtq4T/S/MdV/6lNTeYtof5zXBrvyYq02vauOHpRBroJqUt+/FV+24dilk152c6a7+mY9tzG9+pu+lHbSj1SP/jal/qRLHBKKlCsYCrjlO/FU07ytV3iVbeqe/ZrjreOsmzHttVRIAg4A2gz47sLEAoQBf0AduuaB9136b/OgVz+X50IPeBPvQSZAk2BpX3sAUbtkVRbHYMid4kcx+lQWtvI/sA73tC0B/wSJwDjmY6Aau9t8QT9tZx5SR030xhf+NQ7+yNf+9yz/aH2XVrP5y5p7xmt76pd8Soj5cP39Kv3RMZ75avMbLOjX+9dnGnb3uMXlZf6XBa/q6/NtDuBLzKOdSkr9aq2mVpjt4S8H3bxvfotrbaTOqhXK3YzL95XD7zpe08E/tBv+oU3rmaZE/jL52x8OgFIzzKuGMAZ8Oef8bSfYlsBTgECZwe4jJ04vzIAGGV8eV+QB7gnJNg3jVl/lsTjEIAS3BqgDvvSU/1qTgLk4XwAXLO1gADAAKCzIoDVAwL3pAL8OQcB6bkagPKkMYvJdoDf+B//7cYBgBNgSdBJoNPjtZ//v68cAjoF0tbYmXcuS/MT0Cef4J5041LLCvCX0LEV4LZ9v0zf+7ce+JCgP+nLv//lR90GkI4EnQAu+ycO4Bf8S0ljJQLPwHUbAf851X9YxOs/NeJTL+z6p5n5vfolrdfukrSdutUPQT4WaxrxXvqOPvT069l0W1pPRrdP2Cv1qX2oH8H5gQzfAxSADdKTVj7jtWxPJmm17apb1T37Vfksqxzl2z46EgRVgi7AFoBw1/kAzPQD8CkLKK8ny5M/B9YF7NBeyFUE6GGZbfKUeZXAvzafo47NEppjKt+rl2051lLHXJpjjwMHkL/kOtQRUMF/jQv4SWc8ub8Yf3SrDgB1ty9S+ypNe/TslWnadV+qjF69+myWd/jse2uuXMqr7anHIbTKynY6uvTewaRte29f5by5/pwlfVd/m7m2An/qn9fV0632dWqN3xLyvpjje/VaWpVfdWhFttqD/Nv1upNZ4gT+8Pd/yytXe/t7ALqCfGfUM73WE1hbRko56gOymdUX3CfoB3BmOuUq0K/ya/vHitsOOrN6wJUD0Jf8529ZgQyBPQ6BzQqC9aoB0shP4AKfjgIcC0w+cA7AEuC/rQxOARwBOAWwGc6Ar/i0N2yC2wc8Q6GCe0D+3JkAucd/Cfi3zPhVgNvvVYLzLkF/5Y+1DaAH/nl+XP5PvqAfykoAAlt/iFPuut5//lOu/7zqPzfi01yY+8dpuvWIy3dor82laVOTd0pH205aPwq3xbPeFr2rftWOS+JVRsbp1y0hdev1IT+YEzDACySgFWQYT5rlTDctZfX42nbqBd/TPfsGX8soQ9m2i26CKKgOAEEZYBsA1lsNACgT+M+VA7QJ3JMK7irNMul8WLKKQJ2l9qWCRscDqh2k2qdS7bcPRUaWr/HMm+PrOBKnrOnytX7V3/5l3+vYO/77OAFwFOgI4F7Q9lLGE77STLOsadxL6MAKEIJyHc+8X+Frn+yrtNqi2kob9mxa7d2LW69H63PZey9FWr7DKr/1fdZ75tW1199MO1Dvqt+Sd/Z1L1P7nPF9+taG/MqAXPTmSv2zX/DTtnDGezzblW/N3ayLj3b29rPPn+CsP7PdAub7P/f/XPFS06GCYXlm4AHq/8W/91+vAH3u47cedTYrBtrhgcTNg5KnHIE/4FSAmrrZbpWR8i6SX/VtvWqArQRuJwD8APpPOQTaloK6lQDwYjnOHziGA6A6B3QI4AwwYG8cAdi4OgSc5ZfqDBDMH0p5/9+sp+327u09dz/9eyroz3gC98rrAKvpNc5zRLA81OAKAOqkAwCe2X8dAKzeYSsA/z+uy4jwD4rLf1Q9uuif57rTU5M1G7aU8Z9ybWvfeLft+g+deO8jsabVejN9qzr2bLhPWpWX8Vv6V3WsfcgPY/gEDwKKHhW4CioTlFA+41mmJ4u0bBe+6lX13hbPusq1XXQRUAmwoIIy+wUgSycAs/MJ/smvB8nNzf4L9JLanmm0m6sJdjkAsj589sX+VbCoDaTaJmm1XcaX8jl+yffqbxvHXXlVXvbDPkrr/Zg2wnZ1vJeuCGDMd42V91RS7iXq4fThPmLWBR3qWKJb6lrH1GfLfkLTDtVG2pR0+WPQ+p4hPvM+5B2V76xd/N7vtH36U/We0bnqOPe+btU3QJcyXHN0W95cnbOkU/ciQ69/mQbPZZ8ejV3M354d6hhPTZVDA7KoW2USz7Zb9FL6T7sXdvkugLL8+7P/y8/92fxJPxwAz3nTK04t+een6ADQ0jkwDZAE+HtY3X/4wumRe+552smX3XX3IwDGDZD/0q9/5N4WOMmfn+hj6T4BUA/wB0Aji7hOAEApDgUCadaBsuff4HkByLhshwAz7q/4k//yVGDFAGm5YsADCXOVgDyrAHAAvPEL//WZVwFUJ0DG3TaA3VmFYchVAvA6YXAEHDrzn84CDhxsN/9lvHcu7Jm7SQ2xhScBf+VffcZfA3DVzCseeMOp7QQ6AKA4AXAAcPgfzw/BgwB51nQC8MsgnFdw3cbHhyX/ecn3/slNrYPdkP8MKFPjc/Vaeq+dQ9LQi3rQTUCPs4SUFXzVT5vN0VZ182KaK0N6lZvxqeXfErJv9QO5goQEEAkskgd4AFaYvQSUkCcYEWzVtKzf47Nd+KrXUtCS9ZBjW+oloErQLKAWpOUMPwANcEYaAfAG8KsgsQcEkYtM5Sc1XYpcnQ60py6VVpnZjwoY7bM2kC6xddrxmHzef0vHNOskX/XKftlXqHaAOv5JsdshToC8BwDxAHpm8XHmEJzVh5LHfUM5x5n6xBn7Oo51LNE3+wGffYTP/lfbYLd97J3vjH343vtnnZbvqX34re+z1C3vjTk+yyff0bvquO2d3Kpf+Qv9uXp0W98OzXu0tU/+td1PplwsZ/tJ7Vsda+NTU7EbuHfm8lq69ZPaVtJW9Pa+WObPbP/qZ/z+yV0nj1sHnQAc9CcI7wF9VgDgCKgrAQDlAH9OeQf4I9efDHzMex9/8th3PHYV4Am2C3/PD9+9+n1uQKdtQ1mmLuAU+NOOjoBtlHIEDwRUbq9PF5UG8MduhnQOvPLJ/+YRAkv0cQ54+CCrBQAwrATACQBQT+B+3jztoSdjg0MmHQKsEsARgIMHR08C+33467oU+/Z+UxzWu11bAHAI1Bn9feKuogHo6wzI+qQTZ8b/53/iX3zSAfAjv3fy1h/6wCpdhxsrAl7y/J+5NgcC8o/KK/9pJZ//4OSnVulYAZnIUvYxaFe3/BisPB+TNc34Wr8qs+qZNku+VT/1QZZ5u/jaRsarPgefC1BBRsYBJYBiQGkFJ704dXvARZkJYOAriFkCYLIOMpStPhX4AbQE5gm26RegMME/aYC5BH7wADpAXNaHV+4SSnm3AdAmdZbIS+CYfbO/1d5LbJw23JdPoLlkvCpQ87mao7V81S/759h732mTtJM8djyrE6DeF7vi3jd5f+R4wquf1D5Is4/Z97RLtVnG5+xsOmV7vGnS9h675Z0TafluSn7uHZdl5LvybX+Opv61TOhXZdumtKdnq755d1ee+FW40HvpZdke3dX/Wsc2TTd+VWivP451j05N8SWhV9e0bBM7XFXboNvRLmb8Bd9Sf+KPmX+Bcs6eC/alCZgpBxB01h/Hgs4E5NrGLpqOh5y9Z0YaJ4BbCraB/l15OARYMZCOhuzLRfHpCIAX/EsB3QYP8pPuA/iRfUyHQToDdMykQwD+8Xf+tZNDnAH8XzjaTT4EXZoF+Oaps/41/rJvf/DU7H0C+DneZf+CfinptY7g/3943T89eagB/ww4ATgLAPC/2hLQtgL8p2/7vRO+2y7NaAc07D+r/Ccm7z+4pFNr4xghZfZ4dUjaK1fTZnWrH4lz8S39q20RT/0q37JvuSjDlbTWy3ivTdKmGrI/CQTgEzQkmIBPoJE8QARgDAAGpAhMpJSVhxpPGZXPtlMneXVN/c2TKkPZ6iCQSqAlABNw059emAOIzOxS3vpQZe5DsSGgkdUE1NslL/uQYNG+am9toE2g2ilp2vMi+LwX9+VTv+xD9tF+Q9Mm8N4H0LQjY1C3d+wC8ofms0og74/UI8dTXWsfsn/Z77RH2kl+X1tvK1/fLyU+917Kd9c2vlf/lncabW7TseYVHVNer72efk3EtbzoS716aXNlLKtNajnjljN+1aj62Y+kvXvAtKl1ZC5YptKUXXnsQtpte6UDQIDuTD2gLh0ACcQFxzn7Tz7AvM766wAA9Ctb2nME4Hhgtp8AOKcN24aiE06GYzgBqpPg1CqBtjyf9uzreVLAuUHgLz0raHdMGBcDDhpm67ExTpV9HAm9smy1QA6hrgzQKYAzYOk2gfGrALfPK+dF3/GC36qgv8Z7wD2BPPku6yddwJ+UMsQJrJihHKCemX/AP2C/F3AI6ASg3j0/9r98/DM++rGP8z121Uch/znVf17G6z8841Pr3CGB+tRTzhy1/W10rq5tHKLftjq1vTndWvdO/eOnHJf00dij8TkZvfTafref+UEsKJAmeEhQAZ+Ao/KAVQANQBjAUkHXXLzKMV7bTr0qj+41zfrKEzwJphJsCcIScMOnEwBg2Fv6D/hj5j7rKq9S2yQdvuYTd9l4Ly/TlCW1X1D7at+h2gNabeXYa8eMH5vPe++sfOqWfcq+pg20izRtBq8tGWuW5h8K7JfUQz73V44pvDpIq47qDs2+2ee0A3zaCH6JzdvLZzpj6L2HTOu9t7alWS/pIv3s68K+pHz5qlcTtXlHk3c7Xtmv5Lf1dWm5bTIuOg+d54Ljv41Orf62fPLm5LeszX0Ef9te6QAQoAPOmYF3Dz771BOA90AxaQLNz3jTp6+AvsAfx4KrCqTmVQfAd/9K2/cf7cEbT0cAPOBVJwDAvYL5Y8RdJZBbB9TnPBwC1QnAMn8cAYc4AajzJ57wOSvQzV5rfprwobc9dMLPr33jN37DyZd88ZecTJ82ndxxxx0ryrkM2JNxZ4VBD+jXNNog8MsHGaoTwEMEoTiWlqwM4H/mbfvg3aCOsa++Av4aT7C/hMcZAODPvf8V/BMH+DvzD8UZYKjOgHQC4AC481d/lfMopuswVP6Dn/uHNvePkM6RB10SLDsnz/Q5PebSrVfpVp34gFTv5E0LWuUSn9OlZe39zx9ZXEnn5JPe02dq6aeCH8jQBAoJIgQWSRN4JA9ocb+zjoAELPLUqXzKkc824VOvXbx1lWV7AioBFlQQliA+wT98b+m/QI886yoraW3LuIAvy9IWjhTkZXry1pfaJ6l9te9Q7VHtluN+HnzeY7v4en/WeK9+6px9s7/QtIO20VZJtSeUcZhz+DjuZ6HcMzmm8Nk+fOoGr+7Q7FP2NW2QtoHv2a/aOOOUN568aR3ae++Ytu19tSRPOZVOHT32SavyiM/p07LGdZtYgDHmmhtr0nv3xtK0bXJt2/aht+WFA4D9+O7DB6D/P/+bV34CAMdsLrPtmxBgPB0CAGHKAB7zLIEK9o1DCYJ/nAF/4f3fsPq5vAqqkUtbCf5tmzT0BFSqKysG3J+Og8DDAQHyx3QSpGNA+6hX7cPSOGCfsgB+gT88oFsHgLQC8bk49mEJ9D/+R7/zyAc/+KHVmTY4twnE39V+deB7/+bfPPlPnvHo3n1WBhjyoEbsm20I/HvgX0cA9gfsMz6uAqiUwx85I6J3RsBYBXB7vHJ2HQSIM2AJ6M8ygPvc9088VwAk+AfoA/5/43/8tycf+O1/twnveegPTq0IcCUAqwBe+cB7TnACsB1g/W115Qdj2z+0bf8Up9Yz8pfSbbK26bAkb042uu0bsk9V7pwurZkNiIc/y0UbXHNtkV71mlraqZCgIAFDAgn4BBkVVCUYAagAYNnf7NL4BC49nvoV1Ciztlv16sWzjnJsN0GVgEsgJoiXAgLh55b+CwBdsq+cpLYxRwV+WYd2CZmWfJWVfbKf9huqPdJWOdbJ5/1wnny9D/eJV71S/+yj/U5baB9p2k5e+zL2nsvgWB+Lssogx1TetqXqBFVnaPbJfmbf0ybVXsT3sffCsvVdk/Ft76gmfvNOpBzXtvIpN/mp1dsnZN3ka9tN7C36kTau62+Bs9xvec9Uvt5DGcdqtnv9LbijBxy4xow9TgDAO6fwA6ABfIJqAe5qNh6HwNoRIBX4AjYF9bmaQMAP0NcJ4AoAwT+yAL/IkgLeAdrVCVCdAegL2FSPSimfgbbom44C2zm3FQNrJ8Y2RwAz/+RDBf9QeR0BCcIP4QHsDz379z/OLCgHCX74n33kxF+6efjhhz/BCoHXvvaHT9iX/Vee8byTpz/53hMcAQYAPQC/An/GSOAvJY1xuQX0Nxlf+l/9jUcPh/z+T//E49ah5wjg/+SOW3hkX3EL8N1TZ/xrfN9fA3BLgE4BAD88FIdXzvzjAKjgX0cAzwH5ngtAPVYC4AQA/OMEIPA9d8XNvPmnlf/Mkq//BI8dz7YO5XfpNLVBoAx0V5iTNadbE7nXhZwll+WSVh2qrlMTvAkJEBI4JKCAF2hIE4QkD0ABwAKMcQQAoCuASTAjoJGmLHjbS6o+23RMObYnoBJgQQVfAn+o4B+6bSZYJ4cypCl/KU9d9UEHZUl7cuxPta9912Zppxxj+Bz/8+TznjsrX/XMPtlX+w7VHlDvBWjaD77amHHQoXUs8M8HUc/BU9tO3VJn+OyP/bTf0LRH2uoAu/s+7NH6Xqnx+h7KeFNlA/Th89r2LiOvtjMXn1pZwlx+pqdulW8ixnWbWmDXvea9kPfKHG/ZOYoJba/yt6l5V92aPu/z7nrWn3/G034KB4Cz2zoCNg4AwH+GcAQAuimfKwBwAvQAfzoCvukX3ngK9AOCAefMGrOiALpqs7VFG4J/qWCfOjggjG+jAu10CshfhGMAO9EndBT46xxIwA/oF/gDuAH80kPAf68O8lbL/Rto4tcFWBWAU4AA/973/toJvzwAsOJ30l0VgNNEoJ+UfmUc3pUAOBS++ju/+mMC/m1UZ8BYBXB7vHaWnAMgmF9Cc7ZfwO/SfiiAHjAvsJ9zAJBeHQCreu0nA6sTgF80uIqjUf9hzf1zI33uH+NZ07e1eUjeWfWZq9/ThTEl3St5045Fe+2bVnWeWqOnQgIFAUSCCnjBhjSBSOUBNM6gQgE9Faj2gE0FOMq1zaSpX6bDWw9qOwmqBFwC7HQAyOPEmAN+c/u4BfLKlwowpaYnta46Gc8y8tkXePuY/dYm2slxleaYnwdf77Fjxqu+9sm+1vs17aKtoNWOdXwYA5xYjPfcvbBPOk6jJQ6eqpc6Zz/q+NJn7QBNGy2wfX1HnCXue6fSpsYG+JOXV8bla/0aP4uO1K3yMo5uxMd1+1kgx9Uxp5fy22jec9vKZV7Kvv2subxHE0t2qyPgFuCfjoA1D3jmJ/zmVgEI/HUKfP0b37QB/wJgwDGzzIB/96PbtqC/UsF+AmvT9qE6AaD8wkHGdQzMrRY4ZHuBjhbOF0A+KxNcAZCz/4B0HAHHBv89h4BpuUqA7QOsFsBRQP+/8s6nr8JSJwB9W/0UZMz2bwP/mUe98bOAyx/eq1rynruf/j111r/GWQWwBPxbhgP+APgA/gT48An+KZP5zv5DdQBQ3jobHifAi3/l1EqAz3ne9/w3V9XG6MU/NK78x1b5/Od4DL7KP2b8GPohY5dOK6Oty8mfhdLetsv8nl7Z56kJORUSMCSQmANVFWgLTgAr8ICnnEHHCUC6YKZHzVdWUgHPEpr1bEdQJYiGJtgW+EO3zf4zi9tbxp1y5bNNwaXUMj2KXs4U9/KVC7V/UPutjXLsHNMcZ/l6L1xQnPuRezDvyznectBNUH/7Bs0+awftAk17wacte2PjWOjQ2gfw17LIyHtOPse46pP6Zj/sW/ZXO2gXaNqr8HO2PjS9986paU2FxRd1uaqMXnwfnXv1TbO9VcPjz21vAcady/E/Jk25q0bWf2wz024SPz3l7q94DTPwAFXBtWB8juIA4DwBzxRIZwCz/cgBEDJbD+AFoEtJE/jjBAAYZztZNp0AyQuk9wH+vbIJ/uFxCBjMQzf6g95zjoF9thX0HAKv/fz//cLBv04AKDP4zLa+5u5fWI0FccaFcWI1ADrXGX/j2Ef+u//s604S2O/iAf4ZWKFykx6+262vfPNUwN+LC+63Uff+O+PfA/fu7wfMM8NP2QT+8qSTL+iv9KHmBMDRkNsBPv873vWuNj5X6v9DKrPkn+M+H2JzZZe0c6wyczrsSp9rn+eLPC7po7GL/TunX/ZraiqdCgkcBBNzoEoAkqCk8oBYQRAzqQlmdvFVlnHbnaOWg2YbCawEXAIwaDoA5mb/3daQ9eCVJxVIZptzvHUqzUMVsz3Kpazso33XNoLDHMsc4zr+vXiCyCV8T8Y6jXtvaiHvwX156p8K9if7aL+h2kLb1PsC+6U95et4cH9wX5zlpwJ7BwDO3T/qsWR86Wf2X5tUW63j+9p8V/m5d02mt6Y378N8LyZPmXopg3T586ApXx7KtUvHR0uNv9fZAo5x0mPcZ9gkZV5nGx1V98c//glfWZ0AK5DdWQEAkObXA3QAJGVrAEDfmX6p4BtQrWMAQE3w5H1+Yo6wcQasHQfWhVIfKijPvGPwgn4ouhvvrRRAd4DxPuB/ruzGKbBeIeCWgATp58Gz2oAAgMemq1UKDfhvAH3jPReA+8N0y2dc/oEv+plHV4jMrARIwN/juRePenMPYRdqgSW/BsD5EzictjkAyPOQvx74B9ynAyCdAJS3jmXcLnAL+HcbQXMCsM3gOT/7fzzimQDQq7oaoP4j2/YPctdHYy9/m7zM4+bq6TKXnnUvgr/Qm3/dmPbItk2rfa62n1qlTRA8JKCA74GqHrgSYEkF04AfQE0CmjneutBesN2kvXIpX0CVwC6BdToAcuWCDgwofck6u8Cbbc5RwXzqBI9cdQBwwhvQQXnZP/uvTRyvHEfHFppjfgF8vefOEt/cq+idfcq+2n/tAdVG0LQdvDaF1vFwTBgXnFrcyziD8t5YwvccALWt1AM+9VR/+2Qfs99pj864brN7fU8cI95U2AB3+G0X7c1d5iU9hn4pY67tkX77WSDvI3uXaZXP+2SOR07Wy7htDBoWYPYVkMcs9waEzzgAvuUvvXjlAPCXBXACwH/rM16+qisY1wEgBUjDAxYtg8NgFdZtnXICkLZ2BAj+oaStVit0nASWV/4uqtwsJ/Cfo3WVALqwB/7oDoEGwHGYsCz/2FsDEvwL3qHYn3sAShyeXwz4zP/oM1fbNrIsPPdKUnm2l+QKgB7Y91cB+JlCAnHK8b81bs3BXiML8D3Um/WvadsOBEznAIDdmXyowB5e0O8ZAFD3+gv0zTNeqfkr2pwA7/6BD9/iBGBlAN+bbRimyx4K/6mhx9w/vyXpfnwuKdsrk+3Lz9Fa33I1/RhxZSetPPHLuOb651hIp6bcJiSISHAh4IAKQiqwEqQIXAAxHKYGQAI8Zbr8HBWoKbNH59q3rrITWAm6eMBqYHl/D8wB3nASZHnlJM12Ko8uNS3jyCFOO9sAJjraL6m2cVwcK8cvxzTHOnjuBe4B7wnjpO0brJuydvFL71Vlb3TKvtlfqDbQJvVe0XZz45LjKs/4Mz6MAUv6t41TvY96WwCUK837IfVzfKH2x/5ln7VFZ8x69p+z+VnTW/Ob/xXySeHnLtr2Sj7TTD9UT2SljJQtP+jNsID3gb013qOk1UC9mmZdZQ7at8Cdf/HzvvYf4gRgdlsnQF0JAFDmoLic+Yfn4DdmkF/yKQ+uQCO8WwGgBOoKEBNwJ5/OAHVY0bWjgLLElZd1t/G7HAPVEVDBf10FkPmZ5wqHYzkDctWANsWGbBs4xCkwB/yRaQD8oz/t/dhnf2jF4wAApNeVANaplHpsCZgD/soT/EtxAnzWH/9sfpud/5HjuoYWWLQKoP0s4CseeMOplQDM+Av+4VmaDzBP0K8zIGf2BfGCe+PVGWC+1HJS03ECvPF1v3eLI+BtH/rYI3xr8l3Id96OofEbb0exs2X7zy1p7x/gsdLQVlnyS3tQdbS+8s5CU9ZSfS6jXLWBffZmkU5NuVUQREATXAg4pAKRCqwEKwIYbl6cAMxmA6AyXfBlWo8ij3TlLqEpJ0GVQEuagB4eoN8DbrvAf7YhnzpU3jI9OueEUC+3IlC32oWxcHwcuxxPxzio43/R1PtwKe3pt7pf6Uv20X5rB+jcvZrj0hsL7xNp3i/cEzi1uLeXHBTIKo597qPULe95+2L/7K82iLHVPtV2S22+b7nW9MHvaupuu9AlL+NJt+lL3SybsjKvpo/4zbCA94a9NZ73FHmZ3otbP/MybfBhAVYBsO8b8HcKfK9n50kDZOsAyBUALP/HcSBA1xmAQ4AgoNzI7cze9wA8wNI6OiOkvfJnTRPYI0f+UIqTwq0C5+kQwB5LHAI98I9t08YC+Z4TQJBenQApw/pSnQB1tl9ZPYrTYPwyQDyY14zl2+cVr/62kzrr34vnSgBAv2F1+B8OgBYA5ukEEPwL8AHwgvelVNAPVU7WxQmQjgC2BuAAyPC33v0bJz/xxjf+AgGc8NKXvfQNhHe96T0nUL4Jz2vo/MeH/PyneF58bSf7pS67aNZJefLSpX2wvNT2jSeFv6wr9UKHXv8qKJhauU0QTEAFGFBBB1QgAk2AIp8ABnAFUCLUdOMCWuNJkUlc2bto1oVPcCeYg1ZAV4EcoA2Ql+WyPnzK3taHqlPVSzk9J4TgPym6YU90y7FwjBw3xzLHd83Xe+Ai4r17cZ+01HFzv9If+5n3rLbYdr/WcXEcpHW8632D/XUGsEWDcemtDMABlvdSlWt70tTL+91xtl+OMdT+l3FOe8HvY+ulZZvYU3KNQ7mQc6yrJ0s9acP8HjUtdemlZf7gb5YF5u4H0+doWskymQY/l17L3Zg47zFOf+dwvhXoZtY9wD88wJifekvw7/J/l/pTjplrgP8r7/i7pwLActds/L4gvievl7aP3ENBf62nEwBHAHwG0o5xsKCrBJCF4wXw7eoAQT9UUL6UMo7I5H54+pPvXTl+vuyuux8BtFcngDKpIy/F+XHHHXesQg/wZ5qOAug4FPD6vnqW/CLAxiHQzgTg5/gI6QBgTz7g3MBhfoB04wnik08gX3nKkYYTwaBc86xDXEcAjggPGcQZ0QvI45c0Hn744U/wvXiRo+c/s6TwZwnon/Jqf8yr6bvic/VM35fW9qy/NL2WO++4+kEzVHAwtfxNEFAkoNrHCZAABh5gw2GAgCXjUvLkoduCYKhHe/UEVNAKuhLY15l3QBxpWabWT9n2oafDXJp1pLTlQXMASZwBgEpCb8k5ZdBpDhg6hjmua76OvXHvD+PHoMo8Fk2dNvcr/bK/ec8KltMJUO+dHJ86psTruBPP+yJ57m/uG8YrHTbw3P/WrTJru+qUuu45zmkn+Dn7t6xb3ruU5epR5Zhfy6wqrv+Yl2nH4g+VfWi9Y+k95Fx9C3iPSHdpbDlplu+lZf5N5u9k+TWrAACqgGgA3SasZ+0Brvd+6dc/wh7vz3jTp6+AIeAaBwBlPeUfYAr4A0RmEAyv5C5cCbAPeD9r2Qril8Sf85n/9ycoJ4VnZj4BPzxpyqNsr/wxHAPYPR0w7ukXlEOxf9LkMw8HAOc+PPh9D51wOvsXfP6fWm0HYEyVZ/m5ODJwAiTYh2crgKCfmX94nAyUJ/CNe5MfyGvc92nJKoA3/dSrTv6nX3/dyUNv+yT4xxHACoA3/+3f3MzOA/ozXgF/Be+C+EotB1hPEF9/KUD51scBQB3PIXBFgjIA/vyUJoHvz4sat94/M9N6lLQM6Nkrl+nw53nZ/nm2cdVk5xgkX0HC1BTfBAFVzjT2ABXAJIGKvCBGCsgBHAF+SBP09Hjr9CjySZ+jWcc2pBV48fCQBjhLwAboTmBX6ylPmm3Ka4ek5vUotsEBoI2qbGaQdRCgK+WQfU7AMO8T+Xq/zMUtv4vynFCGq0fn6td2p1Z/FZbeszkm8HU8tL20jn/G8z6RxxHAPZWrSjwHIOvK2w606qKuZxjnasdmrq69a3qtl2NknnXMMw69qMu2d9GL0me0c3tZYNxX5zSeOABYBQAIPeUAwBmwDgBseMpw2JvgH3AL+Kc+p8e7miDBf493bzv1kXtWAH+s+gB1nBoC9h5NAE8+feiB/Cz3lz/tI7+fjgHlcpYAvwBAcOaepf3YhPLYTqeKjhW3V7gKIGlv9YUAfRetgJ5x/o6ve9nGCfAnnvA5qzGu5Wo82+HeAPQn4PeMgC9/ylNW9w4rC+ibgXMpzulWH2LP2QKs4HCWf84ZoAPgH/3v7zr5xV/+uyc/9Zp3rFYC6AAQ9O+a9a+AXeDeo5YF9GfQOWAdy9E2aYL9dAKYBvD/4Ac/tFr6f85mnRXvP8VagHQDeZbLtFqnxq1T00d8uQWqDY07DtKdYCpnVJeuAqggxjggFuBKPEGPwMc08603RwVv0iynrKQCrqSANpbT6wAAqAHgBHNZFj7lZXvwgrVdtNZDZq6QqPnGdQLgoCBNUAjVOcMYCYTb7TJFqGPtPXDRlLu4tklaXuRzJc062ZepldsE+95zXKW96hhpY2mOM3y9D4hzj1TqfQNlvLi3WFHiqpIqp7Zj+1B1VO8c4xxn+hw2SNvAp93kW/LGtvB5UYarR3tpj5Z+9K/5mTb4YYFhgWGBWyzA3mtOfQeACfilFVi75B/aA/9LHQDbnAIAystwCgDKAeR1ll6wLqXfgnmBv3UE/Ukzz3Tr6wBw+f7cT//pHOCgPQA2s/sJ/HUS5AqAdAYIyhOsy0stk1QnADO0/Nxfb1WB5ZUjJZ3y99zztM3BgDnbL+CX+qsKxJ/4pC+8/5YbdSRcCwtwIOAc+Mc5kA4AnAC/+r63b5wAbAHAAZBOAEA5gFxwLhW070OtqzzrZjptExfoV8rMP8CfAI66SoOyz4dfLVvjV6lf112XtC18DRUsTK3MJgimoAIqQQhUYAIVrCRNMAPPTQsQyq0AFQBlnDrEq5yl8ZQF8CJeARhAzSXbzNgC2hLUZfmUV3XIfi/llaFexrdR9CGfNrS/Y+IYOW45lo3Psa73wUXEmwqn7j/i9UKPvLbplf2ZWqVNsP/aA6qN8r6t41TtnuOdfN4T8tucAdz33GNs2+Detw405cKrQ+p2xHHGtj0bL0m3XqW17q58yo9rWGBY4IZbgBUAOgAAbAA4Abg0HQHbwP9ZHADVKcAqAQA2+mT7yQPKiUszL9Pn8imDfFckCPIB6oBzAmmCfrcyZDkBPmk9PtOUhV1z5n8O+Jv+83/x4ycGnAE4AtAFsKwjAD5Bf+UF6ttognfLMS494G9ZqeUrXf06QBtHAD46C/SZ+a+z/5n3+Mc/4Stv+KN5LbvPdx4OgJ4TAPD/9r//d1ZbAAD/hn/8T37thIP0XvviXzmpTgDBOVTgDpXP/EN4ZUEF/7ldIGf/4QX/HPp3VQbIj72ros/Qo28BxwlaQwIp+MkgkEoHwByYqk4AgUxSgBAz7QKhCn6MU6fyKWcXb91KE3jJA9zQB72YWTe90pRV20+wlsBc4Cat5YxXeTVuuaTKhApuGRvHzDFc0xzjOv55b7TiG4CY6b06S9J68kjzsg3jc9Ry2Wb2aa/7Nm2XNoWvts9xh+e+kNZ7ZFvcbQEe3ljlEs+2Uy/1zXE+41hjZ21abZ7p8nO0yrFclTniwwLDAsMCpyzAO45VAOy/dgZZRwBgroJqZq8pm8v+4Q3kVTB/jLggHcAJgAZMV91Mk/acAJmHHHRzFhpKHMDvagfK0GfqERLQw8+lZx7yVs6MJosl/m/8wn99IriXCvCJw5tunDRXClAf/WgbUI3NcQRU0F/jgvMK2mvcckn3LQPwt6/oa8gtDtscAqw++IK77vrmUzfriFwLC7AVoOcEcPafWX/Bf9L3vvfXNisAtq0CSNB+TB4HQoJ/Z/9z1p+l/3xjXouBGEpeOQv4cQ7NMAukWrnu4WrpBBCcQBO09MAUs+sAba5dToAESAAj4wmSenwCKetUKlAD/OOUQBf1MS9p1s82a3/TFtv4Wi/jyNd2pptmPGWfERRyk3pfwM9dlunRvJeon2WSV7ZpxrfRLAtfw+y9qyNkifNKu0pzjOXzHkg+75MlPI4A7jloyrEdqbpAHe89xzpthY3Tlmlz06VzZc2X9mRk2uCHBYYFhgVmLcBMK4ewsYeflQAA+ZxNTmcAvHv+BfyVAkSPAfh3ycgVAgDhOWdApltO0C4V5CMTJwhtUw+QDXXJPiDeOlCdAYJ94+RRp4L+HvBPoC/Yh7rsH5rOAWQAor/tWa8/+fo3vunkL7z/G04e897Hn9zzw3cvcgLsC+TTCSCvjErJ124C/h61P/YF+2MrVzXkyoCn3P0Vr5m9eUfGlbUAzpvqBNjlANAZ8Kvveng1w5/gPmf3TcdJYDCtUurVtBrvzfwL/pn1//A/+8hq5p+JI77/rqzRh2LXwgJ+vEMzJJCaWt6pIJgC+BsEI1ABCjSBi2BGCkACaD/qAjg5Yck9YCiB0DYeOeQnTT7zenIqQGPfPaftoxN8za8y7Ac0+5n9h0/bJF/LpYylfMpI2Y6LY1XGMMc3x937oRXfXJmW/KbAmjEvafK1PHHze3m70qwLzZB9g58M2gKqfaBpt7RnjkGOtfdYvR8yXu+duTh1yMMBgEMMJxRp2V7qoX7qbD/sm31d07RF2kjbtWI7x2BpWctJkT2uYYFhgWGBnRYA/APgAf+czk7Iw/xcEeBMMnFn/6sjwHrOou8C8MfMr6sDEvTLA8rhE8DLb4BsA6Kv+JP/crPtAN4yUECqzgABPuk94E/dCn4r2BfwC4hzlr9X9sE/9+F/+8oH3nPyV1/xskce90/uOrkltF9pwK6O1xy1vwD2Ob6CfeNzdA740yfskH3s8doKZ0CuDOB+Wh8MyP/VcV0jC/DTgDoBoEsdADgCWA3AtgDBeq4IMG0J3eUA6IF/l/oL/N/33l//3/hGvEamH6peQQvkRzp8LyR4mFqZTRBsLAFSCV7gE9jAuw1AJwBnAmxbFp0gq/ICs2xDMFXL1jgAzJl/nAA8ZAnaavlsI/soQJMK1Oao5ZKmvG181oG3jSOAwjbci6+8l3ZVWlp2aTna23XvHs0J0Lt/vefq/ZFx7iPi2+4n87nvcATggIJyX5KWDgL0OONYa7c6XnN2z3T5SrfJsuxcu7XuiA8LDAvcEAswQwdoF/wz+y+Iz1l9ZmMFlQDtCvx1IPAzgfymNwfGHRPc7ytLZ8Bq9r1zfoCAXjAPJQ3AXoP79KHkeUhglaFTAPC6C/g7oy/47wF90yj7mrt/4QTQ/5w3veJWwN9xArASoDpueo6ABP7VEbAtfku91mdWSgjgk/bAf3UG1Lh13CrA+HA2AE4A/v/ekMfztulmXQnAGQDO9C+hnA/wi7/0SxtngDP+6RCQl6ZjwJUDvTQcDKw28Cf93N8vDeCf31K3zdiMjlyOBbyZoDWkA+AUiGplu1sBBCXQBKcJYhM4C54A/DoApKwGAAQBfiqYElCZrhzjS6lyaAPQT9se/KcMyxiHZh+yb9nntMUSPuvKp+zkzU+abRzoAPAO9J4wPkeXlpurf6x09dh2/06tsU3Yx4GFjdP28Dn+8nl/HMqnLO47QD/nUHBgIPclzjGcVOQ53gvHutpGm20bg16ZXpoyzJOaPuiwwLDAsEDXAuz5F7gz6z8H/tMRAPBneX+mwZP+sm9/cPWb2Lwv2SPLR/XqUK/mDADAAsr3BfLHKl8dAoB1ATzUw/6SpiMA8A9Ilcpbntl/eJ0F5BsA8IJ5KQC3OgFIM5+8lzz/Z1bL+//033vyJ26Z5e+A/lrm6772a3auAsAp0Dvcb26Gv5fuOQn2V0p/jhGwRYYHnvi+97O/vN3UUwv8zxv/95oRrvrFSiNXAvBLAP/Tr79uLyeAjgKcAawMwCHAO8b3TJ3lF/RDPenf8lDqI+fhhx/+hGBfyvuL9G9/0Yu+/6rbdeh3vSyQLyt5X2JJ0wkwtS5uwj4gaheAAtB48r4OACiAh3/kgHOcAQQA0LZtAoAoQXrSOVAG+E8HBIBrrqzyBGrZr11gXKCWVBCXNOUs5bN+yneMctwa75jmOMu37Gt5qX+l9nWRAwvbpS3T/jnWc04A74tt98+2POsnpTzPB/cp9z33J44B9HSsd4wzfU+7MMDED72sW+mh8ka9YYFhgRtogUPAfwX9rBQA+L/0ef/t6ie88uPaj2qWz7qElhk2ynDCNw6BY4H7feWwnJzZZIC/y/YF8gn6Scu44F4q0IWmYyDTBfRSgSzxBPzm0943/cIbF83yV8Bf45/xpk9fdB6AToCc1ZevNB0Ac8v96T99m6NncQpoJyiOAAKrAtYOgRv4JF+7Lk/5E4FuBxDcn5XqHADYZyDdUNswHdBP8ADya2fZofC1s4DgAMXlpQmgFoGoJQAqAY48AAewnw6A5HEGEEjDWQAo2gamduVRHyCVjgcful5d9ZQmIEygmP0XoO2iWQc+5W3jaz3itrUnKBTMXaebt+ps3HtXOnsPayOodoOmXav9c9yP4Qjwfqq0toMemXbGsU5bLRlzyy8pO8oMCwwLDAtstQBgSTDPrL97/t0KUKllK33e0//6yYPf99Bqlp+ZfsJPveYdq+CyWp0COAT4uMYZgCPgFc998+qQQWbmAZnMyAvkAegG045JWcGAfPaY50oAnQACf0A9gFzAX2kP+CdAhRfwS2s+ceQy289BfhXEHxLnMEDC49pZAPSzt/R/Li0B/hw/B/x7oL8H9nUM9PL2SUtbYkOcAV/+2Adexv3Nd8XWh2BkXrYFJrYFfM1f+fr3sRqALQFzvwpQAfsx47RJYJk/P+nHt95lG2a0f/MsIGCq9CgAKsFLBTsAbtIA5H/wh3/48QT+czz7o3tAfWkas6k6HHAsbAP/6pd6258EiAkcE1DCCzZruvGsK5+yK2+ZpMrK9tptPEXIsazjbPw63/n2odLsN/zGJo5LdQJgw7Rt2t+xT5r3xln5lAufbadOjrd9yH41Pvtc7dGyj3IhN6+Mz/FZfvDDAsMCN9ACn/XHP/t9gHmAPg6AbUFngOCfGf+v+4oXnLzigTfcAvbTAaAjQKqDgNn/BJ+rXxdo+8cBlQRPgne7gI4A6VkdAcjRAaBMKasCcAh4HkA6AgCt2wIAPwGpgL+mZxlA/zFm+wX8j33HY08IzPwD/gnYK+29hHdLgLP/OgIYm7rc/6c/42Nbl/kn2E9+H6C/tKy2xRmAzmNVwPV4ufGNxUGBL/qOF/wWjgC2BhDSIXDodoE5Z4Ft/MSbf+h/pe1mKb7ZxjUscO4W8ONcSoPy0AwJJOSnVmYVBB8VQAlUErwksKkgSZANsF/iBGDZ/lKwX8vhaBD8Q9la0FtRUHU0nv2wf/YXKjBLIJ52ks9y8CljXz5lKR/qOK2p4wfNMYa/XS77UvuXfYefMqTN0pY5Do61NO8Dee+ROep93stXRlLbgqYu6qje2Zc1n/1NW7Ts1aWdjA86LDAsMCxwIRbAAZDg35P/e1TnAOVxAjDrL6iHMsPv7D7UZf49ZwCHA/YAKIBz5QhoKwEAbjoDdAgARHsOgUOcAf60XK2rEyApZXQIuBIgnQACTqmg33iP4lwA9B+6r58VARXwJ/D/D184PfIpX/Wpq1Ud8EsOApwbE8YC0O84QKsDgD6fN7Bf6gCgHDZHHw4PxNbMMl/IQzUaOZYFJhw3bBMAnAvUkzprX8G96dKsI8+WAxwNgH6+9Y6l9JAzLHCIBRIIJFBIPsHEIvCUYEUQk8AmAZCgSKCOE8Dl/nMrAADubBuwTg/Am5eUcgB+6nO2AM6AzJdHP/jUM/WHt1/ZV4EZVHC2jWZ5+ZS3hLee1PbazTBFqGOY45v3wCH30FWok32ofTOeNkjbrHjtBtWW0DoGjju03hM1nvfPHF/rGM924NUjdVPnNgDZn+wnvP2XtqRxDQsMCwwLXIoFHpMOgB7or2l/4gmfs1olgAPg1S94/QlAnsAeW/fN9igOAbcA4BBYnWTfDp3rAc6aNucUcLvAIQ4BwD0/X1jBf42nE0CeMmwZAFQCigGYObsvz+wzzgLBv/GzLvHfBvqZ6Qf0M07Tp02bn3I8iwPA8dAxk04Z+q4jZNcKgH3A+7HKotuPffaHVs4k7pOxEuBS3jNHaZTvLpw4OAS+5fkveGgukA+or4G6jD8HEPLtdhSlhpBhgXOwAACBS6CQtIKKqZXbBIFIghMBC1QwI7iBVkAk+IayRH+XEyC3AegAkKas5MmnHqFXtupkPPWGtz/Zx+y79lhCs17yKbvHZ1n5bC/Hp/E5fjmujnkrcltd9qv2Ne0AP2VI+2lTaY6B45+03iNniadc+GxbfVLX7EPjs4+1/8ZbsUWXdqTwEn6R0FFoWGBY4MZaYALIM6Nfgf62OCsBqHf/t7xyddq/M//O/vccADXN1QEP/eBvn7z2xb+yl0MAQCoYdZUAQByHAOk6BCqYz7hL/zNtGy/4r1Q5pHuOAKDT2XF0es7nfu+/+6uveNkjFzHTz7gl8HcccQCg66GrAHQCJMX2gGsCfb5qKwAS/DMOBO6NsRLgxr7vRseHBa60BXof9gKFpAksToGnBCMCFKjARUCToEhwnTTBOjP1cysASM9tAAnmk095u3j1oJy8NPW2L/YNmn1OW8C3kZ9qqGWIp4xD+JRZ22vxHLsc0+Rbsdvqyr4ln7Y4dR+33p/6ics6Ljnm8N4Lleb9sg9f5RDPNvO+cLzRuYTsX/a7FTsF4omPa1hgWGBY4MIswPsMIO/SfsHiLkr5pz/53pPv+LqXPcLsv3v6cQQA7Jc6AvyZLagrBFYOgfVPBSbYXMKnU0CHAKAvDxUE5APWl8z+9xwC1QFAXCcAMgm0hzPgW5/x8pN7fvjugw/zWzLTL+DvgX7TAP+sDEBPdUTvYzgDsLmOAJ0A6Qgg7Viz+fvIYTUCYbV1YQ3+uReIM67DCXBhr5nR0LDAsMCBFgA0cCV4kE9wMbUymyAgSdCU4EVwk4BIgA3tAfRtTgBWCLiEX9AvRVbyPdkCfWnqIp+6wtuHBGY9UKYt0j493nLSlAWP/Xq0lrO+tLSVYwbvWEpb0m1z0ae8jNtXabUJ8SmDtoRWe+d9LZ/3hny9f+bilq9U2VL1SN1S58bXftnfpK3YcARghHENCwwLXKwFeMcdugLg3i/9+ke+5S+9eOUAyHMA5HEKuOQfp0BdATAXxxHAdgLrvrY5A5aA/14Zwakg0NUBgF/2//cA/iFpOgUA14Js9uID4A89ud+9/EkB8YB5l/cL8KvDxnS2AlCHgwAZL/oG6EdHDnAk6Lw4D2fAPoD9mGUF/876V8r9wKqMsR3gYt83o7VhgWGBZRYAJHgJGIjLSyvImFqZVRCYCFSgghfBTQVBgm1pgnVAPCf0z60E6K0CWAL8sw3anXMCpK7qD7VPUPtq36HaYxu1XNaTV+YSah1pp806Xo5jpa3qbXPRN6/az4xX20yt0iZoU2kdj7wP5PM+OZRXlrS2qz7Q1LfxtT/Z15Y9gD9GGNewwLDA5ViAvbCuAKggclucFQB/5RnPWx0CmL8AIPifo+kUWLJK4Bd/6ZdOzuIASKcA4J+QYJD46mC/tixc4A+Yl19KraMD4Ou+9ms2h/M5iy+dcwiYn4AfXtDvYX6AewF+jpFpOAec8afuN37jN6z64+w3WxPYw0/f6R866wzQIXAMZwC2B2izPYAVAccE+NtkAf5XBxXGrH+OuTy64QQaKwEu590zWh0WGBZYboEED5VPoDE1kZsgOEnQIpARECWwFvhLE5zDA+gB+j0nAKsAPAsggX/yVZ7xpcBfXdXdvkDto32Wpj2W8NarVPk9WssSn2krx6qOI/GbcNnPXv/TPvBTDdXWdTzynqi8980uWusZr22lLlXPFq99qf1tRcY1LDAsMCxwORZgBlQHAKA+AeU2/lAHQHUM5NaB6hBgBQDOhZf/5QcPXgGQDoAeXx0CgMN0CDizv8sRUB0AX/2dX/0xAf0SWkE/M/aA+B7oF+hXRwBlBf60zww3faZPeWK/ZxNIBcvsjQcQ4wTgntAZQN96ttsnDTuftzMA4E+faEeQv4TS57ES4HLeP6PVYYFhgeUWWAqcpiZyEwQpghfBDFQgJLCGCv6TCtShnPjPqf09J8Dv/O7vflDAL6VO8ikr+Wwv+dQNXp2h9sW+Qe0vNO2wD58yDuFn2kpA2AODjm+rfiOuagPjaSf5qVnkVKjjkvcAvPfGsWiVv+BeU3eofXOMK21FxjUsMCwwLHBxFmD2UwfANsBf85hl5icAWQWwzwqA6gCo8VwhgFwOGTyrA8BZfs8BAOhuA686BQSSPYeAgB/HQDoJXAHAvv9dwL+C/pztx94C/Ar4jVMmQT9tft1XvGB1yB3AF/0F+ZVucwhwdgLnF6QzgHuEvtHfs64OqM4AfiFh24z+krxDwb8OAs6z4Nvy4p680dKwwLDAsMBuCwgUsqRpUEOCDfjJkEBJECMoEkxXkJ0APEG6/DYnAGcFWG4f4E+dbBe+6qW+Cf7pi/3Kvtr/s9CUt5Sfaa+Oj+OWtFVdXaTdjlf2Sz4pfIZqs6nl3xLquHgvVOo9vy+tcoxnux29qu7ZL/lWbVzDAsMCwwKXY4FDHQCsAGD/P4CTnwKsQP6scQ4WBPwTvvvPvm4rYJ8D84C77/wPProKgHhALWH1031rgEwZACmhJ0ewCmDezJS3n/7zVwYE/+yjdzk9/D4OgLnZ/nQACPoB/AT39VPX2f7UtQL+Q+PYpzoDWBmgo+MYzgD15ucED3EGsMXAsRHQI1N+F8VRQnl+DnM4AS7nPTRaHRYYFthtAYCDlyCiUoHH1ApugmBF8AIVCAmqE2xXIC6gT4oTgBn/uhLgox/96B+RR1kdANKsX/naZuoDr55z4J8+2U9o9n/NYxtsoo2kpG0NKXeO3yHDtqR13Fr1G7snvNoi49or6S1j1RuTvNcr772/jdY6xmtbnXFPXeWzT/Bc0kdj4++wwLDAsMAFWuCJT/rC+w9dAbCPA+DB73to4ySY49NpcBYHAICvB/xJF8jPUX85AEAIyDfgHBBUAhitj0zL4gBw2fw+DgAAfQX7Av46y++qAff20za6HArw96lHOzhPcAjgAOC+IdjnYzoDODMgnQHJuyKAXxdgLAi7QD7528qRx1h/2V13PzKcABf4AhpNDQsMCxxsAQFEggsBh3Rq0ldB4CKQSfAjuE7QXQF5BezEOfn/Ix/5yD+vToAfefDBn+yVr2m0QVpti3jqssQBYP+g9rlDtUul2Ig06LFDbSvHK/nW9I29sANX2iP5asPuWOU9kLz3/FkpMpGRspvOUwlV1+xH8q3auIYFhgWGBS7HAoc6AC5iBQA/MbjPCgBAXgL/b/jjr1/t5wfUC9i3Ueve/7n/5wmBuIAX0MsqAgC3zgAobaZM8mn3UAcAgJ/tFTnLL+iHMtvPTwsCWCt4Zwa9ph0Sf+jZv/9xwra6OgNYAYED4NjOAG1MP5nhf/DPffjfplOAtG2AfpdDgHGqZZCHE4eVAPyPv5wncrQ6LDAsMCyw3AIJKOQTgExN1CokaBEI6QToOQAA3RWYVwBPvOcEyLMAKLNrBUBtZ1/wvxCUYQeBY9pIfmWnVmaWYkPzkzct6LZ2HCdpqzZmgzHC+tIulTpOSadWpxvyfk/ee39fmjLkZ9pO/eBrP1rSGG+MMK5hgWGBy7PAoQ6AL/j8P7X3FoCc+c/Z/h6/zwoAwJzg3aX+0ATmS3hlCPz/8qd95PdN0ykAfcWf/JergGMB0GhAD3jaIg8dvv6Nbzr5C+//hpM//fee/Il6JoDAntl8AL8H+JkOZYk/zgRWWzzwRT+zkj0HzAXtAGWcAT2HAA4N9OvJWJ3U/xP/4uSDH/zQyYf/2UdO+OnGd//Ah0+Q25OljFV/myNkbqsAToKzrg5wJQZUO1cAf6w4Zx/gBOB//OU9mTemZb+NbkyHR0eHBc5qAR6avIz7MEEThEwtvgoCF8GPDgBozwlQgTnxOScAS/9dCZC/CNArb1pPPmlncQDY1w5Nm2zjsRX50EPDnPwco+RbU6uLtJt0ZX/lk8LX0LPt1MrNBu/7HvVZqLRXNtNm2qu6Vd2Nt+rjGhYYFhgWuDwLHOoAyBUAzNQD2An7gPwE/rUespasAABYMuMu+IQuAfu1jEAf0C6foF/+lU/+N48YnJFmebqg25lpqe0AvL/tWa8/+aa3/fQpZ0CCfXn39XPIoo4MwXaPJtiHF7BL0YF6tm9cWegO0AfwE97z0B+s4v/4H/3OIzgCcAikM8B6c1TnR+8QQc5HOMQZQB22HXj+AI4AnC2Hgn5XAEirHNoaKwEu7700Wh4WGBZYbgFBRdIKRKYmbhUEMQKeYzkB+AnAdALUVQCC/h6tjoB0AOiYgKau6g+1T1D7GRRb0PdqkyVx60F3hV3t5PjIN7FjNhgjdC5sxKWtKp0bv6nV6Ya8T87Cz8lv6VWnqnMrMsYbI4xrWGBY4HItcKgDgBUAAFRAeoaXPu+/PSFwMCAgPkH+PvxSBwCAErBGgAcYbsDcgqX/zvYfCvwB/71QHQIATQKOAJ0BrA5gdp/wV1/xskewJwcebpul74HunJ2XB/yjA7JwOvTqkUY5wH2CfGWkYyBXBSjLcsZ7FGcDOuCk6W0VYKn/rsCYCv6RYWC5/pwToJc+B/Y390tbxSBPWdrBCdCeUL9DLvdhHa0PCwwLDAuEBfLFJJ+AI8HI1OqtQgIfQbTAWrCdABy+AvQeiCcNJ8Af/OEfftyVAPmLALUOMkmrsmvb6nQGB4B9T3tcNJ/jUvk2NKvLMTR+k6m26NG037ZxnJoBZ0M+B0v5bfJaXk+X1FW+FV1d9s34oMMCwwLDAhdmgUMdAKwAAPgL6pnBB7QD/HEApFOAn/EjbR+HgD8BuO0MAJaW6wCAeiJ/UkCi+/dX4G7tFHCWGnA6N+PvTL8UQNwD+0vSqOuqAMCpDgF0cpUA6YQekM40y2da5WmPNPsJzwoA+gvPAXrM+gPsBf84A1IOAN+VAW4JUC7prhRAVtab49EbRwvjk84AwD1pPUdABf8eOihlfLFhD/DPpacjQF66ukfWjgDS0OuzHvcfP8i3Z3sox//rC3szjYaGBYYF9rWAACNpgpKpCVwFAU91AOAIEHBXIF6BugC+Avt0AuAM4IyAWsZ4TyZp2bb6nMEBgA3od9riIvkcj+SbSuOfCkZYeKXtevzcmE5N/qLgc5F0Qd25+6unYxM3xhwjjGtYYFjgci2QDgBAPYfQ7QocUlcdADoCpDgEdAbwU4EANkD6cz73e/8dh9jhFMAhUJf+W/9l3/7g1p8BZEm44F8AmcA/ecoZSGc2mgAYBpSyp98l/lABP/QsoH+bYwCgCcAkeOCdccAsem0D0kucALU+/cUhwIF6zvqzzB8wX8u6MgDgT6hliFOXkNsDlqwKoC30Rx/GQ2cAlLEE1GsT88nrBe4ryiRwn+PnnARz5UnHaUOfuA8eeOL73v+yP/vfveFJj3ve8/k+bU8u/9/HtcUC4Ilv/qoXv+dr/srXvw9HypaiI2tYYFjgCBbwpZTgI4HR1NpYBUHOoU4AZ+8F80n5FQDOAWAlwNxWAB0I6QRI4C+vA8BVClB1htoPqf3r0LTDefNp/x7f1Dv1D8RxI31cpy2QtpHv2dS0ubGdmtiDAvfWlrpz7alPpU3U6iJ9XMMCwwLDApdigXQA7AL+mb/LASCQh7Ia4Mmf8pQNCAfkGQDmLHt/xXPffGqFwDYHgOBfBwAUELg0sDfdOoBNZqUBox7ud54OAGTTPsF2BaA6A5wJJ05ezyGgA2Cbo6CCeuKAWWbuXdKvA8CZfcoA/s0H3LsygLoCfMrjBCCfoDOgOgp6OtQ0+uDKAO8LwL5jlMDfmX8peTqXtJX2PCtN8N9z5ugQ+LzPu+tZ6++DS3mGr3Kjf+O5P/KBN//t31w5+tg2NJwAV3m0hm7X2QKCiQo2iCdAmVp8EwTNAuoE2QJvgbg0AftSJ8DcVoCUJW87UHVYOvu/A6jR77TFMfme3efSmhqnwD/xce1nAWzLNWdj0reN79TyzxqQj4xeO3N6teJj7DHCuIYFhgUu1wLpADjmCoB0ALD8XwcAIB1gB/BmeTfAG6C74luck+5xCLhtgLrEBcVQZQgWlwJ/ywG+5StFD8AoM+U4BNIZ0OMBwoQeQMw0ygBWsbF2hn7+nc9YOQO+4tPesJqZZ3aeAPjMPsNjJ50BAv99HQHoAWAX4DvDTxzHAME0wHwCfvKqw4D8n2+/HEC6MqxTgf6SuP3xUEfuFcY5nQCVxwHg/XVWJwD2Jazs35w1OYbbeMbsqz71HT//5Y994GWPf/wTvrI91dPlPtmX3zp2YIXPz737wycf+O1/90knQDtX4bOecNczLl/DocGwwO1pAcAHV4KQBClTy1uF6gDAEaATIMF3gnJ4wXrSXAEgD/BnFYC/CkB587KufG0ndVAvqA6LuRUAWxwBaYelfNrxUL6ZvAv8HCvyx7XMAmkz+W3jsmucp9bsIWFO7pwu9E594cc1LDAsMCxwaRbQAQCAyhn+XTzglZ+mS6A/x3/v3/ybJ192192PALZX4LrNavcALGkAOJ0BOAlcDi4YRkaCwgrgl8SdWd5W1jK0z3YBZ+t7qwTSMVCdAZQX+DMDih2e/uR7T778KU85+ZIv/pIT0qZPm1ZlAJEJMpFF0CGQTgGcAT2HwBKQrVxm9gX1gn4oYN5Zf+VRB8eB5QD7OAhcBSD4p5x1DqXeB4w5qz2wX8746wAwDWogT7vUFQAA+5pW45TBgUE/ciz25YdD4I/9sS+4665vfvCV71s5AHQCvOatf/+ELUTc87x7Lu3FNxoeFriNLTAHQAQsU+v7JlQnQALtBOAVnAvak/ZWBOgE+MhHPvLP77vvvhda3rLGobWNbD/12uUAyP51eO2wi87ZcZ/01vwpRwxxLmSM63gW0J7bxmbXeJM/tbCEzsmaa5+eqiP8uIYFhgWGBS7VAjoAcmZ6F/jPMwDm9vCnM4DZ/Nxz7yzvLio4A9AJBhP8C9K3AfnMA8xvm/3PspXPdgGZyGGWmhUMnh+QjgDSmd3Hll/8xLtOAP2Ee+552ibgAMAhQNmlABPnCKBYh0hS7ITNsOs+4NsDAXEG5Kw/TgBCHvKXTgOX/QP+q8Ngn/Yti970gf4xVtiZew0bCvqTCvorpQz1e4BfG3lvSQ+Z9V86ZpTDIXDDzg+Y7rn76d/zxtf93sYBoBPgLW//pyf/yTOesXICjJ9avNTX/2j8NrNAAgz5BCQJWqbW91XQAQAVWCfYThCeAD2Be/ICe2f6oToBfvGXf/n95medHvinLdtOfdRRqt7ZD3j7N0PTFj0+7bYv35rcgD3q1quXVsuM+GEW0La7xqw35sdI29auPVJH44MOCwwLDAtcuAWYpQNA7bMCAFBGefb2zx3kx9J9DvwDiLmkHqC3C/RnPuWZjQWkAXQB5QLxfcG/gP7QetZPHQSjLFHHIeDhglDycAAA8AH6zPgD/nP2nzr7zDQDIp/zplec/Om/9+RP8NOBX//ib/s32FgngMAZHXEUrMBt28ogwN5Fc+m+M/6AfGb+cQw4uw/YF/yTZ/ou+dvyHWP6gD0F/jqmSGPstHkF/TVOOeyA3J4jYGWblmf+MWb993EIcH4A2wVYCs937IU/+OfcIN/rz7z3WT8O2Af4Z2A7AOGvfeu3rpwAOHg4R+GcVRrihwVunAV6YCRBztQssgoJngXWCboF4tB0AsBXIE+8gnzi73znO9/DdgCcAb061QmQbaYu8OoITd2Tt2+F0n/6nHbo8T3bCdyW0tbM5rLOJmEw524BbQ6dC72xPzSt1wadTD3OvdOjgWGBYYFhgSUWAIDoAABs7Zr9J59y6QDQCQDFKSDwZ4YcgJWgfgkPUASQAdzcDgAwTPANf0g4hgOgtotMA8ATYM+sPj8vCMUhAIDFGUCAZ2vAUsD4kuf/zAr0P+6f3HXSCzoE2JKB7bFVOgPQd2XHpgv23wbEzcP+dbYfsO+WAbcApNPAuvtQxhgHBvpiQx1R3GPYCdtxHxHgsa33awX9xKuDgPIJ9ivPtgpWOCwdi/Moh2MnHQJLnturXgZc8C3Pf8FDPQeAzgCcAGwJwEF2xx13eEAg316ri+/8Zz/72c9pEb+f1jmDDAsMCyyxgA9OBSYJcKYmaBUEzwmuE3gnIF/iBKiOAJ0A/jRgOgGqPOLZXuqR+ukAkNoHqX2boWmHylebZbyJW3Rp/0WFR6GDLVDtnHF56K5Q74Gl8V1yzbeDxMc1LDAsMCxwqRbgf6yAahv4d9m/4D8dAPzcHz/tB9gCbCbwBwwuAf1ZBpCGDFYPcCjga1/40Mm73vSeFQXg6WCoQHxbHFnqt63cWfOcqUYObQK8WQGBMwCKDm4V2AUmX/nAe7YC/54zgDQcAqwOeN7T//oKWOsQsG/qpXNmG2B3Zty9/joBzjrrz3i73B/gzz3I/cd9hg1xnOAkAZzTVgacBtiS/ugEEPhXSj7yekv/Af/I3TUOF53PyoBLfSkcoXEOAOTn/7Y5ANwSAP2O7/ivNuPvagB+Pew3Hn74t46gzhAxLHBjLSD4SJrAZmqW2QSBc4LsBN8JyitoT0A/x+sE4DwAvHvIoGyVtc0BgD6p3xz4ty/Q7GPh0xbJp73kW9VTF+njupoW6I2NaY7nLpr3Q+V31TUf68CPa1hgWGBY4KpZYNIBMLcCgHQDwJ9AHQDmvV/69Y8AugC2K+Dflpw7y5ygfhuvkwDQBzhdAdR28v+PvuQf3HLwHOcJ8KsAlBHQLqUAzaVlDy0H2EwnQMqhfWaxOTNgzgnAbDDA/zHvfXx3tn8O9JtOPcNj3/HYk//whdMjbD3ACdDbKoB+K3svWB0gGN/mMFiSl7P+3Ds6nuC5h5yR//m/+PGTbYFyOCh0rMw5A0hHtk4A2udXHhiDiwb3S9rDKcHWnKv2othHn6UOgFwNgJPvG7/xGx49G+Bx//GD45cC9rH4KDss8EkLVMBhXFACTUAztfgqJGhOkH1sJwBnAeDdwyGwC/zjdMj2ew6Ac3ACpK20XzPTAHMY4RpfjmUd32PGMU+2o7lMMz7osMCwwLDAZVrgTg7iAtTPOQCc/Rf86wAQ+APAAFT7AH9BP/Wo74z/S/7zt6xm+9ljzonzLDV3vzk8gVnoX33Xwyc/+fJfX60KwCGwzSkAwMVBcREOAAC1TgDsk84A2iesAHdbGYDDAxAK4IOyv/8Q4J+AH9D/GW/69JPHff+nf+JTvupTV+C65wTQGeDyex0V6OZ4LgHz28rU7QHcHznr7z2HjRh/Z/y3gf5tebTHzykiD9tn0Amg7ffZgrEEtB+jDPcBDiCcRIT1zwle5rvh4Lb5ZucMgDf/7d88tf9fwN+jng3gLwXgGBq/FHDwEIyKwwKnQEgP4JyLE0BAP7cKgHyAP04AzwOwjjRXGix1AKTDIh0Zybd7YpoJaQv4nr1a8riuqQV64Nu03lgfK+2ammuoPSwwLHATLIADAIDkLD+An8AHuGmCf2dZAdQAxX1Af64CYPk59VeArAF4lvkD6nvAXweAVEdA/iQdTgG3CdRVArQBKBTkXhSlzRqqE8K9+YB0gfwSJ4BlAfwV9PvTguyr5ufWGEfk54GB6QBI3r342GjjDFif47AN7Nc8wHg6ABhvZQvGuYcAupQD/G4D9/vmcW9VR4Dt0i/bPAZwP4aMCv6xP+O1Xr16HV9Dj+FXAPJnAHugv5eGI4D0r/var9n8UsB1doZcx8EbOt9+FuiBnQp6p9btVUjQnMA6Z+ITpAvcpbmsXz4dApRzO8CrXvWqV1sPmnJ74N8VANLUr/LZD3n72KHVHgkCW/Fx3YYWyOeC7uWY78NbNyk8l208Ght/hwWGBYYFrogFdAAI8gX9UNOgAihA277AH4AI6GLGH9CbwB/wnmBeoC/NVQCmVeqqgIcffvgTlieNVQKveO6bVysELgr4244AFArwl5qfFIAumE8q0NcpAM18Zvupy8+q+VODUA4bxImDAwBHAKsBKJdbARL4J8/YECiLjjotVls8GpCvYH9bnPsE2chyRt7tIizFB/gKoPcF+bvKIx/9bZd+ZP85A4Bw2c4AZv0J2Jxni/uEZw/+L37e1/7DK/Ka2FsNQPtrX/wrJ7vOAZhzAuAIeO1n/eVPcA8TPqttC2hKTHsrMioMCwwLrCzQAzQV9E6t5CoImKEJrM/iBEigrxOAVQD33XffCwH7PQdAzwmQ+uzisx/y9rHQaotqr1Z8XDfAAgL2faj3SprH+rvSMn/wwwLDAsMCF2YBltkC7nEEwPOhTUjwD4gCkADgAXw5m7+NB1wRAGMu82e5PsAcEJ/A35l90pOvYN84YJ9VAwTAftajvrKhxN02oEMAwJUg/Dx47Cb4h++1gR5f/Z1f/bEE9vCAe0Kmu7yfJf7USeAP3wv8BCHOAJwAnNmQYH+OByj3gvrrDOBwwzkHAGMu8NepBLhFhuAfB8CxZ/9xDADsaYOVBzgctP1cf0nXGQAYT8eEDorzoAn+sQvPIWPFKg54nsE//4yn/RTf3Bf2QjheQ4/5G8/9kQ8csgoApwDP6y/++5+xCl9+x2evnAAr21zz8xGOZ94haVhgtwUqCDEuYIEm8J1afBMEzEudAIL4CvSNuxrAOJSVAD/y4IM/CaV+DelwSB7gT3yXA8D87At89jP4tEXaCH5ct4cF6lgal8710nzprnJz+SN9WGBYYFjgyliA/6NNmQmF+H/JSdw54y/wXwr+N7P9bZ+7wB/gzTJ9gLrgXKBfqSB/jgL4CTgBKvCv8XQGfPSjH/0jAmnUd9sATgnB7bEowF/giUxn0qt8HAAsd06g3+MF/wB6gDwz/RzwZwD8J49MfmudwOFqxP+zZ967qltnw7cB414ewB69CazoAGh7j0CpQxkBLUAW8A8YP+te/20z/wB3Z/ZxABA4d8C20anXn16aDgGdFMd0ACDTWX9siF0Atx6ICE/Abujxmrt/4YRT9dcn5K+eU57Vq35xDgCrAHqz/LvSeDZ/6FMfv3IAvPBTP+fj2gaKs/K6H5R41cdu6Hd7WSBBC3wNCXynlr8JCZwF01A+GgwVtCfA38VTF/DPVgAcBFWWbfSo+pCnTknNl2ZfhhOgjfK4tlnAZ0Zay5ourfkjPiwwLDAscG0swEc1oFXgKqjbB/gD/vNEf/bk8zGfQLwCfuJzYD/TE/RXoF/jvTZSB5wQOgTgdQi4QqAC9X3j1QHg7HeVAygFmPdAf01j5h8HAOC/zvYD/kkD6AP4M+gISGcAY7wPIO6BZIG+cnAEeNAf8nMbCf3HJtwb3COAYE7y3wbo98mrwH/llGj64ATASUH7BAD3XF/m0pENYFfvszgDKvjHTglu4b/oi560cQiw8sZfPKD9B574vvc/7bGv//Hr4AxgG8Crvu3tJ2/9oQ/sdAIw4/+2D33sEQPvDFcAVAeA9nLV0swLNjHNTJGxPXPOMCP99rWAgAWaIR8Y+MmQwFkwLdBOYF7B+y7wT751cALcf//930UaMklP2cln29v0sU6Wgc/+2MdCtUXaR7u1ouMaFhgWGBYYFhgWuPYWmAATLP8HjDAbCUhzafe2Jf7kAUoIgKQE/h7sJ+ieA+QJ8Of4swB/VxtUmvqk8wD+oR/87dWsK2DWMwuc8a4Afi6+jwNgyQoAnAGsAmAvf8706wjAiZCgfxdP+WM5AQTO2It7Alsxe80KAFeS4CQwYDPKUB6ADijeB+xn2Z/+jI+tZDjjDwX8S3UE0B79xQmgwwK9GV/1X0Kpi2yX76P7UoeA4J9VMdgAGwlmocz6f8kXf8lqJQeOHhwBhAe+6GdWTgAcARlwBrBdh2eXb92r+CZi5cI+qwB0AEB/+Xnf/whOABwAHmiZ9oJfnQ+w3r7U+j+tbfAYfkaQ99qTHve854Ml+Obn218bPeXur3jN2oli0qDDAjfGAhXYGhf4nnIANKtMCZoTUAuypQL6QyhOAM8DUN4cRYea10ujTOorn/2hfyWkHbSNtBUd17DAsMCwwLDAsMD1tQAfwYAiAoAEAA+AWzLjL/BnlUCe6M/+fgC7gDuBdvIV7Nc8lvcn8M98+ATtNc+2k1LGeJZHjucJAPyd6aV/PTsIKNM50HMC7OMAWLoCoDoA0hEA4HemP8G/s/6ZhsOBgPOA1QQJiJeA4Lky2IZzAQDZ6QAQdOsAqBQQjj1xIiW438YD/CmfwD95xykp4zTnBEAHw1z/eun0xRUC3DtzDgEdBoB/nGysjkgwy75/x1OqAwBnAL8K4DMH1RHAM4t9mQ1vb6Lpqr2N+M5+yfN/5mSfnwRMJ8BDb3toqwNAJwCOAGyIM4Rv/Bd88XO/kzMIMrhqgl8o4N1Huatmr6HPsMB5WQAAm5dxga00we/UKmxCgmaBtLSC8Z4DIGf8k7csMnACEKq8uTjtz+Uh1zz1lGZf4LOfa147aBdpyx7XsMCwwLDAsMCwwPWzAP97mTkEDK0O92vA7SzA/9Bl/gnE4QXjAH9CD+T30lIOIJ94UoG/abbFsuN3/8CHN6AfG+wbcIAAMqtDAFCmYwXgSbznKABAAsSd4a/L/ms8twEAFPMsgNwCsA3443AwHNMJgB1wBjHrjwOA/sPjDAE8V+A/F59zBgB6AdsV+NNugn/5BP/ygG/0gvYAvWmuDJCavo3qQJDqDMiZf9pN4A8/B/5rOk4AbKADgH7y/Bp4pq/i24itRWwFWPqLAG4HYAXArz3pK/7vbSsA0pY4Ae5ov3qBM+Q7vu5lj/zoS/7B6ldAeD/hCAAL8O4bPyt4Fe+SodNlWEBQW6ngVzo15TZB8CyYlgq2kwrut1HKJ1jXOZByDuFTJvXVU2o/pNnHxtt3aLVPSxrXsMCwwLDAsMCwwPWwAP8PAQmA0dVJ7nuc6p+zjy715/C8Q/b3J2AXjAv+tx3stw38J8if42kLxwKg/6Fn//7H7dO+oH9beR0CgMDcNpDOgHQEAII51E8HALP8FfRnHAcA2wAA/swM4wSoNB0BzPw745+gXx6qE2AbuF2Sh124rwD/uQKA/s6B/bl0bEcezgAB/b5U0J8Uedz/BpwTgHLaq2C/F69pc3ahHMHnjGeGdurMP8v+nfF3LJn5B/w7runk4ZnTESLwty84CK4quHUrwFInAKsAAP//2x2fvjoLIIH+Lh4nAIHnCuDPjH97Q/MdP65hgWGBYgHALVcFuQmAp5Z/KgiaoQJq6BxQn3MAUL4CdcvOydqWrixpLZu6wmc/ah9bXBtU27SscQ0LDAsMCwwLDAtcXQvw/43lrsyKEVaAZD3jvw3ImpcgGRBDfU/0B1ALtudA/TbQTl4NPTk1LWfybX+OUjdBv0v87d95Ux0COgOg6QAg3nMAzDkCetsAEiAmmIRPoF95gL9p8ADJOUC7JJ3l/4Lcuf3/c4B/Vzo2m3MGAPBxDkjTUZDgXx5gLmgGTOap+6RXZ0AP9Jsm1T7GoejLigieG54jnh3ay/3sue+f/f8A/wT/dTyJA/SRhQMAx5L6Y/urugqgvSEnwPjSlQA4AH7qNe9YgX+cAP4U4C7wbz42JrR2jwX8p6v7lh+aDQvsZwFBv7UqwDUuAIZOGRI4VyfANkdABeTnEdeBcAQngP3XHlLsBj+uYYFhgWGBYYFhgStlgVzm75JnwMhSwCvwhwKcOIjs9d/935+8972/tgH9CcQF6QJ64z1KGWf64bOMcWnmzYH8Xjr1nem/aNC/zcY6BACHgESA79d9xQu6s/49J4AOAGaHAf51JUA6A5xBTqAv4O9RygF+BbM9ir69dPqDA4B7jVluHQAA6l3gflu+bVEGJ0AP5Cfgr44AQX9SytBPADP6ChqlAGq3LqQ9EtzD17hjSjo8gWeOQPs8S4D2dADQJnHa3Ab+c1x1AmBb6usAYOXAX/y8r/2H7UV0Vb9N72Q2njMBHnzl+xZtCXAVAD8JWO3mePUoNlmfi3Cm9zKHCeK4AOMcIOhOVmSwBQKcc0D9UWVY4FwtkC8KeahBACydWt4mXCUngGA/wb98z8kwtxIg+9d4+w3VJtKWNK5hgWGBYYFhgWGBq2EBPjjd3w+4ASQ4Y8isIcFZyRUoYg/7OghcBf/steY3yJcA/wTqczygfA74U6cH+klPgF/jNc/ZfkE/fbFfV416yCDjcP+3vPLknh++e3XSfy757/G5DQAwKDiU5qxxOgEA+DXgCNBBAGU1whzIF4xDaxn6wEx3Xf7PEvttAH9XXraJLMB1D+TXNOKG1X3e9EtKHrJwKnzZXXc/AvgGQAMcBeVQ+kO7gHl0qaBfsC/Qh/KM4TjINHja537kmQTMJqDVCcB4MQ69cc3xhUdfwa9OAPpx1cEm397PvPdZP75yBHzfQ7OOAFcBsAKAsOQsAO0KPcJqiDv5NZOf/4l/wUqCpdfqFwhoGx3uaFsRGKMj6LK0/VFuWGAvCwBovQS3lSYQhp8ypCOgAuuLWA2wDfzrBLBMOgNS1+xD9q3x9l2btKSNhzVtR/q4hgWGBYYFhgWGBS7SAo/hhGtm/wAXzGwCQgBkBICHAAkgAmgBoBAox+w+5QRMq3jba8x+43rA3xy435YOsK/g3zTqLQH+CfQrL+h3X/9VA/q79Nk4ApojhvF43tP/+soh8NXf+dUfA+zXlQA6AAT6rgYwnkCRNPPrrL/A33TjS50ACc5xIqF7zv4ziw7A3gXyl+TbVm4F8L72vpXWdOI1zeeBZ0UHABR7VUcAQI7nyll9nh9CBfjEmeFHR0Mtg53SCZDOBngAvOPYozm2jGt1AMTM95X/NuWbnBUBnA/ALPuDzRnAmSJ5TgBOAA4D1AngVgDB9R0NYMMTtB/jyLanI7yANw6AZz/72c/pyLuTPvDuBeCz4kAHEnpy/gZ94gyO4QDoWG8kXTkL+NIQ7CYVCEunpv0mJICGT3C9Lw9I13EgzbQE8fIJ9Od4y0pTr9Q/+9V4+5u2kG/Z4xoWGBYYFhgWGBa4WAvwP4ufvQL4A2QIAA4AJ6BSYDkHQF2OnoCf/f2cns3+W2b+CXyUA7J7QB0w7qx8dQII+pn13zbzX50AFeD34tRxif9VnuWfs71jwxjoqFk5a1o8x498xudbn/Hyk7/6ipc9okMAKrBPoJgAMXnBrTP+gn2oIR0BlAeYC7y3UYDxee7/10GADvIC+jkqwNcpIM3yOMAA9gRBvysB3I8vwAZg8nwxRhXUZ1wHAGVz602WYUxZXYODROAqFcQ6po6h1HSpqwBcASAAvW6Ak3cZy+3TIfCKB95w8pq3/v1VcCuAKwH+3J/5MyvHDXbBYfVXnvG8k3v/0l/6OZbbI+tYb2IcCfyiwLf8pRc/sgL5a6AP2Ode8f6o9Bf//c84+cBv/7uTf/2xj30CR8BVPZzxWHYacm4vCwhwKxUMS6fW7U1IEA2fAFse8C2o35cK3JMC9okn6Gf/o78kkOmWzfrqBVX/7FPj7Wu1RcvarASAH9ewwLDAsMCwwLDAeVtg4kOXpf2AGEBHAv850NlLBzwzcw7A5+e3CPAZTJfqDNjmEBDwV6eAcR0HxqE9oF/TaBt9WeLf689VTqugnxlzxg1QOqe3jhwp4JHxBrQDQJhxBwQCWHEICAx7gBFQL/DXESDoN44M5AKK1Qvw7BL4niOAcu7/z9P/AcAC9rPSbBdZ6FNBvuBesC8lPfOoq8MM3p8VZDzoN3bSIQAwNwDysP02JwD5gn/qzTkNeO6Qg8wE/wJJ2mcsGS/HFOq4SklLIKojADkAVr51z/tldA7yH8P3ON/wzK7jFDCwdSAD6ZQ5r34C3HFE+LOa8GzXYTuCzhbHLCkOi59794dXToDr5ow5h/EcIq+hBQC8XAl8BcPSqeWfCoLopAmy9+F5qCkPrbxp0gT6T33qU5825wDY5gRInaNf9jXtIN+KjWtYYFhgWGBYYFjg3C0wMeMP8E/QD3gUXM4ByZoOgGYGHRAvyP7oRz/6RwTjCc7hKUtI5wC8TgPzWDFAGvEqI+O0Q9z25ihtoOvtBPpztr+Ozba4jgDKIIPAvQDYBnxXZ0ACRcC9ToDqCDAPAIxTYu5+wgFRHQKAa+rU/f/IOivwp36Cf3mW4AvqpRXwk5551GFpPqCcVRX8nN5cQBZleNawGWAPoI7DBRk6b+g3YwA16FyAmlYpetE2ZXQwVEcAwD7HL/l0CuisEIDqBIAig3dGezPxzTqu/S3wGGbyDX/wh3/4cbYkcChhzwHAGLL8HwcAdVjBAEbZv9lRY1jgciyQLwqBbqWCYunUVD0VEkzL7wP+LSvwT0eAoF+a4B/+3nvvfeYhDgDaUNfSH/uZdmhFNs4R+HENCwwLDAsMCwwLHNUC/J8T+AM8AA8AwDmQNgcgne1/z0N/sALeCfbnwPe2dMG8wB+gDvhn2wDbCOC3bR+wvjTbQqag/zou8XcMGCvAn4ARAG3eWanOAO8D2qIdQCUOAYArKwNcHQDIJwAemfGHkgdwpw5AVplVt57eOgMoS13axhnBqhT3wMOfhxPAVQD02QBoh9cRIGWWHz0IpAn6f/wr/9WKr9T8pKwSoI84BHBsELAZ/dQZxzhThiBfgX/Gua+pm8A/eQC9ToC5lQCOJ2MJT/l0AMizZJ2Z8qO+mG6IMEA8s/kEziT4xV/6pdW+/jvuePSAPx0vUlYH4CSgLOcb3BAzjW7ehhbQGZDAV15QLJ1a/08FwfQuKtifozoBBPxJK/gnzoEd6QBI3vIpI9tV19IX+2jfpa3YuIYFhgWGBYYFhgWOawH+F7EHFaCxAv4NPM4BtArYMi7wB6AnyJbvzcL30iw/R6kDcGf2HwcA5wlwiCABnnMFtq0McKYfQHadQT+2BxwL9gClOR7nxXtv6BAAiAIwE7CuAGzbM82ssYf0oZ91j6EbfadtgDeBmfezOgGc+a9UwA9NXmfAqv2mCwBeQC/gJ558L26dSpGvbXG2aONdqwO8J6Dc49QD9BsAkT0nAADfFQBS0noBR4CrAnQAOFvNcnS+d4/7prq9pX37i170/ToAoO/62Z+bdQAwdqwO4F3GYYZj7//tfW/cpN4JepMKjKVTM8gtQVBdKS+iXloCcvmlTgDA/n333fdCQb9U4C9NB4CyU5/SD/sHzf7Lt+RxDQsMCwwLDAsMC5zNAvw/AvgD1s4K/JlFB5j/y3/1wS74r2B+G/A3b45WWToDWAXAz2npDNAhgJMAh4AOA35ycAXkjjhLfgxAu68MALBh37rbyiNzW37NE9TrECBfpwDgFVtbptYlbnu7qHUp5+w3sjOdOGB8X0dABfw1jkxkC/jhDaQBsit47wH9niOAtF5IefbZlRcAeh0COO6wM3kAfmyjfXQAUCYBf/LOKEOZ2Qfs15UA6RiozoC5FQGxLYDv2XHtsAAYxdl/KAf8MU51rIiP2f8dxhzZ18ICAFuvBLnySRMcw0+9UIH+trigv0crcBfQSwH8999//3dBM5ifNGVlW+oW/cg+Zt9bkbG3CiOMa1hgWGBYYFjgcAvwv+nLH/vAywANAASBVwI4QdU2yl55frsaoJ7L/OeAe00XyGe6vHlLaZ4rgAwOBwT4OzOb4I0+ZxAwrQBdAb/72mSbvY6Z55gdU+Z5yBL4S5e2Yf+k1mOMGDvGzDypZaSUZab8v/j3/utFDoEK+muceykD8nPGPwF7BfqZVx0DPfBf06jzyif/m0cyvOJP/suVHeijKwOgrg7QIYA9eNbrrL/AUqojQCcAKwAA93UlQI3rEJhzBIxtAcvf1Rw2yIw+y/rZ3+/PETp2jJV7/3ES8LOG4IjlLYySwwJX2wICX7SUlyZAnnUCtHoTQYDdo87CJyCHB6xLE7gnoIcH9L/qVa96tQcBbnMCpJxsT73Ut9Hsn31O2oqMa1hgWGBYYFhgWGA/C/B/i5/yAwwAoAAG+wIz6gD82d+/FJzPlUuwD1/j1DOt0jmZOAIoy4oEQNS2PgIcAXE5W6pjYAUwW16Cy0NsRfvHCuia+hxL7qFyVvYrNgR05mx02lPQXvuAXXfpQB1lZX15qXLQw1lytiCwymXpqoAK/DOODLYaAPzrrL+gX1pBv3HzoYaffMYfbXjTtlHK14A+2IjZfoNjwfkLgEeDYH+OspTfMx1cDVCBf43rCKCeWwFya8DYFrDsfc0ZCgB7DwG8o50BQBD8szLgpc/7b0/W+/6nZVJHqWGB62OBBL2VT5C80wnQujwZBNyVJiiXT9AOv80BoENAJ0AtSzzl2YZ6qN+a2r/a75Y9rmGBYYFhgWGBYYHlFmB/KDP+gCJAJCBpCegSTEEBF/ws3i7gX4H6krhlBPU1bnqPuvKAbQCsRkBHdE3dl/KASB0CzPQKOHMVgbKO7QzojYdp6IQujp06zFHrzeXPpdd6aY90knAf1YB+G6cJjooW9qrTbK9et+ixR//Ri6XxAE9ALyDV32/nN9af9/S/vnIGMEu+yymQwL/yLPvPpf+AdQE+tMYzr/ICfZ0AUtKTt5zp1QEwF9cxQJ+1jY4A6JwTgHRWAwDoBfc4AyrwNy61rOcDIEdHQGwL4Pt2XPMWuPOznnDXM/gZVoA+9y4/C8i2JsA/KwXmq46cYYHrbwFfEBUIExckJ51a+qIg8E4qKJcmYO85AAD1rADglwCqA6DnCEh5tmH7RW/7lP1uRcYWAIwwrmGBYYFhgWGBnRZYfUA+7bGv/3GAGOAKYFXBlaBrjgr85w7264HybWn7gHvk9MoL+j3M7yyg335rGyh9Btx995993QmA8eu+4gUrEAkFNLqCApC7AskBXpW3hNax4DfurSf4XgHpNuPMyfI4IlZttnbrUnTTpeiPDCm8snuUejo8oAJ807iHNgC/yary0n61X9me/ZpzDmwcCWt9jStj1b9OXygnuAVwAj4B/l/3tV9z8o3f+A0nf+UZz1vFSdMhQNq3PuPlqxl9wHHvlwQA/sz6VweAccYBG7MigAA4F+DLS3vpgnloDRX8zwH8XenI3Ywd92wL6SjRGdBzBKSDIJ0BPUeAwL/SniOAbQGA251vsVHgj7HKmAMCX/qyl76BMH5lYdwUt6sFBP32z3iCYXmBctKpVVwUBN9SQXnSBO29WX0cABwEWB0AxrNOyso2aL/onP2xr9JWdFzDAsMCwwLDAsMCfQvwgfhVn/qOnxekbQNkAqtKAcEso+8B/wTlPT7TEsSbvotmHZ0Jgv782b6q89J4BavEsRUg8q++4mWP3PPDd5885r2PPxX+9N978idIN3z1d371xwCQOAUAUwKsfXQA8CfoX4H1NUBLIA/IBKASEvifhWcZO4BXoA9P/3sAO+21tH+7ytV7UscAOhCqXtgXmatybazUCX1Z6u+Sc0Aq4JSxSeCfKwHIM6ycO60+lDScPgn453gdAJWmQwDAD/jeRs2jnIBfqkNAgG8Z40sp9dALu+LA8p7Fntx/OgNwACxxBmBrQD1Av24PyFUAyecvBuSKALYF9N9iI3VYYFhgWOCT5wBgC4GwNMFy5adWfmsQ/EsTmMMnaIdPQA//lre+9adxAgj4nfmX1vIpz7ZsO3TNfthPKJf00dj4OywwLDAsMCwwLND+NwD8mfEHJFWAtQuQZT57/HvAXzAuTSAPb8h8y5h2CBX0HzLTL1CUCiIBlN/2rNdvAD8AH9D/uH9y1yb8B//q/3EyFyhHeerhDBBUAbTmQHSCfYGsQL9HdQhAAewcZgel7FnBP6BZeco6pUO7h9Ax74vz5vOe3din6aBDwPuacvCsxPhT/96TVkvYAaVfdtfdmxn/BP854y/wh+ZqAMr/tW/91tWKAEB/LwD20yFQwX+NY9dcHeAKgKQJ8uWlAnzi8vtS6mIrwX+CcgA89y12XD0X7b7i7IDPv/MZG0dArgBIB4HpOAIA9zoCkFnb6K0IwFHjtoAnPukL7x8v8GGBYYFhgTkLJBCufALmHj81oaRDbwkCcKigXJqAfc4B8Iu//MvvF/An1SmQToCUZxu2H7plH2pfW7FxDQsMCwwLDAsMC6wsMLGUlhl/PuITRC0FbIJjwII/5+eM+1LAnkC/OgKQYf4ctR3bPQT02w8pwAeg/8AX/cwK7LOH9utf/G3/BtD+2Hc8dgXgAfJzIH+fdOQglxUEOgNcFQCwZiwE9KeAdsszvdJa7hirAHQkJPgnbS5U58BKx2bXpffWoeUYQ4Er4BXecWXGmv39ziQL/AHwBME9QLQH/kkjj3ICf+p5RgDjR/C8AFZHAO6xEQ4Aqc4AaXUA1PicQ4DnDqcA4D7BfvL7An/Ks4pHGzLzLxDvAXTSdARgZ+5dnAE4WFwVIOjvOQIA9DgCaGOXM4ByBM4WQBZhbAcY/82GBYYF0gKA37yMV1BMPEHzLn5q5U8FQXh1AiRg7zkAmP3ng4VzABL8J39EB0BTe6wAwAjjGhYYFhgWuMkWwIH8lLu/4jWAIUAWH+2Hgi1A3YPf99DJW97/d0+F977311Y/p8dP6gHIe8Ae4C5oF8RLK9g3fY4esqdfUAgV8DOzD5gD7LNk/zPe9Omb5fzHAvw954CrAlwZgDMA4AXwq2CeuIC/l1fzKYscgTv5gvOlFOCaM/9zoH9puu1u9D+CY8D7GADKvQ3N+xtQ6nJ/Zp8B8Yw1YSnwxwFQgb+gX+AP+Od8AKiOAMYytwhgJ0F+8qbtotiPcfXsAAD/WUG/TgSeBQI2pL+C/x4FsHtyP8AcG+B08dmC575JZ4DAvToDcntAdTTQBiEdBYwhjgUcCOvtANNNfq+Pvg8LDAvMW2CbE2AfR8DUmtiEdABscwIkmId/9rOf/Zx//bGPfWLpNoB0KGxZAYBeOjF6zo6WPa5hgWGBYYFhgZtmAf4/sWSW2To+8AVMS8A/5S0HsHrJ83/m5Jt+4Y0nX/r/+3/Nhr/w/m84qeFFv//aR179m284ef3/98c2DoM5Z4FOgB7ox3FA/pLT+wUjldIn+gJYc/8+gP/YM/w9wG9aAv96dgBxVh5UQL8BzQ3IZ55OgaTwxpmNZiWA9QXhuyj1BP+WXQr09y2nfHXM+877L+/b5AX+ANe8v0kH/CfwBNji7GHsAa0ATgKOgBooSyDdlQJuE6jgH3kJ/nUCmC7FGaBDYOkqgDmnADZjjNMZcJZZf2zPO6KCcONSwD+A3Bn8Onu/cno02ztGyORnFRP4OyZ1pQBgX4dDBf+ZTts4AghjJcBN+482+jsssJ8FBMXUkq9UAL2NTq3+JqQTQHAOTdBeHQCczvmRj3zkn//Gww//FnzO/MvXOsqzDdtNXRqv3tmvljxWAGCEcQ0LDAsMC9wkCwj8BUYCqaXUD/iX/Odv2YB+AexZaXUg6DB49T94zQmOAoKrC371fW8/IeAweOgHf/uE8wbsA0uW0TODeQJ9lvMDugB+BGb46/79s/Znn/q7wH+uBhDkbYBxB/wL9gX81AGAC/xZAQCQdztAUsoQeoDdcoJzaa/seabZ7sYGawcO48u9DcAE7HsPOP6kMRNNPv3nxH+CwB4eIL8P8KcsdSrAJ65TAF7Ar7PBuJR7kv7YNyg2ND4H+mu65aE6A3gmXBkwtzqAdJf7owd2yiX/gG0BPzwgX6APMGfWHhAuKO9R6iMT2YwJ48E9VZ0BbhPQGaDsdAYgnzht6nhwSwC/DtDe63z3jmtYYFhgWGBlgfpCSGC8jRdI9+jUJG+CQBwqON/mAADgA+5/5MEHf/KkXffff/93ERf4S3c5AGjDtkOf1Lf2rxUbL0iMMK5hgWGBYYHb2QICf4CPM6mCecHRNkpZ6gFeAOb7gNtjlk0ngQ6C57yp/RZ7C1//xjetAjP4AnvAFfxqGf26HED/MsE+9gDw90C/Kw4A/MnrAMBRQV8Adxvw28CagF8ACXBMsC/gF/Cy35397xkAUQIt8gFRLKfmUEi+P/g9cQJxVo+wdeQvft7X/kMCoG7OaYCux3QGMEtO0FFR4wBKgfPKRu2+rfd2OgYAoTgNqMfqAB0A/PQfjgFAK2lsD2DWnxl/gT00wb1OAPMFuzibBPpzdOWUWjsoAMj0AUof1J9xFuBX4E/cPKn3iHH6ynOcDoEN6G/plMcW6J1gP8F8gn7umZzFF7CTRh4A3aX6KQN+Y9fWno4Z7K8zwBUByoemLGb6swz3ru1BH//4J3zl7fxOH30bFhgWOI4FdAxUkNyLJ6iWn5oamyAQX+IE0AHgNoDf+d3f/eDcWQDpBHAFAFRHg+2GLuoHtS+NHcAfI4xrWGBYYFjgNrfAnSyHXQH/NZC4jsD/ECeCIDvpIXKOUUcdAPJzQcAPla9lcVzg7ABEAtY2wK6BRQBsD+gLmj77v/zcnwXQOzPNDHjOgifg55tiz+diog6gizYAcuiCTgTBejoCUvdMX8on8JeX2p4UmbSXYFonQFKANmUA4zwz9AP9AcTYjdl+bEY6QFkwT34GyyDDQFlkUM40KbIE5zroBP1VP1d1oOe+gTYyYBO2CyDHGX8BvoA9Z/q5lwTegv1dFJCuM0CZPYqzBXugBxQb+usMAn3vZXTIds0nnTKrlQHtvbfnPXyVi+f3+1XWc+g2LHAtLMAD5eXDZVrG5/gE1/CTQSC+xAGQs/38EgCrAN75zne+x5n/pEdyANgf+m5/4cc1LDAsMCwwLHB7WOAxAH/ABh/3gIlDgP83ve2nL3XG/xjg+zJkLAH8Fdz34ukMkOdQQsZVwA/QBpAyu58z98zQO3vfbunJ25o0Z+4pw6z+AYBfcV2KPFYJ0A5AjuDqA6hpAmyAegX++zoIBP+V6gSQpjNgF9gWhK8cA22GPMFzD3yvQHx73qSbMsyul5CyE+Tnc7qqswb62CNtZH+g2JFg37Sd7ecKEdPsC23g8AA8EwDPCdBXYHpmpj9B+BIeoM5MvUDddqrTAWeAjhLuF1emsGoAgI+cbE8HgKsAcDjg0OIbvHuDXr1Ev8uTVozRi2d5+HENCwwLnMEC9YHaFq8P5NTaXYWeEyBn7RPMuwrgvvvueyGHAeIEYEtAgn/LWC9l8c+WYJvqsKbqaD9a8gD+GGFcwwLDAsMCt5kFpic97nnPT+CfQGMXL/jgYD+W218GeL5ubQr2oT0QvzRNgL+LfvV3fvXHAHuMMeHPP+NpPwXYBsjzXdDu56sEBFY/L4kjAEdFBp0APccAeekcAORWcFsBcYLj6gTIeAJn0rPeSibL5NdOM56XCs578W3l5p65jUNg7TBg5puVAMx+C+i10S5KeW1Ef7KPmU7/dABAdVTgIAA8C6oB1IDoTDPvmNR20umQKw5wEHg+A31kawV6qYOOACi6pgMA/opvA/CbHOp3OnQi+D0/Ry3XaNZNmS1rXMMCwwK7LJD/MOWT5kNV+Xz4ptbQJvjgCtChAneBPDSBPrP/OABwBFQnQNZRDlT5tpc6NF79qt4t60p9KKDPuIYFhgWGBYYFDrAAABDwkOBlDnzUdEENh/td5h7/6wD+BfxLgf22crvAfuazhN8Ze/7v8/++3Sb8X78WF/pyj3p2QDoD5niBb3USVMCrcyDBvDwgvwLiOYdALQcoPzWbXmbxAfE+SwJq6gjmAfTI5LmEuiUiqWAfqh3MV5/U1355BkDqV7cHrBwa4RBArjLRDT1xAnAOADYWWB9KBeSH1BfEzzkDcASwwmWuDdIJ1Cdc4RUAfov7bQ7dAH6/5xMv5Pd+fvNTpnz3p0zbuRbvh6HksMBlWqD3j9S0pD5U0nzgVg9y68RE8MGce6AT0DvDz/5/zgHQCYBDgLQsC58vBOXbnu2vqfqpr7Rlj2tYYFhgWGBY4HawwNMe+/ofF4zsQwH/gAB+yu86APCL1lHAf9YZfh0BCep7PD8/CNh3Vt///e0e5X/5bXPxDYNDwK0CvVUCAuKk1SlgXCBdwbOAOWk6BRJcy2fZXbwAnHKC60qrDOsckzqz73L/Ss1XT+yEYwInAO8LHAKHAPeldeaAe68+ZZnBZ6uA2wSgxCmvrKTW8QwAHABX7GHx29tv8lMYwW96n3doTg4mn2Wst8UZYLtXzBxDnWGBq2kBHhgv+XyI5KU+0NApg6BckO7DCs2H2IebNLYC/MEf/uHHcQJw8ROBrAbgoEAdBZRTlrJtK9tvvLqpq7RlXZ/ZA5Qd17DAsMCwwLBA3wIPPPF9798X+AP+n/8P3j2AfzuZX8fCMQE/AB/g3wP6pAn2Afyc2cD/9Ta6/M++idedfNNwRsE+qwSqc4CZbE6S9xcO4EnDUbDPyoEE7fsAdYH2LrqPzCVlsz3Kqz/OCMC+DpJ0mJDuNgAOAwR09wD5PmmC8n3qWJa6tT5L/nUC9PQT+JNHWR0AOJauyEPkN7ff4rcAf557MQCUrQsGnGQZTIdmHTHBcARckVEfalxrC/DQ9i7TfaihPtjSqaWtgqBckA4VuEN5aA0+zMT5OcB0ArAl4KMf/egfsTrgNx5++Lde9apXvZpyKde2bHtN1Sn1tQ+tyLiGBYYFhgWGBa6zBfjf4TL+JRRHwWX/pJ+A+ypQQb+z9Gehc2A/AT9gn496/n9f5/vuAnSfcAjwywIJ9Jfygt3qFGAmmeXkOgYAyYJsgLS8QDrjPb6C74z3+J6MXWku+QfYs1IB8I4d6EP2D4eHQSdI0nSI0G8cAG4DwF533HHHYidABesAedrSrtDPv/MZt4B6AX/SBP/JpwMg25O3LBQngA4AAPIF3J+7msjv7sf4jS4O4Bve73705Z3ARN/nPO97/hsm/VgBzOHgfPcT4Ekj79tf9KLvpyx10hmATLAFbdheU7LigF16j/xhgWGBtQUqYDZ+6uFuZX3Ipsavgg8gVLA+5wDgwc3ASgC3Azy6FuDRswHe8ta3/jQvDR9y5dqWba+pOqWuqX8rNq5hgWGBYYFhgetqAT4Av/yxD7yMbQAZvupT3/HzGfg9cgK/Jc/ss7PTPcArKJZeBaB+LB3sE7TX96VpPbCPXZ3ZZyZbsM//63Z/Tdf1HrtsvbEftly6VaDnJADgcpJ8/loCzgVAZjoEmC0HYK8AcgPcgG4Aeg/MH5pWAb8A3+0JAnx0ToAPwAbozgV+Ok+QT725QN88A2C1CmD9awCAcmQLsOUF2sSxFyF1sDwUHWgX3bWlKxBIxyngT/ylEwA+5aiLKwDMsw5xdYD31wXWy/8v+1nzO5tv8NWsfwX+gn4AP9/1fO8z8edh4H739yhlKEsdHALISGdAdQSgQwvoIhZo7LiGBYYFllrAB5ryPkRJBdtTy98EgblA3ZeAjoAE/QD7GsfLx4w/Ad4H+wgOgKbmuIYFhgWGBYYFboAF+F+1moXifxD/R/gAZYYVYMWSWQArp8qzJJ3wuO//9E8AZgW6PWCcYBoekC49FmA/q5zUsdeHXWn2P6kg3/362JH/39i22Tm/FW7ArXWxXeTbx7MDAJk9sF/TBP+cMs/9HhpPPAfIwxkAeATcAlANgG5AdQLa6hzoOQjch1+dBJTFqYAMgD5yBerO3kudvUcXefWxDJQ0yyhrjtKm4B/d3AbAYYCcC8CvS2CDBNiC/m1UMC61bF1xkU4B+67+PZDPrD5OgMxL3WiPtpz9vwLL/8UFp8A/71zeEQn8mdXP1b5zYH+XUwAZrA7uOQJ4J4FD2j0/tTCcAPHwD3ZY4FAL+E8+H/ZbnAA6AKA8iATBvzRB/zbe8lLlZRutM1ME9VFHKX1Wf/hxDQsMCwwLDAsMC6QF7uR/C/9v0lmAo0AnQc9RAFCeA9UJxnUUSM8K9K2fbczpMZeeIB8eoI8jpAJ97JKGGvzlWIB705UB/mQcoJKgE4B0Zv4B+Hwz7dJUmZQHRAtOAZoAT8GngBsATnvOcs9Rwa7AXABvHFp1pw+kUZZ8+5RUuegJEBZwE2dlA8H6lBXwC/6JE3AA4LSgjOBdKsg2Lk2wL7+kLDoa1JH+oSd2TVk6AEjrzf6Tzsn/lLsCs/98V/vdvZr5535K8A9IB6z3QL2z+i73Z2UAM/wE+NwWQNkqg7iOAN7ZTiqiw/qdNYV+AwPsehmM/GGBLRbgAcrggw+dDAJ0AfshTgAe4AwpS/m2t6apS+o4HvpmoHENCwwLDAsMCxzFAvxPmfj/5OxWXVmQDgN4gLWrCxKMJ3hPXnA/Ry2bsrbxCfQT5Av0AZX0hT61vo3/mUe5Tc5XCN9EjNlmdUAD/oB/Zv0PnRVGpucQsP0AgKpDIIEqvA6BzIfvAXxAdoL4bTxlaZdAObcHQDOQR1naA1QL0pOSjoOCmf78KUCdAdQVfGe95MknDoCH5sz8HEBXpnWlKVdeucTzZwFJR346YZBD+hWZ/fc7e7PSiveH4J8l+gB5zvPKmX5Bey7ldzk/93MN5BFwJFCn50zAOUAeddMJwP3Mu7oF8IH6NnZcwwLDArssUD8EjPsgJeiemrBVEKBDE7jzcsgwN/ufZeRTjvJtb01TF/VT31ZkfNRghHENCwwLDAsMC1y4Bfj/tHIa8IHKBy2gO1cX1C0ICdrhE+BnXqbDkwfI1wmRe/P5n8v/z6ZL/m+8cGOMBo9vAcaW+2oNeo7SAN9fOgScsdYpACVtH3C/DfibN+cAMF+azgCdBOkQSGAt2MYhgM6uWiBdcA6tIfPhe+A/QbpgfY6mfGVnWjoAAPm2SRn4BP/M/q+f5aOM9Z5C/MZevde457hXXPLPPcOsfs7YA9JJy2X7gn3qbQuWg+oMqNsJaIs02tYRgE7r52Fq/UNX9d6zu6P4sMCwgA9P0gTeUzPRKgjSoYJ3HsZDgvWhKde21jT1SP3gxzUsMCwwLDAsMCxwlS1wJ//j+BDmI5ZZXEE8FAdBhsyjbJnFn65yR4du19ICp84PAEgbjuEEQIYAnpUEbElwdYOgfxtNh4DlkIejAmANgE7QbbxHE5RbZ3VeQnPa+Wx6hgLplHc1QKU9p4EOgl5ZtwBwDoAz/S75Nw4F5F7SXeT39Qr8802e4J+zu+qB3sQr8BfwOxE4hw3Mt7zOAB0BvbaqEwAdm62mFoYT4JJumtHs7WEBAXW+BATfU+viKiRQTwDfe8h5wEmX1jJZX7m2E1Qd8gFXx1ZszHhghHENCwwLDAsMC1xLC/D/zP9z/h++lh0ZSt8WFtj8bCEg+NDVAIJ+gDoBWRXc8k14qDMAxwBtcC4CwFkQDag2MLOeQdAPsEcfAOW2EeMb1VU96ElYOQjWBy0iQ5mCfyjyjesMIE095+gufbbpeoQ830On9vwzZuiVgJxZefbxC8gpA5DPb32/7/22r9R8cQF1kaEj4EmPe97z62oDdLBN20Ju6/vUghjhCKYYIoYFbp4FeAEY/CCBThnyQfYhhvogL6FZL+VlO41PHdQLyiV9NDb+DgsMCwwLDAsMCwwLDAsMCxzLAncCtFiFIvBd8hOGOA02wB+w3LYw7FKI70bAHe0sacOVAa4GwBHgQYnwBA/mA6irv3zTh+/LY1yrvfLoj60AsPSXQH8IOg+gbN1Z6dB0YjWA+lD3GMocKIPv6dX3Nt/jfJ+jD4Ac/RP8uy+f/lXgTz2/55u8SZlrnrjBb/uVs8E2taGOANrgDADa9LwBnQA6HGyzyVbmwAbNGOMaFtjHAj40UIMPFHTK4EOeQF5+mwPAMkmVBc02Gp/tq1PSVmQ4AjDCuIYFhgWGBYYFhgWGBYYFztkCd65AbgeoC8YBtYDds4BavhEBgABmHAL8rJ9bAKSuAmBrAQ4H06GuQMB50ezBt+RVulbbgvhWbkpdBd34rt4c+if4x/4czif4Boi/9GUvfUMF/4yV3/Hr/vjtvpEb+dO6zCrP8uYjy/Z1plQnACsD0vlg+yG3seMaFhgW2McCCa7lfZCnJmgTfFihPHwGXmjyUJ0BmZZ8ykn5a962oeoD5ZI+Ght/hwWGBYYFhgWGBYYFhgWGBS7KAo8B6APQmfUH+K8B93l8n03pEADk9xwArj5gxr8ZYbooQ1zjdhgrvrE3S/+dgQd4e+AflHiCf7/3+Y5fy8hvdU3yGAD9/fff/1333nvvM+HX5b1HoOqwcUIgWz1os6eLTgDKrmVOaz2UrQ6DDgsMC+ywgA+ND+TmoWz1Vi+IRidDgvcE9QL/mlbjWT8e3o381g5tGlIn9WzZ4xoWGBYYFhgWGBYYFhgWGBa4LAsA7FrbF/ZtRns6HzbbDdZL/de6XJYprlu7q+98vsH5Rsd2AGsO98uf+mPPfwX/8d3eA/4rO1DmqU996tM+8pGP/HOW7yOXOG21AtTz8huftFucEbSNDrkaAVnois7IW+ujLsoddFhgWGChBXwIpTxMGaYW3wQeOEMF+Lvi1ls/tBuZa/nZpg+0Oklb0XENCwwLDAsMCwwLDAsMCwwL3EQLMAMMEGx9n25i/8/QZ76l+b4+BbgB2yyzF2y7737HjDuybrn4vmfmHwcA8jxDwNUArcLUgnX9tr9FJ9qu5xGwPQFdWSkwVgHcYvqRMCywtwXqg0g8wfjU4puQIB5+F+jXS1frpcw1n236UpC2IuMaFhgWGBYYFhgWGBYYFhgWGBYYFjjAAqvve7/dc/Y/l/47054H77W2phb4Tt/6Xc43Pz8hqANApwIOBuQik/bXchrZyFs5AaiPXm4HoI6HAqLjt7/oRd8/VgFgtnENCxxuAR5iLh/mpAnGVw9lKzcZKpg3Xp0BpleqnEKzzdQl+VZlXMMCwwLDAsMCwwLDAsMCwwLDAsMCe1iA7+nNrxgAsuvsP0CdtC0gGxmz15wDAEcATgEOFSxbAvIbf3MmgM6Jqt/MKgDww1a9ZhUeGcMCN9wCPjinHsRmE0H51PhToYL6pfEqZx23HWnq0YqMBxsjjGtYYFhgWGBYYFhgWGBYYFhgWGBPC/BdzTf2lLPsOcPOTDtxHQC5AmDXNz5yKQNwv++++15YVwC4EoBZ/Le89a0/zSoBylKvhfzmP+WgwBHR0zF1W8ugb8gZ17DAsMACC+TDkg8gvGBcOrW0U2HXC6Hm1/rruPKlVQ/jrfi4hgWGBYYFhgWGBYYFhgWGBYYFhgX2sMDqu57vcvbPO8MOGBecO7uOA4DAHnyAOvv3lwbKA9jnHADZFuUA8ujU+uG3fncVQP48ITrjGKBunAUAhkDGuIYFhgX2sIAPjQ+gVFAunZrMW0IF+r14r946TdlS25a2YuOhxgjjGhYYFhgWGBYYFhgWGBYYFhgW2NMCfFOfml0H5HPgH6A8f/YP4M/P8LEdAOB9SHDfvoC/R3NLAEAe/Vq4RU/Afv4sIDqj+3AA7HkHjOLDAjMWEHBXKjCXTq3+bEjwv63cOk+Z0tq28VZ8XMMCwwLDAsMCwwLDAsMCwwLDAsMCe1qA7+lTy/+ZrReo5/L/Jz3uec9/24c+9ogHA/bA+7HS6paA9WqAU46K3jYAdO9sA6CP4xoWGBY4wAI+PAJvqOA86dTSbwnrB/dUei8t6qZM+GxXviWvLuLjGhYYFhgWGBYYFhgWGBYYFhgWGBZYbgG+sTcOAEG1IN9ZdWbWWZr/c+/+8GpVwLGA/i45rDJwSwBnFIAdcqtCXa1Qfw2AvrVAH8c1LDAssKcFBNw9WoH66kXS5E8HBOv2ZNa26cIA/lhhXMMCwwLDAsMCwwLDAsMCwwLDAvtb4Ja99bms3tP/dQBc1AqAdAx8+J995IRfCUAHzijQAcBMP2noaHl0x4lBOR0GzSTginENCwwLLLRAAmz5CsSJ9wD71NL3DT05pPXaVJ+WPa5hgWGBYYFhgWGBYYFhgWGBYYHb0wLMfAt42YtPOFJPb1lW/853vvM9Amp4APVlOgDQJbcEoA+2IMBXfdGVPBwF69XGwwFwpJtliLmZFhB09wD5HHgnfVoQttWv7WF9dak88XENCwwLDAsMCwwLDAsMCwwLDAtcWwswg/2CL37udz74fQ+dvPWHPnDyP7zun3bDGTt4ygFQZ9Q9Wf+yHQA6JNwSgD6Af0L+YoErFoYD4Ix3xag+LFAsIBgnWV66DcTrCEi6q7xye1S1yBvXsMCwwLDAsMCwwLDAsMCwwLDA7WCBx3zL81/w0EM/8ntdwH9kR8AtDoD6CwCA7KviAMARwK8EcC6AToDcsoCDgPThALgdHoPRh6tggQTaPUBu2i5QvzRfeZViC9LGNSwwLDAsMCwwLDAsMCwwLDAscNtYgL3rP/qSf7AX8E+HwAGGuMUBAMB2xv2qrQBgK8BwABwwyqPKsMARLCAAr+A840uBfq9cyunxdoG8cQ0LDAsMCwwLDAsMCwwLDAsMC1xrCzDT/vM/8S9OCAnq9+EPMMAtDgBm0a+qA2BsAThghEeVYYEzWqACbuM9kG5aD+DPpVlnjqI+eeMaFhgWGBYYFhgWGBYYFhgWGBa4LSzAoX6vfeFDJ8z+v/lv/+bKAXCII+AAY5xyAOCEqIfqXYUtAOMQwANGdlQZFjiyBQThc0B9Lv2swN926U7yR+7eEDcsMCwwLDAsMCwwLDAsMCwwLHD+Frjn7qd/D+Cf8IrnvnkV4H/y5b9+wjkA+zoC9tT4FgcAe+pdAeChepd5BsD4GcA9R3QUHxa4IAsIxueA/zHS6YrtXFC3RjPDAsMCwwLDAsMCwwLDAsMCwwLHtwA/U/fNX/Xi9wj+k1ZHANsAljoC9tSUybmJXxzg/AFm+zlgjxl3nAAcCAj41wHwc+/+8Oon+XQQnDd1yT+H+qEjP+uH3dQVvfLQQnSnD+RTnr61MPBDM8K4hgXOwwI+XEnhzxLQM+Wpt2nGBx0WGBYYFhgWGBYYFhgWGBYYFrgWFviCu+765gT823icAeSzNQAnwC5HwJ4G4Jt64wAAaD/72c9+zh/84R9+HHAP9cT9Jz3uec9/24c+9ojOgfME/7nkHzAP8G963rJaAd1SV3SnD8MBsOddMIoPC+xpgQTj8BkQlfElvHWk1BnXsMCwwLDAsMCwwLDAsMCwwLDAtbYAQJZZf0G9FICffHUIkEfwFwKO6ATgO/sUsM5ZdUA+WwJI45wCeLYFMDN/SBCsb3MecMr/S1/20jc89alPfRqz/ejXwi16MtOf2xVcrdD5CcCBJa71UzOUv04W4GEzoLcPn2lJa37G4bms/2hs/B0WGBYYFhgWGBYYFhgWGBYYFrgmFvCgP8G9oF5q+jZKWfLf+kMf2LoSYA+T8H19ygFQgTVAHweATgD6wUz7vffe+8ylgfLM1udPDPacALnkfz3rL15Y6ZhbFdCH8srBGYDuwwGwx+iPosMCR7LANqBuXo+atkSNfcoukTfKDAsMCwwLDAsMCwwLDAsMCwwLnIsFOOjvoR/87dWhfoB3lvNzyB+BWX1AfXUEvOrb3r5Krw4ByyFvbiXAHp3gm/rUOQAA6Lq03m0AAmyX2APSt4UmeyKf8vfdd98L5xwAdck/9VpAN8MtTgp0cjuCWxU6y/9dPdBEjWtYYFjgoiywL1jP8slflL6jnWGBYYFhgWGBYYFhgWGBYYFhgTNbAMD8N577Ix/gNH8O8oP2gg6BniOgOgCyjD8ZiOwa9lCe7+1TAJvZdZb6O7vurwHQnwT/1GuB+lu/2Zm5ZxVAzwGQS/7XB/elzI1udfa/p9+Y/W8jMa5hgWGBYYFhgWGBYYFhgWGBYYFhgWGBYYGLtQBL5Vc/5ddm6is4T2cAKwJ0EJBOHUF+D/ybtlkJUJwLtrVHb7sguzfDXlcAtDamFhKwd5udcwAA4mkH4B5L/pGhUwHZpw4pRAfqeJ4AqwCIb3FOdHUaicMCwwLDAsMCwwLDAsMCwwLDAsMCwwLDAsMCZ7YAS/5X4H8NzgXlS6jL+nc5AnQAeDAgsl1dAL9HJ1YOgFZ+tVyfg/cA5HWPPYfs4dTQCUC5NWifWt2tTgDKcV6AKwAA7+zZJ40VBbTdAnpwnQL/1FUn2kYHf/qPFQqeUVBm/6cmR52QOa5hgWttgXw46Miu+LXu7FB+WGBYYFjgJlvgjjvuOBlh2GDcAzfzHrjJ775r3PeJU/4B70vA/rYyOAIA9AB8wL4z/z2aWwF0AuxpQ/DELQft5Uw7YPud73zne3AM7OsEAMRzqj8OAMA7conHkn/V3Qr+aRsd0IXrox/96B+N2X9NN+jtaAGBPn3z4dhGLZcUflzDAsMCwwLDAtfEAgP43UzgN8Z9jDv3wDV5TQ011xZgJnu1339myf82sD+XhxOAsMsJQL7bCHQAIHOPwQFTrJbb1xl3Zuo9bA9KvDoBAPLUW8tw5h2ZXo/BPvfff/93Oeu/Lm8ZKIG6G0dEzvzTZk+XHc4I2x90WODaWKA+FD4cdCDz5uKWuTYdHooOCwwLDAsMC3zSAgMIDiA47oGbew988k0wuKtuAZf8C+QF48STN39fussJgAPgPFYBsKwegJ0H7rF8/6Uve+kb0gmQBwMWR4DOgBWoJ2+dP7Ux3eSt+U0ZD/yzfdqiTff9M/uPToL/bD/kNnZcwwLXxwIJ3OdAv+k9Sk+VkfmZfn2sMTQdFhgWGBa4oRYY4O/mgr8x9mPsb+hr77p1+06W/AvynX03nkC/l5b5u/hdToA8c0A99jQmmOHUDDzAGhBe9927h786AZixdzVAAfrInUpYtUWajgHqIsN2AfjO/Cf49zwCdOuAfx0LTfS4hgWulwUE7mjdA/Pm76JZ/3pZYGg7LDAsMCxwwy0wQOAAgeMeuLn3wA1//V357gOKWfIvcBd0S0k/K+hXNhQHAJQzAHpnArAKgF8UsF3aPsCI4IoVWAeUC8YB4vyMXx6+x3YA9uN7MGDOxlOPAKBPh4BAX2q+5RP4Iw/ZtOEWBGb+0QFdyKc8dZHX9J7WutOHcQ0LXBsLeMNCK2/aIRQDWE8eOq5hgWGBYYFhgStsgQH+bi74G2M/xv4Kv5putGqA1tWsf+z1F/RLE7gfi0f2LicA2wAopxPgwIECM5xyArgUv64EAJh7qJ+rAXQEODsvSBfkJyVP0G8b1EcWh/shu4J/HQ6UnwH/6D+uYYFrZQFvWgH7MSmGUP61MspQdlhgWGBY4CZaYIDAAQLHPXBz74Gb+M676n0GdDL7DsAWjAv6pccC/HNyaBeg31sFULcBHGhPscLKCYDDA6AtQAeA89N7Cczh2ZMPaE9HQDoDqN8LlDEI/JFV5dNmBf/o1vo4teCyf3U/sOuj2rDAxVuggn00qGnGudFrMG8bTZnw4xoWGBYYFhgWuKIWGODv5oK/MfZj7K/oa+lGqsUs9TPvfdaP+/N+gv85kH7e6bTf+2UAtwHgjGA7wBkGSyxx6kR+Z+sB6pzIz8/wsSzfC9AOUCev5wwQ6CcV9FOHurnXH7m0QR7lcCCgAw4JwP966f8A/2cY6FH1ci3gg4YW8j1aQX8v3quXaZfb09H6sMCwwLDAsMAiCwwQOEDguAdu7j2w6CUxCp2rBQCaLPd/7Yt/ZbW0XuDvMvvzBvpz8tEDgN9bBeA2gDM6ALAr2EGcsTqoD3voBADEA/LrbL3OAIA8S/jJZx//W9761p8GyBPgSSOPMhX0IyNXFdBWgv+y518HwLneC0P4sMB5WSBBeuV9AJfSWt84ustDxzUsMCwwLDAscEUtMMDfzQV/Y+zH2F/R19JNUesx/LQfwL/383ou979MR8CuVQBHcAAw1mIG8MfKCcDMezoBnMHvzd7rDJAC6nNpv+lJcQYgK1cQCP5j1n9q+gj8B55pxhjX9bOADxeayyddCvp75VJO8tfPSkPjYYFhgWGBG2aBAQIHCBz3wM29B27Y6+7KdPcL7rrrm1/1bW8/BfyZiU/QL/A3bW6m/jzTXQXArwLUwFYAtiscyajih1NOgLoaQEcAs/vO6u8C+wB/yrhagLo94F+W/E+tXwP8H2lwh5jLtYAPV9IeoF+ahhzLpkx4LtMejY2/wwLDAsMCwwJXzgID/N1c8DfGfoz9lXsh3eYKccAcP+v3UDvdH3BN2AX80xFwnmB/Tva2VQA4AY48ZBtskT/jl44AZupZro8zgJ/qA8yz5N/l/szsE9wWQB5lKEsdl/o745/AP/b7D/B/5IEd4i7eAgnE5aUC+EqnpmYv1HLGlVfpxfd2tDgsMCwwLDAssNgCAwQOEDjugZt7Dyx+UYyCZ7HAnQn8AdoC/wTdCfRz1l9emnUukq8rAIyfxTCduuAILvHFaksAwJyl+ToC3B4AiNchoFMAkG8gLQG/oL8e8jez319dHtVo/B0WuIYWqMCcuA9XpdM6r0dNq3WI1zZa0iYNflzDAsMCwwLDAlfMAgP83VzwN8Z+jP0Vex3dbupMzDzf82P/y8fZK58z/nPAPUG+PJTy0rm655VOu+g+97OA5zRoYgrxxi2OgHQGVIeAjoEE/IL+zoz/1PpgO7Z7Tt0aYocFLsYCeSPLQ73RK51a3pJQ6xFP+cm3rHENCwwLDAsMC1xFCwwQOEDguAdu7j1wFd9Jt4NOT3rc854P8P++//n/WoH3d//Ah1d0KUgX/Av8jSddKutY5ea2AvALBuc4ZuKJxB2nnAGsDHB1AOC+BvOhbito+k4tpEzbOceuDNHDAhdrAW/qpHnTy09NrSWB8pSzXtJsoxVZOQWg4xoWGBYYFhgWuIIWGODv5oK/MfZj7K/gK+laq8RS/zt/9Vff95yf/T8eecvb/+kJwB/QfggIr2DfuE6BQ2Qeo45L/6Xn7ADI+0GMkbhjagU2DgEBfqWUWYesqzzouIYFbjsLeGN7o+fNLz+1Xh8SrC+1jUpvO6OODg0LDAsMC9wOFhggcIDAcQ/c3HvgdniHXYU+sLwc4P8ZH/3YxwX++876bwPngn/ptrLHzKO9Ko8DDAX/0Gfe+6wfv4QxqDhDHDJHa/lLUHk0OSxwcRaoNzzx+nBMLa0b4lCMmo8M0qos4tlmi45VABhhXMMCwwLDAlfRAgP83VzwN8Z+jP1VfCddM50ewz5/gD+z/iyTPybwT/B90eA/24Zftd/APzw///eK57555Qi4JAfANbtNhrrDAhdrAcA4l6C8B9inln9LyOUzvfxIqzJtK2krPq5hgWGBYYFhgatmgQECBwg8xj0wfdp0ghzpMWQOGed/b16199F10kfgD/h/4+t+bwX8zwv8VzB+0XHAPwcZMvuvI4KfAMQJcM/dT/+e6zRuQ9dhgdvdAgnA5StYn5oRbgkJ/pPvlV2npVzbgnJJH42Nv8MCwwLDAsMCV8YCA2SdP8gaNt7PxsOJsJ+9znJ/XZkX0TVSJJf7M+v/4Cvfd26z/hcN9Ofac/Z/5QDQCdAoWwD4yb1rNHxD1WGB294CAm+oIYE6/FRDAv4eX8uv41Wu7UlbsXENCwwLHGABniGuOfpo7vg7LHCgBc4CHkbdiwNqV9HWAvVKr6KuQ6f+vXrga+NGVuMU+Zz1B/yzFN5Zf2fGoXNA+jqmb8B/69fGAdDAP33/G8/9kQ+0m8Hvkxt5X4xODwtcNQsIvqUVpE9N4VOhB/hrWq2zjlfZttmyx4sBI4xrWGBPC9R/qD5TmS4v3bOJUXxY4I/9sQGM+sBo2GW5XXQAYLPkhw2X2/CybDXegcsskMCfJf/8vB/Avwf+dQRcR7BfdU7wv9kCwAqAtQNgLP9fdv+MUsMCF2kBQQGUkCB9avFToQL9bfFadx1P+bYpbUXGNSwwLLDDAjwvXD43SU2XWpa4Vy/NvEGHBboWuCzgMdq9+uBw2xgB9AX7yW+rM/Ku3ph3XwojcWOBL/7iL/5ST/cH+Cf4FywL+KWkw5t/Xan92dA18Af8v/lv/+ZqBQCrIjbGGsywwLDAlbBAggf4BOhTi58KFfDzUJMmzfxadx1P+bXtVmRcwwLDAjMWSOAu36NzaabPiB/JwwLzFhig7OqBsqs+JhX4Z/ysuivrrHJG/WX39fyb4cbnTHXWH/DvT/z1QP0GKAf4v86OgFV/AP2x9B/gb1gv/782Nwp45vM+765nPfFJX3j/Zz3uP34wA2k4e65NZ4aiwwJbLCAogBISoE8tvgkJ7uV5UDKYLs36az7l26a0FRnXsMCwQLEAz4dXPiummyalrHyWMT0p/LiGBXZaYAClZUBp2OlROwnQoTVoI8sYH/Tq3mM7XxA3sACH2v2nb/u9E2f8pS7774H/TBP0V5plrjq/Av0Af8N69l/wz/5/wPRVvz04sHEF+P/4Z7/vCz7/T53MhT/xhM85IXxWK0f51i+/sa56F4d+wwK3WCCBArwAfWr8qSColybwT958aJWxjtsGtLbfksY1LDAs0LGAzwpZ8kupdaTUk1+zgwwLzFtggLOrC86u4thU0F/jZ9F5OA4u/l6cfzPcyJzurD8OAA78c7//EvAu+Kds8kvqXlYZ9TwF+mdm//kJwHaH8K1/JS+cE4B5QP1n/kefuQqC/C9+4l0nGf7cn/kzJwbSN06Cu+765ivZuaHUsMAOCyQQSGA+tXqnQgL7BPyVz3IzToBspwKYHeqO7GGBG2OBfDYrX5+bfeIYUHk3xpijo2ezwFkA26h78YDtMm1ewb4f1lDzLlO/0fb+9+PZ3h63T+25Wf8E//s4ABL4J7C+LHC/tN0N+HfmPxwAzPq79/9bnv+Ch67i6H9BA+0Af99N6QDwPQXA1wFgPmk4Ab78KU9ZBXjykPXZn/3Zf+oq9nXoNCzQs0AFDQnMp1ZhExLUV8Dfi2f5lLPmsx11aFkDlGCEcQ0LhAXq8yFwN30fitha3rRocrDDArdaYICm/UHTTbWZIB9aP7DNwzbwh9roLHUPbfMm17v1jXDzUnp7/V32z8z/T/3oP92c9r8USFtO8E88efOvClW3Uw6A9bJ/T/zP5f9Petzznn/Rdwr4AzBOePzjn/CVgP3chsCeft9Lvo8A8fBQQ3UAWBangE6Ae+552gmBNGTS1kX3d7Q3LHCIBSqYSGA+NYGbkIC+B/hJ84GDz/LwKavx2U4PkLQi4xoWuNEW8LnACPLHospMCj+uYYFZC9xk8DP6vtz54UeylI9iP6jrRzd2pdw+9t23/D6yR9n5cZ59MdyAjN4J/wJ/Z/6X7vvfBeQTYO8qe5H56kWbp8B/m/n3Z/8E/s7+sxIAPHCet4gAf3NQX5uJB7jnO8c4s/QJ/nkf8T6hrO8myibwdwVALv0nTfmk37N2AmxWAzQHQ+sz32vjGha4shaogCKB+dS03oQE9NUBAPAn7alPferTOEiDstUJkLLWvG1VHVr2uIYFhgXWFvCfSH1OMu6zVGmW2cbTFPnjGhaYtcAAR/PgaNjmk7YR+EP9qOZj2Y9wP7otd6jtqH9o3VHvk+O11BazL4bbPKM3689sf4Zjg39BdtKLBPvb2qrgn1l/A4DfVQDw99z99O85z9sD8M/7pAfYnaUXuEOdpfe9ZF3eT7xPfEcpzzopI/l0DtzTnAD/yTOesdoWQH2cDefZ9yF7WOCsFvCjX3AggJia4E3YBv51Btx7773PvP/++79LZ8BwAJx1aEb9G2wBn8f6fGY6vM/rLlrrGcfEyd9gk4+u77LAUqAwyu0Prm4XmwnqpX5ob3MAHALkD6lzu9j4svqx6/1wO+Xz/Qp4vfcHXvfI17/xTSevfOA9J6/6trefPPjK921+2s7Z7tXsd5sF3waa98mrM+371D2kbLY3V98yp8A/wL/s+0/wjwNgvfr33G4NQDbvFoF4pQnWk6ec7yTAOu8T41JlUQ8+68tzDoA8lPgpJ8CjKwHOrf9D8LDAWSzgx79UIDE1oZuwywEA6H/LW9/60z/y4IM/qUNgOADOMiyj7g23AM8jl89lj/qsLqU9GbWdR1sdf4cFOha4LOAx2r0eDoUE/cnzQe1HtTNsOAYsk3SM9dUd684r4don8e3KoX7sU3/mvc/68W/+qhe/h9+s5+T6DIBZ4s5wO+OdtAeeBc69vF1p1pXuKn/e+SuwD+A3xMy/zpBc+o89z/MGYU+/DkbBeo8CzAXw0gTtpPmOkroCQHlZvvLpBKA+ddIJkGcPnKc9huxhgX0tUAGAYGJqglYhwT98Anxn+5n9/8hHPvLP77vvvhdmmayrvKC2VYFJKzKuYYEzWSDvawQZP5PQC6ysvvXZMO6zsy+1fqXX0UYXOByjKSwwwNnVBWeHjA3Am3rbaAXntWyt7wd5Uj+qv+iLnnRCIG7+nPxd/enpsavOyD/b/Xvd34J8j7JkHLAv0H/ti39lBeoB9szkC6J//if+xYnBNOgK/AbwTQcA9V0NQLkVT1kB85qmvKU8MpaWPXa5qv8q3vq16V/jAf519r/dL3yfnNuVe/kF6pUmWCcv45UnXwelDoBaJuMJ/EknjgzebcRxAkCJNyNM52aIIXhY4EALVCAgoJiavFVIEJ/gXkcAToB3vvOd7/md3/3dD3JQiulXfAUA/ebaRR8tNf5eVQvU+/eQOH3zPrgK/dzWB5/Ps9Bt8q+SHa7CWAwdwgIDQJ0NQF2m/RIwJ+g+Ji/QF9xDTeODGvD/JV/8JZuPbMv1dFhiK/u0pOwoc/Z7N14F14GdAPss4+dn6JzVB+g7Wy1YT8As2M205M2vwJ+4gFh6S5kDHAG0R/vS1OW8eftq+8ZX/aIvODdmwP9FnIS/zQEgUNchYBy6xBHge6tXHxkV/CvfdNu4p50LQN44D+A6vDJuno5+8EMTVEwtvgrpAEhwL8Bn1v+kXXX5v/nWV15Q26uApBU5+pX9RHhts8ZVwHrGB71cC/TGyTHq0aXls9zl9vCTzojUCd7npUenll9Dr5xpVXarfqWcIOgzritmgQGizg6iLsqGguMeuD4kDbBOPakyBPFQZ89M8yOa9HQA4AioZZWXdM5WlCGv0rnyI/049+0Vex1Vde5kKT+AH7D/4Pc9tJrZB+xXoMzMfk3bJy4QPgX0AxCb3qOrtHAELGlX8C9dUudYZezrhq5Bv+BfBwCOFQP2r4NzHnH3/9f3jO8b3zG8JygjSF9CAfDUgSpvST3L6DjAIcBKAOLcn+dhhyFzWOBQCyQQEBxAJ4MAvjf7z4n/v/Hww7/1rz/2sU+wDaDnILC+8oLaXuoAf8yrysu2aMf8Hp0re0z9hqzdFsixSZ6aOUZn4ZUlVRbxi75su1Kfl6RTU85w6rkt6VkHvsomziV9NDb+DguEBQaQOg6QOg87JhiG3xYE6JXywUtaUvga75XhIzmBPXX8cCbd2X8+iAl+nCsbmXM6Yy/7l7azfKYN/vzu0XgVXBX2MYAqTum/58f+l48DRt/9Ax8+NVt+VrC/C0gDjCvQRw/TVsB5HSctHQDKpoz8Nrq03DYZu/JsY6V3OCpW8daPDYVvIff84wDgnAS++S/gBpl4/n0X+b6BGur7gXQB+hIq+BfM886Cp64z/dvkWN/yYxXABdwVo4m9LOAHPzRBwtTiqyCArw4A4pz6z+w/WwA8DyCdAFlXeUFtj7YztOjRL+UjGJ7LtB41X2oZ49BxXZwFloyZY3RWSq9sr/Ln2WP1tk3jPieVTq3g0lDrEld+pS1rXMMCt1pggKvzA1eH2taP3DnKB3IGP44rFazvSxPcs7zfeFLSDXw439OWxboVQEeAOvb6oW3Iq7zlTR/0/O7RW98Il5MC6P/873jXuz7jox/7OOEtb/+nK+AP+N8FcI+VL0BGnnxSwb6OgFM0AH/WWaIb5ZeUO0uZ1GnDA/hxCEAjVAfARR14B5jm2c/3hrzUd4PxfR0AAHfBf6W7gL+OAt5vtM97j7SLss/lPJmj1etmgfz4T5AwtY6sQoL4BPfM/rPvHwcA2wAyTz7rKi+o7aUO8Me4lKNsZMrvS62bFH5c52+BfcfKe2oJ3SabnmW+8fPucbYp3+vL1BRZGqhP2Z4c24BySR+Njb/DAmGBAa7OD1wtta0g2I/bHvWDF5pAP8F9AnT5BPAC9m2Uj1oB/T0N1MPX8pbJciyJpbzt6QRAV3Xv9Sv7jr1qmaU2HOUOu4/jVXApLDP9d/7qr75P4P+cn/0/HgH0LwX+gtmzgmPAPDJcXYBcAb+8bUlXDgAA9Dqog/Gk5m2jlN+WvzQv5aQOp/gA/IJ/z1Fw2T/0PE/9B0twrsATn/SF9wv+ff59ZyTlnZIg3ffQ05987yr9y+66+5HM38YL5i1DvMrPPPINpPNeUwbnFlzKwzMaHRboWMAPfmgChKnFN0Egn8Devf9sAaiH/2U566a8xmdbtG1o7NGu7Fvlbe9QipLKPJrCQ9DGAtq2R+uY5b10KF9lGkeh5DcKngNDO1y2B+31Z2rp3cCzNpe3Tq/ysi35VnRcwwK3WmAAp8OA01nslqDXD95K88M3AT+8oF+QD02Q7odxpfc0gL4tAOL/s2fee/J1X/s1KwovsKcefJb5xm/8hk1Z6hAo13MCLHEEVBtopzuaY2CE87HBrW+E80/hf1oP+O876y/Qfc9Df3CyKwCeLS+QNg7ot/5v/I//dsOTnk6AUwA6gL/pKVfZ5hm3zEXS1GHFC/7pg3yjdeafX1U4r7sBPAFwds9/731nmsBch6PvNQH6NrqvU4C2BPbIlRf8G9cJYNvNTnxrjWtY4NIt4Ec/NMHB1OKrIICX8jDCs+yf2X+2AQj46zYA60CVt6bZVurQss98Ic9LPts4lEdmlWc7gx7fArvGKe+hY/FzbdI7847f00clKl9a+zS1Yt2Qz1nnWcs6VaZtQbmkj8bG32GBsMAAVucDrHp27QFc0/zYlSbor4BfsO+HsB/GCdAF8gLzHgXAZ/hr3/qtJ9/xHf/VKsDXPNJSjuW/+7u/e1NWJwA69RwB9g9q3yu1TKb37DnSzn7vxqvg3Fm+KQH+zvZLv+9//r/2Xu4voAa4A9oNvThpObMP+J6rrwNAqhPgFhBdHAApc1vZbcBfnbaV2ZaX9bs6CPYL8McJUMH/eR/6x8w/4F8HQH3fGefd5/sNKuA+LwrA1wkg6Kct+XQA8J5CT/LHYYDn/voYDSy0gB/80AQHU4uvQgUXxHk5v+Wtb/3ppbP/HVCSbdG2obFHuVKe/BxNXeDnymU6Sho/isJDyMYCaVd4LtOkdczm4lOrm2GuXKbbRo82ced20R6X7aZO8FMNvWcz02r5dbzKtT1pKzauYYFbLTBA1NlB1DYbJoitvEDXD8n86OUj1Bn+BPz3rGfxcyYe0A1YF5AD4gHl3/s3/+bJy7//5RsKb3j1q199in/ta3/4xEAegTgUOcikjXQA2Cb51tEZgH7VCUCf7CM0+5+20R5Q07fZeOQdfg/f+kY4n5Qe8McB8FM/+uhefwH6NoCbeQDcHtgXuJNnfs8BwMw+beo4SGpdKe1ulvsDogv43zee/Tg2jy7IrDqt9J9xAFTw//rv/u/P+9C/O/25P94DvBcyZJqAewn432e2Px0ItmFaD+xbRkpZ32ErB8DYBnA+L44hdW8L+NEPTWAwtfgmJKhwtp9T/3sn/5ufdeBTXuOzrdShZZ3pQpZXyu3xqcMc36tnGu3Ac0kfjY2/x7CAdq50bqxIn0owTZr52+TUNh3fTG9NHe1KufBVt6mlnQr1+erFa52Ip3zbbtnjPsYI4+pbYICnw8HTNtsBXMkXwEoT9PIBafADOEE/H72EexroT8Av8BboA+oF7D/6Y3/nhPDmN795FR5620Mn7/rZn9uEX/ylXzrJ8N73/toJ4eGHH/6EPJQ61FUOzoB0HhA3T0odeHRBN5wF+zoCtI92SSeANt1m95G33/3cfyscL5UD0nKPv7P+7PUHqC7d659AeRt4r0Beh0DWFyRn2Tle50EF1Kul8wscAQnGU4dj8/ZJuaf0FfjrvIh4gn9O+wf8n/dsNnhC8Ayg9t2XlHyBuMD8oqg6Qb/8js9e6Ufb6gPNODwrGY731AxJwwKHW4CPfy5BgMBgammbkOBCgA+tS/4zL+ukrDVvO7YrbdlnvlKWfKW2v5TW+r34mRUfAjb3Ifbl6tl5bsymVp5APnRpmJPXa1u9mvijXsq1zdRpai2dCvls7eJr3XU85dtm0lbsWl3VftmXytMxy1+rTl62sgMw7QeYlthLsJ+0Als+cP3gnQP9LuNPwO9sOwBcoC/IB9gL5gH0//gf/c4jH/5nHzkh/MEf/uHHM/Azv71AGcpTF3kCemb2AfW5NcAVBwB+wD91PvjBD610oB66ojv9uKc5MVzJYH/tv2A/aeYNJ8Dx71Hv4/N6/3CGVA/44wCoB/0BVp1hT8AsiBXUJp0D7AL+zAfEJ0De5kD4wG//u9WqAIG/KxPUZY6q/1x+tp/9OAav7G7bgn2cFfJr2gP/99z99O85r3tCuY9//BO+0vehz3nSfDcKto8F/qs8QX1Pfs0zrgwoepvOIer2cdBhgcuyQP04FhhMTaFTIYFGAv0en2WrnHXcdmr7LfvgKz/qq9yM2/YhNOXIozD8uI5nAW1baW/MptbsMUJPdm2fHmYa8bNeKQ8+9Zha/FTIZwt+1/NHmSpjHc921KFlXYt7GX251Ftq2i7aK0+dcW2xgEBg0LOBLGenE/TD+6Fbwa0gWFA8N9Ofs/zOugP4E+wDugHtH/3oR/9oCcivwN86An+cCLRBe4J4Z/OZ0TfooMARoBMAHZCPMwAHBfV1GuRqAPutHRIAyJMHj+16TgBtPu7dw+/dLa+GQ7LurD/n54y/tO73F7QCtF1yn+BbAC5Qpvzc0v0E/fLIoq4gOeWQJ+Cv5a3Tq6fOgn7KolPqapmktn0Mql4p/xY+AX9xAORJ/8z8E87z0L+8mZhkZMbc59xnXOAvFVgLuHsgfZ+0OTm2k7JMg6IfeZlmnHeQ6ePnAHOUB39ZFqgf0gkKpqbUJiTw6IGOTMuyKWPNZxt+iEtbkTNftU/Khmbbh/Ipr/JnVv4GC8CWXEnTvr3xmlr5Y4ZeG6mDfGv2aFftb+owtVZWIZ8p+XzmKm8ZqXKCZjv2S9qKXbmr2injKKvuu6hlpVUO6ePqWGCAp8PBU9puDvgDXP2g5UMSUCv43QX6AdXO8jPDDuhnZh/AL2gXzBsHgAPkKUMAiFMnQy71l3f5Pu3RLsAd50PO4N/TZvHdlpC64xwA5OMwQJ6OCPRFlnKQlfKUpT2gOgRMI479CNUJMBwAZ793O6+EvZOY+WSP/3/6tt87YXZfsJ+0t+RfwPr/ec/vroB4gvHqDBDwCp7JF7RDjScVkNe6yDDNdiyboN62pOorJZ16yoAqJ+vIH4OqN7LU4xa6Bfgz6+/Mv8Afet6H/tWbijMAeKYF2DoDfFdKyU9gvpTft54gXmBPnOX/tmd+yoXnnYTu8BxsWPs54sMCF22B+rGcoGBqymyCQEJaAYdx86UpY81nG7X9VuRMV5VnPNus/NRa7IVaLuPKlaJ08sTHtb8FtGGlaXv5qYnvBu498rwHpabN1EPu1ILypVWXjLfiZ7pSlrztTk3yJtgHqM/aLpp1UlbwtmXbSVuxK3OlXvBcNe3QuLKSwo+rWCBB7OD3A1QC0AT/fBAK+v2ITeAv6GU23Bl0QLGH9lXQD6AGxPdm+AHaCfIB3AD53LsPoHe7ADQDbRGHEhL0C9TREV0T/APOaz8oD9CnPXXG6YA+uYrAQwSVj1yDMpVvm3UlQM8R4Fjcccd+Y3jTy5fXwV5R/hcB/JnVNwD0qxOAOHv9635/wDbgH+cV4N8gsBdYA6oT+Ap+Bd9QeUF4guJtwFvAb/ltZbNMtpd6qktPTu1Dr0wvLduV79IE/h1e4M/sfwf8T3sN/hkLs1LE96Tgv0cF3gLx86S2JVUf4joGpJlm+Sc+6QvvP6NZRvVhgTNboH5MCwigUw0JKHpApObX+ut4tlE/2luRM121P8rPNuWn1pKh9jfjlq9U2ZWeqQM3uHKOHWZIu1bb5/hMrewm1HtwLp51OnxtL3WperbqB18pCz7bnVp8FbIPFfR7Dkellsu68Mpc02yP9g2NvfQLXbh6VD3PSpWvnFWD40/fAjcdAJ2l/z3gXz9qnfEX3Ar8Bcz1AD/2zudMPyDf4Kw+wDrBviBfMI9MQDdOhQxuJ4DW4DJ9AHoP9Kt/pfesATz9ok+0iz6eS+DKAvQQ9COfQLym6WxArrwrA/ggx6lC6DkBGMvhCNjPAdJ/K+xOffazn/0cQbDgHwrYl7ICYBv4pz73tsA/aToBKLcNGB8KrJW5tD7l7LOgv0eRq0ypbe1Lqa8M+S4F8Jdl/rnnfw78r5f9T7tH/Lgl+Jbp/QSgz7eUZ16wneC/ptW4QD3r7OIF8kmtU+VnGfnhADjuPTKkHWYBP3ylCQimJvJUqGBiV7zWb/GUD2+7jd186MMfeikvaW2T+HRA6MnJdip/aB9ucr1qQ+PV9t3x23U/9vJn7oPannpUetaxqvJsd9O/1FlQLwX0zwXLQFNGp7+2Ca36nLV/Z6lfddkWzz70+G11yeOyjPwqcfz5pAXOAoBvYl0BZg/850drAn/BLOAawAsYBqQ7Gw9gBigzcw7IZ7bfZfzM/pMu4MdBIOBn1j7BvqAeMC+gF2TvogJ/dCUA9AXe9KUG8gyUpQ6gXieDqwvsJ3rPOQGog37qrINAnVKX6gSojoA7hhNg9esT2GFJ+OSbYDn37S960fcL0KE/9+4Pb1YA6AwA+G8D/wBhV7Uk8JdXPgC7B5oTFPfyt6UlgKac8W11LLfNAaCjQt12yduWr047aWemP4E/fG+//2tf+NCF7fmfubNW50WwFaD3TPNc60wVYEN9x8ILzo9BkaezwfbcApBtmSe1DjoMB8DMSI/kC7VA/fglnh/QU4ufCgkmBBfSzKv11vGU7Qe3tBU587WrP7Y/tZYODcqQqr+UTqgH/Lh2W0B7JdWe2lk6NXG3hLz39uV78lqa7UnVR9qKnGmca19tBzoZsi8J6ueAf6Zn+ZSj7DXNdu2btBW50CttQsPq0aOp9z58T5Zptnmhnb4ujS0BCaPMJ8HUPsAf4MosdgJ/gDEA3llygL1L/AH/7tUn3aX8dWbfpfoA5wr2acsgkJ6jAmzynW1H5wq48wOdD3DihnR0IEN9dAQYxxFAn6GkqSMU8E+6jpHqEEjddEqkToKFHBsdNePe/eS927PFPu8p/vf8xBvf+AuC86QAfxwBOgPe+Lrfu2XJv4CXZfcA/br0nzRkphMAUE156wqucQxQds5BYPmk1jUtwTxpNd9yUvOzHu0fE/inHrRnm/Kn6I5Z/znwfxl7/mfuszu5p9gOwGoAnlmfZcE/z7lgG3osB4AydR4YTzqXRzrloOhjneEAmBnlkXyhFvDDN2l+TE9Nm1MhgcQcX+tEPGVnm/BnuaxfZRLPNuGnXqAvpEt7ZVqa9avMXrut+Lj2sEDPhovGr96H/KMgbY7W8lvG/DzHufbXtqZms1VIPemLIUF+5TlkiUC65aXKU35Q206dWvYGgMOf50W7XNn+HK+uZ6FVtm1L1Yf4uNYW6IGCkXYaNAkmE2D6oSogdoYcgFqBP4BW4J9L/J3lB/Q7yw/od4YfUOxS/h7YBzgnkE6gD2jeJ9zTmfVPkO2Hd6WUoe/ZZ0F9BfrEdQQA9nUO6CzQMaKjQEcH/dRJMeeccDxyjOTH/Xz6fk57LH0R3nvvvc8UdCfwn+PZ7w8AFTxLBbTbZv91BCAbcG0dZOAMIC2dBLucANS33lwfSLccNNtUd6jp6HAewF/5VQfjKwrwXxDqzL/xb3n+Cx5aOu4XVU4HQH2/CLShvGsIAnOpZRKYmwaVr/mmW8Y45WiHuO2Zl2XNN204AC7qbhntbLOAH7r5QVw/rKcm4FQQSMzRWn4dr3KzTfVoRQ++lJFya5tTk35L2LMf1q+ys1351ty4Flggx47i2q/amPiUYW7sBL09Olcn5a752r56SVuxgy9lQLOdqcVXQT2zD3OAX9D/1Kc+9Wn8rrLlsq7yoLaxptl+6gXvlbxpx6TKTwpPSP2OxSu7UvpE2riKBRIMDL4PlASSUmenEvwn8AesAloBtgJegb+z/QAgl/ez/D9BP+C4B/jnwL7gOAH/PQ3Q7wo5sz4HrPODXJA913/kpRMCG6RO5NEHgD+rGuyz2wWwEbZwu4P5OAJ0JqTOS1cDcF8zduP+vvX+Lq+DbrQu+Z8D/ZkOOM6Ze0E0AJY87n1BfFJkGBeUW1cATv1d5ShL+7uAP3J0CqizYDvbTd58aeYdyitLqhzjK8CPY2IB8KeMYB/KjD9p73rTe06uIvjne8Z3ab5v5AX+gnCBf6WZL58UPoMOAeTTlmVNJ57bAKyb+aZBx68AdF8fI/ESLFA/gOsH9tR0uiUkmEi+V7alVZm1TeOt6MGXMpLWdqcm/VRI3bfxtd46XuVn263IBsjCj2u7BdJ28tW+UxOxCb3xSsC7i+/VT/mNr+2rV6Wt6F4X9bmUYztTS1sFdcs+COqlzvYn5cAlnQGWSxnKtZ01tX2oOqWOLflcrmwj200+dav81LRaEmo949lOT5dz6fR1FTpA0a2gSJsI+KGC3/wozeXv9zTAXYE/IBdQ66n4LHl21p80Zvtd3p+gH+BMEPAnqIYXaCe4FhijRy8A8HvppO0C//Y9ac8O6qBe6mq76kA+fdNBgh0A/W5/8BwEDzvEhjhSKI9dkFv1Ziz8kFfPHL87mhNghFttsOu9BfgXICfAl9+WB4gFwApmk7JVQKDfo8idq49MwDr10KNXzjI9/axnH6SUxWEg6FZf+yA1/RjUtpQttU8rfQD9gn8paTNB8A/wf+2Lf2VV7hd/+e+efO/feuBDu8b7kvKnfJ/AC/qhgOsK9mu8lklgnrzg3fq+M6CmZfltcpVleb7JLsl+o9lhgVMW6H34+oEsnVqNbpgBFLWscqS9D+/WxJmuXf2YmvRTQd2X0lp/HbdP0NovdWpZ49piAe1U7Ze2hZ8y1HFLoLuUrzJS/pqvOqSOrchBV8pI+VOTtgrqZT8E89IE/fLM/t93330vtExS5UCVbVtrmnqkfvKt2Or+hh7zQj6X7SRNneSnVvaQYP1Ksz351sS4qgUGKDoNihI0CiTz47Qu9QeIAkgFtMxWC/yZzWamk5POBf+AWmf8mfl2mTsz3HOgX0AtpU14aC8AtHcF6lkmZ9L9ILbP2qBS8ylPQEbVybjtJKV97EafAfbYAkcA9sFe//pjH/sEAYcJaTpL3DqAvVN+9kHd0DnHE/6OO06P902P1/dBxll11gPQAuZdlLoC3B5YBsTzM4DVAbCrnuCY+vIpnzZ1EFSwb1upu32kTs8BkLLlE6ibtg/VLsqRImOTtyfwz5n/nPX/n379dScv+o4X/FaO7RXj78z3jjy0AnBBegXfgvBtNOtan3cF7wnzqE+75tu+uiiffPWEZwvDFbPpUOcGW8CP3qT1I3lq9rklACR66es0ZFCnyiKebbXomYAFsrhSJnxtd2ppmyAIqlSgVNONp4zgs62qh/FWfFxbLKCdkqZdp1Z3ExwPqeNWKSCYNGnNJ64MabbT+NQBPvVLvmUtvrKe8qdWexXUQ10TyMML+CsF/LMCwDJZT1m1v7bZqHr0+tiyz/SMUj8v+s+Vdqh86gM/nSFk/Sq3ttua2egFP661BW46AKr9FzDyUSiQ5EMvZ/sBsoDPBLDMUG8D/jgCmOVmNptylBfMCvyRZ0B+hntmwH6mJ8Deh++BZz+MK/DPeNqH9tBFCi9AR34GdbMMYB4HiE4AVkekE0BHgPZzNQD1sJft9vqhvo6r9I7hCFg5Q7a8CCfAaALlOV4A3csXVPfAsaCXMsggwAuAe3UyrVdOmT1dqjOglkG2MpVTabZ/Fj7lZpsb3tn9LTP+zPTnKgBn/k3/1fe9/QTwf4Vn/je3H78GwPtEUO27RQAuQE9gLhhPSn1Dpvd4yvF+II93ElQdLC/Qt33S1YF3CTKIf97n3fWsTWcGMyxwyRbofYzXj+T8gJ6avktDT0794Lb9s5pBOcqvbW90FmAlTYBU+SwnX2xQ21KH1Oms/btd62sr+icPrTadWtomOA7QOl7EAb+mC4RruvnQlJftrPnUJXWE3/eyjnKUPTVBq6Au6qf+0AT9zLpkeMtb3/rTHMCUZbKu8rK/trmm6qJuSVuRjRPAPpB26KWMbENePaRTa2Q2YC/yK91SR7lS203aqo8rLTCA0KP7wwWGUEGjH4OC1wSszlwD4gGu7Fd3BptZa2f86z7/uVn/HvCnvRoE2ILoOarOldbyCZr5mPXDWxtI0y6mWRbnCHpW2aZVHYhbljL0XXtiH5wkgH22AmBHVwPAu4ICJ4pbAlwNgEzbEgSgo/rmGN8xHABbHQAv+OLnfuc2YF/B87b4LifABvQCdls4K7CmvdQngX/yWYa+ZtvJn0WfrKtM6NbgzP8W8J/AP2f+4dnrz5L/t//9v+Oef/4HXunr8Y9/wlf6Psn3EGmCboG34BxKWanPfKVZXp4yvBeIKzfbN33uDADK8j6xbjPulbfxlb4BhnJHt0B++Mr7cZx0ai0vCdShXNaVV74PgbQVP9OVcuFtT12mlrYKAixogqJdfNYTbChzTbPN1Kdlb8At/LhutUDaa/H41TEE8DKOCXx7fG+sHd+m2lRCjit81ZX40ivrptypCViB2OxT6p7APoE/6cz84wAgPcvBpwz7PdPX1Cf1pG/G4c96KatHUwf4qRfUfxvt1Vun1TaqHq3YUfuLvGt/3XQglKAwQS4feDnrnzP+zFYDPlm+L/hn1lrgz+w14NV9/nXWn7q9Jf/O+AOKMwiWl1JB8BxNoEwZ+skHsR/AAmapNjIupTz1qgMA3WkDOqcD6Zah364CwDaupkiHik6AXA2A08VVFDoBbLv2S53ti/SOG+4ImHuBMaNZgXQC5n15nQCC4ATGx+SR39O7t/SfPujkUL/UJXVNPsvswyOjGwT8PUpaCc7wJ5V31v+1r/+uE35eb258r2D6qW0Avot8xwjck1agvy2e9ZDJ+4DypENtL2VkHYG+1PrEWb1wBe05VLrhFuADmCs/hOtHsvGplVsSLJ805cs3cUe5ah+y3am1sAoJGARDSQFLGa981odX7ppmm/YvaSs2rmIB7UOyPDRtCT8Zcgzq+BBPwLuNr3VTrm2tadUl9WxF9rqyrnKnJmEV1EHd1D9BfYJ/ecD/jzz44E9SrjoBlAFVLtS2bHtN1Sn1lG9FVmMEPcuFPC7lSm1bOrUyp4I6L6W1fsRtA2r7lbascWmBmwiABH9JBYh+CAJqK0AFZDJTDXh3r3/u80/g73J1ZqpxEuSSf8F/XfrfcwCgQw2C56TwNejAqOkZ3wX+sQt2Spq24oMZeQLv1JU08mgjQ7ZPeR0A2EP7urJibjUAtsbBQr5bAqi7bUuAeue438T7P/vse6BDH5NAWqC8L/DP8oLsY4DpOeCNbNrJmf7kUx95+oa8qleNz7VZ07Me/GzoAX7KF8BvXJCfcdPqrD//SztjeqWTOEWfZ9R3sFRQnoDcNKl5xis1H5m+z5QvpQ68dQX7UmTA+x5RZjMq3xjjGha4EhbwZqwfvsbzIzn5qWm/LWTZ5JWb7WII4/CHXikb3nanxm9CAocEQ4KjBEumZbkETusX50b2uh3bhaZOLbqJw4/rkxZIO8mnHadWdBPmxpCxqeO3Kz43ttnemk991FHaiiy+rANV5tT42dn/XeCfZf+/87u/+0HOANABsMQJoB1pO4I6QVPX5FvWwVfKST7bhZ9qUN9DaJXV4rW91KVlH+WdhJzb5kowcBP4BH9+CPpB58cfABVgek8DsIBTQKXg3xlqgCfL0T3VP5f6k8fsdAL/nPUX+COzLv2nzQwJqOEreFbXTO/xc86AXQ6AOXvlR3PVMePokuBfXh3TxtpCJ4C2zu0VdUsAdmelALamvE4Axk17ZR8d69ov4nfcwNUA215k/GRcguRjOAGQ4UF7AucEzKYdSpFVHQD2YY5SfpcO5leKnjWN+OLQcwJ0HAACfcA/vIE4y/3Z6/+mn3rVtf8pOmbTfUal+a4RpJMmIBegC9xredOR5zvfMtKUa3moIJ82BP+8J0wfP/237Q0y8i7TAnz8cuVHMHz9SM74tM6vNMvIV7kZb2KOcqVM24VOGQQPFfgtAYqUyXrKgmYbjc/2Uy/4cZ22gDapdkobTq3KKqTNcyzgd41hL7/KSPm2uaapT9W1FVkEGLNeyptow7bVSX11ADjbL+XUf/j777//uz7ykY/8cxwB5kmtC1We8m2PtiOkXqkvPFelj6bu/lvrpexsE37KoJ6V2o9KaznjKXPNZ7upT/Kt6LiwwE0APYK7CvrqByZAEWAKcExgClDPWX9mnlniD/gU+ANCAf7O+LNCgFnsHvAX6EKd9YfSpiFBtEBW0LyLCrIrrfUExvnxq02kfjBLTc8P56qr9oNWHYyri3bWDtomHS6utsDGbrVwSwAOAcaAlRjYvm4J0Hb2Vb3tR70n7rhhToBdb8G/8dwf+UACf/iMz4HqbenUByCnI0AQnYD6LE4Addw2+0+ZOfCvPtKeLuZBt4YeyLdO5sF3whz4Z9Yf4O9Bf3wP7BrPq57P/3WfzTnK+0pAnuDfZxuaIJ44snyHZTnLSrMesokL9inD+wFK2jj5/6rfTTdTPz/K6X1+9FY+P5QP4as825We1frKsZ3UcWrCV0EgAE3QIDBaQrMevDJtI2jqoF6VtuI3/qo2IZ62m1p8E7T3kjEU9FbaG2fHNeVnu2tevarOLXvRlfWUNbWaB4N/nAC/+Mu//H6CoL9S+q8N7HvtLzpEUDdo6izfkg+6rJ8024KfMuR4yKv7Lmp5acpd87Xt1KsV2Tg74G/8dbsDHj766GMCvfyw9MMPgAgoFbwKRJlRBsQzw+xy/wr8c7Z/G/DvzfhX4H9PcwKgQy8ImndRQXZS6thH6xPnAxcbGNI2aTM/ns1Pu/V0Js02Uw958rQ1ZQ3YQ9vrBMD5UrcEsPJCJ4DnAuAcYCwYA+pQX/vSlm3bZ/sCrX29Y33PQG/nsOAFOOEEENADmg2mHUoF3zgCdgHsQxwDyJ8L9AGZ6YTo6WC7gn3L7AX4AfsCfYF/pnVAvzP9OgSc8Ye63P92mfWv9yDA2vcRNJ9Tnl3BPyDcZ9nyNZ7PtnJ8d1E2Q8rIdNpRDmWIQ/n+qrqP+LDAVbIAH79c+REsXz+Ul8atP0cfbfHsf6v81G9q4ldBIJDAQUBUaQVMmZ/1lQm1nTVNHeBTxxYd4AIjtAu7cKV90nZTy9sE7Z1jkGNTecGvlPze2KY828h213zqlfrah1Zs65V1lDW1Gns5AAD9zv5z+B8zW6961ateDfDPPB0B9j37bX9n+qpu0NTZfkq3draTab2UmW3BTwZ1k6rzPtS6UmWvaW079ZJvRceFBW5ncAOoE8j1AKwfggJiASkAFPDorL/L/QH+LPv3d+m3AX/q1qX+znILSu8J4Gvb0F5Qxx4V2C6h1rdsfjD7gSzVZpXmhzJy6EfVmTTasp1Kyat91h7ayXFwSwBOAPb7Y3fOWGA8cktAnguwbUsAbfuBb1/ssx/69JlwR3MASOFvt7D0LYgTADANcAbwSw8F/9ZDjo4AQbWgW7Bt3PylFHAvwKeOcemcnLn25tJPyQHMV3BfQT9ltgRn/JPqAMAJKfC/5+6nf08bP/7f3VYXB1DyHNZn0/c1ALwH/sn3Ofb5hSrLNOX4DvAdaFz5tmE98nE+rOq38wpuK6OPztxWFvCjnE750TtH6wfztvicDNuTHsuY2V7qNbUGVkEQIIAAEAGSBI0CpAqYTLccVBlQ5UJta01Tj9RPvhW78Ze2SJp2m5qFViHtnPbPcXGsemNY07Jejmm2Y9trmnqlvvC7riyvnKlVWgXatE/qpb4C+QT4OgA4+I9ZLRwBgn/zsp6ylG1bM31VP2jqnXzL2uvKuvLZDvyUIXVT36SOWaVZBj7lpPw1nzqoF5RL+mjshv+93QBN9scPN6kfh34AAkoTiAI8AZ0568+yc4AmS/4B/nm4nwf7ucxf0E/9OfB/TwPGhgqa5+LomKGCafuRtFeml+bHb348ayftJjWdstpQ+6Xu9I94tufHtWm9etTRNtUJoEMGW+sEcEVGOgFySwCOgjwgsK4IQAf1UT/7Zl/tO/SO29AZsM/rDycAIBjAngD+rA4BnQDITZANn/ENsBY894A2eQm417yybpHXKdurP5umLtLQaeV8MH0P2gX+65/2A/xzNgP/A/cZu+tWlueRZ47n0HeTz2bGyc9ntPI+x7Wuckn32YcK/m1D+cTJg45T/6/b3XRz9fVjNz+Ce3x+MM/xvXo1LS1N3lku69uGek1N6CYIBAQIAAf2T+sEECTNUcGTVDk7QIa6QNUvaUu+0UCjjh3xtNnU4qvg+EHT9o6HdG78arrlpSnTtmx7TVOvHEP70Ip1L/Oto5yplV48+58AH97D/9z/X/N7DgBsUPt75L52DdASqw2IawfolEGd6lgzRuo/R3Mc4VMWfLbT+NQB3jGStqRxYQFAze0UEqj5MehHoB99fOgJQAGcAn9BpnvOAfse8if4B1Sy17yC/wr6keVSduTTjiHB8hyvftBeALiSLoDtUfpJurSWIZ0P2vzY9YNX20mrDalD/Z7+9JN026OcwTT7N1ffccmx0cY4ARwjnACMDbP/bgnQCVCdNdTTMeOY0H7acYlN7mjPjPcZ/HUO+74FX/qyl76B2WtXAwDej7kaQGeAQD1n8G8B4RVUB/hezbAHuF/qALDdW9pqsm5ZOWD7vXbN24NW4P9Tr3nHCQ5ID/n73r/1wIeu2U/77Xt7bcrzHcBWgHzv+P42jWeQ59V3lJTnMcuQbl3fd77zrOP7DEqazzj1dArAD/C/GaLBXGEL8KHrlR+98nN014dzrx7tkH7sq7alblNraBUSBAgQSGPpNIGXSAWIc/EEHspKoGGbQdWnBzDOwx6t6Wtz1bEjnvaaWnwVHMO0eY7FPmOYQFgZKde2bHtNU6+qdysye9WyyplajZUDwLbVxXsvQXwF+DivTtr1zne+8z01z3jWV6Zt2OYBfbU/sx0uGZZPqg2gUwb1gaqjVN2XUOtAU2a21fjUAz51bNFzeV8h99pd1xm8zOnuR500P/4AoAC+expIBQQC1AGFzN7nEnP2kwMqCawA6IHJnPFHToJ+wD/yDbRHqIAXXWoQlJpe46QLpLfRCrpr2Tmwi70I2k9quh/RyOv1ibTUUT2g6kC+tsh+mqa9tF/dDpBOgN7hgHkuAPn1gEDkqbu6qqf9k9rvapM77rj+joBDXljf/qIXfT9A+d0/8OFbHAHHdAbgZCCswHgA6c3MegXelgngL5BPB0Dy5t9CkbUG/aeW69vmOn/jaLDtA6jAH1nwAH+2HQn83/73/861P93/kPuMOo9//BO+sucIIM0T+Plu8NcDeFf5nPp8ktZ7lkmzrPUyTr7bAEgf4P/QURz1LtsC+QF8LJ4+Kcv+ET/GpRzlQ/2onxq/CgKABAXwzKL+xsMP/xaUl4MgaRdNAJIybcd2g6rTABnNKHEtGr9W/paZcuye4wDYBfgylgSWxWcgjXzKOb5ZH96xXDCOeb9lH6JrGzbzvQ8m+kSgLdtVH/RL8C6gT/qWt771p3EA4MCy35kPnzJqn20Tig7qs6bqKc3+tiJ7X2kDeOVCpwzaPvWD1zZLaa2v3B19zX7KN/XGxUfS7RL4iMuPPj7aCH78AfAAe/c0gJrgXzDJvnHAIjPKLitnBQDOAEGkS8oF/7uAP+3QnkGA2wP1AuFtVABdqeB1F7We5fwI1lbYsBfM157URxb9yj7JV1Bte9Yjv2cD60O12S4ngOOGk6aeC8A4Mn4AqrnDAbU3/VFP75mkaYO00R3X+Bk69A2IE4DD6ATplS5ZGZDOguR72wt6joBTwPwHZ/bVd5wBp8A+9RLUKyfT5Oeodc5ABf6AfQLg/yfe/EP/K/v8+Z936DjdLvX4zgGAA/yf+KQvvL/XL74BKOOzyXMJ73Nb33WmU8ay8JTzPUAZ2rwpKy96dh1p19cCfOxy9agfwvtS5VWZq4aO9Kfq1AUWfvwLChJEsI+aWdQEhgmc5AVQ0pShXKhttf5NJaRuqTemMA5/ky77nVQ7Tc0Qm6BdtTXjIPBlNhxAzGn4v/O7v/tBA84dgnHyGW8cA4xrjiG8sm0r21/z6pb6tqzNcwNfryxr/akVOuXUUBfvL+87qMBeJwb6s/Sf2av77rvvhdrBfMtDU46ybWtHf9UVmn2Qr/2ci1s+acqeWsVV0O5QdYOqb6X0hzRpzSeecpRve2uaumRfW/bWcSX/xlzXGbxU3f3wk/qB5wcdQO+eBlh74J8Z4gr+AY84AwT/AMhcRp5L/AWpldKeIcGtoFMK+ISXVj7LUcbghypxwbVplVrG9PpBjN2wmfardM6e2S/5qp9tQsmzPz2qDKi2c9xyJQArNxgPfyGA7RmOIY4bV3DA4xhguwDjTB0cN4wVcm1Pm6edsFEN2iHtc8cabECvUzjLi47D2vjt+W2OAIB7zxlg2lLqOQM6Grqg/QdnnAD7pAvyqTPH7yNvR1ln+wH97O8H9LPHH9u2seH/1rj2tAArA1w1kM9ofbflc9zL410152zYU6VRfFjg0i3AhzqXH+zJm7aUWhfqpXzjh1LlpC75MT81wavgh79gIIECIAkwxUwqQKICphoXRFXQoWyo7dn+mqZuqbN8K3ajrsXj16xyC1jG/gJfQDBOAALguAJfyzHGOAT44MNhAGDOe8ExdPygtB3BMXTMpK1I96p9tP7USs/O/ud9iO4GAT79YPbf/f+kZ7A8tHf/2ufaX3SKoK5Q+5m0JS+65myA3CmDdlcvqLomzWdQnnz4LAefspSfba75Y/W1ibs9r+sEVrbpmh968H7cAd4EnAA9QF+CSMAgM8ie9O/MP064BI3OHruHHBmC/XsC5M/xgkxogl6Bco8mIO3lkyagToBdeQFsppumnar9enHLUhdZ2Sf7ZZq6ZZvw9kMbEJeXKkOqTbW34weId/sG48gYMZY4AgD7zPwTPL8B5wCBPMa75whQB/Ws+m+z27b786rmnfWtxruYvekAWBwBuTVAsJ50KeBfUg65m9n8BOwJ3HcA8EWrCI4sAztxHzrbD/DHhusl7fzPGtcRLMC9CYDHGeDp/T6/SX3GVzP9bQUBddh6cAQVhohhgUu3gB/qKmLcj37S5eeoZZLCcynv0djZ/s6174f81MSvgh/9UMFABQnMCgumEnwleEpe0FEBh/KzTfVYU/WDZh9adBOHvylX2kBeG03NCJugTbUxtI5jjssczzjiKGC8c/sHspRtW9DUofHq1hu/ln3LZZ+k1JsItmGbtK/O3msJ5BPgs5IBBwArVzJdPuv1nABpN9pXF3Vb0219pT+7LsvYd2nKnZqQVVAHqDaBpq5pI21VaS1PPOXZju2uaeoEr661Dy3rZl5XFZjsq1cC1gpUAXWAyXsaUE8HAACQJf2AQYAiM8UeJOfS/95J8oJ/5O0TBLSCTKlgcx/qR2uP5sdt5SlvmnZK223jLU995NAf+yA1jb70dCONPMrX/ioDqq2gaeN0AugIwAlQHQHM9DN2jK2BOOk4CXT6kMZ9gCzasd3UpeqpDbWHNrvjjut3JsCx3nosVQfErhwsANw1IMchkA6AygP0SUvAbxnzzO9R0mjjlCMgnQFHBu+HOgwq6Bf8Y7P1bP+xhmLIKRbg24Al/AB7Ao6WDNiffL45WlW/DYqUER0WuN4WyBtbHmqgd5m+LZ558Idc2dacDqTnR/zU4qvgB38CC0ECDzI8wIlZYbcCCMC20QQeyoMKNrJddVnT1NP+SFuRG3XRby77D037TC2+CtpT+x4CDh0zxglgDJDGCQCfcm0Lavtrmrqlzi27e1GGK/s1tfgpB4D3j/p53yWQF9yz2oF7FQcAjivTK826yoPahm3ab/uMbusw11f73YrtvLL/1ku5U5OwCravPmcZX/po/6TKtZ3O2KJH6qa+0pa9ee/B36gL0HKdg+BLKigTpAomAXeCR2aO2cPPjDEAMPeOswJA8A+Y8bR/yrvfXznIJAgajVdqflIBZg9czgHnbemC+l1U8Eo5baXttlHLQrUt/bEfSemTuqY+ptU+ZzzlpL3Sptof0G5wbHQEsC2A8WX8pPAG8i2jY4Axro4A+yhFP/vXs+Ed1+x5OvbLDjB1iyNAEN5m5nc5BAT/0nQC1DSdBqZvHAG2d1m09RPAPwf6Af8D+B/7zhvyhgWGBXZZwA/3LGeaH8RJKWd+1jmEV07KzzTbqvn58T61QqvgB78AIIGFYAgKmAJUMTtMPEHTHJ/1BRpQ27LtDthIXWs/jNPPm3DZX2naZmoGWIW0pfbNsdT+OSbbeMozrjh9WFKfMrMt21/T1E19ob0r8+GtOzV+1gGQ95ogPsG99ykzkNyr5LHtIcvIWx+qXG2ivey3fUa3COoMrf1pSTuvWucWOzQJG1ugg/qoH1Sde5R+9dJJSxnKhc70dWq6ZH/n+tzr005DXPcC1w2w9PQVuApSBaiANYAb4DFBIyAR8MdsMLPDOgAA/gn+mSWmXB74B0BUFnIJCVRtL/NqGUFuAl9BpSB5H2p/E2wLTmuacW2l7ZZQ6yADfQXDtR/ZF9uD2qfMJ63W1z7b7OoYJGVsqiOA2X3Gz0DcUJ0A3AvkIQO5jqE8+thn9KZP2kT73dEcAPDQ6xDO6/3FjCp72QG7p1YFJCg/wCEg2E9anQSX4QjYBvg5JwE7uL9/vdT/vEw/5A4LDAsMC2y1AB+7+17WkS6tXz+sqaeMmlfj+eE+tXqb4Md+AgCBQQIHQBLLwt0KIGASPElNl6YM5UJtz/ZTpzWfOmd/Wvam3/C389Ub37TL1Dq/CdpS20LT5vI5JnO8ZRlXQDXjqVzbgWb7jU/dcszsRyuyuUyzHHUnA7JtD13U0/sKvQwCeigrFnBUcZ8m8E+ectaVKtd27L862Gf1W9N9+tuq3HL1bKDMqZVeBdtWF6j6pW3U3b5Uan7SlJPybVMdgqqf1PFL2opvntFMt7/k31bXdQApczoKuqACMYEmoFIAeU8D6YA4AKLgv+4VZ7+/wcPieuAfcKgTALmGbAu+ppsPFeAKfAXGSQXOAk3j9i/j23js0svXXmnDXbx1kKfuSdHVeE9v6mUfk7eeVBul3dKu2hcqQIc6zo41401g3OSrM4AVAgQcAIBVxt1xhsrTFjqgY/YPu6Tt7rjjeoB/9DzvlxnvZgAvM96AYJ6tDVgue/X3XR2QToAev9gRUPTYtsxf3Z3d57R++kVgL7+8oJ9+P/PeZ/342FN+3nfakD8sMCxwiAX8uN1Fq2zLky7fo3NppG8LfqhLp1Z+E/zQz49/QUECBXgPV2NWGOAEwBBAZXwb8FB2tqcO/3/2/ifWuu+s7wT5TTxgdGpgtRi4VVZLxBGTGvQgQoAuKjCikfDAVaEyiEq2bDlyBSkEi24KWsUfCUO1rZSgDVQU1BRON93ttiAuUlWiSEw6coTiAllgUKwEBVSlUEkNogwSInW3316f897P+X3v8z5rn33OPffec993b2nd77P+P+tZ65yzvs9ee9/Ua8jqC3bjG8mv/dWNO+2yGxY4BO2YtkXW5mKd1y5uWepLnm3XfrLvWzl1U/eRdVjXyF7mg9bbDflwxzt1V0fXlusuyT/H/zl6jAOAxxfIQ3dDlq1OANsF7SttMBmzeoM5HuQ1V62T7e1GA/tg39pfvUB1FdU/x1Nly4rYAtn2QfsE1SMw9VSuY8n4qHpYA5mO/Fpcz4msdLpKvJLoQtAgkEkYIYYQOe7wcgw87/77sjgRIgghnN35l2SCN4MUGpKsdmnkS2xBiWQS4Y6sn5OmPSrSFmkEbbcWrUcb6J96V/mYzhLoWq86AJzHtG3Oa8raHHSOksB7QkBHAGsBso8zyPXAGmD+df5QhnVAO7TpHKr/zJ5vPRMnwGN+ifG978kA7ob/5hc+u39B4z/8/B/s3wEAiZd8//J/8eX94wL3cQpYFzw4AyD7XRgnE37pP/8fDv0fiP5wWHBCaB8G2YfwQ/QzSPpFyD+nHxjrY9p362uzwGaBzQLXYAE3y+iivBbdmFfcjbYOwY1+bv4lGBIESQWki38ZB8HCGUC6RCzR9CQetgXafvapHqnbkFP3btyjyIFYIL9uF2PmyrGnTXYj7xC0IZi21d4Vc06UaxnjzKVt2k/2fSunbqmz4xjF9lfNs95u5O4dAPZl/+jnesq1lqTe4/+sT2TyJP86MbI8sm3ZNlhtoS7NuNVbzHEx0Dpu0vIy33q2A+4I9plzqk1AdU375Fg62bLYBGcejhPGSHuOFcy+1adg6puy45nhaOZgm7QB6c/yei5EpeqZpDWJKcRM0ggRJEDcIHAQOYi9d//3R5NvN/j7O5O3Ms+EQwC9c+wdf9rJQDrBfsBKVGsc3QgS3XQCQCaTWEqiGZ/yMbSsNhGpV/PShshvDdJqWsqmZVuptyS+0y3rdPmm2QaYttFezmm1Zxd3Ppgr58h5I85aYG5ZDzoAIP2QPP5jgE4A1gnBtUBd+kOXnCfHqJ2w3XMJT/mlxXc8Lw+EOP/eP/57L/7oX/z2/hGcr3zlD198+Ut/+gLHAE6BJO+S+SWsBB9nQk2jPm37+ABxSP9vfu6LbxP+sR5wUhiS9Ofdfu7yQ/g56XB7p5/flO3aLLBZYLPAG2GB3Ay7eWbgyjPMzfeSvBttHUJu8HPjL8GQXEgiiPNcNQTLI9bkSaISrZNoe6B9ZL/qkzoOOceT4x9ZBxKB/LpeOWbktAfyLoM2TLsia28x58A0sEu3Pmj7YPZ7K6tb1dn4KLa/jIPWOYyFttVfndDLteQ6SzIPmfX4v8//J/lPOevZFmj79JV2UBfHPnTeRUj9c1zIx65a3rZ2o+I+2Kc6gM6XeqZtHMMSSvx5WSKOPNsTsy/7B9WpoDrPsI6xxkdzr3y/kfasrudCVDo9JVwSW8gk5BGSdjPIOEESCOGrd/8h/ZA+HAEQQJ0AxxwAtpuk0v7AjpRKHCW0ktwkvpJh0DElSjTFWTnTLSeajt1I036nIPXUmfZSJp7BfmeYZbMt2tQ+oDbTrjNnQKbnfDhProV0AOAQ4u4/awDyzzsg+H7BCcB6IE8HAPWdR/RCT/R2fNrxreEAQAavPVzJl9U7IM9/+fs++jsQ69/9k8/tnQH//F9+5YWBE3LMC/ODg8DHdXAS/Nbf/jd3/ouALwcEye8CDgaD7dEvQcIPJunHUSHZx3EB2b/9fbkSM25qbBbYLLBZ4PEswKaYy82xsmh64mzDPUvfjcbIA/chN/e56ZcISDCSTECUJFocs04C1clZF9k2QfvJvtVJHW8xx5Q2QOYSX8Zer7+OLced9tiN4R6C9gPTrsjaO9F5EDNPOdvJ9rPfIadOqWvqP4q9ssattxt5hzve9okOrhnXkussiTyOKY//45zirnaSfuQsr2xboO3bXx2/Y0fPCOoPduMeydOrlret3aixD/aZ9kiboKt6V8wxkYdNuOOPnQi+0LOOl/btD1QHUL0aVPdjWMdsfDR5+ByT9qyuaycoM/0kWyAEDCImWYSk3dySf0ibd//z6L9kH4T8E3QEJOmjLnd+JZG0azANpIzpSVQlr4lJbmcEWlK5FiWi4rF6aT/Jaoe1HO1KfOmrhmP9dvnZhvYAtVPabo2s/V0HuRbyBIAOIf8TBOQy/w0kzqFcC84xOnQOAMamvd56BuQfHa/ty4rve8g1d9Qh2xynr06Bf/viT14YuKmTl/MHWkYnAsgpAwOnDgiV6Ev6eUxBwo+Dgt+ba7PXps9mgc0CmwUe2wK50a0bYeOJxzbXs/zdGNgrITf2ueGX+EgMKrGASPDDwA8GR62TRM3kbMN2Qfuyf3Vq9HVsaY+UR5XX6mJsXDlGZW0h7ka5fdB+oDYVtfWpaH0w27fPW1QXUD07HNl38q23G+l3HADqyTpx/eT6ksSDefwfx1Ql/xnPesi2aR+ga1QdtAHjR88I6t+NexSbXp1tbGs3au2D9rZ/9VG/tE3qz5iIg4wd4u+/R9RBkm0g2zZof3XOm/EfdFXngY5jCbvxmzaaOKwR5Ku/ngtRqXpKtCBdEEgJo6RPcg5p4+6/R70hex79l/yTphMAhPThLFh6B8BNOAKQOydAJasSWlGymwQYuSPJl0zTdqeiOqB31bnTu2ufNki3LTHb0y7OqfYS066kZVx5jRPAR0KYb8h+dQD4KIBrAWcQc03b9JN2cByOua7Xa41f/RfU+E7me5277fyLwXQOQNAN/E7w+ympB+vd/CT63M3HuSDBp11IPs/t8/vD78ewDb8D27VZYLPAZoHNAo0Fuo2vaeLSZrrL241+DOQrH1ByAeaGXyIgQUhiocwPBQ4A7yRKomZoPdG27StJh3oVnXOM2kQcRV/bizFyOVYwbfHK3Gq/Oq/Mcdr7mJxrQtm2hw67ElKn1FV5FL8zhjqOfXupM/q5Tlw3rq8k8RBcT6WwJv/mL//y/z0Jf8rUI2592wPtA7RfbbQw/qVxM+bZxfi5tE+2sxvpd5wh9q8+6pc6I+c4GGcSf2zDOzxIz3q2Bdo+aJ+icy+i48qQY6uy4+9wNL+/tJXxq8NrJSbH9JJoSSYhkJBByJlk3KPe3OntnvvHEQD51ykA+UeGEHI0HKfBqU4A+k7yCVGUuCYmyU3yK5FMdIym1bjpHXZlScuArYlXzDLK9LFGX8vPkHbIS52z3bSPctqvyhL/xJwH5ZtbZ41rgzlmvnEGcaycfQGOAGTSdAaxhnAkOb/Oqzo7Dsd7bP1eS/7VfSHdX6G9wwAiD6HXYcCJggyk81ty/+62FjYLbBbYLPBmWcBNL6NWTqyb5RrfjXpLgfKv5LOBJ92NPOgmH5QEJDFIwoAMifCOoqRCMpV3VU0Tsx3bt78kHepW9M/xp51SHlVei4sxeeX4kNMOr8yxtqvz2s1x2j7lLKuc7Q4ddiWkTlXfWdw6h7bUWV1cI64b15EEHszj/5Bcnmtnfc5C1q1r1X5A+zqyLh0DWMc5kqZXLZvt7Eatw+dT+2sTsNol9WbcOEH8fGITLv8zQpZFti0w+7DfxFwDyuh6QshxplztUeOji+u9roWInKqHREviBUmEFN4MglePeedz3tzp9fnuvOuvDOGT9HHnF4KoI2DpcQD6JUAQQQmnRLESVkmtBBJ0LImSZMc7w6yDnPVqvGvjrbdePq9OHnJilqetJV2z7Fo5dU97aKMO055J+lNmDog7F6BzVB0AOINYFxB/1oinQ1gLzj8OgPoYgPrmGLSdNr1mvN5vpk2zzQKbBTYLbBa4Jgu4uUUn5Yq5OU55N+pkIC/jq2U38JIuN/qSgCQGSRogRsQhGS+pxYsX3GmUTFWUSInZln3YJ6ge6lfGl7ZIm41ie1uCr9vFOLlyvGmHO2tAu4naU9TGidq/ljEO2h44dNmVkPqknimPKu0Y9m3ZPn2pD+vD9eL6AZPE5zr0ePuM/JOedV2r2TaPuECWaZe+tVPaIMa+NG7GO7uwC5f2sZ3dSNuHtEe1iZ8bbQMylo748xklnTFmeWXbErV9jpv+DerVobqvQMdbUXuIo6mDjZCv8rpmcjLTLYmlxAsiBimE5Hnsn7u23uGF4En+IXrEJf2id/8hfZwYwAFAwIFA8C4w5BGiL9m/CcJP/6Yj6wDoSCxpHYFkTI4xZdMSM19ZtFyNm459kRNTtlwi+tJeDVnmFFndsj1tktjZTydAkv6ZzFwQmCsdRP4XAOaYuffIv04g/wuA844DgLmnjZxX9XQMjB87PodwlV9Km1KbBTYLbBbYLHB1Fqibfze7YN0QG9+NvHsHNu20Uzfvbu6TaEAAJAWSBVCyBOHw3wJCMnwfQCVYHcnK9uxD4pG6qGcZuzZJuymPoq/V5bgqagNxN0Z9CNpNTJumXElejVvWdsDs51ZWB7Hq2sUtC+71pm3769ZerjvXGIQ+1yCPAkj+uxcBmmf9XJvIEGXeb4FDizVa16R2UOeBOY46zpE9vWpZ29mNGvtgX2mTzi7qXe/485lkLPkvO/385ucP2c8g6JhF+6+ofkvoWBbQcSdW2xDnMv1l7Ir+PgeS0ukoyYR0QcAgiDoAIGmSf0gcBB9yx1veCd7hxQmgIwACqANA4pdOAB0B3d3gm0EIJZiiaUkUJbHqK3EEJY+JjvEYUscya2TLgmnbWTzLV10zr8q0bZuJtZzxHDty2kdZGzrfzLk2XkP+cc7oIILQ+x4AnUDMr2tHpw9x1pSBNphn+kYPdVN/x5q2vVb5ir6KNlU2C2wW2CywWeAKLZAbWOXE3ASnvBtjuWiom/bc3LvxByUGSRgkYiDkAqLBBQHhODbpSbCSZGXdbNN+7Dv1Qdcy/rRN2k95FH8tLsbDlegY0wbIuxqW5jjti4zda1rGs63az4inLup3DK2z19v21aVbe66dXFv1+D/EXZIvVkdA1ndtUsb3CHD3n76SDGsL9Sw2cCx1zKNYe1GOK8vbxm6kHxx09uvnIu2CjjjdOPXw8hN496+fRz5n2g7Mz52ynz8x+1NWlxlqmyVkbJPg+MW0jfKoevgsIF/Nda3EZEkvCSMoUYSIQQBvBhmH2EHavLML4fffhuEI4Hh3OgEgf2vIvycBQIijd4Ml/SA6GEcXyanEVbKYKHEUc3znyLRzrB72pUwico3XdtbouNSO7Xftkmb7iWkr5XQA6AToHAA5F0n+JfPMI+uENcCa8S4/iDNAJwHoyQHQuU4HALppe21w7Xg1X0SbIpsFNgtsFtgscJUW6Db+bm7d+CbuxiimgY02+W64LZvp5le0TqIbezf8STYkCpVMQCggXVIP3wdQSZbxJCKVjFTyoT7q6PhuMe2kDUfWdRIEFLvH5fgqpg2Qdxm0W6I2XYtZFznbv5WrDlXHLp519jrTtjq5/lgPrrtcN64lkDv2rj0QQjwj/qaD2QZOBEk065e8M9diN9ZhpleuWk577EbJfdDu1Sb5maxjTzv4KETaTdnPsLYVHbPoPHSoXsfQcVR0nAW1g1jtlPFR9XquayconX6SR0kixEsSCMmDrEHSOcrty918sRsOAMg/Ie/+12PfefcfImjw7rDk0LvBEsJKQklHt3q3WCLrGETH9hjY2bZLS10kuJmWMvWJ207KmZd1Oll7iNpLXOMA6Mg/xF9HADLzyNzjCIDYk2c+aawlAmXJNzjfdV61j+O/dryeb6JNk80CmwU2C2wWuCYLuHFFJ+VEN7zibpSbhrqZXhO3vaWyuZl30y8ZkCRIHiQTIHdP8/ixLxtLkpVy1kXOtu3P/tVJvR3HLWovMO2J/LpcjiXRseb4kXc1aLdEbXoMs45ybX/Eqw7qtoTW2etr2+rD3LsOXBu5ZlxLEHmJO+TX/0gh0a93/k23Ppjkn7YoY9/gBdahdhimemWNkqct7sxfZ5O0C/bIsSf59zGItFmVtWvFHHuOXzt0yLyR7vzN0DEljvHvmpA20X7iKH59Tr5rJyhVvySLkC0IoWQQUgZBg6RD6iD4HPmH/BOQdQDkS9488s+dYGWRNMk/hJC2M0AOJYPe7ZfwgzoE0LG7WyzBFXN8VcYWpFWs5Y7F06a2l2nK5tme5NZ4Ret1aFvkKdf6Na5NEjsHgDZOTPJ/c/P2c/9J8Jk75pl5JZ1y1AMJkH7yQMpK/olbVgeA86uN3nprewcAX3jbtVlgs8Bmgc0Cz8sCbFq93MAm5kZXeTcqtCE3zg8h58bdjX4SAslCJRPE8/+wQ0a4OwnBglAl4Uo527Ft0D7VQb0cc9hHm4Fp1xG9PpKAUve4cnzKOX7l3ejjTtBuFbVrxVrOeG33Nm6/orrN0HLgXk/aVwfn3DXgunCt5Prh8ROecZf8Qogl/RUl/yLtJPnXeWB/9q8+6jexRY6pjnsM887arPlZ92AP+7Ff9VAv7JHvPtAGOt+0V4eM0XTHm2gfFdXhFFT/RMcmDvvsx10w7VJtNooebIr85NdzISrqmSQRsqUDAPIHKYOoeaQbsv+Vr/zh/hEvHgFIBwDOAY79U5bTApB8ZILkH8x8yKBOgESIIf0n8U8ZUilRlMAmqVXOsaXM2DPeyaeUsSxYA21nmvGuz8yzjmnGO7RMInIXtI2o/XT6YNck/shJ/r2bzxwl+Wf+mHfIPOWzDetTXuIPUpZ20gGQ845O6Ok4urFfW1p8Ae34Lh1xvrO2a7PAZoHNApsF3lAL1I1rxnODq7wbdnoluFGeIZvrWd7a9NygI7vJTxIgSZA8gBIyiFUSEggVBC3zlROzLdsH6Vcd1M2xFBtpOzDt+7r8ADuOxBxnjh/5lfVDmra7DzZt176Np34pm3/QU32cY+bcNed6yDWSaycfPYEAQ34l+EtIGzgIcr3iwLI/UT3QSf1AdD5iixzzkvyKPXKu7NPPgfqA6Mh4Jf4g9khbHZNpgzKONzH7msnOlfotoWNJdO7FYtO0DXJnx5F8Hde1EZIlfZIwQrQk/5BASBvkzLv/Hv3nhFe9+5/kH4LvHX6dABJ/UQcBbUMECToDQAihRNA7wYmSVNIksBJaUdI4Q+zi+Gey+RVn5ZdsnXmdTrZpX8azXpW7srZtfeOJ2kh03rEntjVI/m+GI4gAgWduJP6ga4S5Ji7xzzZshzUl8acdA2nUTceB9dFN3ev4rzHutxDfoT/xgV968aHv+Njn3/3u97x/pPPdtV2bBTYLbBbYLPCGWIDNKldibmDr5nY3yr4S3BhXzE10J9fya+PZVm7mJQAShEosJGWzO7LkJyGzvJjt2Yd9qoe6OZawV9pSG4/sg+2RX5fL8SXm+JV3Y8CvBG3XIfbt0k3r2htp9tehOnZ5B91o37l1rp1714Lrw/XieqpH4Dl1wjqD3B87AeAL/yDO3jW3P1E91Es9Jzap43T8Hdayd+yRNqFP+1cfkRMM6M8pCBwY2mktMk7KOt4Z2t8pqM4dakdQW4plnVU7pS1H0TtOAeJPdl0jKZnpJLECIYOQLYgXhA1CBhmHtPNCtzz6n3f/cQxw519y73F+nQCzUwDkWzbJvw4AyCC6JPFPOQkiektmxRxblbEHadol5VlellEWbecUpK6h9nlKO1k29bHtGWon531G/pkH1gKhI//Oo+Q958w5AnUCSPpBnQEgjoSb4WSwHcpT77k6ACD9P/2xv/siA86Ab/h3PvhhvuOe7Atq63izwGaBzQKbBR7NAmxWuXLTilw3tbuRdie4Ga6YG+djMnW7DXZtM+PZZm7c3fgnQZBkVFJW70r6PHI6AJCzHrLtJSGxX3XJ8RSbadNq61HstXAEOC7HY1x0/OJuFGxDzvcaedbObbr9nYIHvezfdec8M+/H1lr+9wlJMGm5znQCZBprLV+ex51Nyrn+st9u/S2sQcbV2cE5Arv8gz1G/uGkRrUJtlEfdURnxowjQP3PQdqjnu0uoXOjLmvQeU10fKJrARuUkDZLWyqP4ofPOGn1Mm2GtfxZ8SRk1ywnMUwSmEQNcge55wV/Hv3Pu/8+9y/5lwxC7CHyxj32D1o2TwF0DgDIoIQfElgDeeia6ZLaHFvKzAfxDjMNeU3ccqfiMZ1ObS91te0uzTzt5LxjQ22dZB0yfjPmwWP6OgJ0BjCHkHfJum1UzDZpK4k/snHapU+DDgD0dN7Osc1j1vFL4+abv+2Hk/xXmfxRlu+07XqDLPB173rPew04iQjvfOe7vonfvzfIDNtQNwu8ERZwc1oxN7PIuxrcCCe6ST4Xs61jcvbhht1NfhKDJBpJ5iEj+UJAyFn3r9mWnADZD32rh7o5hrBd2rXafBR7ba46toynDdq1Naywy6AdZ0hZ8rLOrWz7tc9j8V22RdvOqXNc19psneUdfNZYPv/P2urIP+kQZh5PoQ5XvXNe197K9ZfjOmaDzM96r5B/bFPtgj6pY9qnk3WuiV0Z02gXOds/VXb+Zuh4QOdedB3mGhly2gs517zySG7TzV+DtgGefD0m2bhvX0kIIYESNYgYpByyzvF+7vj74r9695+XA1JOsl/v6psu4dcZQJxQy0MGIYmQQAlgkvyUIZpZJomtY0vEXucQyawzk0+dC9sRT62/VN42E5EzaCvtqS11ACX5Zz6S/DNHzOvNcA5gfwm/bYmmu65o07VFG8w96KkP8mhz5gBQ/6WxP3WeXxjHHAA6BL77u97/C3zvWW/D19MC/KZ9y3u/9dN/6b0//qKGD37bX33x7e/+8//gz33zN36S39nX0wLbqDYLvDkWcKPJiJXFupHdjTKH4OY30Y1xRTfPFWu5jNMu8Wy/ylkemfYJbuaTDEgakvwjQ7Lqs9keUSavhqxvm0lC7FtdcgxpvyFrX+2dOLKf9cVYuBJzfMiOP3E30l8JzHuXfkZa9nVMvqOHa8815/wy38fWGeQ+STxEPk+azMg/ay8dB8iVGGff3dpTX/Wf2OyYLchv7UG79gGmXdQndczPTMp1XJm3JNM2+YnZ36myOic6JtHxalOw2Kfas6594lz3wWwz29o3fOzPUxOQNf1LpEDvAkPWIH83g4BxPBtyzt1/X/yHA6CSf4/+QwYJ9U5+PQlAXIeAdaoDgL51AKCTZFI9jYu1DOVyfFXGPqStsdNDlXnI/rPtOnbjS+TfNcA6kPgjQ86JO186aNL+zkki+TgAdALQFutEBwAybRLP/mgfXaifc/pQc3Kpdv1++Pr3vOdDkvw1+JEPf/QzfA9af8PXxwJ/5hv+7A9U0r8UxxlAHX5jXx8rbCN50yyQG6lTZOzkBu4526wbc93A7sYADyE3vpUAuDnmRyIJgZvnipbvsPbTxbOebbt5z82/JCIJvOQ+364OOePiVADplknMNmxXEkKf9K8u6ofuacMha+Nq/5H1Wl11fBnXBhV3wwLToC0rLtShfdqr/XRxyt0Jrjvn0rmt6yzXQq6R+h8nWF95ykQHgOhay8cGfOt/9qHsOlcf9QPV2THUsZX4KntQx/ZsH8x+0UW9RD8j6l1RJ8AMa/kapx/SllBd1qD2BHNsOWbtcMSOueYvJY8uD78/tHnSdSki8VDtSBDBJIIQtLxD67/98+4/jwDUt/57nF9Snw4ACJ13d03PuLLlfDZcEogukkv1rCjRRHdk8yW6FR/KptfYrvOMbtUO2gmbYWNJunf/bwZJZz5AguSfeWa+JObOj/PgHGS8a9u5d93gAGCN6PzxJID90F6OgTFda/DLonsHwDFHwP/u//mPXvyvP/jD/0e+E21nw+drAY72Q+aXyP5SHicDODXA7+TztcKm+etugdnGi3G7gToFs71s47nYUf3V3XglAbtR4BDc8Iq5GVbOzfJMTsJgvQ7ph3T7S6zl7cuNe27yJQtJzCRaYD5nDUHj4q3rlZRZJ9uxbfuzf/VJ/cOWaWdtL45iz/5iLFyJji8x7aC8G/WQwUuF2rZx0X7u9Ot6c605p86xcw66DsBcH/U9E6ytY8//s+7yrf/+m0rJsX1l/+qkjqB6Ow7wPjbNdpBtH8x+1SX1qzZyDDkm5Rla5xKoPlXHjDsOMMeX49YmjV1dW2Cu+YeUR1eHzxxye10rMUm9JFMQQcgVJA2ydXNL/E69+y+Bk+iDEvtESb4I2a+kDx28uyyRlLBWNN8xgJZxjInYgHja4inkh9Qh23bsjpu49tF2HUFnXm7GPBAg48wRZJ10nC2V+NumaNvOi3f/mVfatD3a5JEQkMBacT1QrjqBcjxvvXWdTgC/FPiuO0b4M/+/+vG//+LjP/T5F/+rf/av/7+Gd/zmb35hcwho0eeFp971nzkCcAIQeDxgWIDfu+3aLPDkFqgbLRQijavmnRq3DTHbJe05XHXMuWFF3mVwo1s3/m6Gc4N8jmw7idlnJ2dZ+3TTnht5CQPEwiCZB7tTABA1yBtkrHME2I5tg/aZhEEd0T/tOWTt7TyMpMO6RH5dLsc3Q+3Q4W4Y4b7hlbW8ps1cb87hbI3lGnBdgKyt+vb/erqkW1s4CHgUhTVIfdqx3eyrrjnXvnqqN5jjWTP+WibrI2fb9geqA+jnQay6G2dsyKei9S+B6Eg76irmeHKcjj/tUmxW1/Ns/d83fXR753eN+OJ1rcREvSRRkDWJWnf333/759F/HgXgZYCE/Ld/ELck/pX8Q+gyeIcfYumdXokhiCOCUO/qSy47lGiCme9YE9MOyq8jMmbGlWNP22izJOc5JzeDgBMg5Th4mBvKJvnP9qrs2uocDOkA4BQJDiccAawd1wq62KfzmmO51jnzy4Hvrp/+Tz5z578AJOGvMg4Awt/42X/04i/+1//zV3UCiDoDeIEc3598X46++B7criuzwHe9732/NiP0pEPozU/ZtEQdAOLtvF/ZiDd1XlcLLG2gGPNS/iXyah/GwWu7ZuOtm9XdUPwQcpPrxlfMTXEns4EmXezK0Bbptpko2UgdTMtytuuG3Q08KEGQRIHpAEDuTgFAwEjvnADZlu3bpzrkmNA5bTpkbV7nZGS9Fhfj4kqsYzWuLWa4G+2QB54brF/xlfZyrbnG1qwv1kGuCxxLEHlIPM4kkPXk2uvIP3n5XgoeIcg2XWug6w10zeXnTN3BHFOzFl+xQdq51iWebWsbMPVI/VJvZcaF7PhSNq0rY7lE5EsEdKad1D3HlGPVBtonbXYr1/Xseq9Yy83itd4sPro/fO6Q71zXSkzQKwkUhE0SmHf/IWL82z+f/efoP48BzMh/3v2vd/u9owupg/gn+YdcQvAq6ZdkSjSTWKp/pik7Fski6ZYXr3luLq0bY+7mHLtoq0r+c06QdewwR85H2lfbV6SMoToAIPasB9YNa41HTUAcAaS5hlgr6MDapI06n4ztGkN+GfzgB37my5XoZ1zSD/7Sf/4/7MNnPvGlvRPgx/7f/+rFp//6P3nx//rZt8Pf+T/90ztxTgz8b77vc58jcFIA5wDfp0MHvuO26wkscIz8J7lfK0v+RX4bn2BoW5dvgAXY9HC5+VGuaH6Hsw3WsfSuLdK6vm+TrwpSV8dSx7wbGh+Cm9u66ecDnpthZQlIbppTppxlrJPopjqx6rCki33lBl5ikKRCEgZCxGanAHwp4BongH2qg+NiLI4hbJt2dy4qjuKvxeW4GIxyxbTHWnk32qPsGqTMNDA/5DtPucacR9C5da5dW2CuL2TIez5KkmtoRv5J99RAvfsvGc4+1QNUt9TXz1GOq8rH7FLL2yaYfdk/mHopp94pOy7tpy1F0zvsypi2BilTA/qSpt5gjs0xawft09hx7To+p1z9/IzuD6SfvOl1jaREnSTCkkBIGiQQggfhgvBByGZ3/0nn7r+kDcKmA0DiJukXTyH/EL0Z0UT3JIEz0sl4kqQ65kTt8Toj42V8OW7nXVLu3N8Moq0zBiTufErA06Zpe9rPuDLlnc/qaHCtQfpZS4Y8TcK6wVlQ+3c81zp3+cXwoe/42OeT8Hdykv9f/i++/IKAE+AzP/OP9mQf0k8wXh0C5uscwGnw4f/u7+wdAzgFeBcB37F8r/Jdmvpt8mUtcKlj/+kYgPQTl/yLQ/PF36HLjmxr7XW2QN3suLC69Jp2zuZqTZ3aT8aZC+LXcqlL6qicY90NhQ/BjS3oZrdu+t0M5wZ5jUw9yllftP3sT1l9jCda377dvOfmXgJRyb/EbHYKgGPbHMuupM32QPux3xybet7+uB3sO2yt7Z2LnKeR/VpdOcYlWZucgrthqXsF15bonLmuwLq2mGvnHcz1gMyd/NnLJHU85VpE9tSAp09qm9mfa01Uv9TZcYCO7T6Y7SFnX/YPqlO1Uerv58YxdjY071jZY3Vn7dhu6pVyjsPx5Zi1hzZt1uEp6/jUsrPP0VBjf/l9YnyP10pMJE4SNgla3v3nKHa9+8+L/7z7jwOAN/9zx7Yj/5A2iSNyJf8QSwNEk74JEETCjPxDKlN/ZcmmyJgcF1jrXevcXFIvbEN72kjEFmkfyX/Og04Aj+JTxjra+BhaHkxHA/NM+54AoA8cAKwng+uKPNbR0mMAl7TZJdvKL4M1/wowHQCcAoDoG5Lsr5XTIYAzgGB7OBfo71M/9pkXnE7gPw+g40f/vQ98P3IG/0e9yAvt+L7m+3mMcZfj3OS9BXZJ3C8tS/xFXi642X2zwH0skBsc2nFDk+mdfOpGajfa7sKadrr+q56j+Se9Zjrm+HZDw0NwQwu6ya0bfjfCboxPRetXzP7WyFlfHdy452ZeEpCkS/IPzk4BQMa4k0v+zAlgP/arHujmGLBl2njIaf/ZHI1ih3WP/NwuPwvqbXw23kxP+6yRd6MTyiUiT0Ouc2XnC3RtOZ/OL+icg64tkXWSx/2T8Nc1lOsxHQDItidmn8ipjzqqc649x+QYT0HqUt42xOwH2f7B1KvaKsfAuDr7Od7HxtRNOcfiGB27ttCezVpbs27vUyY/L/WzNdR59bokmbh0W5BBiaDkDFLmHVnuxEL2ffM/6LP/kH+cA5TBUVDv/Ev4E2mXAJEj3Nw6AJJ0SvxPJf8SW8ckMZV4gqZlWWxK/NK2vab2HJ/jds61jWRcB4zI/EC+mTPnQxuKtgmSJpoP0o99Mb+2nw4ACD6EH/LPugJZW5wCYG2Rjx7o5Bqxj9ThmuyOLvmNwJH87q6/aZDxzgGwluyfUk4ngHg4afCJcdrgxICjojoRcBTw/T3Gz/ftG3c9xNH/6kSQ/Iu3LwZ842y9Dfh8C+SGhlbqpibzldduoHajvaVAO0v55HV9qUeHo8qTX+jFlfrlOHYj7xDczNZNv5te0c3wDNk4m5eyaaLtJbKxJu4Gewmznm26aXcTnyQjCRdkLMPsFABOAP4XeyVvSVDsy77RRd3QX7uGrXMOcm66+TJ/VL/zmSD+HC7HhK7KiY6vw7TTMXk32j8anIvEusacO9cU6NyCzneuLdcDJ0bq2/7rusu4MqSff/vHoyfVAZD9IacuyOqp3mIdV455jVzrG7d90L7FqlvVHTt1dtN+T4HqU3XNsTi+HLv20JbN+ju2Zsk/tmaX2ug+M6PJ/ro2QoI+SZgkaBA8iNnNIFiSMYgYd/x58R/P/if598V/3LXNo9rUJSTxr3f+Jf8QwBn5l3AmcUfX1H0mSwxF2vDutWlZ9xrn6JI65Vgdv4ScOcc2GUhjXphH5sq5sC6YbaacZZDpx75oh35sn7VG+6wP+mIdQfxZWzoBcAroBKAc5amfOtn/JW12qbbyW4HvLMl+IqTfeHUAQMxPIfanlE3yTz/VCZDxlNc4CHyHAePJ0wU4QYZNdmmX103mN6yS9fvEv+97fvSrXf2/+O/+Z38q+Qcpw8mM182e23guawE2MFwddpsb0pY2RObtRrmHCvaRWHUd3R/GhPwUV9Wp2m43lDoEN7GgG1swN7zdhp+NsSTEDbNpme4GumJt33jqUGXKVN1sVx1yMy+pkGyBSf6RIV0+gw3prxfHumdOAPuyb3TJcWjbtPeQXT/dPI3sw/ohn6srl3kvS13nX/VM7WbjmaVrrxnuRuPT4BxU7NaWc1fXFPPrXIOuK5F1xfP/dZ243nL9dTJrjJcGkmebYvaL7FoD1TPXnZ+ROj7j1Q41bjnR9rSNmH2nTspVb+1W0XHOsLMJZU0/FWf9kF51diyO1bFrG203WX+z9Uq66zVl0yp27dTPymjy8D2BfOe6FJG4ZDsSJgmaxAzSx11W7vrm3X/IP44A7vob1joAaM8AeSPcDOJHqOQfcogukjuIYxJK9V6L1pWE0n62me1c0r7X0hbjQ5ccZ51z5z4dAEn+017UzbaUTdfeonYH7UfyTx+sAdYGxJ41lw4AnQA4mDhhQh5OAspTN+dSPcBrsb163PkyGJHuRYA6AEAdABLyPfG+ff7/FHK/tixOAPuS2Bs/Bamb5W0rMZ0CPm7A93u10XOPcxy/I+wPkaYDgLaVn7v9Nv0fxgISAjcw9KI8w24DlGm70cbq4KZthkfayn6VZ3qPpp7kQh+u1EtdwZ0hbeCmFnSjK7oBFt0Yr0XrVaT9Li11qbI6idZXFzfxudGHJBh0AED8DUunAHAI1KPdtm1f9o0u6qXe2Fh732LORc7RTB7V9nNZsZYn/5ov9PVSTqzjyXjaLOXdaLANubZTdl4SnTOwrifm1nkWnX+RNYUDwDV2CtKG5W1PtD/RdSaqa647xsDYxBznuTJtZch+kdVHVN9ExkTcsS0h9iC/w7RV5pu+BrPt1CP1dSyg49UG2jHX1WQd5lpFbtfqivTaDvH8fCiP5FcvicC1YJIliBrkDDIFMfNuLIQLAgbp963/3P2H/JMuOcNJkM9p+6y2JwAk/uA55H8N+czxVFki6jgloqZn+WuZn0vrkWPUDjpZOpT83wxynvbPdmYy7ZOnfamvzasDgPZZE6wN1osOAAg/68u1xokA1hhrkjI4C3QA0KZ9qtOl7Xff9uo3QvcegKd0AOgo8DRAdQgkqT9H1jGQjgBknAE6PHCKfPd3vf8X+L6v9npucX6vloj+7G7+rM6x8pL+dAB8y3u/9dPPzW6bvpe1AJsSrkQ3KrO0zEfuNj6rN1K5QTtHHv3vJqHqlXqPKocxIz/mlXoop667ocw+pD3c0IJuckE3vom5MT5Vth3qsdkGScs+ldWlovmg7YHq4iY+N/ZJCnQAgDoAOLq9dArA/wxgO9m2/TkWx6NNtbN2H5jzgew8nYKj2mGNUY9rVv9l7vX+Ve+lMVCm2o34rgvaPNH5SMy1NFtPrlXnOedeeen4P+vMdZNI3Rq3PdE+Rde4mOu/jiXHeY5Me9Sr7RLPftVFRFdkdU5kXMQdX0XsYZpyYpWJ3yfYV8XU2XE5Zu2hTV1j3Tq8UJrrvK5/Pzfi6O7wnYB8uO5LIB6iviRNcoYDAFIFGYNk5d1/jv979z/Jv89o+/w/JE7iD0kj6ADIu/43g/jRFw4HgneeJaOSRlAiWUmeZA/EPomZh5xt2LbEsbb7ELZ+yjbTFozV8SdiC+Ig88G8MUekVftke1VOO2dfzqtOJuae9iX/6QDgWX/IPsf/PWmCjFNARxNrjProqu5Vz6e0ee378EVwK3BE2+P+okSYeD0BIDGXqD8G2qfOgIrnOAKs0zkCqjPg69/zng9Vuz2XOP/p4Uf/yqde/MgH/9ohfO/7f25/PH9G8o+lL9XXAVCR387nYrNNz+MWYKPBlejmYw2eUrdudozvRiOLwQ3ZMXQDJy6Vn/SpTmJng1H10a5uXtQN3BlyrI4fdHNbN/lsft0In4tsqt2sI7uhBrPftXLWT53cvOem3n6T/KcDAEdA/i/2+hgAcZ7Tppxt2b79qUOOB5tqa21/izkvyt36OTVtNH/n82n8Pu3QxkNf6kc/yhW1k7gbZV8J2jsx17hyXWfH1pPz7LyLrIdjb/93zVSkDdJsS7SvRNYXcdcZmDrX8RD3M+2Y12LXFmnZn3Lqo5x6KzM2ZMc4Q+2RmHbzM6zz7hjOHDDZZtVFnUHH5Hi1jbbMddasR9Yqa1REngbaWsofea59sX5GiL9yVULwlPEkbZI0id/NIFWQP45ad8/+e9efPAIOAI9n5wsAO/KfDgAIoA6AteS/EjzGgR1zPEsy9TNIgGu7Tzk3l+477ZFjR3b8icwJZBy0fLaxJGtH62W7rC8dTLTNOpP8u1Y8AaADgLWFA4AXUII4pFxrlKW+ziP6sn90vLQd79veK18II2H2GICOAPBAmG//C8BjEH/6SPJ/TM7/KJCyDgPHMMN0BuTjAX/9P/3v9u8N4LTEMNeus+E1pvE7xTrtgk6BJPPH7u7jGDhWBuLfvQtg+68A17hClnVyA9HhbLPRlaWXLr1rI9Pc2HS4G21OQ27Equxm7RSsbUw2Z1VPxzJUfWX8pD3kZd+Jqd9udL4Pji3t4ca22+i7Ce4wN8kpW5bNtXdIkUl3M52Y/a+Rs659gW7ec1Ofm30JRHUAoCP//q8j/6ZxSkBCYfv2pw7opf7YV1tr+1vMeVkr57yeKo9uX1mPtMHV4VL7L2td5q9929pSv9VOu1HpTtDWYq5vZecmcbaWcj0xz855IgSUl0XmGlsj0wblsq0qu7ZE15iYeue6y7ExbuKJ2iKxlsk2Uq59qkui+las48u4tkjUjn5WecwCW/M55LPqyxM5oWMgjTzKECjPIzx8vpkrP7+2LaYuyOqe40obazvXGljX47G4dU5oo34G6udldHn4PCPvr/sSiEvXl8hBmiBPkjNIFeSKzSukyzf/c/cfIpYOAO/+UxaHAacGCNSX1EEmaZNwM0gfAQJIkLzNHAASSVGdK2IbSV+HtbztiZU82salbf7Y7TkOx+94Z8h8SKopY71TMNt2Xbm2mHvXQq4RZILrRwcAhJ816EsncTjl4yY6Kmj/2ufQ74HE7jEA7/7rBIAQQ5wh0xLzh3QCZD8zWZIvUq7K6mq6Y5g5Afb5n3j7Pw9UR8BP/yefeXHrCKj7lTTpVcg8xtCR/0zDEZBOAO/+J9FP2fwZ1jv/xC37nE9SXMWEFiVcgIl1E9DFaSbrzOJd3aV6S3n2kW12aebXzU3Gd6NiG3LzlLIbtGPoxnepXLbb6JF6OpbEUeVBL/uiE2Uw9dqN+D44lhzvbIOfm9+U2RwTr2ga6Wys2bB7dzTrVxJhPPWYyZYVs1037WBu6N3ks/nPUO8e8iI2yf4MGU+2bZ/qgV7qro2xufYPzPm5hJxzfyl5qNt+b9A+l/gydv5f9bVN42K1z24UvBNc16K2T3ReRNeQ6ByCzquYc54y5NIX+LnOjiH1KZPtpGyfiambsnqLjqtD7UAecoddPdPsI1E9ElNnZcaGnGOcyWk7Pp98h2BfiDz/mrMGiX46BLrPLg4CylBfh0A6A6o+6g46PseuTbSpa66uyWNx63W4UDc/C34+EkfVu9djk7+l/iR0kDWIU96dhVRBwCD3EK988/+M/HMsOx0AkH/aMczIfzoA0IGAPpK5JJPqPEPHS36VuzrZtnbIcrbxXFE75JiQ67iNQ6LvQ/5tB2QemVvCzS3pZ01I9CX7nhhJRGYt8UgJZJ81h+OJtYis04kytKkjybVD/475mubu7rfBy1h9DADSrwNAAlwdAI9F/iXwkHsDZD6JfE0nX8Kfsg4C6+sEIF25oqcCGL/OEE4E4Ai4ckL7tXwfJtmfyTMngMRd1BHw4//Bpw6k3rxESb9oHvGx4nbdGtzS1lkgf9w7mVZI51rCrm6mnVrf8tnGuXJualLejU7a0G2aSHNT1qEbt2PY1c3+Gp1S55kNRrUHu2qfqc9u9LoPjiHHl7Zwgwu66RXdCOfGuMqUZSPNpp2NNmSZDb1tJGZfVU6dlCmDXMtmm6lPbuiTVOgAqOSfOHcJuYPYEQjTIBKUzfa1DbqoH7pqZ+3uPNxiztFjyHWN3Cc+hrD/rrEN4+ApF/W9bKtitc1uVLgTtK+o3UXXUKLzJOY6Us71hJxzjsy6goDqFMp1tiRbN9G27af2TVy9RHUXc3zK2EB5CWflaJt69pGoHqI6drozPtIdZyK2Ip64ZD/z/CyDfn51OuowgPTzmfXzK5Lm3FFXZ0Dq5Tgcn2PXjq4v1x1Y12bGzc/yS3LWDbl+HvLzMood9gDI++uayIgECbKkA0CyBqmCXOXxf04BQMI89u/Rf49kLzkAvOMLEcw7/0vkvzoA1LciNiVN2x6Ta33jklf6NS3bsv3nhDmOYzLk+WbMD06ArizjNj1l01xH3ulnnpl3HEAd8edOP0TfwHpDhvQjE1hTrC/WGmvPEyiuPfJxJKA3a+k5OgD4YqiPAXROAEn3Q5L/bFvCLtL/3/jZl2RdhMwjUybLSfITkS2DbKik33GarhMA1BGgEwC7XeO/usM5MSP8Nd3vT94TIFkHJfzI3SmBLKsMyf+eb/zo4T8AkJ7tftf73vdrL3+Jtr/HLMCPOdfsRz3za7msU2XLnorZjnUz7RKyGxraUgZ3s9BtmtyMVXSzdi5me9lvo1vqnnYZRR/kqn0YTz12o+d9SN0dU9rEzS3ohldc2ti7SQYh0BB/SDR32axnO4n2k/2mjG7E1THzlLM9ZHXJTbxkAayEgY1/DRAHScIMKZN92C86qBt6a2dt71wUzPm6Jtn1tIRjKNPvKvKOXdk2ZTOOXO2xG2l3grYFtXei6yfRORJn68h5zblOGbLJGgFznS3J1Cc/26my/YpVP+Pqn5jjvK9Mu7SR7SPbf4fqnMj4iNdx1viS3ZbyJO+Jftb5fPNdxGcWwj9zBvC9xTxST70cQ45Tm2AX11muwbo+azzLrpFr/dt4fi7qZ4b4nQvidA1B0gYmcYNEQdogVWxU6/F/775yB9a7sJSDiHUvADx29x+ySIC4Sd4g4JX8o2PqrCwRTezsS/ksY/0ZZn9de9eeluOdjTHTsT2EHcz0NTbDVtRj7dDGzSDjzjvEvwZPACTxh+yzfgisJdcTqAOAtYgDgOApFNYejgRPLbCWXDuO45rm6s6XQUR8DCCJv3e8PQUgMYZEJ1G/tCxJF+k3yTqyaZJ003AGKIM1TprtiqQZSLPNDnUGVEcAx+2HOV/5vg0TP6rIvzWsRH9N/Ac+8vE7TgCJfSLOgHQOZB4yTgAD5XAAZHl+Nx/VGM+sMxeRP+aoX9PMe50wNzIp78b4XwmzDZMbscSlza+buBnWutlu6tDo6BhmczSqXPzKvuwf3GVQb8eSY8QOhtzsKrsRniGbZo7psrnmjhuOAMpSX7StRPs8B7Md+0n93MQncZAUiJX8E4cEdCQhnQHkU9Y+7Bc9HEtHEHI+hpxzlPOmfGf+St1ZnnUfCnOtVXmoeIfAG5+h9c03LtYx7EbBO8E1DbquxVzfys5NYl1HS2vJ+QZZV5BG1gXrPdfZMTnbqbJrqcNO1xwLMmMVHfepaP3atnHXeeqDvp3tHAfjRK7jNY7NkBOP2ZHPsWWU/WzPkM83joD8PCvzuSZPh446OzbHnfZ0veVarOvUeJapMu3UNOPWD8zPhp8XkEt8GRt/r4mMSJAk3N65hbxBqvL4P48AcPyaO6/escoNrYQNUkddSB7Ezzv/IMQw7/5X8p8OAEilQT1niE3J07bKoumJ5oFrQta9dvnUsTH/lfw7xmyLNG3F3FDPNXMz5pbgPDvvphHXKQCyNlgnBNaMDgDJf64t1htrEdIP+c+TKKRTn/YZA/q4jtBRfdH9GsLhi6AI+RiAxF98TAeARFxMkp6kn3zjknzrkG6aZTJPOduosnHqd06B2WkAfheKaR89ym9zrt9TZNZ63rGH0Cd5T7kSf8l/ngCgrZ/66M/t27Tu9kLA40vCH+78QX+dZTcxjFEZ3HXBzVCim6/E3JxV2Q3sGqx1s4/Uoeia48i5G8Ve3ZiReMaV7VY5+9+NtvdBfR1Dji1tUTf0bt6XEPID6WcTzeYZYpzlJQXZdpXRgbTUZSbXusazT0mFhCJJQhKDzgFAmsROYtBhngKw7xyDNsbm2h90Tk7A6Wfito1j+fs1sLK/XD9Lcl13GR9d3XEEZJ7yUpmu392ocCekTV3XorZP7NaTa0d0HsVcR1XmrrLrYo0DwLVoOxJd4yD9iuoAql/Fbkyk5bhPka07a5f0qkPGU2dlx5PjnMnaxM/rGkziT/mM52c9Zebr2KM+fL7zu8xxahvt6prL9dh9zmu+ceuLplcs679+RvxciaP429c1kBB0kBhJ5LyDezNIHOQdIgbhgmwxP1/5yh/uj2B3DgBJmycAIGTVAUC7Sf49+k+/EjYdERJ/UV0THUMi8ppAO1nOeLafcpZ9LrL6o69younY2KPzyJRxjMpZD5l5cr0wpze3c+sJAEg4ssF5pxwBsu6pANYJ64Xg3X8JE2TIANFn7eGEYk3iCOBEAGnUw6lA244FHR2P43jrrXXr4yHLvf1N8KrkYwASf1DyD0qGL33H3/Yg3RJ+kbQuSPDFJP2kGahrmRlmmdqXDgSwhs4JwLsBbk8DvGrgR0p597vf837XcIc/8UM/v/huANY87wXoCL5pknnjiToAQMj/p37sM684Ab7uXe957yOZ49l0ww82lz/cbwLWzUvGd8MWr4S6GSLuhinRTVlFN23nYG3L/lKnonOOp87nKHr25VqhAeVsP/vdjTL7oJ7qnePRHm5uRTfvS8hmm2efvVvekX/r0y6y7c8QfchTr4rm1fr2IybBSBKRJAB55gBIcifJ65A7hfaZ40Nv7azdnQfnJZB5Y65E5McMS/3mmurkXH8pjyHcWaM1nmVT7vq4YwvtKGpfUbuDzkO3juoaIp5zqZxrSbkSyDUOANYh9UXbSrTPiupWdWZcpNXx5birHY7Fu7ZMs6+qB3F0Fqv+xBmnmGNGTpv4eTXdeEU+v6YpJyIvBQh+95nOtHqayfFrX2zpunM9Jo5Fv1+7mZaydTvMcsi2FZifFT9DI/vwuUPeXw9JLk5pW1KXZO5mECiIGXdjJVvYPR0APgLAJpXNbZJ/6kHkPAEAKYPs0S4BIigp9E7tqeSfMar7fYld1k+ZPp5zcCxghjom8nTAJFmu9cmjnMTeeTSec0hZgs4c2wedex0CngrACaAjgDXEmmJtscYg/pJ/1h7vAcABoEOKNMqybm9u1xh6VQeAY6o2eOy43wMdQhx5tl0HQCX/EGDJ+iUR0k17ku+UJeBLJL0Se8t2TgDzljD7pBzBNDCDTgBshd3y3QC339WdqR80rXMAHCP91VHQOQHWvAfAdwDoBKDfT3/yV15xAmynAO4uAX60uTr0Bz0xf/DXyln/0vJMh1k/WZ4yGVfejfRXQt0MdRsmNmM1uHHtsNvE5gav1sm27V+9is6OBexsMZLPurq2TMs+d6P1fVA/9QUdh+Ordug2727czWNjnXfJl8i/dWo/NY4+NW1N3PbFjlwkUZAUzMg/6RA6xpRkoJPZpM7uEmpnbe9cODfnIG1Qz7YqntPmCXVyjVXZdXgu1vaI72qo49W2ojYXXeOJ3Zpy7STWdWSc+fbEi2tijQNAQms7FembtNQBGX3FTvccW5WxA2naI7GWPRbv+q5pVXfijqmOt4vzOSXdz+sa5PNMucQq+5kXKY/zzvlbQj/jjlU7aUvXHljX51I8683krF8/CyOen5n6uRvZh33Fkz4CAAmSnEnoIE3ekYW4sxGV/HPsH6eyDoD6BnbKzhwAEDKPfEvMJIAQNILkULIoeQTRdSlI3JLYpWz+qWgbFU9t5ynKp87K6NHJpGHnnIO0f+Y5b2Al191c1XacX9ccbeAEuBlrj1AfCeCOPmtLBwDrkQDZz3dS4AggTjkcCKxj2nVtpW5PMR9dn3wZLFxfy5Ht6gCQ8HJX/pLEP9uCZHvXn3RJfRL1lM2vmGVSruVqPMtWmTghnQDoql1AHQHpBPiJD/zSC8j4gr0fJIu766zfNaR/qQzrunsnwNLd/3QAcCqAu/8Z6M9HDK7x5YkPMiErG60/3F08f+jPlbt2z01TB+ojVzS/ouVquvHdaOuVkJsg5NwssQkj7mYMdMPrRi3RTdxazLq2a1/qoX5Fd8cEauchHjZlpK25LFfbMA5mX7sR3wf1Spupu+Oqdug28G7i3chDdpIArSH/tkt/yLXfWRw9uzzbsN3ESiySREgAxM4JwPg4AbDGAQBxwBFCn6lnrpW6TpgP52gJLZfz+NDykj6Rl+utyrkuj8m1rvFd9HWQ69i1a/381zU+W+vO1ylriXnu/lXkGgcA67CuzYznGk4ZPdVRnUU/H45R9HvQ+AzXlKMv6ifav6i+xJUrMlbScswpax8/r+Qpz5DPceYZ9/M9Q+owZ55eWnIAkMdpAXTXBtjDdZbrsK7RWTzrLMm1fvlc+HkR8/M2ir59daTgodMke5WYEYeUQZogYToAIFocsYb4My/8xnjkmruxEn+Imnf9Pcbt3X8cAN79p/1KIpN4ShBTP3TuArYiPfGh7fec2tc2x+xDOeyN7Z2LDsmnXDcXS2k5l86vfUHQCawJ1gbrRCeUJwF0Anj3XweA/wkA51S+l4L1xxq+GQ4F2mUsVfdrmMe3vwl6iePrHGNPJ4BE96EcAJDrvOufBFyi3qWZV3FtWeoZqGOo7Un8yVfek/7hBKiOAE8CYD/siBPgsR8J4LfJUyx8V94n4ARYIvx59N8X/3H3n9A5AHAG4ACgze0/Arz8DPJjzZWYP+DK/rhfCm33HEwdqJ/x+8q70d4roW6Aus2SGzGx2+y6UT0Xs037AdVHPcsY0ibV3qPo4kV5L+XaBvHsYzfih6BO6qjejqXaotuw5wYduW6aK/mnTG3HOP25iRarDmvi1rXdxKpvkgPkSgiqA4Dx5cmGY8TAfB6FUC/G0BEE5wPMeerkLPtUcqdXScu1V+Vurdb1WusQ33UhbeB6Fl3Xous7sVtXzleuH+S6hjLO+nDOE0mvay3jtkGacqL9Vl3Qm7ROf9NynJ2MXbr0Y2m0Txn7maH6Vd2NM07kHG8na5vEtOGSXIk/ZWtafvbJr99lOZ9VhpRSJ23menMdgrlOZ3KWT5n2Mq6c7TSfjfwM1c/cKP7yekwSIkFLMmZaIkQJQgYJg4CxYeVuPwRL8u9Rawi/JJ+yBMh+BogYbUHukvxL/CSaSQyP6VgJLfo/pi2fU1+n2CbXQcp1vLaZmOU7Oec059r51wmgI+Dm9jSA64q1xlrECeDdfx0ArEu+CzwFgMOANUgbnQOgjuep4n4PzJB/H8f/edcJAKHl7vZDkX9PAUCu6SMRuZJx45mXchJ6y86QemvrWjYxnQDpCMjTADoBPvQdH/v8sPluZvdLpvP78f0/8LF/NSP+s7v+s/R0AhxzBnj0H6Ssx//zFMDP/R/+rwenAr9tlxz7c22r/mDXeP6431fOzXftZyl+337X1t+NSbwTcuOD7IZIdAOWmBs05TUbV8rkRrarY3ugfaoLqL4xjhx72ngUueP46eKmZb0qZ/vIO4O6qJ/65hhyjG7WxW6DzpHZvGPGDyGb6CzrRt92ZtjZm7KpU8rmJWbb6EA8dVFO4pAkQDmdAGueC67kwDi2UOdujTgnoPPUYZbrZOf00tj1ZVqn521aXYPnxnddH/Yv1jG7rsVc38jOR4e5fjrZ9SOyjmanQpYcANR3DdpWh50OpKG7WMeRY6xjPzdOH7Xd2q9x9UpEroHxktaNG9uYrqy9jmGSfMpm3M93l0ZZ5szP7jHke4920qauuVyTrtMOKUd6lqcN4mKVrZPtlc9Jft78fRhFDr8vyI/2CACEDAIm8ZKMzYgapAyyDvni7pX/cs03/5MG8YdkSfAh+RCuLiTxh5BB9iR+oHqB6gZ2+pkGaUN+KvL2Jvab9lau82G8w5xb5Jx314OOAB1GrCsCa407+6w9nQC+BBAHAN8F7H1Ig2yxdnU80aZrS72vYf72XwLLf94BccMJwPPsD+0AgFBL/CXXkvhK3Gs+8SyT9VL+m599Wa4iZUizHfONZ3+mVV3XOAGwIycBsCm/l8vmv38uvxF/+fs++jvpAJiR+ywzk3EAkJd3+1Pmzj/xPP6PA4A7/Z0DAGcALwekzp/75m/85P1H/Hxb6H6oTRPzh/0hZfsDZ/0s5c3qnJK+u+0b3Ifc8NRNk5skN2Bibs5yA+tmVayb06W4dcTsw37RJzdqjuEW0w5p6yqP4ofLPBKQuUwTs13knUHbqZd6qrtjEXP8bsQrsllO8o+MQ6CWI+5GP9vtZPonfYZdXteOaVWXjjwkKUCW/DOWGbmr5ICxU5aTAhwH5+4/jwwQ6FM7a3fnwXkRnS/R9A5t47Gw04E0dW2wrsc18V3Tzj6t67+OXfuK2l10fVd0vXRY11DGmee6Foyzfrr1Zlq2U2X1IF1ZrLrP4jlm5bVIm5StbXdpWQYdiatrh46pjrmLYyvStdmpmESfuhn3c5/pa1/0yRxf6gRAXcPEXb9iVyY/D+Uzk58zfxvEUfTl9RgkBMJTiVfGk6hJynQAQLq4m+qRa1DyL/G/GaRfsga5nwVImEGyl+R/ppP6Yaskb8riY9hy6+PuCxHT9shLgfklP+fZ9aYjwHXhOmEtubYg86w5HQGQIE4CeDqF338CJ1VIZ93iBGB90g5tq8O1zKPfA0t4883f9sOQVZ0A3NGG6Hq3HhKsfCmEYFdyLYmXfBuvOMuX0Ev0rWd6om10aeaBylVX0kkzYC+CjwT4ckBsyimLJftfIO8d1QEwI/drHQM4ASibxF/Sb1o+AoDsfwDIu//KnALAQUC5Md7dBcb8rJvwh7pi/qhXGaOtCbWecfpCFk0XTRdNfyhsx5IbHuTcFLlRSqyb3dyopuwm9djG1XJitpF9qYP6qfewb44rbYddDUNsCb7plquY7SHvDPavPuoHqneOxfGB3aacNEgyP3iSHZDN86w86babsmlrbL+mjDqLnT4diZAMgDg2uOtfx5djJQ/CDwGE6GEPyYV95tjQHVtre+fCuUms85Z5yNadIX2QZ1+nonVn7ZNedVLnCda12cV3k7rtyw2rbt0YXdtirvGUmafZ2nKtOqeJzDkkkHXBeqjrRedPXW+0QVpitptr1zUkqmdijkWZMaesDWZIWeuIszTbragdSVdW7w4ZM+k59pSrjaodl+J+Fi2Tn+9Ophzzucbh51znIz7a1XWY67N+VjKe5ZSzDWXRMqJtlc9Ofr7q78Qo+vJ6aCIi4ZJgVfLVxSkLAYN46QBgw8ld1yT/ECvJGQRL0iZCuJAldYnqI6rHEoE0D5shP7Tttvbvkv0le+R8KDtfHTrfousAzHXiWtIRcDPWnKcBOIHCesQphRMgTwHwKABOAPJZw6xT2qU/9Vsaz2Pl+T2whHzP6ADgzjXPs3un+1KEn3YgzaLkWoItWTe+FiXw1s84su3MZPPTaWBah6RhG1EHAPiUToCPfPijn5mR/qX0JYcA38n57wEl/DoCjPv8PyRfwt/hT37vZ/cOhT/zDX/2B5bW4+ualz/SjDHjyvmjrrwbZQ2kIc/QcpaxjWtCdXQMxl8hAW6ARDdIohsysW5W3aR2G9NMc5OaaSlnu/YFqof6HdmoOccdfs24unTTuvl7xW7qoV6g+uYYcmy5GU+ZjTI/eEmIuevNJjrLdTLtk579zOS1c2R92+36JU0yUDEJAaStji3HSR4b/yT8tpf9qpO21dba3/lwXaxF61W03YfC2h/xqvNYp4d118jdOn3lc17r1T46PeqYtbXoHFR0jma4tJ6Yc9Y8Jz5YMziBQNJ0CviZcH0kuh5zzaQ804l0Pxd1PDXO+Elbi1nfOpm2JKdeS7qnTSmXY+7ktBmfUz53BJx0GUwXzWNO+Lzi0CMwJ8QJ5FHOdknLz3onM7fUox/01SauNddirlPWcPd5MT3LWn+GWba2WT47ft78nRBHsZfXQxKNSq6MgxAtMcmXBAziBWniDqovYINMcQQbQuXR6iT+SdxSts3aD/HUqSOK2KcSthp/SBtubR93AuR8KINVNk3Mua9rMddPOgHSEcBpANcnTgBIP98NBP4tIE4BnAAQLMqxnllz6nUNc+v3wBLyPaQDAOQ5du5kP6QTAMIMiTZI4M9Byb3knzYzbSZL+s03DtJGh6apN7jWCcBJi6V5uE8eLx6U6PM9msQ+ZcusRZwAvgdAwt85ALi735H+mka5N/lfAvIDzeUPdaI/5om7UfboBnqUoRzBsqJp2eYl5XPatw54JyQRqJugullyMya6SUucbVhzg1o3pG5Y6wY327XP1El9GUMZV9o753utnPWRW5vZP6he6qnudUx17MTdjNcX4hFnE20dyimL2o64faVs2jloO4nINaiX40hkQ7/0rD93Btn4p7Mg69u2fToO7au9tb9zkuv6mGwdkbZyTm17LaITZSsu1bfvxNS7rsFz49mmcvapXHXVzqL2r+j8dLhmHUkw6xogzlpivRC6fNqv6yXXTfZf9WMcpDmelE3rEHuQXrEre26aulSdM+44tYvkG3tK1iHpEna+WwjaEwccm2xPW3g3njTyaqAuxJ72mRf6o28/x6SRpwOHsvSvDso6DCjv/Dhe7YptXY+uT9D1K5qWZahH3PpLmPVsEyyftfxtyN+TUezl9RAkJAmWpDsJFoQKIiWZksRLusy/GXdbIU7+L3aQOOSfvFqP+va3hJX4qa+ITSRpYqYhb+H52MA5dH4r1vWQa8c1CaYjADJ/M9YgazGdAPx3Ch4B8GWAECQcWDquaEN9rmEN+T2whDyXnQ4ATgEc3gdwe8z9oU4CQKgzSLwl2plX5ST85EnkOyQt0zNOn+bZP3F1MA00ZF46AI6dBHgoJwCPGawl9aeUY31TPkl/PgLgSwCXjv+nE4BTAtTn93RpTb6uefkjnXL+kKe8G4a4T8i2LiXP9KF98rp+TE9EPoTc5CDnBqhulNz4i3Uz66YtN6XKbuzcpC6hdcTsx77VTX0dR45tyNUmOfczudbRvq/YzL5B9VG/1NlxgDluN+oiG+K8M8aGmw00dSyT9ats+4nZ9zGZ9rJuxmtfxtELWf0qsvlnHDkuZdIr8ZdEZDv2BTqGtC821/45J66JY5h1lG2vQ+f4Eti1rw5i1b+s8cO6PJZe2yFuH4mdTnWsaX9k5kV0jio6fzmfysw3BJCATHqugZQpA2m1rHnWsc0O0Yn0qhtx9U9E7gL2IF3sytAP65nPMAEZnY3z2ZAcS9Ahw0tB0iyJhsxL5CuZ5/OVhN7P3TmIM4D26A+dGUf3WXUuTsGcJ+cl7YmNc03mWnUN59rOfOWsvyRTnnzr2W75bOVvRP6OjGIvr0uTEMlVEn5lyA/ECdJk8Jlq4uSlY4A0jllDoAi+9A/iRVnak6AlaauErourZ4fY5JpI2qXn6E1oz/nrsJvzbo3kmnKdzZwAPg7AYyq8sJL/DuDdf/JwEvgoAO1eyxz4PTBDvld8CaBOABwA/leAU08BQIBnzgLIM3mUSSJdif0pcdqRvHc4S8v0lG2v6kC6pF/MNGQdAT4KAPpOAP87ADZ+5zvf9U2z+Tg3nd+pSuzrSQDyj50G6PJxAvzARz7+4i/+u//Zn3oKQPT4f5L8YzKnAN60lwHy48yVmD/Y+UOuvBvlLxVs876oPrSDXNH8RMtk2iuyGxzQTY+YG6X7EIDc4J0iuxl0c+6mUF3UT30dy9fcnb+Z7Y+tA+vdsZl92CeoHuqlnmCOIcfOBpm4G2UIQG7M2XCz0TY/0XrZXpXtl3RkcSabn4h8LNRxqCckZ3bXH1ICyZFEQCQM1hezf8cEamNt7hzkvDhXS5jllW1LpA9k+zqG6GaZlE3r0L5EdRHrGMoav7NGa16tS9x2E+07sdNV2yfm3HSy64p5lrw6/6xz1grxnG/lbo1BdqlHGddKlrNuInoR7/QzjTEh59jWytRjfOjFGJOYz+Qk8FUmfixI+quTzbv390UcLXxWdWCkrc+VnbOcmzov2tz155rM9Yqca9t4LUPc+iLtOtf2bV7Wt/3ymfK3AczfkRF9eV2KiEiqJPtJniT+N4O4E7xzD0LkdQJ4d580ypHOnVPvoGY+dSVl9NURONPU7RheyhZbO8/jdEC3HlgzpLt2wFzLyHkawLUKuYfo+68CeSQAZwBr13XLmibweaCPa1gnfg/MMF8AWB0AnAKYvQ9giejPHACkQ5TFSrKPxSHqlEmkvSTwyMeCdbpytm8ZkLTEKhMn6AAQdQTgBPClgDhXcLjwfT6bkzPTvxbCX50Al4r7KIDEX8QBwHiS9B97FwBlP/K+j331zHE+22r8QHPlD7Vy/pAj7x4g1D5OiavPMd3Mr0h902zrgG5uwNz0zDZMbsbcnCW6gU6sG7xZ3I17l5/tZX/qUjdtjmmM+zDOWxk7nBJq/TvvStBe9q8+qWPqnmOrG2c212zU0wEAgajlaGPJVuTTp30pq4f5phu3/FpUh0RkyA8kDt1zLMqMEUIjmZiRftqy7dTJcaSNtbvz4LyAroUlzPLItpNoHx2mLqfKXXvZL3LqV8dxu65fWaem1/LEsz3l2qfxql83PudkhrnGIMZJVD16DolN8u/cJ+aaQGaN1c9IrpVOdt13ujo28pRnaDvo4ZpnTRN0aqi74+/6zDT6yvgpMn3RN58tP2vnIp/RJP203QXG1aUvpVlnNjeOOe3uGnRNumbBbn13a5y6tImNcLSybtJxwpiJk0+5rg8/U7eYvyPuJdxnjCL3/zeAkqiOMEGUJPmSfsl6kiodBBAlj0pDqIhDoPLZfwhU3v23nexfAqduM4SAkZdErMYzb5OfB7FfmifnV6Qs8izkunKtgTqfXN+cVmG96gSAEOkAYC3fjHVL2fwcLOn5WHn7L4GFP/y/+kr8uVttwAEAgV1L+JfKSZIlzEmskbsASSddtIzxSuJpm7SKmZZ1unJZ1v5AyhpXBg2W8dQEttjLn/jS3pGSTgDsvjAtZ2XlfwLgTn46BLo7+6c4B1jvtJGPAuAEwAHg8/9riL+OAurwG3fWQJ9ppfyBTjl/xJV3Y4x3AhsK0o5hrXcbp93dCLZ/DlLfYHvGl3BaNseCTMhND7IbLtBNmJgbNGQ3bolufLvNnhtBNotsmCEGbKRnZbPd7Bt9Uk/H4JjCbtppjf0te0DbE+3Hvju7pM51XLlJZvxsuHPDTpz0LNfJtd2M0z9xscpdPOt3MjqQnqjM5rmOo47Jee7GUtNq/2lP14B2dx5A58a5WkLLitmOsn1UTB2Uz8Xatn2L6gd242nW+R1nlXWyHWX7SKz6EF8aW86NMvPn2mNtQLByPSjjEGCt1/k27voi7hpB1pmQ3xtZ1vqiuqhfh9kH7aI3/RiI2x/1l2zy0Hkz/SG42HT23D55NfC5xXlAXb93tFtnU9PEWtb0GVo+Mcej7VyHuTZdt91nwbQsYxrjcs0tIeX4vNiGn53yGcvfkdxTjGIvr/sQDUhTR5C8QyrhIU65SrKsK6GC2OMAkPBD/tmEEodY5WMCtCkhs53a/lKccZOfeB9bbHWfr3Mg10G3Zlxfousu1/nNIPieZNEJwNr1BAD5OLqsQxv2+5Rrx++BDvl+k/xD+CGoklQdAMQ9BZB39peIfparsmRZAi2hXoMQc8olgb+0jF62qZy6IhtPNF2sTgAfBdC+2P3S/x4wXwSY5D4dAZl+qlxPAfj8P44Bib245Az49Cd/5QX53/Leb/10ty5f1zR+oLnyhxo5f8SnZHmUazfTdWNAnLKTUPs6Fs92Zrqdmp5tvjImNzxgbrjchIluzsTcuCmzsUPODR4yG8IMbKzZqLIhgyC4uXbjmPVtG7RvdVLfHEOdn8m83LFJV8Z2RPuwT3UA1St1zTHk2JEZbyVG2AOiUcsa147Z7jE55yLlY/XoM/vLuPqAEId6gsFNNunccWOsWWcmdzqlPbUxqO2dC+cGdL5mmGWRbSPR9sXseyajK3nHsKtvP2DqgZz6zsY0S8+6yrV94tl/yp2uOSdVZg5JY84hlrO14Vrv5pz1YXon0zbElbVnuWOonpajXdqB9PFdxDpF3yTDlKVeZwPT0lZVpgxpS2g7x1A9RMo7pkTHxdiWAuXSttqlw6VyS3ldW5mWeue4tBe2c626dsW1651yfKf6nbSET+UASIIkIQIl8RIcyA5p5GWdKtuG9SBR3j3lDipHqdmgcncVElXv/lu/tptxCBbxDp+SfG19P63TwDVR10WunZRda2DnBMBBlU4A1m11AGQ92nnqNTD2ktMLwggR9V//QfQNOgN0AHSnAHACGJLoz5wDkuMkzt41X3IASPwtY1yifmlEP9vU4aDu6jCLmw7OnAA4V3wUYEzObjpBJ2a8+93veX9H6vPuf8pd2aU0vrfJz+P/nAiQ9INLxD/LIXMK4JLjP9Fcj1Z8Rvx1BCQJ390a5A7ONhiz9K6NSJOw134zPfs3PdPuLaM7OuUY3FCJbrgqKeg2qHUDRzw3eMhuEEECm7GOGPCsqWWsk21lX+rihludHUOOj/E24ah9sw3bBe0r7aM+qWPqrh0cHxtzCEfdjGID8ignWifR9mofGe/mIvOXZPoiPzH7R2azXB0YOR6IHwSt1pvFO33Snsjauc47c5FzlHOXMmWIZ9k6pzmv9mO/FdWp6rk2XtuzPxA9MlSdc1wzudbpxtqNl/6rbsZnY2b+HDdrgzvNuR6qfAp5z7XoOuGzQh98TkyriD6kiUn2cSB4p5zPIt9LlHWcHWqXnKdMo07GZ7JtZ37WNX8JnQfKaPcZpg2qjZ4q3unqeLGLwc9AruVuvZPffbZJY43U9Zdx1gHrCVt0/ZTfj/wNdz/hfmMUPe0RgI4MJfGHxBMgNlkWWaKjbL6kynYg+JAmXqTGv1ED2VTqAPAINf1Qx/q2lyixM824unTxzNvkpyXoT2F/1orrwnWT6HoDk8z7GAtOAB9f4X0AOgB0XGUdZPt7irHS5/5LoP/zDl/+5zF/yX+HOAAktJXsd04AyugIkBQTVwYh06LEegkl5Q+F6JJtZ1x5SV/yMmgXENsRsKOnAHACXPJlePy+VAJ/qbv/tosTIB8D+NG/8qk7DgBJ/k9+72fbdPPFS5+C6Jf6daT6w5w/1PkD3hLBboOxJm0MebcitH2OeqaLa9o6uUwdR2543Gx1pMDNmdht4OpmUrLHxpsNP4SRzVZuvlJecgJkf+oArt0orpiXvS1PtU/qoo5pB22QyB3HHDcyhAQ7UY4NKyHrpEz7xLOfJRm9lvJtq8PsFxm9mMvZnV3Gwhwzxlq3tr+kk7YU085r57zOpfHZml+z7tEjdVI+F21vaXx+LlNvZMfTYS1rG4naMTH1SJnxqevSWJnjJccQ64N818LSGujyrOddXci7aV15dWXN0jcXa9cTBNTNcXYy9jFdWxFXPgVrPePZfk0zr8OcF/Id7wyxEXmdrR46zX473XJs2tO1mmu5W+uZlmWVadvfIObd+ec7iu8z9Fnqq/x28PtsyH3FSH55rSEexwiQpAZSlGVt2zTiEh7TQMkUpB6CzxFq3qKO04x/q8bmMp+jlvzTr4Qs26ty7Tfj6rjhm0f2cx2wZoxXOdeT601kDbIecQCwdm/GKRUdAL7AkvVMep6KqZ8Z+n6K4PdAxa9713vey91/yKjH0yX++7v9n/jSPh3ZIImV2Evyk+imcyDlJMYpr3ECQMp1DFA3SfpDyNlHJ6v/THfzRR0nOgCwM3bHAcAccOe+zs+5cd8DUO/017iE/hyE9OME8Nl/yTx4ygkAHgV4iHchnGu7h6yXP84p++Mt7oYSd0JuKE6Va1sRp7/sx7iYeReXGQf953jcIIlugkA3YWBuzpTdxLFpZBPNRopNFhtzj9Sy0WfDdexu4Mtt+cu/nA6gHULdkNonqB6pp/o7HjDHm3K1ReYhZxvItp22UQcwdUu9sU0GxoVNcsxsSN2MYscMWTfl7ONcmfaom5h9VJm5rbrnOJAdizrZdvZTZcuKacuca+zsfOd85FzVeTTuWsiys3m1j5xfZfWpOmaccRBPTDnLKtu+qA6zcToOxyeanphtKNt+on1XREfS1LVijg0nXl0TGWd98BmgDeqdG/iM+L0ycwKoJ31I/Ph+WXO3n/FiG22RdnoMOftPPdSnQ8ZLuuOeofNlvnHngnTlzDP9PmifiTmWtK1rNdey63wJszyy7YCpe6YrZ1374LcigvsGMPcVI/ryOkY6lsiPJCjLKNuucdF00XTaghRBoiBQ3Pnn8/eVr/zh/pGAdABIpI45AOjD9pUT1WGWlvmvo6xtxNdxjKeOCVtQR5vM0LUvkdcJwJ1+HwPwfRaeXnHd1rr2caqulyjv90BF3v7PUXRJPyjx/8wg/xkkrukASNKfd7hNr+SfuIQYTEJf5cw3D0yyX+OZd2k5+0I32q9jSZ3NY8zaI22EnfMUwCVJMPNaSb2nAMSaf2qcUwCV7HfEv6bVuG3we1fX5+sW58eZK3+kkfMHfDfid4I/+uci7VG3thvxGeGfpd/RL9o5Ob2OKTc7boDE3IjlBs0NFJtoNt4SfDbj3PklsMnITf85skcycyPqZtTNo3qpq7qDObY67mPxrIuc7dqXfYPqo23UuRJo4h1BgpQk6Ufu6kqmK9rfWrQ+5ZXBWYCwoeOxeWQNSK6y7TV6pQ1TTjtre9A5qXN1ytzaBphtI2e/dY5TP+dcXDtWytV2ap/qlHoi1zEvxWvdNWNNPdBxafw5DpxYxz77fGessdGaMrkm6/dF2tbvKh0PjinHmbLzr/2fGtEtdUpdq+zYEtMWKefczeQsv1bOtpbqVN0dJ2N13ebaPvbZzvysZ1vHMOtkW+U3N/cPubcYxV5eMxIhKUmEuBAXM2+tLLmyX+vRJmQKkgSB4n+o8/n8p3/0x/u3qUuicBCcewKAvrJ/4+rypmC1eZ3PN8EOOffKidqoQ+xlqA4A1qf/EUAHgCcAyEunlWs+7f/Ytvd7oCKkU9KvE6A6AJLwK4OSWglu5plfHQCQ4s4JIHEWk/BLpCXcScTXkPxf+zv/9I7TYE2dLEP/xlNOPZDVU92NJ2oz7IOdsXmeArjUUXjfAzAj+5c6CfDZv/Xy/S15919CfyytOgIu+RhEXefXEs8fZ+X88W4Jd/7wI7MpWMJanvgwwK4JtT/jYlfnkGa7FZt+DnXMyzrIhtzw5OYoN7xsytjEQUo9xg/RO7bRP0YWj+WzuZeQVjLgpjI3kOqc48jxKTv2iuYnZlvI9gHat7qAVU/1FyEi1W44TEivDoCMW1+kH+Ta37F41rGtYwipQ8dj88VpDwiWOmRfpnWY9ktZ+4pp+5yXnK86pxmnHHHLZxuzubVv9EJO/ZAZj9iNbU1abdM+wdmY0ddxdGj+0hhtO/tTRifkqluNO37SWcPH1gn5knBtQ13bWULLi9Srx/rRoero+s50x9mhn23tcwxdOzM8Vv/UfHS2Tqe/aYwXOcd9TbK6qS/ouHLd5vrOz/NMpnx+zq2fbS7Jls/2/R29RX6vCe4pxJH08uoIR0d6alqSlpp3LF77pLxkCAcABIqX/0H+f+93f/+ryJAp0uuz1NS7jy70jT4Vq46vS1xbp711qKQtX5fxHhtHzjvy2qCtOgfAzc237t9ZwZrl7qlrV+eVdZ0DnQL2fUznS+b7PVBwx91/7vIn+U8HgKRe4ipK8DNuWdE8MEkwBJkyEuVEyhGvaBpEHFlCXlGyL2Z+l5b558jqor7E1VUkT6dH2gQb1FMAvI9hzBHf5fe6+D3xjn6S/ZTNX8Kf/rn//X5tz8pwgovHuDjGXwn/LF6Jv+Vux85v12t7OTh/oEF/vMXdSDuE/NFXdkNQMfOVRdpEzrYvIXdtdmn2lXnINeSYclPEZoyNM+QPIs5d/mOb+2ME8dR8nxN2A+/GX5LgZvbYBpJx5TjXymkPZDenYPapHmDqqN4ixIcxVTtwRzTJfsrW7ZC+SE/M/pUtk3HTunZNm+lb9SfOGkHv7EO5w7RZJ6d9kdP2OS85l3Vtz+JZp86r/dT+Ox0ZV53zOta0c82r8ewj+1cnMMeOnGOpci2b7SBnH52c+nSy4ydvDflnnSzd/bcP211C8+iXdrlwrOEQMI/2UibuOFM2rdpnKZ62pRxx0bwar+lL7a/JQ2/Kqf8xdMzgU4Rj+uWYtVWu6e7znL9zNT/rItvmDGt527OPW3TfAOa+AvlwJZlIMkS6hOQYQmSOleny7ds82oGMQvT5DwC8BJBNJDJ3rDgFQJ5ESvKVhMq2OsxyM50dt7q9TqhNsBs2JNwMskrQsYL9tc3rNHbHgg2QE6usnZbQteQaxG44r7Qpa5WXALJ2wbpua/3qBFAn9X4oPHwRhMD3m8RfhJCmAwDnAEQ1iWvKEFsJP/WUQQiwdY1LkEH7Mo04MoRZQt3JpK0h6xJ+cU2droz9VUTXLJ+65jhI9yQEsvbb2+bW+eKjALwLgOP7MU1ni9//Ax/7V0ncZ6cBssxambZ+8dM/+eL3/vHf239/pwNgRvC79EzjXQKXfA/C2YZ7wIr1B5p4/oDvRvxO8EdfrJuCLm7ZirXtc+O0S93avum2W+M1vdbPsbApYoPGhhnSApmDALLBZlNtwCFgII1jt5C/fNbfRwHqne6X2/T1f71bKCFFtwy5ic3NpRvJbqOXY64y5Unr6tkmmH2lDqmbOmtLsDv675F57Z3kP+VsL+Xa5yxOHfKsm7Jpiczt2vmr5D91qHLaq5PTtspp+5ybnL+6trs45UnPeranLnV+0cG8xDou49XOadNOtp6YfTh+cGYD9e/GZB6Y9bsxOk4x9agyupqGzPdBt1ZIw3HIuqcM3ye1ru2ImW9aovkibfqNwpo1PesoOzawhmqfWbzaNOPK1FUWTatofoczHWbpdUxdHFvUdNM6O2VerXdO3PZq3RxT2sJ1XT/P/rYl1jL1s05b2XbK9pNoe9nHkHP/UPcXI/vlVYmFxGOJ/Fwqz75tD1KkA4DnSLmLxKMAvEkdEkXgbirvA+AxAUgV4eaWxIqQ2QySXQhaBvrKIJmTAKuXej53ZDzaGPtgR46nE3zHAvbADpR97uNVf+fR8TvPzn2uCWTTO7QuiC2NU5a66QCADOm8wr46WaxL/Wwj01NnZcdzSfR7IBGyJfEHJeT1uX9JvMRVMmucfAm+aFsgaZJ7iLHxT338Cy8IWdZykmmwkukk3SlL9MXMQzZdrPnnxqsjgLgh9dduOgGwg7bA/v5bQJwAfO/nXJ0jf+TDH/3MWkLflePu/8xpwPczx///6F/89t4J8Llf/Py9TwBwOuFb3vutnz5nrM+lDj/QXPlDnT/gu5F3CP7gi7kZOCa72bAuSNti9nOOnO12crZpn6J61Hp1TLkhyg0Zct2wuVkU2XgTIDkQVx0H6SCA7LpZX4u0k8TJfupGv+qX+ue4TpWznWoHxw6mXtoh9WYc3QmKpbv/2DHbSNk+EtWBcsqZb3q2U2X0hLStnZ815D/t1Ml17jKe9s+5y7Vb1/WxuHWzPWRswfjRMXVIndOuKa+xbbV1zk22lf2lHjNb1HHUeNara9j2HXP2fUxmPHy+k/wj4wyEjLN+c1zItFkx07o+Ld/loQN9sg5n5eoYjYvVPjXe2bOm3SdOf9SvmG1WnWZxxkSeY5shtiSvYpY3L9OyTk0/J17HkWP2cwrmZ9rfOtKUxSyHnG0oZx/IpIuWyXZs+xZz/5D7CuTDJZmAZCAvYc2z7lqUyIhZjzTJ6c0g9GwwOfpPgPhzRxXSL/GHTEG2JGzHyJN9zhBdMi+JGTJ5qe9zk9HfMWE3HCc4Vjhl4X9awLbkYcvnNt46d44114XzmGXXyNTL9pLsY68MrF3siFMF8o8TC2dW9w6LbFdnA/oe07muVePnrMnDF0EI3GlecgBATrsTABJZMElsJfIS/ESIseUynbR0BlAunQBVnpF1yX2icjoBrJ95pp2D6Es9MYl/6p62w4Gi/ZgHTwHwXwG++7ve/wsxVWeJ9UWAfNee+gjAT/zU9x6cANQ3pAMAJwAnuDzKn3f1TevQciJlfvADP/PlswZ75ZX8Ma4/0Pnjjbwz5A/+bOPg5mAJazu2fw7SFvVqm0vx2s+xNnIsdWOUm7Nuc9dtyNmE1yDxgVxBDpIwHCOaEAzri9l+6pA6pu7IdWzH4rU+8WwfOftOndRThAhB9OtYcQhgE/IN3NFUTrStRPokbt+dbFoicg301elYdc44jgLqVT3UB8RGYtoLudoz49X+OV+5ZpHr5yE/A5lnWetnm/aHXSCTrruqs+PJMR6zbbV1F8/2qr1mdkn9Z7LjErMtZOehG2dNUy+QO/rpKGIts368y5/j0WaJte1z4/TDdwr9Op5sy7Q6buPapWK1J/k17aHj9ilmf1XfjDM2447zmlDdKub4/Iz6mfVznJ/tKs9+67It+sh4J9uX7ZV+cg/h/mIU2d9kAPdXRxokfzO0jvnG12KSLuuQBiGCCN0MEsVGEuJEwAEAqSJd4k+5Spay3SWZPsm372NoW+infEr9Y+0/dD66Sjaxm3f/2bTzjgVueEBWfVkdThXH+tC6rW0/7e5YluZ/1q7z1mH20cn2C9J33vHnDj8kHxuydrEt5B/nCk4s0n0MgHrqLuoASDQv++30Mo0xI3c4s4ffA4ncIdYBICnPu/+S/70jYJBV7/gniSXPumISe+SP/9C4O3x7tz9JfqaZbhptJXHu5BlRl9SDKWd504+lZf5aWSdA58RI22lPbagTwH8LyG9DztepMv/isbuzvzaNEwDpAFAGCf/t3//Z/d1/HAD//F9+Zf8egJ/83s8eHAEz0o8Tosszjd/hU8f6XMpXR0D+eD+aA2CykdgNI64KuSE5JtOm/YmmdXXrBig3YblB6zaQudFOOTf/ypIeCCPkAbLAxr27K96RTOuDtilm31XPHIMyY0SuYzXdcmJtM/tDVg8w9VSG5HfjhGhCXCT94jHib7vaQrR/9TE9EbkG9Dv1dAZOHOrZV8Vqo4xXe2Zcm4s5R8h1veaann2esgyybWTb9gdif+YLm7BWGZv613FWW2acdojnfCpnOeVs2/7AmX1crzkO5RyPcraDbNvZV5Xr2JlzPrd+Rr37ztpN/ZVpL9uo7a+Jq2tXlrbrHNVxdnFtUjHtp3xNiL6pT9U/44zbeGeDU9Ns69KY41H2Mwr6+Z19vmu65ROzPWT6Scz8rFfbHvHcQ+gAcJ8xsl9eEoNKHEy/NEpWRNsnDtGRoEKY3JBypxoHgOS/u+tPXdvskH5I71Ad1uKx9k9pR32yTdPWtrO2HH1AKrHxzXCmQFRxrkBWkUmTnGqrtW1fqlzaQaJd5/aSfdGWfaZsWkV0MWhLTgDcDNuxRnVcQf5xrvAiSx5jId01nOtXki/xN8+4aDn7rlj1NH7MVn4PJHK3FdIpcYfwI6cTwDvUklVQEotsXVECD/70x/7unvjjADCYr1NAJB3ZdsSO+GfajJRL8GeY9SyTaafISfitJ/kX0Rm7qXvaUBszZubDRwEucApgx3crn3sQ4q3sd+4SUlayL2YaDgDJ/7998Sd7J9gxB4AkPzFPAJB+qXcg5Fq/Bjl/nJXzx3s3lDyE/NHPzYBy3TAYNz8x20LOftbK1su26IN+CWzC3OBZZta2bZFvWTH1zvazHzd8sw3jbGMuCRAlOiJkCEIBEV46FUAZ64i2Cdb+q57qfyrWdoxnf6kHsvqBkr3uzjrjhbhQJp0A1qmY7SLb11qs9YnTL7aXzJ2C1FOPagPjaSdk7VdxNi+uQbGuVddwru/8DGR6ls12bDt1QD9OAGAP5gnCyxp0XKLj72xb5w9b0wYB2fxa17bBtF/aLHVVf5E85CyDnPWVs/0qZ//I6I0d8nNKnLFYtiJtmlbb7+LoRbr6ZTzTlW0DG5pm3Ro3Hay20WbacA36XZlr6ZhMu1mvi6/pmzJV525Ma9K0R8U1de9bphtrtWF+bvOzPZP9zGc95NruLF7rlX5y/+CeInEUf3kdIwgPlV8JCnFIDUQHQoUDgE0lAZLqM9TkSZIom0TINteg46JsJ5t2DmabWd90MfMeQ6Zf7IX9sKMnAfJdCtr0MXSkD4PzaPyh7FHHlXFldZihuoLYC5KuE4BTAKxZjj7jnCcg48TyPQuuYeoaJPrMTQbTE60jpj6dztjSsVW7+j2QWB0AENAk/90JAIkrmA4AiX2ipB9HgEQfNG6+dST9pEOcSU8CLXkWJduiRD4ROeOWXULLL5Xp8tCVdPQTO/3ThtoRJwD2rqcA+E3LOTtV/svf99HfqSR/7WMAkv4ZVgcApwAg8JXQJ9lX7sqYxr+mPHWcz6E8P8xc+QOdP+C7kXcI+cOfmwM3aaQpi5mWdbItZPoRs881cm1rKZ792J9oXlc/dXdMjJFQN3m5kUZ2E16RjX+GSnQyDhmCDOeR4iSjEA3KZJ1suyMZVc9TNrhd3W6sVYfUTxnilKTJcTFWyJOB8SUxnBFE2xXRAXmGmWcd2j7lJX/qnOhd12qDug6Mdzata8u4a0+s67Ou4WOfo1o+27MP+1ZPbJXrUUcA4+5smrZ17kTqeAKEdjhZgAMFJwPzQD5zbxtp05n91Fd0HKBpomMSbXOG9G8eelXizxjqC/esU9F2ZqhOIGWMp1zTzMs2LbOE2qNi2m5JruvG78pTMNtImX4zXttc0qvm1fE9VJx+afsUrLpmvI4/P7fHPuNdftZHru3XeC3ftJn7h9xXuNcYVV5elRA8VjyJigSFNEgNBEkiBXHi7mk+Q50OAMofI0CSH9H+Hmus19SPtsJukEqcABJO4qSnnc7V3TbApXBu+5esp360qTxD7QdiK+2IDbEld/lxWOkA4AQA71ngURYfA9Dm2jvbIc35cJ2L5GWwHph6Vd2XbOX3gMjvEmTTIPmXhOsI2BPTyfH/mQNAsi/Rh8hX4m+emM4AddAx0JFonQCS7UrIK4nP+JKcebRpXKz91Li6ko5uxE1LnSH+xHUGYEtszdg9BXCJ/wjAKYJ0AOC0yviSPCP+pPNdjQMA0m/gFAAvA+QRBon+GpT4W5b4WKc71+rrgvUHOn+8kRnwPuQPf90UGGejgixW2XJitmk/a5G6lE3M9jp5bdu2m22os5ibMuS6gew22bkZTznJjLJER4QoIUs2kmgqQzgsL9qemP0qd7qek2Z7ifYrqhco+ZvdYedUAGUYs8G4dROzbWT6NE15hpYDcUgkscW+nYNCu3eI7urg2BPTRsidveuaqmvOuGtSzHWLvHbdZz3bAu1HfVJX7N/ZijTWI/OWts35Uu7s3dmUNIg25dO2acvUTX2PYdZBdj6y3ZSZR+IgY6xrg7Ez7q5Opi3JqUeVq773jWMf2pjZyfnv0PVR10vGT5XpJ9s1bjvGK9Y65K8Ns7GvSV/bx33KOXYxP6unfMa774Laln1UrOUm/eYewv3F6Pbu8/8kLJGDh86TqNgPcchMdQBAnHAA5CmAJE9L5Mc+KtInaYnq8bqjtsBukEuJJHHzXncbOD7XAHFlbTBD15t2Yy2yZqsDQPJfX2bJiYt0AiSpTzkdAVXOcuqhXlXvHJvjFvkOyCtfACjhhvQjJ/lfcgBAXiWtknXJvjgj/kvp5NmeuoFJoJEr+a5xSXtiylleoi7aP7qQZjzRsqBtqSNpyKLpEn/iyukE8BSAjwHgBBjztsu5O0U+9z0APv8/cwJ85/d/57/mvwBA+tMBwGcBAl9JveQ+celxgdfxMQB+oLn8oc4f76MOADeOuQF1w1Q3O3UzQTw3FEOHA5lHPidke1XO9icbl0P/5tc26hhyjI47Me2iXDf9SQqVkzClDGEiDrmopAtyBBGRHFnPNsXaP3F1Owe79kizP1F9KkKg0L1ejIW7voz5GPmnTW1T2yeODh3WsvQDwex0qWk1jr4E5sU5cOyJ1V6dzXMNIec6S7mux7peXcenfJayDdu3T/WqOmP7md28k+8dfMoasDfp3Vqu9s04dsZpRH1tq12rbuo8w1qeuG1VpC/TWDud44o08iyXdUirccuJ9t/p9RBp2IV2Z/Zx7ivm2kAm37SnxtSl6l3jjLumEZ+ld2UfIm3JhvkZPfIZz9/z6W9qbS/j6JHxlJvvlewP2X2FOJLeviQCT4FJVOifOGQGssOdVO7+E9IBUMlTJT8zEtT19RRjvqY+sUmSfuLXpN9j6pLrY0l2fYGuPR0ANzffundScfeUEwDc+fe/WHAqgHTukOLIch37OEAl+BmnjCHTdQKoh7ql/sds+PY3wUvJ4//cbU6SfV8HgORdgg9hzrQazxMAyqL1JN2Sacg2BFrSXRGSn4H8jOsEsF11or9zA210jgCdAOo+cwTgBMhTAPxHAF8GyL9rrPN3QvxrWY/c+ffof8rnnABgbeMY8N8AVifA7BQAY0oHQMrVYfA6/jcAf5jF+gO+G5O6D/nDj8yGFfLGhpdjumzGScuN04U2MQcd1CURXYgnIhuybCdbb5ZnO2AdT934dZvo2abdDb8okUmsBJW4RBfiBBFKYoQMmbKM9bNNZftNRFfiM51Nt0zW7WT7EtVHZM3MyB+EkvwaGBtpkshE2xXpt8qZZh6EvSOw1bZdHILL+qcN9bIPxy12NtKmYl1DdY3VNTjboHfreU1at95TB/VTX5BxYcuOEGsz1iq2Yr6xtcFj/5Zbi7SDzZl/7Ju2Td3Ud4ZZ1rFkW8r2AdIvY6m68n2Y5ay7Fu0/sepX42vHtbae7eWcp5zrj/SMX5M80y3HslbGJmvLUu6h7JCfTeXJZ7r+jmd819WxPZExKM+waSf7cU8BcokvY+PvMYLw0PkSUPqBuBCH5ECQOgcAjoGbQbQkTpCgSoAkQmISoirbbyLymxLSHm/KmOs4sQFpiWkXZNepawpk3bH+WK+sR9YsJIjj/rz4j+D7KyD9nGIhn+CJFurcjPXMiYA1IR0B3dqvejumOmbjhy+CIfB9k0f/kevdf+Lc3T92AsDHACTTEGgJvMTaeEUJ/po6lqVNnBQQ6lOC+om09xCB9tM50TkA8s5/OgR0AuQpAE4A3PdlgN17AJaIP3f/906C27f911MA3P2nDI8A/OYXPtueAoDcV1K/J/zDPhL/Nn/Us+473/mub8p1+9xlf5T9sc4fcOSdITcBbHIgoGx42fizQeo2PW6GxCyT7SHbz6XRtsVT26965hiQGVsGN9CJdfMNISCtEgPIQwYJaocQnxlpdV6sl20q174vEbftiuohStq7F/9JqhjDWvJvuzNEH/NSvg/xh4Cqo22DdezGq33rmsj1gpxrCrmuO+N1fR5Z3/Xzfeczbl3btI/URT1Tf8fG+H0xoPP4UMja7+ytLqmfOlfMMsjWrcgckgZ248O5wfdhrbc2XvWYxav+XZy6XfratJzrKvt957pYg66lS+KafrOMnx+RvDq2U+PZ/kPKM7v5WW2w+4xn2m7UWfzcz/rM9KZf27Uv9xSJo9rbl0TgqbASFogVhOpmkCLIE04AUMLk3VPy1zgBavsZZ8zHCNJT2WXr9+GdMM59Yq6PKlfynw4AyDtrk7WKA4B/qwiybiX5IGV0BpDnusaxZaCcgXWuY+DU9b5mDb39TfA1X8OxcB0AeQJg5gSA5Bs8rp6IkwDiK6FWlvAbl8RbzvxT0frXjIy53vWvcR0BOAG0Z54C4DEAHADf9z0/+tUxf3zXn3VxnD4J/5r3ACw5AHBs/eKnf3JP/nEA8AhAPQXwm5/74ot6xJ8TAJ/+5K+8mJ0ESIcA8uv2MsD8cUb2x1vcjbR9yB9/NpNsNHPj4+aqYpZJOduzj/sibdJGxXPbzXZS3xwHct08dpvtblPfEQQJY2ISTMizcQhoR7Agp1nO8tlmyp0epqG38gw7Imb75qmDODvBwHjQv5J/766LOhFE2u3GbH/ogwzSxsx50tnTNIge9dC96yv7cPxgZ7dcD3W91PVU11uuReUja9zP8wx3Wd82s191UtfUP8eHjVmX3ekU7XgfpN39242bdyyoR+qm7HdWp79lrC/m3DGu7oQDuuBI6uqYVpH+SLPfLp556vyQ6PzOMNfCkuzaESmLLN5HzjZsv+KSbpfOw1ZLbdaxVl3PiefntMizz3aXfufznu2s0SnLh1z7yb3FKHZ9JwAgWRIrZe5sQnrYULLh9DEAyRNECYJEGUgR5fNuKMTMNhMrocs4ZIl44hoCtZV5eKL+kDbOOc/1oJzrR9kTJ6w57/6zJnlUhbUK8SfgDHCdJolHvhnEnkC+6xmZtCzbkf4163utzfhS8KrP/3sCAAdAhmN3/yWt3JGXxEPKlRN1AphmnPIpd/ldm9dM/qtulfh711/ibxx76mjBpvkYAE4b5+9U5E56OgB8FCDTlI/d/fc0QDoA/FeA9V0A3um/g8MxwnozLUk/aTgNSMP5QbjPuE+100OX50eaK3+s84d8N/IOITcH3cbHDZFImZStk+0gZx/XKFd9HYfIGGvoNuu5qVeu5CCJI7IEtkOI7IxoQcKyTm3XOP0jVz2Oxa0DQobBLqQOyujdHaGWGPpICeUy0A9xMAPtErf9RHQiDlJm6dSB/VdcQ/y7sZNW7ei8i7lO6hpyfYl1Ha747ORneUnmM04+uHeg2Zd9q5v6qj+YY9QOOEmW5rja+Fgcog0Bp13XgPNqn+qRuimrN2haonUr0jZ94pSqOlbyX+vWuP2Rjiyanpj6HpOdG/FYefMtfwxdAzN0rYiUU34sXOpzpnemYwPiM8yynfyQ4/RzuYBLn+1ZHp/1w2c+214aS5YrcvaT+wnlUfzutZYoPGQ5yJbkCtQBwN1RHQCeAsg7ppClJEjVCdARJYldRcZH2kOOc2v7upwFznddC8RzPVa5OgAg7KxLHVaQJtYtaeS5RnEWrAndOrbPqgvx1P/UNZbfBh/58Ec/U08ASPyX3gEg4a+IowDiLnlPwt6RewlyLd+VtYxo21nW9s7BT/7y3zqcXMj6s/Qsc4qMvp0jAFumA0AnADZljjwFcN+74a5ViT7rVrmiJH8JdQD87p987sXv/eO/d3gRoKcBOBHAuzEqwYfk49joTgFYVmTsvAeBRyD4ncw1/Bxlf5wT84d8NwZ1CLkx6DZBa9KyjVsDHtrPvq5FVseqdx1rt4l2o10xN/oSgUoWJDWJSWyRIbQdMYGoQL4gSrVOtjeT0YW8GWYeciVimVb7R+fuTqrkSlKVxD9l6neh9pNxyuNUoG37WYMQf3T1WfNsUznHipyhzmmd91wXdf3U9VXX35HPR36G18p3Pof2px6pn3o7nhxnjh+7zdbnGvtbhnnAoeW8a3sw+0s91E1EZ2TRdDHr0iZrDmcRn6POyUaad/4pT30x26J94on2WVHdEpFryLlQpozypdC5r+jaEMlXviac6VXHc0781HEe+bze+eydUHbtZ3tW7pV+GdcJ/Vu/tp/7idHcq3f/STyVMDxEeQmXxEcHAHf82ZAaIFjcZSWQ591VCRb1bEPCdKoTgPGhT+JDjHlr8+mcATm/SZ5dhx3JJi3XFOvMu/+sQ9YkTioJlHf/167Nbp2mHuaL9yX+rj++A7y6FwDqABAhoGtPAEBaIbhJ0iHHxkVJu3HKmCaZ7vJME7PtWt+4aLtr8NKkv+sTvTpHQDoBuscAeBTg9vfCaTwJIdGu2Ur4M37s7f86BXgB4K//xv9t/xjAzAmAM4Aj/92jADg30gkA6c+7/8gETwKwZu/5MsST7PUQhfmh5sof7Pwx3428Q6ibnlM3TrX+is0GutD/DA+63ZY7NV7bndbvdK/jn2286waeeN38J2lIUqOcpCflJTLtv6KzPG1V0mT7oCQm086R7cN+E7tnqCV6IEfsk/ArQ/6QE5MQImc/yBA07HMq8af8jPhjD9peskvOZco557kmct3UNVXX3ZF1np/dc+TD+rff1Ec91T3Hk+NM2zBn93UCsI6d6zrP2VfqkLopd58786jLvOJoWKOv5D/77GTaJ91+llC7dqjtHxpzvjuZdUG66+MYHlmvh/V2n3LHdDg1/5TxdW0vjYXy5qds2kpc+mznb7nyUvld16e6VSxlu3bts+KoeveSCDw1Qr68Owq5gjhxNBoixXFqNqNsVHEC6AjACXATpwCorxOgOgKSTClX8kf8qe2w9f84joFu7l0XiUn6lZP8s/7q3X/WKg4B7v67Jq2bbaec+mR6Vy/L3ne9xLfBOyBb3QkA7/7vif8nXr4E0CPpYr37b5w6EHRJuphk3TTJufGKWUcSXet0ZSybaL1Mu6T8n374/3E4QZDysT7SEfDf/F/+p8M7ALQn9vYxAMg/4T4vxeN3lu/XmRMA4u93ryR/ht79xwnAOwBwABC6RwG++MUv/v887p/oKQCRPNZlBsi/joE8DTDWMr93z/KqP9T1R303RrUPbAYydBvEWVrWS9m2z0R03ev2GJh6K9fxzjbo3aa+koFKIJLcpJxEl+PJSaBT9i4ldbOO8WzzvrKkODH7REbX7m5q6jxzAKQjIMmgsn1BzCCMkLhjfWW/yNzt9fGDJJppL8c3sxdzSF7OZZ3nXAu5Xupaco2BR9Z3/cxmvH6+M57lXvks2b96qav657hyvGkb7MXcnfPOBebENew857zUuUgdUjf0JS5mHrox5+i31lHEOs55rvNNHn2I2V8na88OtfkaZJ7WlKtlnF/rZ1zZtXAM6zp17YrkP4Rc+7WfY/qazziVE2fpWabr+8Jp9XPaxfNzPZO7eq987lfonnVqm7Xv0dzhBgPy4bovgbhUfUgNZMfnn0EdALxQzcBGNV8MWE8BSLh0BEigxCRXyEmmUmZcxDu81Ji3dh6H7GvnnM+ca+S6LlwvFV1XrDPXqHf/vWPK+sQ5hRNLR1Rtv/ZvPMvZt2mWER3XfdAvAr5jIV06ACCZEn/v/oNrTwB4SgDiSjuQ+Urok4SblwQ581POsjM523kOsuMADdiNEwDpCPAUAPPkvwPk3Q3O4zlYXwbIOs73AfCdOyP9pvMfAPz3f54C0AEwexRg9kJATwHoBBC98w/51wmQyOMQ7KvOscFT1+EHm8sf7vqDvht5h5AbH2Q3iEtonbqZynYb2U3GMTzo1rQxyzvWpvmv1HcsYjfuusE23m3wKyFIEiPJqIRKsgtCiJbIFUQYkpN1JE4Vs59jctatMvEaIOZrngmHhEGwJPwgYxSTCCqTB4ljrGtJHMTSgP3s07E4/ho3vaJzVeevzm+uAdcFWNeR6wtcWNes0y74WV6DWf/OelcHdUt9HYfjy3GnbVwHzNXSaRXIfne5fp1r0Dbr3KQO6pWIzsQTaWPNulQ3TghkP51MH6Rn31XWfjNMW3eyc7IGu/WV9Y7lsw4o73qoWNcn+TXtMeNL/Vfdz4l3Y1nqs5T3tyUxP4Onyms+41lm1v6u6HksPmsn+1IeTb963Yc8XLouRAfSBKkn4ADgbj/k/3P/9a/tg29XZ1PKnVcdAJAxj1tXJ4AkTEIFSqpACVVFxkdaHWeXVsts8ccl92vtXec41wFyrpGUJf4g64u1djO5+48DgHWpA8A+at81brmKlls7xlPK+Y3A74/kX6xOgNkJAO9Oi+kkIA3SKqmV6ELKlUXTIPs1zTzJfOablmh+Og4y/yHkvNPPcX4C/Z+ig3qDBuYBO+oIwL57p8q4E84JgPu+B4A14L8ErCcB1pB/nQDc9eduP8/411MAv/e7v/9VXwbo+wDAz/3i5195FID1x/g6R0CSf08F6ATAQfAjH/xr9zoR4efhsZAfZy5/pBPzx303ytwJddOUm8kqU3a2eazt3sbpm/5Sh5lsOXBNsG3rLbU7bW/t+LuNO2l101/JQSUVSahSlghBrpeIL8TLsom0RfxU7NrItCpD0CFykqhjSFkIPeOibiX/pkHGjh3xh+RjG0ge7UL2OSFAXUg/fWiDatuMH5PrnHUEMOc910Z+Zuramqzr2brNz/BaubZ1WPfqkvqpt2PJtZs2SHu5HiDvzOux+c985ivJ/xoHQOqk3OlrHusg++xk1pHkn7ExVjHHbZszVI8Zat8O6zxkfI1Mm5QTj9Vx/ivWNUl+Tbu2+BPo6G9N/XxdIr72sz0rN9Ph8Nk/Mn+z+rW/0cz8aOQpZOGhy0J0IFgQf8g9gUcAuCP16//9f/+CY6NsLvn/6hxb5c4rZW8GEfPkQDoBqiMgCV11AkC6JFodMnbSH9oGW/sP4zjo5jSJdl0bSfgl/awnyT/rjbv8OKjyzf+sS9JYk5R1nXX9Z1rqomz+Q64Jvhy4OEZeiT8krN7938fj3//VRwAkp9UJsCesQWqTgCfp7dJNq0S61jNu+adECDt379MRcEwf9QcN1FHGhulk4c74pRwA7IU8wZK41gHAowLc6ccBAPIeAEKeAuicAP/0j/74zvsAcg26lnQEmMe4Jf+JOAA4FfFTH/25Z/dfAvjR5sof7/yB3428O6FuCM+J1zZL3P7pF3mG5mU+chcsa9s1bhvmG+/auvOmdMY/20x3G3nTkgRUwpCkQrLRkSrJ1TFiRb5laUdZzDRl0TLiLN38RAjbOXd+IWHemYd4oT/EnbYg8hB6SFkla6RJ9ilLXUh+Ekf0v0Soc5TxOp85185/JWL5Ofqa+Rp2fYr5uT1Xti3wznpXJ9e3uud4HGuOP+1b1wNz0s1dnUvizOGlHADoid7qK6LrkoMKBxJrKMfXybRHuu0mpr06Wbt2mLZXfih0vjusa+PEuGtrCXMdLsms0aV2yD8pMF7rzGTzF3BJ53Pzzv1MH6u3pA+2W7JvV3fW32hqf5F/53pIcnFq2xIeSDzkX2L1S7/0S/u7SjqRcQSQhnPAUwAQLk8BXNoJwDjQrcNTx7iVfxiC39k158y1JUqywST/Sfwl/CLrisA64w6/axTC5CMqOqZujjgA0LfTxTSwG9Ol0/wySAeARKtzAEDKJP1iklLqSP5FylGGdiWzoOQWTHJvnukZNw1cCrVOVzb77PLXpHnXX6RO9zI/+4KkHmtX3cEuYFfsuXeq3J4CYC/iXJ6Lf+6bv/GTrN90ACB7h5/vY+VEPgc8/88dfci/AUctpwKI4wgAj70PgDXCuAw+dkLcdQniBMj3A3AKgIADgFMAhOf0csDuh7v+wO/GxB5C3RyyAEibYS2fbRW59ntKHP0ofwxPbZP22lDHpQ26zXm3sSctyUASBslEEo0kVcqSK0gShLkjUaalE8B6tKP8ELjm7ir6JXGHjHm3njERTIPcd6cdSKMc5JITAo5FO10CmQvacU5SNq3OIfGc41wHuU5yLTXrrVuz3ec200Yzh7tvbr4zv8rZx2G9q1fq6hgcV45ZO2gr7e58gKxV1gVz6dqc4VoHQPaLnDrVOUDvms+66XRg3bGesv1u3rs+u361GagdZ5g2r7Lzshatv7Z8LdesycMaafLyezjX1VPJ6KpOS3qfmnef8dTP333iY3jtZ930Wdv30T/rdu3bN9helyYU92lP8gMJuxkEijv8bEg5/s/dIx3OICcCvNvqfwSgTjoB0hGQxC4Jn3doJYTqMEPGV8lZjd/HBlvd+zsIcj66eXSuk/zn+pDwg5J+kfXFOvPxFMk/DikCd0zJoxz1WV+dDqapi/HHnn+/FNIBkOSrngDoHAB7R8AnvnQgbdbXAWAdSCtEOEmtZDhJb02bxU2vaFuZLgHPtHPlJPtdG+kAYMyeBMAuXXnTUu+0USdLlMnjFAD7HOfyPvgf/oX/6AvVCZBkfyZzt9+7/xJ9yL9OgDwJsOQEgNi7fkSdAKwj00SdAaD5OAJ0Atz3/Qj3seXauv5wU14ZzB935F0NdYN4Sry2FXH7qv2vjaNntmF8bf2unG2Ar4Ru3G62O+w2+0kKKjFJ4oEsoUqEVBGHqEBYOiJjmm9UT0L2UDJ3TTuSB9mHrOOQgHh5FN+j/ceQdqnjqYBK+h1P2ugcWXs7B7ShXJF5I63OX85tzn2ujVxDzRqrazI/p508mjiQAeS8KM+VaBu1n90otw/qp845DsfnuNMuaXPnRMQJwDyyDlybHUrA8xSAbYD2kf2qi5g6IpueSFv1VAK6kZ5td3K2k7L9Vkz7dbJ27tC5AMnP+Cny2rqugSPI2mGt1DX0XOLqPsP7jMPP16VxmPvO55i4V/18kz7r/z5jo+6sXXWwb/DO9diE41h/ECFIE+SJu6w6ASD8HBfl+4Hwla/84d4xwGbVkwAQL+pA0DpHQJI85HQESMRECdkSMhbyHVPKpm14f0J/jg1n8+b8gs6/60LiL9kXWUsSf9YX64y7npD9fD+Fp1KqAyD7rLJ6njPGS9Txy+Dr3vWe90KiMkCyjjkAJF3Wk5glUoYAGe6cABLfih0xNu2aMB0CHvlnnJ//zP/y4rf+9r/Zo06ANY4I7eAYjYMZfCkeDoBL3e1mL5T/eQUH15rHAHg0Kx0AngLgezsfBcARUB0AvhMgXwrI+nFtuZZcRyDrMstob2zOuxJYj5wG+L7v+dGv8q8OXefXirMf8NwY7Ibyr4RTNpyW7dq5Tcv+rk1+Zew5DsdWsdvAm1Y3/kkSkkQgV9Ih6UmUDEGUIPndXXIJFsQG8kVZ6p0SrJOETJl2zKf9zhnBHV37tt65ONMbu5CX9jkmY2PKVFsvpZPn/NQ5I55zmvPtGqgkLNfU5DMx+6yO4gcygOzlJlzM9K6t/NztRuF9cF2n3o7HMeb404Zp95wv5xxnD2vCtVmRdVzXi+1k29ln6qKsnonmgdRPPZBn66H2RTzbyj5S1mYdpm1nsvPwkOicH0HWCWsj18ubLnefp0ukDTMfPtt+jkXy8lpKP6bLOfM3axOdZroc9L0EibhUG5IhSBKkDNIFmcIJANHi6D/fRTgAcGoT930AHE+lHKcB0hFwE84ACZ6ETwIozsiZenXI2Em/lA22du7vMHCenBvjoHPsnLsWXBuSfjCJ/81YR0n+8+WUkB8CDgDSWX+Upz7t2DZ90S86qNNTz7dfBHkCAPIEuarkP+/EctdfgsZdW4JOAOtL3PZt3b43oHMCSHRBye5Mzvys9xhyEv2Us28cABBQiH8NOAGqAyAfCXBsSfKPyrePAFzyTjePAvj4lY8DHHMCSPgTdQjU9wF0ToB/++JPXhB8KaDrSZIv6U8ngGmUweaSf5DAGsW+nAb4rve979dc69eI/lDXH/O6IdgN5V8JazejXd1Iq31dIo6ul2gn27BN8E5YssNsQ096koEkC0koJChJPJL8KEuMQEgTRL/e1ZRgeWTeu/AgdWxDIi9R65CyWc66tAP5J9Cud+vBrp21abY/w7SDcofYkfRqT+M1z/SKzkudq5xH5JzjXAuumbqWbuO57upnM+Oj+FlX97nPPnej1X1QT1D9c0yOVzukndL+dd6cd5wArJPZWuWEh2WzjWw7+1QPUf1E0pHNN+5jAHxu1qwB6tFvtmNb9gWmraqsPWeozXMOlJ2fh0D6mLSba+QUOdfsU8in6Hqs7H31H6Y9EGTa4prhy9z+r3W63MxTTkTuwrGxk9/Vq2nqRHp7PTUByf4lRRAkiBLkCSLls9Y8CuApABwAPBbAHSaIlycBcAJQHhKWjgDJnIRM4icRlJhJEEV1WkLGQH5ijmuT70/qj9kw7V9l4s6na8t5Zx1I0FkbBNfKzVh7BIk/ziXWFiQfYuSjKaxJ1iLrEOJEvuuQOrRBu/SpbsfG81j5finwG1kJfDoAJP/74/6Q+U98aU/4IWqQVJ0AErfa1p6sjXo6AMB8HCAJv+mZliT7WuR0AiCj94z86wzACbCkf3UCaIMlRwAnAL7+Pe/5kHN5Cfz3/+Nv/53qBJgd/ycdB5jk3+f+jYOkEXwUYI0TwDV0zAmgU0AngA4A4qxX6uMI4L8lsMe7hH0eoo364028bgR2I+0QcoPohrTDrNPI9EGbta9rjqPvYujsYFq30a+kIMlDkoskOcpJgqoMWYLUQMTZtHQEizTTKacTIAmX8hqkP+6eStrQIetJ4Eircparsu0kWj+x2iDj2Ix42k55Dc4In3OU81aJX867awFs1lJd+91nc1Q7EAbkvCi/dGV+bbv2vRsN7YM65zhct45bO2gnbZpzkHPlXDrXrJnukRHWJU6CWjfbtS8w9VC3GVqWfPqgf/SpY7B9061XMfvRPh2mHausrTt0PtZgrq818qRN1sRuhLo2ZvG6pt7E+DDX4fPp500k7ymvh5wPxrV6nI9FNNb2I1mDLEHMIGMQee+4QrRwnBN0AHAKgBMCkDKOr1IWogb5ItTHAiR8a50AkEb0qoExZZpjJE15w4cn/9pYu+ecKOsAkPiDx8h/Jf6Qeo9HS/7rWsQJwN1S1h/1r5X4azO/BPkNlXCBkKZ0AHi3VbJFmT35v335Gs9d6wQwzzhtSeLSAYBMuuRWsitBTjJs2mNjkvxZ35aBeEr0l5BTAtapbWqLtUj9733/z734M9/wZ3/glO99532GrAfWsCcAwM4B8J3f/53/mv8AgANAkp+oEyDTdAKQVx8H4BQAjwTs19ZwLLkmXT+uv/16HOQ+48isKR0ByJlGWzwSwF5vNu6nTPdHu24O6iZvN5S8E3JjWfOIH8sfZWofzyGODdATnAbGPgt1019JQhKJJBkSETFJkDJECTkJE+RGZ4CnADqEbFGO8hKzNYjjwLv9lJfcJc7kWr6WI74UHPcM01bKpyD2p3zOQ5VzvpBzPnOucz00a6eu/fp59HM6ql7ksr3sJ3XYjV72IfV2PDlGx5920cZ1XnIu69rilAhrsK7N7t0V2a59Zf/I6jVDy5OPLvRvWrbp/IuWScw+0jbK2q3DtG8nOw+PjLkWZnKunUvJY5gHIplr9Fj6pfo/p51ON9Jml+Oa5V863f4SzxlnVwddTVdv+zH+CkoErgGTrEnQIFAQKcgXm1Du+OMg1AHAxhMy5ikAyBckzTuwOgI6J4AOAFBi6B1iCaOobjPEfuRpx5RN2/BhnAHaejY3zqFz69rSEcQaI+Sd/0r+cSqxtnzmPx9HYS0SZw2y9nA60Rbt0xf9quO1rQG/EPjdlGyBkvbOCUB+Jf++hV3Sbz5oe5KxdAJA1kiX8EJoO5k08yppfsz4jLhzZ3+J9GceY6465/gcv+i4jVfkBMC3vPdbP82exvm8BPIoAN+jvhSwcwCQxn8A4HuYo/5J9GcyxF8nAA4AnQCSf5DveNYNY3UtphPgcBKF0yi3gXVkIM11pozdCbTLOy8uYaNLtOGPtD/eFeumbzc6bQObVvIqzsrfptf2HzvOeO3TsRtfg7sj49vndxt60yoZkCyASSiSaCBLTsQkQ50s6YLYc4feu/6VaBmHhEG6cAZAigiQ/AykkW+56jSgz47cq0uHlj+lLuOlfDdu7EO6djqG2rbaexbPOULO+UPO+XXO/YyUtVPXm+sxcVTZX6Td58r62T5y1WM30vZB/XNMjjftoK3S1jk3s3nXGcAa4xi+a1FkrVk328t+7BtMnZZk69AO7RpPJC/jVc72tUli2ixlbVpRm5+IzB1zJSKvDdap89/F65pZEx+qHCX1lLnvhS5cS7hG367MUrv7To/8UacjxR48Wz0Su/EeS0PRLHOS4tdGSCRxkjSJGaQKcsXdfk8BcPQa4pUOgHoKIB0AkDpJnuRPJ4AOADFJY8rqdwyxq6RPXGvrU8uvbfd1K6edEpEz5Nw5t845a+AU8g/BZ62x5nwUhT2cL6Ssd/7pR/KvTtc2B35Z8NsnWZewJ/lXJk9y779dk/x3SFmC5E0yJjkTfT5ecpukt8qVPBvP5+lNe0jUGYDuhLUnAP7mZ//J/l8FVt26sZu2hLzs7tvf/ef/Afsh5/NS6PcuToDOAcD3Kw4AyL7P+s+If6Z7MsBHAXQC+ELAmRNAgg9K/EHirCXmAJKPbJprjHLkUYa0S7434RL2nm0Eus3fbnR437B2s4lelD2GnZ5LablpOSYvtWPeSfaom33iSQqSOCSxqKQjiY/kJYkRssQ4EXnpmWsJVyI/NnjGDHieScsXCkrgJPGipO2SmGOrYyauPaqNarzadG0850U55w055zTnfKznul5cR+BsPY6s9qL8fS7rZ7+pz240vg85hhyb49YOacO0d85TtxZy/eBMqmuU9YbTibrZVvaRfavPGsx6KdN2xqtc29YWYtpJOe1YZW29AnOOHkPO9XFMHuq/QsBJO3a5Fo+Vu0S+fa3FNX3a1pqy11JGnRORZwG9s2wdh3k1/ZX4NRESSRIIcYKwQdJ8DIC7UdyB5W4TBIzfQR0A+RgAz67mKQA2sb4PQAcAxI+2JYOgBFFM8qisbqlrytiTuHZN2bQsY37FLLvJ85MDaTfkDM6Za4l5db51AOlgYl3c3PTP++edf9YeDijWH/sv1yDrklMCrDPaon36o+/U6drmMr8QfvADP/NlCL4OAO+8LpF/yKdBh0DGSdMBoBNAQiZCnpUhbUl2IckZT5m8JdIvQa9Ee20866ec9SHzBMYAucw7/TOZcjwGoP6MyTbr+Jbi5ukAeIi72vx3Ab4/fR9A5wT47N/6L+84AHQEgP/t3//Z1jGgA8DHAPIkQDoBkFk3vF+BdegaYp0Q0gmQDhgdAebn+tIJAH7kwx/9zPgMsHd7sit/rGc/+N3mcjc0vm/o2iUNPcSZTl36rL1M7+qtTct2luTVdqmbfwmCKIkAk2gkCUnyo5zkqMpJvLijyg9JEv21MvWon6StyvT1EE4AxiQJFOs4iWuPitiPtA7TtlXOOUg550nZOQRznsfarusj11Jdi6P4YbONfMmLvrhqn8RTJ+SdIcfiGB1zrtO0Xdo/5ynXYpVdS3WN6gTIdmw/+0TOOUJWz5pOvNZdE6/t2L6ofcS0XcradiXWuXnoeLc+Mm2ofVijpF/zdWn9Lt3eY9qu0500049h6mrZTDsqXxshkSxJ2iBskDTu3vtMKndhdQD4HoA8BVAfA4CUESB4kDPJ/zkOgEro1DcRmxpXXkLzrCOSvoVXbYB9tJmozUTmKYNOHdZTkn8dADcN+cfhhCOJu584mCD/OJxYcxB/9l/c/eexFE6esD49ZfK6OAAk/xAv7/xL8CtyFN1gnicAdCzUu7ISM++iQ8qQ6U+CC0KQM56y5HkJ01FwTM78rk3z0VPyr/4z0p/plqVt20LOMZ0i6wC41L8CrD8aPF6AE4DvVZ73r06AzgEg8Rd9PEDnAKcBTnEC8N8BcAJI/CX/ouQfNGBzZNZY1tMBQB7yp37sMy/YL9ZxP3bcH3Cwhm6DuRvl7hCDESdtTejay7Ta/ylx2qF8xVPaOFY2dT0mr7HH/rGJJAQSBlAyASbhSIIiAUpMgqQsWU6yxR3VU5wAEDAeD6CeJK1itn9fGd1T74w7rkRsQDxtkTJ2I572W5LT5lXOuVHOuUN2Xsea7NZCrp/ZuhtVH/SiX67af+q2G/mH4JhyrI4/baRd0/7IOV/d+kinETKPBOR7AViDOAbqPNsfmHogo5/Y6Wr5bGMmWzbRNsG0S64B7SamTY/IORcPLdd10MWHugeiiNxdrqsu71rSnoOOl7TVJcd777aukWBC4qoDAOIOiecuK0exJWEQMIgZBM33APgYgO8B6BwAOgG8IyxKFBOTSCpLNJcwyelMzvq0Tfwa5+TadNJOab+UnSfQuXSOIefM/xryz1rK5/69++8pTBwCrD3ukEKSboYjwbVFv86pul2bHfOLjbuhEPY8AeBdV9LqHX5JPqQfWfIvkqYDAITUc0dW0l8RYkw+aF51BJxCjCXVknjINvUz3XgSccuL5okQUXSs5F9in2S/yo4LpB3bVA91q+OcpVOf8Jfe++MX/08AsTa+lrWNg6uSf+KQ/HwEQJKf5D/lPBmw1gnAIwE4AViHknnv7hOHzEv4dQBkGkTf8tg+yyDTLnvJGPOTiP6ggzV0m87dKLc2UJ+yXTum1T6fQ1zdT8GpzSQGYJKIJBdJOipBqUSrkq0kXsiSLwgWPypr7v5zLDuf9U9Z4pYOAftItO/EmWy9WT7pNXR2IK3aaxZPG3dyzodyzlclfbdrv857rpm61keVA8Ei76Gv2r/x1HE3lDgE12qOW1tos7RvzkmdL+fWue6QdVbfXYETINvN/tQBVK9E07NcyrRFvGKWUc520x51HWCztOGCjN2xddr/krLzeyoOlQ7rEjkv2tquzQKrLXBthAR9JEuSNwgbDgBPAXBHFtIP+eckADInAHwMgHwIGQ4ANq4E78wunQCQIEoYE5NQKqtnYuqf6cizvFl71zg3T6lT2nBmS8poT9A5dG7z7j9r4eb2zj/rA0cRa4V1ky/9y7v/rDnv/rv28vg/7eEAoL/n5gDgmWgdAOkE6Mj/jPQn+ccB4CMAtIszIQmwchL+mgZxI+0+joAk0xJpSLOkO1FCLlIe2ThH9yX6M5R4VvLvWBwjxNV21UtMnVN+JX88YkEbOABu/xPA6u/+Uwr6KABOAE4CQPx1CHACQNIvSvhFSX/GracTwMcARI7/5+MAOAF+83NfvPMYAKQeO2LbzgEg0SdPJ4D2J24+yBp9iMcoTrHz0mZwafO5G53khnUWX2pjqe/nkrc0vlketroTJFaihCJJhsRDgpLEJwmR8hrCtcYJwPP+lfAn2VfuCFxNk/Qlpkz51DvjKWcZx1tR+5CuXDFt2slp/5SdH9F5E+v8jnhdC7P1PYo+2oUOXFWXqutulNkHxwc69rSLNkw757zkvCnXNdLFIf06qzgJwHrMPpDtG0QnMfVLOcufImcbyNpBTBsha7sFrPZeE69z9hDxoXJL/OlruzYLnGWBpyR0Xd9JmiVw3rGFXEHQOJadL2Pjrizx+hgAJE7yrwPAO78SQVGCKEocE5NYSjRT305mjF26aY4RNA3sbPPc0y4xLttIW6Wcc5Rzx7w6166BdABI/iE1rBufeYb8c8SfO/06nDitSXDddcf/OwfANc5ffmlAfjoHAGnd3f81TgAdADgRIGuSrw47R0CWoz6OAO6cJymeya+Q5XH337LmScBB8kwHSTPfu/6V9HcOAXSu5B+CSXp1AtCnfdCnIXVR5w7VkX9v95AOANaJjwLgIMuTABB5ib0o4U9EpqzlKXuOE8CTAJJ/11WS+c4ZkLa3juvLPOz5zne+65vyc/EYcm7ilLtN5JrN6Dllur5ep7Q1NtmNib4TkjxIKEBJRxKVSoCSaKUs0UpMkgWZyqPW9UQAedUBUOM6AcBsW9m+iSuDNW7eLN38ijleZGwjVjtVspg2VdbeFXNOlHPOJoSvroW6zvm8k/YUl/1WnVLn3VDsEHK82iDtpA3T7jk/de4y7ryLmcea4zQA65MTKXV+7RdMfZbkrLNGrm05fjDtMlkHBxsOe6Z918p1ji4dH2od1qHrItOQt2uzwL0scI2kBJ0gdZJjyBSkDcIGUWMDmi8DzMcAPAXAXSqIHISOOjfDeUB9ggRQQihK/sUkkMpJMJN4niNnm7W+NrjW+VmjF2NyHHV8GbfMrM217VAu50f7Op/Ms3M/I/+sLRxMkHoeKYH8c8Ikj/5D/nGA5/F/1plOJvqhT/pHnzrW2TifIj2/PPjdTMIO2Ya44wDwuH931N+7/olZnjZpS7J1LkrSqC/50yFwzCkAsZNsJ0qqJeESatNpv5L+Lo5uqR+yTgCIKfpmmjbg7vWppF/d9jhsi60fwwHAWtEJ4N1/HwFIMl9JP3GCjwmkE0BngPmzlwLmaQBk3wmAXV0L2jcdAcqeANDuFZ0f0lkDD/U+hfy8zeRjG8m1G9S15Y7199D52MEN7il4Cb06G+2GPoeQRCIJRpIPyUqSLOUkW8hJopQhWBkgV92/YINscceVkwKS/I78Z1sp0x/xRHW4Lzq2Ol7i2qKidquYtu3knAflnKcFwlfne7aGxhJ4sis/A6lf6r4b2h2CY9cWYNpN+6b96zydOv/UZy35byipb/v2B6Yea+WsX+VZGzl27SGmrYqcNl0r55xcUh6q3fkedB2Qvl2bBR7EAk9BOo71mYRJJwCkStLG5hOCDznzrixkjLinAHwPACcA0gEgAQQl/omSRVESKZlLgim5E1PvmWx92zVeyx+z0XPJr+OaxRmPeTOZ/MyzPKgdRe3rPDLHzr3r6GY4hTz6z5qS/LO2cDB5978j/6w71lt3/J++XC+pI7pfW6hfKvwngDwFsHT3Pwn/TIac4gCAYFXSdd84hI+Q7UCoM0gOcRB0TgLIdxJqy3V39mfEX6LvXefUJ+Usl3rTpw4IdEmHQOrWydTDxg/9CECuE04a8L2qE0ASjxOA4L/7k9QbF0nXCZBo+eoEyH8R6CMBOgFwUGFj5xnC7zwk+Ue2XM5JlZ2Xp3AC5IZPudtgrt2orinXtf/Qaayl2fhq3qnxc3XvbLUbne+DRAJMopFkRKIiCUqsZIt4JVxJ1JEh+DMnAHdcye/Iv44BsLZpvPZ9qXg3TuxAetoDWXslpj07OW2vnHOD7JwVrPPbrZNR5bAukZ/y6vQjLcexG/FD0A7aBUwbauechzpfa9dBrZfzaz9g9q+c+lUdLXMqZpvaYWEtYLO045I8m4dz00fXhzVGG1wVX6a+/df8t1M2abPAhSxwbYREfSROEDrIFEQOAnczSBuEnru03KGF+HM3VkKGAwDixnsAKOMjANSD+BEkgpd0AqjvDCWmjkeCSHxWR1s8V3RcjlE0fQkZ81J+zaNtg+TfdaODx3nXAZDkHzLj0X/v/rOWWF86mTz6z7P/3v2vx//pg7Xq/Krntc5h/Rr50Hd87PPVAZB382dEv6ZThzQQkiaxqoTrMeK1b4h8OgmQJffoo7wGk9Qr1/5okzTzJaiOHfIKudcJsNoBcPv8/2M7AFgzX/+e93yI71a+Y3UAQOBxAEjkJfwz9NSAmPV0AkD0fSdAOgJ4H4BOAGyXtsTW1RFA/jEnFOuAMs4f8/EUjwNg3zUbzKWN65q8Y32ox7mY7dc2zMt05PtetMu1hPbdYbXbbrS1D0ksknAkWUnyk0QLuZKmjmxJ0MWZEwDHQBL9Klu/YtfnfdMYF23U8SUprLZIO82IonZNW6ec86HsXBWsc9rNu2mj6uEi7bEv+0xUN7COZTfSDkE7pJ20Y9o856Obt9ma6MpmW8j2Y79i1Yk4eaZbruLS+rCu6PjBtEvI1X41nrY+Vx7dLX7/kL900e92bRZ4FAtcKzGROEHqkshB3iBuEDZIPndhIWSSMk8BcGeWO7mUw2Hg8ezqAFjjBEhCKbGTbCaqM5jpyo4Dgmha1lG+1jk5RS/GQvmZLRi/4z2GtjMrpy3BnKulu/+Sf+9kQv49+u/d/zz6L/kHcQiQRzmdTDe3DiacDd38OgbwmkL9kvnu73r/L3DHHtJOQK4OAMl9Jf1dnPqSs4dGCHv2YXyGs7ISf8igMmW7dpLUK0sgs30JqWW8I20ZHjXQAQChrScTurv/Og2Yj4+872NfhZTX+XzIuE4A/jVgknhkQiX+kHrSRGRIPw6EJP+W0QmQDgDl7iSABF90Hoibpr07zPLIzAm2fUwnQN38GZ9tRusG9lh81k6ms2YynrJ5FbMM8lJ+5r0s+fJvrZd5x2Trri1nebCGasPdKHMIkgxJB5ikRQIEVnJUCVRHtCpp7x4H4EcoHwPoHACk1bboj7Su3/ukMS7q1/ERrzZI+8zIXdq2yto/Mecn5DqPxOtc5zoY2Vd3pX7qXse1G1ofgnZJu7k+0/Z1Xrq5W5OW7di+/Yl+RlKnTrb8MezqOm4w7XErV5tlXLveF0dXJ60v+tuuzQJPaoFrIiNVFwmfxM5j3DeDbHn3ibv93I3FASAxwwnA6QDvzh47BeCdYe8US+IkkEkqZw4AdE0iWuUk/10bjjWx2uO5xXMsacNqG+JZ9hS5tmU/zp1zyhzj/Mm7/5J/j/6zXnAqefTfdZXkX0cTpwMoT10fMdGZlPPrWK517uqXjw4ATgF0x/87kj9Lgzw9xd1/iTokL+WMm54ISTTeEcRan7IQRUm9KJHMNswTqwOAOvVRgEr69/MxnAN30oeDBft/+7v//D94iufWeXEknyOcAJB4iD+YhB4ivxR0BICGWl7in6gTwH8RiF24i4/dJf1izkWVKeM8Oi+msX5/6qM/94I9Z/2sPGTczSh9KK/B+2xsa1/GE5GXLje1FWd11pab1b9EeuqAbEhb7kb6PiTRSCKSpEUiBCZBQq6kKol3JezGu/8O4GMAlyD/6CSB77BLyzpVJl7HTTztkvZSTntWOe2u7Jw0mHOH7JzOcBS52qvTuY5vN7Q/BO2TNtTGoPNQ54h5WxtqXdsEs6/U4RQ520Bequt4wbTDrVxttWY9dDbv0kYX+7W1hOR50cZ2bRa4GgtcKzFBL8kTJA9SBamTyHEHF/JVTwHwvDZ3Z30MQIJG+Zvbu7TdKYBLOAEksklK1RsiKjnNfOs4VvCa52Stbjkexysp1w6geYlZdyZneWXbtR8Qu7tmkvxD2jkdwvrg7j+nRSD0vvjPo//+yz/evYQjgPWlg8m7/54uoR/6dFyp+1q7PXa5+kUEoYO4c+feQNwwI/tdOnUgUpVwPUW8I/aZhp4ZP0VHSb1IXQglZFJnALL5pnV93CH3lew3cU4N6AB4qn9hxx1ynAC8ENC7+ToC8m5+ypXgE5f8J9Zy6QBQxhFA4F8EQth1AnT27dJco86RTgDL0iYvWbzdX9aPzIPG3TAmdhvRS6YxIPurgzN9hrW88Vre9KdAdcm+SetCkofdKLMPSTiSmCRpSUJUyVIlWekEQJb4J/Kv13gJoNfSKYCsl3LtJ+PoRLxipmX5TK/jIV7HnPaoJHGJ4KWtlZ2HBnO+lLt5HVXbNd6tDcpew1XH4fjE3VDyELTVOevTuVszr5TNuc3PQPatrF6i6eLSWrCMaBtijv9W1jZiteG58dH8K98XmYac1zWvq9Rzk98wCzw24TilvyRQkDyIlYTu5vYUAMQNsg8x810AkDdImi9oY3PqXVrqeSdYlPyL3jUGk0xKMBMlnx1SThJqnVoux6iMjZBPsdW1lXUsoGPGBtpWoqxdQMsl2g5pVc5y2Y5z5lrRAcDc59F/yb//8g/yz1qqR/8l/979p8zs7j99q5f6gtc2P+rTfd3xHgCdABJ/sCP5S2ncsV4iuxKsh8JK6DOeMv3X+BqdrCNxhOBLHiX7oG0dswX5Pgqw5Ai4cxLg9gTAn/vmb/wk+6BuPh8jjX3bv/8ff/vvVCfAMdJfCb7kX4eA+cfawRmQTgBJPbZXFp2PRPKwv/PGPFqedGzOYxbDluwlH/Sqm8VzN6lr6jEQ+xNzcKaJmfc6yHVcxkGD5AHcZZB4SEjAJEBJjCRVYiVXlVwncUfmTr//dk0nwK//xm/8dncCoNatbWccPSqZN97lzdJyPI5RTDusIf/atWLavpFznpSdww5HE/uLvGu71ElEP2XQ4DjF3cg7BO13zvp07o5hzm2u/ewTWV0SM72WX4pnG8o57ltZm4jabIaj2h0b13hXr5Yh7kV5LvFlbPu7WeCKLCARuFaUREGqIHkQLAkdZI67txB9CD8OAJ0AngKA3OV7AG4e2AFQiSgk1DSJYaLjq3it87FGLwmvY3K82kFHi0TddNHyibSV8ZStB9qmjgbXCs6eJP+sifrcP8f6K/n3+D/ryrv/PvtPG8/57j9z2X0V8Ww3xD7Jv/IS4a95T3H8P0mdskS9i2deypZdi5BEguUlkukAMO8YLpH/mucJgMd+/r9bNyPtHTgB+Fz84qd/8vBIwDHyLsmvqDPA+jVey3sigJMAvtCv2lpS36XrBID8O5dZHlvjHJuM/eLJdeNoPBH5lICSXf1U3vxMe5Pkzp6SCHCXQQKShCWJELIkqZKpJM1JypUrked9AH/8x3/8P+oA8F8C6iDQGVDrGbfdxCT0a2Tqpt6dXMfp+I+Rf21ZMe3dyDk3yt0cjqqHtY/8XK78PHbjIs1xT9cnNnWNztYn81PnbhbPOa3zaj9inc9jceslzuqMse+akPaY2cz0UX3Vd6jlljDzkLdrs8BVW2ANoXvKMkkiJXiQO49zs9nkbizkjXcAQNi4UwtZy+e0PQUAYbsZTgCCJwBASSkoeRQllWCSzZlMOevWMklcc2zKidid+FPa/9y+cxyMOe2AfbT9km3TVsi0WdNqu2l759S1wtyzDlgz3P3nCH/3L/9YRxB+yT/o+yU4JUAdHy1hHblm6Bt91NW5E8+15UPWm3w57TjyLOlPrCR/Fl/78j+JViVkl4ongVvTJk6AU+vUdhmTDgBPBNQyszh1Ia+V6M/izA3/ApA92GQuHz2Z0wjf+f3f+a99L4DvA6iEfU08yf/v/snn2scE0jFAGcLeATzu6s/m0nTR+SCeacg6E5Cx97e891s//ZhGZaPq5aZVJN180xK7/ExD3q63LZC2JDVtmaRiN/IOQXKShGVGsiqhSgKdxBxZ4p7I/12H+OsE4FTAEvGvbRqvZL/GKbcmLfVHruNLopg2SVsha8PEtHEj53wo53x18mhmfznPxp8TqnsdnzYAdxnSpmn3nI+cJ2XmElk0PTHbQM72Z/Oa+pwr5/hCThsgVxsZH1l3vjfXxpfqZxvI27VZ4Oot8JDk4lJtSyYhVhAsiBakC2LH0X5PAbDpk7R5XDvv1kL+Zg6AJSdAklRJXhLPlMmX/HdlK4Gtccd6zaRxzbzmOByjc6eNdAJgL9IMaU/rdpjlatsd+a/P/eM4Yn1wpJ8TJDw6guOIteM6Aol7ooR3TrDeXEuuG+caPXPsa2z1lGVmX1C8DBByD+GBzOsEmBH+mu7d/yRTkqynQPRYc4d/bbmlMUD6dQCc6+DAfjPSn+nMy2PelZ6tl5rOHtFHAnQASNTXEP8sk04A2ziGOgGW5inzcp0iGwdxAPBohoG5eWybs/HsLtOPbUy7ujXNtmr6mxrXpmIlF7thmEOQyFQClAQpiVMS5STREvTEdABA9nkBoA4AEKcAZcjLsilne8r2S1y5w2P5WSfHlcQx7VCJorYT066NXOfBuPOUOKofiB7yc74Yl1eOMWVtAe4yaFsw12idl1yjx+RaN9vN/pRTnypb5hjWehHPsSOnXbTdDEfxO9es3Cz9TuURsRzpKddyW3yzwJNa4CnJx9q+JVSQK4kepBHydTPuwHJHl7uy3PFP8panACRtkMBLOAEkfJJQ4uhU7wabL3ZEtqY5XhAbiWvttbbcQ7Vr/47D8WmDtNVN3EFfcgRQ1/m3nUTbdA50LtA+cw5hJ/jcP+TfN/7Xo/+5hpC7o/+0mbq7HtDRcYva4xpx9uXDi910AEj+wUr0uzjlIE0QLIlUkq3HkJ+qX8bmCYBT7/5Xu0A4k+xX2eP/3HGfzeNTp/NoAt/PvBxQUi+hN74GqeMJAHHJCcBLCC1X7Zpx1wmobD5xyf9nPvGl/XrGsfPlL/3pC+KPfRLg3LncNqDnWU67gYZKMnYj7xAkL0mEkJMoSaoqUU4SLUEHk8QrQ/R//w/+4Cs6AXgsYEb+sy1l+kJOzP5nsnVm+XVMjhVMG6R9tJmY9mzkan/jzk+Ho5nX8mKsXHXM2kTcjTL7oI3BnIO6RnOuZnOYZWpb2Q+y/Xc4y7eNrk6T5ljFahPjo2p7kc8lpmzaDLuypG3XZoGrt8A1kpJOJ8mUJDCJHoS+ngLglBzHuLmry7FtjnuzEfXO7cwJ4J1jiTz9GCB5s6A+oGQwCap6g8qZj2we6Hg7WzyHNPUXHRvjxD7aFKLOXGh309PO1U4Zt5z2px3JP+1K/pl71kge+/eN//Xufx7/9+h/vviPNXQzHAv0Q3/Od84b434O87T0BcVdTp0AngLoCH9N44VpkKiOVEmurhnXnBR4aP09OQABnZ0G0CFzJc//T5cSeznIMi8I5DTAGsK/VEbiL8E3DkL8M66sPXPeujRJP3bXiUW5PNXh6Q7WOf9+cTrwLePZW4BNfw2SDHE3yhyCxAVMYpSESVKVhLmSasl6og4AkH8NyPE0nQD8l4DMR6aumO0g059Y+za+Nt+2czyO8YnI/5iSO2SOOJck7mXs+f+ta9O4a1PcjaEewmyNLjkCcv2mnGscOdtGzn6PyaeWH+05vkRtkDiK3pl78rjEl7GXfzNNeYZZb5M3Czw7CzwHkoKOSSSTRELCIGOQMsid7wLAAUDgDi4Ejzu+EMD7OgEk+B3xNC8JasoQxIx3skTZ8Yra4NLz9ZBEVd1Bx8WYsV0l7BD1JSeA9hapX9vQmSDpZ00w3wTu/PNCSO/8Q/5ZK6wNX/zn8X8dAKwdHEiQ/9nRf+fc8Tnmh5qvS8//0hcW/1buFAcA7w2gPHeuIVpLDoCOfCU5O0emv3PqZZ1LtJHt3VfWTt1pABwA2Jx999I8Xksejop8N8ASyT+WJ7HvnADmiQenwHg5IEQem3bBPOaM/I701zTm4Lve975fuxYbb3rc3wJu9mlJGcyQhAN5lyFJUBKkJE4S5CTNEm9RYg1Wck+co/86APjR4iWBtVy2oUz7yPZzDlLf/nA+cAIhx+L4csxpi0oW036NXO1tPOdEeVR/rS/GmZdxxy9qI3E3Kh1CrlHkOjc5b51cy9f2sq8HkB1TRceeOLq/c5FXL9PEtfmWF2u9Lb5Z4KotcGlC8VDtSawkkxJJ7/hytxeSB1GD0PF7iAMAJznEDhLny9sghJBE6hBuhgOB4J1jiago2axoPigRhKCqWxL8Sv5rOfMlkmCOGbsST0S+xqDe6uqcOUbtg820oXfrvauuTbV5En/ynKubMW/M5Yz0e+SfuWdtECD/rAeP/rNe8vl/1o5H/ynDewLyv0nQJ/0754ynm69rnJuq07EvJ04BQHIM9W5/jXNSwDunSw6A+xLja6uv40C8tH7VEcDxf+bk9l/THZvGq8lnn8hpAL6DeUkg5PwY2V/Kh+SnE0CyL+oEOOBwAngHHzJfg3mJkv6KlGFecML8mW/4sz9wNUbeFLmoBdjcd6GSj90odwhJiJIsJZmSJCdxTjIuYa+YJD/fB4CcebUe8UuQf9rgBAL/hhDyT7+kOQ7HBeZ4tUPaBjntFjL2xZ7VzsS7+SCNyzzlfeJr/scxd5j22w073Ak5F87PqZhtLMwn/S7NaebVssZzLCl34x7d7ddCIvKai/a4xJext/+uSZ+VebuVTdos8MQWqITgmuMSS4kkpFASeTNImacAIHiQfk8B4ASA5NUXAuoEoC5BUikpPYaWlwhKUiX36QCQ9M7KOKbESip1ADBHKRM/N1yqna5/5wtkLI5NW0juJfQSeeyq7S2TeDPmyrLe4Rch/JJ+SDvEn7v+BOafoAOAu/+eAPAUAMSfY/8+909Z6tIm6wtHhfqhk+R/aa4621xL2rGvn5tv/rYf9hQAhLMS/hrnWDQOAMn/GkIsub00ab5Pe2v0zvYtXzHLXELGVtiX9wFge17WeGwOrzEfruC/DPS/BSwR/aW8A7kfzoD6wsHMQ8YxwGc+Cf5auXMAUJdHND74bX/1BWO6RltvOt3fAm7mwQxJQiQwu1FmH5IYJalKUixZljyDkOkMlchD8kmT7Ps+ADY8EHPLW864aNvElU9B6vHfB3j3AMhJgNTfMeU4c/xpF201wWpf4zkHVR5NvbEXtuCqNtFur6zRUXaX84Gcc7Uk13rEaW8SUodLynWsxocaZ13Ur5dpovk1bvqGmwWehQWuhYis1UNSKZmEUEsgIWcQQQgbd24hczoBIHVs/DzKTTkJ3ZpTABJSSb8kkHSIYBJ7HQBiEl7LkZahEuQklpVcaqv7kvf71lePRNt0nkTHl/OGLbCd84dNdcpoZ+0uku5pAeZQwi/p9zl/HgdJBwDznuTfEwA6ATwBAPEn4BDIo//0Vcm/8zubn7TLtcrHvqTYw6UDYMkJQB5kCBIMSdURcAniO2tDwj3LPyX9km2d0u+pZbErdsbePKZxbA6vOR/ekCcC7vOOgCT7tAPZN2QeMp97Cb0OAOMzpFzNsy5zsb0P4JpX2v11Y7PfhUpmdqPcISRJSjKV5FjCnCS6EnLJu5jknuP3kHEeB8AZkHmWF2kXubZ/Spy7/vTFUTkeQ6CuujsWMMfo2NMeaaeQJanVrsa7OSCNS3wZezP+1jHP7KP9xN0wz52Qc3OqXNsqcfu8FM7GOLo9rIFqF/LWXtYVa71Zei23xTcLXLUFrpWYzPRKQimBThIJgexeCJiPAuAg8H0AEs6bcVfZIPkEk3gSp4z55NF35wCQ6ItZTr3FJMcS5C7PsSdiJ+LgOeE+dWf92Wbqiew4HVvnALgZ9k2ynXOAvYlDxH2+XwcA82mA/KcDwFMAOgF0BHgSwEcBkvyfcvQ/HQDYxPHP7HNN6Wu+nPJfAkJ0MugcADn+z9vRqwPguRDrU4l4lmeMjrNilruvTNv79wEMWz/2v6Jbs1bOLQM/4L8Z8Bm+9IkAnQGeDtApoBMAUi+xl9Avxc0TqeOjAM/dIXPu/L2O9bpNvmlghkpsdiP/EJJMSYRBCXKSZok0WEm5JL5D7vxztwNiDkHvytT2zolD+O2Ho//0o845DscG5pi1Rdqnkas9M552r/Joan+R/iZfjr/aJ+2ovBuGuhOco4rMY00jTn2xtGUfl8A6lll8qHDxi764xJexl3+7tMzf5M0CV2uBayIja3WRWEqWJZISdAgkBJA7uJA6TwHgBGDTBwHk7rDHuo85AWz3ZpBTgqRUUi9K9hPNA02XAIsSY8dTkXJZBlkb3Ids2sZaux8rpy62WzHHwJi0B7aR3GNfCD5zqK2xdwbScQDkXX+IQ8arEwCnDwEnQDoCWCOsCd8DABLHOeA7IzwpkvOO7s5LjvOYja4tf80X07vf/Z73Q/Al++kAUE4HgHf/PQGQ5Pi+BPga60v40c2xJl5KZ9r07j/OlteRbMIXOBGgI4B/H8gd+6VHAHwHQJaxjnf+dQLsHwGI0wH7/NuXAyahn93tt0yiMo6Z7RTAmm+U51cmN/nIXehIzm6U3YckTkmIJcpJniXUpzoBvDPPRodj+TMnAOmnkn/q0L7kn+f/k/yjq2NwTDPyPyGL2Akbip09TevsP6q2BI30N/HqbESaNkzcjfRXQq7ZTu7qRFq2X+WZbuemj24fbe7Rcbs2C7wWFrg2QrJGnyRckmUImSQSAgkZhPBB5maPAkASIZoQvM4JcHNLRmnPQFoSwST4VUYfgumSRom/KDGWUGbcMqJ5YNoBuxFfY78sk3VSzjJrZOuCs5C6Ox5son2w1c2wL4H50AlAvDoAyE/C791/kblV9lEAMB0BngRgjegEkPxTjvrowNyjg3PpPNY50AZvvXXeaYynqLf2S8x/CThzApDO8/+cAHjuDoAk9GvIe5L9Tl7TxpoytA3JxM6v093/bg3OHAES+kSIP3FRhwBpyuaR1jkBcPz95q0jwFMAiZL8TKsyZXCIvfOd7/qmbkxb2utjAUlAJSyV6BDfZZBIPZQTAGLOKQCezU8HwBrCr8MhEZlHCmiPdrmWyD9OgGMOgLTHgtzZ0rRq94yPJh+NDNLXNV2uy9TJtLQRsrYUdyPtUsE2K1Yd7hsfKh+ccchctLn2yrJr5LXtbuU2CzwLCzwF6bhEn5JMSBhkUiIpiYTUQ+C428vmrvuvAEny0gkg2YdkGiSBkn/6MUhgE80DTZc4Sn7BJMVVzvysk+na4Rzyad1LzAdtZHvKYjc2xoFNcu6wb9o/CTh5N4OIE5gX55h5TsLfyaThADAw9zoAOO4P8QcJrBnK4WCgD/pz3p1Dx+P4QGzw3MLaLylIDSR/5gCA+BxeAHjrBPBxgEqK15DdLEP9jF+LnONKp4dy5t9XZ9rKu//8S721c/ecy+kI4HvgJ37qe1/84qd/8kDgvaufzgCP92eaTgCRPOoarAPu68V/Cqgkn/iSMwAHDY8yPGebb7rPLVBJAvEuVOKzG+UO4RJOAAh9EnxlyLrvA/D5fMsmrnEIUAYHgCcLuPtfj/2T753/NeSfsactQsZm2EhUrrY03tl9VD+JAFL+db2wj1dnK9K0ZeJupJ8TaIN62VbKMx1OTR9dHOaYuk99pQ4pP7VeW/+bBY5a4LkRltRX8gUZk0xCtiWRbBohchzn5lEATsbxGwby0jePeXunVyeApJ+4aUsOgCT5SfyV0Umim0RevSWTM5TwZ11l6mgHMW20JNfyxCkvLtWtedaxTVH96tjUH9QBgJ2wmfOHzbF/OgFuBhknkMc8eQoAgi/JnzkAsowOAF8GKOIU4Oi/a4J+JP/OIzo7LsdZ7fFc4ke/IKLAsVMAOgAgqnkSQCIMCUa+Lxl+iPrn6CUpPxD+cvphb4db4n5O+zlO6nv3/wc/8DNfjml5I0R4Bv9qj/8csHfsjn8hqDMgCTyPDGT8QOoH6Yfc4wRIRwBptbx1cBz/w8//wZ3/GLBE/nEOMDfo+kZMyjbIO0SkEpkkP5Kj3bDZPlzKCZCkHicAcY7/s8nhrgcvCFxD9lm0En6RNO/+41TQoUC6Icn/PR0AB9vc2kibVTtmvNrc+Ghiu4oFJKfaKDFtqrwb9U8J1usw+zpVZhjU4bLuy9jbf81/O+XhpMfs6+FGsbW8WWBY4LkQlapnJZwQMsmkJFKCCKHzfQA6Afht9Li3hA8yCdk06ACABEoEIYMSQgl+ovmWgTRKHL17LPlNUiypzLROtly2IQlNm1R7dfFZPdvp6tS0bKOTHQN5yqD6gzpH0gFwM0i+jhjnxXkgj0CcOSJf8o/DRzkdAZAGA2XSAeDLAEHSqUebtE0/zKVzqP1zrG+99fLOP2nKzwVP+RLkbuzSKYDqAKhOAB0A9yXDSYyrfKm2j7VDvsQfYk4gLponVj1PidsXb/7n2X/eyXDKvL1uZTk9zQkI7rT/h3/hP/oCLw3EGSD592QARJ400yX6+7v8tw6BlLsTAcecATgECLwE8Ln+S8bXbX08xXgkBRKUxCREu6HcIZzjBJCod6ReBwB5kPU8rt+Vr2m2nYgDgRcM4gigvMRfTAfAsaP/jjdtsFJOG6acdlYeTR4II/J2vW0BbdRh2nUm70ZT5FWclSe96yvTRpHDfJHOlWjZlzlv/7XM2ymbtFlgs8BJFnguRGWmp0QsSaVE8maQN0jc/o7RONYN4fd9ADgC/NeA3vWVPFI+nQAQUdqq5F6SrwMg882TOEpyk/hKJsUkyEty14Z2qCS0xtOOWcdyM8x6ypYlXtsizhjEbjyOQ9tgK+cO+90Mm6cTgLkkDvEnT4cA6cwX84YzJ4NzCqnXMUA+RB/Cn6Ee/ad951HnjeOo49Umzw1P+rIYhSFeMycABFXCuz/+X+6IQ2QNEGDkU4jwU5ZVV9AxLqGOAPFc3bUX7bwJz/6fuh4pDwfRIfCXv++jv5MOgST/OgMyTacA5B9ngKiczgSdAaTRBt8dn/7kr7z4iR/6+TfeKXPOvD3nOh35SKKiLCZB2o2BH4Kk+JR3AkjQK4HPOM4AjuvjBIDAZ17KttWhaZRHrmFG/nEE5Hgco8j4kdMOK+W0o7I2ThzNbdetBbBLXsbTXilr1/tittnJ6GR66rckU367NgtsFriQBZ4bYan6JhGDnEEqIWsQScgbJA5yCPljw8axTk8B8DgAjwb4L98ghZBD7wBTD3Ip4aS9pXATTgKdAsccADPyPyPOlpc8G5dspz06W5FGGbHWM73Wzbj1LZt9KkuUK6beyjMHgPPHHBA8CaATQAcASBr5OAG8w+98VicA6ZB91gPOHwNzr/OH9m5u59M51NaOMe2Q9nlO8jlfI/VRAO5K5zsAIMadA2CffoITgLuqHXGepXdlL5XWOQAg5UuB8d7HASD5B737/6Y8+3/OurQO3INTEpwQ0CGgU4CTAp4W0CHQpdU8y9AO7yL4/h/42L/i9MHtfLBX3q7NAnsLSGoqJqHajZKHIDFO0uzd9CTZlYAnQU9Sr4wT4Pf/4A++wnFH7+Cb16HtJXZ9kpZ6IatvJf+MyfGJOfYTZOyHzdKOytXWo9h2LVhAe1FEuaK2PQdrW8btTyQ9L+MVs8wmbxbYLHAhCzwnsjLTNQkZhBOiBqmEhN8MEic5hOBB+rr3AfCIAHl5FxgHgGSTdgidA8A8kTL0DXE0SHJFyW9iJctL8ayHbFlt8dZbd4k+8QyWo55yxa4NythOLW9cXWZYddcmoPbCftjxZticOdAJkAS9OgAop7OHuWYuDTgBSCPgAJD0i5SzbZ0+9F/Jf9pLOzxnPOdrhD1ddwqAO9R3jv2PEwAZrw6AJNWXIurntKMe1E0546aDjENynw4ASLoh0x33qbrRF4G2trv/56zUl3XgJ54QuPnmb/thZBwE/BvFDKSRVwN1DORRB55zvkZbzdfNAhIWx2UczFDJ1G7k74PkuHMCsNgk3B0h78i8aRzh3z/vOP47gGliEn3SMt71Y5q6iKeQf8bJmEXHL5ouml6w2jFtrDyqbNeCBdJOyjOs9p7FZ/UzHZWI51XjmbfJmwU2CzyQBZ4zeUndK/mEZELedAJA6iB4kD/IPsf/OQFA4PeRlwJ6EgCSWMmgpwBuBiFdCjoI6HfJCVBJsCRenJFn0md1k5xqD21EvMqkdXUsWzHrk9eFTu9OX9Mg/cg6AaoD4JgTQAeNpwA8KaADQKcOBJ+5l/zXu/+e+qC+bTp/6lhtpT2eM577tQIRqk6AmQNAJ8ABb4mtpHoNMb7UXf+1fUq+LZ/xdABI+MVPffwLeycApN00yq8ZYy1Dn9SlHU5ZYPNz52urt1lgs8DjWyCJj3IlT7uh1j5AegnHnAAQb8l4Rcm9SL4vBeRRAOLmJZpue+QpJ0r6xST/yKk7smPq0HGDXT5pWabI1Y7adxR7hWCStl29XbTbQyK2p30uscr7zO3PZoHNAo9ngedMXqruElKImqQSQgmJhCBydxhiDxnkUQDfB4ATAJk0iCEkMR0AEEJJoY6ARGTj1QEgifROskRXlAiLHYHu0iyfWAmq9gCxVaJ5S3Usk/Vm7VBmpifpqWfK2kFMBwC2057YF3JucH6cF+cIpAz5zCPzKdln3rnjn2nEc75t72Y4eugfvdC32intgPxcw32+aXjpGU4Ajv/7CMCB5H/iS3vyStw0iTMooYb0SrIrAV4Tv5RjoPaV+qmjhBz9k+BL+iX8IGk4RAiU/fRf/yernAD2K253/++zQre6mwUe1wIduTENNFTyuht5+5BEWDKdJFvi3TkBJO2Jknz+lR9v8udEgGQ/y5mWZL+Ts3/k1E19E3M858rapsG0o7ZNHFW2a6UFsBtX2u+S8svW3/5rf2+nbNJmgc0Cj2qB50pcqt5JUiWjEDcIHETuZhA6yJ1HxCF+9X0AOAG6UwDUyTvDkFGJouRfBwD9QFrp0yCpFSW7YhJi5Y5Md0Q627AO48+ArTKuPCtv/qye+Ym2JTqODtW5ovYBtR2IPbGrTgBJfr4TgDTTmS/yIPb+ez9JP0haHv3n8YCcY+cQPdCRMTAux4tdXpdwzy+b3fd9z49+VScAd6khrJX0G6+OAEmuBLuS8HPjl3AKpG7qQZpODB0ASf6Vk/xjE+J/87PHHQD2CdInfeFMwLmy3f2/50rdqm8WeEILzIhUEtjd0G8fkihLppNoJwnvSHqS+ST5vz4eA/itL37xd3g3gGXMt50aNx3Mfiv5Rz91FXMc95W1TYNpQ+08it2500x8u962QJLvKhvXlucivWVbGX9bk03aLLBZ4Mks8LoQGcchSUsiCpGDRErcIYeQPshgOgF4OWC+FNBHASSa3n3WGSDpBJccAJDYJLcSyyTAHVHONMYjETU96ydRTbKqPUBslHHbzLRjcteGtrY99UusunbxtFF1ACw5AZifnBsdAMwfZJ855j9A6AwAmXucAJSxPnPoPNJ/2rTaxfX23PG+Xzz5KABkF8Iq4d/f6Y8TAJkukd6XuSW8Eu1jeAmCv9SHBJwyVZak6wBgvN7pFzMN8r7GAWC7idvd//uuzq3+ZoHrsUCSoSRVSWB3Q919SMIsoZ45ASDjSdSrLKnnRYC8FJDTALMyNT3jSw4AdUxkDMRzLEty1u3qaZuCab+0q/YexbfrRAtouw6rjTNON7XOiV1vxTcLbBZ4LAs8dwJT9U+iJiGFyOkEuBl3kiGLkD7/MwDP/0P+Db4PwOfGKceRch0B3i1OR4DEkfYhq4YkstURUElwEmZk9a+y5Wb1JeRpi062fbDLNw0bK1e0L9tSN7HqaFwnSJL+lKvdtCf2xdba3rn0kQDJv48AQPaZTwKOAAKnPHQAMLfUSScOfamfts9xY4/XJVzieyYfBYAES/S94z+L38cJsETgu7zqNKjxWkfin6hM2XQA5B1/nQDgT37vZ/d375ccAEn4bR/ENjgSOF3BS+cuMU9bG5sFNgs8rQWSLCkngd0N9Q4hybLk+FwngESe9wHwKABomqijwHjiEvm/z91/ib7j6zDtkPYJOW2oXcHtupwFtOcSavvaq3Vq+hbfLLBZ4Akt8LoQmToOCZvEFOIJqYPcSSAhfpwEgCT6nwFwAvg+ANJ9RpxyS06ANQ6AJLjKEuKKEugZ1vLGJazHSD320TZrymrPROoZUk91qeiYj6GOkiUngMf9cQDoBNBRwzwxXzhwuPPP3BrSAeAJD+ozf87hkgOAdYYN6np7rvELffW8Ix8FyFMAkn8Ic3UIVAeABLiS8WPxY2T+WP2arx4VLUc6YyRU8v/xH/r8/kQA5F8HAGmzRwBoK/tB1i6cqOBf2V1oju7TzLZ/u4/1trpvvAXyA6QMGpLA7kb6IST5lRyf4wRIcs/LAPNRgCT6M3nJAaBeojoTV56hdY5h1k/7hKwNtak4imzXCgtgr7yMi5m3Rj633pq2tzKbBTYLXMACz5W4LOktQQOToEJIIZU6ASCROAEggtwRhiTyHwEI/JcAyCJOAIgkZWZOANoh3Iy70wTaN1QS25HfSpSNJ6lOmXzilrNN4+Q57iTsVaaMZWvesbjtp16pk7qA6reESfopV+3mvGFXbJxOHOaQAPFnngi+AJA5xKHDnIJ5umN2919dtA1j1R5L6+455l3gK2TfBHep/a8A9V0Akn+dAYmSXbCSYQn3uXgfx0Al5cbRBV11AHROAE8B6AD4iR/6+Rd/42dfPtdfx+KYRe1Au9iTffGl5uge7biXAzPco8mt6maBN9cC+SFSlsCCuwxJfiXK6QRAToI+I/Gm4wzgMYBf/dVf/byOAdEyidk2cu1bnUB0FVPvlM3Pesi0KypnmWwDOW005LSfNgW363IW0J7H8HI9bi1tFtgs8GAWeI6kZa3OkjaJrgRVMnkziKROAMh9OgEgizgE0gkAqfQus48DeAc67yDTrg4AsJLZGRFO0tzJ6p95tS3ykrgmedUeYBJ4y1S0fE23LkhfhtQLueo2I/YS7mqnGk+bOnfe/Yf8551/5tK7/z7agROA+SQPJ4HP/rMG8u4//VY7agtx7Rq89nKX/GLhbnV1AkD+M0j+90T3E6/+hwCJcBLuSpofM64eIn0zHgi6OHMCeArgBz7y8f0JABwS2Q5tEa8B2/DugEe8++9+zuVgHOwC5WbptrHhZoHNAgsW6D5kSWLvOAIkv0mIKxGvRD1JfJV5ESAvBfRfA9Z847XN6gBIfZDVcwlrHeN1PMbN79of9t1F0H755bQwBVvWZoHNApsF3lwLXDtBuY9+kjVQsioxheR5N7k6AbhLjAOAUwA4Abxr7EvjPAngnWdIqCRSInlzxAkgue1IsjqCS2FWV0KeRL3aIu1RHQZZb0m2H1A9O52WiL92OIY6Upwz7JunACT/3vlP8s+/ecQJwHzy/D9lKM/8OW/OF3qgL+NJu6T97rMmr63upb/5PvQdH/u8TgDuhEv+If5V1hkAQnoNEmIJ8mMS/q6vStrR07FA/hknqGwcxAnA4xGf/uSvvPitv/1v9mPs+jANJwHtUIf97qXnZ2V7uX9Omf11xmfyym62YpsF3mwLdB8gSewdB8Aw005SnYRYkixWwi6R75CXAvIogP8asCtDWrZpP2Lqon4dSt6zPDLtiLYJLjkasn3sEkHbVbuOItu1WWCzwGaBzQJpgWsjJA+hj+QtSa+kVEKpE4A7/BB9j47rBCDuy+NmJwEkkzMngCS2I7sdcYaESkYl2GKWz/Ysn+R1RuIl7pbVUTIrn+nUsX6n00y/1HWtrN1A5wsbVwcA88LcMU/MF3f8If+EvPuPAyfv/t/cOmvQR70Zk3Zh3K4hkXWK/BDr9THbzO+CS8kzJwCkea0joJJuCfJD45p+dVCAOi3EdAzoEPjRv/KpF5wCwAHQnQLIMZHPIxS8WPFS87GynbpnJu5+eg129Vd2vRXbLPDmWIAPSl7G8wOUH7jdKHwIkt8k0kmcJc9J2mfEnnReBshJAP81YJbNNiohp5/UQb2OYdZRrvqjA48k1HTLg9lP2mfI2i7tOZK3a7PAZoHNApsF0gKPSTaeoi9JmsQNMidxhexB+pJU+iw5RJK7yDgAdAJwEoA0jpDzXgCIJA6DfBzgPk6AJKAS0URIacY7Am2+BD1Je5W1QxLdWqbGbde6VSf67/QyrZJ5Sf1avBlknQD5x9acvmDOmAcdAM6b5J+7/8xdPfqvo0adtJ3kP+3i+klkPef6eor1fd8+87vggvI7/M8AnAbw3wNCjiHFkmTREwAiZDpJNgTZeJLla5Z1Djjmj7zvY4dTAOTNdGfs2Oyd73zXN11wPo415V6Zcsruo8HdkZBlrZ84qm/XZoHNAjML5IdFOT9Uu1FxH5L4JiFOslyJu/Ek9ynzGADvBKjvAbCemH0gZ/+p10zO8sq1TeLogUOiy7MeaD/a5ha1m3YEt2uzwGaBzQKbBYoF7ksgnkv9JG6QWgmshBUSeHNLLHUCQCi5m8xjADoBuLMMweTlgBBKTwPMnABJMivJlRTPUELaYa0jiSWd8klik8hK6EnTBpQ1vUPLVqQeIfWrehFXtzr+Y3HmwzLIhkr+Pf6PU4b5gux791/yz3zlc/85L9qs2q3aIteQ8lvhBEhZxwBp1xzK18FFo5BYHwfIFwPiBPAkQOKSA0DCXMlzjVtuLd63PnfsCfQHeZ/1y6MAnALI8rUseTw2gLNgTAT72Me43B+7X3b/DO4I7rNnaLlbtL7tJY4i27VZYLMAFvCDl3J+WJD9MB0+jCPtzgcyCXElzBJ3UMKfsmkgDgAcAVkn5dp29jv7YqjpWQe5tkl/pPFogg4A07JstmMf2OU2aLO05cjars0CmwU2C2wWSAtcMzm5tG6SNhByJwGG+ElUbwbR9M4ypB7SCNGHVM6cAP6XAO5C4zwg+F4ATwTQLkFC22FHnmuaumZ6tkV6JbIS9yS0OXadBdpEpEzKtmPdJP+pj3LqVWXtsQYh6wbnRjtD/pkjTmxA8nHQME84AAjMG+k4ajz235F/nRk5xrRXrh3ltwa5R05Efk4hvwseQmb/5r8IPHYSgLvlMyeARF2s5Pkh4sf6Ih/SztH+L3/pT198/jP/y9QJQB52wAmA3OmrA+Db3/3n/8FDzMWkzdwnu3fejbIHnpH7bfftNW3lPty+JqpsyZsF3lwL+OFI9AMp7oZ59sEPHJgfxiTKyEnilZP4I5POXXecALwPwHJibTP7Sz2OydajPeRs175AHBHok2lZ1nZA+9Qut6i90pYja7s2C2wW2CywWUALPCeycgldJW+g5FYiC3GFqEIQk2hCMn22nNMA/ncA7jZ7EoB8SGa+IBAngI4ACezNCkeAZFkiPUPLVaS8TgDJfRJbZcdtGe1hfoeUNdDHMYdE6ubYl1A7JTIXOR+e0Mhj/zhpIP/MDS9wJBD32D91aIO+0Ukbzex0jPznOnrrGTsC/B54YPxa3wuQToB8BEDyv+QAkJCLHYk2zTKi6SLpszzLrEHu+kP+uXjkBBLfnQQgnTH+hfd+8MWnPv6Fw6mB7EMHALZ64Pmw+dwfI7Nv3hGSV+TeO/fkyOa5J2/2491ePPsd3d25GUp8uzYLvJEW4IPBlR8QP0CHD+fI3xH8sOWHtRJrPqD1Q1vjOgG4644TIO++54ectvygi6mDelXdLGOdqmPqgy4/86lP/VfVATDTw7bB6F+bpR1H9nZtFtgssFlgs4AWgLy8aSHJm6RXMgwxhCB2TgAIvqcBIJo+CoATAAcAJwHSCeBjAXkiQGILETUkSZ7J6iXOypmexFaCXwm9Y57lZ3nKZOjIv30nOkaR8SNrh0SJvmRfB4p3+5P4c9cfe2N3yT93+5kXTgAwN+R5KqMj/44nx5nEXznXi/Jbz5j0o7vB74HHwHQCSPjrOwFwAKQTADItWRchzZW8E6fssWBdSDjH7TuynqT8mKxOOAEItt/Vg+B7CgC5liENezyiA4Bpd4/snvkV8u/+vN44NG5+8gP35aP93W2wfdA+xZG0OQEwwna9mRbgg+DlhyIxPzy7UfAQ/KCBM4I9cwJI/P0Agxy/58WAyNSrIfvIvlMn5cxf0i/7h/j/6q/+6uc7B0DVSV3sx34Haq+04Ujers0CmwU2C2wW0AISgTcNJXKgTgCIoHe0IbE3t0QV8gj5hNBDKCGWvhuAu8zIkFCdAJBTXxDI6YHOESDZlQDTV4Yk0Wtk61rWO9ySXDCJrukS+cxDzvKWFa1DHzOHhPqIjlN0/KJkH0zCj+2wIXbHpjhYIP6Sf2zPHHj3P4/8U4/26BO7VJvkmCX7ousi18lMfiucAcjPKfg98FjoewHqSQBIvycCdA6kI0CiLUqeJf7EOVr/Dz//B4cXd3oSBIcQ6R7Rp33I/0/80M/vCXdHxm1/DapD1a3WpX//LeCsTxwSj+gAcH/sfrkl/xJ99uQ1MJ8Ey+Qenf35wt68cwSoD7hdmwXeSAu4+PPDgOyHFNxl8EMmIRYreU+ivSTrGKj1bTc/2PSduqSsXmLWt+2qh/+akC+a/FKxnPVA27P96FtbpQ1H9uZlxAjbtVlgs8BmASzwnMjKpXVNQifxk/xCciGNN+EEkJxCLD0NIPn0FIBOAPIhrToA0gkAwZXwSoAlxon0XYM61fSMLzkBJPGgzg6QeBLiLKcs8bdekn/6r7rlWJAdq2MXtYdOlkr6cahI/LEvzhbszV1+7O+df5wB5OMooC36U68Z+XfeE3NddPJbz4zkL+n7RN+C74DkphOgngTQCZB39CXYInnIkHte9vhvX/zJi2MBpwDk+6c/9ndf8O/5IOSVqD9UnH6XHADkM+5vee+3fvqB54V9MZf7Y/fLBwcA+2v23OzBJf2cDO7C173rPe8lrHEEFL5gv6L6VHyp7fZ3s8AbYoH6ASDuh0TcjbRDkARLisUkzMqS6SW0rGh7oH2JqUeVLZP1bROsOvAOgt//gz/4SjoAdEhY1vrZJv2UvrVT2nIU2a7NApsFNgtsFsACS+TgTcmT5EkC0wkgyZXAJmmF4HMn2rvQElDvUIPVEQAxzUB7xG1XklzJM/GbxiEwS4OMS3ol+BJ5UDJvGfMcu/Esm8Rfu5xD+nP8yBD+JP0S/iXSr+PF9zHgFKBe3vXHNmkHxqKTw7kWXQMz5LNA3hKS99zCU34Lfv173vOhdAJAfg2eCOhOAegUOIX4V8cAdSHjP/LBv7bvc3ZH/pLOAE4A4HSoLwLUoaGDALs80ry4N2avPCX/kHuJPzfoPvrvfeD7DcQJ5K9xBFT+QL+3wf06qF5DvCMT367NAq+tBVj4Xsp+GMD8kOw/tCNtR5Bog0mMkSXMHUqqwS6ftNpe9mX/M7RstpH92L8knxcAdg4A86uetms/oYe2SvuN7O3aLLBZYLPAZgEs8NwIy0PoW0kfpFCiCGmU7N4MQlkdARBXHwvgjjTBxwEgsBl8QaCnAiS/EmLaQtYZAKZDALlzDNQ09IT4JvmV8OsMqGTe9CT+a8l/7d+4uuvkyHFK+LFFHu/HXtzF904/ttTBknf7Jf6cBMDRQhu0r420QTo4nNO1pH9G+B9iDT5Vm1fwLbj77u96/y9wJN9/D5jkPx0AEn8QAl9J/alx2uCZfBwB6QBAzoATwPh9HAK0gQOAsSJL/EHaJf0R/wNA7ov3XELuwP6cfbZ3/yH3lfjrAEikzLvf/Z73zxwBuXev+3b6Hmtxdxu6vTv6cokvY9vfzQKvmQVygSPX4IdD3I0y+yAJ9oPshwxM0n2KnG0gZx/2u4SWz3bsX/Lvlw3ICwD/+I//+H+sJwDSAbD0RRK6aJ+038jers0CmwU2C2wWwAJPRTyusd90BEgSvSMuYb65dQJAciGbklsILQQf4to5Arg7bYDkUhbSCgHuQucM0DEgsRYl3InoueQEcDwQ5CTJ6QCgTAbL2m7aQnuok7bRPpBzxiTxl/R7tx8SL+mH1Ev6Pd7vy/14nhtHQBJ/2qQfdMhxqztjYh6d05znlN966+27/MgGHQGzuOnPEa/lW5A9HY8FQIIh/XtyDN6GJP+sBcn+2qP/lk/kzf2f+8XPv/hL7x3/6nOcPpDkI+MU+IkP/NL+bj2fT+7a89gAd/Epd6ojgDo4ONLZIPGX/OOM4Bj9I86Je2P2yndOAEj+IfNryH86ApCrIyAfD8i9PFxAbiBXQJfb0O3h0Xm7Ngu8MRZwwfthBf1g7D+4I74z+CEC/WAlSr7XYNZDzrbt7xhaJ9uyb770DX4p8F8IZg4Ay6QDwC8Q+wl9tFHabWRvHkSMsF2bBTYLbBZ4jqTloXSW6EkKJYzeOfaOOAT4JhwBkl9Jro4ASCpk1UcDIP46ASS+plGnBh0EOgO8gw7OnAES8EqGJe8V85TAjPxnnST/2MD+EtVNfZP0HyP+OE8k/ZB9As9tS/y1JfaT+NM3uhAcDzrjADhG/t96622ir5zrwLTXFa/tG5D9HI6APA2QTgDu2v/zf/mV/TP/YBL6c+VPf/JXXnzv+39uT865Q08gjbX2m1/47Is/+he/vUfW7ge/7a/unQU4AtY6ASD/ODAg/yD1dGjgbMDp8eP/wadeQLYfcT5yX7znEXIG9tdLDoAf/d/+n3++C9UJ8A3/zgc/nI4AxocjwEAf7unlBPIEdBm22N2Gbi+P/tu1WeC1tUAu8PywKvuh2H94hxV2BsmwH2g/VKIfthlaLjHbLB9O+1Uf43u0XrZlv0n+/TL49d/4jd9OB0A9CWCddALYdtFLfbSXOMy0XZsFNgtsFtgs8LoSm/uMSweAmI4AnQAQzGOOAAgDBJ9j7J4KwCnAnW7fD0C+d7/BGsjP0wKQ3iWHAORbMn4TpDiJsYReMg96t7zDWp52cTDo+JDwix3xZww6PRyjd/y92+9dft/eLvHHdtqNNrgjqxNEPdDJ8VTy791/51OCf5818rrUvdZvQPaIP/iBn/lyJf//7J/9s/8PQSfAuaS/1uMz+pH3feyrrDMdC5wQyIs6n/1b/+WL7/nGj+7J/JrTAJB/TxTsnRrjuD9IgPhzygDyD1F+pLlgH+zlnnjPIdg/s5fWAQBRr8f/O+Jf0zpHgM6AmUNAR4D7+m1P7xRtuFng7bvWfmBBCa64G2mHIPEW/UCdg7YBZh8hq4P4ih7Z75ID4Le++MXfSQeAjoFEnQC2Y9vqeauXuqTNkLdrs8Bmgc0CmwWGBV4XInPpcSRZRE4nQH0sAOJ5MyHFEFUIK84AiK+nAiS1EA+DhJgypoE6DCC/x5wBknCcAB05liRXlDSnA0DiD1recepksL8k/XnHv5J+bMB4GKPEP+/4S/pxBmgjylfi7/jQh4B+OYalO/9vvfXqXf83Ne3avwTZ933kwx/9DEf1WRM6ADj6n8f/U67kfm1c4r9UHocAJwJwFnBqYOYEgPgTPvXxL7z4qY/+3J7sS/oh/rz8EOJPeMSX/uV0576YvfL0EYAk9JL9X7j53H9Tg3li1lPGEWDAGZAOgXxMYIUjIPXf9vU5s5v8WlqgLnjiklxxN9IOQUIsSpRFCDRyRfNB64LZdsj2XfGOHtmmxF0iL7nnbj8vAMQBgOeR9HoCgDTr2Y5tq2vRrdptZG/XZoHNApsFNgu8qcRn7bjPdQRIkEFIsgQZRwBkFlILAYbkQoAJyF2gHAHSvNYZIDHviHKS+ZsgzxLoJP4z8p9j8lSCjg7HKNlPZ4ZjqS/0k/iTnsQfh0fe8deuODdS9zzu7x1/nTY5h2vn/U0p91y+Adnr/ciP/sjPsz54HOTSJwAg/VxL5N88ytE/65JHAiD6PhIg8eeI/6d+7DOvkP8k/jzqwLiecA7cG7N3f8UBsHQCoJL/jOsASNQBkKgjwNMB+fJAnQHpCCj7e/mGYwC3a7PAa2WBXNTKueCR/SCIu5F2CH5oRMnyMbS8mG2GbJ8d7nWwfvYncZfIpwMA8o+XFwcA5N9gmc4BQHu0b1+Nfmmzkb1dmwU2C2wW+P+z9zdA+31nXR8aZzp/e3JM3QhWMsZWxIEoxxkdDo6CqeEIoTSn0DlgQHooSSQmhESI5MRAbCUm5sU2o4b5EwphCEk0SiaHGDiKCAYPhHoaYNqKCK2U0h616rGdjqZ1puT/nPXZv/tz5/tcv7X3ve/nuZ/3tWfW873W+9rXernX99pr72do4KEQncvcZxLIPA0AwazfB5AwP7cRa4/IS1ol5RgDIM2+IpAnA3waztPO6ojzmwIaA/yGAGXhICX5igB1agSQNNO26nyCfgz5zyf99Yg/pN+n/JB+2o3zHrw3yJzGD9KRD30k8Udf3gPttq2eVvBpfxL/7LNf9avGE/8lHdzBFfAJ/lX0Bz/4wQ9veWIvaT81YgTgYg787mc/5yleVcAIwHF/vyPgvzjkyT+yx/0h/hDcG9C9HMKq3Rezf3/MAMDeu34EUFKfhP99X/Rf/Gz6lU3bw9/7jNe9/pAxAB0tGQJo787JPbyXeo8t2biGBu6HBhzcOdiRnQTzRG7+KZ3EuGKScuWaBn+WFXLW2ZP3baAMywch7JJ/UHIP6ccA8M8/9rGP8+VRwnsGgJ4RgHJte6eNqa8WPa6hgaGBoYGhgSViMMIfJ41JKg8ZAiCnS8aAagiAtHtUPk8GeOTZ484iT8uJ0xggaU5jQBoCNAJIon01QHzuziDgyYCKxGvM0HhB+T7pp17ajYP08wRfsi/RFyH8kn7brzEDHUD8NWDYbg0XSfwPkX77aozjx8dx6uQur4Ds99gn8uHomzAGYADAsMA4xQjAV/x5NQAH4Zf0Q/yJ498d3hDxX+vm5A+zEcD9OftsDADsyyXrknlJvogRQGdYovl6iDFA1zsVUI0A+cCv3djUnPwj9/nI4xoauHcacGDXwe4kEKd253snOT4Ws4yQrUO0LfrBc3VrAGDyusAk+Wex0QDAwvqa17zmjx9rANAIEHXbHtun7lqScQ0NDA0MDTxsDSQZGPI6WYJUoiPJpehR83oioH4wEAL73CDTEAdfDZBQQ4Al1BBjSHIaAjCO6zAIaAzIY/M8QacMn6InoaZOibUnEzQM0LbqJP621XZC1vOIv0/5aStt0nGaT1niX9tKWT2DxVbij97tC5F+Gu6wDu7R6vcED4vYN17X6QCNDm9/xx+fx9rn/Y7fMRN9yP4XftoLfvKZn/Qbn+Qdd/a5Tc+3ae9pW3JfPO/Z4Qc+pHP/vfUUgAYAMQ0AVe4ZAgg7xhAw9vv3aPaOWzlKAzlxlSW7iVMr9Zw7xgBQ8+78WT6y9YvG7+t1UXFhWTMAsGHAAPCWt7zlrS5AvVMAniDQoEDZGxcE2jmuoYGhgaGBB6+BQZIOk6SejiSaiT1DgB8MTGNAngx4bscg4NH6JNlJsPmN1AggYgxYIthpCNAYgOFBY4CoISBR4k8+n/hD/D3iD5nnCD910wbbA2qgqEf8OSnAvVEe5dom6qJudIKrT/x96p96Tv0j9/pqhC2P8Xu8AD6dB0oYBDghwIf7jnkNgD0o6StmGRgA+K8AEH/I/md+1m97DQ7Sf8f0yp54v293n+4DunoKgNMAEniJvaR/CU23hJYnVkNA/Vggbcu9Pxyj3cMU9yEfEVvUuIYG7q4GGMheyg5u0UksTi1D160ZApbytHDLFa030bh9vdblwrLFAMCiPQwATePjGhoYGhgauCINDHK0TI626KYSUP1JUvM7AZBYjQH1NYHnLhgDKvFeI90QbwwEPIn3iD2E2xMBlMXTdp+4S8Al4RoGPJlAeK3fkwkQe57uJ+mX+KcxAmNBtsG6rUODA/fv6wcYSfywn8R/6R1/db6lv0aa8+P9ipaVW1kspPGYEwIQfAwHf+e/aadwivued/+5//oVr3r5z0D8282y572rV927d78FgDHl0KsAS+R/KbxnDNAA8PnPeMd3awQAfTVAQ0B9LWDjw7+72kej3UMDixrICYwsAU+cWvhlXZanXOuu9c91XsQAwL8D9Ml/IkYBXZ4CYAHYuAjQxnENDQwNDA08eA0MQnSeEG3VR+9ps0Q0MQ0ByBoDPBngh+w8FbD0mgBEHOIMGfcVga2nAjAEQNrzWwGUwVN4TgfgKLc6wknnE/9a39oTf9JSXxoeqpGhEn90kMQ/daUeU7fKW/tspHt8rD/UBZC9ImQSx3cE+LDgc5/zBX/i9zznc9+mw6+TeLLnJG/T233aR7qPd1+/NwJwvz6IwwCArur3ACDtknnJ/vu/6p/8SjrDl/B1n/mRn05HmRgBTmQI8P7Ehzrsx33fEw24+CQ6uEEncuLUwrsujs9041u+LEc566uyaebyLmIA4CkGi80S+WdRWjIAxP3Yjtq+dkvjGhoYGhgaeNgaGKTocVJ0WZ1ATClDgpookU1jwNqpgHwH3+P4GAIk5/nhvd63AiDp/JbmE3nJOXlxvstf/RB40h5z4iA/6IdBAdIv8af93E++2+8x/0H8Tz8Ot4zjh736jbvfaSD3x+yZ9wYAT+umEUADQO9VAAwBkvw0ACg/+Xm/9L8aXzENAMoaAdIQME4DjHE7NPAJDeTkTVnymzi1bMe6zK+c9fRk0811HWMA4L8AzC9etT/1Q4AYA3z6Xw0ALFSeAAgDAPXTltrGFjSuoYGhgaGBh62BLSRhpDmenK0ZATQIaAzwSXcaAtZOBKQhAJJdn9BD9iH9+YReQwBH9jEUcHyfkwE4CL7OMOL9oB9l9Y75WxZ5PV1QP+iXT/mfW474J+nPY/7oQ92A6kt0PKpj/QOPH6cPe/Ubdx8ayD0ye+auEYDvAeDWjAASe0k/+Fe/8FfO0o8hQGOAaD7Jv/hFv+b7/+oJDQF5n8jjGhq48xpwINfBLRGvOLU7PuRqHv21jp7ftHMdaQCApGtV9HiRpJ4jRmkAuMh3AKwr7s+2ZDtb9LiGBoYGhgYetgYGaTqeNF1EZ5JVSawo0fWVAIjwodcCINW+P19fC+AJPIQcIp+GAAwAW10l++nHGKABwZMEGCA4kUBb/IZAEv98r1/S7/v9Gj9E9bFG/C+i/5GnP84vsPqxjxrXNg1M86sD7TsBz/yUZ30Ex7h2LCIb7n8MaMVO24q+klTukd0zP2YE4N37Yz4KmKS/GgG++/f9z2caAipK/hPTEOD3ATwNANIu2oeDWyw8FPTevNcxnq9kKI1Cr1sDOaBTdsCv4dQaS7y4lDbLXZPNT3nzIgIxh/yvGQB4wv93f+7nfsETAMgYBZZeA8hXABYme96P7W1Nulfvb3E/4xoaGBoYGjhaA25GB/YJ0in10jMCSHglwPUUgCcBntuenuPylQDINsfrOQXAk3e/DcDT+DQEQNhxGAR4au/pAA0CSfBTNt4n/Z4WoHxeF8gv+Uv8e8f7NWh4b2tP+5eIf+rulH3y0Ms6esEYGQ5qYCbJjfQztn7vr3rW2df/mn/jV/7cr/n1Zz/8f/gNZ//gV33yOUcYcaQhLXkwBlDGwYquJoH75P0e3r27D+7m+7vASQAMALrvfd7/foZbMwJgFEgDADJGgDVDgN9qoI2eEk5u0FQ27Rz3572KLWhcQwN3RwMMXC9lB3Oik/mymGWmTBvSbz1TCz/KAMDH/zQAgPU1AE8LOLm19DnJfQ2AenfOtmT7WtS4hgaGBoYGHrYGHjoBuon79+k/uNUA4McBn7szAvAaQH0VgKfwGgJ8r19jAAYB3+f3hACEnqP+1fkaAOnIQ15Jvx/142m/7/bXp/31KX8l/Bg7vG8xdZLyTfTPQ6rzYa9+p717ib+kv0f4qwGg+smjMeCGDAG5T3bvfO4kAHtvjQAQbl8H8Av+fhTQI/31FABGAA0A4ps/+188VU8B6K9GgEOGgCONANxj3vNpB8UobWjgGjXAQObKAZ2yE/oimOUoL9Vl+VNL0DUAaE1MQo/8wQ9+8MNpAMAgkKcAMn3vBMAwANAl4xoaGBoYGjisgYdEdm7DvUJuaYckVwJcTwBAmnlyDpnOUwB+RA/SrQHAkwAQcoi5rwVoEMAokIYBjAPp/PifaBxkn3yUwymDJP3UnU/7D5F+71P0/pfQvlJf+gee9qRKXSHYX0GgwBo3/Msa+MzP+m2vgfjzNL+S+ov6KYsyKXu55iuLcY+/38vXkwCMkfpNAI0AS/8VoEf+PQmAEUAn+a9YjQEnOA3g/Xm/4pUpdhQ8NHCVGmAAczmQe+ig34K9/DXM+kTLnVrA7Fw8fAVAAwAkPkn9W97ylremAQD5h3/kR36a/wiQ6ZCHAQB1j2toYGhgaOBiGhiE6rSEaos+K+mVFFcjQDUAeAogjQAaAvJEAAYBHUaBJaexIDHTWgZo+UtP+z3e7z14T2K9555/i+5GmtOO11w1IP5vet13nL3mpW+eXzfBn/FDflwD7GMZkzy1v8gT/0PGAU8EUAd1Pd6CKwvJPf5+P+8+3v17ngTgPfzefwaoJwF86p8I8cevAUBMA8Cbfss/nr8ZAKYh4NBrAX4bQM5A2w88KESp3P+4hgbupAacvDReuYdO7CXs5THMskXDRcqcdC4chwwA/D9W3j2sRgA+DsjrAPmfAIYBANWPa2hgaGBo4GIaGITqtITqGH0mCZYoS6Al1L4/nycBNAQ8d/c6QDUIaBQAlSXwW9G8ll2f9vvE33bSbu8BzHvryeiJ8J6+lsJ7aUfY5cZvrBpP/+YXfdvPvvcDf/8MhyGIsbd7+syeblxFA5Bfxuopn/ovGQSog7qoszTjqr25n5/39O7le0aA+jpA/ltAyDzv/Cfxr7LEfwkh/+m+/Nf+8j/5d5/xU/8lLg0B9SOB+VoAvIG247gXXFPi1Jw8yHse4/6qR9co/2QaqIM1B/FVyt6A9VuXk2lqCfbvEB0yAEDweeJfDQD4+UARhgBeC8AYMAwAqn7g0MDQwNDA8RoYBOpyBOoi+pPggumSQGsIACXZ1RjgqwF+ZT8NA89txoHLuixXA4RtoE220XbnvfRkdUWcstgLM27g1Y1RVwyejj75p95/9oM/+kt7x8kQ+pkv1RNv2oFPe9p1kn+NAjdkBHA/D+739FdhBFgi/b1wjACv+c3/0+wwAlRDgP82MA0BaQTYcBog73sM+aGBO6MBBm5e+nNAX0am7CzTumqZ+8WiJTj3HQCtbxJ4JmM6yH3PAGAYRgC+C2B+y8O4cOBoj220zQOHBoYGhgYerAYGubo6crVVt5UsS6hFiXYaAyBmknFQgr6GEHqNBolLebJ8jRC2xbaBtf3p36qDke5mxqELH+ToyTd/ZE/+NQTwSgDjg7FwQ++i28Rbg+w3GePX8eRf8i9qBKAN16wQ984ge/v9Qz3awl48XwfgJADk2w8CehIgj/Tn039Ifu8VAEm+WI0BhoPVCOD3AdIIcOjfBXJfOyd/yftuUeMaGrgbGmDgcjmAUzbssjhXEH+yPCfQ1OLPGQAucwoAIwDfCZD8gyxAOMl/HOmhbtuRbWvB4xoaGBoYGnjYGhjE62aIV+odMoE/ibNyEm1kCXii5LwipE1DQY3TfyhN1oOc7bGNiXlfysQrD7z58ZZ94Or33Od8wZ9457f//GMGAAwBb3vfX5k/+MiY4TQA+yzzPUREfzdB/tMIQBtuQPe5h141AvS+B8B7+3wPQCNAkv4e+U+yD8H/6k/9lx/HSfqN168RoBoC8jQA7cLlaQC5RHKIptupucEdbmCQjSqvRgNOXkpH5jLsEJo2EdmrV56TZ2qJjjIAcBqAbwH83Z/7uV/wqb/IfwngNQEnrQYAfpSGAcDuGDg0MDQwNHBYA0kGhnw7yFkS6p6cJLzKlbBfxF/L1N9ri2E5dghL/5Bvx7jq9YMrxJoBACPAe972/fP3JDAYYQRYeRfdvaBF3yvkFAQf/JOM3xTShhs6kZFc4TEjAHt3TwL0jAB+EDCNABL5JZT49zDJf8rVCHDoNADtTi4RDxHlMXnf92pMj5t5WBrIgexiXcP0o5kqq63M2wtz4kwtcna+NwRR96m9RD5fAVDmy//vfd/7/hKGAN77/7Ynn/zePPrvhNVyNwwAdsPAoYGhgaGBwxrokYIRdrsIm4Rasr0FIe2kk7wfQtNatvn1V2SMEJZjpfozbsi3a0zZH64QGADe851//9wJgB/70EfPfuTFb3zqb33W5/5Lv3APft7v+B3zKwH8n/odUXqae7VW3mSZ9w0htvxbPnVxU+SfemkDbVkxxFyl+uUE4KIRgKfsGAF8FYDXAXqnANaIv3GQf+SeEYCwJP/KGAGqIWDLaQD5RBgBpt19cq957807rqGBu6EBCXttreE9rGE1b/WTPt28OLSwCceEOtYIwNN+SD9Ow4BGg2EAaFod19DA0MDQwAU1IBEYeDsJ2lq/SLgrOb8KP+2wvrU2jbi7NY5cNr7k+V/23WkA+NC7PnwG8ZdscuQdB/HE8QT6uc/9/Pk0wGc8+9lfiwEAZ3n3ETF43OTR/2pwoC206YZ0/dg+3709BJq9OsaJagTgWwDHGgHWyP/nfdLHHzMKYADQKNAzAvROA+QrAbRdbuFDxabjqTkfaua935D6R7VDA4c1wECtl2FixhsmZhzyUrhxxoM4J8zU5IMGACadJH8Je+Rfi12ZrHOd0QbbZBtb1LiGBoYGhgYergYGYbtbhI3+uigRN98hPFSH+cfYuXtjp/aZKx8nAN79Z35qfwLAp/4Q/fz2AzJhGAE4HfCal755/i4FrwWwN7O8+4Y+/a8k/JCfp/RV5+kn/jJGhRs8BUAX5556ftinEcC9/DN/07Of56sAngTAALBmBEjCnycACL+I+6Z/7R/OHwjsnQZY+kDgMALctxk87qenAcmwWNMYLi7FZzhpdecMAC18NgJA1HEQd10S+y3kn/TmtTxPGFBPONtgm5bupWUZ19DA0MDQwMPRQG5Gh3z3CV3tw0HW71+f1j6+jN+Vjqf4b3/135wNABB7n/IvvTqiEYDXBPhIIP8pgLG2eyJ97/ZY3Bf3fIjw1/hDBgD7jnTovOY/5KdNN3gKgOGT++pVI4Bk21cBMAKsfQvAJ/mHSL+nAEDlXp5DpwEwVODyNIA8o/NwcfAKF4+B90oDLt5i7+a2xJHGSTI1eXaSdEm7JD4NAMjVCFDjzQdalmVbV0PrB2mPronjGhoYGhgaeNgacAM6cBDFMQYe3hhw9eMJ91te+YEzjv5DRHkqvUT+CffJNcYCPhL43g/8/bOve9nLHhkB2mkAnvxa9j3AiblxEYK+1QBA+RcxMNAm8jYdTzesZ/fW7LX3D/rYtzO2PAngKYA0AmgI8Gm/7/BD4tfe+69kX/9FDAF8G0ADhYYA2kzbx2mAGx5Zo/o7pQEXAjAJ+NT8j70GAHmXzFeSv+Q3fZJ/LXQYAahn56w/26TckoxraGBoYGjg4WpgkL6HR/pGn48+dwzEyjd984u+7Wd9+g9xXTMAEAdh5VUBDAC6N73uO85+52c+e38agD1a1HEnRZ4Io49DT+N78WkAqEf98dcTOr0yDoVRB228Bcp1b703AtD/GgFoI+Qaog3h5l18XweoJwG2Pv3HSJCEX7liPRHQOw3Q+0DgkUYAugAdjGto4MFqwAmQi8G8IDSNTDif1PvkPgn9Euk3PNMiW4ZlWscOewaAFjWuoYGhgaGBoQGJwMBBCscYeHhjIFdAPgSoAeAQ+fcUAE+gOTWgASBPA/jtAI6os3/Luu6SfNHj/xD3NQMA8RgBct4dIvu9+FvwGkB2Z+77570++3SeovM0/ZAR4E2/5R+feRKgkvaeH6JvuHLiRQ0BeRqANmsIYBzLO+Jh4+AZOQKG/KA14AIgOjmmppXZSdYl7yCTSifZr2i8mPkt0zp2aN22RWzR4xoaGBoYGnjYGsjN55AfHgEcff6w+zxXP18DePszv/zj1QAgma/hGADe87bvP2cA0BiAYeCFL/ya/UkCiDR1ZJ13QeYDh/XpfY+I98KOMQCQtlfGoTDaRhtvkS7dZ7P/vhYjwBrpr0YA02o48DSAHwn0vwT4WkDvlQA4CPxjxQhwi7pjNGVo4Ho1wALABUrC58Wg+SechD1JvMR+K5rXsmIyznW0eqzbBcl2tahxDQ0MDQwNPGwNDAL4sAng6P+H3f9l9XuC1wDe9KJ370l7JfzpxygA+fQ7ABL/inwk8N9+3vPm4+5+KLCcCJh8QsyTVvZ1rV3uHec9G2GkKe29Fi/k+iLv/0Pc1wwA9en/Resg3y0zANAv7rnnfT/9x76ePqSP104CcArAkwBLrwJI4kXIvEQ/ZcOWUCMAqCHg333GT/2XGAE0BHAa4AgjgPc9j9trGaCjkqGBW6aBnATIEvGpybOTtEviXSCS/HvcRjQu8yBblmXv0DrB2p4WNK6hgaGBoYGHrYFBAB82ARz9/7D7v65+kDM+BvgFn/38mbAn4U+Zr/7/6R/92zP5P2QA0CDw5J96/2wIoByMB54IYP8GIeRfEb70JS9/P4ijLa19T0Aaf89zPvdtN3V6gPYeegq/FJ8GgKW5xhH+i5J/66WNtS9vgd99d9cIIKnufRMAAwDkv/cRQEl/YpWXCP9SuIaANAJoCPAkgIYAxipjkXEJJ5GDNH1PzVW+cQu6YTRhaOB6NcDE58oFYF4EWtikk7gnoZfkLyFpnXROPMux3B1Sn8522K4WNa6hgaGBoYGHrYGlTekIf9jEcPT/w+j/3uoH+f7WF//ZmaRL1sF0GgC+7xc/9pROon8IORHAqwGf8em/dTYy/FvP+/z3fO0XvfrDGB7e+vJ3nHECAYRo8fAHZK/Xa+t1hDEXJNrH4hYDAGku+oqB7aGN16GLC9Th3nve/7t/9yTAkhEA8q0RIE8BSPR9yn8Ilwh/L1wjAJiGgN5pAMYkBqoNRoALqGxkGRq4+xpw4oMS8XkRaP4JJ3EHWRjS9QwAGa9sGZa5w6wv24E8rqGBoYGhgaGBpoFB9B4G0Rv9PPq5NwYWFsGn8yT+pV/66qeS9Od3ADjKD4Hn6b8GAPAQ+c94/nUg/zXgt//2z5qNC3/oeS+eyT/GAAhWa5t7x4VmXk8wepNoH4tbDAD2y0X+DaDtoYzr0caFanEPfrQRAPKvk6BL3iv5N/yyaD1pBKinATBcVCMAXKRpZ2qO+/SemziuoYGHpQEGP5eTAJSUT03eOwl8zwggyV/CzJtlNtm6ciLalhY9rqGBoYGhgaEBN58DB0EcY+DhjYGlFZAn73wPAFIO2U9DgDLklqPr9b8AXMQQwDcCKPcznv3sr21tYt92ay7aJdE+FtMA0HvKD+nPeddLs6VO2nhrFNZviPvvp7vX5yHflpMAEPE8BSDxr0TfcLHGH+vvGQLqdwEwAvA6gK8pc2/t9qfmknv0NTJChwbusQac8GKS8qnd994lka9kP4/7Z1zmybJ2ctZl/WJLMq6hgaGBoYGhgdx8DvnhEcDR5w+7z9dWQIgNT+Nf/AV/bCbn1RAAWf1bn/W5/zKf6l9U5rUAXito7ZnW2rQhbnr573zRN0HINqTtJtmRuL0R4qo+AiixR6/OQwwGhm/FW/oRwJ5u3YOj24n9/CEjAE/ecRoB0hAAoT8V2V8zDqQhwPbwXQCcJwE0AnBP3Ftz3KP328RxDQ08LA0w+LmcBEnKpxa+d0nmkZPoV7mm3S3W+7JauVlPTkLb05KMa2hgaGBoYGjAjefAh00ER/8/zP7fsAI+wVNODAHP/5yvfMrj+ktP/y9qAOBVgFN8yZ7vF7zvz/3sGcRyw73NSdhjcvKAjxLSBj9QaH7CLvpk/tAJAEh+ngK4iAGAtp1Cd97vFWPygU1GAJ66awTAECAhXyPtp46zznwtwNMAG4wAV6zSUfzQwO3UgJNdTHI+tSbvXY/YpzFgKT7L2MlZh/UmtmTjGhoYGhgaGBoYxO9hEr/R76PfGQNHrIAThoAvef6Xffd/8KIX/j2+D8D7/7zHf1HSTz6/AwCB5SnqEe3pJuW1hfd/28+ffdVXfdVXdxO0B1IQfj7gloQf0o9x4yte8Adnl4SadBd9P3+LAeCyJwBoG21cuN/bGOx+fPPrALfBCOCJg0NGAIxPuweT+QDyNvbDaNPQwJVqgInOtZ/wTU6CPjX/3i2R/KXwzLuTs+ycfNbfko1raGBoYGhgaAANDCI4iOAYAw93DFxkFWQ/BoHmqTkGAUg3T/CffPNH5u8BQOr5LgCY7p3f/vNzOMf9+ZeAr3npm8+e/6Vf+oMYFlo73CtepEn7PP4HA04s0D7cZ37Wb3uNZB9iz6sGz33u589E/+te9rL5Q4S0ibZilPi6r3/5PyCPhXKvF3kyz9P9NQMAR/fz6T/z8CInDahjp0ObfBfQPTn79AudBLgNpwE4meBJAP5NIP3gfwYoRoC70CejjUMDJ9WAkzyxkvSp1XjOLRF+w2v68GfZWWdLcpofGAoa19DA0MDQwH3QwCB/D5f8jb4ffX+CNezpvG+fBgHIN07DAMYBHWHEQdQv857+Urs5RQCp//e+5Plnn/c7fsdMwCHIEO23P/PLP55Ef+nkwh/4mi/8mfIKwcRcgbBvfS/fdGkAODTfOAlgvq1Imyi36WNa0sktDnePfikjAIaAUx/5P1RevhKQRgBeB2AuYATgpMmuX7g/7nVcQwMPTgMO/JzsSdSnppGuk/CLS+l24VmmE846xZZ0XEMDQwNDA0MDaODQpnTED5I4xsD9HQNXvArun+xCqIMQXWW1T//hH/mRn37P275/JuwQ/9/5mc+ejQE8Xee1hSXi7ysJ+fTfhl70NYCtBgDI/0UMDHfw+L8qFd2bs2ffjxf/OwBP1CHVPF3no3s8ba+vA3gS4BBpP3X8ISMABi64S7sv+Yj3PHBo4N5rgInN5QRPrGR9auku42p5WVe2o1UzLHEoYVxDA0MDQwOD3N1fcjf6dvTtoTFwH1fA73nnO/86/50Acsy7/ekg2WtGAE4o7EjbOdVwsgAyv/XJvOkOGQCIv8ix/yz/FN9OOHez1+9xv941AmAAWDIC5McBr/skgAYAkLo9CYCxgvbSL7uTJFNT6TACXP+4GjXeAg0kAXeig5W0z5O/hU9Hul45WY9yK3ZcQwNDA0MDQwNq4BBBGPGDRI4xcH/HgOvAfULe+4dUJ/FHfm577/9Vr/qG2QDwfb/4se5JAF5NWNIFpwAuQ9Yl7adC2nLHPv63pFrC3afPPIDTIpDni5wEuC5DQBoAekYATi+MUwBrXT7iHooGnNwVe+R9akrZ6nr5ax3omLBxDQ0MDQwNDA2EBga5u7/kbvTt6NtDYyCWgnsj8gTfp/+f8em/dW8I+Lef97wzvgHwoR/4wbOeAYCn/7sntl1deArgIkf1T0X6LYc2cHrgHjz9T127d+8aAY45CQAhP/WR/yyvkn8NABgf/Chg5xTA4CHZ20N+MBpw4DvBE3skfl4AmnbEqck4/Ut5styUW9ZxDQ0MDQwNDA2kBg4RhBE/SOQYA/d3DORacJ9known+fc0AKSZ1wPqdwD4rwRbvqTP9wEwLkjEbwppQ+9bBfegD923z3v9ehJgqxFAQp6k/ZRyzwBgnbwKwPcKFgwA3N+4hgYenAac2D1cIvTHhPfKRck54VJ+cB0wbnhoYGhgaCA1MMjd/SV3o29H3x4aA7kW3DP56RDkagSAOGsA4F8V8rFAnvxvIf/qB53e5KsA1E0bbM89RPfyt9YIsMUAwLcA+I8A8R0A7+sedtm4paGBwxqQgDsREo8h+zVtllNlW0X4uIYGhgaGBoYGdho4RBBG/CCRYwzc3zFw3xdCniDzTQCMAV/4aS/4Sf4V4Ku+4vVP+e8Iv+T5X/bdx/47QggdX+2/CSMAdVL32qsK96RP3cffKSOAHwP0BMAwANyT0Thu41IaSPLtxF7CSu7X/EtlWJ94qcaPzEMDQwNDA/dRA4Pc3V9yN/p29O2hMXAf17Sle4KMvfQlL38/DgPAy3/ni76p98X/pfwZzrv3120EkPzfs/f+U61Vdn9/K40AeQoA4i/55xsAC/8JYPCR2sPD/+A04CRIdKL3sBoAemkyDIXiz6v6M27IQwNDA0MDD1IDhwjCiB8kcoyB+zsGHuSid6Kbvk4jwAMk//aSe/vHjADo/9hvAkDaT/ktgCT+/htAnv57/J/TJZxCaTdD+wcPsVcHPmgNOBGc3KdGlGuZD1rR4+aHBoYGhgaWNDDI3f0ld6NvR98eGgNL68II36YBjuKjY74tcBX/HYAyKZs6HsCx/yWlu5d/zAjAqY6tRgDIuh/qO4URIMm/X/73yT/flOBfGO76bGo3NgwAS707wh+EBpjE9TIs0cl+DFJullHrGf6hgaGBoYGhgaKBQwRhxA8SOcbA/R0DZTkY3gtqgG8M8B8GTvldAMqizHv6tf9jNS0fOIkRAAMABP4yhgDy16f+GCMwSnA6AfK/e8VkkP9je3ukv9cakKznTTrBCVM+hDWt5fXKN27g0MDQwNDA0EDTwCB395fcjb4dfXtoDIxF8HQagPTx7wch7Rc9EeATf8qgLMo8XQvvfEnygZMYAdIA8Cn/6n97dowxoJJ/iD9P/ekvjv13yP/gJHd++I0buAoN1ImhfwuaJtvVC8v4IQ8NDA0MDQwNNA0cIggjfpDIMQbu7xgYi+DpNaAhgHmjMYCn+b1XBAgjDoMBackziP9qn7C/x13aCACJ13kiAEMAYYnEaSAwPJ/8+9TfI/+7p/7Tro22t3nHNTQwNLCkgUHclzQzwocGhgaGBq5AA4Pc3V9yN/p29O2hMXAFS8oo8hMamHgqDKF/5qc86yO4T/3XP3Um+fQLsuGkIW3LOn0i+5AWNCCpPqkRQGOAmGSfMEi/znf+F8i/R/5t58JtjOChgaGBJQ1oEDiES/lH+NDA0MDQwNDA0MDQwNDA0MDQwNDA/dGA5PrkRgBJfkVIv8S/97G/8r6/vOX+aHzcydDA0MDQwNDA0MDQwNDA0MDQwNDA0MDQwNDADWngKCMA/54PAl+JvU/8xYxP0u+/95P8r3zsb5D/GxoQo9qhgaGBoYGhgaGBoYGHqQE3hRfFh6m1cddDA9evgUGUrl/n961G1/nuSQBeq+CYPqQdAq8RoGcISOKPvIX888G/X/frfuOzmlKn5jz6f990PO7nmjTggthDB/pDQNTd08E1dcOoZmhgaGBoYGjgFmug9/vgbyPN7sVvDV/Ke4vVMZo2NHCnNJBz9U41fDT21mnAsfR0juFDyPkKPx/l4yl9GgE0BEjuK+lPv2k0HPjkf/6uQyu389E/23HrFDQadD0a6G0cHBSXRe6gV/59Db+Mvno6IWxcQwNDA0MDQwN3UwP+/mXr/Z0gzPgebk2XZVe5lpt11rTDPzQwNLCsAedjnVP6l3OOmKGB8xrIsfTYSQD+K0PPCJCnAST7GgD0g6SD/KcBYOHf/Y0TAOf75V74XJASc8CtySgg8231Z5618u9rnHpKPRi2FY/RTa9MwsY1NDA0MDQwNHB7NFB/E2hZDeut/abLOMMqZhpl0nDhH9fQwNDAxTTg/HFeibW0TFfjhn9ooKcBxgwkfDYCcBqAkwAc05//NWN7as/rAL4S4GmAniFAA0B9+u9X/zUAcNogPv43DAC9XrnFYXWRcTFaQ26nl28pfK2sq45zMtwEXvW9HSp/qT+Wwi9SHmWNa2hgaOCaNcAP8Gc8+9lfe83VjupuTgOsz73L8C24loa4tXjqNj7lDCN8XEMDQwOPayDnCbKukqZMZym9MOMGDg2oAccUyLiajjECVEOA5B/06f8wAKjqu4UuIIk5WJS5q0yz5Df9qfEmiPpdqfPUus7ylvq5hmeelGs6/ON6wBrA8vzc53zBn+AdtAeshiu79X/reZ//ni/8tBf8JIaAK6tkFHzbNMCay7WGuS5vlQ+VuRafccjjGhoYGjivAecrocqge89pF25c855Lh58r4x+FjL9DA+c1wBjR7Y0APKnnJED9LkDvNEAl/nn8XwMA5fgBwN0JgKnVS33W3cRxXZcGXBgS7Yge0q5Mq7+X9jJhLnC3Aad2k1ftbsN92obL9NtSXsdJxWPSk3dc91QD/DB87Re9+sNvetG7z3Tf/KJv+1mMARgF7ultX+dtTX/wD33lR171Fa9/CvfSL331UxgDhm6vswuutS7WVq5E19saXv2mOxZ75WQYspftwp+y8QOHBh6qBnI+pIw+8LNXm3YOmbB0zTtfmTdl4wcODVQNOI7mMQZJz48D+kqA3wZIQ4CEP5F4XP0AIGW2iqfmknfUtgz/iTXgIpBoh2cY1fb8mbYn25mJUyvraMfA00KkfFFksJ3SsWl2UpwKKXPNLbX/ojq5aL6L9GXkyXGxRe6NsaWwVs247poG+GGoxP9b/v337o0AGgNIgzGAcXvX7vGm28va8R+86IV/7/Xf+OTZa1765jONABoC6IObbuOo/1o0wNrJtbSGHhNuOVsx6yYPl2GPfI/+GlYx0wx5aOAhaMA5wL0i69g7TTuHbLjp9beo+TIcT8qPYsffoYHzGnD87MeZPCdPA3BKU4K/hpJ/3/+H5+z2cVOrNsfv+VYM36IG7KAeotAtbmrpzrk1UlgJ6BJZZYAQB6bz6AfYcwyOizoG4nU4B/JVIfdg2fV+lsLX8tQytvi18JF2qT/W4mqeXl8bluMj5aWxRbgLUR2P6a/juI7z5t8yP5bS9OacYa3ocW3RAOOEJ/xJ9s/JL/nLsxEgwzQGfMnzv+y7hyFgi5af9jTmGk/7If9vet13nIFpANAIwGmAbSWOVHdAA6xHXIkp9+Jcw64C58aUP7antqUk23sz/T5wCEMD91ADdazrB3GTbvc76F7F+BbdNQoQPq6hgS0acCw5tubvArj/Zl+RXAF+0jMCyFtISx738LtxO7WGUL51bWnXvUrjjVdU6Ws4NU0QD86uEp8kRcpL5CoJGDKdla4Su/RXYmmngz3HR6gIB7e4z/ys3/Ya0oF30f2e53zu22x3yobdNax9oX9LX/bS9MYIYXVcpT/HX8o5ZpHruNZf54HzI7HOp1i09nOuzb21OVrj6jzX34p5GBd652k+xD7JvfK37Ig/ZL+GZRzxjKWHobWL3SVjWfIP8ddhCOidBHj+l37pD16sppHrlmiA9aReucYoXyfSnqxPfyKyF2m5Kj4Kvdq/1nm1tYzShwa2aSDnTcr7j7TFnoS9RqZxLBtmjYbrHzg0sKQBxw44c03GG/sK9nHyRPffuT9XNs69OPnKmM1xu9SOexOeClWuJGHJPzUtzBPfTkiyYqeg4HQSHjEJkp2TaMeJS+RsC4E/RGwlw+CS48kUcT3MMORTuWf90d/8A5Z1nTJ1Zn224TpRXVOncg8Ju4g7NCZ6BgLDHHO9Mel4TcxxnXLOAedFYs4f5DrPmH/pmJfhluZvDWf+c7kO6H8Ueg//coRf4i+5T6LvE/45LAwBGV7jOEXQVDXdQ3Vd6pYYnxz7h+j75F8DgJhGAGS/C3Cpikfm26AB15LElGkj/lO4LWWRhivbYN01PP3IXpmXMP3GXxQtR7xoOSPf0MBlNeAYXEP2EZP7fZC1voW5vyBvOtqkH5kL/7iGBrZowLEDzmOv4bnTAO6d3Ve719ZPvHtq982UsSsvy29B9/PyJrk7ZSfsEk4t7SrhdxFQuXYEqPJBO6RikqUeqZJwScAqLpG5NWK4lczyNKq6P/A1X/gzhCUiVz8k2vCBj/RT9VD12PNnGDKO/lNO/9Z+TWNCHSeMJ8KWxlUdf+nvjd8c34x9/HUO4Heu5PxhTuXChf8IQ8DSnK7hrgWuC+C9u1j086m/RoCZzO/e9/fpvoaBPTZDQMppDDAcIwD9c+8Ud4kbgvxzvF+y30MMA9/64j+7fyVAgwD/JaBVzVgd193SAOuJl3Ii8nU72mOdyhWNF4nnqv5Hocf9pYy89IsZp5xxyqJpBg4NXLUGGHPVsS7PBgD2LexR2JcQ1pz7i5on/S3ZuIYGjtaAY8gxdo6bykHdN7uXNlxD1c5YNbXaKccywXt7eXOiClzCqWninHKTeKhQFSxKYnoEJ4lQJUpJolJeImGVtOlfI4BJGJErYa/k9Cr8X/xNX/wxyj0FZhk3JW+5l6vQ49Yys59r/+NfGy+OqYpLBoIct1Wu4x1/zofefPGH1bkFOu/AnI+5sMXixhxemt8Z7pogtmz366I/IOrV9Yh8fbovwc+0mUajAWFveeUHzujX+6W9i90NcwvyD7lfevqvQaAaAfw+AEaA3Xi+WCNGrpvSAGuJ60kPjb9uRB/ZnpR7cRmfba1p04+cl2UY1vNbNmmURfOJNb/hA4cGTqUBx1iOQWXw6azL7EPYp/z+3//7Px859h7uLzJPlWkrYeMaGjhGAzmOHGdTK2CRr+b+mHQ7R94sq3nvz5U3hqyiEqcWvlcakxcnsUiykSRkieQnoUGupKeSIvw9gl8JF/41otYjdlsJYk1XifQLX/g1Z4QNd7U6SD0rH8KveMEfnPuGdPQjfp442qeG6z+E/Hsy0vTG05qxoDdee+OasDoH6hypc6gaBpx7OR9znjp3ncsi87y4XAfqWlH9LeuduyZ0hP56T/2T1J+Ty5H/JPfIps3wNAZoBKDeO6exEzaYsQ6J52m+JP8QaiTwBIBGAF4JGEaVE3bO1RbF2sGVWNeTm/DbptquXrhhh9D7IJ2X5eNPeSneNIkpW06GIaffsgcODZxaAznOHHfgbABgf5F7EvYfLW7auUN7jJZsXEMDF9JAjsV5PLZSGG/TBue4rGW0rHfrqjfgjZ1ThCRAciBhSBLBJE6yUYlIEpVKYiQ7vFuLq4SIr2Unga8EC+KVDhKX7uu+/uX/oLpves2r/5fqXvnWP/aUjjjkP/kf/Udnhr3hjW+YZfF17/qTZ8igMmnTrzzwkY5uWg9vfetb575aQtpH3JKjv4kDe47xUl0dZ+mv4zLHLXKOa+Q69pkb6XLuOJ/EOu9yTiLXOet8Zm7nXHf+g64JrhFt+Zt2LtcS5LrWVH9LcrMX9/lvvPhP/Ief/qoPfeg3/MOP/cq/830/fyZph7inm0n7oWP/u/hM+5i8YjDYbYZuVik3UDtjUfIO6ZfYHzIAZNqeEYByb+B2RpXbNMB64KXcw7puXLefNlqnsmg4aNhW7OXNsCzT8K1lz41pf7IMwwYODVyFBnKsOV5F9wYTewh+d5///Od/CacA2Gewl2gNmpoznWj+RNqOf1xDAxfRQI4lZMfaIcx8F6n3SvNk41Lu3dTUWjI7Jp4bejf5ufFfI/lJJirRkICISVKSvChLcpL8vOJVL/+ZnoNAJaH6k3/6db+o6xE0CVwSvLe//c/PpBBccu96z1vOvvO7/tOzt/7Q286QQf3vfve7Zz9hH/grj9IkIr/3p//iHNdDwk7t3vH3vmsus4eErYUbvxVpu+Wd+j4uUt6PfeQD872Dp3I//Df+xlwW+KEf+MEzEbnn3v997z+rjnHSc4wjXW/8OZ57WOfES1/y8vf3nHNLdC4m5rzN+YycxgENAyBrAs51wnVD44CGgfhRZ63prUMt+Pov7gvCD9mH9Ou++gf+x6cg62/48ifPEX+MABzT15FGl0/1lX3iPxP/IPvGZ3iGUT4nD65fIzdbI2NK8n/M0/8l44BlgZwEwNh8s3c4at9pgH1JvTJMGbwNjrZuacfWdHl/5gF7l2mJU05E1tU0hovEc/X8j2Ier8PwQ0iZ4xoaSA04Jhxv+du//wYABgAce4md4XtqheAyPbLlJLbgW3vl/dPI6r+1DX9gDcvxdIx8K9TUa3CdONU/tZbvj+9X4s8G3k29m/zc+CchSLKQJALZp/tgEn9kyMgxT/YxCNQnpPUJKv6vfPUr/8WrXvUNZyKyT/R5Qo8f55P9q0KeJlv2TT/5vkv1p86Qqx6Nv0p0fORYUT4Wv+5lL5vHG/mQZ1dOpdRx3Xv6X08A5NxBrvMr5x5yzs2cszmXc45vJfYHyH1vbbrxRZMn/ZX0+9TfJ/+HyH8aAc4R/XjyvzcOlNMC+/AwCqQxwLLpjxtX1jU14NTk35MD9TQAc+WabmlUc1gDrA9ciSn34nprCmG5x1lKc1Ph9T6W/Nm+moa4GqY/8/Xkmi79yF7WoX/g0MCxGnAM9cahc3RqhZ4zAHzVV33VV2MEuOOnAPLet+jN9FvSjjRXr4HemO2FXX1LNtZg40iu7CTr4dTS7Ym/T+gwAPjUDkwDABMSMpDkAFnikGQiSYYGAJ4yQkDASlLwJ5Hx6T+YJwC2kv88DaAMUXzta187k3Exj/YrczpAUgnpxH8MceYEAOnBS7mf+o5H+cEFxxN34hJ9Ym+4/h5uSWM+04qGb8GaRz9YZcP2iB5Jdwl92h/H9KNp7X/HRUXHSg8ZZzjHYGI1Wh0i/zknkHO+HCL+dT7mXHX+5rxO0s+8dy1gfXCtEFlHmuutMa5D4G26Joi/T/mT8L/5dR8+w0G8IeJbyb9EfSbvQfx9mi9K+MUaXv2ko2yMpLdJgVfVFsZiPq3P4/xLT/ePDU9DwM4IcNvG51Wp9y6Va5/kGnKszJpEHtH86U/Z+Isgur1IPvJwJaa8Je4i9Vpu5jUsMWXbRRhX+pVF49M/Zxp/HpwGHAOgjnmn6xoA2IPEKQDTJlpWosolrHcZfgh7eQ+F1TIzfY2rftMarn/g0MAmDThwxJwoPfkc+ffJvwYAN/wXefoPuaiEI59CVvJfiUwlOmkE4ONqPaJEGE/6QZ6sIldce2ILeSO+R+K2hkEYTSt53IqXIbf7vJLkHaneE+jmh6TjT9xC3NfSZHlVzrrPyScg8/v73RkEturYdPQRsn21hDkelBPzZAnhOMZcxflJv0/8Y2zOY7WdAOiN5/zQoAawOi9y3tQ5lfNt7ak/c/UYAwDrgmvFBgOA6w5rkuvSpsXsihKdI/484X/ud/1nvwLhf/ur/+bZ27/+/bP7zm/5oTOcZD7f+YeMz2lbekl/xT25T0OAT/4bSvI9LbDHOAWwT7MLow50f0V6uRXF8pvB8XwNAMcS+y3pPQ3AfxTAEEB9/IeA+67bW9HB641wfVhD15GtyPqzJe3WdFvKOkUaNJXl6Bcz7rJyr8wMQ64XdeZV/RmnvCWNaQfeDw3Y52A69wXizEXgGjz9/yN/5I98PW7lPwKYb2nepvayDRl+SDbfoXTEL6XNe65ylmt+02TckIcGDmrAgZOYk2RqJczOTbubeIk+KNkH65N+SQKYTw8r2a/EoxKTJC3ISWokOmKPGEma8ulpj4hJyCB3yIlLhO9QuKRRInkMQlpJX8nrhfxJ9CXUu7CZ4Lewc0hcOEl9kvY5fUtjXM+fcaeUe+2Y9bK7p7ntO7J/rL7U+TF9xTgg/aHxsBTveCNeORFZNxsHeA0AA8HudYClce+8EHPu1HlV513Oy2qcy/nsPF86DeB64frhegLu1phcd5RZl7jER75r/Ms9+qR/T/ob4Zfsf+8bfvwM9+SbPzIjhDuJP7JEXwMAaFjFNVKvYWFvKOgQf+Io0zTInJy6RpVda1WM16/43JefQf4h5hD0NUJPmrX4Q3EaAjwN8OIv+GNn/O5d602PytBAb00grDrT1nD9S2TA+C3oemVZ4pa8V5Hm0D1fdZ1ZvzLIRd31sj2Ep1zTDf/D0oBjxTGR8wx5bwDg6P9rXvOaP47b8BpAnZ9oNevqadk2VFzKW8tb8pt/S7k1TfX32n0XwqbWSNy4TqyBOkDS/9hkanXvn+6f4ol+Eob8WJiyZMMPiyVKUiAt9UNl1Z/Ho/3QGcet0+VH+5B7H0urYX5YrYf1Y2x8qK/n+Aid4coX+TDdMXkg2aRPPCXxvi1l5T1W+Rh9XTZt7yON9jnjBBkDRG8cEca4E+sYxO/YnY0Snf8wkOOc11FyPijXOYPfuVUNAzkPkZ2nzlsx53caA5CrQQDDYL4ekAYBjQGsPzvn2pTrVYu6vos2+XE/iD9P1nnSn4Q/Cb0yhDsNAPiNq0hcdUnyNQZI5n26n2kek3dGAdNS/je/6Nt+9vo0dz01McYweEHAeRq/lbhrKDiUnnjJfi+tcZRHG2jP9dz5g6+FNSEv/a4VxNUw406FlUCkv65dNc42ZLhhN4VLbanh1d9rb+rffsp0xhOmLGaYeYybE48/D0IDvXFAGOPvnON3mr0ET/01AHAKYMNrAEtjORXsGBSJU+5h5t0iZxmWLWZclW27aLx5t9R9G9JMrRHV2a4aXv2kMwz5wV52fsVzE6VpB/+Ec8MNXoTo181+EgHJQQ+TWPS+NE5YEhXJ/BImWarkqhJ0/PWr6tWfX2P/4R/5i/PX2fkKvF9wX/siPGkgkqQBf+In/tbeb9hWzHKOIacSfvIor+FtIfJX2Y6eLo7R6VraJeIP2We8JTo+NQSAlfhD8AlLhPxvIf4YAZbIvycEQOYXxMl5JvkHNbrlPFXGCFDndM57ZNcFyT/oiYA0AEj+QdYf1yPXp4auXXVNw3/lF+32mD+knaf9En/Qp/8ZLrlPQm/YGmZ65Ur4JfNJ9g1LI4FhNT/lck+nUBx9Rl+eoqyLlMF9MFY97g/53vJUH8JOOl8V2HJS4FC5lInTCMAcuMg9jTwX0kCuBa4TFKR8GcyNtbJIua5PonXpF3tpieulN+ymcKldhosXaZ/9soSWuRZP3LgelgYYF1yOD8bgOSeH0QDwlre85a0YAsprAOfyRBmWewzWstby2vaKmce4DOvJWe/UMuEXkclz166pNfiq3F3TxUna6yBIdDDlAFJeNAbUY/1s+tzMg2zEcG76xUoKKmnQD6GQXFRM44BEpeKSUYBwn5iKaShIWVK2hJA44qoxIZ/uQhD1I2NUWCONl43rEXoJNGUrP2TsvhoQrzLMrwac4DUBSDzk/BgHUeeIv0/tl14HINwPTvaQJ/u8DuAT/iT5yr1XAnqEX+KfrwP41F/c8iqAawLIGpGkn/Ukib+kH4wfAdclf9ByHTvJAnmoED7yxxP/Svw94p+GgCpjEEiyTx78pDMcMq4sEgZp1wBQifxM/BeO+1eyb1rLtFzW3UP3fiieMcBxe9wzP+k3Pok/+5o+xqDTyqH/TnZRLnUl8Zd0g70n9Bkm+SetBgDI/ZoR4BhjgeVjjKCdJ7vxUVBPA64JxulfQ+KOda5FvXy5PpnuVEh9WX7P32vTMWG98o9t/5b66KMt6XppzAvmRdpx3W8N2Md1XPTG6PwhwDQAYAQorwH08hlW61jzm0ecWjcog+ald5SPxSwv5amVOfM1cOeIR7buJs71gnfhmloj9479YfpPJLdixsUg5OoNxhxkDqippX3MOLB0WoANmpv9NBIcYyjAcMDmKZ3kQ0yCUr8DAIlJcoPcI0CSI9HvAIi+c71GzI6NgyCSJ/EY0ljTSjzBo10S3x4p7oRhTJA0K4tJtjPNTRogNIQkXtbw0svvCQDilDUGgfSNJwEwJOEH3/Wet5x7HSCNUsoar5ZQA0IiJwB6pwAY69WAln7mikYAMA1yzj1Q4x3IPE1jnwZAsBoCNAawTuA0BLCeeAKA9aa5uha5XrWoq/9h+73PeN3r+bCfT/bf/Wd+an63H9S989t//kxnGFiNAZL7RA0CGYYs8Ze0i9UQsOTP8Cpb1mVfA2B9l/wfwud/zlfOH8jjI3kYChg7jJUcGzleltZ+xiJlQNoh5DqJPOFrJD6P8ZMn8x0yAJCX8rcaDDAC0BbS024G7LhOqgH3MBaafmXXi8uiG+oe9taoGnYVfu8pyzZsDUlPfOZbCqtptvpr+WvtMY5+ROYy7JD/UepHf81jmHn1D7z7GrBP7eveeJx5Cr9PHP2H/OP4KCBhuwcMvXwZZvlLmGmnptbZxcML45fyHwo3/xLO9blf6uyZKL9evbCa5ib9U6t879wTXpERwHpaleOqGnCgOEiXBuEcnk/ukHNQZiciu+FPAwGTUiNBEgXkuilMglE3iUlMkKtxoBoIIDl8IV0jQf5XgJQxBGA44ONqyBUxEGgsONYQsDV9Ggo0HFQjwJofokn80cYBDAodA4Bhe9Lf0r3in7z9KcMTTWM8/p5MHtP2kLBjnYSffMo9JOwmHK+YUK+nRNJYkHI9cbJ0QsVwjQZgGgzWTsmkASDlPH2DnMYA5DQCKNd56jzO+e2cZ/7nuuCa4Y9a/KhObaHqrUWuU2Jdzy7ifzoEeYn4Q9wh+RL/HmoMSEMA5H6J9K8ZASTtS0/356f88Z8CfOpvevMnIqP3iyiHPKynh4j/KeJ9pz/Jdz7NR5bIgzWu58/0GMzw45aMB5B5yqEN2Z61PKTPfBgumtomdDeuk2uAue+l3EPCjnGuN+RRBtNfy8t0VylnG7Ke2h79meYi8lR0cEwZtkEkr/IStiSLaTIOeVz3UwOMDa7EHC+9MTgbANhH8NQf8v9tTz75vX4HIPYTvbyUbXjWk+HGg/sn8O5XCNs54msZh/xZdpUtd66T+twrycFafeaxnha01x3ybbum1qDHnPcFsj9M/0XkXh2dsBY0X1P7q5sDHuKfHEAOqiWcleUgTFwyBuSGX2OAhCBRwiCBECvByFMCyIeMAfl0E1kjgEYBTwpoCNgbAdqT09kIsENkHKS8ypJ74/Ufgxcl/hci/BD9A4Q/if0hWRJ/KN2ti0cH6kH5SNTYsmaUqXEQEfv7mDHi6wAe/fc1AE+0VHRsgznukXNepAENop9zSqLPXEPO+egcBZ2/oPM6Cb+LuT+e8ePMmpLrjetRxatYm2fyDyGHvEv2IfTKPcJvmMRfAwGoESBJPmHprzIEPQn7EqmX5PukX5zT+y8Dd68LWKZIH11EgfTlH3rei+ej/5D8lJP0L4VnmkOyxB/kKX2P0BMOGe/F1TDSUhbpMZD9tR//9tlI9rLnvWE+UbBkBKAc8mgAEAlbahd50giAPhj/F9H5Pc3DfL7MlfmrrB+8jMt1SJnyqpxhxt0knrI9U7tfHPcjHntv9oH59B+LrQnnSA35ucSenHFz4vHnVmug11+EpXMcPYbsI9hb+J8AMAL4HQD2Gq2cqbnH8h0ZNhNx64LHuI9ZKT/br3yoHbR179wzyaHkWLu9E2VZLphX9WfcTcpTq/yc4x75nUznfV8Gaz0b/S3Zw7ocKOKhAUr8pGMgpnOAitmBDmJRkiAmgUhigZykAzmNAElW6mmAJDmV/EOCkiBV8iTJAreSNIke6SV4hq2hJN40+hNnotojp0nmJbMrT/IvQ8JvhOj37vnIMPSqLquszrdg9uvWMWE6Xy/RSKQRKTFPmMz/4o9/8xeOtJ5KeeELv+Ysx6+yhixQ0l/nQRJ+5JxDObfqvMt56Xx1/oI9ws8a4I/l7ofL9SPXGtYfXROv/qJdkGPIuGRfQq9for8FzVuNAJQl4U/ZMFCSnphGAIm+KOHP/ziQsoYCkXwYdi6iVfp8ibj3SH8vjPwZDqHGD1q2JFvCXsm8fkj7GgmXiEv+eS2G1248ZcPJmWMMALQrHUaANcOBRgANCMMI8Nioc6/xWMQlAnLtsHzDDmGuQz2Z/L3wrWFTyY/fMGX9W8s8VbqsN9uyRb5IGw71xaH4p+0u0+kXCR/X7daAfSTaWv2JyLi1sTaTc9ZZXwPw3wHyG9/yTgfyr5U9x7FvYQ9DefAX0D3NKcqP9tHW+bsG1IGTGFNvp071kzprRdzKa2qteszlPbqn5J69f1E9ZFyGZbh5wF6dGbYlTaRv4v27cvAoH5wUTQ2kmXRpCHDCMGB12SkaAUA7MYmEAyEJx7GGgDVjgMRIlDyJ1RiAX4MAhG6rUQBSmaRxiWR+9bvetOljcn/4r79zJrIVX/s33zeHJ85yMwQcwmMMAh7nJ48y5SuD6c90KWealG0LYVtl025FyjXtXIdGkxWjAv2WBoSlfuyFZ//nk39kjQNr6Fhz/IG98enYFR3bYBoAkvwn8VdeMgDkXHR+gs5b57Fzm/nu3C/EnzUj15f8EXP9aUmu7qLNEvCLkP01g0AaAOqHAalz6TRAJf+Sd8Jnwt9IfCX573jtXzh78k+9/+w9b/v+2X3oXR8+0xlGPGXwmsOuH45SLONBki4mmTesh5Xgk6aXN8m/T/8l0hL/xDUCTjrIPwT87e/44zP5xwCQzvheOdZLmiT+KW85CUA5GgGYO0cp/X4mPsXctow1JC7j9fewrkPp78mUUcOnTlgvDelMq7yGlJHp02/5xuvfgmt1bomr7TDPlrpNox57fdILe1q7ajhhXBn+KOQTYfoH3pwG6B8u8ZHvE3+z/3qyY2YJZwMA+w7e/fcEgB8CbNVMzS3lPRRO3rl89jPJV/DHvuZQOYfi9/WwZ6IePmzInkokjLhdnZSXumrec9eSrs8lumbP1Op7zKFH7tM9pQ+d3E9uQfLWdJRbXa0/42vcEf6W9O5eDpRE5EMD1vippZ0dA7M6CYCYCmdA6+w8yYTooACTgDhIxCQtyJIZMUkPchKiejIAApVPUXnqSlg+qV2SIXLEgf/3N73+qZ7f8B5iCCAc7DnK64XXMAwEhCUib3GQY9KBVTbssigJp5yULVdDQsabroeEGc4pBfJ5WoH37o1XvopvALztfX9lfscfxGEwSBm/7+0br7+H+W5/fb8f48HSO/75Tn/Kh97v3/KOf85B5JyfzFnnsfPa+e78d31wzWh46IesJTn59XQIMWRc8g9pXyP1x8RRFuXWVwF6T//TQJAGgD3pb8f6Jf2ESfb5ngT/epR/N4r7O/9N3xlPWgwC9NGx2mS9XCP3EON8mo9/iegTbnwipB8/DhliLhFP4r9Flpwn4a8yhgHT9cqkbk8Q0CbvzzZmO3v5DUsjAL9Vx+r+nqbPvcZlb5GyannpN34NXYPc01wEp9YOHfmVrxpta9bTq7+m66XJMi4iW8dlcK2fenFP213EcVXMsDnB+HPlGuj1gZX2+jDTZ/zWcTS1wvf/DYBTAJwAwBjAPiQI89byTDeXa9mUxf4GwwIOYh6EnLTm24r78qmDdrJfog7Kpg7uARlH3O5erCt1lTpsxd3aa2otm9wXJsrx+J2Ew7G/dD/Zw9x7ppxps/wtMm27hGtZb+7KwbB1AJpuas3eOzfpiW7gE6tC3fQnZmdI6hOz45QryZDkJ1bC3yP9kP9K/HvkP49KI+vSEOBT1WOMARoJNAZoGBAh+tWZtoZD5tcMA9UAkH6NAIbp32IM6KWBXBuuDFZ5Lcy424x/+Pv+0qPTFg1pJwSeMJ7yi70n/r0w+pXwxGNOAPjUX8wTAI5NcOmpP0Yu50J9x595wrv9zqmcZzkXnZ9gzmHnuPPedcEfx/jRYo1xzQFzzWre67l4En4VxD+NBHkKwJMGPvnvGQJIowFgftq/I/5J+NeI/pIBoIazoThWy0sGgB7J9+k+BDmNBmvhkmnJNQYACfSxCGlnXlXC3/PzagBGgN4pAOr1BADtwXk/thMk/6E2DiPAfsS5Sd0HNMEwMeOUjUtE1pFO+aLoepTr0zHy1NpA+h4Sdlln2UvlHIpfytcNL2t2N83T1u+ptgf/VnfRPmxV7MdByrU84sZ1Og2gXy7xke8Tf3v6r2Hp3zpOTDe1qvavAUCcMQKA7EmIa860W5D0e8c+hj1NknLK7pBy81y4DvZSlEv7+a2mHsK4D9qxa5flp86Q86r+jLsJeWqV7p17xETuU/LPXpQ9qUaA3Hv25N4+1X2pmHUpr8WZJtt9hNySXv3lAHBA9HBqzZhdEnrlJPQOdG8cdFOfqNJAiICYpAC5dlR2UspJOFKWkCT6RD9RYlOxPuXHL9lPRE4SpXxRsp8EHxniLlZiX/1J9CX8ogR+Cb/yne/aP/VHhqSLEFZJ+zmZUwEZV04JQHzJ95If+tHH0DiRdMpizdcra9+uUvdR4dyD97GTuXcdOkNe0h3h6rmHhB3j7O9EZB1lKffQMVgRgu/YXTvaz1zIOYKc8yjnGXLOR2Tnbs5p5rnrQK4RyK4jriuuOQ17a5Lr1rX/SPGjAhH3ib+Y5P1UskRf4q8hADQM0p/kn3f1CeNpPU/tK4G/rP8bX/GKN7Y+OeqqBgDJvIRYhBAri4atIeSaeN1FDACQeAg7T/Z5179H+GuYpwCWDACE0yba44mAvC/bu9UIoEGBuXhUB9y/xFvmvWnE1IJha0jcFsf6RLreOrU1bGr5caQHb9od1Q7X7CXkfoi74H3VtmzR6ZZ+W0vTmrono6Qb12k1oE7FWvpa3xC3ZQxsSTO1svaOMcpeJIk6+5Xd2N1SHmn25Smzt2HvAxn39QLIOWHUd2Bu1HrPlU9eyqedthvyrwGAMOohje1paJlVzy1qP+6Rb9M1tcbsnftH7i0de0/JP7+T7Nfci4p1r4rf/axxps2ye3Kms03HYN5TkZv36i8noAOi4tSaMC/eDLR0btjFetNu9MWqvCQGyipTtDMq2lmJSU6UK4HRX4m+/h7h94kopKnnkmAR3yNjW8IkdMeQxEwrASVMGXz+f/zt+yP/yqLk9hBCjEkzE2SJ8grOpL3Fi+RDviln/VvbT7q8X+U1PaFr4hOzH2q/ZN9tlRlHpF0bT45H0iD//q/7hr8DLpH+fLLvPHCegM4lMedczkvnrHNZdN6zDuQa4boBuq6w1hRX1yP8rlliC7qei3vgyP1Vkn6NB9RRDQD6NQTgh+xL+mkb7++f4kn/kqHgFAaAJMHKFSHHGgqQiTdM4mwYfo0AoAYASPfS03XItE/vL0L+NQZQzpIBgLptF/+688c+0ow17T8JEJb3S/s1Aqy1WSMC6ZmP1zPqb1Utdc5X/1JjTSdmOsNAHfG9cOOXsLderYVNrR6caZTBox3rKPnEi5SxJY/lu24fg7V8y6rhHT86mppTV1txqa8Ohbeq9mMAmcs8ynPg+HNpDajXRHWcYcjZ71PzV5fxyDV+1c9+hD2LZBo5xmgtu/ofK5u87Bsg/7xWgAFAIwB1sCeK8h/L/7SV9pOP9lo+RgXqwGkAoP2ljmxz1W2r7tZeU2vZOcd9ub8U2Yfy21j3sLlXrbJ7WowFyqRxT5toPSDhpsvwlHPPe0iu99f8V37lAMiBgTzpGGjpcvOOXG+MAZkuFSIxqJhKVrFLHWUngRITMTs+ZcmNuEb2Jf2SqYoen14jYsZxZBsZ4rZ0PH+JACaBRK4uCWePnFYiu0aAJeunIOnP/a7/7FeWysk45UNIWf/O9/383oCgLNZ4yyM85WyT4Ws6MQ7dqsueng3DsIIMpqN/8dvPKRu2FR1LiY61RIl/GgEIc2zXp//VEJBzB9n5JeYcRM656lyuc9x1wLWhrht1XXHNcR1qWNeo6s/1TLllO83FNxB48g5Jvw4jAAQfR50+8c+n/xoCkvT/d//kp89wSwT+suGnNAAkCVaW3C+hpB/jgGmQJf4ipLySaYk+pF0DAMhR/qWP/UH0/fq/pD+RvGsGAIg9beYbHer+h3+kfVPkrW89419yagzgXjQCLBktCB9GgP1cZn7nVf0ZV2XTriFxx7i6Fm3xT60O0oGbHesi6Xvomilabs9v3Bbs5TesIus4YWKN15/1Epb+I+QteqYfSXdMf/bStiK6RgHCx7VNA+iVK7HKqfte/04t/945ni4whpx74jyn2JewV/Hp+a7cXjsybN8e20Y+5gBlQc4h/u993/v+EghBp3zniHkWcN8+47NsjAuUR7k4v1/QMTBke5HVcxPP9Qf+23RNrTHnnHtH95TuOeWO7Fnheu5rc49a9674If/pMr0kP+uwHtPhty1b0XtIrPe58ze4mssBUAfG6lP/bDCyG3qxKiCJQE+JSR6Ue50k+RArSdEvyU9cIvz1qb5PSyvpx58Ea4sMqSNdD7cSvkwncUxyiSzplIhuRUjt53/bB2dym4isgyjjSKt8CCHmpAFTzjDjtmIvr2GJVca/1XHPpPXee4huCVfHVf+1b3p++pTwP/AfvvnjyEtI3NL42TL+SOOpFMczfsc4RgBPBtT5kXMH2bklOgfF3nx1LtcFNNcDZdYM1w8x1xl+KKvjR1DXlsdp5+pa1vO77oGbLtatUzz9f893/v1NHwv0BIDkXwNAngKA+EMqT0H4/6t/9KF9OSln+dRzEQMAY0OCf1mEKGsEsCwNAZBpSLSYRJ9wHKQb0s57/pD+NeIP0Yes8+Qeh0xY5qEcytUIIEriiaOdPPlHl1merxpoBCAdbTbvEmoEID3zcdMAvvuJnKuid1T9hoPGVaxpiK9pDDuEvfVlKWxq9eCIBze5usalX/lYpG7y9NqQ4YfKrWvykv9QORnfa9MRYUu6z/BDfVrjW/Xd8UG4F3nGta6BqqOq5/Rnf1V5P3YZN3XMOZZaUyYcfuVDaHnsQdyT7PLXNlT/XJfl2wb2MBBxSPkHP/jBD+M0AFA+8aY17yHMNubJgm978snvtWzCKRvd7Mqr7U1dI9/ma2qN27vcF6JDyXjuNyHz7Fvd1/I7mXvUJPvI7mtB40ifZVaZeNLW/W3luLaRcOSe857yPovcvCe+YmDvCb+TyQaBbsiz4W7cxbzpnqJS+cgSBzE7QLmSkOxQOzafaCJLdHrok3sQcqSf/53Ox9FAHRtFZEgYsqisP5GNJX4cG0NlMcMgkIZLJg+hT6F7mGHI6SCs+CG3+VQ8/ZUkm47wSuKJy7CtJP62pMv2p+w99fSi/npGAQ0CYu3HNBL0DAKGMR6QHRcaBvSvYRoKlowDnAAgztMBYp1Dzi0x56FzM9E5LNa5XtcD1wrXjkTXGNccMdcj1yjQH0+xLZHTztUfvOr3R09cXV358B8k3CP6W3Ar2V8qSyMAqCHAp/4/9qGPzoT9FOTfJ9MVMQTUsIsYAOjfJOvKokf98SvnE35Jv+kTK/lPki/R52n7FrKfT/Yh53/tx799T/41AhCeBgDKhvQn8U8Sj0x7QY0IlIEhAEcd+Gmr95X5txgBmHerg3dEVg045yuSjrBjXF1Xev6plXm02+3P9nsz17ibQtdd6lfeipnnMu1Hj+Tv6BO9o+Oe/pfC7GfikU1neA9bsnMXacZ1vAZSt+qfMPugh1OL3zvHUXIU5d7ewPQL4+dcubnf2KXvtcewfV7bZ13sX3j6DznXAIDME3v2OrWd5l9CyiUP5Ur+Ka+Sf+JJF+XYVjH1r9yS7w1dyLfhmlojzrnsG2T06B6TvScyKF90fwtZJ1yC7x4WP7L7XD9ybfq6n9VvOfitP9F9Lkh4+lN2z+t91fvd+Ruc+MqNtw3KG1CuN+yNiygsXf13YenPfyu29G/ICM9/YVb/xdm73/3us3S8X1kd/+Zqi+NDWVfh/vSP/u19uco9JOxUDjJLWSDuq3/gf3wqERmSW3Ep7FSEnXZQVg8Ju4izvF6Zl213Gj2qYST9aRQg/BjjQBoFMBhoBFjDNQOAcYcMARjGekaA+noAi6YGANDFUXTxFCX/omuG6Foiut7kGuRCCEr8RRdHkB+2dP7Yim2ZnHbOH7se+qMHrl60EQK+9dg/xP/D7/+ns3vvB/7+2WUMAdSp0wjAO/6XJf5J7mtZ+sU0AlzEANCU+3TGEOQ8HURXl+FVJg2GV42yYJL7PcFvT9mTnCehX5Mzj+Rcwt9DTwFoVHjry99xhksjQMo84cf59B+kHhwGAB33kUaA+gpDNQZ4EuD5n/OVTzHPVgfx3Y88OE/LLZpeJDrlknxP+jMd6XvO9YQ45R5OLV5HvPIeWbMId+1Kfw3PNCnXtVC/afArH4vmtcyKvfWYNEvhmZ+26F9qFzqoetBv3AFU773+6YVln9a+b1WdGw/4uUjHVfFR6PhbdZN67fVBhk0t8zmXY4Vx5h7BI/v42UM4BjN9lWvZ+h2XIHlauG3Otil320de2uHT/7/90Y/+DA6yDnmnnbU9u7rOlWebiKNM8vXIP/VYLunMt0PbKno/Ykt2K6+ptWrv6NN07hnZT/IbyP5T4s7eNB8KsweRs7pvFeGvud9NI4B5LJd6kM2b4cS5x01cCqfd3kPeF3Le905ucMLLweSEoSFuyN2gg3kjyNxMulSQMspJo4ByGgOU0yiQ8pqBYN70seHbOYwEyD1jAWFpMKgy/1OdMBBDgphGhWpMgGgTliiRN1w/BgblUyEknrJAHWQYueJFCbHkWrItEr7F/an/9/8ytyUR+ZSOdlj+oTYd0sNW4g/RXyP8PUMAxJ7wJYLP037iwGMdhJ48icjV5QkA4jAGeAogX4XRYpoLIrLkX3QBFCX/Yq4RvQUw1xhk1x7QRZG1KV0ukqxf6eqPaVsqp+b8wavIDx+X+MjX+cvatfXpP4T/B3/0l2b3V7/n/3uGWzICbDUMYAB435/72TOe+n/0ox/9eBLyJbmS9yT8vTz12D9pKENnngsaAJ7G74KkXeJc0WP5FWu6JPO9OMMynaRdJE3GS857hD/D0APE/U1vfeX+VAFEPA0APsEXMWhwUoHfE4w3lKcBQNQIwG9YGgEq6a9+6qZ88jDHOsP3PgQdnKMbbjLLUAZ1FKG8hnUd6fmnVtaic50ijfJWdL0jvfIxaL4t9a2Vm+uwMumVEw1fK4+4LW3KNGs6LnH00dRcr68Io797cUvjoCXfjxXkcW3TAPrkqvqeWlh19tk+PPse2XHlXgHECAAJ1hjgOHTs1TLwd+qe6zTtLj7HQh0r+zaS1nzUSTs4lv/DP/IjP/13f+7nfgHETzht6437XX2PlUlayT8nCDAk+E2BI8m/Yz7vqVU7X4TdlmtqDTnn7E8w+12eKv8U2beyz+W0Nyix7/FT0ube17SURXrL1E960mR43fPiJ74XLq+m7XkveY/l/pv3tBedvZ9oDlzQCQPaoNyII9vo3Lgj1429N9ozHqAYCYOogiUWosQjkU5IZweKdHrPefxfhBAhV9JU/T5pzVcBDNuCPO0lXT0mfsgPeSRNkktJaA8Jqw4CTFjiIVJM/CFiLQk/ROy/7xc/NpN18JSOei3vUBu2GAu26EQ9mrbquvrpN8ISs08P9X+Nx1hAGOh42jL+TMMrL3O+MBQ4/p0TYJ07zisx5x5yzk3nbaJzHKyLYq4TyHUdyXXGtSfXJNcp165cz9o6N+1c/fH2R7BFd68n+NL+lqf/EP188o+MMQDcSvbr6wDkw0H+JeE9PIbwm1bslWeYBgCRjUdXS4cDJ4n5qTFJvcReTJKvLOkWId9J8qtcjQP48x4wWGAAkJzn03/CMARA0DFEo1fLz5MAyDjaQrs0AlDWlpMAGAE4CcC8OdwVdzLFRTemmS9llJB+ZXDJ1bWj+qeW1zDkcy7Xo60ya5lpq+w6B7L2pX+LvKVcy7F819iLoGVtQduWSL70K1c9H/DbP1twaRwY3qp6bKwYBo7rExpAZ1zqDv1Pzc1oX2Yf7+L3hNo0oGOIccgeQOLPcXt+ozAC4NgnEE8682QdlmldC0gbbTdYx86U+SyTOmkDRJ0n/xgAeA0Ask67eu0gb5alTDjlcZ/cH0aEpWP/nTJqe+v9cE9c4iPfzf6dWvXnHPevc/8Huk+UX+Z+E4LOHtY9LTJhuty/sqd1v4tMHOksL3kp4aYxHkxjQKav4fjZ/9Z9rvflfVYdNP9JLzoc99gAcRAn5gRCppEicm7GuRH8YG7cle00ECX0XCUI+pNEKGcnKCcZUc4OV5bMJDoQQJ+S+tS0GgX0S6gkWUu49BS4Fw5JJBzc6pJoViKafsgrfkls4hLpXyLYa+T+Z/+L/+1syf3Tf/bPfoU4EPfPP/axjycaDpquV5YGgCVcavcWgwC6UDcpG1bRNCAnMojPkxme2DDMUyH4lbcip1VIC57CeYKGspQ9ZSNy+ka3dEonT/Kk7Kkf0YW4Ym/BdNF0HXABzbUj1xXXGhfVXJ9cYP0RXlpVybv1+D9EPUk/BoGlp/+V6Pf85MWA8J9/+OfOfuEXfnHTsf81Up9xaycCMp2GAJEN1pKuDoXT50mcTyEfQ/4h1km0JdygpLxiximju6xXA0AaASD++HWcAGD+pAGAuijTckHaqBGAPC973htmw8KaEYA4TwJgBGDcH+qLOxh/2c2pex1uvScbtoSP7ZFaOVNzhINdl/unrXLus8iT/jU592Okq/61vEtxrpNXgdnGpfoNVw9LOkT/xC31Qye8159LYb0x0YrcEybiuUz3yDf+qhM1oX7A/byhj+3fHBO9vnY8mM7fdH6n+W3CQbB1+CHNpHM+WEYtv7VpCrdv366tte11rOzzWi51Uj9P6T3+j0wYcbTDtInRhrlM4mg793iI/Ne8O39tK/68H+UWPF/4b/qaWgPOuVyD3NPlfo99IHtC+F/uJ+F1GAA4gYjDTzz8Lzmf6XzwZbosS5m8cEPQMHlnYsal7F62t3f13rjfqoPmP+llR/cGyNRqml0OTmQnkJgdg+ykFL0h0E15YnaicipGOTf+KWsE6GF2hrLGgESNAYl1cODHGHDIYRAgjYYBcOux7p4RoIZtNQocMgRATHsGAIhrdT0CvUS2k6BL4CH2S+6sXcT1MMOQuZbKIdz6bMNSGwnv3dMhgwA6UzcSf/yGG5Yo0SdMOVHiTzlbif8x6XwlJRG55yD+hOfrL8rE1ddnNBKIGgnEJQMB4WuGAQ0EoAsnuMUw4HohuqaArjuuSa5RS6sqeY4xAEj6L0P8MQZA/P/hP/yH/zvj+V+e/aPHyH+S9CTzKUvaQcMzn/G9MOMSOb7OZmpJV4fC0fkpSP/WMnziL6YBQOIt+a7Ev+cnLXrEpQFgNobtyH6eApD8g3wDgHToU+Lfq4MwjQAYAjg9oBHAspcwjQDo+lB/3KF49ymnbHJuei3fsMTe3oiw6ZCr+6Y1v2TAPdVWZL9FWvdgKWeY4YnI1Vme6SxDZL1EFpVdR2s6/WtY27DV39Nn7RPS1LDiX+rfGp5jIuVWXNcQkOHID/1CZ1zqbtavfZjjjbUrx1NvPOR4Ii2/Szxth/jzZFyHvxoByGuZ1t8ZJ85x0DYn1vExtXR7R3ncB4Sdp/4YAPwPALTVNmT9nTbM5dFWyuI+vD9OAHhflpX1F7m2deme7KOWfb6q3/DrwKlVsnfZ3+hC597OvR7IHpG9YnI5yDrkn30pp1/hcsSD+bAX8k88LvenyLU88lkOcblPrfVnXvexyWFtP/fjvXnPqYed3OA0lx3cGyCETbg6SPE7gUQbKzqBE70xN+GJdmSiSqmYiku5ZwAgTOJfMQ0AKWdnpey/TNMQIK4ZBCD+xCcuGQQg+qRLRK5P/nthNc0h8t8j/pJYCS7YI8k9Ui3hBiXhPaL+iMKf7m+vDuvPNvXa3Lu3vHflJPMpq0PwkLN/SKdcMfsVeYvjlAnplk6bbAlnPJIuDVbKHp3SKpqLJeM/Xc4V5JxTyHX+sVA7Z7WI5nyu8z7XBuRcP1hbcq1xHXJ9yjVst67VNa8FP3591ie9+CX8673eE/q1sIse+Zf4Q/rTVZIOCc2wlJO0L8lr6TUW1LxsYNDr41raHsIP6VYCf5l0kv5EiPUa+a6vAqRxQBnd/OP/+RdmA0B+BwCSz3F9HHI9AcARfU4KJOm3TDHjlowAh04CUK+vA7ReYYzf9cs9yqH7yHTKiReRyVPXif2+qMVNay7XnJRZk9xDia5TW5F5aFrXuiUkXS/OcMtJ7KXP9XVNJi/xlpGyYYnWS5jyMZi6rfJa/0Rcr49rmGMBrGOphrUk82U6/Q8Rqw7Ulfqd7Gt+wyXykHnk/F3PMZMy48u8kGLIMb9VOvwQccpzLFonmGOmddC0c7YPtM2JGY9svhkplzZB2GkH7/7z9J920IZaL22oZeAnnHtFH+SlPI0alE/cUt4or7ZVf95PlVv2+SL8uq+pVTi77Gdl7hvnftB9Yu4d2WuyB2V/KmoAwBDPfta9q6Sfh1I8yOKBlw/HfPjlgy8MCKSjDMpjP2M51KMRwDqNE01D+/JhFvtg2s89eX/eL6g+dtjgdJcd76Do4dSqm11OFuWcTMrZeGQGfXXeaG7kq2wni3Z2RZRHWA6ClCUaiZWQ6K/EBT8dV52dCq4ZATIuDQEaBnqkf4n8VdJY/RLMQ4QUIkuaJLQQXvwSX7FHlHuEmjBJtyS8R9AJO4UJwHJ6dVi/7Vlqb94b94vf+wZTP8qHdFv7ZMlf+5hxcBn3Od/wzWfmh8Djl8gnMu7wgxB6ETmNXIzrOuZ7c8N5I+YcyzmoXOcufud3nf+uEbl25NrienPgB7W3prnurf7AsUhfxACwZhzoxWEw4Jh/kv6UIZ2VkB/yVyK/RvoPlUX8t77+W7/jsj879O9liP3mvO2HmrRpAKhEW7+YBFw54zS60BcQ9GoAeMOXP3mGe8dr/8LeEOApAEg55NxyxSzfsPxQIEYJTwJYxtIJgAznxMEXftoLfvKy/XVH89c5rR9MmdszrId13Zha+oPODbn7o4q5Zm2RWe9Il+veReWLlJNr71bZ9pFeeQ3VA2lso2GHsOq351/oN/qX/qz9vOTvjRHDWjH7saSciPyQL/UkquOZ5NLH/NZDdHWQeZ9y5z4gx5HjkXgIPukhyJBtSLdP3jkRsGQEyPHSOmjaOdsH2uaKmQbZvLNRgzbRFurGCIDMvdH+rBM58yoTrl64L9qPQ6Zs4pbyWkZgbav+ek8ty2NrZIYhX/U1tQpmZ1/b/4nuGd1Pur+UWEPGk6PxVB8CD5lPIo+fD7X/0n/3y/tTl/KHHnIyk7R/57/6u09hIKCsNARQZz4oS5k42sVeWUSmze6D8x69f/UR2MSru+qg0O+gOYRTaxppwHMuB74LuwNdvzdd0ckOppKQK3HA7wARHSiJDhoxyYuyxEasJKiSJAjVFgdZI12iBA6EIIqQSPwgYUukMsMPEVUNAKIENwmwchLllCuxhnCnIQC/k6hH1A3DICCh1zigP9H0Fa1Dwm87avvwZ/tT9l4T1YmortZ0Sx8Qn31R5exD5TQI2O9glQ1LhNDjT5T0YwhgnEn6RcI0ABxL/J0LonNFdD4l5rxzToJ17jq3c77XtcC1ItG1JdactXWKNY1LfOQrf1mkr9IAwMcFeerP+E3CX2VI5xKBz/CtpD/TpbxkCICUXvQ/ABSVPq2eAkgivUXeagRI8o8s2RYh3ClLwHthSf7pC9JkW3ka4AmAJ//U+x8zAhDHcf5ax/wvaFtZhoPWhc7rSYBDRoA8IfCHnvfiswdsBHDYOb+3IGl0vbVjavGLzs2461APc71ak1nviBdN21sHTVPjTuHPNfhYuVc/ZfTCvdca17tvwyr29G0Y/Ya80n+9/q5hjo01bFWs/6aQ4AFd6Cqv1B363T/l5nef8QGR92l3kt40BtSx6J6BvBoA+OjeL//yL/8POAwBGgGsh7HmGMpxQpuay77PNqecaeZ72eWdDQBpkPDIPnVTZ6c+6jznSMN9+vSf+0cmzDJ6eWpY+Gt705/3pdyyXvtYnmhvXQfsX9H9o3tK95mSf5C9KdxMAs6Tfp7cQ9r5beU/KkHk2XvBJ+QQEHxJPvHV+WqmefBTHqcH2NtQT8/RjsoV8dNO2s+9eF8g95p6QC/FNe/dvRxkS5iDM+Wp3fI552QSndSgClxaMCQfqXgHFejAEiE4dZBJgiALuN6JgUMGAcgfaZL0JyFEhkSKlVDql3gmrpFViC3xEtyKSYaVkzSn3CPbGZbkXNlJdwyaV6QO5KyrJ2dbU/a+KqILwqpO0r+mW+Psmy1o/9a+r/48+g/xxy+mrFFAY0DFNAJoDEiraV2wqvHLsS9qABCdNy5wObdyzjkPRRf6nLfOZdC5nXPd+Q/u1ohcN6qc605L3r+u0gCAYYEP/FWy3/NrAEiyL1k/ROAzPvOnbFlLyA8cG5q+lo4LpU+3kvheuiTevfgMSyNAkmwIPOSbMAm/mGHmQYf0gY7wrOdVr/qG+eg95J9+nV2TPQGgccDyah1ZN3H0A3WB3AOnADAGYETQCJBkP5/+K5MWIwBz8bgeupHUzMelay1uKc9aeM79lOsakf6pFbjocu1JmfUJf65TVV5az0iXa951yrnuXlam3ZRxFe1PXabeD8lrfdnist9TZqzgzzGTcovaE6YaTtxDvlIfyuhywtFfjA9+9yXOkGbf5Uf2KD8kmDSkdWy6X8i8nACA/EPQNAIkEac+x4/jxfbs0L63vRWNT5zvh3JpE6QdgwSGDNpGndRV6pnzZBhpLKPeb6+thm0pu9WT7U253h9+r5QNuwqcWqGLBoDcMyK7n3SfKfF3P8r+jf0sT/894s+Te8g7DxrhHUn2iZPwI2MkqC7TkFaDAGWRlhMFPBDwWwIgBgH21+6tldMAkHtk7s0xnesmugnXxLt1OYjE2nrCL+JyECtPray9c4IwqVKhuYBIPkAHmgOsGgPSCJCDTiNAoiSqZwT49Fd96EOGQ/I0AlTCpx8SibxGJiGexEtADyGEljRJbKtcyXH6JdOEKSdCxvH3SPkpwiw766yybct2L8n13pf86uyQfom3P2q/+a8d67/5009f++/+HANiGgGQt7hqAEhLJYuSzoVKdAyDV2EEyLnnwufcFHPe+sOd6ByPee9a0EPXmZZ8+bqIAeDQ+/889cflkX9+kHrE37A1AwAksZL56idNGgLwb3WQf6zmTUtL6/ayAhdi0GsS6KuQJf+UDXmWfCfZXpJNC6I39GkfSMwpV2PE3gAg+d8hrwPk9wGyPsqufuvV4MCmgn6qRgDIvUS/hxoHMDzwnwH4PVvoitsWfNkxtpSfcB33bDrDemsEYdOac81Zw1yjqsyalmH6c627Kpl1lbJ766thp8Bsv3Vm2GXk1B0y/dALW+qfhb5dGguEO162YEv+4C/nmYpIvann2QBAvzE+IMqQ3jw+D5n3PfqeIcA9A0h+CDfGA578S9BA/OT3STpjz3HjGGkNnXbO9mWbq2yaxPl+uBfq8ck9dVFHlG89jyHpyJ/3tZTfdvfwQF3ZZmXuDznvs3mv5ZpaLbNzTfD+5WNgcjH5GeRZTgb5T/7FHhbyz3v9jAH2Wjr8EHodBF4ZZO9TXU1DuiVDgN8K0ACQ+23aRTttdzUAcK/ev/pQP4FNvLsXg4zLwaa8hKbroQM4cWoF7V1OEH8kVCyTzQknGamDLgcbnZWDzk5My1MOQmTIk2Sfr5srV4TgaQgQJX09rKRyiWyuEVVIbsYvkd4aDok2bIlQ13DIOWGS9JQNW0PT13KX/LSPuETbvIbog/jUy5Lc64MaRt8R1utDw3hijwxWV5/sVz/kfumJP+OI+DrW8GuN7JH9Ywm/80J0zojOKecY6CLnHASdlyBzVXTeOpdjfue8X5JzvWlZD1/M61O/AkB5kn8IniRfXDIGQEJ7xL4S+Ur0t+TJMuoPHv5TvP9ftD1tJf2S7K3pM51GAIk2eOyTf/THD7z61xBA2bYNiz9P5s+dAMAI0E4BQMY9AYAhRZJvm6ohgHD6UCMA9ZFGIwCIAYAye+S/hpH2Cz77+WfMmdIH98mbewLuq+ev4aap68XUEhIGLrqdPufNvuuR69MWdE2r6HpH+LGurp1r+Wta/eAhx5p9KA111zQZpmwbSVvDjDuEW/RNGvspca2PW1wdG/gdN2vYks3pEpEf6oWuuFJnqdvHjAA+Pfd9fo7049IQQBoIv3sIUAMCRgDykkcjACcBfB+ftIyrOi5aG6eds33Z5p5suj0yvhjPtgeknijbOsR9XtKQ1rljG3t5cxwfknv5W1jWW2XvtSWbL/xXeU2t8HNP/9Ebzn2j+8jkXu412asl//KhFcfy2cMk6dcQMBvYd0QfYk86Cb5+PwgomgZUNo+GAOqiDvL40cE8EcCem/bBC2mz/JF78R69Z+4/1z90FK6Jd+/qDSTDEpG3ujp4q39qZZ1zThgmWyrYiZckBdkOsYNAB9+WVwPobJ6egjOxD4NAj5gRBqETJYSSxR5KMCv5XPJDaIlbIrZL4RLjxDUybZxEHL+y2AvLuLUyjOsh90D40r1sCV/S31J49g39Vv325UUwiX7vQ3+MlyWyz7v++b6/i6S49nTfY/2iY1/MeeFcyTnkYg46x0DmHnNQ57wE65xt/jqv8ffWiBZ8+evUBoBD5F8jQA8lnknWD8nVGHAoPT9opPHHTaRvL6/N8yUwRpKsb5El3FvSQpRJBybZTsKtMSDDkHGScIk/SB/YD/khwL0BoJwAyFcBIOx5EiHrrO2z/qyTMI0AvG94yAjgKQAMAhgnnvkpz/rI+R64Nz7mP1eisuG9NYKw3npi2NTi9871KNenKruGHYu5/1CmDOVD6DpKukNyxvfSGw+mq+t2xl1U9r7In23RvxRmPlBdp2xYD2uf2a/Z101mDNj3jgdxaSz1wlsx+3GJ/NCv1JH6nHVtv9jnEHmNAJB2nt77Xj9ImO/15zF5xqlGAE4RkA7iD9mDlJGXfJTtOLPuMhZsX7Z5STbtjJTj/KUO5FL21AbCuTz6zevYbeGkfcyR7iKuV1aE0SbqAvNem/fKr6nVsGgAYA/C3tP9ZhJ+STQIv8Kxp+XJP+RcQg5B1zEeCMfPPsC9zrwHakYB8hGO0T4dYcYhm7dnBKB84tkfYAjwdQCf/ttW2++9uZdmj+S+2TUPHRXXvHfzYoD1LsN7mINySe5OrFaRg3tq8uycQE62nLRMXJUvkZHY2EGiHQdKkOoAdXBKsiRdEDaNAshrDsJIvMQRYomcBDNlCCr+JaJ6KBxyTJotJLmmkXT3SPl1h9G2Xp222bbq34I93Xmk3zj9HumvSN8Qln2GzNN9ccvRftJA+kXkdFgcHVfKPvEHHYuiYxRk3KZzfOdi7Ph3PoDOFeeOcwlkbvnjmxs356PzMzDndJ33LdnVXPwbQI7r977cf2zYm1/34f2T/x7B58eiF26YxBNSmET+WJK/lH7+4duR//xh+553/7n/+mq0+7Snse4tkflDZP9QPOWaJgm2csUk5EnA2SBUIwB+8lv+VgMA7wdSdtZlOwwXNUBodADpd4wIfBOArw+vfQ+AVw/SCMB/BnjmJ/3GJ6+qL6+x3NwXuBZQfU82bAlzXXlsf9DKnNK5PvUw9xBLsmtdRfcdbvKWMNdM5VxLe7JhNX36qS/Trcm5fq+lOzbONojkVwarbFjFqnviaxj+Xh9mXxe5jhPGE2FL44pwrox/FPIw/6Y+1EvqdGqB+9M09rVEnmP7GgEg8zqMAjzlh+inEYB81YBAHgwAIGWRhzSOD8cD7dg525d9uCabHtyfaGCslfIyXZXnumnLLg9+08xxhtveU6HlBlKv99vE+cJ/VdfUCl41ALDP9Gm5e1LJvmRaP+Sf325JvgTdI/7GYQhg75N7HtMSBvnnd1tHGOk9EQAalq8DMNY0MpB+/s8DzRCQJ27Zb9Ne78V74z5zD82am+scegrXxPtx5eBKmbvLgajcQydLD6dWzuxy0uSPg0rmx0fCIoEBJTVJdCQ/oOSIjkS2Y8EkVciSLVBytoRJ/NMAsNUQUAkmfkiqKGE9FiHK5NlCmJfSSL4Te2T9FGEv+aEfndtKWcgVMwz5su4Pf99fmstIRO65t73vr8zhFUlrGIsIfqyJGA7A173rT55D/t84DmMAyEKYx4+U/WIpWJ3GgRyjucD2Fq1cvHJO5Fxx/oA5r9xUOv/8Ua4btd38rXO7rgMt2Wku2n4KAwDkn6/9S+bXcMkQIBGsBoA0BlxWrj+E+HlSchpt9kthfKYRQFKdYReVLauSbH6wD5FwCHgaXZRF8tsu5hlknH6en/rnSYDdxwA5AZCvAEj0sx0ZpgGA/rbvGTdpBGD+HzICYAjwtQA+Csi86/fErQ9lntfLsMS6Hiz56zqif2qVPOZyz4Ds2pT7B2XXMf1grmmG1zDzHcIkx1XGr6OcnmzYVnR9zvSGiRmnnHEpG7+E2e5MY/gh/ahf9U76DFOufdrr9whzfIhL46pl2e9X67gk7iFfqTP1CE46+8S+TiIP2Yf0J5lfMgIw3syrAcETBLxGwCkAvwXAeLBe29HQ9mWbD8nmOXdPUVbGL8lTpw21vL2xxHavoeMdzLmT/o4OqNP7beKVXlMrfe9oI/2HY6/oHpJ9JftM+BR70ORRuWdlPyvBl/C7twEh+LhMk0ReAwBpIf6cuNOxd8DlqQDymocyIf8gLo0APCjwewC0t7en5v64T++Z+0cP2W+pq53c4O5eDDKvlAlLv4NxK9YJNrXyHps4OQn8sXHwJUmRvNgxYBIdZA0AlfxvMQAcMgRA6CT/Pu3FAEB4IjLEXuyR/0NhaRy4jJFgyUAAsdYgoAwZJ0x/yoRJ1pfCzQdeh/vTP/q353rAUzrIPuWBl3EsWOR34QIxIKSDQOAgYUuuGgf4fkV1dSHTGFAx50vOI2Tnl3POOQg6L10EmbOdH6x5frc5Xuf90nrRkq5f1HsZAwB5cXwYsJL+JPop13Tpl3xelujX/PzQ+QOpNRs/P3JNQ7kGryvsArH0YzUCSKxFibz+rWi+NAAo73HBGEC85BvUZR/YDg0Ab3nlBx4zAHznt/zQ/CFAjuxbp6R/3ky0eiT+Gc9Tfo0AGgBAxgPpfR3A0weS/ERPAaQRgI8Ctm6aLtBVtyWL47GHGYa85Nzc1rUCvewdm2r8vc21a5DI2oTsGlX9pjONmOlTZu1JP3Kug8pixht2GXTdFSnLNblXbk1nGsPNKxp/LHqficjVqe8MNywx+zb7viPXsaJ/aYy1IvZrJ2ke+qUOUl/qEJxw9od9xPhgzEDW/bgfBF4yjzEgjQD1uwAYAcjLE3+/J0B6Xx+gbOpyrtuOhrYt2+s9tOjFtYU05j0lTq3cvVNPovqqmOM/55rzECScdJa1q8e2e/8teD+ekU95Ta2w2WV7aZsGAPmVBgDJv8Qf5Ok6+1lIP3sqEGKe+5tK9CHongIgjrQaB0D2QLmHJp50hOepgHz6r9FBY4B1kIcHcHkKwPbD/9hHawDgft0X21epG/UV2MT7c+VE864MS3Rwig5acKrOAZ6TRKU6OVS2RERi4kCUuCSZSeLvAIX0byH+DIDek39IPuF5lNsj3uCS++p3vWl++gtC3reiR9FB8oBr7g//9XfO8b2n2fuwlmYvl6fhx5J0yql5DLsIZrt6MnX1wi8S9tq/+b5HT+5/6G0z8tSect5a/IRfxkFEPBGArHvlW//YfBoAvycAEvPrpEn4Wajw5yLlqYBK+vE75teIvwub88hFjvnlnBP9cXJuOledv87nMs9zDUB2bRBb0OYfsqfzVPfY4/6ZHgOAH/1LMr9FTsOAJBAiWgn8ZfxatJP48yOHn35EWVd90d+S6avAJNY9OcP25LwRc/Qg4dcYoB+dQ8I1MvAkvmcA4EOAEHAMAGwAJPvWk5hxyBoArFtk7PivAXklgLpxeeQfQwD1ViMA6e7gqwDMXa46h2u48Uvo2kC8cuLUws8515hE1x/RdWkNSVvje2GZxo05YVV2TTwG63qaeWucfjAdedJvOsN7ZZo+02RY5rmIXPWTOqyyfZaYfYtcx8DOn+MEeWmM9cJb8s2/OaS9z1fqJ3U6tZveGwDoB/uIPmS85BN9TwNgCMD5ccD6OoDjLA0I5MX5GgD1lH7PdmV7a78Qx5VpqrxUVk2nP9OnPLV6ZlfHa+oqdeZcUnfoAB2qR/zqBx0XPVi37WrVX9k1tZJnl/OVtsm72Dcmt2K/yV5U4s9+FmM4v9nsmyDfkn/2MpD2JO7udzQWkL4aAIgjzFMAYBoAMAzwm57k33oNw4/TCEAeTwGwv9YYkAYA7tN9svwz+wkdqa/AJt7PiwHo5WBcQgft1DKcczlJHGROEBAFSzxAFZ9EJUk/chJ/yY+YR/4lTaKEqpJ/BkMl/T7tF7cQf9KkIQB5yUn4M94wEbJPPDgTYMk//jXXSO5j8b2wrWWYtyDtpJ7EKuM/5LhH0qiLlA2rWHXd65+lvtO4Q54qGyYavxVdXPzwXw8dj2KOWWTHMphjHbnOhZwnzh0w55SLGOjccy6KztP8kStz2TkuLq0FhrfsF7+++UXf9rOeAhCT4FfZNCDHwd/7gcef/kv+k+AbtoZJPi9D+skryfeHEH+697zt+8/YEFxcc8flxNCU5F9inWHHypbRJfhtU5DhyqLEHF2pdwk4SHh+CHDJAJAnANIAcK6ecgqBuvMEgK8j2A7GCG3wewAaATAybDECzN8DaHPzuB66VamZ21zO8a3omlFxamWdc6w/hOU6pJybbGTXriXckibzsjbiF1N23VxD19eK5Klh+JfCjOuh9Wde5Yzr5c2wbJP5Loqpw9R5TyZMZ7+KdSyEv44b/Uvjr2Xdj1Fl8CFe6IgrUf2Bk85+sH/sV8dKknne54f845A57l+NAOaT+BKP40QBZVE+dVp/w2xX9m2L2rcf2SvvKdNfVM76ladW2ezUj6ieQO4l75f741QE95r37b07F1d04D1wr94n8qmuqRU0O9qgs13uJdlfsueEHEv+2bemAQCyzp7KI/iQcAm7T+vzab57H9KTzz2RJwAg7qThd5v8lE8cYZaH3/f9k/wTRv3EawzACEAaTilgsNAQwD3UB2jcq3tqdaBO1JF6C2zi/b4cjKKTA5zSMTmcGCoM9MdFZSZBUdEq3kGXZCeJUBIk5CRQkiqxkn7JPgipYzBI7nhiiwxCAJcQMkp8DytR3eKHRJMu8TECv0bWSxxPvucn6S1crGHVT32mFTOsypdpn3nrPad/i95M0+uLDEPG2Z8pG2a/OxZE4pV76DiC6CNXdPw5HsUcs1dJ+p13ORedn6A/ZjGHc26n7NxvSa/kB4ly9xevO0jqK9lPfy8NYSz+ldSvEf+lOMgf7tTE3x9Byf+H3vXhs7d//fvP+EHaK+F6hKkaAY4l/DU9BgCe0vtkPUl3hqED/SJpcehF4p0GAAm4RoYlAwBGIE8A1Pr1i9SdMv56CsC2MKYYC74KwKs9EHue/KcRIE8AEI6fNHwP4Hq69dK1uOl03vf8GVflXDuW5Km1kjhwdq5HibleIedadkg276F0Ge+aeQjdy2Q6wvBnXIbVuPSb5yJ4kXLIs+Z67e6lT91tke0TMPsZ2XFQcGn81DHX87eixrXTQOondTq1+HNGN/vI/nR8QeYht5BajvPjfLKPEQCCSxrHjuMFv6TY1wUou/R5tinbWjuQuLz0Z56LytkG5EmXYzX14z1WQwf6wKEjjQDeu/opOsi6bX/e5ynl/X3Zx7RJl5xMAwBci/2Je1r2uxD7JOKSb0k9JJ40+Qosfn77SSs5x68BgPKQCSM/CIGnTP3WSf4k+sikJ20aAdjfEb70PQDuDSOHpwA0BKgH9KKeQMfEDk/ZL7eqLAchmINTeb9o5IRAQU4KB5SEX4WChwi/HULnpEvyJKECHZggm1oGqC6PWyND7LY4jnaTDoRwJiJXv2kyHMKLX+KbOB9Tb/GJVcZ/rHvFP3n7UzVPDUv/W3/qO/Z1LIVnmlr2MX7un/SJqZMqqzt1K/GvfvqJsMTsY4l/hvVkiH6G6+8ZAAjTouhYEzEG5JjMsZpjOMe2chq80hDmwuTccT45v0TnnfMwFy/nav6gxQ+xc7uHuR5c6ULFDw0kDjKvS+JfZQ0BIj8Q1QBwUb9PnpeMAPzYrMX5Y8gPkD9O5sHPcfVv+fffe/ay570Bcojer/1iPJ3SEMDTce5xT+y5991791sxib8EnDDyHzIAeAIA0m19En10rpxoW/MUgG2gfh3jiLQaAdhU0HfUlQ7Sn444Tgswx6+9g7dXyBz3Uu5hrgUp99aNDJta4TjCwHOurkmuVWKuY6xt+lM27Fh0rVzDuq7iJ32iaRJrmRl3Edk61/JKxDKN+bI9xOtXFg+FG79V1/ZjYvZ5HQ/hzzGEnGNui9yyPNgL/XAlpj6nFjc7+8L+yX61rxkbaQiQ3II+4XbskccyMr/ji3qsu6Ftyv5swfOVba9h+sWadovfOm2DOLVC9zwn9cN9cU9J/DWIcCoCw0iejkA/GAAwhHD/5Of+KZM6do56bUttd4s62TW1kmZn/9AmnHvKfBALF+N3i32ZXIun6fyWQq4h6JBvHMTbPY9H+TEA8AReQ4DH+skHiScPDj97NxA/5VOmRgHKI446rZc4ZdKTBpz3WC2vdZCO+t2vszfnfnTcH65nBFA36krd7bDB/bly8DkJwAlXJ4CTgImgkiQhDqRDZF+i7yCzI+wYUQIlqWLDuuTmd1N2X2LnY1dJ6CCU+MGLOt4jJy9YHeSWMLHKEOk5D3hFjrrf8fe+6wwyL3EHe2ES/pq2F24ayqEO/fU+5ntv9YmQeu5ZrDL+Xl8kySe+56cvJf7Zz8qV+OuX2JOuJ0v4jdcPsoiAkH0xiT9yGgAcu2CS//r0n7Gf5L8e+5f4iznHnHfOQ39wQRcu0B9357K4m+M556t8lT9IrfpPXKwF1QCwxRCAYaAe/+fHoUf+l8IzrcRzjeATJ6EH0/FDpDOc9IRx3B/i/8ove8eM9OknNHAzEmODccSaW5/sL/r5yGX793/pJNOVYEPGuXfje37zoCf1L0LIibeuQycAePpuXeI5g8CuLRlGOk8A1NcANALQjvoqAG1ZOwWgcYB0zNGb6eHNtda5nv7cI6Rc14vqn1rthiHvnZtg1yLRtQrMNSzlur5lHPJaXuJznawy/URYD11nL4qWuzX/1vSSL1A567CcROR0pNevLBreQ/VZ+yD92afK9ndijo+d7NgRc+wdklsR42oaSD2pR3DCpf7tm+w7+9zxxPjKJ/sSXMcd6TO/snOS+nZ1Z1uyjciHLtOIh9JnfK0r27GoF+4DHeRpCMg+HzrU4dcQ4CsSeQKAMtR3a9DUnHVnm7Ktp5Spb+/sF+5JvsbDJvafycvYF2gAgExDqnGQbMm/BgD2O/zWawTAAIDzdQCe5pPW/MiS/QxD1khAPPs2nOFn7aJ+60oDgGVqNKBNcEP36nJJ9+fcXxoB2JOhD8e7ekrd7eQGd/PKweYATJzabU0uBk5cFwIQ5Ug+kpBIUsD6FFOSI9lPpBMkSXaMg84OA+1EEEKWjk7GSQJTNoyPsyFDLEH8PRJ6TJhEFjzoIP+k22gEkHSD5lEGMz5lib95JOXmNVxcCjfe/PiVxZngt3CJvsh99mTC0K+YupbsG6Zfsi/an/pFwxMh6/jFlAkzPNHwV73qG86UQcbbF3/TF38sx2G+AsAYxY/LcYzs+BZz/CM7P6oBIE8A5Fxz/oHMx5yfLlo5h5HLjw/zPOd9lf1xFVvyq738DoBP9TEI+OTfMP0gYaT5zz/8c499/T9J/ZpcjQIQviT/SeKRJf+Gg/wQ6TLctBD/N73o3XvijxGAH9mr1ebxpTNujjIE7IwAEOMu2d5wAgC9kRdCvmQAQKdbDAD8C0A2HLbFcvVL+isSnwaApVMAtK8aAer3APIEgK8BYAj4wk97wU8e3yPXkiPnN/IhV9eJ9E8tP35w1bkWJdb1yr2H6xmYBCPlTHNIzrUS2fXTTV/Pn3G3Ra6EXxImLrUz73lJTh3UNPjTZb8Q3tN/9m32ecqdMZNj69C4zPhW1IO/0AdXYupzanGzsw/so9p/2deOKceeaHj2v+VZPmidDbMtvb6z3S3pwcu0F8FsB/KEo622n3viPjntALGX+PsfEkCMAH4gkVMB9WQEOqW8jg7y3mv7D974EQnm++LecPax/ZZGAA0ASf7Z+/JbzX4pyX/ud5Ah4DhkiDnkn99kTgB4nJ/8kHkNCPgh/BoBJPyGQ/iJxylTPuUl+bctGgEoD0cbkiuyf2evzr6ce8SxB3ev7T4b3agn9RbYxNt/1cFVB/u5Ae9EZaB6405+lJGkQyUtkX4JDYPJASXpUemSoSRLSfiR84l/dqKEX0zShyy5rwi5NEyiuYSQWOIOEvtK/jcSfAj1e3/6L87kXhIO6ohXFg0TCVdO5Em9eUCf3Gf6DCfvlTmNHuqJupQPoPpf6qMMxxCAn/7XKKBfrONki58xhgEAdAxqEMCfBgEXlxzHOb4d86DzQXTOiGlEc54578Ccj8zP/PFl/voD5rzu/PjU9cD14kZWNtrsKQCxngKohgD8awaASvDXjAHEQf4gepJ3f1R62CP9pDNvj/hD/ln/bkTBGytlLPFNBkn3EnosX0KdRFtivxSWeZBx6C2fuKcxhuP3tAOj3Le85C/vjT+MExyvAGAA4ClF1ok899POGLGPC8ODYRoB0gCQMu0hrUYANha+CuBJAA0AfgcApF0YCpjDG7vgOpPVTWf6XQ8S65pR/VNr/H5f0WT8j7lck1J2zco9iHsR0T1J+pWX0Dw9ZLy7fipfFqkny9R/qNy1dBJ7kbIkYIm1DssUs12mJW4p3rglXNK54dmnKWe/l98mxksdV/hzHK7JLem4QgOpq9Tr1NJsPgXQ6/86fkhT+91+pq6dyzZk21r0tVxZJ7LtmZo8O9rMWOV+fOrvEX+JP/8aUfLfe/JPPvVBWTHGrQ/MtjTvlV1TK3nv7CP7D2RP6cNbORt7V/aykHjINCRc4s5exz0QiF/yrZGAMIg6v5UaAEgj2Te9BF+Sz74tZfyQf5A81kv5tiONAbSRNpCeeF7by/27+3SNANUAoF7UU+puJze4/ReDiysHOYNu0jnQGaDerBMdJSTJkHxIRsQkKhJ+B5DkRtIvSookSkn0lSFXyKBEH5z/l3rrUIi8jgGKg+iJyGwIwTUZMko6cLZYHSClM3kNwiyJB491knTyIYuGXwY1CCyVcSh+Kd/W8K3lZzplcNXRR0cYEuizeWzs0DGxhhqKEpExGjAGc0y6uDh2KzrOHfcuPM4H0LmScyjnlhZK553zcckY4I8P89ofoPgRYg3o/RC14Gv7UaKucxf3IqlLsp+ypwAIw7HYHyL2Gc+PQvqVD5H/PZlsP3b+4PkDJPIjxDv+PvH3uD/E/7Y++T/XAeFhnDHOlwwAhEOGuXdJ9GPEHl1V8g3h7xBwyoFkS7pB++RYA0DWqbyEtl0DQL4GoEECZJxgpOCeNQJA8DECSPgxAFTZbwHw8cBQ720Q6+Yz/T3ZDWuuGylP7aZWHevPkmON0rkXqejeJLGmWfJnHmX2OMhu+E6Na2UnkV+rN9MpJ+HvyWvl1TjbuKaTmsa0IjpHXtK9/SoujYGF8eMYc0w6DvWDXOIj3/irPhLVJTjh7Av7Bqz9aD8fQvNZlmWD1tcw20DbdE280j5UD9ZjvbZnahH7p//MkyT/POWH8GsAqOS/vvPvfEAXt+D+53vj/nD2k2uBe0l+891zyuHYq/IEH0IOca8GAPY8On7DJd8aDCDi/N6nAYAwyyI9ZbMvw0n0xQwjHwYADQfUR915GsA40lIuCK9zj+5DO/fg7Lu5V/fX6kLdqCt1t8MGt/tycIMO8HnS56T05kAntzcO+VcZoMQjBwlKS8LioEGpSW6UUTpPlyBElSSlfyb58U6//kr4JfsSfbC6JPZJ8FOeSf2O+LO5ww8eS+jX0kOcK8Gvfsn1Urjxl8F6OiDLWovLdJeRvbdE5Kty9qNIPcg6/9WI44RxseQeG1vN6OTYXMIc18rMgXTOj8Q6r1ykXKBzPiI7VzXaOY+d1871+uPc1odp53KdUM51BPnKL+5TIwAIyRc9+i9exAAg4QcldqAEEJKn4wfmkPPHzY/7Qfor8f/aL3r1h+mPK1feFVTAeGNs9wwBkurZOLJA7I2TaPf8hKFnCbdGAPuBubo/AdCMKY6J/ThpRheetDNvrWdL2zKN/Q9aP+1JmTFD+bSHjweSn6f7fg/AEwAaAjQGkAbH6Z4r6KJji3ROk885XcP0J7omLOHUyuu63HP0ZNck0bUqMdexKmc6ZdIgmzaRuYjfNXILSr63pN2S5lB5NV4/uOaW6u7dr2FiL69x4CGn7ivSr4TZv2KOhYWxU8ca49GwHJsteFwrGkhdqb+nq3/7I/vtUF8bn3mULc/yW7umcPv6W1i2q3mv7cp69+2hvbSde2OOcZSfJ/8c7/ddf4/789Sf4/68FpDfQiAvekgdtLuadm5fV/MjZzua98quqZU8O/sIdL4nv0tOB4+Dq7HHgYhD1t0PEYaT/IvEk04DAPkg4uaFoGsAII1EHcJfryT/pgVxlGOdtIN6k/xbLnVjINAA0Hv6X40A7qfVD7pSf4FNvJ0Xg4rLweWgm1rY3uLHYM/B4ITmpiURkoocINUAwIBhYyNhQZm6JDTIGAB0PhXtGQOw0tQn//nElSMdGgPEPAVQn+ymgYA4/BA+UWOAmAaBRbk9gYZM8iQahBQvoYQ545V7+Ux/U8g9UTeoUSDDjCMsXYYrVzS94fpXEeMMde2MNFuQfiZdHQtrfsaS8cpgviqQ4zBlyD1jVpIPutgwxh33IvOBVwGcI84Z55Eo4ReT+Ds/na8g89e57Pze8GPkWiG6foDXfqETyR1kT8In8QeNz1cAktBD1lj8EyX9Ek38EDzJn4RTnH/MmkEA9AdP5MeHY/5J/H3SL/JdA/ro2hV4+gqfTp9oBOD4PyQYvVRCL6l+DNkw1NMAEUZZ9oukG6QvthoAMOZpALBd9JeycbSjhjsGqgEg2+R4Ib9GABADAE/6Jf4gBgmcHwPUUNC6ht/jm76Y51x1vutPdP+whlMrq+vYZxAnGUhkXcLv+iS6blV0XXOTrb+m0298opu6rSjxNn31Hwo3/li0nkTkLe7Yug6lT/0dktV9Rfu2hzkmOuNoadzlGG3ZxrWgAfTEpb7U57k5SX/Rt4wFxxhPwJXBHCeOg6V+XuhT6wZtj+2zjeBVXdaVddumWR/qgHv33/r5rw/F/MifOiKfunCMo4N2I1M467ru+9+3wTaC9qf8zj0me0/2o/zms4/1KT0Em99piTfEWkcYv6nES8Qh6uzBIPI4/JSlAYA44w+Rf9OB5KcO66HM6rIO2pX/ErDuy7lP7pf7RgdpAEh9RT828fZcOZhzgOdgm1pz9xPeAerNOegZEJIJyYWDQ+LhIAFR2CHy73vPEh8wyT8yHSJhkvz3DAAQMUjXfAw7jACQtiRsaQzwlIDErqLGAckiqCFA3EI4ewQWkk94kn2Ib7q1uEx3apl2WWa2nTD9KRu2iEeQ854+6Zfsg9pPh/yMCdIkWb+IzHvGjLH6AcAcl4zX6uqYzvGO7Dy46Pv/LkrOS+epi3j+ADGvneP+EDP/dy7Xhd7a0ZLd/MUJCd7tluiLGgP0s/BDzHQaAfSLhkvoCEeW+EE0lUH8/Jjx45E/eJJ+jvlL9CvyxJ/+uXktnrYFjDXWaQwBj5H5HbmXWM+ku+mupuuFk2bNAED8lhMAbEaS5Fc526Kc7c3+d5xojNDPuGFskF8jAL8hkP13vPYvzEYAZYxD1QDARuO0vXJ0ablHIHNdA9Kfa0VPnlp+wsHHnBtg16AldK0S3Zckur6JxCGnv6Y3HmTsiq6ZYiU3hovGi4ZfFNfKyThlcKtbalPqIuVe+tSTcubpyan7nkzfEm4fJzouemOohfXGXY5Rx3NLOq4VDaTO9nMW3ds39jVjDWLLE3D/3Z+YT7sdO+Szz+1X+xRsbZp2Lvsy23PdfZh173VB23s6SD3U+6/3nve9cu/UmW24yvtX9zPaT6D9lxxPXqcBgNN/kG6fursf4rcWgzscid8/ED97JX7Le0TfcjQMSOp75N+TAzUNfsuB5OOoS4OAaP2kJQweyL7efbxGAPbmawYAdKTOdmNYfTbv9V11sOjPCaU8tWadI/veAIPVAc6NSSIkFTkQlgi/TyZFlFddHm9GZtPYc0vHpg2XyDPAHGQiA67nGIQQSRDHJm3JQb6JA3Fs6pSXkE2lcSkbdixCsjNP+pXB++gwJnBfPXzM0HCEgeFYY0IajzQi5JP/fNKvzELSG9OEpTEgDQF1nrDI4pxLYhrZkJ2LxxgB6g8xa8LOuU74I9SC5x+jROQbv5aMAJJ/DAQaACBokn3RsB7mk3+IX/qZ1xL9t7zyA/M7/RD+JP31mD9PgemrprTpxhV3xQ3gPiXXIOumRHpPrFuYaXrxxomQakm2pBuUbB9jAFirj3baRttuG9IAYBtsUyLji02OBgDKy6f+GAI4pYLjNQCNAIwRXOse5t5NXu4f1jDXiZ48tRvY5OqmuPpdqxLds2zB3IST3n2OyF4n9z1ufCsm4a5x+k2jv2KNr/619JlWGbyIq/XorzrRn2haMeOWZPW+1l/2L2mUQcfDynjqjb8cuy3ruFY0gK641Bn6nHDonj6w/yD+kFxJL8fccX7ojqfgHn0nzdITcPsUtK6G2Y+2xba16P0+BPkqLutK3OvCMem4r/OOcMY/usKZXsx7Lvc9tZtZunfbwv2mjP8U19QK2Tvb7j3K/dhbuu9kH6oBAI4FiWaf5QMRn/rDr4iXn8nNCMcQ4BP6fBovgfd4fyX/+CX/vTRJ/peIv+RfQwP10zYNAJJ/9um32QDAYEiXA0h537F0cg5AJzUd7qJtp4OQfztfTKLhYAAlJokOkEpqUCgbd5S7Rv4lT5J9kA4CIV/pNASADjaImjKYfgclhgCNBMrHIB+fIv1JnUfZE5F7fsMr0qYapt84sYbj956UTVOxllHjM79pj0HbUZCNtW3syRlGOvtpCRkfpsux4pgBdYwxZNCxmGM0ZcfwEjL+NQDUeaKfeYTLuYWc8w8556bzFdSI54+Tc92Fvv44tXXCtUPMNaZFX8mPEOVe6EIXEP3qMAK8/dV/8+xD7/rwnjhK0noGAOMklZI9/Mj8uPHDlkf6k+SnnE/8edpP/1zo5u5wJsbb97z7z/3XkmdJ9RJWsk06jQbEaQBI4m1fkXbNAADh5qm7dS/VtRZPHscEmO1w7IiML2TyaATgdwZyT1sYmxoAZmNVOwnAuPI1gBv6FoCbyx7mGqDs+rCGUxvCxINdl3uSnuz6lOjaVTE338ZlmGtfD3Pvk3IS7bVw05EmZfNkGLL+Kps+0bSWbZ6LYJabMjrBv6Qb400j9tLXMPqCsET7p4fZ18g5LjrjyPFVx6Hj1PHcso7rgAbUmbqcWvr9v/2mDxlzGgE46u6x9/wIXn4AD2MApwPIw5ixv+1Xyg9nvbbjpvou60eex5jjkLZ7H2Ids/rNUzHumfv3vsWsv0Vf2TW1ks8574e+wrmXXDIAsCdaMgDseVbbK8vR2F8TTr48DSAZ75H6agRYSlPJP0R/zUH8zUO7qgFgjfyjlxzP6K3osnlv15WDKmUH3dSaO7scrDnYc2Hn5iUXDhIwiUgOGglLJTISnJ7BQHIk5pNTZI9ZS7A8vgH6JDZx6ch3Ps2V6F0WIZQzUSzkVeJ6Yygpv8J2ed+JVcZ/KpfH+ylzqZ/XwjnST3wi42jtX/o5/uq4dLyKa8f7Gfds+NM5V8ScUznXnH8iczLnqIs5mD9IzvOGzv3EXBtaktt/cd88ia9GAPwYAX7sQx+dCRukbc1BMiV5yPPT5fZE2KPakPzqeI8fko/TaMMaR5+h89uvvStt4RPf+IpXvBEinKQ7iX3Kc5qmb9OLGF+ScCuD9BHpNABA9D0BInr0XoIvzvXtTiLUMNuV4Y6NNADYFsm/qBGA/BgBqIun/Yyfc+S/GQPSCICRYPcfAZiT130x97lyDViSc83oyVMr56DLvUbKzB39rl2JubYhbyWYuT4is3YsuUq8SZdhS/kOhfeIu3ksv4e9fBcNsz6w6uQY/1L+Y/ok+zL7OMeAYwFcGFd1DDpuW/L9eEYe1+MaQFdciehzwqFz+oJ+or81AEDs0wDAv76DyOn8V3icDsBY4IkAxpd9ax07tA/tu2xPS3ItV9ZpO2zX1Fpw7kFqjsutMmWEs2zROsWWdN8vyKe8plbY3uU8dH1wv5lcjv2NfA0SnwYA/JD7fPo/Pyxrr2Tznj2yRgANABLxJWJfDQA9P3lxEnrGIOVqAPDov2i4Y/UYAwC6QC/qSL2lLpt86y8HGOjgW8LHBr0LgjefPxooRlIiOpDEJDU5uCQ9SYiU01iQchKslCVg4h/4mi/8mWPcC1/4NWek/+Jv+uKPfcUL/uAZqCNO+Tbgc//8c+b2HIOZtsrVzz0SthRuvJjpDANTNk2GmeaUaB8mHhoHjBnSOHbEHF/KORaVHbOJju3EOg9cXJgnzp1E5lbONeefyLzU+YPU5vdUXG+eux60pFf2g0PZV3VN6Az9VSMj/m99/bd+B+573vnOvz679nSaJ9TpeFpBGkgrxxzRO3pFj63R6EwdJV7V/dybctn4SeYl1McgBgCJtYQb3GoA8ON7tkHiL8k33DYZn+HEpYHIdtCulG0niBGAOE8BUAbH/SH8GAE0UIAYq0DiMQCwjtzQAGBscyXmeEfurR8ZNu3SJCIvOteqRNexirnWKa8h6yXxuW4iu4FL2TAxibhkm7gMr2l78eataNqt4TWdfo9a6++h7azo/Vf9VD/5DEvZsET1nYhcHX1bw/Bnn+eYWBlDOf6UHbct2348I4+rrwH1Vef4OSMA/cz48jUAyD0kn1MAGgEgYpIxwojDWIDRgN9WyqCfd7+tU2uOfQZmO/otvZ7QbEe2b2rV712OzzU584Sc5V73ve/vIeeg64P7KfmZxJ/fJh528OC1GgB8DaAaAnjqj1EAl0//IeSQcMZKj9gfG1YNAUtGAAwAxGkAoF15AsDXANj3c6/cM/fP3j336OhK3UWfotdbfzG4ucQ6EKt/amm7hgAXaxUB5o+BAwpMMoOsQUBEudUlYVJOYpWyBKyiZK2HkjtR4pckkbj0H5IhsKZRltQSrjzwkVGg6iT9yonIW1z2m7L93BsLGVbHkP4cbyk7NivW8exYF+ucyPniPHJO5Rxz3on++DBPi6tzOX9oWtL9GoA8rqGBk2uAse6T8CTWe7k8+U9yDvFOoi3hBj0BwOs9fKCzdwKgGgAq0acuw1JOQ4DxngKwDUn4ezJGANqoEYCN0Le85C93TwHMRoD2KgCnAP7Q81581jphOnlH9At0D5CI3HO9tSTDaDN+cNW5+Xfd6qFrW2KugcfIrqWJudamDMHBX4l0DdMvmh5/himLpjuES+kl/Iewlk956dAFfnWSsmFb0d+omr72EX25FJb9rFzHxcq4ynGInOO3ecfvHEroXD09pS6nluecEYD+Y6zkaQC/BcC/xeM1AB3kH+d3AjAYkI9xQh/v1oGsr9eeTrOvJIi6ubINyNk+5Km6Ok7TX9Pu/LXMWme2pWU52TW1kvbOuei64L6UfSt7WYk/RJi9s6eved0Vwg95l2j7hJ1wnWE+dSdtOg0AFz0BIOlP1PhU25VtIc660wDAyd+LGADQY+i1ibf7ysGlXAdkzz+129psCEAp9QeBgVZJj34Hn1jJk4Oykiz8ScZShrjhl8AlQvjwJ/Fbkhn8xEkgQUiomIS0F5bxVyk/64/+5h+w/KuULXsJacMxcWvpLQe9KpueMNxSv2V49n1PznGTcm+8GdYbo45f0fGd6IIr5jxxURbdDPmDmT8uux/QeV62udmbs4Tlj0vzjmto4Ho1wNjN7wLMBHtH/CXYooYBNhGS7YoQ7moA4Ih9PllHxgDAET/LTGK/JNMOjRCz3Pyk7RkAbNeSAYBwysAIAPKEn1dW3vuBv//YSQBPATz/c77yKdaf6+2hfW3uB3LNqPLSOkP41JyI3HWuW3Utw5/rnbJr4bHIumqeXGNZd/G7/oqQZmTJc8prYVvyHcpfyzB9DyFRul58DfP+etjTS4YdK6vvJaRPjVO2n6u/jo+l8bQLz3FZx2xLMq6mgTq/UUrqKnV4bh7bF/aR84expjEgTwZgFNBB/P1vAaRlHFIOZbb6p+asN9vSgm/synYg2z5xamEXdZaRWOvDf+pragXunXMQpD/cr8qzlsg/JJnj/BBqiDdEWrIN0ZdogxoCwNnAjsG9OfzEk578lzEAJOHPdtiWbEOtl7oxzOcJAIwccIp8+l9PALiOqsPUa5PvzOUgS8xBuSZP7S7PGQNyEU9ZJYn5g6IiwSRIKTswE3vEyzDJWSIbKvxJ7FKGEOLvEcMMg1DiT6xyks5jZMgt6deQuDUnMSbNVcqWLUrOxaV7yPtTN6bVfwizP7bI2c89OcdJlR1TFXMsIud4TTnHd457ZOeDmHPGH9uKzLlwa/Mzf1Balv0PP/K4hgauXQOM5TQCQIgl5ilLzNee/vcMAL0TAISlAcB6lp7299pjnp4BgHakEcD3/zUI9E4BvOx5b9ifAqivA2AEwEjwBZ/9fE4BXPWVv/u5XqzJa2sOcVNzIvKic/Nf17hcB5FdH8VemHE9dK2t62+uzcgQmYpJpI0zTL9Yw/WDNU3GVdm0YsZL+ntIOsMzjzLl6dBFyj1/1ddF/L3+MKzXj7Xv69hwzJRx5XjLsekYbkn3l+N9H3DPBe9XXaxh6i7lqelodrUvsq/oU8eH48pxV5F0pC99SZ3ZvuadL+9B/1Wj9SXartSL8tQadKwzb0Xrqcg9Z3vwH3tNLcM55zy0v9jHss9lj7xE/nk6DlnmnX4IvOQ7yTa/rfVbAPwG6/wQIPl75P9YY4BGCMqzbl814HUE3Px73zE8UD/tOmQAgBegG/f96kwdFt02792/csDlgKyDNv1Tu+2uy8UjFw5lFZnogiKqdDGJlnKSMTvLgV1JXPor8at+JoVhyj0yuSVsibSSdynuLofnfSknIl/U0SfktW8q0seEZV+nnGNE2bFU0XGX6NhMzDGM7BgXcy4oL82bXXjOMeWckym3LOMaGri1GniC7zBItBMl2oYlsUbGup9h9QQAZP/df+anzp0CmMPaO36WCWY9yGwODJ83CjvDhOlE6suPAFbyL+nvIeX7GgSbJ/5bxGOnAPiPAM0AwIcnv+JzX37GOnVNvZi/9VSZ64ky6w6y688hnHZpwUXn+ge6PvbQdTTXVtKlf03O9Vk513HkSlTSX+OrP9OmvDVd5lmSk9wjk06sci3DdoDpUhfKhxA9m0ZZJFwZ3OqyL+1/x0SOkSqXsdUbk47flvReX9wnV6L33sOermrY1Mrbu6p7+8f+6qH9X+PIuys766ztbElu9KrtwZ/tTXlqcVtc5qlyra8VuV+LkS9zTS3z3tkvrgXuffnNYT+NASCNADyU4+Eejifk+Q0Afpch3zxd9/1/SD7E2v8A4EcAOW5POoh37x3/Y8l/lkFe2sJvOPXQBlBjAOH1BADpaSenGo49/o/u1GPqtsnjCg3UQZ3+OgH0Ty0/ciLy7OpCVBcXO2UN/QFLdDIkVhKYfiaNfidQxSSbh2SJqkh6ZVBnuP6bQtvRQ8Iu46oe06/O1zD7MOXs75SXxkqOrTru9DsuD6BjW8x50JNbcas/5sT3Lsoa19DArdbA0kkAibhP/5NkS/7FQwYA3quvBgDJvPUkPiaHYYC4ngFAsm+b9CfWDwJiCOBdf8h+978CtHDiv/DTXvCTV9yJuVb01qBemOtXxam1NcPwLzrXzoq53iqzNiOLhicurd+E5zqvnL8JypU030a/hF9jgJgGANPU9nufiegDv3rZij29roWt9Q9x2Zc9uY6TtbG1i8uxmOO8Rd/bqzdfDUt9HJKnpqHHXO2D9G/pM9KXcms7bCvolbJhV41ZZ7ZJubZ7yT+1huKW4pfCraeHrbhz+0L8W66pJdq7nI+uB+6x3bfLK6oxwO8BQK79BsCaAQCCvYX4U9aaAWAtLg0ByBgYIPueRACrAcC2Y6So5B9DR74CgC7QizpSZ+oxddvkcR2hgd4gP1UYE4yyliaa4dMuzfxKQ5PPvdqQC51yb8Hrhfnj5kAhjXIiP7z4t/4AH0rnj3qig/ZYpC7LyXoNE42rfsNF7zPvf6vc03ENs49E+vNI57i4CF527Lam7q2+lmUYmBfxXOIj3/g7NHD7NfDEmhFAQg3qNAYYVw0APFU/dwKgPUnHAMCPPwRegp9P+TO8yhoLxJ4BwLbYtiT+KWMEYEPiKQA2Hb1/C+h/BPAUABuPa+hK1w/Xmx5uXQun1l7SJiI/5lyfRdZx5Lqe89uwFLb1d8PfHtDfJ1BXyXLPT1rCxZpmKXwtTy1jyS+pl/Cnnzz6q5zlea8V1Q3hqR/DlxDdG6dsfxC+FGYakb5Nufa1fsdJYm9cRViOWcd0i74316F5m/ffk6emic0u9X5RudRX22QfeV8t+Y1d2YZsV8q1/fqn1mpl0TDR8CXMemyLYa34/WXcPmBBmFr4OeecA3NNkOSmISBPA2gA4EOAEG0crwDw+8Zvq6Tbp++ELz3xl6wTf4jg9+IJ00HoqxHBts2/+bsTALSVJ/+kxXDBfdQP/1XynwYAdaX+ql6bf1xFAzlIlcVMatgaEndRtzTZtoZPrW4deZQPIgsm6Xt4zGLKjyHpE/2BvC1o+2p7DO8hYRd1x/RDJ+3Wvl9Kd9GxaL7WpD2BNwzkEh/5PvF3KfwTKe6H9ASnPDiShkWWRRpL7Rve+Ib5R4YfFo6c8UOD48gXpJIj5n5tmDG1VRXU9Vmf9OKXfP4z3vHdX/Rrvv+v/pZ/8/vPPuVf/W9nh0zY733G617PD2OvXMY7Pwpb61tJ93TKWom/L1HnjAASdIi2hLqSf8PBQwYAPrbHRwAl8OKe6LcNgWFpFEjZNoE9A0C2B1nX+xYA94IB4K/9+LfP9fKU/82v+/DjrwLwGsDuFAAfBLzCzq7riH6wuqX1r4ZPLS9hYNft5s6ikb3+buhnbimLhoE9J0EFJbjKbuQgychJlm+rLNHXEEA7M6zX7rw37zlRHRGmXBHd1rD0q/sMS9n4Nax9ql/s7Q8YY46nhfHm+HQ8t2Tz5VjXf5cw2573pew9V5zaTR7tUu/kT3/K9JP+lA3r1F3bZ/u9P7FlvfHLtmQbkes9VP+0kGYpvOav9elvxZ67CN9yTS3R3uV8dE1IA0CeAuA1ZIixjtcAINMQab8BINEGIdcQ7R5xl/hLxpfSkM6LNNSlX5T0g9RnmYabz7iMZ//I+//sLasRgPvF8JHkH92oJ3WX+tzJDca1VQNLA9dwB7xIuUtxpjkG64Q71j+19pzEsVBSlgvmVaGL80WQPObrtW8trpd+KUw9nEq3rZxj+7WX/phxtZa2Nac7hjMc2YuyuMRHvvv7d2LR5V0z/r1bute+9rVnGABYuPmB4YfG9860NLPw47D+Evetr//W72DRXlIXpB9yL9nfghgEMBTwI2C5tJd2678EPv2lL3n5+y+R/y5lnfIkAETbp+qS/yX/IQPAm1707rM3ve479k//k8xL/A2rfsMTewYA27ZkCNAgANZTAByN7J0C8DsAGDD4l4AYnK64Q3NdWVq3euthDZtaO7uOdd64pTWfcH9fKjLPCOshYUsuSaiyGzixR5p7YaQnXOylOTZsS1mV4Cf5p75D8bbJ+62IXghLrLK6A9F1+lO2H5bSGb+E2cc5BpbGjGNqAev4dGy35I9dOQcei7wlAbWN3k9ivWf805pb0m2Gkz/9x8oL9de25n20LDd6qWvRxmQbU673Uv1TK8C+qHGH/FlPyrQJ/zHX1BLvXc5D14UtBgAeyGAAYM+VxJs9mQTbp/oQcEm4+zL3biBxkvk1JB1lUgbpzGc4cTjLpm3I5iGf9Svz0CjJf/0PAD0jgHpSd6nPndxgXMdqwIEs1vyGgzrS9MKNvygempDHxE+tjVfiXIQpX/m2oW1LRL4CR59Q7jF9s5b2omOnl681qztOMxy5XpT1oC4WVxbkJP0pv/CFX3P2FS/4g+ccYV/3spfNpwK0OIP8AGiRxhDwja94xRurMnmiD+HPp/1bDACmIZ9l0i4+lqP/osjmmR+mi+a/a/lYsyDgOEi2ZFpyvYSPGQBe8pcf+wAgJBsSn0Q+/RL/iqbJfD0DgG1Nor8keyqAUwC+CvCal775zH8LOBP/3dN/jQDE7/4jwFWsBbXM3tpF2NI6ObW4g27rb1ISvjXZjdcW7BHRJLvIEuTrxl7dvbAeyT8U1rsXyq5O8p7hhoGEp78n0w+G2yf4U06/4UvY63vGEOG9sbRhDOb4zTHesu5/l5HvypX3kHLeJ/LUcz0dLoWRP+P0ixm3JPfasAur7c17QeYSH/lu7m+2QxlMV++n559anup66WpY1pNyK26+COMSH/ke/zu1oL3LOegaUA0AvW8AQJQ5jclxf0k1ey5dkm7DMAywJ2MvxolN9mbk7ZF+yb1x+CX6lKOf/Mig9YDWQ13I5NFAYB78tIMPFPr039MNS68A+B0AdKXuUp87ucG4LqsBB7JYyzMc1JGmF278ZbFOylP5p9ZuygKHe1wHp9Jzr5zLjomav3XhuTHY8xNWL8rhEh/5HtBfNhD8qCThR+apPyT/d/3O33X223/7Z519xqf/1rN/8zf9GzPqJwz3733J8+cfGMk/PwDp+DFTpSzglyH/GgEsD2sx7QRbGGPt6IsfFn6UsK4fnfkOZ6AvINsS6iXST7hxWwwAGFJ6ZF7CnwTfdMZV7BkAbMsS6a/hGAEo513vecvcLgwU+W8BzxkB2jcMOMHAKYATnSxZGiGuOXUtw99bMwmbtrolYmB4j/BlGGMDP7jkTG+8hLSHbnTFHllOgm086ZFFw49B84qWhz/DlsrsPe3PtMZnmHWI1iWqI/zKF0F1D2Z+/Rm/JNvP9qfoWAEJSz/yxrHoWHact2z7vSNheVV/xl23bFt6SBjOexOnFrZ3VV/H+imr5umF1TTpz/bsZNsqei9iS3arLtrlZRsTvY8eTi3jFtfLa1jWlbJt2oLn2uA8dC1I8g/Z5XcHx74JUux/AWCfxtF59iqSfQm2CBHnCbx7MYwF/B7j2JORTiIv0QcNAw2HtOsoj7KJl/QTR3nUpyOdez9kwklvvfhpP7/BGAG4JwwbSf7zFQDJ/4bXALb0w0hzpAYY8FziI9/5v8Y5OTJ9jTPNKdGJet04tRvFUW8PCbtOV9th3detF+o7Zf/2ympV7Mdkxmc4cl6k4xIf+R74XxZeyH51PN2H6Ev2If86SD/hGAdw+lnYWfz50fFHAMwn6yzokviL4pf/2l/+J9ltkH/r4ceDH9YWzzhcvNgk0RZIP1ZxkLDFDPc0AtKQBgDJdZL+KkPaIdMYiniSngQ6PwAomZfki4aLhvcQ4o7LdlWCX/0+9Tdcf54C4FsAr//GJ+f/CJDtnz8I2IwAxF/RtwDq+qMf1PXW7KnFH+V243kmEeRNYoAs0avoBpVwZTD9KWca5CSiKbvhTayk+ar91C0pTzy2Xkm/SP6Us7y8X/SRfuSqo/RfRK59YP8s9Rnha66OG/0HxiNjmPGaY9nx3YL3v8MZRni9iL/pyzYm5n15r1Nr6OzU0RKi76W4XjjlZnj1Zxyy8WDH1bbnfbXk+75BvsmLdnnZRvzKYL0X/VOLO9aZt2LW14rd64dwLvGR7/G/UwvaO+ej60DPALBE/vmQLfspn8hLwivxZz/Efoy0kG32ZBJ4Sb3EXz/kHlljAKRd8q5BAb91QeZJ4ykDCb9p9RNvHbSD9uS/KsQIwGkAjQAYP9ibrZF/dJg6bfK4rlEDhwY8TTENmHIvzjRXjXViD//yAtrTzVX3T5Zfx0nPT9jSRVlc4iPf+HtOA1iXJf9YZHnXH4TcQfIl/T7996l/GgCIwxCQBgCNACDhVsri/uuf+Lr9h/6ONQJ83id9/Kl/9xk/9V9anshGmXf4qQ9CT518aRZij4VZh98fUdLg5wfYch4iftVXfdVXJ8mvBgHjRIg6ZBoj0bfEKwD+C0CJPUg6PhDJNyF4HQT3R/7IH/l6Nji4Kpvm25588nvJqwEAlNDbvvQfknunAF76pa/e/1vANALw3wAwDnzF5778jI9UXtGYcF0Cq+utvVNLt8lJAExfyYH+SvrcmK6heXppemRVgutmNzFJck82rXH4lS+C5q+4VpakfgnX8mY9yNVVfRFPmFjjL+Lv9VP2YU82DGSsiI6bRMfYAXQ8O85b8v3vcs4Dwm/DVdtku0XvR5xao/cu9aOcOl2STQsu6Zx6Mt0WOdu2k2236H2JLdmtuWiTl+2z3VOL2Bs4q86qP3VFvgVn2RWtO7EVcfCaWopzzjnpepAGAJ/881CjPvlnX8beBQINwZewQ8gh2RBySHcl/+xzJOsQdp/Gk1+SL0HHryzRt2z3VhJ+9lnUZ/36qUtHWuIpkzDaz33gOM2AwwCgEYB75t41AuSTf/Sl7qpOm39cN6wBJ6p4qDmmW0PibourC8Jd9N8WXTI21vrdeNPg713Gi700I2xFAyywEDmcR/9BHEfrf+/v+T2zEeBT//VPPWcM0DDgKwD+KPEjgeNHyB+i/LgehOrTn3jeGUYAvwEAqV8yBBCn48n/5/7a75jzrtzS0/mhgNRCJqk7HaRzNkI8InbTSjkPKqoaAST7oITbMA0AEOg8AYDsBwAh/1jwmxIvMzefgHhhPEgDgG06RPozvp4CoH20/9ApgGd+0m988sQDQX2AVTas99sytfSrjg1upun5CasExE3VFjTvUtoeSXWjmwhx1r9Gok3Xw635Mq+ydYOHypH8k065Yi3DchOzTuUk/IYl9vRZ86Tf9PSPMrjUX/QncfZrD5M49eQcc0VmHE/N5Xh2jCe2JPu5gHybLttJm5TzfqYWvndVP6nPXh/YNyJpUs48WVat55A/27iT8x6QvTeQS3zku/6/tX7bR1snnPpQZzlvqoxOderU/FV3lr9D9WT9iS3JXk+1vcRxTemsG7SN7MH4reyRf56MQ44hymkA4Mk+hBoSLwHHDwln38UejDSQf0g6RFwnyTcf4RoCCMPhpzzKIj/OBytg1oNMGaQ3LXLWR3m0R7KfyD36PQAe1GgE4D9ReQoAXaXuUqc7ucG4bqsGnBzioXaa7hgk7XC3Rwf08db+O3Y8HEo/4o/QABZXjQAVPR2gQcB4jQVal/2B8MdB5Ck8C3c05wlIlUYADAGQeowBOoi+zjDS4cjHD0OUN8QTaQCDiSR/DelrXgGAQPMv9Xx6zn8AwMKPgeDUT87ZvH3wgx/8cJL6Yw0BGAFsO22krS/+gj82t/+d3/7z+/uY72d3CoD4pl7XsRNpel/M2u+VG09xark2OTa0mTY3uG56QealmJurrfJSXjfaohvdipU0V7/pCUdOzLTGZVjKGa9cMdP3ZAk/cSnXtJSbZetfQnSUcWv+1GemM3wJ6U/isl+z75D1KycyfvDnOKpyjreQHbuJOeZb0v2eDZnrqubao9IP/7X+xGxz3gvyhEt9qDv1bb/Yz44ZxpEOA2w6w80DZh8e6o9sD7LtDKz3kffYkl37lfq28gyzfXO7vT90jG7Ql/rjVJnuNa95zR/H6TcN6ekH9WtfpV5bI6adS13ZDtG2LqFl7NG6qDuf/vNwIp/8Q4arASCfnEOoJfNJwNl7+SAGGTKuk+xL1o0nnN9GiTtGAPzs7zACkE6/YYRrbCDONliGdWGkIL+kP8m+JzMl/nzQGYce0IdGAHSl3pqi97oMuYnjuqsayIl+7D3kRKzlrPnNN/ATP8JVF/TFmg7X4i/Sj8fmGelPpAEsrSzCSfB5HYAfGX5MWMBZ0P1ADIu6Pyos/tWRB0K523w81srZstsMAc/8lGd95As/7QU/+fxPftlM8CX6iaTBaICFfKm8xyoYARfSAMf1K/mvJwB4Gj9/A6C9Jy/5B3n/n5MgbKwuVPmGTGzgkvinnMaBnpynAP7aj3/7/HrC2ikATgfwLQDG6oamHZPENZU8dc3Vn5tO5Knn3AgTt5sbXSROYlLRjdUWJK/pUiZMgiLhAdm4iW62E92Eg+lIU/0ZlnKm2yofk1+yIB5bB3Udcms6Im/VaZZn3kyTsv0FZp8pg2vOMbaGvbG5C3PsOp4d34kt6X6fkTJpbvLKNip7P1Nr2J74q0vngX3CWJGcQkIlpG95y1veiuNVp/e+731/STQcJK15HQP2pf211ic1jvYWZ5+A3p/Ygs71Cf6LXJTHdQgfpfrEX9shErNvr/eGPpyP/Db09Itu06ljDQMaBSjHeeVcsZ5W9xT126ale2pJ99fUpL2z/0Dq8uk/RBfSC/nlCbjH/zUASJ5FTwRAwD3KLwFnLyZhr/sy00jeQdMoS+Apw1ME7gEN08CQ5ZiPOnAYETyhgLGdtif5553/6tCB5D8NAOgJfam/1GmTx/WANFAn3WVuvZZ1lX7KPqXjvq+yvZfRa69tGXbZskf+q9HAEyy0/AjxbjyWXhZ6fxiwNmsAQPaHQyQdBJKNDhuUq2niKPWqNcCT9moE0A+xxgAA0YccpwEAP0aaq24fm4CP/MSP/wNJ/poRQNJv2noKgCcqS6cAeJ0BowYGqiu6p7Xfg/1mt9WNPFXn5jSRNOlPWdIgokfkROTLuiSfbqh7mBvujHdDn2HKxm1F8lmPeQzTvxXTAJBy5rfsRORTOwmm5abOU7YvCVO2z/HXsaA/kTGEP8dSynVcrvgd0477lnS/J0Lmck+TcobNia7oj/UkIuts/9TC5nmGXtCj/cFYkLRL+JPos7b+8I/8yE//7Y9+9Gdwf/fnfu4XcPqJx2EUgKBCTimPfs7+W+qPpfCF/vJ+RO/T+z9GzeapaBlZ9laZvL20tndq8fOrAOofXal39CfxR5/pDO8ZA5zbOWfUH/XtHG2wbU1cvKYWs3f2If2Z5B+y2zsBkE/IkatBAEMAxFuiLcGvD2cg7oaxT0sCz/7NsJoOA4BGANJQBvvCujckH+VI/CH/fkuAtPzOpgEAA4cf/fPeE9lHYHifHxS1PakGAOdB6rTJ4xoaWNUAE5Wr4qPQ6/lb676o/3pa+4laajs/ETOk+6yBJ/gBZOHlB5X3sPnR9EcUvx92Y5PCxocfyfuskIdyb/SjhF9ynX4MAFj0zxkA2pF5NijXqKMnGI8S+62IAYB74QODnAJgc4MBwG8BnHsVYPcaAKcE2n1NJ7q3XE+rjB/nBjeR+me3m2d72c3pGkIMes4N6RrmRpgyDqUlfXUS1R6ydhBesaY1fikt8VfhJASUnXLWZZsMq203vhe+NQydklY0X9U1fvrI8LX+sj97Y6OG9cYXYzLHo2O0YI7jJE6Od+dByzZf1W84uBaX6U4h275s/97Apo7pB8eG5BNi6W8lhF6y/8u//Mv/Q3UaADAMkId1TfJPufYn9dkn6Fz5ENr/lkP66LO8t9o3qW/1voRV3+ou0fIy7Bi5thX/hFMf3Gv2B3uT7BMJf8XeaQB0T1nqnTp0u3p7+mpR566p+WZnPzhv0wDACQAIsEfgIcjIkOQ8EaBBAEOAxgCM8fm03SfwEn4f0OCHqEP+JfGQesN82EM6jQJpACDeMshPXhxprUsDAOQfowTx9UN/3EM1AED4k/SvkX/0qE532GBcQwM3owEWMK5D+CjV5f8eqqfGX77GUcLQwNDAg9IAm58k/coQbQ0Ar/yyd+zfm//mF33bzzYFTdetJIxQW8m/6TAC8A0AXmPgY4Cveemb5+8Z8PX/NADwXw0wDBB/Rd+dYK1ecnWzi273G94m45+dm9JDuEQU3Jj2UNLQi1sKk3iKbnh76CY742oYfsN6aHwPKddw68gyjNuCS+TfvNaVaJ2J1p9hh/LUtKlb5YpL/eM4IL4nGyYyrpAT61hzLK5gjuelMd+y7+eDciLyVV5172Q757Z7/+gCXdMnjAlJpkRTQ3k+7YfkJ/HPJ/894k+5lE899qP9sQXJYxtzfFImcdxLU+S0c1v7Zk336iqR9OlPOetUNl7/MTi1umZnP/V0YH/RZ/ZbIvG6nKfoUr13dGe7WxO619RCJ/vRuZwGAJ/+ewQ+MY0A1RiQRgBOZXoSAIOApwEk6JJ6n/5L+CHp+UR/zQBgWZL/+uSfOm0HafPov0aLJQNAJf3oB6e+1B+IPotr3nENDQwNDA0MDQwNDA1cWgOQa4m/qAGAI30aAN79Z37qjA3MpSu8YAF8a0JyvwUxAPgdA04B8AQlTwHkaw38ZwOMALtTABds4WPZ2DByJbqJFOvmd2rpzzk2oludm9dENlL6c3OFnMTDONIq99A8YDqJjBu5HiZJUU4kj/5Dcsab5yrR+sCeo+61NMavpbFc9KoMqueUDUvs9VcNcywkSqYM6403xyVxyh2s4xm/Y71ii5ovwvNKf8qZ5lSybaKd+yfMzgH7TEIJ+eepMuRfx9N8jQCJngwgHXl8+kxZlEu/2TfqfQ1NK5Kf8UB5GiWoI8u3H7m35mrfeO/HYitqsU9rHaf0cw/nnPeXekv9qCP0ZF8i13lEHueRZcY49x7UU2vGfk1H5pp01m89aQDAwIzzSTiYRoH6rjz+PA3AU3ZIvOQb1AigIQCyjpO8i2kQIF4DALInBUxDGOVB7pE1CEj8ffIv+e8d/deIwT1wj95zGgDUEajeRPVZsHnHNTQwNDA0MDQwNDA0cBINsHGV/IMaAHgqrgEAwsyP90kqvGAhPMXZQv4zDU//eRUA5HUGSH49BYDfUwBs2C7YvF42N41L6OZSnFoh51xuSA/JuRGushsrMQmIYVvRzbIbbNENXfUT7gYcTGfcUlgvPtMqZ7qUjT8VWnYPCdNRX6apsukq9nRH2JKjz4iz71I2LMcCYenvyUvjrI7NBb9jGXTcp0wYl3GPfI+TKtMZfyq0XHDf1rxndJT94tNjibYI4cblUXOJPmnIh5OUU2b2T0/3Ncw+FMlPORJ/6tbYoKGBONJ5T+0+p53b32/cu/1wUeyVecow276K3muiuiSsyhmGbjMfckdfVT8tyXxN7e/e2U+OH59wJ/FV1gAAQe4ZAjxCjxGAd+v9KCCE3dcBNAJoCICUS9wh7zoNAaCE3nQSf9MQbnmHjv3TJo//8/Q/iT/kn1MOGgC873zij57UmZj63MkNxnWfNMACMa6hgYemgfmIGP8+LX8Y+HF6aIoY93t7NMCGp2cAgDBjAOCYPI4f65tu9TFGgN4pgJc97w0z2c8TABoAMALwTuaJ7pENo5dy3UTWjfLUMjzm6uZ0ze9GV2RThezmKjHJSIavyeRZc258K1ZCnP5D5NyyenmIW8tvvLiWdi0u8yMfcrbVfKY3XDS8h+jZ8DWdE7fWZxnnuDiEvTHG2CS8N0Z3YYznqbk6rnPct+jHyD9hXKZ75Lu6v9aT7ey+96/+QYj1kqM/iQOzb7NvDuk847PPkB0L1IFxgZMFGG7zNQMMAcSRhjyU1+mvvOcqq5c1rHmW/FPrvlM56uiW1bm/brql/CW83ot6aMkWr6nF7J39luMm5dz3QYh9Mp7GAEhzngbwFQDJNk/cOdEGOed1AJ7IYwjwFIBP9yHyOg0BIPGm1QhgvOkxAKRxAZm6QAwG/Otnj/vbPhBjhcRf8p8GAO9fnagvMPVY5OYd133SABNtXEMD91kDT7CoseCxuLMYPuuP/uYf0P2f/p+f/XEdcfdZEePebr8G8lUAnqCzEcAAMH8EsD0h50v57S5uxbq91QiAAYB74QSALu8pvwXAfwPgxAPxJ+yt3EAqJ9YN57TTMTi7HhEjzM19xhuWRKLKueG6iCyhAatzU7eGEqSK5JE49XApfYZbRuY3PuMME9fiTAOSzrSJNTz95u+lN90aVh33/PQj4fZnyoY5DvD3ZMPAHFPKOR6VO1jHc/pz3Les58g+cfXqhdU0l/Fne2jnhPN+0YO6E1P3hKVf2bSJqdstcua1HsYRxJ6n/BJ/yBjkj+8O8I0B4lgb7X/vBfT+dpj9cip51l+p57aFHbrXHBPK7ZbmsZqI7DU1Ye9q3+nPOS4J9ol4GgLyNABEGkItwa7/HpB37yHuSc59ci/B9wm+xB4kTleNBabXAOAYY5wRR53zSYSdAcBXFBI1AHgvGjm4T+8dfagbMHUYchPHdR81wEQc19DAfdHAEyxuSfIl98/4/mec/YZ3ffJj7pPe+MmzAeBz/vv/69nTf+LX34qnq/elM8Z9XEgDT+edeV8BSAMA78jfNiMVm+E86r8k58cA+RYAGxi/BZCnAN7x2r8wGwAwAnBC50Ia/EQmNo9cPXRjKdZN6dTynXO5ke/JSdrWCEZuuJZkyUPG1zDJTiIbOvy50U25Emj9EuRDSFk1j2FreW2Dec1T0TIM159onFjjCDdOJE2VTWd4+lNO/a7J9hVplNeQMUJ8b6z0xpdhdVyu+OuYdqyLLeuiAYA013XZHtF2T60Be+f9O896etsSZjkVa177zvnEGPKpP/9pAMLve9ggYT79J619W+vJe9rJ3u9lcdZVre+QX32artO+udylcPItxZXwLffnGKjYilq9pha7d/adYfpzXitLhjUESJQhzvzeagDQCNAzBPB7xmkAfq+TrEPg0xgg4QfX4ozXqMBTf8L4TwEQf9qg499I+5qCR//10/588l/JPzpQN6D6CmziuO6rBpiQ4xoauBca4Kl+j+hD8qvDGGAYMgYA3HP//HN4wjquoYEb0wCkuhoAePLP0Xg2azfWsIWK2RQvEX/D62sAnATgNQBPNvBxw9kQEN8BOLGxgw0lV91Y4u9tTKcW/phzk1wxN9FVxp8uN1xV7hHMmkZ/L61khY1dyvglyikbdlVIXVnfklzr76UzbA0zDlmX5S+lMW2iOlzStX0hkq4nG1bRcWG4frGOs+rvjdEIq+O6N/YNa9mu/aJuL9sB0m4Reeq5qgv86C2xl6aGZR71DtonjAfWZNY5CD7H/ZOYQf4JS/LPOMiyss7evRhGup1c+27JP5kXJD/tdhzahqw/5bxP7zfjq2wdiVl/R7b/ltqf4TkGkLnElDNsTtT+TIec9wfmHNcAAKYRIA0AEGqfrku8NQT4SoDfB9AQAMFnbOgYMziJv/4eZh7Sc8KA4/4aIWyL7UrCj8FCVw0Aea/qQL0s6K8Fj+u+aoDJN66hgTuvAX7IIPS9p/yHwsiH4QADwCf9N88+wwJ85xUybuBOa4CjpJBnnijwwTyIMhuO23pTh14HwACAUcNXADwFgBGAY/+eAsh/B3ii+83NIrJ+ZTE3osjTmqsb4+pnPSIsERnnhquim/YM74UZbxyoc1PXQ0gw4UmGLyNvLct0tsl2VL/hW9qUZWZ6y6zxW/yZN2V1u4b2SUXy1LD0Ox4cGz2sY0v/yvh0/CYiO9bFFnRuPqQf+bov25VIu9NNzX/OqY8lRKdLcTVc/dNH9B3jAPLPRwUh+Dzlh7BB0HwXu0f+yW9ZS/Uv3YfpI371/k3HvWSbnU9LbaEe79N8IM48VT/Vb90rmG1fk7PPU25FX/iaWs5zjvtK5zxPYqwRIA0AEGpItoRbIu7rABoF9GMUwBDAhwL5DYfEO24k94wfnWEgaTnmz8cAKcPTBZQt0bct2S5k2qyD/GsA8J68T+87dVF11fzjuucacELe89sct3ffNcCPmUR+ifCngSBl00P+MQLw2sB919e4v9utAb4FoAGAo/IYAfjXRbe51WySfeK/hPwXgHe95y1nGAAwBnDUH6cBAPQ7AISz4TzhPbOx5MoNZpX9TQSnJVc3wkt+1qXq3Fzn5kvZDbhIuBty01Q0LejGrqJkIMlylSE6hIk1Pv2Un/5j5MxrO2t+04jEp1z9llPTZLnGJWa+nqxuiVNOzL4gXL9p9C+hY4N45UTGFf7e+GJsEr40RnfhOZ6Vc8y3ZI8ZATIM+aou2sHVQ9tomytOLd8519PRsWHqnv6gzyX/fOwP8u/Tf4ia7/wThwGUsZZjoPbpobZQt+MGud7fmt+yyU+bOa3AtwiQuY/alrxP8pCmzhXvhbSW38OVdtU+6/nt54qt2P24SNmxQtiha2oJHnPoQsd96yTHkGUeAlUi7VN1SbdGADANA4bnCQGe3kPkMQjw8T7/CwDGAb/6TxyEn7Qc6ye/Zfkv/jQAZFsg+fj5cC5t9hUG7wHknrw/71cdiEVXzTuu+64BJ+R9v89xfw9AA7/u66eneq8ASPDBJP5V9hQARoDbTrYeQHc+9Fuc+MiUJwBO+FX8K9XrN77iFW/09YVqBMjvAED+MQKw4eF0Q54C8L8BYABgQ3OiBucGkyLTn7K/iYlTS/+Y622Ge2FuthPddC2hRMBNeC9dpkF2Y9fDurlPP7KkH0w542qey/ppJ2WIW8ozrVjzGH4ZJK/6TEx90x/6s28IM85ww/QnMibwJ+Y4Qe6NKcJ6YzLCGL+M2RzHyDnWm3fvR/YizU1d2T7leg/6p9bIS7nUrXqnvxgDzAPf+ffoPwYAnO/7Y/SE/Dtmsm/tV8vNuqpMWscsYxr/Wh/X/PppO+32xMKSccI2UU/eL/fCPYOUQ5vyPqwncaUP7Kce2rdr2Iq+9DW1Eh5z3JOOe9RJkpeMAJLtJPyScZ/KQ9p1ngyoyAkBDAIQe18hMI9oeSBpPAHgk31RQwXtIEzC71N/kXvzPr13saOjFjSu+66Bqd0gblxDA3deA8/8lGd9BJLPe/xf/E1f/DEwyf8hGYNAOQUw3XmljBu40xqQPNylm8AIUMm//voawKFTAF/7Ra/+8AnunU0mV+LaxrO3YZ1a/sdcboR7sgTODTfopqsifW1/E5fyUlrziG7wwC3kmk0+jrTKomGJyJd1tq2W0ws3DFSu+fD34gzrIWFbnHrtYe0T+yzT9tIsheUYqXJvbDEeCe+NywjrjeUc+y3p3gjg/CCMy3SPfFfz1zpFa7FusXcfhk0t06Wc+kXv9B9jChLMU3T/1R+kn1ezMAYQDlFmrjCOyNPr1y39aJ2UpUGB8mzTMUgbaLsGANpL+2kr4UvtdI6Qjrzcn23JfLS1156O/u2bivZnD1sx+zUamYt0XOIj33F/p5b8MVf7Cx2kAUAjgE/SJdppBJB0awQQ00AAoSdcYg9iEJD4axwgj/nB9JMnDQC2RbSNaQDwXhJd8/LeO7ppQeN6CBqY2k3ixjU0cOc1gAGAj6XxBBH39q9//9mrXvUN5576pxEgTwBkOCcAcHxU8M4rZdzA0MANaMBXGCT+iT/2kQ/MrwEcOgXACYDdvwOcTnQLbjopzg2lYRXrxhX/VF1vM5xhbpgrEcgNWE9e2qiblvjq3Ny5mWfjvsVJ+EXyICduKec60xxzj+qF9lU5w4wT0S9y1TN++kFUPpQu05OHMQGmM6yOF/05tupYPOCv4znHf8v62HwgjGsp3aPY0//t1Zdzs97HRfxTa/Y5p17pC/qJ8Y8BQDIM6YdIJ/F37NR+PaY/7W/KomzJOuOOONu1BbMsDQAYLTytsGYE4B6oU6OH90t7KAt9EM+9bRyLvX7JfkyZUWS/I3NV/6PQi/+dWtbHXPYV94eTMPvkHHKtk3Dn03dlURIPgddJ6PVL+kENA8RRhvnBLJO0prE9om2lfZxexc99eE+Jec8dnbSgcT0UDUwMhnazTNZxDQ3caQ184ae94Cff87bvP/vQuz58BuK+9w0/fsa/FuNEwBLhT/JPGv4doN8CYCG900oZjR8auCENsHlM4q/MvznkOwAaADwFMBvv2jcA6n8DOOEcdFOZm88lubeBJWzqOTbohPc26m6YE3MTtiQvEQvCq8sNHrLkBEyXxB75kDOv+fQv4dZ0S/lruPdCeMqm64XVONOIWZZhYM9VPaeffkv/mrzUxzU8x0hP7o2v3njcheV4reN5ady3rPNlvP6rRuqrl23oYb2fi/qnVuk8b9E3feiY8Gk4BBjnsXjHj/1d+7Dn7/UlYaSlPsqGdPvEnjqI6/U3YVvL85sFIOsx9VAfbaf8dIRRL/dNWtqjwzhBXuJJR/3ZNnRYXO2PXh+2LI8R/ToOqp88F72mlvExlzpwDahGAAk2hFsjgORbv5ikvZJ4yb2nAEBIPUgcZZjf8gwzLfG2J9E2VwMA9+d95b12dNGCxvVQNMAEHQaAh9LbD+A+MQAk+dcIAL7/P/kv9oaAJPzIPcOArwIQ/wBUN25xaOBKNNAzAuRrABoB/BbAfHpnZwTwY4BsjE7YODeUPSSsurqRnVqaRZebYuXcrLMB05+bsSr3NuikMRzUuaF3kweyUV9zEvUtaBrKS3mp/C1plvL2wuv9VP+WPGtpUm8pq9+K9pXh9ov+NTTvIXSM9NBxBa6NxYib93rN71iuY1x/S3Ju/Pf8hF3lRVu4emg719B7PAb3BgD6hbHCGNbl2LFvD/Uf8fRdL519ShzlUQ8E21cMWDOp0zJMvwVrmRoA+AI95VMP9THOqZv0OvzOLU8Q8B0ajBIgefMUAe1xLLb+moqr+s8+a0kfu+xvI6rf8FPg1Ao559QB6BogoRYl2xB/ZVBDQBoHJO2QdYm8xB6U9IO6TGueLJvvAJGWdITTLuq3fSBtz3D8eW/K9f6bf1wPTANM0DQA4B/X0MCd1QDvCyfprzLGgR/9j3/p7IUv/Jou6dcwgEHADwLyHwHGBwHv7JAYDb8FGvied77zr/v0X6yvASydAuA1AI4+nvA23FgmVhk/rm5i0z+1+HPOzXDFunFnE0aYm7GKbszFjCcsnZvVRMgD/iQuymz+kROR11zNm/mNOwat+5g8F02rHtYwdaeMjpFT18r2h/5j0Lwg+dJfZcdIHT91fNVx2PHPe70WnuPXMd7DlnRvCFAGuUjPJT7yXd/fXntrWLbPdtY0+NXH1OTZCGC/OA7EQ31V+y79OT4yHJnyffoPWec/C/DUnTlCfO1786+1hzjmCyQe4u6/n/O/FhBO+Y5vywTJSzjxGgEwAGA8WDMCoL/i1C1Ydd+C9uPH/iHsOq+pVbZ3qQNk+12UZEv8q78aAtIYkLKGAUm/JwIk/0n4U6Z88mIESAOA7QBtK2g4MvfDvXqPed8hN3FcD0UD8+Tkh4QJ327ayfpQ7n/c5z3UAIvq0gkAjAE8XfyxD310fi1g038M2P1bwN0pgJv6obqHPTVu6aFpgM2j5B/M1wAWTwG0+fr6b3xy/g7AbhNzKrU5l92YUq5yRX8bK04tzzlXiZn+uonX74ZsC+aGHzldbvzY+OOvhDlJd5XxV0f+Gma+HhpW69VvvGj5GZ9xhid6X2LGXURWb+RVTkwdVzn7rMZRRg2r/sxfZcaHYY4V0TFVsY7FFb/juI7znr8Vc46omYbwq76oi6vio9Dj/9r2iuhjwqn3xCrbD/bPIXQ82f+ZnjDGHkQbkg1Rx6UBINMrk49y9Vc0HsMCpwkwLPh/5pEpP5/kL+VnPl7CCOA4A6vOW9CtuKbWinOu6gK/fQgm0ZZkixoHqjGg+iHyEH/JPIReUp9lpEwdGARMy0OpbItttP3ZVsLqfRZ/847rIWlgnpwMDBaLduM5WR+SHsa93iMNrL0CoAGA/8HKKYCveMEfnP9DwKF/G8i3AHgdgIX3Hqlq3MrQwLVrII0AGAAg/jr+JSAyH/2D9M/fAWivAvAaAGFsfq6gwZVc1I2qm9f8fVSeWnv2rhKy9EsaRDdpF0F+r/3ddqPv5k9cI8NJspH1KydSTo03LNOZxrhaf8bXNDWu5j2FH71QTqK6WkP0u+SyD5bSWLb9BJoPTNk4w8El8kl4ji9kx2LKhhV0/NaxfsjfijkZGaesi160k+tYfJTr0d+8V/QxpVOH6lh9O397mP1lH9rvOQ6MA4ln/HO0XpK+xQBAeY7n3rghDEcaCDzrLk//MQKAh14FsI3UQ/vWjACkoS51FHp0nIGp79pvLfrGr6m14JxTB4n2I2HKokYAMcl7lZPIe9QfJNz8S0g69qLVAJDtVLZt+Ov9hb+J43poGpgnpQO53fzUnBP2oeli3O890cCLv+CPnfsAYH0FQD+nAN7w5U+e/e5nP+cp3/9fMgT4LQDi+ZG7J6oatzE0cCMa4EkX3wDASfrTCCDh57TOu//MT82ndngNgNM9J2xwbkLr5rTn97dRnFpbzjnJguiGGH8SBjdnx2Bu8t3ci27yEreQZok3uMVR5lI646w3y84482eYcs1jWVeF6IuyU29LsrreipSzNS3pto6FHEeOsx7WsVn8jmHGOXJvvBvWos8RbcLzqv6Mu41yttd7VB9Ta/Bjruo3+wCZvjMs+5F+dew6trOvkRknPqWHmP/zj33s4xoAyJvpLdtynUuONeNFyycdBgZIP3Xg8hQA8ZRhvorEkcYPA2JMwHGKgHI9SUA+9BA6VK+i+s4+aMlvzTW1lpxzVRfVj26qWyLuGY5BQOIPkYf44wjPdMpZh8aDNADUduH3XjLOsIbjeuAamCclg4PBtRswTtQHrppx+9etgd0Px6Wq5QfvZc97w9m73/3u/X8AkPAnQix++G/8jTnNa//P3z4bAjgN0PsvARoHxr8FvFTXjMxDA3sNsKHm6T+vAeR3ADACYBD4zu96dAoAQ4CnADgR8NIvffVTrZBTbx4tr4eE6fxtFKcWd85VooBfYiDmZmxN7m38SU94z7lBlNBKPHrIZp5wcMltjTed9Vh2DTde7KUzTDTtVkQHNa1ha6juKqJnwnr6PhRmPnEpvWOA+J5sGOMH2XEE9sZbDatjdOd3DIOO763YsuzzIOdFGXfhynZ63+oidTO1m5ld1Wv2Q/aN/UV/MhYZyzw9lyQ7HkhHGvy+/68BAPQjgDkuLJs8lEuZOORMp2z5tIN0lIkRAPKf7/NTf7bLekDvjbIsB9IP+ddxf7SBMsiDrnZ6S12qX/Xdkpx8LafMy15TK6DruDfjUkcpo4MlJ5kHIfoQeFyeDiBuKb/hpDGv6bMNtjEx274LbzCuh6oBJ+YTDAwG1m6AGA6Oa2jgKjXwxGzB/JRnfeSZzf3Wf+Wzzj7j03/r2TM/6Tc++et//W/6fcdWzI/OF/2a7/+rr/vtf3l+YpiEv8oYAPhOwId+4Afn48X4v/Nbfujs7V///vmocdcQsPsWAAYB2n1s+0b6oYGhgU9ogA3l0ncAMATwxB+nAQBjAAYAnn58opSTS25Oe5i/jchTdVtIQm7UluTcwJuGsOrcEPawEmHJiOFs2DMM/2VdLS/9KffqNt426AfXHPdOvLiWNuNM39NdhlWdr/nJtxa/JY7+Jp39nlhJJ+ONsDru0l/HaPhzPPfG+6GwVtTeEEDau3j17jH1cm6ep17Vfe0T+4uxALGGHEOYJcnZt8ikg5znEX0IOnkcT5YpMo4pmzS4HoHPsUY5zCvaAGmX/HMSi/zUT5nZNurKe8NPvHV7XxgVkGsZ6KcNiKm51Gfq+y6MF9q/6uyTiuh8zUHcfeJfn/r38mX5xJN33j/vDAbEH2priW/ecT1UDewnJQMHwsXkbsrYhz9UxYz7vnoNsHBB9iH9Sw5DAIvkltawgP6+J77g7D/4V/4fZ3/qGT940ACgQYBTAO947V+YHUaANAS89eXvOHvta1979pWvfuW/8BQAhgFeMfhdv/N3ne1+4LY0b6QZGhga6GjgG1/xijfW7wB4CuCtb33rGad5mJO+BoABgI8mdYq6bFBuTHty/i4qT63Sc441QZebZ+TcwB0j50a+ymwECcsNIxt0/OAW1yPjkvCtSD2WU2XbsBS/VIf5jkHvWySv8hoS13PqmzhlsRdm3BLS70txGW66pXGSY4vxpt+xl1jHaPE7lsXe2D8U1oo89ySX9Lf96rUx71N9iFO7ofk/BKRuU/f2AX3G2JD8+5QcP+ORfrZfkQmDQGsA4Pg/xJywpTFmHsqWgDvWcxylTFnMNcolj3kxABBmftrmvfTQ+6MsSD95NSJ4j9RFXvSD3ppTj6njFnxu3OC/bdfUGrTZ2a9LiF7UH3vbSvx7T/OXytKAkHmOaWtLO64HrIH9hGSAYQBgcDZ9TM0Z94DVM279KjSA1dKn/UvEv4aT/vc+43WvXzgV8ASGgq/5lHec4f5vv/ZbZiMApB6SD3mQ7PeQ7wAQztNFDQFgGgM4GYAf8vGmF737jHf0+HYA7boKHY0yhwYekgb494C+/y/yGsC73vOW+TTOW175gf0pAD4E+PzP+UpeA7iqKzeoKfubmDi1Rpxza+RgaSNXwytBID438sj8VhuGXB2b+TV3LBlfIulr4dSf9eg3rObN+ExjOHhZh54oI7Hqrufv6Tz1r3xKrONCf4+UGVbHn37GaZCxHLOOZ8a6Mphjf4vcsuzzINeLMm7jZbt695j6mFrjZ6dORXUPOlcZY5Bi35WHcEOWGVuMEfsSmbTEQch9N598mb6OK/JAvMnjU/w8BVDT6ycfc0vSThsl74Rn+/K+vFfQcNtOvbRVZzncI2l3elOXqecWtb/sh33ALROm1h4c17TF2cdLiK4h7xL4XHeW8hhO/cgaEMiL/0C7WvS5tuMf1wPVgBNyYiJDrnYEa2r6MA4c19DASTSwhfh/9q/+PWe4NALgf+mnvO/sz0z//Yx85X8+HdCI///l17zg7LW/4W+dvfO3/fOzt3/6Pzp747N+7uwP/+o3zUeHNQAsGQEI5wQArwLwtD8NAEsyBgMurPTUTTtOopxRyNDAw9XA0yX+iRgBeO//W/79984GAE4B4McAwIbnCtWVm1R+A/En+vs4tfBzrrdRlhi4eTsG3bivYW4ckdnki8hrrke0CUvHBj/9a7IEoyJ5DKv5bZ/h6Ve+CKqDNcw4ZB36RlbvymKNN90hpO8PpTHetL3xIglLzLHXk+tYbX7HccXe+M+wNbkVO1+k4RIf+W7/33pvqZupNf+xUwDZB/QVY1VCz1H7HkG3b+nrTE9aHAYD5kOON8cFSBzE3ff5NRhQ1lIe8xNPftqIIQCHPw0ItK83hmoY6SgPR92UA+Koz3LQW3PoMvXbvHdufNBmr6kJmx26wJEHVG+JplnCWh95NSBYdk3T/PWaWgBuXA9YAy5sswFAS1TTx7Rzxj9gFY1bP5EGnjhE/iH5EGocR/nTCEAY5P7Nn/0vnvqmf+0fzkYAnvTzxB+jgMQfQ8Cbfss/ng0CHNPnX/35oT+f6KcxABnyD6nvEf56KsA0H/3oRz+OEYC8GCr4UTyRnq6tGH4sOI2xcKri2toxKhoaQANsZJL8I2MAePvb//zZK7/sHfP3OeZvAbQ5+4ee9+KzK/wGR25Qq+xvoji1pj/mcpNcycHSxq4X7gbajfsS5gZS2U14RTfoYi+euJ67iCHAcrKeDEMmTlTW30ubZVWZ+69h1a+OLoL0AfnsC2XR8ET6Nv2H5EyvXMcH44qwHF/KOf56coxZx3FFxr1hdQ70/C35nsgRf9eu2ua8R/UATrrUq3q3r5gnEHjIOU/0NQAwDul70pkWP+GQcPJ4YgByz9hfGivEaQDIOgivY9H6ap2kxQhAe50j5CWd95T3WWV0QRhpyUNenGURhiPNTm/oMHXbvPur9sE+4o4IU2vnZpf6Uk+JW8uyHPPu8jUY19DAugZc2PYGAI6TtCzTzhm/XsqIHRpY0QAE89C7/pBoCL/EH/n5n/yymeDz5P/rnvH22SFL8t/4f/zJs//kU/4/swGAp/7Vke5tz/nrM0n/iZ/4W2c4PviXpwI0BmAAQJbgV0xDACcFKIMTABgBOJJ8R14FeIK+4H/HcoKCUxK+NrGb9yu9OKKGBq5eA/xLpDQCYADAzxzzNQBOAeBnDF9hi3KTquzvYeLU2vCYy42yG2k3yW7UtqBkYYkEuNFPdAMuuhlfQ4gA8YnIl3GWl2XYhgxL2TyZricbthXVRQ8JO+TQf6ZJf+0b0mVY9WfcIZkxQhrHSsqGOa5ynCHnGEy5N15bWI7pKuf4Vz4GW/F74wDybb64Ly/vMfUxtcjZpU7VPX3CmITMQ/o9zs8xfYi2Y8G+A+lTwiHhGgEg9sim740T5o0GAPYifDQQAwLlZD7ryDoNIx3OeZT5emPIe+8h+iBP1kN5+NVVy6cu1W0LujNjg7Yec00t8apLXVX5UN6MV88R1sRxDQ2sa4DJOOEYQJAAnggyEHfhTtbmHdfQwPEaYFx96r/+qeeO8+fRfol/Pu0nPcT0Nb/5f9o7yP23/Oon53f7+cgfMh/6w2EEqOQfPycDOC2AoQBDAO/xcxqAD47xBN93/yH7GAbyNQAJv6hBQD9GAF8F+Kf/7J/9SrwKMB2vpSvN8XRO9vDRtK/+zX/yf5PwY0jRGUa6K23JKHxoYIMG/uSfft0vViMA/wmAUwCcAHjnt//8/jWAVlxu2DeUvjmJG9Qe+rsoTq3Uc84Nr5tiCULdINdNH35Jnpv+XphxIuusjs08spv6LQiZMF0ScmVIBbJYZdOJlKUs1rD092TCDFdOP+Vm+BZZvairU2D2gfIhzHpJi7+Xx74nDjmdYynHVk/Osahcx+vO73hew958yLBW1H5OEs4lPvLdjb95T8jqZGry7NSlc5y+oR+ZIxB+CDkGAE4B+DSf+OxDZcYuBgKc5F8ib5o6Phj/pKUeDADUtWZosJyKjr8cg44j79F73oLqw/FpGWDLrx7VbwvaX4Td52tqN3fOZV/UuGP8lhN5mjiuoYF1DTAZJxxPBjUAsCAY3pA04xoauJAGfvezn/NUJfz6edqfx/0xAuB4Mg15xwAAgReROer/Xc/6xT35/6O/7v81nwjI1wCqMYA4HIYATwVI+v/Of/V3n9IYoAGgdxJA4q8hoJ4C4EQA98U97b4JMF1IYafJ9ARzmXYk6Zfo9xBjwDgFcBrlj1IurYGn8/E/jQC+BsArPcxNTgBgzPuKz3352RUardyMulEV3cAmTu2O9y43vLkZdkPsZu0YrJt//W7aQR1kAvkQIa4EeomoGy6mEcCwJaQNxIlrsmXY7uo3fCuqgx5WXS35DT+E9kcPyXtMuGkZH8iJa2NG0pbo+KtjEn+O2SLn2K6y82ALtmLvHPnnvrzyHtXD1CJnlzp1bjNmfSoPIcflu/n2Z+1Hxgh5mVs8+XeOEZ5pHRsg80ADAA8hMAJQF/mJW6qL8hwjylkHcXlv3u8Cqhdx1k2mjbFGGuJBddvEOzdGaPMprqkVcllHO+Yy6ENlAsc1NLCmgf2EZeDMx7Tb03/fCY7BZLq1skbc0MBjGoCASvYrSv7TAGDYa5/+nj3B5wk/pB2HAYBvAHzv8/73Mxwy7/tD+DEE4JAxEsyEv8lpDNAQQDmkhfTyRf/v/K7/9IzXAzAGQOw5XgxCNnQS/0RPAfAfAXgVAILCfXJPGD6YS48p5QoC+KGnrvn/wQbpr0/4e8Q/wyjnCpo3ihwaOFoD/B6lAQCZ+cUHADEA4PiPHLzOcnTh2zNIBtysgv4eJk67cHB2uYFGdsMtUcgNd092856InE5iCfbcVqIM8ci0Em9RMlKxxusXKVMZTP+SbDrjE5GXXOZbSoOOiEtUb4brPxbpF/Jk/1yV3BsvGZZjLeU6JvU7Zgvm+E4550JPbsXsCZ3xhHHh5xIf+W7vX9sPqoOpybNTfyD6p/95gr/09J/xkP2UMnkdt84zwjKNsuOK9NUAwGkDDADMB8ej+UTHRLbfMDDDkePe1cFFEJ1lvrsyBlqzr+yaWsmH3NbKazlb8410D1QDTsb5a5RpAOCpCotF08vUnOkeqJrGbV9EA5DRSvr1S/Qhyjzxxw8R1c+7/xgBeGI/GwCarFGAMAj+d/++/3k2AmgM8MN/GgIwGED4l4wBpP+zz/j/zYYF6uZJOU/5MQTw4UDI/be++M/OjvCeIUAjwS/9d78M/59fCfDDhJxi4D74NgA/2BfR4Voe5is65j1o6rTeraTfdKDGEH781+occUMD16mBl77k5e9PIwCGOVy+BnAD3wFIMuBv49T0cs7lJjo31z3ZjfkauumvyCa/OsmshGINkzgj61cWJSX6wRpW/aSh7sxTw4wXTbvUZvObPnEpD+HqKGXDEg/FZ1pl+gQ5sfbTZfyMC/I7PlI2rGJvnOWYTLmO3Z3fsd1D5sAW15Lt0yHflUty6j2mDqZ2E+f+CwC6pk8YmxDypXf/s4+yfwx37Ilr/UwcYw6yD+n3BMCh1w2sN/sfOe8Jubi8/2Pknv4Ma1XsL8Ie6jW1G19yx+okyzk270j/wDTgRJ4NAJB+nyKCLEpNH9POkXZcQwObNMCPE6TeI/0Sf5CwfOo/k/1G1iHqkHaIrEYB3vXn43++6w+++Vf9xb0xgHf/qzGAUwGEQ2oh9uT3VACkv54MwI8hgFMBkGH+3RjfA3j3u989k36e+GMIgHiA+DEGeBIAIwCvDvzLs380GwH41gD1ci/U6z1xGgLSvkmBnUTolHlJOX4cEaOFMm2n3kMuCT/5cS973hvm49St2jHPO7ofQTenAV8F4DWAN7zxDfNTf+Yf3wEA+XeAzI0rbqGbVtDfzcSphZ9zdYON3813Ir+z+CUBidyXfuTqJKCJkgfwok4SLlZif8hvvkTagl+scqY1zrSJVca/FGYcqI5SPjbM9GtoH5FGeQ23pqtlMC4Ic3yIOZZynCH3xqTkr47f5s/xXeWcD0tyK+Ix8k/au3R5b3n/U7uBvQFAfdOPzAue/kPCeS8/yXj2Ve0X+y7Hlekt3zSJpOfEAQYHjv/jrJO2EJ/prTfHAfey4vK+12T1dAy2aufrro0J230qnFpBuFNcUytEd4ryRhn3WANM6AnHItEzABC+S0PacQ0NbNIAT719yg+Z1wBQDQKQfUiyx/hBCD3kHSNBGgxIqzHAkwHVGPDk5/3S/+qJAJDyyEdZPJGHjFuHdfqKgIYAkHSv++1/eSb+/AsyTgTwjj9kPw0BhGEIIJzvCHB64Hvf8OOPyH87qaDh4Z2/7Z/PpxloC7rhh/iQIkkj4fcpv+QeEi/hp0zDDyF5IPxf/E1f/LHn/vnnnP2Gd33y2TO+/xlnT/+JX3/2SW/85I8fatOIHxq4bg2wieUUAAYAjAEc++e/AfAKACcBeC3gCv8doLfb29j2NsRTyzC73GS78V7D3KhXuZI//OhFRE6XxLcnS7B7WIl4+g8R/xpvXtqgDKa/yvrBQy7LWkuLboivaFjq7hhZ/VekDMKuwjE2KLeOkepnrBlWx12OTWXHbWBvfGdYb07UsFbcY0YAwm77JSn1fvK+p9b42aE79cxY4mk87+BDwnEYA5KI9/ohw3r9mvH2p8g4wwBAnXxrAANA/U8AprUc+1v0XhrmPaaMDvCri8tiK2pfFvK4TquB6bTFjdLuqwaY1DP5Z5HgA2BspHQuRqRpjrTjGho4qAFIq+QfTPLvEX/CIauVhEPsJc0ghJUn3BoCLDeNATzt9zUBDAL4+UhgviKgQYH85MX//2fvb2Cta676TvBFit6RHg1hM5AG1CQhTdRKQ7cmyCQC0p48dBvT0TuCSBA+nCGAFWzjjw4Yj+OBTIA2g+18KMToxQSMjA2NSd6h4zEMEz4SY9mOUN6AIghOG4KA7gCCTDdqBTJIwb5Tv/2c3+F/11P745x7zr3n3nu2VGetWrVqVe2q2rXrv3btfSyn94qAzgDqgyPgtZ//9PidAHYG+HpAdQSwOwCHwG/81gdGJwBlYJtyLAtHAM4FzqmCFm7QCfjzL/oE/IL+BPpLOwBe86nfNn49nfP4ole94rcF/FAcADoBPv6//YQfXOzcs8K5BW6gBfhrwPw7QK41XwPgOmRXzJGqxWKXI6kLYBfFUMPQ+DG4wE7qIhzKPbdSF+tJvQ9Da6hgVUALXRsqiE6gPscn2E9+Lk+mUT/jySMz3qM9mXlIWwpTbYacvDXdOG0vv4bWvpqLY28uvaYxPpAlzTEjn+Mt+RyTyTt2C3Vs96jXQqXNxHgoz7j8baDWP899aBUfA21Hu9IXjEH+gk8HgF/jZ0zZV/ZBtrm8aZVahnL71r7n2qMsHQA4HqgH9WFcoWdeqOVBPY9G8/w8ZyjyjO/Kt+zbuRO+d2DzfJxb4NwC19wCXNyjA4AJKh0AfFjJSQudFtA99nEdZRz7HO61fW4qbvEX7KcDwDQA8fhUfAOOAcXIKhVAA3i1B4h3JwEyXhPw+wCA/7orABu8FoB9QLX5ycuOAsoE8M86AlpeAD2OAHYE+JeBfBtARwBPJtkFwHsAv/ybPzU6DrBLuRkohwCY58k+jgCooD7Bfg/wqyft7QAA9PNxQ7ZI47CgvjxF/c//h+d8MIG/DgDo2QFwry/dkz95dwF8/V//6+M152sA7AbgNYBrOIG6+HVxDDUMjR9DLrRzAV75XNBP8dyLa5gCoYLYJSAsaJaiD78UKtiv8bn8lpE0eeuijUxLPvWQG5Qbh9pO8pWSrkzdNZT+mNKrfbUmjq01eqmT4wV5xuUZb/A57hibxHOMwjt2C3VsV1qvhxpvZi6BP9LzqPFMu2neunlOee5Dq9wYaDPalr7z7/sA4wS+BcB4JC3bv7Z5xnt9Ynr2H/YI9DllAPjzLweJc13Ole05NJrn5vnO0ZZl26/ZTj05Mo8pXdPP9NwC5xa4xhYYWllbBwBPHwEjgH+CNyQmmqbnJHGM6mmb+pyPW9wCbG8HWPP3XNAE//KAcJ7YJygW+CNLvu4IAOwK/gHygnlkPAn3FYHcFeD3A5ABvCkD8Exe6gT19QDBeQXu7giA4gjg/8hxBPzoj/3Y+P6/rwbwLQA+xsP3AJ75W/9i61zIc4XHDg4QKPWm/gJ/gf0SVZ82IRAH9PPtAsDSj/74943gnzhOAP7pwG3/Cfzlzw6AW3zh3YOquwuA7wDgdBs/zNleAfA1ABbDR2yGXLzm4th7l3RoddgGF+9JcyEv74J+iibog+feXIMgFroUBMpS9OGNy0/RHujvyaby13Ky/Lk8pnl+aUfZFKW9SKvtZnwuTZ1Ke32hrPbZXBy7c+mkMTbUcZwoNz5FHWeV5riEz7EbvGO70rwO5Fu2LjgknUP6KHb6v55XnvvQqr39BgBtTv/pAAB8A/4rAK9t3Wvvnk7Ksv/sa8atHx7ECcAOhJ7zIe1Q/wiem+cqbSpXPuxv6ZUNrjQw+EozuGb8S+T2jTO+wUSg7VbauRY16rf5PhR9cT7OLXAtLTC0UiYdAFxA3mDQa+EYg9PJ58FmQmzFnI/b2ALcBAGyvJNLEGAjE6hDfULPU/tLYD/AP2DdNCnA2Sfn1bb2KSt3BWDH7wW4SwB7vnoAyNZRgQ2ANOkAc8qCJngnzgcDkaUjgCfsP/HOZ0dnAH8lyN8CfuADvzi+jpA2kvd8KId6LG3lF/BDdQ7wPj/Olle/+HXjU/4E/QB/Aw4AHBaCfSk7AuTPDoDbeNXdrzq/5W3f8vOMY3bb8HeA3/G1/2j8GCAOARZ6R24NF7EukJN6HxtaHbYhF93J9xbyLugrFfRJEyzCZ5gCv8oFzMahypLC9+LKpbuC/rRpHbTVi6d+5TNfpmlnitJepGW77crTF5nHvlGe8TW8ttboOj7Q7fHKkjLeiOe4y/Eon2M3eMd2j+Y1UPlm4tYBfurMwblweE713IeWNtCe9B3jDwcA3wAgcF0wxmxz2zcp+deGzJd9iH3Kp0x2HegA6L0CkDai3Dwvz7Ulb49sB4S7xreGOnkz7aA8bcL3mLhXfOVLXnLxZV/2pWP4wi/4CxeEhw8/c/wWE8D7oAXvaez/9PzP/J6xri976a/Ccy+jnzfmaPPtq9pc92AzxhhOcXSRobPRP5NzCyy3AJNH07rkAPDpP5SLw5sMei0wWRzyyMlnrEczfugyDlnfs62ZFuDpP1txeT8XUOoTfyjAXHCuA+Br/3dPXxCqIyABf4Jv5QBm5IBgHQFQg2URB1RjvzoCAO/pCABUA/61Mb5WsHEUzDkCAPT5agDfAOA1AHYAuAvAXQx5LukIgM+PBPo0n/MT9MMjJ3BOgn6AEM4Wn/IL+CtlZ8LXfffXP+YAEPxDzw6AmcF9TjqJFmBR5IcAcXr5GgBzzhG/A1DP3YWy9NJ9rCkPGXLhXRfv3IMFCfI9yn3YwOIWHppBUJsUfioImk03Dj12oMwsYymeuvKZRz4pfAbayrh8tt+UrOpk3H7oUftrimIn02o806Z4xgppvTGTshx3yefYlM+xu+FzfFfeayBpy/YYUEwZ/G058rzy3Id2AuOalX4DjBEA4jgCGGf0C21tu0rJV4J2lRuHKtvuONCO/Ug5lI0DgKf/vdcPzANNm423rDzPJt72H/xVDuxySB/Fjv/7gH7ww8ysh97whjdcvOY1r7n46q/+K2PAKfDpn/ZpJ+EI4Ok/DgDXbezW/Pr/x9f94su/+qU/DSVQfwJ6pKPLAx8COz7RwXmwcWrQr+fj3ALTLcANoqVuJzE8SToA9EIxuanXdA89qLYTHOVsJicnpOmKn1NOrgW4GQG8fR/+ec95agT8AmqdATxt1wEwAv8GznUETL0WIPAHQOfOAB0BgOIE/ZYJVQ6gxz75CfCUn44A7FEWrwNQT/L7aoD/HJDAnfoQZ0cAlI/s8Xd6vA7wz971/otf+uVfGb8ZQBmZL/l0ClA+QbDP03156gPwB/DzDrSTP5St0N4QvIFU2nMA+PRfenYAnNxlda5QpwV46gH451rQAcB3APiORkf9GKJcLMN7zxo2PHQMufCGd9EOTYA2x/fAH/fLGgAdyAS5SxQgjc4coDbtqjTLSVtVXuNTuqlXeeJrgm1V23HXOP1DnqSV7/VhlWmjyokzPnpU2dz4MS3Hnnwdn5s12Hb8bsax47tH67VQ483ErTw4D448nzz/EZDTtvQbABzA6XilX2jjbN9maygh7c3x23xpD54yKIty2fbPk38CjghktR4z5XueTeXuHLQP/fK+977nV/kuE7sCRnDd1lA4AwjpCODJ+g2d/ZOAfeq2JuAEV8+14E+87wdGZwDyv/TlX/avNjviHMc3dFrnYk+1BR5484AyiVUHAN8D8KbUTmJogUnqUAe2tl7NzfsvA7IWDllOM3c+jt0CPH0D9AN+eSIN8P7Tf+K5H+JJNbsCiOMEAMQKvnUASKd2A4xP7xvYTkdAAmfAOWnYpox0AMhTPnw6AqiHdQGkY1OgD8/3BADeBD8WmOlZBx0ByLDFk3s+xIcDgTj5Uh9eR4BUmY6I8Wl/azucKmx3dqL3nwiI+24/k34F/RnHAfCKN7zyQ/nEv/LX+AT12MPxbP9ut8ADnoIwz4zXBX8H2D52ufkQ4HUteFwwQ+vifWiyMQioXLgLvKACszWUe7T3ae7JU2EN8J3SATCQJog5BK32Mj7FW26mK1ui5oHWQJshS2o7Ku+lqbMLtb/WUmz3dBkbyHOMGJdWnZRnPvgcf/KOTceqY7fQOsaJ5zUwxzfVW3vkeWUbjGtX2tox49gkTttesT2zLPjBkP3lPML4BfT7/QF4ZNTPunTqYxl5jnQU8bt2PEl70D44An72F9497gLQCVAdATfxagCO7QT18rtQv/3ErgDWf3/hi7/ofTfo1LhrY+hOnc9jDgA/AMjTfwJxgLk3lHb2TBiHOMaJhwnJG9RmkA7NOGGqHCespE392o+p+l17RU6lQIA3YB8HgIAfylM64x/7H33srAMAR4C7AeAB/gJnwf8UBTSjC2imLgJ+HQBQZMoB9KNjof3Nn44AaIL0seyWDognP44AdwRYXuoL4K0zTgAdBxXk13zmVY598rCrAG8v3l3AfoJ6eW8Qxnu05wDwyb+U6/1UxtO5HucWmGsBFts4xgh8BJDwxc9/4QX3qrl8B0zLRXPej+SHVtYY6oLdRbv3vjnqvRdqmAKiLHAJAhLjSWk34tLklUGPHSz3UGVqDzoXsm2m2lE5duSnKH1CWtLK229J6fOML/HqO1bQl19DGXNTIcdnByQ6jh3XleZ1MMW3S+HWHZyLR56X5791ANAXOT4E3C3z0AnmT5r2k08d+K297DPKo3x2IbALAPAPz/hlbKib+Rufti2zie/+QZt8zlOf912f8ic/Zfw+QDoB4PlGwE28GkAfUjY7EnhNgY/d5nZ/1nWs9Xz6L3X9lxRdXw9g3cjugvOrAXd/bO9yhqMDwBsPQB8AIPiH8joAwNybTTM+tMDEseaY0nPi2X57APsMTi7MZnhoQR3LMT5F1bsK1Xa1oRzKUeOPpPf4lzECsMYBwIKcnQAAZuI8pWNhjhMAcA4gTpDv0/9K1amgXAeAuwIAzMrgAd8Ab8qf2w1AfdkNwPv52LrkBGgygTggnMBTfPSxO27Fb2WgI1BXX0o9dCAgSweAOsqkyqXY5vUCyuYdZ7y7vSf+Tvw94K+s5wDIHQAf+U0f9cGzp/geX8S38NRZ1DC/8PRfB8ANPLlh8Zz3BPghgwvwBGBrQFvqeJ+GJtiQF6zOgd9eWgJw0gX+ySs7FD2Wbe1CK0+ctjJNPmlty6U09ZNmP03x9OtUWpVX3RwTu/I5/uQdm9Ict4WvY9y44DFpy7p9ioz8Nh95XvCe9+gAEHwzBug74rRl0xsimKdHq/0ar3nS7rYOlM31CfB3+z91Yox06lRtWmar8rbf4O/y8STfrOJjgNUBYBwg7scCNzuUj94e7MJmJyZ1+2+e//yLP/85T20dArz6qUOANV91CLgOTIoOa0acAToCNq8GMAbOxz1ugQdOWtB0ADz1uZ/7QzoCAAVOJK2thhbWDBx0pnSdfAYmLctm4UZ8M3mqkxR7NWR6S97rSBu78nsVeNcyMVkBqAH5Pu2HCv7HRfqf+aV//8Of9XsXb33+f7h4uvE+7a/AP+M6AUZZ2+IvMIYK+qUpAzgTn/s2gA4CnuoD/qsToDoeBOk4F3AAkA+HgNv7LTPrCE8+85qW8R6fMvLgBPiaP/hr4ysF3AB0BAjunfCNV8rET5j6C0B2AOAA4Pq7a2PzfD53twUYr+ww8jUA+BvYxeLiuXfvGFrrj4t0AZbAC7oGwHGO6EEN3DNrqMDWeFIAQsYrL8BHLn8Iqj2p9dB2ypXNUUDOVDq2tCdfKW2nrLajcdLl11D6Bj376NDUsYJdx4OytTTHnrzjMkFr8ozfFnpjW5njf4q27Lfy4Hw86rlx7uM/AHgd0y/w0Xa2zxStNo1Tpry02hgo30CZjAHGH9eF3yIgXupEnmrLMqD36qB9/tNP/OMjyPbDgFAdANKtI6ABc/JcRyPRp2CyrUNg4xTIHQLULz8KmE4B14RJ8/UAPhjIvZLxcR3ncy7j9FrgAQOMwKCG8sRf4K8TAGBOGhNcO4WhBSaQuYN0v+g/hGJOPNsPD2KbMiZ2GpgHO2OevNkha0Gdxi4e6h6KLhZ4HxR40u7TdhwB7gZgQc7Tf0C64B8HgAGQDcivoL/G0xEgiIb2wP+Y3p7g8/QdUA5AB6xbP4B/BupKnDK7ToCyG2D8C8AmA/xjl8CuBsqlPMG7NOsL35P3ZFUX2zgBcEDQpjnZcxMgDsiv4J84cr4bUB0Abv1nJwAOgDZWh/swXs/neHdagPsUu2Pe1r4DwHxzjd+xyAWzi+i8r3AtbQMLOgILLkPey+b4BJPcqzMIVAW0u1IAA3mk8sahhwralmYZKdu3PGxoR75S2i5lxm1T0iqvTGp6pbWfMl55+rvKluJzY2SXNMefYzJpjtnC59hO3rFfact+J54me16ez3ju2Wa0p/Fos2yj5LVXKfbzqOlpQ35oGcZAHRg/XlOMTeKMC+q20TOftJbR1O5En3Eeqw5wB2skPg7IOgpQ3XMGINv+fWAD47TtqgIOrERfgpncrf1ff+ln/TT14q8OdV6kU4BzSyeAPM4A+K959av+N16HuIGdcwdumbO5XVpgnAAY/AwmJgt4HQAsqgx4oAhOJq0Q8k4do10mnc0FMjRFJxvpdus/ZVMuH7+ARhnk2wZvbqQbJia2lm17WN4cHZp2hqprmvKMt6zng/7QAQDVAcAOAF4BAKwCwl/3nN/+kMD/u/7L37ogALgB3tUJkA4A03UCQOvTeR0Bo73NTgF4QTnUDwQK+KsTAPmUE2AsrzgCsAkY1xHgbgDA/Lj1v6UniK8g37h0Tpc0wP+rP+F/HeknPvn8cbL3Qy98EZ2noD0HgFu/3viyRzsAPvwffvhjfwXoDoDzaD63wG1rAeYfgD//hMHrR9fkAGDhzFEX0N4noEMGAYLgS+q9Tcr5VN57nrQCT+IJatfwAgV1Bd3E5Y9BtV/LzbLUSRl8ffJf4+ZL2/JJs/2QZ/tlmrw6xnuUvkFuH03R7NspnZSrLzXNuBS5fKWOtR51XEoZs/A5djd8ju3K1+vAeMt6aw/OIQ/PCbo9/2y3lHf4zJ98lgFPmkfqwW/LLfzYZ/Q7Y5BrxTFQ+rLmT/uWee8obfYN3/gN3/6Tzz7707/xWx8YnQGAY7bc6wxwN4COAL4RAF6inW+6wbiuAfDUh/ufTgF2LlDv/JaADgAcA8gJ/nvAi7/ipc/QFjd9Pufyj98CTASDT94F4vn0Px0AeJsYGJvBPrS85O8do11uRqGfk84l8G/548BtDgDzUA4Tl5OYNz3SDd7wWiWGFrKMLV8mP/QuhVpGTY/4eF4l3qLng7FRHQCAa18HgAKUv+Rjf/eDAFgcAQBqwDaU0HMA9GTpDIAX+AO45QHLhIzz9Bwd6jG1G0DHBeX2dgJYV74ZIFgXvLMDAAcAgXohTyeAdVJfqlx7GYcX8HMuOFH4S0AcGQaAP5M3rwUAftIBAA/45/1oPiRIXp7y9xwA7AA4/wXg+Vq+rS3Al44Z/wSc1dd8HrmI3t57Wh229wzuM4YEYd7fpN7TjEu9/0G9/1UqSE0KPxcACqRLk0d2iNCzqUz7Na58ilbgn3ragvYC7aZcXjolt61Jl5+j2V/2aZWtlTsG9qGMtcyXY0/ecSlt43aYCHVsG8/xn3wzcwnMEr+NB+fEkdRzH5qcYBwd+GyHKb6pbQ9tbwXB1PyWVen4SgL97diij+nXZmtoIfWrTcuXRvH3in2S6/qrXv7yb/q597//A/m3gbkzQJ4n7+PHAhvopq1PqKWeZByAr1if6xTw44J+S0AHB84Agg+LcASQt53PcELndK7KgVrAiWB0ALBgwgFAh/ccAAwgADoXBoOq1WFoARv1GO2igy42mYia0tACadDte/888adMQjoAnLywQyCuPWwaSn2w7Xlty0KHMrUFn/G0b7lOmPWGiK5pzQZlnI/WAkwuOgAA0e4CcHs8fwXI/9kLZj//I37lNwGzOgBGIA+Y34Qe8FeWFN44YDkBd4L/5N/8n/270QEx9U8B7g4Q7M9RwTpgnkA5fuCQfDgRkGe9zCPVESBF13Zyuz//OmDAfp4PDo2XPP/Rl2JxBjCJC/zhv/Yvfu8I/NHDAQDQrw4AXwM4OwDOl/NtbQHuIToAuK9c83nkYjrvQdv7kPcSqMDLe1Kl3od6FBmB+1oGgesuFNCc+sYF06RVmWn7Um2av8aVJxXsSzOt8tqD9gJthty2W9KpuuabovaN/VSp643sc3VMIy5f9apc3dRLnrFG3DFXaY5L+XbtDBOhjm3iOfZ7fFMZD9Ju29Grc57jvu2RdpOv7ZNpWa58LX/7QUDHQDOYuznUN3/SWva9j3M9MOe85c1v/pFf+ZVf+Z/520AAMtvrc1cAPB/qwxEAViLfiTbe+M038J4OARwYBBwBvjbgRwZ5ReAtb/uWn8cZAOY60XO6F9Xiwu0dU/KerjLyDAQGKoNBBwC05wAAnBNYZHHD2eR3MmnR8TA+AnwWYQRulC11MDAxYYMBhT3K1MFAHDnpGbCBXJtQ4sjRw6b2oZwXsmoLWQbLwI7nluny2JSHbsrap+1b1rt3pANAR4BOAHYCAKoB3ABbA+AWkJxOAMG8jgBoT5bydAIAuNldILhO6usAyNgNwKsIPBWnftQVaqC+AO25XQA6BtwNgF1A/Ajk2w4B0l/3Yd83UtIA9oJ8daGGBP6AddqL3QQAf+KAfvJTdwKODML3f8zvjP9iwI4AXrVgNwDv+n/zl79tBPyAfgIOF17HqOA//wWAfrx7o/N8RvelBbiPcP9q5ztc4znnIlp+ey/c1IX6bBfnCcLyvtLjvUdJuVfVUEFqD9SmDNA8Fa+A+pBxyjyUvSVngGXlecrTfvJzNPVqm9c4/dOT2W9Q+neOqtsbBynTRsqm+BxrlWedlCHHauEdz1PUcV9pM7N1EMB7oHebDusrpe7wtAd0TWhqVz6mysl+uTTP0L+t1GETpuprxbB/PjotwLXDroB3vOMd78IR8Oyzz34wXxHAAeDX+vlyP7imY+bURONuB+6b6RDIbwn4wWkcH3d1V0BePMkfs7MoZ5cj65V5le9ki5tFyzCCWgE4oFoHgFv/pSyqcACQ7s2H/C1YvnS0CfBGlwCf5ZEfmeAfnXQwkOaNFJ5A3dDPoBOg1GcL1JGjjy3twCM3mIYeOsqleVNNWZx3Y89HOgByB0A6A9gNAIj16TaUeDoAEvj3eJ0BSSsPaOfbAoBkwTU0n5oLovkoIbqAfeutwwJADbgX6C/RdARYLmVunQDx/QDToQB/nCEAdEA/5QL8fdJvXRP0A/zJiz6BOB8mpI3xRrvdX/Dv0//e9n+f/uMI4Do8j+ZzC9zmFmChds31d9Gci3Pvh9DBINgSiOX9JXnvNVDkGYf3/ljpHJjtpVVHQOoI1JHJX4WmnSl+yX4P9Pdk2odOBdrOtOSrzDZGLr9Ea3/14var/Y6OfE3ryat+6sDnGJNPmmNRnnFaAON27G7GcI7r5HPs9/iW/U4dvWve8+ZEMz1PvMqNp06Pr3rEe2E739inm/60r2oeylLWK/cs67QA1xHzDs4AXhHgoYtb6X01gK32/DMW2KJj4lRF3dcG2CHAuhJnALtKoXyz7VRPYm29vCjGiyYmvpSvtbWrXpYB77FWbh7o0IJx7UzR0T43MG8YAHA8QAxUeEA/gB/Ke5UEHQAABPO2AoYWRntSbJKuMyEdAKRx06rp6PAFSgYUdRDYJ0WnhgTtnovlUwaA3g8LYkt9nQFQ5AT0iJPP4E1bm8bLebfo+UgHgKAfQG1QBrgFjAJ4+R6AuwAE1/XJvk4AQb7xOYou9vzIYHUECL75G0J02AmAIwDHgd8GsN6Us2YXgPWHom8ZI23AHzvWC0cBoJ+Ag4D24Cm/T/txBJDmE/6k6APqqefwEcPFh33Yh40Bp4UOAp0Ign4ogf+ynXv6jwOAeeA8ms8tcG6BnVvARbQ074tDszYG1hgJwri3EIfW4P2mUu5PyLxPSQWucxSAbXryVWbaEiC/rvQeyO/Jsj6ck+fh+UlpM/klqq7tvJbaR7X/6Gdk9rd8pabvQh1LOcbm+ASJ8o7VDmVMM45zbMs77pM21UtA2DTkt/Gg/hxJ156TeR5Z2P9XO0mtg9R+GloxhKU+airbQ7tbwZmZbwHmDz8e+LM/83Mf4kk5ABmHAE/SAc+sj5k35i2dbipzCPgIDOZOAfDh6dZ4Xc28MIamPj45ppPCEYBcncYe/BiaRe2voegbUl9ZS148yDcIdrnpsOj36T684D8dAPA+pQcwe7PCVgujTXjk2AZsY2scME3fmxjtazpp6BC0r76AHTsE5DUI6LFJuQR45OTXvvkoB3mGtE29bBfsaFfeeJwz530+WgukA8An6dDcUm8coAsg1QkAqAUgA54FytBe0BEg7emkDXcD6AyAAvwBy8r8VwIpYFyHBfyuDgDO47HdALGTgPrxdF+ALo+zQBAP6NdxgR6OE776L+CH+t+1eJwB9zgEaEteCcBJoLMF/v/wsuFDgP+eA4AdAMjZHcA1ch7Q5xY4t8DqFnDB7OJb6v15aJa2QZCVoMx7Y496X0ua9yP4JQDbSxcYS6uOcmjllR2DCuortSzlxqdong86GZefazvT5ihpvWBfmWY8KX1NPPu8xjNtDc+YQi/H1hreMVnWvdsxG+PXMV2pY75HW/ZLgJn4XTo45zyMV6qOcuNr6VQ+5dAa6Cdk0ky3XGQc0kex8+8+LfAkcwvOgPe99z2/ymsCvEPPF/ZxBLBG26yvzm29T+seME9OYJe2jAMAcyJuZQ4tpP5UNdQx3Th06hhagiH15UmTh27rCh9p8MYbO3loaxAEc5NiUKYDADBucAcAVAcAgJp83GxaSYOBOHJBNXYJlOXNrwf+sYt9dLFtfoG7VHvGodgWtEOJa8dzQk8e2wbt+P+X2sKOgfNJPs7Ztpxs7PuUQJsLmnUAEIc3uLUeqhOAXQAA33yCDrhPgJ/8FOCfkpsXMC3Al045ANgNAOim/tQ167Yr/5gjYHOugH4C9gT9UHcFAN5txwT9gHzeL2M7FjcWP9rCDUY9dgDgBGAnAXYE//muP3xu/Qf8o8dYv0/j9nyu5xY4UAvk4hre+8PQ+HFbtUArQRn3kxpcf3jPTMr9aCoIbKeoQFiqnvE5StqxQgX1Nd4rVx1pTwcZ5yj1fHehU209J6e/SM9+S57+Ni6fY4C0jMML7qvcNNNzbC3xjsekjNWF4LhOWsd+M9EFlHcN+NTzqXHawWMuTZ01VDvSzKMMOhV6+ik784dpgfHdep0B733vuy/4XoCvBYA1DlPM2UptASemKs+4OkMTjqDaCZmOITiBM8GiswnmkzbxeBifo11dym0JwyZkfmVQ5VsHQKnXKA8bje0e2Bl1Bdks+AFvAGQBtjsAEvzrACANvWwfbiDemLAnsNam7UkeeNItEx1spgPA/FLrlZQ0zgF7AnTPSbCPE8M8lKG9pNYj7WEz7cpTf9pvE+yTFn3sME36mMJdE9B+FfBnHD7jgFufUAO2AcKA5XE3QHuKXZ0AUwC/yskHsE751lazC+jXATBHeQLPk3Pqad12Bf+pn68E8CE/7LOzwO8DwPtaALps8RfQA/o/5U9+yriVDOAP6Af88+Sf7WX8w8LH/kcfO+4AgPIl2td86rdtPw74vOc8NT757z39xxEA+Cec/wHgrl2V5/M5cgvkIpuijDvvQwdCgqwKzLx3JnU90qPchzIkoEWe8SleUCxNPWVQA+ny10EF9pVStrI19bDeeX678rZp0mz/ytNnyHp9V/uYOHrKk1cGdcxUWaapswvNcQnveO3QHNPJO+aTtuyXDtLu8lHPr8aPde6WI7Uc41CDaVDTldW48jM9TAsMzFXf+vTTb2VnAK8IsI5j1yzX+2GKOFuxBXJyUpbU9KEJt4CajhBIAmYS9Dkpox9BO9JemjJ1HqMJnsP2mI/JPSdleOpiMB0adbSMZu7SoXzcpg9YBvxKBfaAZ4BzBf/E0SGgQ/tkPagDNz3ktJ/A2jJIo30TpGOHYFnomleKzICuPOkE7FGmdknnib52odQ5nQFpW3naw1badSxEGw+tZW1PaB4pl8/0O8nTtxXgG/fJvzsBkgJ0DTgCBMq+FuATfAD9FJ9g/28/90cu3vra94wOgJ4jYNSdcQS47Z56AMhxUuz7GkA6AHQiYDd3I3znx//i6ASgXqPOplzK5kk+gB6vMaCf4Htl7AL4o3/4j4ygH4oTAGcATgGcA8hoV3YC8HFA/oLRrf65E0DwD20Dc7iTg/N8UucWOF4LuHh2oS1l7h8ycP8mVIDGvbMG761JK9A0DqCFXwNsWYiiJ01eWVL46woC+0oPUX6e55p2QifbVD4p/Fyg70jPPpS3v4nLr6WOH/R7vLJKHX+OwYwnn2M2eNcylTrek7Zs5+MGWoA+qIf9ojx1kjf9TI/bAgPzG84AHQFgjeMWef+se/Otk1XGL4F/JmpADGAPECm4ROYknxN0a9Ihg2lO6KYhl2/U8ocNDx3fxzc/EzEyqLKk2Lc+lkU6PCHsUlYeY9nokj9BsCAZSqgOgL/05V/2r3QAkIYO+bFjufACfEG69tA1zXJ1JkC1n/nkodqRmoYtwXratf5Q7Ft38hPXpmnEyW/QZlLqT9u1Bh02wb7s0arTstz9gy+eJrivPI4AnQFSnm7rKACwsm09nQDbp/cT3wQQ/Osc+Gfvev/F7178+sU7v/tdXScA+ury1N1dAOwMGMttuxAsH6COE4F6sTuhAvp94+kAoHzKxpb14tsI/EMCr0d8/kf8ym++5PmvHZ0AOAJ4j4w2c1cAMkG/uwKg7BhgBwHfDcABgCOAMh7+3edePHjvH9o+9dcBwLx3V0eoOynO9NEHI+9bOxx5XLuITpr3hKGVPwZBVgVmxLm3GLynSut9lrghgSqyHrgV0Geasjl6COC91oagX33jlZouNd34HM3zX8vbpklt+yVq/yW1jytVp8ozXseJab3xlDLGnXHH4Bx1vHZojmt5xn0vNPH5uKYWcO6hOHlprwpzaT39s+wILcA1yfzFtX8E8/fWpBPT0FrAoEw6gn8nXSZyAF4+SQYsCjB9AoyeeaBMwFJ5bwrEKV9949aJCRgeuXlSV3s9GXU1ZJ3goxzPNelYHnk5NwG1wFgqgPbJvAAduaAa0Jx1gKedql3b0TTTtQX9ype99FcpC13sAszh50IF7cTRt87YtAx4bBKQaZfzQkbeao96GnAEcH70hf3XaLar/BDp8qTdi4M2TNAv4AfgG2o6T9gJOgQA2wBVQTg7AdY6AQD3OAAy8Hd4dSdAOg1wAgDIoQTLTUqd1uwC2MVJUJ0AOAIof3uu7bxxAGxDe4IP6Ae8PWxOAN75ZzcAYN+/n0HGdn8+Doge+vBf+Bkv3f5NIG37ije88kO59Z9+u8sD9L4B3vP5XnZ0XMPYZkGdwfsBdDAIugRjUu7ZGbznJ3WNIAXAykPXAloAcupmXL5HkV1XENRLLTfjyZu+C8026PHZptnOu/D0H/rZj/C1rzM+xTNWMq0XdzxV6rjrUcama1HHaYfmeK58jvse38ydjxtsAfqEQ/oodv49t8AdbQEnqKGd3wh4oS08JneCFsimA4Bt5AJAKCAwHQE5sctDBcJQJmzLqBN/TuakYZ/82kJm3iq3jFof5Ohiu5wz504bjA4J8rHoFwhDBciCZIE0ILnnACBPtgk87VTtomf7mQ4Ixz4U24J165Mg3bolhacc7BnMa32/5tWv+t8oQ/ucl2V6jpSrrWpPu1D7hnYtN0vH1Ni+2afRB63Z78fBuKoAH/CsIwCebe28W892f8A9QBiwjdy8OAQE5myFJz2f3AvgkwKcAfsf+MAvjq8A8CoA/C/98q9cwKdu5RPsw6cjgPrhQOAcRsfEgXYC8O4/5bgDQcorAZwLH0lkN8TWAdCcAZ/xEd8+Avw3vumvbr8DwLtkvA4A0HdnwCd90ieP3wZgZwCvDbBLAAcM3x5gNwDl/rmv+XO/gxPgPrz3fwbElwHxfWuPI82+LqiTwhu8NwxNNvkNgHrP8L5f7/2uASoFvCrrAdmeDKCccuNJdwHTh9AV0Eu1aVyqXKpcqnyKct6k5fnP8bSt6bbzHLXfsh8rT58jy76v8Uxbw+sQqOCf+BTwZ1yuDI7lOeq479FWzBmA0gjn49wC5xY4fgs4UY0OACbQVuRgYEJExqTLZC6gBugJZAWUCQThATkCb/KZt2cHGWWoZxxZBuSUq13iBvNClaFnXTOfdfGGsTlf2mI8d+SWJVCvwB/wLUAXTEt1CpBH4Gz5tlO1i15Nw562AOGA9QT9pFmG/VDjlJMBPXSwZaAceCj2dTSgB085nkfagrfO9jltW9p1bFPa1vFEOv0aeo7Dpnb3D18BACwD9gX8AFk/7gfABlQTBPc9JwDvrJMHRwEOA0A7ALyCd+M6AAD8fAMA0A7w539Z2RGgXo+64yCBv04BQDM85wQoRwf9NWFJl7qwa6B+mJC4TgDOndcAdATwegBP9AHwf/5znhq/EeCTfv8dwO8FsDvA1wIAfTgByI8TAGcJNu7+qHziifsGeM/ne9nhcaQxLtDBPDyHMqhz/9D4vRwA3Eu8589RAeoUFfBKU09ZUngDuvLXSRPQJ08danyfemUbLPFzbV/T6rou47k+cJ0gdc2wC+2B/Z4sHQCMxZXB8btEc8wn34rpXhcphz8f5xY4t8C5BQ7WAjlhDUyITrythK1DQBkTeAJqgR8gEICYwNA0qAA888IT1EMn7ZNWbxjEBfnk04YyQb1yqWVYF+WUyU0Fu95c8ryxRx7OS9AMIBb0Szl3gb8UGSHBuvWwnRKwY5dQywN8a5PtyzoAsh7mrVT7D5/7vL+WZaJH3bBHoAwCvPUW9BOnTPL07GkXSt1p22xPxg5tarvSzjVsdByLTfVuHow32umz/tgX/FOf7vseP5Sn+dD8X3vBNQAZkE8cZwABwAvYdjeArw7gTBB090A8gBnA/2u/9mv/QQcATgD4JQeAQNx6QXUGQPfZBWAdyU+w7lOUMtwFIMUG543jIZ0AOANoV4D/w3gdQODPmGdnAE/+cQqwI0BQSHvSzuM3BpqTpY3K4W6OzN8/K8/9TC8D4/vSHr8/Eg7KAXY8EvjAO+9DB4NALEEa94kMeR/prRWUAVqTXwKxpidYRkY805Sl3q78VWwkuO/xKVuqV0/XuiWtPPEMtvMctd/QkZ+j2edreNex6Dp+kmdsKZd3vEkdhytojt8lvo79XrwVuXUGwJ+PcwvcpRaYGvN36RxvzbnkhLUF/E7GTJrwUCZrATZARjArBegCEgE4AEWBoemVYqPaIS7ohgdMErdcgTtUwKmdTNOuabVs4qZlGZwj5+p5k4Yu55PgmnM1CJgF6UlJs11sE+zZRgJqbRPPdPL6VB5AzhNKHQCkURZlmN+yjEMt1zKRmdennoJ/wBA2iVsulKCttGcfS6k7bZbjx/Z0DNWFAbrtahlaYCzeteMB7UH7APoB7AB8QC7AEiBLkOcJPoAeiixBdgJtePPoBCDfC5/3yotXv/h1Yxh3BUzsBPCJ/7/9X/6X3/uOr/1H4w4AZM/8rX8xOgDcIUBccF5prVvG2QkAGF/zLQBAPrZxiADe4WmfuW8ETL0SQD7K1ZHiTgAo7ZR/Czg6vtp3APyHAAEe/ySAjG8EPGwOA14X2H5o8JET4K6N0UvnYzvcZYozyPOT35Wa/67RS4PhsBEXfliVh15ag7T4XjsA6n2lF0+g2uMT4Nf0mpZxwTV55NfQKf0puTZ7YJ20lCe/lM/0OWp7oNPjlUFpe2ntB+73yFwjLFHXD+jJ96iAXvBvHF35SgX7Pco4nAk5Zpf4HOtTfCtqC/rVqbKMw5+PcwvcthZwbEM5avyR9Px7bS2Qk9foAGCSrJO0k7hAXIAN4EvACngU1FagqK76GU9ZtS1QT2peypCHqpMyeUEqVJkUkEZewavniwx9yhE4A54JAn+pwBlqmHIAZBtpG/sE6qSMcnhSKUCHB4xrF976VKo9bHkO8NadvD4FlYdSd8ARPAEnATLykb8X3GFA3Rkjth83X2/cyBw/UAPpbbQ7Dq9t4B+poCc5L9obwA8I9/19ATLAvQfuTQeoApx1DCD3lQCcB9gbbbb/rv/mL3/bxRtf9sxI3/Sa//7ie/72P9yGb/66bx+BvU/RK4BnB0B1APzEO58dXwPAGcC2d/4hQAdB5sdB4G4E652UumMDMA6QnwPz1I/z8rsGOg6Qz+WbcgI8/Wd+6d/jSMAO7ZROAOI4AQD3/BWg4A3Q/+mf9mnbbwG88Y1/94LA9QEwJHC+9Bv9eqSxcxJmbZO7QKdAPec2lZby5G2POZk6t5keaRC64MN8LvrgnfuHxm+DoCxBWwI/7hsZvOdUKhBNgLqGF+gKis2jvMbVqxQ98/RoyjKv+VLW49cA/Z5Oz9aUzLokhZ8K9AFptS+I22fyUuVTNPtePscGPPKU1XimOb6kjD15aI7Fwjte19A61tfEW3GXnAHEz8e5Be5CC4zjn+uQ+aGd0NCC18RdOL9bdw45iW1fAWDirJO3gE2wLHiGAngIAEWAJyBRCm+6lDyC3cxPunZTV1ml2Mg8NT3TtJdUfYC+fJ4nMvQ9nwTZAn+ogB+gLi8VrNse2BREIyNgV550ZdgQ9APE5S0bmbzUOmrPsqCkoYddQD723AUAT/0JlgMlkCft2Sbatk2pu+3n+OGGDs+4IaCjswVdxlq7ahyHt+4CYjLjvGgDAT+AVoC8BPgBzqlDPpwAAn341zSw/9rPf3oE+k//d8+MIP9tb3vbFuwD/JHjBCAA/om/4aWPnAmAd5+0w0/tAMABwCsApuMA8BWBdADIj0/qW/0F/8Z73wIgTWdEpZwrDgB2MQDcoQTKmcuHEwBbve8C4ETBFu3nE3y28lOWAA0ngH8NyDgX9HNN8FHAL/yCv7AFitSP/Nj6uI/8j5++dQN1ZYVtm9tK5wA6aYcKtI+25JPe1vZbOUz2UXOhV6lz/9CMjiGBWII27hUZEix6v+lRgSpp8lMUENxLS3nyqas8KfxcIL/pyStbS68K8qfKsU5zlLRe6PUFsuy3OT77uvKMC2RJHSvKjfcoYwz5AtjfjknHZlDH7RSt43wp3kxfAkPo51HjmXbmZ1qAtRmOewK7JF/8ua/6UAbWtptxMGPlnHSAFhjHMHPF61//+jdw/W1snsf2ARp3HxNOXkPLfOkVACZqwRxUAAd4S8Ds018uMsElF5SgESpQhAoW0ZGXmg5IVCZF1pNXO1N62OnVA3nahReoZh7KEVxzTgaBvuC5OgHQE+B7ftYDm2nXcxGoC8YF6wJzyiQNoAJvXZJapmVYjvUV+EuxTZq7AYiTRtxzsN49SlsJ7Gk/xw7jiHiOGfVIY9y14Dhs7Mkfw3gtNBDIDQWACfDnY3OA9977+wJkKYCfp+TEyeOT/Qr2Afbv/MEfunj22Wc/yAf6+Ggf7+1DAeuAfMC+oF9eJwF5cQIA6HsOgHzCz1N9/xIQfXYWkA4lLuhPik3PqVLOj/Ph+wRsyUd3CsxXBwDAnXyA+LldANg0UJ7fA5BSbxwJgHfaeHyXv70OQBxwL+B3rAP6cQiwGwBwx84A6sI/CvBdAb8tQJ/dVSfAbQOu9FMF3gLz66BZdq2L8dvUpkeafV3gQTM470MHw5QDgAUj4I5QgSP3kl5gsYm8B1BTBgDOuPyU3HSpepWSXmXGp9JIv2o4tEMg6+o5z1HbPGn2D/1HvPYjcfvYfs64vKCeuLzjI+NzfI6zdAQk75jc0ByvS3yO87V8K2Z7fcCfjz1bgHHE+oxXIrm/b+/1bT3EwxTCN7zw71x89Rd+44de8vzXjk4B1sx7FnfOtq4FvA7G3TYtC9eQsnUWzloHbQEnsaFZ3b4CwKTK5JzAXxCXQC6Bs6AQwMiFJNAEqAI+TU+KHsBRJ0KmJfhGTtyQeoDTjKtT86dO8qkvn04EdTkHgTDU84Nyjr1AmnkE4tbLOJR2IMBTnvYF4wnSx3eXW3mkIc96kM/ytJlUu+RhUiToXIBmeaZrz/pme8jbbowNwb1OgBwv6Nm2pDNJM+5acBw29uSOEfBzrgJ+ACsgkACYB/wCMAG8bJ2vYJj4HOBnKz+g/Z3f/a4R7Av02aIv4Odv+nACGHAK4ARw2z95ewGnQP0eAMCYVwAqwE8HAFv/SUdvygHgE3rP1x0AxNkFoBMAEA6gx07PCdBzAJAHfQH+mlcJKFfwD/3hz/q90XGBLb8LgBOA8IrPe9PFN7/hFeP4F/Tzvj+g/xOffP4W9PsKAeAfRwDOA8NddALcFrCa4FoeahCYG78Jah2Snnr7HnH2daGX1HkfOhASlPXAmwCwAscEl5WfA6qZJjCXZtouvPml5JWHGrRpXJ2Umzd1rpOfK9806ztFa38Qp/+U1740Tl/D2+dztDdW5mQ5zmYA/zgmHZuNOk5z3E7xOc7n+GZ2BEFSdCu/EZ3JUguw3uQpP8Ae0P//ec+3PRbYPcmDDQPrL50B7AxYKuMOptfxeaxTzHIow/ixyjvbXWgBJ6+h6W1fAXByTgeA4A4Al6COuKAWkCQQBjgCKIkDOAW3gkYoOlABZKalzZRXHrvaMa1nz7QEslmnLI9zUh9qHsA0ZRESeHvOPYoe+gnwsWc8AbrlkAdbAHyBuBQZacTliVsf62eZ2s86J9DXAYBM3rKQace6fc5Tn/dd8LYLlLajzQyMDx1GymxT44wtbuiMuxYYhydxsBig7p/+4V/3jQB+wGnd0g+wFfgLfonjEEgnAHoE5KPTYLOVnyf2gHUAPMAeoA/YFvAjq4Bf4J9p6QRw+z9P/Ln5Gb7xq54ePw7I03TANKAdYP3GV/2TxwA+ZVAn0vkA4JIDgF0D2LQNKnWnA+0HCOer+ryfP+Zp3wYQ3NM2AHSethvQp67uAOA1iJrP/FJeCeg5AXBiaNen+AB7PP9/5r/4L8Z6/aEnv/Ix0E+9E/TjSGGxQPtgj/FxEoP2gJU4dYAKkLeOu4J6nDvkge4bzL+27AT/5LHup0oPOJQwxQKPw4Vejbv+gA6GBGeCuAr+BImuVQSTSROQIicuzbRD8gni5Zdolq8uMvmklSd+7GBdsmxlSeFrsL2zXyqffdnja98bd2zsQ3OM7egAyDHb43Os78q3S6B7eN10E8/CsQUecD/mns7TfUB+D/wr+4H/198bd07qBJByf2ft1CzSt/fhcIx6rjWuPGlvPPZkmSd5y5Bm2pm/xhZwAhtamdtXAJhgmaR1ACT4F8AlFTwDDAGiAElAqU+VAZIC3gSP8ADMBNv78JSZgLRnw3LVI25Q37jnk7rUn7oaBOmcp4HzlJeiZx5sVJsC9KTaTgeAfLapZUizLMuEIs8g0McmdU6qYwGqPepm20htM2h1ADA20klEOvnUI43xxZhrwTHY2Bs5th/u+8wPf9N3AdZ7QLbKLsU3H7rj/XDkgFUCuwEIgPNn/sEzF+9977svfuO3PjACawE/T/sT1Av0exTAL+gHqONE8P1/dhDgxSbgBPB1ANJxAviFfcAywJp3+3E45BN+6oJNAC72qSP1R38q4AQYn863877UJhHHCYIOIB8nAOCeergboDoASAdg6wDgw31/8Lf+jxd/6n/6P1/KJ/BP2vs4IDsB+DggNqmDTgAoT/ON4xQQ9KNHYEFB/7E7gva6aAd9w46G8w6A6/mrPIFz0iUAvi/Av0q+pTpl/dMxcErOgCPPwC74oM770CFDgrMeuGN9kkCxAsqMA0iJV2B67HgFy7U805HLV2oa8kwzfmxay8/yTINWXpnU9s9+kdeBk/0pbz8L+HuU8YG8N06WZDnOVjoBHKs5duUd0znG5/g25C85yIybxzj0fCy0AE/ux6f+7ck+ax6B/hytOwFwArDzEbrZCUDf3vWD8faE19bmZEfZHic+PkTeI9+pZPHaq/RU6nfwejh5Dc3y2HlOyEzQ6QCooK7nAAAMAhYBmIBKQStgEiCaQFIACciUTwpgJC7glKpjHIpd7ChTx/zGTTcP+ayTusTl0bPeyCuYFnhLAdNzTgDLquVj13I4D+wJzLMd4XUAWKbUcsk/FdTVJnmwp02f/JuOHetl27kDwDhtBbAX3NdxgRwdzl0dnrAz4TDmWnAMNvZ6DsqmngD+8cn8BvSPQDWA6xSgHeUb0A8PuCTw1Pxdz/zbESz+6I/92AgcAd+A/n/3O7/zQQDkHODvOQIE/QBQHAgG5DoJtMmND7CKM4DgrgDkAFl3AeQTfgA+cSivG3AOxCmPeDoAkq8OAdqh7orwY4Ck2ba0NwDfd/wB78h8Qg/VASCwB/jjBHjFG175IRwB1MOdAeokHXcCtP7JjwOmEwDQ79b+BP2jvD3lx4GCI4T2pc+y72hrDtqfjwgyT17PqL2eUk4JjFaQvASwl8D7H/3Df+TiqoEysDFX1lI9qyPglNr8SKOsLqiMO/dDhwyCswriXKgKEnO9IqiEAj6lAtE5mgB7Ti/TtC/NNO31ZKZJ0Um+xk2DJq+e8kpNh8pn/qo/Fa/51dOm6b24abZRUnhC9mXl7e8pWscHcXR7cmWOraSMPeM5Dju8YzXHrrzjel/aijsfu7YAD5QA/zy958HGHOjPNHYB+OQ/KU4AbN2T1wEYq094TW/afpRN9EOm5ThHfXyIPJHvNog5H65lD/g8X+W3kuaJeQJOXEMTbHcAMCkD/nUAANgqsKtxQTNAT/CaT5ORVTApwEZu/krRqaBT8JkU+xmHx5b2Mo06GmqdlKMPDwhWhq7gWjANpWwDHxKDz/QE0tqSYjOD+bAjEIfSlgnW1ZOSBm/9kqqDDF678NZVGXHKglov6mr7JW/76gAQ4Bs33bY0nfHFTZox10JvXDbx4Q9u8J/9v/+HP5xP+StoHcH9lBNgA/pHsP+C3/y9f/w3f2kEyoDC+mQf4AiABki71V+gLtCvVEAv6E+QT1rVzzi2KSuBvw4AHQIAXIE7T/7JTx4APwCaOvu3f9pGn6f8bKv7uu/++pFqI2nPAVDbkrbmI4nI/Uo/deK1CZ626wTAAUAckM9OChwAgP6/8+H/34uHf/e5250AS04Azul1z/ntD/ldgHQCUKY7D6gDoB+nDe0I4Bf05zcYaBPSCRy011N/6ovu1HbBUwKjCZTnQPUUGN8H7PMdCPMlr2yKTtUB+Vzd8xxPoe0PPOvm4kkeSnDtAR0yCMSkAjfBnWBQsCiQrFTweQxKWWvtsrie0q1pNU4+ZUnhMz6lZ7mpa95d6VwZ2rK8Hq39U+P2Z6X0NzL7vVLHRR0nGU/ecTVFcyx2eMdrjl95x/YcbSa3oAI9Dumj2KPfnizTz/ymBViT+vR/aet/dQCwRkrwnzw2WcOeUEM7rhxvUGX7VtP8lU7a47rh2t2UjR5586hx0nqyzHPT/Pb8nds3dVZ+0/W7Uvk5YOA5Uja0+KUdAAn+e68ACPKSCrYBmj5NTgqgFPgKKKGATahAX+BoPHVTD157glvjNY9x06HUBxCc9UrQiw7p6vZAtSCacxD8wxNII5gvy9Gm5UE9B/IC6AHlgv7ktZ9lkG5+y5VWuQDfdCj5tUs6eWp9bcOk9BVjwA85Oh7sQyi21GMscTNnvLXgGGzs8Y9P/sgXfkUFpVNxnl4DOA08wX6mgX4AMwCQ7fEEgL+gsFLAIwEgT74EkOgKsgX+UoG/6dKeE8A82sbZAOD3FQB3BLALAI+2uwAE7+jz1B+HAHXlBkga9aPO8Dx5f8M/+tujA2B8vWHilQDaMh0quQMg2xkdAq9MAPTZDSD4dwdAOgAA/T71B/S7I8BXCPLpf/LuBNAJgAMAZwDb/LHPaxG0C+cq6Bfw25e2fY/iBCDfXfoWwE2D0AqIp8BzD3BPgXPlAPpDBW1O0V79ps6lnvNN9sERZ2EXUlLnfunQyt6GBGcJ3hL8CRQrkAR8uoiT9gCpMsGx8SVabda4+Xt2U5Y8eTIun7TyxHtBW5nWk2X6HN/LW2XGob2QbSQPzWB/Js3+7vGODdLkl2iOrcrnGFzgHbdJGdvEHeNraFMfD3Q5pI9ij357sky/1zxAnQcUPLxIgF95nvhXGff/BP3JuwuAsXUiDcw4YHwNQeX3HSPadNxK5+wNXLetDupIm2jyqOVMKl4hwXpIdzFFnjHfi170ope9+tWv/qubzFv5LsZOTZdONQzBb2U5udK5OgB64J+n/wI6wZ+AD3AIuAVEAl7TAQDAFPCiYwCAAhITWFYeXW1Xqh3Kk1c/7WSa9bBswS5U8CtvHJqgWcCctOcEIJ82LIe6wBvSNvbmHACUUcsBwGfdpnhs93R1IEAp23plm9nutq19nmMhZbY958Y4YdwwrjYTquOwDceDH4xrDukYYct/gtL8aj0AVbCP/Gv/4vde/Nf/99d9kPB/+eZv/BBPhwF7gP4KEgWLUIF4ytBHDqAWxEMB+oJ95RVo9uRpW331SKMcnAA81cYBwE2ObxAQB/gC6gHKOgG4cZKHc8MRgBwe58Co057CMy7GXQDtSXzPCeAHAQX3Cfhtc6hf4QeEuwuAJ/4GHQCAc5/wA/4F9shwSPzn/8NzPmg6dSaok1QnADsPAP84A9gBwjnQNvQrT/IJ2a7wtS+NJ3UnwF35HsBNgk/LngPKPWA9BcLnwP4nfdInX+wTpmxO1aFX37nzow10CNge10nHifLwPy7IXExJXX9AhwwCswRzuUaBFygmiITvAdBdZIDhnv6c7bm0amvKfuqpM0czrfLEa8C+Mnmp8qQ1rcZTFz7T4XvBdoL2gn2atPb7VLyOFeLopjx5x1ilOQ4Ln+M0x27yju1Km6nHABM6HskrO9OFFmAt6vZ/1jkV4C/Fe98BSCcAtiljoRrXlfzAseo4Jt4KH1rYd/yQj/FrfnnjLenSkfLkLyn1Il77m7Sd8rY86GeoRZimfFf75COP1/Kw4avdJr59hycFHSIoH7f/M6iYeOmoXRwAgLsEflwwgliAaDoBesASGTrkIwg0BZBVlnHzQAW9KdNWyqyDwJx8AnRlSQXH2pdW4J/AXF5d7Vu2VDkUXWySd8oBoF3LJg5PHS1rjmoXnSwTG8TpB+tEHbPdkrdv7Pc6Bmx3yoHXAcD4ikmL8XeIw3Fc6ZDGKZev+wNOE5QC/Inz13D/1U996fiEmXfNM/DU+Q3//NtHUIgjQFAvGOyBR9JM12kA0OZGBfAHdKoDBcQL5JX3gGgty7hlsSvhZ3/h3eOXcL/jO//euBuAGxlfsQdg+yV+HQBQADR1A2wTcADwHjxpo6xt/8cG/6vbcwCgl06AdADAC/wB32y5px44I9iGT3p+G4AdAdQRRwxlAfgF9YB+vgeAA4AyiXP+7GLAqaBeUpwAxKkDDgp3APi6BP1BX9hHtucaSptz0G93wQlwnWDTsgS8AmPk8tIKpHuAewqc7wP01+aZKrNXv3oOnlulnr/tc50058sD8y7IXFBJnbOZq7eBudpFrjSBnwCxByJ7wHNKJnAlPfkp/Sp3UVvlV4lnPeR7FFnKa9w6KK+UdGXyUuXQJZnpSStP3GCb1b6zT3uUvkeeY0A+x4f8HGVszYUchzO847ZSx/Va2oq4dJCPQ/oodv59rAXoY9YkPJgAtPee8C85AKa+A4C9E/wWwNAa4QHXwc+9//0f+IZv/IZvJ97CKG90n2McZ1ybPPluBnLcztlzfEqXdNEbNgHdNfnQ80h9+IynDu0xla7eFDVfpVP6t0ruQBlarf1Yw8gbd4JlYk4HQL7vDw+YIwAI5QWCAkPAo2AScKkTAF7wmxRgClhMkEm69pDLJ636AGHtZlrypANyBcCC55QliDY9ZZyH4FtQzjnIk24wXwJr62iZ1oX82BGoy0vTPjxlqGt5UMuUogPPuZBueUmRZ/tRx2y35O0D+12qHIo+Nklj3HQ+/teG3pWOevMdmrVxbDOW4Vt47GBs/+XPftW7AP28z//U3/y2DwHwE/B/5C/8iYtewEHwvT/1feMuABwBgESBt4Ax48mTDsgEWLO9DMCdNtCt+tokH8C+BtIBnzgUsMdTe8IPv+XfjB/EAdgD4AHdAG6D7/0DjAHSBuTc+Dj4oA5yADIBnnR1pyiAHqAtBXgD/H3iTx0A4aTzaoWBOPXknwJwENA/gH36RkBfHQAAf5wVUHQ4995uAHcCYJO6sOPgCz/jpeN5+dE/+8I2n6O1n2gvyr7tToDrBJtZFiCYeAXDFTT3gHUF4VPg/VP+5KdcHCpMlVHr0qtvPad6zsZtj2ynY/OPTZaHEbhYqwurnL+HVtQYBGcJ4gR7UuZ3QgWRFWQavyqtoPWq9pbyC7xTT1mC8+TR7elUufGqm/KaZjlVp+qZnhQ+Q+2zjNuvUvo7eft/ijpmSJdPqmPJMVapY3CCOl4Zp66nlUnrGM94y7YFLnlNpBz+fKxoAV5p5F+PWEuxPlkC+730OQeAOwFwMrB+XVGlY6sMrYAHXC+//Js/dfGtTz/91hZHRmD8rTkcd+qOca4xruUmrONVvSWa+eQzz1jORpB86kzxoz515Nw7NrT35Ate8IIvQa+jM2W7yrGVoabf6vg4adXJs53RpQ8A0sg6AOoHAKsDQOCXVPAn6ARk6gDQKSAAlgJOSTMOeCRfgk557RuXklfwqx0o6dgiKIcXHPcAvmkJmuG1DyUIyBO4C9al2F8T0E87NY/2pDoA0DOv9bKe1Fl9eSjBNrBtsIPcNrJdpbalcfqh9rt9g6528+k/Y4/x1sLaCaupdg9vuENL3Tq0uPgZs5tJQJ2uAcYyT5IF/j3AD/jsyXEE/MT7fmC7fbwCwinwCJDnaTNOADzXgEaBJ2kCfUAtAcCPDPsAfALgHsBL8B8IoPWVBgB1BrfdA8B9Ag+ITycAAB8AjVNB5wF15IOH6CGbAv4pp1ycAIBtP/LHU/0K/LN+OALYqo8OAB2HATsO6AOAP+AdSp/9ua/5c7/znR//qE1wVOQHGWkHHQZJ0wbnj6MhnQC0be9VgKm+RJ79jhOAfmX8dQfcLRAeG2CmfYHuFK1AuYLpBNs9QL4E9j/90z7tYm1YstUrP+tX617PbaoNaC/Sst2OyR95iG4Xaq0ceOdn6dBkYxCYCd7qmoX53ZAAEj7B5rF5y7acLD9503elCbDNmzJ4A+nyUzqmqytV3svX00l9+dSTh/aC7ZbU/uxR+h950jomjDtmetRxNUcZg6Q7FieoY7ZSxvWa0NTGA93zsVsLPAD8A8wF6Wue/vd0lhwAPAzBycC6drcqHkV7fAWAcc21wLUD30oaWshx5PijEiknznhNWeqSbjx1kM8dNU/Gd7HTK0NbT3jOGyXlSR8wB2yuXdSuWnavPrdaRudvwb4TrRMnFBngXwcA3wAAKBl84g8F/AEGEwTCc7EQAIAAUcAgVCcAckGmFBkAVP2UCziXqHmwI59UucBUQAxAFjBDE4STRr4aPJclWvPNxQXxAvYp3V6ZVdd6Sz0/4lPgHxvZXvDZ5jVuPydV3/5kPDBWBOWMsTYGvWnuczGZd3AsM2axy5hlnFrWmnLI9/H/7Sf84IP3/qHtDgAAfwX+Na5TwNcCcgt5gsIEjwnwAYt4cbm5ABoB+gJKgCh/JwioTZB/CeA3IAyg5UN60ATSS7yOAECwQFugnCDe3QA4ANhFAPinrtAlRwD2KAfQj8OBLf4AeEC+uwN69UQn/ymAvy/EQQPox2HCBwGJU0/aiPaBp81xWhCnbp5P0q0DoDknqBOvGhBYSPAEgQ8n0ge7OgHsY/qXfmV3yT4D+xTyHBNcpu0EtRX8VnBcwXMC6wq8e0B9LcjfR69XXq1T1reeSz3X2ha2kzTb8Bj8kcdgLtbgncvHdUmLDwYBWoK4ca5mvt4E1y8JIuUBnfBJe0B0jazaqXHL6MlNsxx1jO9K1wB0bArKpT2ZaXO05st48tqYkiE30Aa2g7yUPoW3b3uU/kfuOJAyViqf46fyjrGkjr8OfWyMNp0cv5WvY70XbybGgzSOSh9Jz7/bFmB9x5qAezZP/nEA8C2f3tP9NbIlBwD2KYe177YSN8cwPnRO5XiEz7FTeeO9mpPWCz3dKdmYn+uIa7cpDS1ocyrPkpz8HNA8P2Xal3r9kc5h/kex9b/aS7o+9wlr2kDQ7TZpJ9ycdOEBUQbBPxQw5xffAXcAveoA8Ov9gEFBJXoCV2TEK9hEjg5ppusQEFjOUe1hxzK0Q1raBgQD9NVdouRNHUH6FMW2gXMQgFNuL6gzZW9KTp2ybvAG04jnuVI+9iiT9oGiA7UN52j2geA/ZfYf9hgbjBvGFDdnxl4LjsXGrj7Mc2n8Ytfx6jhl3DarQwvmWSyEcf0x3/1R49N+AKYAvwL/GtdZ4GsBgEeCT/DzKX4F+D/5//73F2981T8ZgTI3GkD2FhRvAP4I7ncE+FsbZQdAygXhPJ2f2g0AsAZMA6qpH95weIPOAkC2vFQnA0/xKTe3+VuP8Yl+S5MqV3+sYzt3bvg4AGh7At8y4Ok/oF+AD09daU+C8qTpKMEBkB8eZBGBAwAHhzsyBPa7UPoeJwDjfnHQnaDCMUBltSmY7YHdBMQVLCeQTpDdA+FzYP7hw8+82CfM2SStV4+sZ9a/nlued69daEPbrbbnIeNHHJK5oJJ3fh7n9Fb2YGAxWQGb4A4qMHT+TwrQJC7gvApdslPTjU/RXesCsCZPj6ZMAC41T0/HtEp7eedkpvVo2oavgfbpBdej9u8SdSzk2IDXGVDHEPEE/FO847BDc8xO8Y7vJdrMjwd652OmBVjTvfB5rxyBv9v+WZMQdvnrv+oUWOMAoAwcDjPVu64kx1Mdd8ql406BVin0lF2ljtioR8pGnuv59a9//Ru4pjbKyFOv2qhx9aWmG+9RznFowTZRx7y7UPKmnUO13y51OKquJzdulXCypeN86g8lzgVXn/7rAAAsEVjkAhQBf/CAQSk8ckEmegJNwGYCc9KIA0xJA7gKIpEJTBNkTvHY0o55pdgmJBi2PMoEFEsTcKuvjLj8HEWPQP0J1MPg+Ronfa3dWibnoMwyjef5wFse6cRNtx1It+1py14gL/JeHyDnXNRhnDCWGFPcmNvoHlrYjsMy2lPe40fvJ3ZyzOa4hGcMl3JKMf3oWMfObgBBvk6BKcprAe9977svAPY8vfcJPn8f6Fb97VN8Ab4AuMUBzTwpZ9t8guE5fmtvA/bNq1w6ZQNgTh6AOqAYKmgWzAv+dQaw5Z5dAeipU3nOxe8FUAfAvE6HHuBXJqW+5kGmfShAnl0S1IP2oi44JeDXOACwx84EHQDsAshXAdhJsOsugNz1gQOBcBu/B3BIMNmzJYitIDcBMHwC5ATOCagr4J4C6A93APz/zfOff0FYm2eqzFq3rHeeT55nbYPaRtl2vbY9hKw/Mx5MygKLw0Wa1Ll+aGljEJglgEuQJzBkzu4FACfypBWEzsXNW3WUS9O+MqhhKn+Vr40DttHtge6ltKk8yrUr3cVe5unZIz1Dr61sM6j9u4bmuEh+HycA428DYLZj0TEZ1PE6Rx3blTYzW1BEmoe8FHny6t0rytqRv9n1ib9P/QX/a9/9723/xxmw9C8Arn1wOtyChh/HC+MeIM61sKnzocbR+AHCZpNx74Ftg9cO6crQg1dG3EMdaB7GB+aCljBsEpUTHXnmFM61xYeNLHWaaPVBPq/nofGGXr1b8u08Lp0gA4QGFvxzsRmQ9f4CMJ/+A/YJgEZ5gL87ANIJADAEWAI0BZvElUtNTyAKSFW3BzpTRj70LQMeGaA0bVewLRAWiAuk1SNdHcH1WooN7BKoSwbllrPWZurVemV52kc/y4WnTaHkt22y3ZBbZ/qHYFnw2e6mWwZ2GBMCcm7k7ZIZNsFxuJaO+Riv2HFsMlax79jD2UB8M/GRR/uNXX9gj1cCAPq5GyAdAb2dAOryt4GAVP9dgG3641b9DUifAuPIAeMAWQB01RPMC/LVV8904oBn9QTgxtVPqiOAj/ABjgH2gm5BvhRHQM8BgL5BZwYf39OW9cpyE/BPyXUc0KbYonwcAPIAdutKGsF6JHUHAGVyngB/nQBQPga4zwcBezsE2AVAvRiP60fezWseAkT2bCR4rcA2gW8CYnjBcgLoCq57IPxhB/QL7q9Ke7aR9epR65rn4bnVc872qG1lO/ba+BCyI49AFlk1OEdDB4LgH7rkAOB+wBqmBhaGyBJ0zvGp2+PnZDUt47vWwzoKvonLS5UJtKfonF6mJd+zVdNrvJdHGbq9QBvZTvJJ7Vfo2sB9v4aeEyDHV+UdgzPUcZrjNnmBRB3nvXgrZns9wJ+PaAGBP+BbwJ+UHYn1if6u8bUOABwPm3Vl1PDkWMfYwDXTaje0oOwQlR0/QNgMMd7zoAxklpU8euYbiLRDvUex349fyse1yTwC3SiSj8P8T3J9M2802aW8o9ZuP9jExhN8SPAd73jHuzb9vZXvZu40tTlBwmBgoKQDQNAPFWCxiCX45N+n/wIvQB9gEMBfA3LSBYgASsEmAFRgLy8YTfAJeCWurrawa5r5tC1FLihVlzj1IA4FMKNHQEZAVkF5pqvXk5km1RZlWZ68VN0enSuDtJpOedqVIrMdoLY3lPzoUbb2bD+pcqjt36PYsMzqANhcUNux5xjs0c1FP+p6U+dCd0wyPus4JE56lDNe0M3+zgfXhN8G6DkCchdAdQbgCGDLOl5rQTegE4eATgHiBuXQ7/+Y3xl1RrDbnAHoAIy1Ay+grxQdgb9pyogrk0/ADY8TAIoDgt0AOAIE0IJ/qYCbOGAfqu6YttlV4F/w8ReBBM7LJ/u1fM9VmunpBBDgUya7LPy3giy/x+sAoJ3Z6YADwO8g4ADgnHkNACfAPrsAqiMAJwCvFDCWdh6AN5ThECCyZ0PgWgFtgt0EwoJjaILmBNQVcD8soH8K6P/5z3lqfMoP3SVM2UNey651y3rn+eR55vlnu9Q2M95r56vKDjTsXKilue2irQmTd01yaV0iMNMB4D0gqcAwgWPlAZ/Ikk4B0p58SqZN07NcZMZNV5bxtTyL4NQ1LsjuxU0jn/wSrbo1PldOz7b5ob1gG9pWUzT7GR49ZUlzbCTvGErq+JqibYwOM8Exi458UkFDjvPKt6zjdZAU/ny0tveJfwL+5MfXEf/BM10HwNTTfpwDNW2NA8Byb4EzP8cY46jG146tzAfPIX0U+/1fdZ2/vQ6Umxe5Mm25Y2D8wB9zyMZs1dNmtaEdyzDfxsxOhLyjfeYq/mKROaTJlO9k7FSVsyG3HwNkQmWRCngCWAn4KwVg1R0A+ZQf3qf/UmQJFAGcgkoBfVLAqekCUgAlMsElIFSdBKbktawsJ4GvNgS8CfItA51e6KVbPvry0F5+HQEJ0JWpb960pUydpOqlTJuco2XRBsSzLWgj4tiwD2g/eNvcdpZaHpS82d6WgS6OH8YL48kbdt6UufFmXJ4burwUGeNT0K8zKp1NOhvM3y7AoQXG+5UOyvrwf/jhj+0GqKA/HQI6DNwRgDOAj9d90ate8dsZvuzLvvSCwBdtCbzr/orPe9M28M4b2+gTnMMD6gHxgnvjgGRBvmlVTweBNEG2vLsBAMk4AaiDgFoHgHQE+xvwjyNgq9fqyFN2HQNQnQDwlEUdCJZbqY4AqXmglqszwHLnaDoAOKd0AMATWHjgAGBr4a6vAVQHAHEO/smgDcLhSgPxmjJfFUD28u8L/hMoJ4Cu4PrhAvCfAvlf+AV/YXQALNGp/AB/0tIxUOtS65rnkeenI2CtE4B2tl17bb6v7IjDzMWaizSpaxKuj20QmCVo834ATeAHn+CRBRzxpALQKjeeusp6VNmcPXWk6h6CJgjHXg9492RTulVe41Pl9fRquepA5wLtNBfm+rqm5RhJPscRPONL6liD5hic4B2vS9TxPUdbEZeAFbr3+mC9JeCeotybf/THv68L/ns7ACroTx1sTZVT5awxb0Hn9MbbrtXWBvnk69jMOHw+5Z/Ls83nPE4hXo+b8hClDa818xLP9OTJO3Wopz3toG/asOGRqUfanTg8IeilDwEuOQAAcxl8+g8FiAEI53YBCBShgkuBJ4DTAIgUbEIFnMoErMixI3ClbIMgFlCsDcEv1JCgWd0qy7i2kFmvOZp55QHk8IJ04/vapE7aTqp9z9Xzp/0ItjeUtIzDc17YRpf0rB9yA3qk2S/okiYgB7QztrjB15v11E0fPScHdMjPjQGbjEHHXHUA4MAybxvfjvUrX7jjQmLzbQDBvYBfR0ClpuMEyKB8LcVxwPvpgFeBsOAd6tN8ZQJ+vjmQTgBAc5XpLICSLhVo6wiorwUIvhPcwxsnnfpSb/IS91UAnQDQUW/jCKAszs9zlFIXQsa3ToPNKwFZLjanQs8BIPDn6f+4k4FdFAfcBeBHAdnOeOWBeA0G9gWOU/kEqT61luYT7gS9AuEEx4LmCqYfBvBPEC4w7wF3wP5VA3Z1GmQZtQ5Zv1p3zynP03PP9sh2su2ktDn8VNvvIz/QEMsFkwsrKUXIS52rh5Y2BkFZArdxHt5s815zL0nQyX0k45VfSk99daWmGYfKmwbtyTJ9jheIo9PjlSUIV3dJtiZvz1baneKnzsm2yLaSX0Ppf/TqOPD+n2NFPsfSFPifcQKMa+Y2Ph2rU5QxTZpje4o2lVEnKfy9Pfj3nAq6a/yq7/wn+IfHXv2uQC2TODo81DzBzmF8DS1AD3E4Xh3f2pXWMrb6Xo9NQRm65ttSrtEmHzZpXistOh7mTTrWxeu3aWXdtLvJPknQI9+wCfLQLEu9fcpopk778KSGVs2tA8AJ16esgC2DoN8n/8ThAWEGgJhAEl5HgFQZccG5ALKCUYGm6VIBKZQ85tOxkODfMtAxP3YBpwJuqQCWdHQzjiwDaQbk8j2a6Wljiu/ZmJKlDeqccXnOz/OFGmw7268Cf+KkUbZp6iKzjeRt36ToMzboB8YRwJyxZcApgEx58k4iUMejoF9qX0sZX5RDHm72jO0WGOsHPagPrwUA3n26PwXkdQhkunnSITDFW4Z5+N97AH0CYQF8An2dAgLn1OnJptLVBZhjM18LEHAL+o3nDgDANs6Lsd6bHQLopQNAHl3++m8L7DegvwL/jNMO6utgmAL+KccGrwC4AwAHBfV+9Sf8rxeve85vf2isR7vZ89T+qv8IwA4APg54mz4KuA9onMojOBWwShPUJtgVAAuKBcnQBNAPdwD+S2CfHTjouBsnqfIlG+kEgF/rCMjz85xtg2yXbC/bUErbw0/1wa7yg06Yjy/+MO+CzUWXaxLokKE6AQRy0Ar8XMNUCgBFtgREe+mZL/nUreUZT52r8ILzakO5wJt0+R7tpVdZjWcZvbReOcpSXx7aC7atbbeW1jGQ4D95xovgIanjK2mOvwk+x2vlHdNraStiez1Unvi9OOifqff8Ad/8Qw9A/ZmJLf8V1Pfi7gKQqrNmBwA7AtmNyS7NE+wQxhrj8FAH9p7gOn7Ri170so1Rx3OvjG0a784TFvKM7+03Heps3qS1DNOe+KqXv/ybNh/8Q2crrxkm4ugPBOYAxlw4+7L9tCudMHd7xU5alxwAgjPAmOAfqgOgR+uTWEAgoAxAVgNywToUoCpoFHAalwoyofKkAWaJC0wBqmkbPoEsedAXHE/xlqtepdYBumuotjK+r62sT9qDzx0AOgNot2wzAX6lqQNvsB2N2w+2W6XoMYYA/AbGBf2TY0wdxyDUcegYkwr6sSFPGnm86XORt5AX9UGvVq6F+lqAgF+awD9lyafOHK+TAEANWAbAAmQT7Nen+6SlY8Cn+1WmDSl2ewFHAHIcAQRBP+BaR8AloN3qyasPBHWnHADuBtDZQF1qHdLxkWnqcl6Wk/WovHnRr8D/hz/r98Y2428G2QXAwuPXfu3X/gPB7f35tX9lS5Q8HHxXgHF60MF4YGO7AsYpfUGpQFWaYFaQK+iFCoQTHK8B/wnCpwB7gvur8lNlZD3SEfAwnBZ5Pnmennu2h22U7WZbSukD+Km+2EV+4OGkORZTHC6qenS7Lml6A0FgJmhj0Wao4G8KNAo4BZlr4+ol1cYUTV149ap8TVzwra5xKXJ5aOUzrm7KzFNl6kpTb1deG9CpYBtBK68sKf1OPGkdC46RpI6hpI4vqeOuQxmbQwuO0R5lTKe8N8ZT1tS34B/5vTx4mJhP4OUF/byjX0G74P0Q9On/7tHT/d5T/5TxauAXP/+FoxPg1O/hVxxI4zjm2uG6arYc03NjdBzXcR2N8Za3l0dZ6sj3qk4adXjSOWRjdy7PlJ2BBN7vZ03HPNKi2ifpXhx2aPcbAAAvwJoADbBTn/4jA3RlANj5lFlghgxwqTMAOaAVYIiugLECYACsadAEusaRoYetBLCCf2S9cshj3h6PfeRTwXrVOq+J1/IsY03e1DFf1kWZNB0AtLVOANqktpntV+Wpa38pk9rO9ot1gqLDGGEsMWaII0dG3KADwJ0AjD/SGDeMGSl9a8gxhj4XM5NWu4KHFhjjRz3GxcXEawGAeYG+T/BTljx6qWMaMm0gSycAoHYKEAvwoYBdALIyQX7KTFNfgFwp/2KADgEHAE/Q5wA3jorqAKDe6QRI3t0AnBdP4Xkar9Mh6+J5Sz1HHQGU4YcHK/gnjj55v+Rjf/eDPPWnrLc+/z+Mr0d86Ue/afwOAK8F4PUn8G8DPMFfAvlL6ToB2FXAjfKog/MKxncBi1O6glEBqjRBrMA2wa4AWFCcQPlhAOgE1gm4KyhfAvlf+ZKXXKwJS3ZqucSzXlnfPI88P8/ZNsh2sa2y/WxT6VRf7Cq/wtDJrCyqOKSPYr8fR16D6xLoQHBBKWhLQJegLwFi5V00QknL+JQsdTKPtjO92lBfmukpqzam4gL0TE9Zj1cGnQrYq2nKpNWOcmnNbzzT5aFzwbaBrgnZ/5UXvDheHD9JHVtJHXOOv0JzfPb4Op7XxFsRlw7y3Jsjt/wL/AHkhwD8aUNemo4DHA0J9Kd4PjpIHdkFgCOAut/BjmL8Of+OY3yzVhma3PHcO+2aVuPmUW4Z2PVaIm3qIA09D3htKVui6A8tPMnOBr7yXxwcS/nvVPrYAU6UTLg+dfVJbToAAGN123+Cf3hBGgBPcCYFvPrEFiApmBUsEhdIAhJ7OupKAbrw6CYYJS6ghWor81k+VDsCZ/SUK4Mq0456aeu6eetiuVlfeJ0Agn/awvahzWwn209qX0iRW4Y6SUmzLlLyylMXeeQ5dhhbjjUdBTmeHEMC/6Skkb88/XdCuZYLluvlY777oy6m/jZQQA+9SsA+uw6g7AQYwWwD2YLyY1PAMR8ENPCBQMKUIyAdAD1A3gP/OgE4N4H5d/2Xv7X9d4J0BMhXRwCgfmyLzWsH1QmAvtv9sc1HBHkNgH8DAPjzbwBQtvz5McBDOAB0ELAT4C1v+5afv5bBuUchuwLGOX3BKTTBq4A2Qa7AVyCc4PjhBvwnkE6AXQH4FGBfA/Z30emVU+uS9cz6e055np67bZHtY5tlO2b7wtMX0rl+mUvbY8gsZXFh16Mu4pyzpUMzunUAsAgVvAnqpIK/HmgEcCoXfBJXvkZWdTJvz5b6UnWMSwXXxpNOpaX8qjz5a7AO2q7pvTh5evK0oY72k2b7wNeAbpUZt+8rdWxU6hiSJvgPoDOOPcZfBMYlccdnUsYwccfyWtqyXMpD3AMbd/ZgvSbgB3ADwr/jO//eQYB/gvslHofAFOCfkuMIYF2AI4BdATy0usaOcpwdq0jGHWUMLcjXsd6Sugf6GXpK2hxaIuFBXHekTR3aHZqCbTCn37Mzlh3ljWVv4ti8V4edOu4CYEJNB0AFZIAsAsBMmiBOwIYTAKAHIEzgJkAENAoGBZDowwPsBJyAVPXMW6mAEjn62iMuD01b1i1tyVOeZaJnXIqeum9849/d8spvgmYbUL51leoAoA10Atg2tLXtrQzakyG37VKXcjINHfqRccCYsH5JSTPd8ZRjijTGDnak1hWaDgDyM24Zv9zs2xU8tHDtFzMLCr4NoCMAkD4XBPLQXQL20ceRwL8FsK2/AtypOKDYNPkpil5NA+gD/gX+UIAzgTRtQwH/5Of9f7zlmSaPDrygv0e/8+N/cXw6zxP6uhsggb9P9aHoAfDhsV+dD7QZuwuwSaCen/jk87fgHwcAAYcAN3qeSADe8zUAwfyu1NcHcCic6AeFnpgDh2vSKiglnqBVIAsV4Ap4BcAJih/OgP8KtnuAfArQf/VX/5WLXcOUrV65tW46AvZ1AmS7ZXvW9l7TR3M6R1oF5WLNxZwy49s1yWYev+QAYKE2zrMTrwEICntUEJnAcxcem9pI+8p2sdXTFSzXtJQnr15PVtPUgRpSp8oyDT7T5aFTaSlXTxl0KmQbo5PxbHN5QD98D/wj2xX8M74CHLCOqIHxicxxCmXsZlyZY3qKtmz38+BBouD69a/4gRH8LwH1ufTeU/05/UzbxwFg3aE4AAjXdS8/Algd2ihkjHo4ngff54dynTUFx7K6+1BsDASuT+wyp29kXDtzh+VD9znMP7TMNXjd7mP3qHnq5HKowrQ73mSdTOv2fxwBPvlPkAbwqkFgB0hLsChoVgYYRSaoEzgbhwIqAZc1r7oJKOHRxa4BmUAVGemZR9vVfuqRlnqWDcUBoL2UXwdPuZQDtR5ZLnWuQfBPW9guPWq6fYBOtql2lFtutoXAHfBuPTMd244VxxC6CfzREejD9wL6N7H1f+4CpD7jRwK/6aM+uAuwRzef8JtXmXEp8v/qp750BK+CbYDsVAAIkzZH59LIC8gH7PccALxLPz6R34B6bCHDYQDfC9R73LbfqOC/tyuAvO4GqI4AnQDSsQ4bJwAgf2o3APo6AKC83uCTfx0AUG7ufAvgUK8B6DDQmXDNTw/mhu42bQ4cLqXl0+cEpgLWBLH7gH9BNDQBdgXgPaA+BfaZ00iDToWpvL1yal2ynll/HQEPNw6OdHroCNExYltl+9mm2c62v3Spv3rp24FwGCYXay7AlGUcfrsmafxgEJj51DaBXYI/gWFSgWTK4JVPgdEqN4/5Mq6uMqnyXWmC5po305JPvZ68yoxLyS+fFL4X1O+lpcx6IZOvNNsLvhfI05MjyzEgn2PEcdOjjq0F4M9YdGxWWsfwVLyZ2AItdDgqfSS9w7+Cf4A/gQ/w/cT7fmAbEpxflU/HQPLVLrsPcjdCAvw1PB8vJFzTKwGOmUONEsZz2oQfx/i3Pv30W3lXnmuP62qjl7r71AHbQwsPsM2DEOy3OHaRX9V+MzF7YJ9gPSxP+Wzmm0i0osOm0mPnBL9vndLO9mOAPE3NVwAA/QYu3uoEAKQJ4gR1gDkBHxTwJlAUHFaAp55AT4DZA+Toppw49gWqUIGnMhZ2ytDPYN20Y5rySkkXeJun6hwzbplZD8pTXsE/cRe2tAeL2R74R68n77WnMvQtF0q89q1tkX2GDuPF/L0n/ehYH8eFFH2cU4xXJqfwjDKuT+JgEQLAo55cIzoGeIpvENBDfbrfoz398eN6n/pt49N2wPRUGD/+F+kZh8+ADdMB/cShyADnFfwD8JELvHUCkI/vBOAw6IF/Zej57n4P/OsYgFIHQTtb9y+V2UA/cR0B7AIw4AggjZ0AuRtAJwAf/vPjf5/+YR+/ffrPawD8jSG7AA7xbwCCfyl/D/jss89+sA3W4SQG7KYSPVC4VlbBKHGBaoJXAa0AV8ArCH64AcVQgbLgOQF1BdsVkPeAu3PhVWjPbi271i3r7bl4bnm+toFtYhvZZtmOtm1t97X91dM78lisCy4XXlLXJVwTYxCkJYBLgCfoqwBRoNmTIzNdqkyKvMcrgxq0Uam6Vb4mPgeaM01eiu0er0yadaiyjMtDa8iy1NOucanyKZptJW/79uKm2f/SHBvyOXbgHVOVOuYKZUwyFh2bPer4XUObqaMDHco4qeP/9uXf+i/f+Kp/ckFgG/2P/vj3XfzMr79zDDgBAObSCtKPGV/zLwBLjgAcCKwTOMeTavTdK8P4Hcc71wbXSosrQw5/lWO0zbXKe/g4AbiOm0GvqavaX1s3yhn/jYD5aFM+ea+rfMpadYwN5kTWcgwt2FiVThlUL9OVQR/7GCBOAF8D0AFQwb/AH4AnsAcYAgQNpAHiAGyphz5gTqqeAE/gJ9DUHiASXaiAkjiBBR360ExTV5m2pOSVhxIX4Gu7UtLVMU/VOVbc8qDUwXKU5/nK2za0j20rRWY7K4PWtsS+utjNctEnbn77MSn5e0Ed8yYlrcYZM4w9wT/XBmO4BcbyyR9MrDrauMa8rnAQZPjItotA4C9VhsOA7wC4BR/K/9hDAeUpB7TzVXue4MNDlwJgnODX/nma7w4AyiEIjgHnAPotIG+gHh7HAeUJ9qeoTgAAOTqC/p5DAAA/91rAtg4bh0A6AXA0YN9zg3/MCdDOGSfAH/8DnzwGXwPgKQHA3Sf3gvirUuy95c1v/pFTGrQ9ULhG5lPnBKMCVKjAVSArsBXoCnwfHgD8V4Bewb7z4j602qplpSPg2E6AbN9sd/k1/VZ1DjQWcyEl36PICMzdyQ8tvg0uRlmQuhaSCvwEhHOUxR7pgtDklUl7acqk6kKVSTNtiU+QnHzNl2nJq5ey5E2vNHXkpejKS6tM+RKt5U7Fs+3gjcv3qP2f1LEBdcxAM6wE/47BXC9X3nHbo20Yb0EF6XkYl2baneF5CALgF/zjTM+n/oL+So8J+tM2DoCr7ADQOaCNW+4EcAznGB/aYMz5+SpjE/uX3vvnOmyyAXkLhzg8B+jUMabpiGhKlj2XZ8rW0eUPmMic4OBbiUOE7CxPxErVtF58tGUZTLI+uRSg+BqAoD8pT3IT2AkmkQHgAGwEnQBQgnJBHgBSMKgMWyzStO+CDd0en4szdMinXtrRHlS9lCVPuiHlgm9l6hyTWhZUJwTlKYfP85XPdhHEV0pewHbKyZftpj3PkXLhyWP+CtjtS9Ktp5R8qb/EY0vwzziNa6GOe8f/badMSJzbsKEPWMR47jgSuFYJOBKe+lNf9KE//SeeOwYAeoYRuLd0dAiAW959rwG5gTTe4affsUVcm3wEh5snzgVANYAaMA8IZ0s9zgPKNI30qUAeADpb/eF1AkxR7LALgB0B9SOB7gLAjg4AKDsBCOwkwJFgvdDDznYnQDsXHACAK14DYHsf3v1Dvwag8wAnwIu/4qXPtP49iaMCwrXxOQfAWvCPE+DhxgHg03GflucT9ATWCbgTjOec5zxW5y/nsaTOaSmTN7+0lpHlZ72yvnkenpvn6rnrDIHqINFhogPFNtUJIOiX0m/2ydo+RO9Ig9CFVVL4DHVtMrT07XcAErwx72dwbdQDiMoAnfCCzyl+Sk997Ul79pQdggqutTUVT/kSv5ROWeok7fG1Xqlj2i7UdiaPbbxE7X9pjg34HDvy6QBgnE2EOiZrPMfvFN9MX3ICqIf8Th+s1QT/b/sb//zive999/ikPwE4vOC/yq8jfigHgI4A6C3vVMenY934mtNCd+4gXbtD4w3IlvI2lcWj2qhxDSA3IJOf0jffjdCxwZjcnAjhneRajYYINi7UQ9nQBIZLMiZD7FmGwCJ3AVTQTxwgD4gT0EEBcYB7ZQJ9Kek9JwCLLNIEjPCCUdJcmLn4qjQXY6ZZB+NQZPn0Xp2kgmtkll35tOEC8djUOlJO1jHl1iHPGZ72sT0rJQ86Kbc9SfPctWkcWvPRb72AbetpfmxnmfK9/MhwNgF2uQ4Yr5vxnGO9ie7vQZt81h/7gn8qUH/J8187fs0e0O5TewG8wD/BPjKAPf+9+8w/eGbklfGVXgAO+tgAGHPz5Cm/YBpgDaBmxwDgmZ0IvkowBf6V4wBwiz+AHZs6AJJXBl27G0BHgE4DytIJgG2dADoCsA14whHAdwCO9RqAuwr4OCDj+hRG7i5gMUGmwFMqMBWoQgGvAlmBbYLdh3uC/wTezltQ5yuo86I056K1vHmlaT/LzfroCDi0EyDb1ba27aW79iX6RxyDLq5ysZW8axLp0OoyBsGa4M21j1Tg5/rFddIc7YFS9AWelfZspU7a007K1vCC556uaZWii8xgXvWML1H1pamfssoTVzZF09YUn23W43vtb39n/8M7LqCOmaSOJ6hjrFDGIGPPsThFc/wu8c3ceKDnkbyyO0FZq/GeP0/+eer/G7/1gXG7/xSod1fAVPox5JTJWifB+yF4dlDfiU7c7SQc/0u51OOakj/EdaCNB8xDXO+biiiv9bJs5MlXvaW4eStdyrc63clnYHIDnBOYEOtk1ywOm2CepNut/kyM6uZkiT3s6gDIVwF0AADEAPMCuowD3n26D8/CCir4n6PYwSb6BOLKWGi5SMtF1xqefCzY1NVOUtIzDi/Ad7GX6ciWALj5DkWz/KxfyimLONTzlbJApX2l8sTJU+Xm0742LUM5epnXfrPvKEeZeS0TG+RHh0C6vNS8jCvBP+O0jPMWPR+bFngAaOcpPw4AAoBd4K4DwC/YSpHztJ9xDfj/0R/7sQveUSeuk4D+Io6T4HnPeWrcOpcOAMA8gN9XEgDWPpEX6M9RgLpOAChP6xPw93iAvMCePIJ9KOUTUqYuuwHG+jYHAE6A/MYAuwF0AtCOvALAvwHwtP7QrwHoBHjnD/7QMcHX6otjH9Ao4JQKSKECVZ9cTzkAlsB/AmhBNTTBNvMKwbkLypxicM6q1Lm8R6uucW1CszzrkPXK+uZ5uBtgaSeAzhLbzra0bbO97QMofSld26+rB8o6RRZFHHPUhdOltUrLMxASrCWIy3ULPPcE1y89sKhMAEocvtJMzzzyPX1l5j0EFUxrayquvNKpfMorrflrHP2UwWfQnjrG96W2N/nle9R+l9ZxQTzHTY6nKzgAHLO70Dact9dB5YnfmYOHEF/7FX//4unXve/iJ975LP98e/HLv/lT3af/APub2AGgw2HfHQCsCQg9h8F1/SvAnRkwhzkRr8WBOYjrfmMW+dRhnqn0Jbn5894Fr3wp/6p0jW//OgEgBDiH9pwBzeoQ4VJ+J0omUxqJSVAZFLkOAF8BgALKAWE4AlwEQQH1ePsMOgCQqzcH/EmroF/QlyCSRRb2crG1lnexpr71qpQFoLLklVWKjrZr2jHi1gkqT/nyUuvk+UJdmAKs6yKZuppuHmzAex7KjUPVMa+gfYpqA+o5YAN97fbyMqYY74xNxujmxu24XnUR3TOl4eM++uPfl06AugOAGx835/GdvEYBuAAV+4Yn/njHcQIQXv3i121fARi95m/6q6Nj4TM+4tvHJ/6AaB0AlMW3CADVgm+A+Bz4Nw1gnk4A8pMm+J/aDZAAHpBPsOxKdQJAcVhgk8ArDJTt6wB894CPAfJPAOwC+Nmf+bkP8fE+t+8fmp7CqwBrgaJ6AswEngJSAaqAVQAroPXp/8OFJ/8JmhNMC7Kdf3Jecw50XpE671yFaktqWc5vWR/rmPXO8zm0EyD7Qd6+WkOvYZ50cZTURZNz+tDqsQ2CNoBcAjp4Qq5fXMP0wGLKBKbIBJkpS3nmq7x5DkUTQMuvoehUPeuk3HilNd14jyLrBWyqr/0aV74Lre1t3H6ufe+YcJxIp5wAOc4K71isNMftHN/MbQE/er1jSt7TvRWyEfz/xe8dwT+vzf3uxa+PAcDN1/jrF/kT/Ce/5on/rvppk7wEQfz4qkLbvg+g931+6LiLYSPvgX1k2jD9mv4R4FaMh2uqpNeh1yrx5I9VDcsZWgHJUzbxgx2ezOgEAKD7dH7OEcDk12owZHDixIYBmbxUJwPAHiAu8Aewy7MAArChA0jLgJ7AToA/5QgwPYF/gn/ssKiqCy0XXLtSF26VCqCRu0BUh7LlM129m6C9eiDrtZOL0tpWPV10tAMlIKttkLbsI6jBMqGmw9tWgExsG1dPXShjBgcUN37GaYxpronzMdMCzA3ckHm6Dyh/4fNeuX0lAMAP+McRANUBAFChH+gX+ofA0+mf/YV3jxRbvhZAvzEGcAJ86Ue/6RGQboCasgiCegC4gByQrbxHSU+ArjNAR8CUA0AHQb4WgJ0M6QiwDOzjPNBuOhJwBHzdJ/39C5wf3/hVT48OE/665tDAX3un8CrAGpCozhz4r0//jw3+nYucz5y3cn5xnoE6ttfSzJt8lmPZ1oXriHBMJ4BOFp0uUIG//WN/raEz08m+SS6EoMljTxnUNQ50yJAOAIEc94EaBIOCxB4FfPbkVaZeUnl04Q01rvwQNEG0fFL4uXivDuqTNsVPpc2VV/P0ylZmm83RTIPPYF9L61ggXh1GxB1Lm4cIl8bZZszlOISvY1NZjl35pt4d4z05sjt1gANe8XlvuuB9f5zlgn8oYLuCfwH5WiCvntT8+1L+iaACf3Yu+DeFAvp0BFSHQAX/5LnGDwEy7jxyDCq7K9Rzk9bzQu59I3mv1ap/qPhYH+aar3r5y7+JsJlXDl4uBscTpAAmPQA6wCgDC34APBPl3MRIOvkF+ToRoDVgnws7FzoAM0E7ix74BP/wADfk5FPHPOkIUJZUR4BAkEWUiyrsyc9RypxLz/OZ4nOh1+PJ15PfhIyFLOXmuRBf0w5VBxvI0hZtmXH4bF/7yEXvFCVfXXRTT2xlngT/jGnGMxdauw6GzbXQyPlY0wI47NjGjwMAMMtrAdUBwFNunkz6pBLQQp/QN/QXT/35iA83duLsLsARgN53f8/rx3flcQTwRF0HAGBakA8vGF/aDUB6AnRAOnZ5Is8rB4J9QbtxKWUC9nUeJMWuDoksA5n2qhOA9xhpNxwlx9wBwOsF73vve3619Sk3lhs51oDE1EmwCS8QFZj2nv775B/6sD399yN4boX3qTjUp+U5LgXUzheMU+Yrg/MUYzdDnXcyzvh2nCdNneTTLrxlWgdozmnWGeq5eG55vraBbUL7ZHuxe0Jnim1rW9v2tU/or7XOgCMNuhzP46KplVOpaxzp0HS2QeCmA0Bwxz2B4HpHmmCx8oBQZFLTjUuVV0q6QTtTceW7UEF5pWkj0wTlUvQyPePaMH0uTZ0eRdYLPXuWCc32Sr6mmae2PXH7WOoYSJrjRN4xtFmkb8fWZpw57pI6RpURT970Hm2q2zEOnwf6d+rgQYPgn/tYgn94QHrPASCYl/bAfKbJT9Fe/p6M/AQegHB/B9gL/gX8PUcAAF8nQIL/5K/ZAeCYZDzduXG1OSevL8+xnqfpDwDhL3jBC74ExXZwrVbdMeFAP6N95pfvffvbv5+/NWx2hxaOUq4Tz7gLgMmv5wQAsAvoqzOAPE6gpKGXDoQpvjoAXOwA9EkDsOsAqOCehRD6CfCneIF/Up0ALKZc6Mn34qZZrgsxaAbPoUfr4u6m47nwnOOpZ6bXhaltk5TzN277IIO3bVKuzDy7UPJm/eSx4WJe6pP/M/g/zFTFXMHTe8A/N2qf/EtxAABMEqAYp//tK74PwPt8BF8LwLmAE4D+xQnwh578ytEJkA6A8QOB7em+wBw6txsAJwABwM/rBJTBhwWhOAIE64L+HsURwD8L6ADgib58gn9kpCEjD7ag6jzzgt/8PV4BwGlyrO8AuAsA+5sbyWE6fkcrCe7neAFlgk0BqIAUCkgVsK7Z+p9gWIAsYE4Q7TzB3NGbn3LOduxKAfv7BPMnzXKcG6HWKee2rL/n5DnmeeMESAdAOgFsQ9uU9s32tg+yX+b6sabtOFym1HuLLhdppmUc3vUNdMiQwE0wB03AJxhM2gOPPZng0zTjSQWkKUO/F1fXdONrqGC76lawTbqyHm/+ai/jyWuj5lMHmkF90823htrO2T4pk8eWvDTXsNnXORYcI8jkcwx1HAA59uRzfPZkmZ58G7pd4I/OnTx88s87/z3wzwcABeFzTgB1KrhXfgj6M7/+zvFjhK5hcOoD/HtBB4DUHQFJE/grvyYHwDieGN9cg21gMUY57to489oaONd2fpynMs6Xw/joANi0B3J14Y9xUO5giHnlaOVieCyQyY1JUScAfwNmSCAPyNcR4CRK3KCu/0cOONcOlIubRYyLG8A5MgAaixz0p8A/aei7IEpgrxMAmXqZLl8dAC74oPLUw7gUmXWeorl424XXHgtB8hlP3gVgpehaN6kydbUH7dUrF6DJo5/x5LWj7SyLNrPu1kmqvtR8tvNaSj7LgPrELfNTBgv7M/hvV/kRDuYMPPU4AdjS7isAOAFwAPBxP/qDPug5AugfxhR9x0cCubGzK4CdBb4WQF4+JsguAP4NACBdwy67AQD/AH/BPw4AZID0dAIkrzMARwF8PtEX7OsISKqDQCcANv13Am70tBHb9FnkCNiPQdllsbmZHGEUzJusgHAuniATXvApIPUJNWBV4OrT7Icr3/sXKOuMYlzOgX/nOWjOf3OAH6dWL5AH+VTetJ/l9uZK66wTIM+rOgF6uwBoL9vOtqRdbWPb3D6ofUN8ri9Nmx8de6W6OINyZBzexRI0w9DiY0jwJqCDMp9lSEAo75pnDe0BzppvSkd5UvilMAegTZNiC34qmC7NfLUemTbFm8d06JpgPiltCF/bssbVkdZ04varNPs/+Rwn8jmOHFsbmuNO3nFKPMep8h5tqqOuFB35DXu3CFhg3FHYwD/3wvrkn7gOgB74T1Av8E8ZvPJKq95UnHwAfutCfQx8B2kE/+27BUtOAHcG5C4AeNYG6Qi4xm8AjOOS8d1GlePx1AeY18Taeo76XNuvf/3r3wDdZEw78F632vW6NX4MarlDM275lpv1O2jZFDB+HZfGYFL0SX4Cd3kBPhRnQQby1byAecAaFzaBxYw8W4kzIBfIk8+n/8oE9i6IBPVJAfgZh0eWgcVTAsXKY19gCrW8XJTtyqeNtKkcWdo0nunIDhG0KaXc5FmIEqcsF6UsWuV7NOtuOvm1C0WHNOXQ2va7xrFp3cxrXYifwf9B54quMa5hdgMA3H0VAMqNnKf63/yGV4zjgP6ojgCuRccF4Mh3/RgbvBbA9wIAyPQxtl780W9/zBHAbgBAtrsBeNKeuwXSYeAuAcC8uwBwAPQAv8C/R9G3vAT9Uzy7D8hDgNcBwPke8zUAHQpvefObf6TbeUcWCgSXaAWYAk+BKHTt038Br0/BBcRQgbLAWSDN2GTMOTc5Xzk2ndN64L0H9tfKevYsC+pc5jxqHamvdfdcPLc8X9vANmEnwMONs6TnANAJkO1uX2QfLfWn6UcaXi6GetRFVC6gxjVOq8tgELwJ5qQJ+uAFhkkFjj1AqSxBZ+Uz3tNHho56PV7ZvjRBODYynvyu9s2b+ZRBp/jUX+JtH9uuR7HRk1dZ9it87X/ijA2p48TxA3VMFZrjjzHpuJSfok31foF+TpjDhwlsoZ8C/4JuwPmUA0BgL4A3LlW+D+WJP2C/55hAxocKX/d17xp3RfYcAMrcBZAUh4BP/ZM+fO7z/tqjFjrqr+PRQmpc+W2nntf4L3jtZIYWlHluxqFex8rUWaLqJ13KQ7r6tVzkRzksaPsqAJMkQF7QnyBdmTQdApVHh7wAdxcwUBYxaRNep4AOA8E/VAeAwN5FGrQCfuIsjqAskAT+uWBCTrwXtG19XYBVSnqVEa/5jFdqOdCpfNo3L7qHCtqEZvksOpFZjukuSnsL1p4Mm54bPPnR0zbU9kdPfheKDcu2LBbelIcdxg7jmPHszb1dQUMLjPnzccAWGB2B7Z8CANU4A3j6718Cjnx70kp/Ebj+BCtQAAz9xxih/9gNQL/ybwGAY56SIyMNHW6iOAIS2MPjCHA3AEAcgI4c0K2TAB6ZDgLAvzsAekB/SYadfC1ABwD/PpD/QAD/NX/w17ZOAD4GyA4Az1GgPkevslOANmTxfcAuX2VKIDhHfZqcAFPQKRD1yfTap/8C3wTDjjkBswCauYLxR3CMMoc4b/XmvimAj8NqTejldy6DWibUulg360q9PQfPyXPM87Yt1r4KYFvb9vZF9o/8XL+StmqQrFfKRZC8Cyap65mkQytifMghFcAJ6KQCQO8XxCtIJF6BZC8+B0Ln0rSlTtLk0SO+FATd6C3xpFedjKcN5UvU+qVe8nM2zQvN87WNlGV8Vz771/5P6tiQOnakjKkIjDviOf7kHaNQZBnv8U1l6wyA50Dvzh2CfwBxfu2/B7TdATDnBCBtLeDndUOdAckrc5u/T/mXHABv/rb/8eJr2QEwsQtAJ4A7ADhnZfB1F0DrbMbKsQ/Ho2OV8u7iWMvrzHNUlm2sLGmmr+HJm0eNZ1ryWWbyqXNQ3k6/5AQQ0AvkK2g3rjMAmnmUowcQdwEDBegL+qXICDoMBP5SHQBpS8Ao0IeyQHJhJHWRp35SF1TUy8XWGur5oCtfF5HIU6ZeUvKrY7mmV9vW9RC0lmHZU7bRR4dFaS5WK+/iVjlxePJ6ntjqlZP9Yp+hJ5/p2MM29bFMZIwBxhGglMWAi7l2xQwtXMdketCL8zYZY+HkLiDnAij9ASih/xwHgBYBi44A09hKl1/I59UAdgAQBEfcYOtrAQJ8v96fuwFIA9BD1cMZMAXy1Z9KV67jAYfD03/ml/7927/lX17847/5S2PgfX+C8be+9j3jR4L+9nN/ZPxHABwAeZ5zDoCrpm0+CHitw2kJIJouoIQKOKGC0KWn/77j7pNuQa9A2HEmUK73hZyXGIMEx5nzGNR5RjoH9nFakS6d0tWWNMuzDtbJOdu5k+vJc/HcPFfP3bawbWyrhxOvAdRdANkf2U/23Rw9wGBz0STVpAsj4vJS1zPSoemMQdBWqeAOmuDPe0eCRHjvK2vApuAV3eR7eWu68aTwVw1rALg6llXjVb6Ujj46NSjX3hy1zdCRvyqtfZv9D59jA76OHcdWUMdd0t7YVNajzdwlAIbOnTpoR95v58v5PgmfA/8JvAH3Fawn4E9eIF9p3UGQ9sgP8Gerf5YL7/b/nnOC+n/vD/zr8W8LlxwAgH6cAIJ/aT79v6b3/3NcOWZTdtd4r7ehnRjne+jDa/VJPiDIHLIpQPlSedZP/UqX8u+Vbsc/5gRYcgDoCJAK/DNfgnYXMQn8AfmABJ/8u8BJ8I8Nt/S7YIO6ACJdgIhcXiroNK4NF1e56HPhJVXHupPXoCwpaZnHsqTWxTzowpunxs0HPWSw/F3sW0/aprcodiGb1PPZpZyp86T/qAP2c1FNGYwPxtUZ/O81Bxw1E98JwdMPUHGcc+0KWKCAFp6M87Q7n3jzBJtvC7CbQEcA44OFQ3UC+NQf6jZ9HAFsva+AX2eAYL5H1zoC+MAgrz1wbrwCQX0zjOO1fSQI5wbfS3jNp37bmM4uh+t4DYA2vO4PAs6BQ9IAlFLBpYAzwb8OAN9Xd/v6w812dkEtIFfAKwCGMrYEyN4vmEecY5wHHZfO+wnGcz7LeUceoL9LMJ807We51sW6WVfrznl4Tp6j15JtYJsccheA/QadCkeYUHqLo5S5jpEOrQ6PhQriEuRVAGi8AsWMz4HQHlhVJs38yqSmGYceMgjcl2iWWXVJqzLj5jMOlc98lTcftLaB8Up1zlR5L65u9qN9Dc0xkXyOnc7YctxVmmN0Dd9M380jgT/b/dkyz1/9cX/qgeqeDHBeAXwF+FPxBPrY0E6C/l6ZytIhoEz6Q//4ly7YAYATgPNa4wQQ+EvdAQDlYcqRR0GOxSMXdXLmOfe5w7aZ0+mlafdJ5i7mjo2S8l6elI165GPeagnDJnFt/rS1E++kdckJ4OsAAnwoIEsqkM90eRYngHoXLYJ44sgB/QSAPuANmaAfHfL75B9KXKCvTWQEF0EsjMxrmpRFlPngXVxN0dR3wVUp9tSz7CxD3nzGk5ofGbzx5EnTxqGoddjHnnl1ArCQZRFLW45gJ7bDEudc9imn5qHcap8yGR+MOz9SyU2cm027AhzXO10MZ+WjtMCTH/eR//HTABOuSW7G9CfABdACUKFv61Nx4oArvjPAKwZ8H4DANc+/EADsaxDcs01fRwDb9fkOwFpQ33MITMlwAFC/b3jh3xn/xtBXIColnYAjgzS+B4Czo57zVZ/49/LzzQGui6P0bMfoFDBMucBf2nMA8FR6avt/gv+eA4BxVR0AjD3nFecx51rvBQnCGZN1zmG+6wF+dqv0Qk8XmQ4AqWVl+dbJOlpnz4Hz4VpIB0A6AdIBUJ0AOlN0rtjWOF10wtgn9pE0+7HHd4bEIUQuhJLCZ3DOhw69kEAuAR4810gNCRSTZ5EmmEygmcAVuXFp6k7x6iatPPFdgwBcSv7kq71M6/Epq3nTtnpQ+Uzv5VU21UbK7YPsm8qjW2XEa187HpDLQx0zjKfN2qKOrRx38nVcEict5fJNvJXLQ+/E8eKveOkzPPFnJxxf+QckA5rnQLXgOnV+9hfevd22PwX0q1ygjzyBf+9Jv2XuQnHiA/x1AODU2McB4GsAR376n2OwjkXGWo5H43diDO5wEl7jO2TZql6l/cj7BHMVc+RmnkE0ymGOeThpXXIC8ETVJ/o98K8TAOqTfGUuVly8CPiR+8RfJ4HgHwrQR0engcBfMM/ih3SoMillkWYcih7yXEzJJzUv+bXvQqtH0enlMb+0lxdZzU9dtAclqDdlY185ZV8lr3WnzvBQF7KVsqDN8jyvXcq3jFxMYxfwz/hM8N8ukqEFx/Mxr5mz7R1bgMmN3QCAFMYB44ZxgGOAvs0n4vC+AgBg5h8CDDgB+AeC3i4AHQKAffj6fYCeI2CtY6CnhwPgSz7h6/9/1EeQv4ayawA9wDlOgNz50APxV5W94x3veNeO3bW3eg8UKgNEwgsmoQJNgafvowtKAakC1ocrnv73wD9A2fsB8wnBeZZxSEjwLSDP+SznH/ge4F+SVRtp3zKzHtbNulp3rhvORwf4GieAThPb0DalfW1r296+sG+yv+xD+7TSvQdOP2MugOShNTjnJx2a3qUgmIMK8irgq8CQeA9ACiyhNQBgkUkzPWXyayg6a4Nlz+kLxqcoeU2r/JzdXto+djyHbLvK0y/Isn9qvKejfq+vHRcJ/ieAP2Mrxxt8HZdz8aa+1Ye/Uwf4AeBPEPh/z3f8652e+icYxwGQT/Ir2M94Bf6krX3an2Uu8dyXAf+cF44A6PhUf+FbAD75l+oA4NXJIw0CxqFjlSKIDxsKfz4etYDX677tYf5s05TZB8osx/jQBATj0Gs7qNwlJwDgikHp030BvhRgL5+AHt5FC5SFi04CQD3p7gAgTR5Q5yIHPYMLHhY9psPX4IIJHco17gIPitxFFnHtCUqtr/EeNQ+6piuzbKhpSdUjbw2mSTPfqfDUzTaCsoitC9uMq8sCl7y7nAf69FHao+8YL+xSYXxyM+dGzthtwQussefjFFuA3QDPe85T45NLdwOwRb46ANhKzxNznv4L/vngIA4A5NgBlAPy/dK/DgDpLo6Aqaf8S3I+KEh93vDSN+3kBHCXgN8+yPO/KuCv+bH9VS9/+Tddx3iogLDGK5gUZAo6BaFTT/8fNicAYJan2ktP/wXI3Cecd5y/mJeYWwjeD6ACccF5zj3wFeTzTQdk0F6o+sSrTcuy7KyPdaS+zqWeC+flObqjZmkXAO1HSAeATgDb3r6wb7LPan/W+JHGmAshF0YUIw913k86NPml0HMACPh6YNB7i4CxRysoBQCvkVWdGtdOAmp0Mr4PPwXGp+SUkWm9MqfSq9x4pWmztkMv3uuHXWT0Nfq1zx0LFfwXB0COseRzHMrnGO3xbYhuD9LvxOF7/oB/tvzzZJyn/kuAei59zSsAPeB/qKf9vbrhwNcBoBPgKq8BtM4fjjQAHI8PvPZaOY7dmxp3N1XukZp40iznSRg2tPJNvL2XwXOY51HsGn8ZFAOByZHJN50Agn1ogn94Ab4LFRYp8tDUqQ4AFmWAf5/4Eye4wMkFj2mmpxOAclww1YWdiyrk5EUXGbz2s86Wk2nJayP1tJWyzJN85s92Mq+2Ms8p8NQ160gb1gWtcRa0tDcLXPLtUn/K0LaLZuKMo5n3/Rm/5+PEW4A55ePaPwgA5t0BULfD810AgDWgvzoAAM8sykY7G0eAT/wF/0l1BPhagP8Y0NsRsAT4azp/L8gT/V13AeAw4DzIi7MDkH4sJ4DfV2A+P/bQqICwF09AKcgUdAJCfSLtFnXB6sMN+NcB4DZ333vvPf33/sDc47zFXOR9gjnFIAAXkDuPQSuQ74H9NbK0k/Yt0zpYJ6h1zbmX8/HccALsugvANrWNbXPa376wb7K/5Hv9iuyA44tFUB7GXRwldTErHVrG7Vqm8cTH7Z06AQR5CfrgKygUKPYAZg+c7iID+KIvTV5QrMz4oamAALvya+naumhvjb7nC+0F+gF5rz+WZPQtOrWPM+54cJwU8M84coxVmuNxF76ZvDsHT7MF/jz558n4Lu/694A2Ml8B4KFBbufn6b47A5TrCAD8T9k7hNz3/wH/OgA4531eA8BRcsS//3M8Pvjet7/9++NhAGOYNI/klR2abuvSDFu+skOXdQr2ODfOc8TUzDWbuOeedbQdoDd2ULFthZkwWWjzxJWdAAn+AWPGE+DnAsvFCwAf4G/gKa5P/gW71QGQi5zkXci5AIIio9xcOFWeuliWC8KUabcutNCtwfJSt9queYxnOeTPoA2peU6VUk8XyLS3C1x4FrXEaeNd6o/NtIV9bOT7/ozLuDkzXs/HLWsBXuEA3AP0fWoNWGXBoANA8C/FIQBwbqc6eLqMBXYEsCUf4N/bEYATgEDaoR0B+7wGkK8K4ATguwCc97FeCbhox1ve9i0/b5sdi04BQ+SCR6kAEyrorA4AgerDBv4Jgv9dn/4zpxCca5lPCN4jBN4C8QTnzmnQCvJ5CjQXqj7xtJflWLZ1sW7W1bp7Lsyp3PsOsQtgzgFA/9hn0Lk+Pta4anZdFCXNBZPrlqRDy3cpJLCDF/D1wL/AkPllKvRA6lVlAGVtVNCMvMp2iU+BceWV7mJ7ra5l9PQ97yk61Q9r5fZpjzoW6hgpYyjHV4/PMTnHN7N358gt/37o7ypP/fP9f8A6YF6g73Z/gb5OAbf61y/5HwLs92zoAMDJYZh8DWDhtQDa7C9/9quO9aoe45CxOnidbOLISPNwvBo/NN3Woxm2rKHxtR6HLvcm7W3Pk1cx46PMJ33OVI7w2CsB+V2ABP0A+4y7aIG6cBH8QwX/OAZYyLCocUEjoE+ZADLTSDdeF3MunlhMwVMH7WnLcpVDCdbXeOrLm6Zd4tpTZ45mOZZXbc3lP5U0zoOFK20s4Nch4EKXvsn6cp4Zl7dNsOPCGVukn7f83+QcdryyuSHxbQC+os+X8u13HAAAfYE/lFcHcAAwd/RqxMLNVwPcAeDTf/66TydAdQTwjwHf/J/8xt4fC8QBgBMjQf2uPOdKnmO+EoBzgfm713aHks2BQ9MEkzoAEvzrAPDJdDoAfI89t//79B/KDgCfhAOKuTcQmD+cW5h7vDflPYL7hAA8QblzWAX/c6B/Ks2xfSgnAOflOdZdANku7JSwzWxDnCm2rW2NE4D2n9sFQB/OOQEONY7CDgsoD3kXVZW6bhnXLi2TdGj8pR0ACfIEfj1QyPyE3IWzFIAKPwVUAbekSaf0qjz15ZPC7xMq6DYuTZvIMpDW08s8V+VrO2Tcdrbt96X2Y+1nnT/QHBfyjJ0SHGeMP3lpHZPGm+pjYAvZrT94cu37/gBZtsUzB/ZA874yQL0OgB7wd6v/vvb3yQfoz1cA3AWwz2sAtNsRPwLoGGSM9vjeGFSvl7avDJvjdeI13eLDRkbabTh2bZdRn7nkRS960cv4m8B2kjlXnOw5W8nHnAB+F0DAD2WBxRN8QT6LExdaUBdgPvmXuvWfdEMu2pC50IF3wSNoRsZCzqcmSS1/CnBiN4PlQ8kDJV2ausqzHuavelPxLMe8We5UvlOSew4J2utCl37QQQAlTz0HZKS50IbSl4wtdqCwIGDS4ObdrpghLqKTvYDOFVvfAswpgH4CzgC21AOqdQAA/Al8E2BpqxxjhN0iAHOAPyEdAjgA2MoPzQ8FTv11YN3234sD4Hd9DaA6CbBB4JUAdkTU1yLcJTFFlz4myC4AnCzcjNb3zG6agvxKBY2Cf+hVHABrt/8zz+TcyvzqfJT3jTnwn/NZD9yzc2Mq9PTTng6GdDpYF+9l1JNAvev9hvPjnlgdAFPfAriqA8B+rP1rfLfRslo7F1093oWtaxbp0EoYw2bMX4ojE/wLAis4nAObCVKvygOgezauAqzXgnb1puhV6rBL3t75K5vrh0yj/4wnn7LaxzkGGBMZGD917DSZ48uxuAtt2e/O4fv++aE/7kP7AOq5PDgAfPLvE38+7HddT/tr3XhdTwdAPv2H3zoAFp76+xFAXhnAAcDfAB5xZDhG69itRaqnvMaV70OxRflPfOvTT7/1R3/8x3+qsUML1qmxBz+sv2UY36cg83oe2oSaVu2qO4QOvHkae9qHJ3nJEeC/BOQrAIB6FihQHAHwLl6gLMRwEiT41wHAIsaFGjQXbsTTKWCa9l0oQVk8ZVxb5FkTrENvoZX5p/SUp26PV49y5KU9/VOVUWcWr7moneJZwPbOgzZIBwL2kE089R/a5cKYPB93rAVYiLENDuBPwBnw4s991bgLAPDPNwOYL9ppM6muOR7gWGCHgYDfXQAJ4qsj4HXP+e0P/Y3hf7p4zce8e3QUpO4Uv893AKoDwDi2cjfAErCvDgHAaJURxw5OAL6/sKbx9tERCPZogv8pB4Bb0Xkq7RPqhwfY/u98zhy0xgEgMM+5LMF8D/DXNq86mT/tWpZOgDkHQHUCMJ/qANAJ4LcQ3AWgsyR3AdimtjHtbdvP7QDIPuz18T5jZoc8XvcutqQuplyrSIdmexsS2Mkn+NvVCSA4PSRNR0DylGF8F1CN7hywr2mpL4+OeruWvaSf5zXVjoL3SgXyKVeW4L/KMg5fx4BjQ5pjaMM7vhx/a2jLereOBP++7w8wrmD5EHGAvk/+Bf5pt74ykGnH4LmX8sS/twNg/A7AV/z9R/8IsJLiAGAXRRshjK2bOC6NYcZ+q8TQgvJD1Alb2ByYF3gaHuVw3qQf+rBM7Q6NqWV5jl7XpisnrzxpHA+cHxbOIfNV+48s3YJfK37JCZDfBuBJrU//XWyxOEkHADxpOABYyBtwCrhlUxDcozoJsEs69lwsVUoaiyX0eqCzJ1PXsqlryqbyeL7omsd8vTzKLKdS00+dUu8E7rmoTZ4FLu1SzwcZzhp0WRyjR7/hVDo/9b8Fs8KRquhuAJ6osxsAZ8ALn/fK8R05Fnv7FEs+dwW4A6CCeeTf9PHvv+AjgQQdAeweqLo1PvUdgKl/B5iS6wRgJwCOAJ7YsxNg7QcCBf/SBKXIOLjOcK7t045LeXqgUFmCx2M4AOr2f+cb5inn6F3AP+3kPJbgXWCfbbvEmyftaJtyDGucAJ4L5+U56gSwDaZ2AOAEYBfAVRwA9mePLo2PA6SzoOJwYZXUdQp06IVctMFX8FfBIfMGsgSZ8lOA9ZDyBNCCZWU1rlywXqnp0F4aMuWp08uXsn156z/VXrQzaUlte6h9lbx91aPqJ639X8eHi3vpZkzlOMvxJ9/ULoEZ5HfqwFEPYAXsEq7yvv8agA7APwXgb12Z79MBwJN/XwHAKdD9O8CpHQFNzq4B2pN1700MFK6DVi7jejy47jbb1RVddQyTf5yXN2UNxDfXldfTVcuwrlLLfOB8RpmbYFlQwmCIax1d06UPaBfaB72ovzuFzNOybg/zJt0m3iaGkxsITrA0BIOWRTvAzff7AfWAOQNAz8UXVPAPRZfAIkaQz+Im4yx0iENd0PnEP8F/LqAoh8US+rlYctFUqXrSXGj18le9LMu0WkYv3rPd0zslGXWmbwXvubBNnj6q50c7IWfRiy42iDN2Jr7wz5jzwm3s+bjrLcBN4sVf8dJnWGgAVjc3jYOcNgtG3oV3Z0AF8+OHBJsjAAcAjgBeDeDDgXxAsOoa598AcFTs8xrAnDMAJ8Cu/xLQA/8JUHECAAIP0pjFSA8UIgPwS6fA/9r3/32i7RNun3gLfnUmM186DzPncD/wHsTcxZxD8P7hvUMwLkDP+Uwgn+3J06CpkHrmTXuWYZnWwTpZR++jnkPeazhP7o3uAKAdbBPbyDbTAaATIHcAuAtg6TsAOnJ6fV2GwyGjLp6wCc+hDOr9IenQ5Nvggi0p84ohgeEUnwAUnvXPvmGX/CxgKSfpGuAtoBfcG8+8ypJWfeOZb463TdSx7sQrr26P1vY2PtU/rkvn0k2j3+Htf2iODfkcQxveMZbjT76pXBqfxO/UwX1Z8A9wPTb4F3TjBMig/CYoc3m+AiD4hxJ2eg3g5h0Ajt2kI8ZrA1fZVcYwNrhmhg194LUm3cgtS33yKGvspUN50lTQxoCQfz7YfIDvScpsImxzoDeCd+TWh2sf+Sa9kW09HvAuP3NVk41/q4hd5jXiLQwtYPPOHpzkeKJMnt7EcAL4WgC7AdzmL9hjIcMihgWZixgWLjoAXLQJ+pO6kEsHADZcLM1Ry3QhiK2pkDrw1D0XWsgyr/pVlzzWWZ3Md9t5zon+nAP/pNFHea6OBfNBWegyBtzuz4XFmGJstXE2bMaaF2uLno9zCxyuBZjw8zUBAT3UHQE6AnQG9BwBS38HuI9jwN0AOAFwEgAyd/0uQAJQeXcB8MHEw7XkI0s9UKhM4HhMBwD3Ee8lzsHO4953BNP7gH/bEFpBP7s0DDUt87F43NUJYJ09B8+JuZjz1AGgE+DYDgD7tNJDj6dmry6miNfgmqTSoeleCoI6qYs+KfedqSD4TNoDrfvIXEfN5RVMz9EK4tGdk2lLHfWNQ5M33XxJqXvG4T2fNby6SbOtezx9hdw+S76mqSO1zyt1bAQIuDSGNmPKseZYbOLtuIS/kwfrNMD/W1/7nvHJPx+tvS4ALvi/rvLmymH+Buj7CoA7AHQEjA6Aldv/+QaAOwAY+zc8cBzPUA7jj2L7/WJjvF6YB5hPNtfWk/Cx08BralC/UXnr00TbOimzjpWOul7HUZY2tTXGqcdPPvvsT2/q8yRzCXmaUtqljk9ubD7AscB6CqfARg9b1qux20MbW8FtZ7ad5UTL4E1HgLsBWJTkYktQzsLFp/9QF24J/uUTSMJjowf8eZICqKQ804mvBeIsrFxUQetCyzTqIJ966muHNPXqOdzGOOdFewricyErTx94zlAWrZlH4E+fA74YM4wdb97twhg2wTF226+Vc/1vQQswj336h3/dN7KdvzoC+B5AOgLe/J/9u8e+ETD1GoBAvtKeU2BqN8AxnAA8DW7d0rtZ7d1bFRASB/BLdQKs/QDgw3j/n6fW1Nmn2T7dFuzy5Nt7iHMr849zMvOQQJr7Q96TvFf4JJ45Kuc4n94L5AX4Av45qq55teV8aVmWbV2YMwnW1bpzHp6T8yznqxNglx0AtC+7AHb5JwD7kD6tYe+Bs5zRBZTjNePeJyodmtlLgYVbhgr+iAsQpyj3KYL3LGgNplf5XJ6erjIBdI8imwosYEmD9oL5Ui/1K6/+EqXe6EiTV+a5Ja1tazzpVL+kHP2MV95+7vV/jo/NQv/SGGpjKsdZjsOWdGk+dawiv/UH/XRT4H8OjF93GnP9P3vX+7evAFQnAM6Anb4DsHEA4FShjU9goOSYXjOGl3RI55p5ko//fe/b3/79jR+Qef2RRryFgeA1uImPeRvvge4IwjftZbr1GNOZAzbpQ9N/EPExHRubMKYD4nnAsgHzY93IQ97QJc/2/X/sM3cyv8RcgY6HZRCXz3T1biWlYQgDgUawkasjgKe8AkEXNjoClsA/CxsWOhnI64KpRynDxZ8LKMp3YThFzWNZudBSJsWGvHpQZDU+Vd5tkXNOtjkLVxexSZHT1p576pNGP5HOWGALdgX+cQE5rtqwOh/nFrj+FmBs4gxYcgT4zwH80wC7AJb+DWAK4FfnQC+ObfIDJK+6E4D8AM9D7wKogNC4oFHacwD4ETrBKMD0YTgAAP9TDoCrbP8XcHsfEZAL0J3jBPAC+gr6aVNk0kw3jza0aRmWaR2s05QDQCeA9x/uI+kA0Amgk0SniW3oKwC0b3UA+HeA/j2jfWXfQe3XSo98pbpwyoWU94qkQ6sHYbs22cS3C0vuNS4+K61gscZZ4xhYANbgGgi5fKXmUW58iSaQXgLhpgvuiU85AZSnjny1k/ZM61HOBfnSOWW67QHtBdeYpMnX/pmL29fowEuVQxN8xJqE8WTIsZZjUb6p3rnjgeAfoMq3aa4DePPU/zrK2aUM5nVee3C7fz79dwfA9jsAuQugAf3tl/9T3nh2AJyQA+DQg5frYpyLvdZbfNgE0jjUGcH1W9785h/ZbNl3DldP3Se4dl/96lf/1c01qhy9UZcn+bG7YFDeKDa1Bx3vC8wpzFfOAchb4EhdeILfLxg2cSgB2/UwT9Kqc6vjnLQdNesIYMECCGRh4yIHoMgCxqc3PvVPKlAGXJrfxdIUZZHUA+PItFep+pUK7JHXgA31U08gTFot57bEqTvtSF+xWHXhWil9QD9yzvQtC1oXt+TFBq+F9J74cyG38TNsxlDvAmpJ5+PcAjfSAkPvFQG+E8B3AfxgIJQPCL728x/9fWEPwM/JersBevo4AZBzbV3VCcDWNQBi3ECv3MAVEGY8AaSgUpDp+/+ATxwAvpv+8IgOAOapvA95HxGMO38x1wncBfIJ7gX99EcNqWdebWHXMizTOnhvtI7c85hfCcylhLzXcD+5igNAJ4BOmKV/AqBfe46AKw+gZQO5iJJ3/ZF0aKYuBYFdpQn+uBetCT1wiswFrnzqkVblKTPvHBVQC7jVNV6pYL0H8JVVHeXYqny1vyZuHZfoVNtkG8rXPkJeZUvx7HcX/Tk26vjZxHOMyTsOpU11Cxrgb/3hF/9xAjzzt/7F+PrTLqD5Lukyj+sAqE//0wHw+lf8wCTgr44AdG+pA8AxX2mOedLqtTJsZJlv1OEaZKcA2+ubDnoE0jzMo02oMnTkh8YTenrocEBJHzYhgb12W9KlQ/uZb2gaPf2xnOKMsOxLRu9ChAYYG4VOZAJ2UndHAItpXg1g8cKiJhc6LG4AnAn84Vnc5ILHOIslF049KvDsgfMpAI5u1RfIQ8nnwgtefalpxqVT5Z2i3DrTH7Qhi1QXrZXSBy5S4dFlYQtP/9IefByy944/46ONl2EzZhg35+PcAifbAozh+uFAXg345v/kN0ZHwPhawKd+2/ghwDVP+qd0lpwBh3ICAFa5Vg+5CyABv7xA8ZAOAJ9s5/b/+gqA8xhzkKBZEK0TeR8HQIL6CvhrPHXhWTw6h16HA4D2sa3YBTC1A2AfB4D9m/TIF68LJxdgSbdrj1aHcQ3S6JAhwV3yFQguAUfXNYJR1zgZlwf09nhlUIFx8sqSArZ7ceVTYLwH8NFVLi/YVz5F1bc89YxLqSt80qx/8tkea3n7Yaq/6FfTKm+89n2OC/gcP8E71qA5BuE95KXKbx3l214Af3cAMH/dJUC/67lw/n4AEMDfcwIgGx0AM0/90wmALoFr4hYNEMa218IQfG/MI0t946kLj51tiGvQa60lX7rmaly76huXol8P0qbOg7S5Q7tTemO6c3szpP6czVuftm1MOtCJmsGdjgCeCLM40xEAaARwChwrOGbxljos6tDtgX9lOgHSgeDCsNo3Tjr1mgvagJIv4+TLuHZPnVJn+4N2ZoHqYjWpC1faWOcAsgT9bPPnb9e4edSt/oyHNsKHFhwn0PNxboFb0QJM5vVbAewI4BUAvgPA9ki+3M9fGE6B/N7T/Z5sKr9OAN5FBHTm9bmW55rlYF5qDT8covETDCaf4B/+qjsABLXpAGAHmbvInJOdw9MBwD2DoOOSewRzF8H7hk/maSOCbQqAT1BfAf9U3DzVAYBty7Js60K9rKN15h7ouXhu3oPcAUAb+ArAsRwA9mf2MfwhxtCMDRdPPeq9hHFMIA4dQwV2xisAFDAu0TUglfXOGj111IeuDQmwBd49muA+eXSNm09Ar9y46btQzgP9qfPh3ElLantUmn1CWsZ35Q/oAGCc5Xhs0bt1+PT/jS975oL7za6A+a7pM2enA6C+AqBTYJcPAX7zl7eHn+31Pq6FFaPnVMYb9Rg2gWo753pNINvlwJ42xm35mzg2ejazHeTRy6AcGzdx1PJr/CbqdG1l2hFDK/HSqwEMdIAhT9VyR4CLHyiLHxY8AmoBNHEWRy6YpC6kKsUWCyhtuTjUXlKBu4urOerCS6pdbaTdU+Y5R9qHNqXtXOzOUSZB2p08tivfcuAfINjlcQb+13aNnQu6uRZ4kvnLjwbiAHjqo14yAn+cAAacAVNAXtC/lK5eUpwAhKs4AXwqfahdABUQGhcwSvd1APgu+z4OAOYpgmBacM0c5n2n3ksq+E8HQAX7ozdl81PT0gFQnQDeryzbulAv62idPQcd2szd3n/WOADcBVC/AXBLdgB4pbuISupaQzo05UtB0C8FBMLv4wQQgFaQalzAm3H5OVrBsHbmqAC7B8x7IL4C+qqTcXWlvTLmZHP1ph0837k2IQ2AL90V7Pf0a587FhwbdexE3PEFzfEn38SjHHrrD5/+A/6v673/U3YYMI8zXwvypekE0Dkw7gDwXf+FnQA4ALi3M8ZnBo1jrDcGZ7LNJrnlHdu7HmM9uGZ4X3/Fl/DX2Kce2B2gzA/ML4333Hv1NI18HvDKld0UtR5Jb6ouN1LuOFBayQPByZzBTge7K4Ct4ixiWOSw+MkFUc8ZwOIHPRdQSzSdCi6aKjBXDvVJi4st4+kUUL/aOeW450ab0ia5yJ0D/fSHbWibTIF+b+z0NRPEpu8dB3mhtqTzcW6B290CfifgL/2B/+vFC5/3yos3vea/Hx0BgP9dHAEsAtY6A9A7hBMAzMqOndYD3KCudAj4e1TwD93FAQBYXfsPAHM7AATPgmnmP+4fBEG39xzvJTk3JvhnIVhBfjoA4DNdBwB0FwcAdaOe1tlzcP69igNAJ4DfW+DbC2u/AWBf1n6+0uCZz5yLpx6f9xb4IYPArkcrGOSehQy6FFjDzAXvg1M6NT3j8MblK2VxjGwOhJs2B+JrmnFoBm1J58o2rdbZ+FSbTMlrX6CnTF6qfI7WfndsOG5i3eJYqmOMeG8sNvHdOHj6D/hn+z9rw1MG59dRN+Zv3/8H/NcA+CfwLwCXHAA6Aiaojn3G68zIYaw5BlFznkM+d8ylX9kBwHXEl/037+xbx7ky5+pKGnnH/Mw9G7uX5ETiUP+Bc1VLy2szVE+Ktd7Sk6rcMSrj4B2a8dERwIBn0uamgCPAXQFsH2dxw8KHxZkLM3gWRchZBAFm1XPRtkSxlQ6FCtaxqd0E/cmbDq35TyVez4M2o+04f9qogn0Wprk4RQfdbG/aGrCAs6Y+6acP8wZMH2+C/d6i5+PcAne3BfxOAODcwKsA+zgCWBTk9wCmHAM6AbhWAZ31ul6Km4d/5rhqz1RASFywmPSuOQB64D+dAHfNAdDrZ2RXHT8L+VkocSR18QT1PgMdahDgVVqBoOBf2gOR3uega4L3xjW6qZP54A0A8MoLypOyICYuzbQqVycpvPGa1zj1gLc+c9RzQwe+UtOnaK8vdpXZr9nvOSbquCnxHGPwOf7km/j2Hz795+n0T7zz2XsP/nEwsD72CT/gHz4p7/4D/tn+v3UALDz951sA3sMZyzMjZxxv6PC0nWun6TrvQaeOubSpPGvk2B0M4TDzulhjY0oH24S83pTVPFs57cI/A2zybuU1wwnEa91q/ASqeLwqZKeO73owqJ30Gdg6A5iEAJuC/HQGsOAlCOYB6IBcZOkE4ClOL/QArqBZik3KNiiv9JRAP3XlSZFPuGwPgIAgv0dJp01oY/Jy7pwnT/l5TQOnDP1BoH/oJ2/g9B19GJPA0IaP/Xy8kXS2fG6BE2wBrhWf5usIYFfAvo4AnxD0KPZdQOz7OgBglW31rSm5Ee19TAHD6gi4aw4AnCg9J4C7AO6aA0BnTu3vvQfObhldLFXq/UY6NLPbkCBPPkFg5bmfLQXXLIemeV/Fdt5r5aEC7wrGjVcqmJfW9F3jvbpkvTJdfqmtbHP1iMMrPwStfe14KOuX7djZjCPHVaV1HDb123/k03/Wi9fxhP3UywBHAPj98J98Bf5b8J9P/KccAU3u/ZtxOTNyGHdPcB393Pvf/4H4izvkV7pvz5Q5l0SZlD1sqNfFIepSrynjrajHDtOsy9A0bJN96rJPnscqtSAY60xfMudu6ruQ5e4lO2C2Hefk7uRPA6UzgKdUAFIBLmCVAHDl4gTsCmB5cm2a6VNPw3QQkJ986VSgLB0BCfxvAvRbPiCfOtkO+WS/B+57sgT8OE6wzTnRvnygsT7lr6Dfvio3zezTuzdiz2d0boGVLcDchSOAm7tOAOiUIwC9BPjoZnyJdxGxjxMAoMoceNVvAVRAWIG/wHEXB8DDh595tFcAdJJ6H2H+12Fa7xnOoYJ5wb3UJ/5S5VDzaMP7EG1OOQTLti7eh6gj8zOB+T7vR9wHnLfv2TcAuApd+Enz3rNdUzS9IUOCPfkKCL23VYoeMtcnSafkqbMvz1xCXmgNLCCVTQH4XQF/6ievfctbS637mvPPNkc/44fga18TdxxIc7wEX8cXccde0ia+3Qf9yrb/89P/X9/ufGAO594K6K/A36f+l578A/4B/Qn85TcURwFtzL37xZ/7qg8xFmdGDmNs3LJP/3AttPiArAXS6uGYdNwar3pz8bSbvHm0CbUePT31d6FpW34qv+lS6zKl35OT1yN5ZXPUcqVzuts0+pH5tQmo770+HKTQgeBk702DxkpnAFvQ+egcgBUwzAKJxZKgPx0CLK5cdO1KXZxhl0VZLsbSMaBDQJAOndo5oG6l5k2A73lRNnVwgcr5eS4uLHsUHRea5Ne5Yd1YOFbAP/eUPyaesZ9aX2Xftej5OLfAuQWiBR74jQBAvM6Ab/66b7/0wUBeFSC9OgIq8J9yDCDf1wnA/MDBXNDqPUTdd2J7DgBlgn/ovg4A/saOD9nt8xFAHabO38yDBOdV51bnVx0AdZ4VzEMT5M/x5mF+ds7GrvOy9xjKph6EKQcA5+F9Z1cHwKH+BtC+tG+lOw2Wqym70Ko070XbtUQraiAI8Hq0BwyRuQ6B1jgy1yfSKjO/6btS1j3mkYdm0AmQVLB+SEqZWUbWYY63/mupbZhtJ5+01x+ZXvleH+dYyDHimAlaxxbxOv6I3/rjL3/2q97lu/+/8Vsf2ILgU39Cf8z6MYfz/r9P+xP0Pwb8Bf/SdATIN4oDgMA9fq0DoA0ux53zW2/MOS7VJZ78mjGqjWGPvGvsH1rH+kp3ts9cwBy1yYidNUctb02+Xp41+dbU59brMFANQ+O7zgBuOOkQ4P1bnrilUyCfkLuwcoHnQmxf6gIuKQu53mLOsqXUwXqgbx16AH4XmXaoE/ZdRNIOLhbd0r/0hJ8LIW+g9MMm2DfSJj4f5xY4t8BSC/QcAQB3wL8fC2SHwBpHQHUMGNcJwPUPKHVOWKLoMm9cZReAQDApYJG4oPFYDgD++q5+BFAnrKDZJ+g6VXUALDkBbDvmYsH8GgdA6sJXB8DU/YL6OHdTR+pr3T0X53POEUeyOwBoh2P/DWD2b/JL4/8A6blwkq/U+5J0aOU+FhL4yfcAYk+W98UEtciNq5P3UdOWKGubqqNsDmhXcL4G/GMv82WeTKv8XD1Iq/XfJd5rR9uzR5ccAabXvrTfK+2MF8eStI65jLfst/sA/J+f/v/+038cC8zdgH/AfgZBPO/yb0OA/O0OgJC94vPeNO4MMK8OAMbhzMhxjDkGocpqNuSjnmO/xYeNjLTVB0+oueY2GXbKu7qQy4rXUcblEjc7KGgr5r+auBCnvk+Sd9N/Y3xNHvJt9NbkWTB5N5NzsA/tFLffDMibhDejdAjwFFunAO+w8/E6Fk0soFxMuRAEmLMYYwHsYi/pLiD82LrWS0cDdWexyLn4ZMhFIQtDztt3+GkPn+7XLf3eoL3B0tYRsh+a+HycW+DcAvu2ANfgZ/2xL/in3Ph9op+OAL4VoCNAYL+W5k4A5oi1TgDmPo5Xv/h1e+8CSDBY+UM6AOouAEHvdTgAmN8rsJ96+p963hecv2nvYzsA3Cnh3yceagcAfatjJ/t53+thj3y5YJJPmvcr+aGVsw0V9LmAU07cwD0RPqn3yXrfVL5EyYeOVF57U9S1TlIBPLIE8Et82jBvUtPTvrJKs76mpQyeczTUtLm4eaT2i32CPHn1kmYeefu60hwnG94xlDTHW/Ity+09Hj73eX8NBwCBueqYT9Vvi23mbhz0AnbpFvAL/gPkb7f/T8hGJ0DLh62VDoBdBhXjkbH6xLc+/fRb3/LmN//IJjMy0paOHM9DU16bb8nuVHqWl/yU/jHk2S7WYamcrR7fZGDe22RIW3M2zN+bV+by3cu0bKShtcAYmLyd6L2JeAOCVqcAT+F4+s1OAba+A5ABym6/96kRTgKfEPnkHppP75kgXdgldZHXo6nX48nj4pCyBPj5JEig71Mg6s+Tfc6Fc+Lc+F4CQGMO8NtuUNtzQ7Ot4c/HuQXOLXDgFmBuWnIE6CDoOQDm0nyVgPlkrRMAPUDpvrsAEgzKCxR3cQDwl3T8Pd3D9v4/wb8B9BWAQzgAdP76tN05Pud32oK5mOBc7pyd4H6JN482tLnGAUA9CTqtd9kBsNYBQHvv8jeA9m2lB7485szlAkvexZQ072FDM0Ycug0V+BkHIMILFJPmPVPedQdUGXQprm7Nn3H5XNP0eMG+acanqHpzdFfgb10rtS2Qe84pq/rqKVc388rTN/D2kfJKTYfazz2a4yP4HEvyjrNKW7bbe/DxP57+A3hvC0A/Zj2ZswX/AH4A+1WAP46B137+0xfuAnC3Ba8AMB4PNHIYk+M45Ql+vGeOjLSpwzSoQV3TjB+SYpu6eUzV0zqN59aUjV+1bmmn8tZpiqpf6zSln3Lykm8oYer8m9r5oAVs7KRDk48hJ39vInmj0ykAFSRD3TFQHQSAax0EgG53EiQQd2HmQs2FW4+qk/nzqb2APkE9T/GpFwFwjyPDJ/p5Dp5bnq9tkO1iW21otiP8+Ti3wLkFrqkFuI5xBAjaAfZ8I8B/DYDOgf2ecwAZ9rADAAWkCkDnKLsAyNdOfdj19CsgzPiSA+A//cQ/Pv4PvWC0OgB0Avg0W3D7lS95yQWhvgKgUzfna+dd52Scqjp5cQQcwwlwFfCv07c6ADynvGfkKwC2iW1km+FAoR0JDzfOFdrZNv+kT/rkC/qB8Ef/8B8Zg99ryP7TqZP9C7/reNlRn8VSPZS5CJui3NOGXtgsurvfB0jQKO89VJBqfB9abeR9Wr5H897e4wXuSZMnj/Fe/iUZdUKnV7cq67ULOsirbo338iqjP+Brv5humnH1pD3w71jojJO6PjLeG28t++09AKSAXByhxwTWt8E2DlruCekAuAT+J57uLz39J73nAGijZjjQyGFcOudpEtvISJs6hpbQS+/JpmzsKsf2aD+cFcqyXHjPyetv2MhSr4n2OizTzDWuXGq6NOXyS5S8470n5yVkLXCO52OHFnBQSIeWdwxM7N4IoPVGkzc8AXR1DiTIZsFOAIgb+P7AVOCJ/FJwmz7APsuCzzrJZ53l63nlOdsWG2obSZv4fJxb4NwCN9kCOgJe8vzXjtsCAf35rwF+KHAK8PfkgHns8NR5jROAXQB87fjjPvrj37drW1RAaLyCR0GlIFPQCQAVjAJMdQIIWqd2AKQDoL4GIFjuOWjXOgDcCZCOE4G9zpXcBZBp8JmPfvDJP9QdBzof3JFg3Sr47zmNBf+c+9T7/zgBqgPANrbN1zoA7NdKdx0vB9LPBZg8lHub1Pvc0GSPBYFfBYUuypLmPbXy3H+rjHjKk09d790pM69p3ud3oVcB+rUc69GjvXpXWY3P2THNPMTlodkn8MpSR1nVrf1svDc2msyx06M53pJv2W7fwVoTBwD/AHDKH/9jrj22A4F52h24tMehgH86B3AC+DrBxunOGDvU4Xh03Bq/qn3taBeqbK1t9aXjebONPv7e0DRtEh8IXs/GGyXtKodlPcmcx1yzMdazW2XbvC1PTVuqE+c9ns83fOM3fDuvazBnIWthbJNGz8eeLUAD1jA02TbUmwVxbzzSehOcigvMr0p79q1L0l7dkbmYifOsbXAeWK1xzse5BU61BXAqPvWnvuhD6QiY+1Dg0u4AFhc4EgCia5wA7gLgRrtLG1VAWOM6Ao7lAKi7AHLXVs8BALgWaAu8BeIC8wTrbt1PQF/BfsZTz7xpzzIs0zpYJ3cquHPBc8Cp4bmx00EHgN9CWLsDYF8HwA3tAFgainUh1rvvIRt6wfumYFDqYrPSqfvvIeTc57GTFL63Nlgj29UJkGXBrwmeN7rylZqWtGebfOpUG8bpj8rXPurF7dcp2hkbU+MIeR1zuwKAZuJ0js956vO+CwfAefv/r4/3Subqn3jns5e3/V/hqX+Cf3cB8LoFToAjOAAcWDlGlV2FOod6XQzNmNfCGrvWR13tQD169sg3tPCAbxq84x3veBfXsLJGr3pg/wkcEJtXJoiOMphyDMxPTTaVXtQno5zn+JH7n3z22Z/+5d/8qQvmc2Sb0Mj5OGQL5GBLfmiFXAoMLm8wS7R3E9tXNlVWDPZL9Yx65/kk31TOx7kFzi1wy1rgAY4AXg1IR0C+FsD2/t5T/56MBQZ51zgB9v0WQAX8xgX+SXtOAJ5AuwtAcPrwCt8BuMprAIByAXqCdoF8gvsl3jxpR9uCf+gaB4A7Gqa2/7sDoLf93x0AtqltzA4A235p+7992qMncH2xIMuQ90H5oel0wxQorECSe3QC0Lxnq5uyfXgBcG8dIegnTf6qVFuWhz35SjmflHl+yOTnaOppR33TpMrnqG3eo/Qpcvs2eddU0olx4biplHGmLMdcE9/Og/f/cQAwNx37Cfup22dOpx0e2/5fHABu5a/gfm28OABOfeAwzrcfYudaMt4o18KaY7xWvJ5bBq+jvIbk0x6ygfBVL3/5N/HEPK5byjZPj7bkxSPzoWy8l3Fgftzo9NKRmb/S1Kfe4w4AnA44H2gXZC2sbc+mej6u2gI09lIYms5NhKV6md6qdz7OLXBugbvWAv59oI6AfC1g1+8DrHUCsAsAwLhLW/ZAYcqO6QDY9zWANbsAWAgmeBfQS3sOANOkmV/wD9UBsAb8X3X7/yEcAPZh9qv8LmPlwLossjxccHFfTN77JHRowTj8peDCEmoQOEINLmKlKYdXnnRKnjqVFyRDKzDPOLxx+TmqXfMYX6LUD51az4ybLjVtzrY6a6ntndT+WkPtd3TlC3WMJHVMzdFm5tYdA2CU+wNPIk8doB+7frwCwfz89Oved5Tt/+kgoN35COANjJg6hpeqsJ07AeE8tWZ3Ucvk9YG9pWPUEfBulGs9enaQbcuHj+sWuTayLslvipok5kch+ckMmwR062F+02pcfeTb788wj8U5mVfdM73hFnAwXTe94dM+F39ugXMLnEILuCPghc975fjkP18LgF96FYCdAe4EYKv63OsAOADYis4rTWvPXSBYKaARmeAR2tsBwNNndwDwVNon1A/bLoC13wGYew2Ap+eAaLfUu8XeLfeCcKjAPMF6gnh4wf0Urfppqwf+Kde6WDfrWsG/OwCue/t/7duMrx0nR9LLRZa892ri8tJhI4NeCoJH5PLSBJvyANYpPtNSZy3IFTCjLw+dA+2ZJg81pJ0lvldP8vTkVdbT65WX+cwjzbTksy3lofZTj9qftb9n4o4VqeNqLW2mb8fB92fc/g/4PeVvABwb/GOf82f7/xtf9U9+3wFw4Kf/OgGO6ABwnDIIk18T7w1croOBcEUHgHVJ2isPmTrbsinf4LW/0dvqcP2r0yhy7Kw5LG9Jd86eNsbt/Zu6KEu7yKjbtt4Rn7OfNs78uQXOLXBugXML3JcWmHMEsDug9wpAynQC4ACoH6nzaTZynAC7/CVggsEefygHAE+y868A2e7uDoB0AACOe68B7OoEwBlQwXsF90vxzK9zAZpOhznwXx0AvvvfcwC4/R/qx/98+u8/AOhc2fUDgDpzev17A9dfXSS5yKrURVbSodU3F17EL4UEkYJLF5xLFLBadaosAe0c3wPNyAT3ySuboqmbdik/4/DKrJsy4zW9F+/JajnG0+4cX9vVePaXfPZpT5bphc+xUvk6vjLezKwGG+iexPHwuc/7azgAmJPODoBfHz+a+7a/8c8vXvd17/r9bwAUB4AA/hD0CDsAGJMcvbGp7AmexHP9PVJdHLfkG52i0rimuEbWHtvyWwb4qYO0cY62HK51+CYfSIu4uuOH/PhGwGZ3QlMbbcyVg84hj7Es6vn617/+DVGPqTogz3DIupxtnVvg3ALnFji3wF1rAT8W6I4Atm/yziJ06fsAOAHQ5X3/KScADgCA59p264FCZQn+cwcAOwHy3wB8F73uAHi42QUAkNUBkE4AP3ynA6D+GwBPzH1/nnM6hBMAUD8F/BPwJ38I8F+f/q/5+r8OANqRkA4A27z3/j/9k31nf/bo2nFyJD0XV0lzUVVBXMaHVqfHggtNF59JBZ1rKGA29RLcKk9Zjxck96hgnzR5aU8/ZZSV8eR79Ti0jPLW2rStejT7Jnn6lXivfzeyHAdr+BxTS3wr4nYcf/mzX/UuvnbPfOYT8Ot40n6qZfBPODz9vw4HAN8ROJYDgGtl81G7oYxExu4TgFOuwU3aKCt6GSV9BN3lffWhyZfyph149A01zTjp4zvyzBF53SNvgetVG9AxztzHDoXNeVWdpnb0wzqNHwuk3q1EZUcv/EoF0GibCl/Jzh3PPLBlCq8pgb9POcHzHQcfW3i5eE6wfucqnVvg3AJXbAEWt/z9KP8a0HMEzL0WgBOAbY44AXzyn9RXBNbObz1QWGUJJnuvAQhGfTItUH2452sAuQtAJ0B1ALDN3i33PoXPJ/MJ2uET0O/Cp520b5nWwW3/UOva+/J/7+k/jhB3AOAgcQeAr1DQjrapbWyb9xwA2V/0JfHap8avOJQPmd3FVlIXgtAMQ4vPhgSUybNOIp4L0ylZ1VmKJyhmTUZAJi8V6EMNNY24eqZJezZJQ35qgTajTr22y36BX+rTlp5jYA3PWKp6Ob7gOSp9JD3xX/4BAAcA7/+fdwD8+rj9H/CPE4Cv9I9/A3jEHQD8DfiBh8g4DrlWNk+gGbscvTGb8lFp4se8AzY315nXhON+IutWvFaPDKOzgWseJwYf/oNyTlG2hrE71oW5Dp0WRzbsuMtBe1ehlGvAjjz0dA8+NvWn/8RzP7TLts/TPZvD1owBB+hnouSdHbZLZcCDSvphS93fGsCf//JmkQ2lT7mQmsXTHoT7n/I557kF7nMLDO4I+MLPeOn4GkDuCJhyBOAEAMT2nADsDEDOPxGsaViBYI8KHBNQ9hwAc98BeLhxAuyzC2DpVYAlJwCAPQH8WkdAzZPAH34t+NcBwHm4/Z8n/1d9+o8TAAcA7b7GAdDrW2VrxsgRdbyv9SgygwvWpENLfywkkISfCwlKUy/lPV5A26PICIL1XWgC/uTThvZrGSm/Cn9IRwJtR116bZjt3evHJsu+viqf4wgee8qSNvHtOXiQ5QcA7/v7/9z33v4t//KCDwBelwPgqc/93B868GhxLGq2xpErk6o7RdWDctT4I+m6X/POaY8f+mP+Yks/u0W+9emn38ocwDXfMnrtYSM/Cji0uOFBOASaeKwz9NiH51fpscvdzz4AEfBPYJEGaGyWhv2s3ZlcAxMj4D7BfvK8c5tx/kpllw9nHauluFni0GGR7QLNfkXeyh2OVfbZ7rkFzi1wcy2AI+B5z2nvyRdHAB8KzG8B+FFAXhfgab9P/HMXAA4A8jGfLJ2R88wcXesAAJROvQbA0+yl1wD2eRWg5wQAoFfQXkH9mni1IfCHLj35F/xPbf3nXH0FYunp/8OyAyCf/i85AOi7ub5dGh9HTGeRlUdddNV4BYFDy4wMug2bReYYr3yCzjW8i1Z1jfcArTKuuQwJ3uErsK/xqm9cm8STr+mmXZVmOZxbtdeTVR3itovUtqw0+7Dxta93iTtuyCMv7clI45A+it2CX9aEZwfAr4//fsD2f97/39kB8BV/f++dAjxYPMIwcaxKdynCPNCpsU7aPkfmS77a2joAAP7ve+97fpWt/Vz/XPNNmXqNh3NIiwwRSN/qNJ6y5spryffwAOwL/lkEcKP36Qxp3FjuW7MwIfae9Av4pQn+5cnHBc2gvOF2G71f9GFduCEDKJxAHW+4ic7Fn1vgTrbAk8xhPL3vOQJyR0B+DyDBPzwH3wpYsyuszjE1LoBccgIISt2i7pb1h5sdADoA1joBfA3AXQC+CgCwdot9brsXkCdI7zkCAPU98K+8gn7i1aZlZfnWifpV8J9P/wH+S+Dfd//nPv7nDgC/xeC9P/up9mUvfgJXUS7u5F309SiLw2FNEGSqa/wQlHvwVEggLEBfokuOgLQJL0CX1vRDxzlXbSavTGqbEJdP2mt7+yeoIGAf6pghr/xa2rLcHrDBa146AO7zNwBwgv/wW/7N1gHgNwDG1wCWXgHAAYBOpSmr/MbmKe0eZuC2g3HuuCfu9YP8KseYn1cIuJY3hqZsjg4Arn/mJr9XsMk3tLyZj/ohG7+8v+FJz9Cijx2ZLq+S8aSm3Q1KYwL+eWLEgsubvosA6ZoF4N1okSee4GIU4EMNAnxp1UGuDJ5F9uZp+003zbg9mL6sCzcdAdxMb7qS5/LPLXBugcO3ADuScPbhDADss9Aj8ORfRwBynnzkLgCe/uMAQIf8SzWrc0uNr3UA4IR2B8CuuwB4Al7/ESA/CLirEwCAXkF7D9gvyaoNgT90H/Dv1n8dAD75h069+/+wPP2nbQX/S0//6Uv7r/ar8aXxcY3puWCrvItaF7QuHKVDq2c3JOBEZ3PP3P5VoLIqz3w9PkFt5QXD0iXwv5SeduQrTUeA9uZ0atpcnPMjvXeeSzLaDp3ahrY7tITs4334OnaW4q34LShB99YcOI3SAXCqH+c7dr34S9fv+Y5/ffHmb/sfRycArwAQtqB+A9i7X/4X+CfIz10BmR52eGB4ggOF8Tu+g88c0PiBeAv7jmvzjZTxxrXc7HGY9ij2+7/It/NrXv9NPlUXXwUg3WPKvunQ1FnDZ97by7v1n49IEXgKwI1e4J+URcIJeqoO2vjcnAT8PSrI76VNyXiFIAb7Qeu7izHOjf7uLeRwBGz6Ni+cXcyfdc8tcG6BE28B5gDAPO8c8roS4J6AA4D5i6f+An++CP2XvvzL/tXaV5oEgnPUuQda7zM+gdYBMOUE8IN2a74FAED2Xfl9dwII1iuIz7hP96WZlry2pIcA/1Mf/rvK03/u+/aRfTbXr6SdwNDvLdyUQWvgXpdhaPHJwALU9OSRCUozfU5mWtIKgI1zzRIE5oLyXWna0OYu1PJ3yVN1PScoaRmfkqmTbSVve3do9uuufB0n+8RblcaDvLfheBIHgO//S48NuE/N/rue+bcj+NcBwGsAPP1ftQNgA/wB9F0HQToGTtsBwJjlmhn/JvAnn332p7lWN4N4l/Gc180m+3YOzrh8j1qXoSUSvJZ79ejJWpZL4J54HgPOCATMKeU8x/o7TzWVMZ6Zbzs/cKNnocUOgC9+/gsvcAIg44ae4D8XA4DFtYvCW9ZAT7IoTiAv4Jdm2q78iThPnqTv6MO6sCOOg4Ab7i3rt3N1zy1wboHdW2CcC3AI4KTECcC/ArALgMXgZtfXuBBYY3oJIJqe9xJ47zPpANAJ0HsN4GF7kp1OAJ9451Nw34l3m/wuTgC24CcwF6xXmsB+jq/5iKd9t/xDl7b91yf/Cf5v8uk/fbtmjFyTTi4EXbQlZUwTdzEpHZpsG1gQZrzHqyNVx7h0Sk66QaCblMUnQfCddM4BYL6k5k3ZFK9upej3ZFN2lHNO8HluSzztoo5tVKnt2qH2aaW9fk8dxwky+R6t6U19CzTQv3XHW9785h/hXwAA5ffRAeDH/9gBwEcAH/sOQID2LsDPJ/w9Xpl0Yw/McYKDhTE87gAoX/xfO7Z7esiUS2/61B8wL1EJ55tNhbZ15S8PN3+lSNKp1HtTzSsQ3vvRAeBrAFNOgASLLuAAkdwMrlCFk8rKB/8E9QJ+/hpFmfyu1PzQI33sY592fIBDgj50YS5Fdt4NsE+TnvOcW+D2tgCLba57/lZwn1eXnD/WUO8hPQcAjgAdAFO7AB5unABTuwAAw4d0AgjYe2B+rUwbSY8F/n36TzsR/I6CDhXalUA763iB6ozJ/lnTn+ic2MjfLuBavVy0KYMm6Et+aGlHDxXIGhfwSgXQlSYIhzeeej1ZpidvedCUV75nsyer+bSb5azhbZcp2umr7MvK9/o9ZTk+5njszqW35PFA59YcfGDtPgJ/dyHwChzA///5bf96fA1gZweADoIG8Le7AAT7UnWC4nw/wUHC2HWcUz2vpbVjeszP3BB21uRFpwbKP8aR9al81iHPPfWOUafrs8kTHm743Pj9CCA7AHACEJBzY3dRMLUQ2PVJ0fWd4U4lDQnUKy/or/J94lzwmwtjpwoeQ5kbK/3Hgi/7lzjyzU6PuzPoj9GIZ5vnFji3wBM5f8zxzjUJMr3HCEYBpjoBBK2C2IcbUJu7AAC8dSeADgDoLjsB8uOAdTdAgnf4JfBf9Y33gP/cB/96T/7z6b/nrkPEtrGtbDvbUvCfDgD7IPtFfq4/TTvRS8B7Vy7okndxV+nQzucogXsutnugNkFxBdHEE2zD11B1ejaqzDKRJ596WS7yGk/dymMTmbaXaK9derKJ/qn9SF8js8/lpcoPSVtxt++gj3QAQOUFyHed8vE/HQDPfOujbwBc+ieAAO3dHQAtfQv80a2gv8Y39njweKKjxWuiXitL1SUfx8DT8818R1w5fO+wPPVqvJfnELIsx7Kxq9wyMk3ZraUDN39v+iwIdAL4OgBOAHRcBEC92SdFzlPjW9sSreI+/ffJv8C+B/yrjDjhra99z7htCM9hDaSpRxmEE3klgG57kt0gvd0AjA+2CHPTvs39e677uQXOLXDcFsh7whKf9xR470M6AKA6ALg3CVwFsg87TgBBMNTXAXQC6ABY+iZA/kNAdQQsOQME91M0QT+82/0T+PtXf/m1/wT/1N9z8hzzvH3yjwPANrLNbEPaUwdAtrd9kH2z1I+ZftzRtbf1XMTJJ2VxOxWGTRp0l4C91foV3AqQK5DuxQXi0tTpyUy3DClyeam6ayhlGaq+9pJyzjVe22FNvNPOtS+zr3s8+j35vrJmbgt0sHGrjl/5lV/5n+860O+dHx//A/yz/d9A/JIDYALAd50B6kLldSBEHIcB18utGiTrKuv1g3byc7nVG+JfApTN5TtmmuVD787B011v/tz4WWzpAMjXAXAC4BBAhj6Lg7zpy292AdzaBmJrvqAf2gP5NV3AXyeO7/2BR5OI1AmFD4swoWAbBwAX/wk5AZ7ghgzYZzzYr9L79FoACw8/DHJrB/S54kstkBP7Mfil8u9cunPFLjTBpgDU+xL3pOoEEMxCHzYngE+6ffKdYFiALGBecgL0/iFAkF7Be8YB/MQrTZ3ktSkF9Cfwvwr4rw6AbC8cAAn+aVvb2rbP/vBeL13q11swoF3E9a73Chx78aGdI4E06JXDFMhNcCyfwHoK3E/JMy88NqXa79Gaz/iacpbK4Nwtc6od5uSd9s8+s4+RyV+FztlpRdxe0E/lPb737W///h5AvusyPv7n039eAWAHAHEe5PEvAONHAAO4d0F/B+Bv9XqOgM0uAdv+jlGvNU4Lfs1hnuFFL3rRy5hrWiZla/KnzpPMHZv8Kb+/PJMtQD1v/CwAuPlD0wGgEyB3A/B6AHF0czFAfmzf5pZ1B0CC/Mr7lL8CfgH+FNURgANAJ4BfF33t5z99wdP3q7YdFwvb9QmAV4I3aW+irYyhBW9kU0VuPxKYfQzPQpDxc9v7eurEQz7cg3OM070zLDcLjjU0deDnwlqbPT1k9+Ko88VcXFAJNQhCvR9xn6kOAECsoPZhZxcAAFgngA4AqE4AqI6A/DBg7x8C6m4AAXuC+TW8+SoV+Cf4px4E62Zds/55Xp6rDhAdIraNbTX39D/b3b6wf+b6sKad2CD3+qZa8lPXuMCRdHnvk8aHSIM3Xnn1oVVH3ceo92gp959eEIDvQ7FHvp7dnmyfMmqenl1knKfUc15LaVd0oZuQbd7jp/p9To4dx8OUXlO5dN8wnhT+1hx87Oyug/16fvzzTYJ/1vHVAbB1AgjyD0GbU+BEPwB4yPHKtbP28Hp7AH5hfmgZvfbW2lDvAfhnk1/Z/aRMyjzB5UbPjd0bPgssgvF0APi0AAro99sAL3zeK8fvA6QjgPybxr61DcyT+AT8dQcAnkAmBsH8FNjvyQH95p1yAmwG+97tN7WFn0Waizr6mnEAiOdJP+fM2Cg30/GCRYYOeepCb7TxyGnBTfJ8nFvgJlrAG0ulvbqkTvLoEj9G6NXjTsvqPLEm7twk9V7kvQkHwHU4AQDcgm+ewOduAIF6BfD7xLUltSzLFvhDjwn+8yGAbW4fSL13rOlHdE58cHuNU035KdoDkT3Z0Gwhl1beOOnd4L0XWgNrgl6oIHspjg10erayzF66trVhfBfas5vlJk87EZdmmvJOW/b6RtlUHy/Jya9O8sqkTW3UkyK/1cfP/sK7x38CqED5rsZ5+s/63o//SVmrI7/0GsAhgP/myT+7Ck74/f+bGMNeU0+CJ5k3NpW49dfUTTTmtkwAmwsqbu7e8JUZZ3tgOgF8T9AFWHUE4AzAMUAedAMYbsu+LQw3tHQAyLPNX/DeA/e7ynAg9JwAmy+BcqPZ6+BiAbDTv2sXbOo5Jsb+2zgI2EmATTxxOAyqXeKUt7kp71Xnc6ZzC+zQAt4EpGY1Dq18T0Y+5ceilgG9N4fzyRqa8wm8wXsR1PvTsZ0AAG2Bt0AcKjjvOQMA8EsOAHUE+9K0m+VZB4E/9BhP/nvgn/a2D7Jv1vSlOrdkoE/NEXUuSNAHPxWGTlqVEV8VKuDlHowMSqjAuydTxzxTVLuW2dPDlnLtrqXmqzTLk5faTsYrNX1D6ZOhham+qX26Np725vK0oi/dczIOfyuPb3366bfeVbBfz4u/vOXpP0/8Af4G1/XVAXDpI39XcQa0p/84ADYf2b6V4+RIlfZ603yNKz/TNS0AeBPUe5N3keUCC4qMhYG6gnqdAOiQzo4A0nJHQHUEkA44bPWj827NwXYcgT8U8N974u8TfSeJNTTzVCcA24uYWK74dyC09fi/nfyFl2B+38UcizrGxGhns2OAMeBiT0r6ZhK7VX19awbl/axojiX4DLRIL55yean2zJdyZUlZAGZ8X55y7s3hnLALdX5K8Nm7P3Hv4V5EcDu729uhDxdeB2CrfG6dF1gn2BaAQxOYJ2CfcgYI7qdotZH2s9ysj3XMervlH7q07Z92sa1suwT/3vdp72z/7JNd+vKWDPRdrmWBoHmM70OH1j4E8kLHAMCFr0A34wmgK/g2TTlx+B5VV9vE5aXq9KhlJEUv4/DmTV4Z5cBbXqXZLpmmPOjaPrDvdqFpu5evVWN7f6g8cQ/yckgfxU78lw+wVaB8V+P89V8+/Wct7w4A1/WXdgCs/Q7AknNg4wA48aFwU9XzepHeVD1ufbkPuOHz5B5Q7o0eys0/g4su9DKwcCDuAgLqYgy5uwKSZn4cELcFIOZ3AJgUnAAOQQX9aSt3AugE4D+4DzjqHnATZTvN6BRofQFgdxzssrhD10Vizcc42nzH4HzBHrDz7qEpxw80A02RaTXe0+3JzJdp8rnokzdtV2o50Htz1Hlhbdx5Jan3I+9R3HO873APEtgewgkA0E7gnYB8yRlQgf1cfAr0U0aWL/CHHhr804a2qW2c7Q6/tt+q3i0b6FzTHEvXNnOBOs4LUxS9qbRhkwbdBkEuMvkpKoiGJrhOvqZlHvgp28qrfsYppwbTU66s0ixDXtprk15a06N9hw2damvl9tuxaKvGdmzAc1DWrT9++Td/6s6/BrD09J+1us4Av9nFU/u6C4DveL3i8950wQf/pNuP/3UcAercg/f/T+E6qNf+KdTpeurA9m0BvCCeG7w3fmhdDLBASAB/SD6fJgNICa0lhutpjeVSAMq8+z8H/vNJfvIJ7Jd4dxXoAIDqZWRy2bTLcoX30xhvoNycccykY0DnQF3YrYkzls7bmWY75E4sDGbPcLdE2yOpkzWWenLTD01dME7RfcvbrUVuufaaeWJOJ4Fo7x615AR4uNkFAPVjeD4lzyfnCarhE3AnEIefcwYkoF/DV1u1rKxHrWPW33PyHPO8dYjoINFxb9vV+z3tnO1O/+zrBLiFw9frmqrLT9GpuQG5eeZ0Mm1oebZBoDtHK5iuoL+mG8dm8paBTL5HzZN0CuSvqUuvDGXZFvBT8o0e7Ti0kO05x9s3h6Kt6Ev3pozD34njHe94x7vu6lN/z6s+/RfsT1GdAI/9rd8G+APsM/ScAKS/5PmvHfWOvM6/E+PwACfBde/hHGD8blM+8gaAdweATgAWAXnjd7GlcyCdBtUBwMICGdTFBdQFRspq3hp3kcIuAZwVp9AbeOWYAHgnCCAvSF8C9fukV0dAOgFu4KOK442Vmy9Anlc4dnUI0I+tD7FzPi63wJOMb3Z30L6Xk+5tzInZSbkXz7Rj8nMLyEzLOqQcPtPk71XnAh73CQLOBKLei7g3CVqh9T7jPUTgm2BYgCxgThBdAXaCb/gKznvOgAT0OACMJ69M2rNby651y3p7Lp5bnq9tYJt4L7bNsh3znp/tvk//mecWDnavU6iHfFL1pq5z0nM+qHHThqY3GQS+PVqB+Fw80+R7NtfIzC9NsJ+86XO0V160B2002TabNNtR3Ywv8fbhvrRVYTvHJ4+9PGo8024N/4IXvOBLfuO3PnBndwHk03/W7qz5DbmW1xmgDg8Hx78E3DzZ92m+wN/dAMp1ApgO+DfcmsFweyvqte58YfxOXKOL3YKHCdCdDgD4DIJyFgs6BlwcJHXxwGIiF2IuLqR//A88sqP+lG5vceIOgWM+SQaIzdlnKzsfBTHkZOATf2mm7cvrYIAyuehlPJHtQeM3BcZ/GNi8PkAf0acu2l38QZGzAGgD85gX2Hgxs5igL3Fy4awgMN43fTssXhzXrzA6Aaj3TNHU+5htN1P0tSRxbp5f5amAsuukSwvHTKdeGa98rTfndG+OnAt25XM+SUDqPah3P/EeIuAVAEMftl0ABIGywBmagLqC7QrGp5wBAvkE9lO8ukl75dS6ZD2z/p6T55jnbVvYNt6Xs/1s02xn+ss+kCLbJdzygc61yyFNvl7XxLn2l+R1fiA+1LC5J1yS98DyHLjupaUN0jO+hs88PftTsjW20antsBDPtpPvtW9PNtdfvT6ckrUqXupz49DegZ1be/zMr7/z4q46AfLL/xX4G0/w7/r+h9/yb8aHgukEqCBf8C/oTyr4v+L3vm7tmLrmio/XH9+0eNGLXvSyVjZzA8etvi4fncLy7wAoAuDzwT5Bv4DfOGkZkKsDZSHhIkLKAsLFg4sJqIuMnsy0KYrtTNMZAMADgG52CAzLpz1qDHinEyDydBqbnBN0zg7gWweA1AlAekgnADZ1BOAA0Alw4O8BzJ3y2jRvrgM7FNwl4FjY7AAY1hqb02OBAJgH1I/l0H/hhHAM9hao49h59DeFc0WcXBrn7F8znlzlrlYhJ9yklSd+3cHxXOnQ6lJla+K1/ldrtVuWu3ct7iJzHkk6dS/xXiTQFfgmGH5YnAAAZ4F0gmv4Cr6J90B6gvhd+J4tZL1ya92ss8Af6rnl+doGtoltlPfVbM9sZ/hd+qqne8uGq/NPr9pex6TJq5/xOX5uvhia3W5IYAzfCz3gjV4C9l6+fWXa7ZWrLG2rv1SnaAPaqtseRT7Xpktpc321lNaqcWkcpD5pHMju1MG/AfAtAJwAd8kRkE//BfuswSuvLCk8oe4E0AkwRXNnAE6A89//XculMl6nzEObHdVet9dS+I0WwiQMYALwfvHzXzj+XR9AP8G9fDoD0K2hOgiqk4CFRzoKXHDkYkOehYa8VP0pykLGuo7grgH4SzSAIXJ1oZ6bFBk6c50D8Hzmb/2LC4IOACgX/qGBvxOKtrGPA4BvEfA9gLndCnPncE1pXFCjs2VzgQ2HKJdzpo96i8y1so0zgkXBqRwuEKboWE8mK5wAG4fXqdT9UPXICVh+itJ3pLmwU894TVfey2PepD39oZVXg3praZbRzN2fY+21uUYvwan3Caj3CMEtVMArAE5Q/HDGCVB3A0w5AqacAVOgfo18F+BPPfcF/7SPbZbtmO1Lf9xDB8DUhen1a7rxq9A6dwzN+GzgPoAONIPgWmoa8SozDVpt1ficrmmWIVUunStfHcqdCNlGqZPyffld+q5Vbwvmycdhfnmp6cTzmJKnzsnzrOnYBaATwHfnbzvl6T/reQG/T/qnaK7RXafng7op0J/y3AWAM6B1/nDyA+D2VzCvW86mxm//GU6dAQACEMTiKB0AFbwnWBYwJ+CHN391DGScvwLMuDz5Bd+17FycsEjJBUryLmCgLvxc9LkA9DyyrOQ9N/U2g2Gq+Z5gFwBePkLPEVAnhan4rg6D3AnAPwNsJos7cUOZbOxIYBGxK/jXqeSilgUtNlh0hOnbxD7JDpbbVOGJujpuc+KVn6L7LvKumm9o5zAVdrGd5zXRLHdTvAbYL+kIRL2Wpb37gfcC7wHcE+acAA+bMyCBtE/Wd3EECNzXgPypJ/zagNan/cSzXllf6m9IJ4fnnPdE28Z7Z7afbSpd6pO16XdzVE+CQa5zjrzee/zU3DG0vItB4DxFp0B3z/bmfrgt0/iUbWxkWgX+U2Vnnim+U7+pdjqEvNcvu8hadbv9jJwDW3fyeMvbvuXn75IT4AMf+MVxTT8F/v3215IzAAcA63PC+DoAfw84FTbfC2AtTziR13vv5HjtnFS9zjsqd1A0vrfdQBALAcE4FEAuCJ6j6LEQgdagnbQLjxPgxZ/7qg+tDdrRfgL25OfqaVrqT/HqQtlaPtftADCewr/1te+5shNgyjkwJU8nAJPLCb4KMNd0V00bcFz1Fp0sWFnQAu7R4dUAdguwyGiFjosVvNY8Qd/snMgbsxPBVeu3T37rMUX3sXlb8uQ52wc9eoiF3lVsDK1B5wK2SbeM1FUGzXNr0ftz9K7ZfWVc6+QVpEITxApsBbo9JwDAOIHywwDQCawTcPcA+dzOgATza/mpMrIeWb+sd56PwB+6D/i3fZPC7xvuz0jfAr6c2zj9vPbhnQ9yfhg2cmg35P1sCkDPybGrjaUyMj1tKk9Zj8+yMl25MuNpVz5ottOh+NonS/FWndn+zXT4O33w7nQ6AG773wMC7OvT/54zQFldo+sYQK4ToOsAKH//B/BnFwD0vP3/Tl8yp3Fy47vzDSixaAIQC9YB28QTDPd4dATm0jmHgPaluSMAhwByqE6CTDcP1LKmQHzK1YVa30yX750fIHJpmzVOgDe+7JmuE0BPYZ0gpuK77ARIBwCTDK8C4G0/jZF1/Fr4CoAgIBekyOg7HDgsLtbWhr5+9yd/xu8uOX7W2jvrLbYACy0P+anF19Rib2gGMqiHTF7ak5m2RLdlbMbU3AIaW1v9wluO59mS78+R1+kh+AT/8j0nQG9nWILjBM0PJ5wAAO4E4PBTQF25T/B7wF+ngbpTtJaZwB8+65vnkedXwb/OEWi2l20oPUQfpY07ONKdtzg1eamnaxyagbmAuHNCpUNLmw2C57V0yV4v3fmONMvp6SlLfWUHpLWNrhrP/lji22ls+09+jmYa/J09fuJ9P3ChEwAHwG11AvS2/gvopXVdr5x1fU1Dxlrdj3e7I0CKY8DAGp5A/M4OlPOJnU4LAHQASiwAAMCCayjAuAeKq0wAnUAbvjoC0jb8XKi2jFuWtNYl4+pMUWyalvmS54kRT5CXegzg6E4AdwP4XYDehDDlAJiS5wSTOukEYEK5j18NHR0B7Uk/C9ZcaMrv6AgYv8J/Qw4AFh8cU/RR6t37ddHluRtPOrXIG1qmq4Yp28ofs+8iWLpjHbTr+bXs9+fwujwEzWtewCpNUJtg190AAmKoQDnBM/zDHRwBa5wBUwC/J6+gn/ha4E/dPac8T8892yPbybZLSj8RP0R/YeMOj3Su5zzq9W18ijovVDo0o6uC85EA3Pja/Bs9yl9VXtWz3Conbpq0pzMjs061bQ4Rn+oP5a1al+7JyDl6VNkjjXv0+1Uvf/k34QBY4wSY+1jgXNqxvyvwz971/se2/rP2roE1eMpyTb4Lr2MA5wC4AQxB+JynPu+77tHQOZ/qTbVAfqEd4CtIT8CdgLjyAGhkAmmoeaXarNR0adrYlc96WYe0QRk1nnlYLGUcHhlbyDcfrlvsIl6nWHIC6AyQ9iYLJoWeHFnPEZBOALyH1GOxsndPYQTu9BcL2t5iVUdAO/Xh7p3+rTyjXCzBz4W60KMPrz24oO7Rqfp0FryeS55/y34/jt61eVWZADWBK3yC2wS9AuEExwJm6Jwj4GFzClQg3gPrOgR2oT07tSzKz1DrmueR5+c5Zztk+9S2u2qfTOW/H6N8PMve9T03x5nm/FDp0Kwig3aD89JU+oy8ljVbzoydbr2uoN+r15LMdoSimzR501J/iW/mtvcp+TUUnTt//OiPf99jDoCljwMK+KXHBvlT9n3vn7V5gvvkXYO7Dq+UvHNre/K7Xhf8A/wT/IMh7vxAOZ/gabSAgImbP6BXkJ6gvALjjAuqkclDK+DOtJvi154T58JiicXRmqf/2ZOAb14H0BGAZ29uJ8DSZKEjwInGCUh5TiiUxS6A+/7xEF6D0LFVF6H06ea9/+y2U+BZeHBM0Uepd/M3z7kuwKYWe0Nrim1w4dujPb2UdXjKHFqQwo8h7fc+btXTI4/yDfWcPNcmvj9HvSYPFecehq0KZBPkJvgVEEMTKCeAruD6YQHfFZxnHDBPvAfqezJ100bytexat6x3nk+eZ55/tktts2zLQ/WPdu7PSJ88033mO+cM6dCs7xPqnGZcu1Jsy6tjeTWufF86ZS/Ln+KdQ3el2lvK15phe0+Wz/5TlhT+Xh7cE3u7AJacAILym3IC8Jd/rMXn3vufcgRUuWtz7PkwL0E/POX4SkAF//dxF++9vFhO4aTzFQAWB4JkqWA9QX/l1UmqQ6DqKk/dq/LpbKi854Fjg0BZLo5q3VhACfxdEO2zFZyPd6QTIP8dIAF/gvoesHciSVrzmOYEw7cAeH+Ibzucwvi6yToAvBzfLj6hOL1avVgAnI+bbYFcSE0txFyoSYdW5UshQTl8D5hXnYxXe1Nx82C/F0yfo2Gb8/GcG3t/jrwWD80ncHUOhybYTRAML0D2vgBNMA1fwTbxh8UZQDwB+1X5nv1ePWpd8zw8t3rO2R7ZTrbfofsl7d3hke58lqc4JzPNeSBpzg/OfZUOrSBk0DUhdautXhybPXm1o17WQR3zZ1ryNd34WppttpbX9lp99HqH+UmrOsalvfx3UvYN3/gN364ToL4O4HcBBPqV4ghAplzHwDEp4J919VrwL+B3zc6anoDc9b3U9Tm2E/jXLf88MCSAG+7koDif1Mm2wAOelrogACDnLgDBeQXLxk2XKk9q2qGoIF+K3eSNIxP4w1MnF0fy6LKAciFIO7hgZPHUem3Yp+d4h2cXJ0ACe3knEeNT1ElGJ0DsArh3N5+JvnqgI4DXADavSJxa21ifKTpxandCnOcMT3CRVunQ0rYhwfa+oDxtpG35TIfvlYOs6vXi2myU8/JcG3t/jgSDx+AFsRXYeo+TJigWKEO9R6x1BEw5Ax6GgwBnAPF0ChhPvR7fA/3I1gB/zifP03OX1jbKtvuwD9v/S/9zee/4SJ+6ppHnYVz9Hs05os6DGR+aYQIy6FQwPfPO8djJ9BrPtMpbhypfE8+2QL/G00amHZJvxW5BPXY5tC8/Cs8/j7eAHwTUEQDwNyTAF+grk+oIOCbw1/YPv+Xf7Az+WYsTWKMTjLsWd+0u8GdtDug38KCuPvnHAXCiu1Mf7+Cz5O60AF+xd0EAME4HQAJr0gDM0AzIevKejrrHoD7hT9vUn0UXCyHOkUUT2y89X/iv/uq/cvGGN7xh/Joziz4WTCyENk+K9+5otvL0nABOGk4SThpQQX7KUu5EM6XHROM/Auyze2Hvk709GVk8nI+bbYFcUFETF1aV5kIPfsiQAHsKlE/JBfJpo/KUVWXaY84kGJemfk8W9ed8PN/G3p9jDhweKi2BbAW5zv3QBMfwax0B3EemgPkah8DDcA4kb94p2xX0E0+HRda/nlued20T2+tQ7T9n5w6PdOe1XU7ROWCJ1rlwbXxolVmrW/XMC5WvOjW+Vq/mMz7XDuiYnryyY9BW5OxBmXnUeKbdG/7P/tk/+5mA/5/9hXeP3wTo7QTwtQBBf6UC9GPSQ4J/1uSu7QX+UEICf9bnPvFPev7bv3tzeZzeifpPACwgAM0Cf+kUwJ+S7wv+/StAQTzx7/jOv3fBXygB1AnYZuED/84f/KHxyQqLG8D8V77kJePCjDgLo6//6399fOpCnEXOa17zmotnn332g3x1mXPFFuAfGeWQH4cBi6erOgAAA3yUTycAk4CvAzhRCPQT0Pd4ZAYdAhnXznYXQNtKdP6S6OldZzM1cuEwRWey3pokzy0rrCwpvAtC6dBk29AD2gBugblUEL5E094Urw1tJzVtjmp3cx65gG2i+3PMgcNDpiWorYA3wTB8BcsJpBNgw/dA+BRgP4S8V16tU9a3nks919oWtZ0O2Qc9W/dnpI9gde50medy3kNX2Rx1TtyXYnuXvMOO+rvYnjvPm0prp7vtF3gO6pJHxpNHZymedu4s/9RTT32OOwAqdTfAHNUhcAwHANv+///s/QvQdVtZ3wu6q1Kf3Z+iy1s0VR5jYqpjwznVWGgKTYgbhW08Oy2peEMT5WJQriqBQ5BtAgiCJKE027OFeCkBiUR3e9QtsfGKHsE+JwTLVsQYY3vpDpYkOVRKSawS9tvzN/f6Lf/v840511xrzbXeyzdX1Xifcb/PMcf/P54x30PAP6DePXxKAX+CfsF/68RfAuB2/27XtX0IrkrDALtsHNgsAL63kQBTgP8UEiBP7SkTgH7/D95/9op7XnsGIFeF/21v+/mz3/6d3+2JAOrIpsXTEjZDbuL8n8tuiIxzZ3fiQhryB/wD+iEMSAvgpz3YrTObLkgRNvmHjCEqPZAAPOgsAC0SQMCfgF77mJQIEPwr1QJYFpVDRm5JO2MP5IZIu5JisFeTm8hVF74xAmmloDsBOXb+e0f6ES/d2E2rNM8qDc88WvlnvGo3z3VbaJ9t7qwX+nMslEetTAsUHstPcItsmQqOK3j2PYKsoBt3C5yn31QCgDTEzbTV3io/61frXtvWar/9bj/pPqY86uS6uMwPeXZcB5S0QvuYzDXE9ZL46a+7+pmv/qZvydU6z1ZY9atxs/wa1zpcBtk1se/zlsTPH3VdfhN74Ku/+qufJfhPbYDUCDB8jAyYkwR4z3ve8yeAdkD62P66FZZgn3DdAn/BvpI9v0awX+WyT584mZZox+sBvgMgAQAIHiIAKvDHvY/xmgEn7m94wxvOAPgAfsrFD7CPH5sgNjmCdTZBuN3sYO/vdXO3O01HaEBq7Gr4eB4be/oDM0eP148CSgK4eCBdbAT1uNPeCtfPuBIASD8GCMjJNti+9LuqdgAV7Xn0Yz7r1ff+uS/64M8/4rP++Cf/zx9/hsGO+et3Pfb7GMdHPvKRn9Fq51n3a/kf6HeDfp/67yPXZbmxGJIHVunCktseKlDtuPVLiT03i6vOvTECaaQgO4E9/Z4mw1p282jJLIPwTG8Z6Zd5VH/rvW4L7Wu1v/Pe/OyTjceMFvO2DropIu0zFvlQVscEl2N5C3IrEK5A2XdLygTa2FtgfAohUEH9mHuojFqXrKf22qbaZvop+2Os3+YOm31CXZ0Mx54rw5Bpp3X6IXPdSP9D7Zlvrr3HsGdds31pzzjHsFuWMstIP+z8CF9+e/TA1z/72S8X5FcSQCLAcGWLDJiDBABXsF8+FPy7dx8C/uzxBf7IBP18o0s3H+zeo0uXJEsPzNsD3BdnY+EGAlAPGN8H3LfSkBegH7X9F3zNK3vQb/6o8fM/ODn5h3xg4wPgv7M7tedUxM1LD/A7UE9dOVlnsz1vLxwvt/o9gDESIIH9FLtEQRIAaAGwyNTvAACWUa169nOf+UvrMF7wgz/6GRIFEgMAMxjxtAEr2iHY/w93fMzZkMk4EALrDwCeorY3AYBdQcvG4U83sPS7Gy3tSv2VufFcdZF6I4hOYJ5AW1CuhPjRriQ+9pTYE7y37MTRmJdS/zFJnutniLbQPtvaWfsfbn7Kh1zz/7VcpWXWcqt7lprMDSi35SfQJZ7vkpasoNl3YcoKvnUPgfX0B+zjVmbYmN0yqsx6aa9taLXT/lBu67+5w2eZRNc7E587n89jylyHLCf9ch3e1W5+KTNv/P0ZB3f6p9s4hqd7yF7T68488OPX8nsoZL+/5rdf6muUKjUBAPlTiIBKAhxCAKDy/9b7/2MP/A8B/+7HIQDIx5N+Ab9uQb+SvXgC/9790Bf/eR6W39IDF9sDACPA+Z0d6GYToRZAC8xP9VN9n3v4qN6TjlP+P3z/+z8I6Od+v8SAqvdshNzEAPg5vV1/GfNKPygAg/weAAsDi4UMooyiC4ygXvcUWQkAtADqdwDoSxZfFlPkM571zP8AwF/38eaFJfC/995/1n+9FdKA7yR87xu+7d9BBqzjn3zS0o950j8E/Fv+kAH4z6XZMWPj7fchOWNRJ8vKtlCg9pTYNcbRrXTDueoi9GaMABCMIwH+afTLOGlvAfckATLcdOavG5nxqn2EALC99sOYJGzfn+Ug+bWkcR6KcYS/cwPKffIT/LYAsu+flALsKisoT/cYqB8LyzzSXsvWnfXU3mpXtnmfPpsrzRGm1FXP0ucw26FfS/qMnlq6HiMpu8r0m1I32ku8+hvzM8z8SatdqZ9yyJ9wfxkn/bSnJO7y27EHUhOgkgASAsoK/tl/7ksA/Oqv/NqDAnbklL10xnFvrnTPngSA+3mJANyYoQ/+8V0w9gM7duESfemB4/QAm9ef/Kmf6j+axyaCzQWA3VP6qaCfeAB/7uIjOdUH8AMkDQP4Qzag6g/w92Q/wP7qOK282FwBzpUEqB8FzIVnH3uSACw+fEuha3W+sFYv/uZ7fouF1o+sCO7RCuBkHUKAcWMRzjhpJz3xUcHv8l+dqmepHyBeMN8C+lP8TlXf27wcN1VV0i3OyRqmOzebqy7+5ov8U4E5AJ2vEQvUUyZoT3sF7dVt3MwLu/7E1640jy0EgH1iv7Tc+O3zs0+nSsrIuLr3KfuWNHMByUPySTA8BJYF0ykF3UMyAfuh9qEy9M96aR9qi31lu3VfhLxlQiwe9EB97rNXWs9iy8805qU0/0yzjz3X5JpeMqD6b3Nb56nS/GqbdLekfqTVvrae6/cxP8MWeUAPvOSlL3mtav6SAIJ+/XHPQQCgVeyH/gDru+6nBfzKBP7aPfFXCvyVqvqnXMD/ARNoSXq8HvjKpzz51+/sNADYYLCh4JRiKgEA2OeUn4/rQSQA8gH8nPgD/lH7J68E/Kigs0k+XosuX85cBZAEYJFg4ZiDBEiNAUkA8mbhqdcA+m8SxMl+AvtqryRAy/1DP/rPz77mac+8HwLnyON54/F/4Ut+cYwAmEIMoEFw+WZGX6O6QdF9SavbrJZ1bkn8djFuOFddulECQLAtMAf4t4zhLWkeSEF7lYS10uKX6audfLYQAPYLnVrt6UfYLj/z2lVShmUpdyl3MO5FgM5WmRUMD4FnwXVLCsbHJEQA4dvkWB6EtcrXb6jutNt2Klt9cUq/wYmxBPiMZk/ks6e9JVtpySf9tV82me0dslPn+ks/7Uripj3T6q8ci5vpFvsMPSAJkMAfe7olANyPTj395wN/nPgfAvwhCsZAf578DwF/CQBkBf/ra4Az9OSSxdIDM/YAJ/GAdjYqbCzYdAxdBeD0/mUvf1kP9AH4gHtO/WHd+Hif6v2bU/713f3bXe0FoPCyL7rvrPWfAVx0kLuylcSXBJAAGPoOQDdlVqj+8/FFF9gqWUj1067Uv0rGnbnAtYN6pWCmaXqTOZogP+1TTv4B/3wwcKb6LNmM9wAbrH2N4B+5wqj+39IAEHALzhP8MxfTTRzcSu24zQeZ4D/9W2XoV+Pp3oEAsL+6Jm82sG5UlRlW7bj5mU9L2retsJZfK7++kH3+nBJsTilLYJwSe8sIuIekQH0bmB8L9907VAb+rbqln+3GT/tlkfvMmdswDc9h66e/kjjakdXUcN013qnclO8vy9RvmyRN65f+aSeubmUrffpNjZdpFvsOPfDt9933ek/8BfseLgH2c285Bv7RLubDfv/6re/uT/vZO3s6v88eWvBvHgL8IekhXgL+apcAWD74t8MEWaKevgc4XQWw5+aEzQakgHf4CRfwY4dtA/h53x8JGYBBlXx9+rw6fWsub4mpBcDiwIKBFkBvugVsXwIgFzxJgKF/McK4MKY/9/YfOrfYuvC6GLfkNiIAJpcrBFwRQNsA8DPXaDCnPvOOTzz7tg//uMEP/w0RAYD/Z334J30AEmGu+hwhHzcfyiMUcZIsrT9yHyNIVfYEwK7gn/9FnAawz/dOkhDQLoivRIAgHmkc0yj1b0nSDRAAtG1K3zBg2Z+4x34ZF7t9OCa31YPyMt90Y5/8uyxAtFWPBMwJqIfsYyB9zjDKnwr8bYOy1c6L9Js8UZaIPm/0xJDdXvL5zbj6VTklTk2zq3uoDOurJF9+yodc2//W+LqV2/LMeNtLW2LM3gNf/uVf/hWe/LvP5GN9gHpBP24Me04MYJ9DRnAHH/VjzytYRx6yd07yYAjwt/wr4OfqrX7s71/zwn/RH/jN3oFLhksPzNkDADbU9+/srgGweYAIQPLVYk73OTEmHJAPKQABgMo/6v3Ye/X+DqCtv7S+LLDDg3OzkgAsLEkAuJB5qp/gfsxu/G0EQFe1G1/8ZU98O2QOJIALsARAyhbgJz7+KTONdsghNEXufsIT3jzHF/gBWAB4gDwGIgBgP2aIY3zSXkItFJ+VXlK/K6wmZluY/dh1a1cOgVHCa9iq8zunAQCg1iQwZ34IyplvCf7TThyJACV+QwA+/TN/7RnesksCrMeV9thG+2Ob7JLc0p/6IfnVPCxjF1nzqG7L6Qvc589Fgs8pZQucU2LfZgTohwJ/yjGvbWUSTpuqnNLOi4qzz5y5TdLwrO368/kkXdp1m595p8z42o8hsy6WX+ule0hmuiF7ps046b/YL1kPfO93f/dPcILfMoB81PnZDydAr6Df/fLY3ngozLxa4B4/wTyyFSfD0y74HzqEu2TDsFTndu8BCADu7PMv+NgccBUA8M/mAsAPWISBE+wTj3BAVb1nfrv35ZT2oyrf+h6Ai92+i1qSAGOLDx/w42OMkDuSOT3J89Pf31/jgGUdIwYE+dskcwrzk12+zDHmCuBtSh+14gCw0ARIIkCAPySJv/5gYSvLy+K34jsKkBl87PCyVGrPergBQ1azCyAl7gqTVwAS/AOukwQQlAv4OWlIo3+V24gAgX3NXzeSOFXi1yAAaBNtq32zzd0lOZdGt9L0tY9XXQRNDUu36adKyt3pd1HA89ByE2Rj38cksE/7rnnRlqzPoW07ZfqdJssSeagHeD7zp3tItuLil8+5bmWGjdmNnzLttU4Zhp1fjaP7odBpf/dJMy3nJdZRe4BDD4B4gvRtgD/3ydoz/ZjdvFuAXr8E89VuHGQNww3452N/9b9wHbUTl8yXHjikBzgRBugD6j/z0Y8++xt33dWTAGw07uy0Ar70S7649wMsAr4AK1f4pPKQrpotLWCYhWKOqwACfxY+NQD4ON9YZSmfsXS8IXUwjLXEAP/GEfIHtX5O9FHb2gb6DSc+6dEy8G6XVwSo20IcjY3OlQzLTRj2lknAOcW+6vIZJQAqOAeEC/AT/Kfd8JQJ5gXy5i24z7xNW9OlewsBUNvf6q+WH5Oj5Z/59f1G342YjF/trfzx45dS+0MhW/6eEmweUlYLYFc/3KcwtMOyq/2QNl5E2i3TYwnevwfGnkPDlJaSbu0pseseSmO4cdNtmiFp3Fb4WFgr/uJ3xXuAA6sE7gL7fWTmg908djnxb4H7lp9q/wJ/DvaWve0Vn4y3W/X5BgBq/JxMAP4BggBDrgJACqARwEnqRf0P+Os6HpxMSwLAKB76XwEkApBTxwoGlhNQSJ2/ftdjvw8yCBJA0yIFuP6xTWOAU3/ioU0gKZDyHe94xwf5t4Sn/neC13UuXbJ2uYFDairIxL0qRj/lJhzCkbmaGgBjAF3A/9Vf/dXP0uhXJXOwBegT+LfAP2lSeyA/Oog9CQDq3mhr7RP7aldpPpv+oiyvHShL+cY1bUuO1aPL7haAgN/g7yJA5zHKTEBO/rpTYt/VtPIa8kt/7FfBDE6MJWBbD/Ac7vobSpPPdOZp/CqNYzrc1W4cZc1Dt+FT5T7p9kkztT5LvCP2AO/I+77p/g1gF7gfKgX+SPbY7rU9zW8B+138AP8A/zGt2yN225L10gOH9QAnwRAAAP47uxN/AH8P+jt/NriH5b6kHusBgAIkAAuOC5MLXmUydQv0caddtnPb6f9YfdZhN1FdhskkL9T3n/eC5/8Xrg2gBYKGgASB2gL4c+Kvyj8EwNh/G0gygLhr1nQ1oW5LlMvbA7n5wl5NBZmrLs5WA4AdIwDy1F0gD8gX+CO//tnPfnm6KwmA27SZn3aeU8NNqxspQcB6qbsSAAHEaz+03LXvhtyk3fShfdWSGa+zn0u3du9ajy7ZZoyxj/6uAkidWscE+6SpbvOp/tU9FK/6677KcnRyLIEX1QOsK2M/1x3jDMWv8Yy/q2zl3/LbNd8l/hXpAYgAQLX74F1lD/TjvwJIAAj4U+4C9FtxPfnno9dXpHuXai49cL4HIAAE/Z72r0+szkdcXEfpAU41+Thgv+h1DKULGAufoL8lE/y7SM4A/ofaeJM5ATEAyAGws+ipNSAp4FUC3GgAAO6HDNcDMFwXQCOAqwbcgQc4DVVi8b8yPeCmzY0hUoC56uyTjWCW+dfSABCkC8gF6AJ+wH8a/ZXGHyIBzBeZcTO+wN+4uKmX3wCg7kEA2Hb7Y0xm/6XdNH1e2UfYLU9peKMOpCcvpfmmzHKrvUs67XeVwesuda8gX3fNQ39lDb9u7mmzZIl1gh7gGa4//ZQ1fHEvPXDSHkAz71CNgDz1nxP4QwZ48s87/qQdsxS29MCcPQAB8PCHP8JT2DmzXvLarQduAH6f+cinPA8gz+LHotUC/9UPAgCQs1tx88UGWHBKyqLtdQL+AwBXCp7xrGf+BzQIMGgJaPgvAWkgDPjmANdQuHIyX+2WnC6gBypQxJ2gctW5e5PgNO2Epxswi4EE4KXLs4LZlQCQDJAAUAruE8Rrb4H/Gj/jYqde1I/6JhC33SGzX1r27EvDz/WdfTMksx+1R/l9XuG2jJRZh5a9Sz5+JeC6Adpd23O7AP2hfmGCLL9L1QM8x/7Sjl91p18Nq27zXOTSA3P0wA32lajY5+GYh15DkriC/np6j3/12+Y2jcB/OfWfY2iXPC68BzitArxdeEWWCrR6YOWpO4sg5IAARvmIj3rq0wAZrcSXxI8Nwk2AB21hrqVh/tE2DdoF+F2Sui/V2L8H3BgiNQkqzwF8gemQFNxOIQAE9T4jL3npS16rXUkc7MZFtkC9fspWfMOULQJAEqDri9WAyb4Zs5/rN/KlT6qxv1IO9S3+pU5D5TuOyi7ZZmyxD/6GgOHifzXu8B86ToMTYwm4ij3A87/8lh44eQ+wNwSst4A/oD9P/QX1EgFK/ZF+yC/90p7An+u6aOuevNFLgUsPLD2w9MDSA0sPXLEeECgiE1SuOndvBKUJVMfsSQBMPf2HANAA+luEQJIBAnkkxJTuBP9JGBiuTAIA0sv22FbbPiCzn6q9B//mh6zAP90ZT7t1wK0d2ahLLTvHstq75ONEwKEAckl/tYkCJsjyW3pg6YGlB+boAQ6R0AoAoCfoF+QrE8zvYq/An7J4t85R9yWPpQeWHlh6YOmBpQduhx6oYFFgectJtoBWsNqSvITrFQDV7wXgAnVP+wX/337ffa/XPkYCmE/KzBP7EGFAmkoAUOcKuAdA96qbEBj6CLkxgnX7yH6gL6ohrGVa/Wm+A/VxrFLW8dTdVXf4twD4qw3gDx2/4ZmxhCw9sPTA0gP79wDvNTRhuToLUOf6LGBfEF+Bv/7KGo6b037y+oK7v/B7Fg3p/cdmSbn0wNIDl6QHuJPsHf1P/NpP/rGW+dwnPf6Xqvn8533++4eMcclr/TX/S9LapRqXqAcEiUjB5Kqzb0iABKct8Jp+LQJgCKwn4IcAqCSA4ZIFCewF/Sm3xZMAgATgeaOu1N32JeBOO30xZIhnevtB0E8ZlqOfcVrSfFJuqYfjpcyx1N5VfXNvGL/lt/TAte0BnheetXqVDfXkliEezyjprm2nLA1beuDy9cBNnsckBrjDP2QA/MQlzeVryuWvEf0GDpiBMLlBHuAJPgyOQRPT9ZZyZijj8nfoUsOlBw7pAR4gHkjA+53/7DFnpzKUR7nLV/0PGb1rlVagiBRIrjp7b1oAF/AqeK5AVqDLppprAIBtCYAK1gX4gv/v/e7v/gnthqUU4Gc+2PWvssbDLQlA3bINQ6BbAG5/IPWzb+wP8hP0t6R9k9L+m1KXrEPYHTNljme1d8mW39ID16cHeH54lnmf8vEvQAJ3gfnA7Vc+5cm/roEM91/kIu/s/q0yhg8tb0z3gVtIeDawPNvXp5eWliw9sPTA7dwD7Pn/+//lUR+8+baPO0Oyzu3aH6QhLebjX/cxZ0OGcEiBXfNf4i89cG17AIAB6GYjciqwP7UcSAH+beDC3F3b6betYQkUBZKrLtEG7DJ/E6wmiK12wa8EgCSAgDyBOgAf0A/4TyMRgGyRAJmHduPpTmnZEgDWcQh4094E+tVe+8P8aHMa/ausfUbfZl1wU4bG8hmTYhyvlDme2PkpH3Lt/rem143UkGvady9lSbFvD9jvU+S+ZVxYOp4HQT6qv89+7jN/6cXffM9v8d9pevOaf3B2b2d++qkvf3BX87rv+5YzDPnwH29e+MIXnj3j6U8/413Nf71Zb2Z5vpbf0gNLDyw9cGV6gLWLdfLZ7733QcA/mOCjXv4xH2TP//i/8CW/2DVk6rq2Il3LfPSzVg+mkSTo8l5dmY5aKrr0wNw9wKb/Ik75pwL/oXgSAou61dwz4lLnJ3AQSK662o4SAIJagGvL3iIAEpQL2CUAfuRHfuStmG1EQOah3byU+qesGgDUeQx0C76RAPB0C9htd4J+CA/ItPQz3pBMQmAI/FMHxqRhHDOlY1lll/QgIqDmt6ub8pffvD3gGDj2qy77ljHc+PPWYt7cVmxcAd8Q04D95z7363qAvwHrHdjn39Y+90tf+uC9f+6LPjjVPOvDP+kDmqE0EgiSC5AC/Ktc/n0uWgbr9yJ9vPyWHlh6YOmBS9ED7BvUXurJ0g7sf847n9SbJz7/OX/0FZ/84v/2tR/9r86+5mPfdPakj31NL/Fb7ytG28C+RfAP2MeeoD/d2CEBwD6jmS6BSw9ctx7YRbUfoD0EwvUnThrUFvt0axVGVRlb8ly6A64ZkA8PMypALDLXbcyW9mx6QHAgWDhHAACAGf8E/EOAFv99CYBKArSuBiSwF/QjU2Mg42AfIgAqCUAbE+ynnbDsA0E+oL8agALhlQzAr/ZbJQAsx7LVAFB2I7YqxjFDOo4pO++jgP8sN+1Z9pCdOi2//XvAfqXf+2fV+dKaP8RZG+dI57xcP0D//+VT/tLZZz760T3A/+Oz3z/7g/f9xtkP/eg/790J2v/ajcedfeYdn3i2+sjV2R13TPuQI3GnxCcORAHl/e9/5llnSAgHCQhIAYgJCIFFc+5yzaGlNksP3I49AGnq6buSvTtgH+D/wo//+V5ix0gCILddCWDfkcC/RQYkCWD5y9p4O87E26zNPHj7nvTzoCTY/xt33XX2uEfdffZXPvUxD7LBwXzKjbvOSf0f9aGPPsPg3iaJQ54SBT2JcAApQHshO26zob7uzQVQ8EP2oKKT50gAgUUlAQTCglvdgmJU7wHgCcoF7p74qwGQ0jBlAnzTKwkbCrdcrwBYT4C44Nu2jUnb3WqfbUUC/nUbV0JAd9ZhqB4COqTgX8nYFDMFgHdJRokA5wDx+AkyU2Y5U+2Zvtotpy9w+TOpB+zDDfBn3jo/k2DCjzDnUJf7qjOMG3lcih/vkj//333SGYY7+q941XPOAP/8fvU3f74H4LzjBPB/6c88ogf/SogA7Ur8phq1ApSka5EKkgIQAmgKQASgKQAZwBW/ZcN7KabTUomlB267HkgC4KN+81P7dZTTfgG/dmUSAi//xHf3hMDInv4m+AHc8OQnP+lMMkDQ35Jgm0UL4LabhrdPg2HN9gXSqOYA/Ekv2AfoC+QF+ceWcxACbHxun1G/li1NICCwQAISVpieAV7fSa9AIwFt2hMEVwKggnYAPsD/J3/6p9+pSSIAe5IAFegL/omj3TKUQ1oACb4lAwRNtjWBFW0U3NOuIWOcKkmfZIBgzbItE4lJEkAQx3g4NiETjOc4YuenfMg17W/mk/mvuuQbM0JKGCfTYs98d7F3SZdf1wP02U2fS+cnADSfO+eZc9z5Q9p1Hp24mB9z2xN/wPZf/R/+hx5Mc9L+kz/9/T345w9gm3DAP+BeI+hPt34Cf96f2JU13HgCf8rSCPbRAMDgJn4SA/j1GgLrbxFQd8iA9fN5MR27lLr0wNIDt10PsJ4CxPk4H7jiqz70Fb2av4AfIkA74J+Tf9ZF1s+//ZEv2hAFXAsA20Ao8F6xI/lmwGte+C/OXvXM15y95KnfelaJAMrWQBBQD0iAEVLBrBe59MDV6wHYLU/vp0qAPw8FDygP36kBP2UOGYgItQSoH2Zqu4i3sH1Xbw43agyw4NcDjE4CFJpaAAJXQX8FuukeIwAE9hIAb3/bL/wHTBIB2FskgGDfPJT6C/6RLQKAutsOQZJAXGl4tlPQ78cFvV6gf0pepLizP7Cbn/ln+YL/lEkEDADuqSCb8d32q6DcvFddws18EIBm3bRbxzUY6tORtjPmVWUtM91dsnOkAe7b9eezuaKvmacCf+bZMx/5lOelwQ8iwPlFmq7jVp2h/8nrZD/qwOaSL+9/wp/9hDMMgJpTf1T9MZz4/+H73/9BwP/PPfCOPjxBvnaloB53tQvwkbz30l3tSQII+ockJAHxrT92NAL8mCDfDFi0AU42rZaCjtgD6/XipOtENCffAcesQy0n3VGdS2+9CakK+AfgawD+gn/k53z4l/SEqkAdsP6hn/fhvfYxBEDGBfjz/kC+4p7Xnr306+/rzb3Pur8nA8AJagSkxK6Gc9drq0vfc0sFL2cPsIGEReo3Dt3kZoL3Jv+FT2dnglbDvwTC4K+dfxXEl4Q5uW7lxUYCVURe7qocYnfDgQS4c09xKkjeAOo7H3tOvX8IjF8WfwgB2nlnV2/b6kM9RA4sGgGX8znaUqt8uebLT5A2qAUgkK0AV7cAWLAMEBeYA9QF7ZUASBIgyQDjZ1r9UkoCIMcIgEoCJCDHnu0T2NuWIZnxtCvtF/O1DMuVeEDOSAAw/DnGY9PBeM6DzRzoEp2bB2wOs47VTrhGQoA8BozltKR1ackuu9vqRx/04yD4Z04J+l/66f/za9/0eb/8rvu//L0f+J47H/hx/SUBGKM1KUM/k9cpfqsE/bxPBc+c/P/Oe9959ra3/Xx/qvSGN7wB7N//7v6Yp/cEAO9D3rn5DgbApzvthvXv6QD/5EOYspIAuAHzAPwh8N/yJx17BcJe9vKX9d8KQK7B0yn6dylj6YFj9MCKffd6vThG/kN5us7nu0C/udcs8rOcVWfXuD7OXV5XxHF/kI+snRAAgHklJ/+QA4D9h/3ww84+4/f+Zn8gyZ6e/xKAH2QAJ/ns+UlHGvJ66uP+fv9fUiAAXvA1r+wN9u980Vt6AjdP/7FLBpA3OOu4LV5yvxI9ABgYqOhNJi1Av4J7XtZMQNRUYKeYlPc8/Ad68+rH/MTZfX/1t/9rGvxe9HfeePayL7qv/0qwk7VKJvTdn/HEB7lzr8GtnyfiyNx8YKdOGMIExgDi3t49ONzl5wEi3LjXQdIe2iX4HyID6IflBGRgpl8u7/pyw53m3IuRjYCgT6AqgBXYCnSrBCx7Fx9ALkAHtAP+WwSA2gDKFhEg6DcPpH7IIQKA+grCU9oe/bJdAn7bodR/SNoXrH/mV8uXAEDatwmoBdJIwfR6Y7bqxgzjWClzHHOc094lu+WX6cxrc+rv+FM364ls1R//Vhuy/mnvarIaMNZDmXVM+y2NuYYe9MGKfqXPmUeAfIA/gP99T/mTD6aBDEgSgDFhDNf9vG0uzNF9Kz7sVwl13X/rC+4+4yv/EM0Q7xIA//qt7z53+p8Af6o939W8fxP8Sw60SACJgBbYH/IjzR133NETCFwF4MOFy3WAOabPksdF9QCkHfu9kX37vlXLNbuuQbj7Na6Tm/cO9rW/aTvnpJ/xyVO7CTdl8R6q79gu0qqRxrSXWtIWDj7BS2kgBNi/A/jZv1cDASAZAO4iPiTAc77wNT25CY5SCwD7fd/0kCYApIIkgASAWgCUwbvqUnfYUrnj9ACLBy92Xo4YXt6CfE8B8GOyPeNh9z404W5+39k3PezNZy//sF88+65P/K2zez/l989+/PEfOGdef9ef9OAfwC/Y5//3cjcFyaaC/+nLyxjVlWq4z8LkRabBD/N9r/7hjSH8hZ/+HT17Rh01sGkYiAnqj2qNQJ8NxhRj/Ksmk/wYIwLYqB5nZi25ztQDvAT55ctRu4CrfyEL1gSBAr8Ey4JdwDD2BMUCZgkAgbrgH4AP2H/HO97xQY3gX+l1gAT8Lbt570MCJEjPNlj/XaTtt1+Q5M+J7BgJ0CIC3KA4Dt2YrcLkWDl+KbuoW38Z3/xWXarNyT/PM+Pu2FNPxx8J8achrNUOSQHbU6XtU1J+GOulzDpr76Jfyx/t6+/+0//0t+C+Bf4lAiAHiMd8YzzWa/Kqy4v8jvm7meCffcAj//Kn9vf9sXNqDvCHBMD4HQCO/1//sl/Y7BemAv6heBIBSkE/bu1DchdtAEkASAL2HrSNwwBOUZnjx+zoJe+lB+bsAeYs4B/zuU96/C/NlPdm/XLN7/JddYa13LUbe3+9yXcNkvi8DyJuZ936I8+eLPWdE3n4/thcpfJ95Rq5jrvq8iCfK/ejzeCSWwiAbkw57Rf8A/g1vWbA133DRmvAtOAftJrAU0kCiK++9LOe2c8VT/4lAZCUs1wRvnLT5/AK85LnpQwwZiJilwhQEgbI/5cf//6z7/6//mEvsWsE/t/z1953BthnIjLZvuyup26APpOQr/EK2h943VvPMNwh1L6rrHm94ilvuIUAeGFHVEAGILVLCnzln/mfzjASA7SzZQD+lSi4KmQAHy6sWgFqB6RcHv7Dn6UT5OBLDplm86Ls/DdAkBdyAkHACABDoCvwTSlwnkIA/Oqv/NqDmBYRoCaAZEC69UtNgJYWgECcOmME5NkG4lD/rDd11+g/JLPt9kur3ATQbkLsWzcuboLcCMXmZMW4dMZxQub4pb0L2rqZMb75bcacOrSAf/adfYkfRjIAWdtmG5XZ1mxvtnmPdtPm6/JjbPoNK31JX3v6z0m/gL9KrwIw9xgH+pZ8OkN+R/up9g/QB/gDhhPs4w/A4BsAEgC8y/mhWsoeYQjU7+rvO9b3LRLALglAfkMkANcChk7+q3/mQbv4TwFsnDmQ+OIve+Lb0XJkvh+t05eMj9oDjB1j6LVUgPJ1HE9P/z+jA4M8ozNoAbDW3GTtYQ0iP4zrEeu6hjj0KWEaQXmXx4p8OrNt7bpBfqR/xEc99Wmf+bB7XorknURe5G85uPG3Tr63CF+/b6aU11Xp8v04bEV72qsAfAwQLWdO+jEAfvfqAHUAPwevmD7uGreBY/IbAJIASNY4Pg7IQezXPOH5vZawRABSsoFn5vL10FKjWXqABw2VE1X7eLkzaTjJ/6cf+7/3IB8pCYBkUgr8IQE0EAEAf075SVNBP5uE7/yuf74B9wD9n/ypnzp74Mfe3PsJ3tlEcHrPByswgHgME1XTM1vh5guXTGaN2gGQDgB4AL4aANukpMBQvCQLkihwk+KmRXmZiYHUCHBBUbrYLN8HmOVRmzMTX6IpsacRCCI3KnmAsnyBCmIF0Al+K0CeSgD8xm/81lmSAJABqQlQgT9h+qkV0NIAoG4tQJ5+Y8BfAmBI1vbaF5k//aSx75BsRjRuUuhnzAgQzjFys5JjmOM7Nn8yzbnxzrGmftTV+tsuT6OR+OWGik2VGys3dUjb2pK0X5N9kP3AnAxjP2Q70j7W9qsQRls26v/0MX09dvoPGQA5oBYA40Zfrje25HeUXwX/An8loKISABAEaPDxqx8A3BXwt+L7Hk0pEQBwJ00C+Gqfog1AHIgLPgrIfzMA/Pcb5G6TzEcCMexfIAN4H/IMHGUAlkzn6IEbrD8Al79+12O/j/0tV0cBOWnwn6Owy5IH7eX5BPxLAPA8H1i/m6zbvAMA45/34T/845gE5vl+wA5g1+DmHUEeXT1WnRlbu/p1kvikp5z/+8P+zf8b+diHveZ7LJMw31GWYxj+O5R3YNccJ3nf3924gVskAJBgGffknNDj578L9D8EkIb1kLUSbJIEAOtXXgNQu/q5X/rSB/GXCGAt5zowZSDRiKJPj9PaJdej9ACbBRY41NwBsvlBBxaKe/7y298pyBfgM2kAv7g1uJlUvHDJx9N+QT9S4M9pP/f8PemHPeeE//4fvH8D+vsT/TXgB+gD8Jl4AHoMZQiwYcAONQJ08hkC9HP5U+/UHhgiBOhnw5AXaRxbXhwC/5S54KwX8aPM1yXTnXvAFylyyAisVl2cURIgQWGC6ATFSQAI1AHugnuAPuD/t3/nd3sjESAZYLwhKQmAVBOAMq1DC5DrpySuAN/vFVRpO4yX0rKQ5okULCPtKyQbHIkAXpKYFgHAs7MGb/1YMB6dcXyUQ+PYRd36I635NE//K/hP4D9kz80WbR0ySQ5oz/7IPqEvJvRHqy+2dsIljUBbegKAvqGvh+7+pxZAJQDow2MSAOwRPAjgCkCe/EsA4AcBgNo/J+UY/HjX8+NZZwPK+zbBPFpnmPTb1S4BkO9O/JIEIM9KAOCeQgJAAHAIAQHAVQBIANVn2cdAAkAKcFWRbwV87xu+7d/RZ74XGVsAJyDkks7Da1ktngnWJYgZ9rxombYAf4J/7ACf6wRs8vQ/SQDWjT0Hvl+3mNcAbMD4F33k774XIzBvgXPianh/MDYT164bPEs8PwB+yvmKT/jjD1oeZVquhADlYNdteeAf1tzO0IYr8wObsYaxxrK2qcoP2GdNZT+O2j/7dXELYRIArI1gHv1Iw9rMusWpP0YiIAkAwzhI1fQfEOwOVVkTZyCSrswYXOmKotrEIggYBeBzUg+Id0IlwAe8EwcQCHAV9CvxYzIyoYhbT/0T+DNRUVGBPWKyDYF+JhOAH2KCOjJBMZQxhzE/JPlLKPiwnFJSPoZ2CbTdxCAF/mnX75SSumlg+/qPInYfHGkRAYs2wIUvD/lC046sRjCIXGHYKGF4yfKC5KXMBkgAC6AF4AJ4BcIJjgXOnM4D0AXsAvpKACQRABnQuhZgWqV5JgFAuRWQJzivdQXw57cE1CbQr0UI2E7zUmY5QySA/ZeAl/7F0NcY+96xWMscI+x1DDuvzQbGscav/kxnfucIAMeYjZhjPAT4x/w9bUlSwJOYlJUkSEKAOYfJ/tnSN7YtZW3/ZXf3aq20OQmAMfX/lgbAxE30vn1xE/AvAZB3/AX/SuJwNaBFAPCvAHmXuHHlPSzQlwQ4hAjI92faAfm4kwyoRMC2KwESAD/39h86RwAA/tnXQAZAAkAAYPDX2BfEgTzg/vXyDYF9p+JouhXrGUApT/e3AX7AfhoBz3XZz9AnPLMC/5R7trFfbwXkAH0BOaBcYP5XP+qDD+IvESAYVwLQeTdQP9b5bmR9z9VBprz+qgHvF4C+5SgpS5NEAGVbvuWVtZK8L/2POQ1O07Busn4C5jV8+JyT+aff9bJe3d8DR+OhEQAZoGYA6YgL2GetAptx2u/8xw87z4Z+SvxIx94N0oD17NJ34u1WQSYNDzgMDUATgCvwB7TjxwsbCbDHT4APOAVoVvD/og+9r3+Z8kKFMKjAnzw47ffEP4H/LXf2u9N+QD+q+UxEJip1mcNMyYv+oA2nBP5DZdHfPrD0e25gsJ8S9LfKkgQgrEUCQAjAQC7fBrgUq4wvNWQ1AkHlqovTmyQAACS8KHk519PhFgkgcBZIA9IF7khO/3hZvOc97/mTNBAB+GNSG0BCQGlekgACdwkAQXlLJjlh/aZI2iT4V2b+SQBolwhQE4C+ow81FeAOEACOTco6junuhnDwZzzz2hAAji/AswX+OYkeM2OEQIYlOVDtbAAlBZIMoL9qXzXIANuEtJ0pBzvlEgX0BABtZa7Qb/T5NgKAKwLEIz79xvPatWnVGdo/64/8Bf98A8jTf6QGAgCgi3YAcQS9SOLwbwH5Qe5/1ke+tt+EsgHlPZ3gv9olCHaRrXenfgJ/8tOeckgbgI03VwD414acmqkBAOjHTbvZQPMfDyAE6A80AX71N3++N8SjH9gsY0cSDy0B5vqsA3b7ZHaT9YM9bj3dF9ALWJQtMGNYlWgCXIeuZI5xKpzAX/uep7esMRtADsAWiCsF40kCCMYTkPM+YH3hPUienanrl+v5iucEEF8JgCzL8iQBskzSUh75bCEcLtWws7a7/rkO4wYvCP4F9YJ8MBRrHusr8TBgD8NJZxrs/Jc1AD1rGFexkS0tgHx+eD5Y79i7QT6s30GXqu9uy8rwwHN/m8EHWDLwqvQD0LEzOZhEhCXwhwAQgKZGAGmYVKRBkgbwj9Rw6l+BPyySwB+wr517+J72TwH8tEVDm9K0QLXtRppOSXnYW+kui59kAMDb8WDMWuD8lH4SAbxQUgtAu9cCbssH72Ib7YszpS/PlAmasK80EgC8jFnMBYieYgsStxEAgP8kAADxgHtP/SEA/uN//s8fwEgGSAIYV+AvKYA7SYAkAFokgIA9iQnrtU1KDpi2EgFJAminTwT/SPrKfpMESEBL/yb4X29IHIs6Rjl+2rth22yW8Gv9jIs0z1sIAOoHCKfeAvcx4D8WJoBFsuEyP+wa/CoRgHuIDMh+yz7r2rQKY/uyzdq7aJf2t5cGQH4EkA3tevO16lpJm2f9cbrDxlPjV/9R9ec9IAkA2OekEbAsIaAfYJgf1/ogANACYOOJxF2Bf3Wz78APOcX4rkRqfI8K+MlHe8oWCYCGAAQAgB7AD4D3CgBtA8xDfLBxZs8DyCcuEj+IAyT9QjrshGGnj9izMc9nHbhrmBnz3BP+VOcfAvwV1O/iJk+eravcjbxXhk7/JQEA4Du00XfJir5hTd8GyBOUE1dwjibARAKg/y8p1JM0c5QXBMAOTb+QqCuwnGseayvrMG7WNfbjCe4B9fgRj3S4n/cR7+nBPmstuAdMlARAEgHE4TCW9Yl1DTLAKzE+O5IAPnOsbWh1U6eL0AToDxC69ZM1tBuh2d9/FzLq+xRKBzAIAFwAOwAeg12QDsBlcjB5PPX3X/MRj5ck6dUEQJIH8UlH+tapPx/4u++v/vZ/7cF8p+7PBBLsb4B/d+IP8GeC9fG6coakYF0gf1mAeasex64j+dNPbmByQ4PfqY0kAKyfwL9KiIA1q7vPVF7S7NYDuehh1609pUAJuUozRADwogckSgAAFCUBANoCZYGzAFvALqgH5EMCCP5TQgSoDQDor0ZCgDzzOwAVnI8Bf7UHWtI6I22H7WqVIfBHjp3+J/ivQDbBbCEAGJccJ+w5htXeBZ/7Ee7PuOZ3CwHAxsqxFbAL8gGaQ8Y4u0qJgJSVEKhkAHOQ/qt9SL+VvrOdQ31mv1wWyfhsvgEgCUOf553/tOf9f8aNvlmvtasurxz7wTbSZ/QxGzb2DS1DGHkTBrh18wkABrxi2CQiAbYQARACd9xxx9mnPfLTemALMMYP1Xd+fNj34248o9+AJhGAHf8K/Ftu9jhTyADek613pu9PQD95JfjXXq8E4IYYANTTZggASQBAPH4AefoIf9y0WTebZK4P0HdcEeBbAsQhP9Y2yQH6enDQbtMAQD9z0VN+AYlARGAytyT/iwA0cw4z84nnT7DfkjvOOdaX/uN/vDeSAKgn8dVd7+tPIAB8d/XrI0CPNF43qPlXN/EsU60DCYf1O4N3xKX+MTauV6xVGtYV1lnCwAca3IQRDwIAkoz9OusrQF/SFaCvwb9eDZAIYC1jbeLZ8rnL5ww/NAXYu/G8UC5aJcckM8nb9xZrglgRiftSD+gxKkeH0/GAREA8gF6gKsiHAIApYnIwIQT4gn/i87JEGoYkDXkzsYgL+L/3U35/Qyh4158JBCDk5eYd/w3w7/59333fdP8twJ8BSwIAtxPZ+l9WST1bdRvyb8Xdx0/NgNbG5qKIAMA//26kRQKwaB9jzi953tIDvCz9+eKsMsER9pVGIAWQwLDpwrDYJgEgUJQAAABLAgCcBdKCbAC7BAAvCU//uQ+skQhIbQDJADUDJAQkAMi/BdQF7UN1kZQgfeZlfa1/K2/JBWUlAQBvGPoI4C/4F7zap0j72X53HELWsapj6Xgru6TNn+nMb0MAUA/HdkgDYAj8j/kfSggMkQFsODH2p2RA9mXXA6swttk+SNnsrAvwpE6b/wLA3IGEoQ8T9KedvpeoYY7RD7GhJb/mj02TGydOkQTqgHTAKyAe4M4eIY0n//hxmgiQxQBgMRAAAFs0AjBoCJCXRAH54/7js9/vDe98NqRp2JjqboH+MT/2J2PG96IbaSR+gv0kAshHf0E//xYQO/4Ad0kANsaSANjpC9r58Ic/YkOE0K/EJx2GEzWIBLQJ1DRQs4B1kvy+8ilP/vXlvfkhH9KTgB0A4hopQAawkeDjFPa7n/CENzcfpiviCTZogf70gyCY2BzXz3OAnBP5Cr5b7gTkpJlIAPSn/6xxvBckAFr5t/yyzCxvyno5sU+OFg1NF9cq1zfXMDAceMmTfCR4Aj/WNuKblvUbP8KNLxkgBgPwg+EqEQCe6T/E3pGZYDuJgHwWsfPf2li/uOJlnmtiafB9NKXjGHfWgc1a0L07yH/MrMd2SvZXOw6bIe6eCfwB+ZzW40YK/pFMGF7gAEjiJchnYmQawiASTIMkzZDKP5OHRRrVN/7VDyf/Pfhf3/FnAjkpKKfajw2adwHac9cl80v7LnUaistYMjY83C4M2E9pKB/DdwFaJAAfJeGDPFf7STtp7V0wfdnOKQVEylXXsh4QCkQFU4JVFmBBImBDAqClBVBBt2CbF4On/y0CACKgkgCSBUjJAK8DCNwF6VUK4gX51mNMVgIgNQHIX2JhCvivBAB9iLFP7WOk/c44NIzjhByaB11Q/3Pe6E5pWvI5iADg9FkzRgJMCUuigM0ZJrUCsCcZ0G8COkIRcLSNCFhvAla0tzNj/dgFX+iPsVkxF5gjPGOCe/owgT92/Og34tAPPJvMK/LoDO1s/gD+CeqxQwBwag9QB6RjIADwr3Fxs5EE3KININgnDe/9V7zqOX168sKOBBADejkJJ19OwfmxHxDsD0m0AdjEAvzVDFAOkQFuklvS92NLCvhJl2SA/oB/DP0CaOd7BgJ62g5o96QMMoQ+JW6e9Bsf4oQ8CE8jKUDexEGrYP3eHBzT5kBfcU/mct7pT6CRHyjbBfyTRzVT05Ou69LVVexW1oY77xw//ZcImEg4sVbNBsg5lfdEnvWPvDuT77FNebSFuKQB1LfAfstvAgFwWYf2Jif47K1Zs3JNw0+wDqBPozo/GMs1HDxAGvAC33ATT0gGgN8IJx4YxbxTM4C4/Cc21nXWc4zPFCf/aAFAArC2SyaQhnrsoGHSf9OD+Jzkc6BMvchjzFBnDOXeNhoAqobQcMA5RkAIeE/wzwTqX0gd0K/gnzQSCJICkAdMBiYdYZzyV/CfKv+w3HnqL/jn1B9GiDwq8MdN3Z2MFyXH6pBhaZ+jrnPkxzhRF/KiPxkzNzjYT2V4SDG8bFraAJADz/nC15zd+ZjHfeNlXW0vQb3qi093Suwtt/4tmeAn7asur94IQhOYClYlACQBALeSAFULQCAumBZwA9whADzhB+wD+ns0sP4zpA1gmiQBJAAoR7CfMoE/5MOQsX5K65352iZJAAkAZFX/t28kAOgzzB4EQI6Tm6I6tt3wbeYC9vw5R/QzLXmtMIw1Y+z4sgGk3oJPpAA9wbzgf6okLXHNg38x2zKqaEoEVDIgiQDs1BdTtQKct7TPeW2bO5n9ap8ou+AL+VF+v6mm7swX2uU4ZP8J/AljrGg74xdkB3nd8oM4cTNYJSfWAFWAPO9xwD17hRoPNwSAGgISAaz5gGBOwJEAYMAr+UoAAI5Jh5sf/+IXMC/4/4t//od7O5JNo27CBfvE1+iXkr0K7twoVzvvxnxH5rtSsE+aFgmAH/2CBMxDZgjqabMkgJK+IJy+YLPMx7JMJwFgmeZN/mgbkDdaA+SLNgDjfMugXjMP5jB7Wk/7Ve/fF/STHoDCfwBAe8DvBeyqSUAePI9Xsbsh/QT42+TE/wbQr1WsraxTrMOs07sAcj4SSPwRDYDs6lvK25UAGCpvvWY218uswEXZGTsAMM9DXcfAbOz7Abysly0DiCec9c70rHfs000PGUBatQHEEKQBcCcBILFAnlzhhkBjXUPyrPHv3ZGQlxAF5CuRgJ28y3O0wq1GGsCdOAJ9ysGdfoZV2cfr+om+2vOjlhc1zPuVSyMZSIA+wBzgTicwsIJ4gD7hDD4vb8AifqjxEwcJcMQQT3+/8k86wsgfAoC0mtff9Sf94FImkwDmZ3Pq353+437FU95wywD2A7Ue5DlA9Fge1H0sfN+wmm+6h+xTysq0U+LXOJIBzAHmBg+xGx7spzRDJMCr3/SjZy/82TctRMDwY88LyZeS9iEpMExQM8W+6srYGEESUgJAECVwFciqAQD4UANAEgBAzCk5QBkwLggXfG8jAAAGkgCpEQBZkCRA1QJI0G6ZAHrL9epAlYYL/pGZVxIKkgD5LQDV//P+P/2CoZ8w9pv9aL/azwMg1bHJsRyaA91Q9j/njO4qTW+eGy0ACYAcW8GnBABSAC8gnUoADMVrkQD67UIG7KIV0HXKam3sB6R9o+y8TvqjXOqx0QKQBOAZcyyU+LFxEvwzh0i7zoO88tefqLTAPGATsC/4hwAAzLfiph9XANA6xADqUffnxB/AC9jtiYDX/IOeADB/VeMJ4/ev3/ruDeAH5Av4kS27J/8SAMokANLO3mWIDPCdKPhPyTtSUE4e2JX6028AeNX62fBiaCPthwAAuAP2JQOUkACkQ+WffMwzJf70N3HUBuDUjY1yDuw1sq8E/oB1gf/UE/qM1wL9gn8lZWSabXYIgKva9/TrNuBvOP+acsKcYn3p1ykJgLkA+XodYx3M36Y81ru5NACo+yUnAPrTf+YeJABrkIb1CqyAYa+PbBEAAnuAO4CZdOaBZK0Dj4Ej1AqQCCA+4aTBLpiXBDAeQJ/nh/WNumJnfWOdA8AbXyIAP+Yk+JWyK5Cv7sSLGcahMiQEpMNHP2v1IFrGfnz8Wv8Xsi+4+wu/B7UQBh0QL8hnsCr4BxD64gbgJ/jHTXziSAYgydeJwsSo4B8iAPDfszMtlf8O/PORH9RA6uDppowKXndx1/TpTnvmmf5pH4qT/nPZh8pt5b9L3JpeIoA86HPmxkWYFgmAHwQA5sXffM9v5Up/G9vdtKfE3jICFuSYWa3DkU2TwL8F/gGrgkOBbIJEgIgkQOs7AIJxgXbrCkCPBhp/kgiQDEgSwDwTvGsnTLBPmS1j+FA+EgGSAJ7+SwDsAv7pu0oA0LcJ/tebkRynHNvWPOiGdUMUYZ/yMx/yXmGoQ46z45vAcwoJcP+Xv/cDaQD9uIfAf/UX+FfJ5nIqGXAEIoD+OtWPsnotAMbE545NL2A/DX7OKecQaTtzS325Q8pmy31ASoAmp/gQABoAvQA042onTNCPNgBkACAfgCoBcG8H/gHAyFQXRbuAwwK+A/AH7/uNDQGQgF8yoBIB+AP62bgK/pUCf9zaU+amVzt7nCEDGCdMUE4a7Uj6AEN7WT84rcdAArDxhQTA0E786AOJATbKEAOAe/o08007YZSBNgAbagzkCZvnU03IU5TD/OTUTvCwDYwPhZMeMEBeQ0YCYIhgwF+T5eB3RdWKb9555zT1f0kA1pUt484a07839gXkrRN5yh0A5Ecpj/WVdnTmljWz87vwH88FwJ95zfoD5pMIYG1ib68Bx2HAAUNEAACcMPCAa6CS/PCHBNhGBADoyUtgLxEAGGdtY41CE/xXfv+B/r+9JAmRacWCCeqH7MQlTK0D1tKeZO7WX/AE4D/NtSQA2ACwEAHkGHhP4gHt+DEB8EtSgAHmRQIgbIF/Bpv4kAFI8iANE4I0gP/6sT/AP+wLi+ktKv+c/HfmGOCfNlegO4d7KN/0T/scZdY8puQ/JU7N96KJADZhlQTgQZUEePZ7733w777ipdfi/+zO8MbgRTTFJDBM+6pLP2gSYGJPA4hIAyAUFApEeEEDDgWIagAkAZAkQGoAAMwB3BIALfX/ygEA+vFLIiC/ESCAJ29BvMDfcvx2AMSBdqWkAPmYXgJBCQlAO4ZO//Pkn36op//0Ff2GqQSA/e04lLHLcW3NiS76Tj83OeZl/hstAMfbcaYtnjgj9yEBkhDgv8OMGQgBwisBkG7JgCQE8nsBeUVAMoBNagJm57bAOZ+LrkftF/uJTrbvdurwPSJbZnNMWvPINnRlUW/T16L7zTpxmYPsI1S5BLizP0BCBAjm8RsznPwTlziQAaQH3AOI2Zh5/x8/rgEQB4OGAYZTbX783+kK+Cvw160kPu8VwX/K9K8EAG43vEpJcfY71QDGCReUkwY7oBypij7gno0vhAdgH6AOwOcbAPhhiEO/SALg95Knfmvff+Y/JC2PK5WQJqS9DiQAcxFQvetpfAXmpBfwsydlfklm4YYUEPgjh8oT+AO4sLfKWT9n9fm6tG7WQID95/7DV35QgL9NTrgGwDrTJAAA9q07+NWvdSef+bBei+t6O1t5vDd4X9AvlEc7OlPL67wu/tefkK/JrB6gr+1oW4n3wARpwG+4h0gAATiHt+Qp1sv1kPTiBvCEQB9/tIox2M3LcCT5CtJZC/lvb5UA0A2JQD4tIkA/JOXx3PaAvyOUka6lyNuCAPiGp3z7u1i46AzBvGDfAcHtKT+SQeUFzSAaF5CPwQ/wj8q/4J/BIA2TCz/AP+k0uL/nr73vIXWQbpFMlf/Nl/7XH4CgTrI2sjq6KacC1avmzjaknXZsc7fi7Nr+WsbU9KRjHBhjFgDksQ3lbCMB+HgIG9SLX3YvtAa+iJDVCExSrrp4TSOoEVxWSV+3jOCIl6NG4CH4rwSAINgT8bFrAIBtALgEgCC/RwMT/kgGkJ58APESAQJ6/NUUQEoaIPVPEsD0lQRIDQBP/737b1tpO8BfUwkA+86+tH/te8eljGOOcc6DLtpms+JcwW/Xn3lazjnAKQEAUDyUBOAbMZgkAniHjBEBhiXwb9klA1rfCzgCEWCf7drXu8annFvGxfmiLPOG+HvXjzmZpMCQtkASApz8A3CRGjamnPgD/vk4IP6AV9JBBAjKIAQAyPzYNwwRAAL+liQNe5UE/9oF/ri1t8C/m17fg8iWAZj7jqQ9GMA/PwA5xIaECO1kU8pVACRglPZCEAD+MfQPIL71DYAxEoBy0RqgTPqPcdp1cl2W+BBQQ0A8gXfLDjgHpGvUMFHrhL6tBq0M0kEUVHBvGeYL2KhxdPOcXJY+nFKPXdT/JQY++xlf96tb8mat2fzL0vwGwK4EwERAfkt5pINEmFoe8fjegOUxjqx7tKMz5H/ZfivWJ9cjTv8luQDZgGj28gB+QT/u9AMTDBEBagOA03Id1I4/6cGa5Ek+nvqD51gPiUNd9K9EgN99I45hgn/d1oM8yQ9DO3kGeV+wbiKTQHUdVV5rAuBrnvbM+/lYDqofdI5gXUDPBGGAdCMF/76smCAJ/Hkh68cAE588GHwGlrhD4B82tXnfvzv158v/9z7r/j4vQT8SwCn4d1IlwzQVvLbiUW/9045futNew0x/mWTWN+1Ddcw4aa/x7XfiMJ9cYNzgHEtSTiUBcH/F6zq2sbsKgCbAbU4C8BIaMgKClKsu/jkjKEgpYKhSIFqlQBUpeBUQSgAIcgW9pyQA2HRLAgjmkQL6CvgT/Kc900gitAgAT/9V+/ejfxAAttt+sF+Q9pV9aL/S346F41TG0TFuzYUuavO36wYm86a8FYb6UDfq6JhLAtDGbdoAqvQn2Bf8SwSgPaaBCMAu4J8iJQLYzGkkApCSAS2tgJk0ArLvmoMxg6dlOBf68WGMwhiGNH5nnefHPOivDnTq5gD5BP/a/Q4Ap/+QAQBbTr/ZH5DG/xBAOECYTRybOQAxYI0fmgAtgD/VT5Av+E8J6NedRECLDPA9OCR5L7KfYo8k+Gc9oU133vnYvv30AX2CwU6bMWoHeD2CjSv2XQgAiAH6nTqQjn6jHmsSgPG/Kr8b/FcDAbXge4oUoAP8mWMQLAJ9CBeNfkj8IEswEA4Ai1ZZmbfEQsbD7+5/8h0PfspzH3jgqnQ09eROf57+Y0+3oL/KLumK9AM/5ts5AmBXQO4HACcC8mOWx/p56X68dwXjSPAfBlAteEYCrtnLt4zEgAC8kgGkB4CD0SzL9Q83ax74QcyAXSIACaYjPtK8sm7EoWwk/spql0CgHrwfeDeoScYzznqZBKrAnzD8U/Vf+3XQkPoQ1Ccw/hsIQTwSoM8gAeIE//gn+GdwGEQmgsQBE8WBxY/BdYAZyBb4J382a0w+Fl6A/s/8k9/efPCv/5+23Qvtnte9uH/h8fLji+8AvDT48UJ84vOf80csqKiK8AEJQar10H0qSZ9YVtrx2+Y23RRZ85o7/yl1qHGoE3OIOeF8wX4Mw0lJ618EQgJ81U98d08CvOhpPzD1f9FeukX7wAq5iUNWk5v9VRd+ixFMCuIEmcoK9HULTJUCVqVAVinIFfQiAcKeiCNTA4CT87wKAMgGcAPABfI9EtjxD2kT0Gs3zyFJPEmCJAFSCwD1/22q/2MEgH1lH9q39Lnj4XjFWOYY5/h3UY7yyzIouycAnD/UlXrTBtTnGfddSADIAIkAwb9SAgDJe+WVj/qjB1tGQoAraK/4i39wzrzgk/+Ps1QjrWSARABSMiC1AthgYQ64GpD9d5QB6jLNMsbsxyrffFec2EoEKAH4bNZQ9cQAuHi/A4DRBmAfgCE+UgKAOGz0OMnmx3+GmQr4W/H2IQHYO1UiwM1vSwK8aYdXF6g3eyHIDAxt8rqD7YYYkBwgnA2rmgG7gv/UDKAu/DtC1lIIl6uiCcB6wn8zAGzvQgAIyCvoF+gL/JX6JwEAUOBkMUG99gT/pKEcyjQcSRwIgI9/z/s/sH4ufTYurWQtB9gn6KcNGEkAZSUAWBdHGsZatDcBwGl8JQAoj3djl28LkN9SHuv6LhoAWR7vgS3ljTT9NEGst4JyJBiw1wJYg23AtIY9vWBfyb4egxtDHONXCQAHqLPnt0zWQOxI8klsRnoBP+nED8TT3zi4qzGsSrUBeNZ4rwjwbzsCAOb99S/7hbNXPfM1/SAwMAJ4SQAHCjeDo78DRXyAez3J91/51S/6G7fljx+Dwxf9Af+oUwH2n/Oqv/+gp7p+fRH5sB9+2MakP/abb/u4s4/6zU89+4zf+5s9GAQQfs47n9SfBHMXnIUXUoB22BYmVgWul8kNMWJ9al0zzDiHyiwj7TXfsTDjZh9DADHXeOiPQQCQ50ICNF8gY5v7BIarLvU5I5AUuAkwBfhKQahScNqSAtiUAn+BoASAp+ASAKrI+58AKgEA0JYAAIwD1NlM7/ozXQJ98tA/88s42CUBJABSA2Aq+N9GANiv9LdjwNg4XmUcHePWPOiiHu2X5fUkQFfSOU0A6i8JAGDmFH2qJkCSAJABEAAJ/qu9RQK0/CADIADSTCEDWkRAagXQTp8PxmxgvC5qrI42CaZmzNzlZCUJAIAtABjADzDllFp1eMExGgCQAhIAgH/Asifp7HVawH4XP64EeNpfpaf/EgUV+LuXcsNbCQDaRRhrl+sKbQHo235BP+2SCLD9hNF+3n2kA6gC4Mk3gT3l4t4miWNavrcEKTHx6+1Th3r2eKwd7O32Bf79qWAHCgT39CGn+swhyCfBf5XEYb8K+Kf81r8TxB9DGeQP4MBdCQDcEACsGbN30BEypJ4SAEiA/1f94L/spf5DBAAYZKRKG0DOuAKo99UAAMiTnrWX9aUrk/W1/jblAdyJTzpI3ylXAJJwaJRH3pfuVwkA1yjANoCa9x0Amj1+yyQRIAmA9ESetGkE6VUbwHJJK1YQOwjgSUs69vdgiPQ3X/2U+lepNgCHw6yVkgCQcp78Kw3z1D8l/XfpBnVKhQT/qNLT+Qy44N9/0YcfLwDU8QX+AHgNoL8Cf8OGZH7oL+OQD2GoTwH6AfwV1Fc3oF4/7Smxp4EMSAMhwInwE7/7df1HgpgkdfI5CausoDfdaTfdMQC6eQ/JVj2G4uK/a/yxvMbC6GPKOjYRwGaI8U/tEOyMuYaPQ015Xq5JHF9CyDSCDeWqC++NQFK5DfgLSFMmwE97gn3tAn6lwD9P/wX/UzUADiEA3IjvIiUCKFcSgKsDbOw5TZv64b8K/u0j+7ACyQlg0vHNsW/Zu+Hv5wdyjl8tg3qsMMwr5hR1rySAm74WEcC/B8R4HSBJgDECoAJ9wD1+yhpuWJIAz/uI90zSCthGBLDJ3IMIYDzoz2v/48RZEoB9CAY3wB+tANZ3QK9AGHIAkwQA4Biwxo9T7F3A/ljcCv51t0gA/dzkKvGXBKdt+OfJPwQGbUTSDlXzkZId+FcyAAIAP/4zAOvPGAmQxEC1SxDY93xHgT5Etf4yTj72tADqqeBfQM6mX1AOMFeVH8BPexkTvjT+//yF72gSAMRnjpEfe+UE9NqpE+GbaxodCUCZjG2rvv/jD/7bM0zXz5f+WedjfvX0/2lv+ZmeANBfWTUARj4E6DvjnAbALifyLUDOersmAFr9it8t5U0lAPgAoRoAV4UAgGh1PaoSEC9wxs6eHSPQ111lhgvEkRrylFhgjaFcJXbya+GHHp+ttQjADpUEyLKIW922JSWELmVzyAzg53nMawCAf64JDF0B2EJgXcZl8kM+hEpz35+TdjseUAYBYMe/+jE/0X899r5vur+/O5lg/VB7kgDYAf+oYQLOONUX1LdkAnzDh8gC4gLyJQGwVyMhkGQAqoJMHvpiaDLaT/vKMUIgw45V/r71Nl2rXumXdtNUeWwigLl9552PHSQB+B4ARAD9fTmf1Flr5Qu1JQWGylVXcm8q8G8RAAK3MdAveE0pyE+ZgD9Bvyf/SAkATv9TA8CP6QGwe7XVDnCrht86sd8F1E+NazlqALABF/xDAFTw793//PhftpU+oH/styHw77g4Xo7fWjquytYcGPLrsthsQolzyC/LoC4rTJIALSJgSBugkgCq8tcT/+oeA/lsGhPsb7OrEeDGj80ip1QYNoGaSgakRgBEgGSOJA7jud6o9n3U9VNr7Drv6/ujXwD8GkAv4F8CAPDv6TcSsEwYp+Vs5DAAYb4ZABjGjIH6XcME/VUK+PHXrqybbN5Rgn9P/lkzaAPvLtqABPRjIDggP+gL/ZIMkBAhHQCWH8DdMoZO/rNe1EkyQDvpMXwckNPwbtatLtPM4ySu9VE9AXhKgDgHTRBFCfwB8QJ+QD92DP04BP5JQ7iq/4D5evov+Lc8yrRc5ib1yfoRH/CPFsAnPfUb/+Fl6udWXbz/L8jnQE0NAK8BGIZMEmBEo8R3xQaQs4buogEgAeBazJrLXqVrw6ozrXcZfpvy9tUAsDzSbymvK+5if0MaAIJy9vGCdezVAPbxq1I//JNIkARAmi8HzawzrkEA+6GDWEE9IF5SAlyRoH7MThq0CFpGAkCNAJ5R/HgeIfby5F87c+piR3DH0u98zOO+kVP/+//pL/cn+74Y6HT+pR5h/Zf2u6/so/bVUtXflQAQ8CtJj13wjwTMt8C/gH8I5EsCDEnBf8pKAuiWDEDix1UBJkwFrlPdPART4+4abyjvIf9d8q95VPcueRF3W/pjEgEsLB/9rNWDjD9zKI0fBeRldUX/9+6OT38f3RdrlQKMVRdrYwSUAkwASpoK/gWoSEGrMoG+9gr4t4H+BP+AZlX/8/7/RRIAbLgF/5APmKr6T/2G7v4L/u2XCv4lWeh3jGPh+DheBTw6no5xlXUudFNgs0HKsPTHvusv88JuPUa/C4AmQNUGqP8qUE0ASQA//Cf4B/Rjb4F/Nor4p8ReDWQAfkkKGKdFBLTIgCEigPa1iADHs+urVfRX7ccu6Hr+APQQAIJ/JWA/wb9aAITjrxYAQJowgBy/b3nOD52UBBD4K9nkYnezy/6LzSiEJfUD/FNfgDwgHrAP0Jf0uLMjAwi3vRAC9A/5IPHnRJu0GL9/4LcALBeAj92Nt+4arj+SMjCQAKxDl2XGcYo5Bfyzkfc/AnCyp5o/EhAP6E/gz5wZO/kH/Kv6T/nmnWAeOwCfsgH7GAkAJWE1jQTA+lsAq8vS1416rFLNH4DPfioJgCQBEvxrb+SJl2tcD8hd//clAFh3yYP3ZZc37x3yrz/8ZiEASnmrLt9WebX8k7s5DPaZb0nWBwG8WIj9vIAf+5ghnnEB5rwnIVqxSwJIBKDaz1pHmdswhkQAUoyhXxIA+An6wbgCf/wI4yrAyz/x3f1/qcPNBxDRBuDUn+sBxKd9pBX0p7xM6+CUybPi5B9gj6GxfPCBbwDop4QE2BXoZ3yIgzGTBAALYAX/An+JAe/7J9BPUJ/ADrvpSce3ADAZX7vgv0rJgDmIgG2TeWo4E7EVd8jfuNvCjTdF1ryqe0oeQ3EkAmQEWQhYFA415FPnB+78zwB8FHDN1k55jq5qHF+qVQrElKuugb0RgCAFmYJOQaigdAj8C/aRAlulgDelIF/pl/Hrif8Y+GdDzcm7GgBsrk/xA/wnAeDp/y6q//ZNBf/0r31t3zsWjg0yx8xxLNJxrrLOC91d8s2GDPuhP/NVUo8Vxnlmu2gnbQYcs4FLbYApJIDAP4mAFgkgASCg31cmEYAdEmAXIoB2DhEB9lEn6S/7rrNezs0lFTv057cABP5KCQDBsIAYoAxIlgAABEMIANb4AfR2PenfFn/KdwEkAJRstgHTbCwBmmgnUDdJDYgLwH2e+uPGeMpv20lDfxAXwoDTaNpNPNuNdkHd4PNe1C/t+qUkHEOdkZfl5EvwXwF0dQPOAeJs7OkTwT8Anv6vwB8/Tv3HTv4lAJhr3P1vAXn8KLcF/NUCgLAxrTIJgBs/93OX9t8wAiCTAPD+/xABUDUASMs7q7FOuL4NEgCs0ajdY9Kefq69AvJ1Wa6ftVjKHCQAahktN2s+JIXlBeFQy7oUbt6t+Zy37DzvAmdAMoZ9v8B+SBonSQDS0kdJAkgMINn7s45R3pAWQOIH8iMdgF4sIri3zkri9mAfwN8Z0hFGmbTbdJB5aAWbDn/W1wT+2DlYXI/vpRjLrZVAnZ+P62EA+nz5H6mbj+QA/InHFYAE9GP2BPqcvADuOYkxjd8P8HRGSTriA8YlAATmAja+6M/X/FkYUc3H3PPwH+jrRx0x5p8Sf+53E5+TfMCexABlJClQwX+6KxEAK5QTcKrdyTkUf1v4ULrL5j9XO1g0KhGAe18yAKKLcXdeKf0WANoAt8FVAF+qVVYguOoWk40RUAoyE5wJRAWmkgCc+gPYhsB/An7sgn1lC+zXE/966p8n/wBvDCdqAPJTgH/KmAr+Vf2X3KDd9EOC/zECgP6m7x0LpWOEdNyUOaZrex13N0Z1fujukp0Dnrj3/Zmn0rqsugzPEQEtEgD1Sr8NIBHAlYCqCcC7Zgjwpz+bOcxcRAB5JRkwlQigXTw3GIgAny/G1zGlfzpjf9l/yGv3o82AeoC/4B+3BADgVyCMBAADkiUAlAA+rwFA9m4D9fuE16sAugX9Sjabgn/U6VmjAKKCfyRt5UTf9gj+kbRdwsP2QxgA+Nk8E0a7CcOfdvNDw5NyeYfmRp8Nfrq32cnjEnz86gZae2zWK9hPN/tGwD8gmzmQ4N9Tf8B+NVPBP/+ZijpUNX7r0J/+r68a9Cf+HQEh8FcDACnwN10SAJf5KsAnfu0n/1iq90MAcP8fAoCrALg1Gc/TfyRrXWPhcl3bEACAasA1a6nrtWBfiX/aiet9fNZT3oVdWaydrR9lNgkAtb/MW9kqTwKA8li/ujyHymvV4eR+fGtl7JlnHWJdIQ6EJcC5kgDs+zGSAbr50LpgWiIAQO27kbwwrLf6UQZr1BQCAPwjCYDETTmAd+qAnx/8o9wE/KxjtMt19uEPf0QfTn2ogwRAC/xfOQLgG57y7e8S7Av4lZ76QwBMAf8CfsA7IB+wDSh3sBlwB5uOTKM/cRgs0gjMAfqCfIG9JIIfHByT1ItwZcbFj81dTwx0GwAWWogBwH6C/AT/1W48yATq6Yl1C4Qz+Vr+6TcWJ8PSbvqWn2HIbeEZd8w+Vz5ZxpQ8ffhdDBL470sE8CAPkQB8D+DVb/rRfq6efAU+TYG+UFtSMKFcdVXqjeARycsMI9hEClAqAZBXACQBBLfIJAAE/cgW8AcsC/bznr/36RP4c9KFyr3g/5QEQAX/1IOT/7HTf9tuf9hH9pnXJ5CSK/a1JIBjkOPiWClzHB3bkI57ytY80a9LOtups3kqrcPgtQAB8hAJcM9ffvs7IQIkmsdIADZwLSLADWZKNn254ctNYMardjc2SIkAJBtFTH4ngDZpJAEcZ8aX8VxvYlfdGNhX9h3jcu1+bFAFxIB/DMBY8JsEACCYcIAvIBjgh+Eup+rwAGL2PLzD9wH6Y2m89y/41y34Z9OJ4b3myTPAlHrTHqREB+8rCQBk2m07UqPWAO2n7fQL+QF0+UE28B5lD9YC/S2/FjCg/hd9ZY7yh0C3IBrgj9nl1J8x2ab2D4ng6T9XCcY+/IcmRj39TyJCEgCtDUkA5J3f9f/6AMA/zWX8HgAHdAnsAf0SAAD/JAEyXhIAA2RSv6ax1rHusRayLrJeso4KyF2PXXNzTXa9lQBgHV2vneTd+uG/lQDIMn0nWP4A4TBUXqsOJ/dTy4pnPdcA7KwX7LdZrwzDPkYCsL9njUHe/4P3nz3QXScH5wnKCcMu6EeaHxJDmVNwQuIKwT4HwS/60Pt6/KUfkva5/gL8WV99T7Be8vFUwikbDQHqyCk/Wuf19F8CYD2fTj5mOxX4BXd/4fdU8C/oV/JNAE7/+QaAoDuloJ/NlIAfEJ9g30FnUABwGj4umAZ/BsTB80QfwJ5ljtnRMiDcqwRTpBs924KkPZwI7EoE9B+Q61hO6k47dp2stn0OeRFl1zKre452kQdzhbwrEbAvCXDnnbd+FDCvArApvJJf9ty+IvQv1C5alYKIlKsuXm9Y4DSCyQSagk9BqSC1RQAAagW4Al6kILiC/wr8E/AL+gHXgP4E/qr9A8hPefoP2YDx3r8EAHWVuPDkH20G22v77RP7qEUCJBFAH9vvjoPSMXLMBI6O5frFtRlnx7uTOQ+w1/mS7i54tl/max1WXe6j2gCSAJwOpSZAJQFc+4ekG7iWzE1etbvhbMlWXi0yoEUE0B7ahqq1RABjy7g6lvRNZxyjzjobKUNel+ZHmwG1AGOMp+GCZgGwkrjYAf0AK4wbPU7akwgAFLPveeU9bz2bSzPAKwGAfokA7Gwu2YTyjmG9Apiz8aQdgHXeTbQNoC/4F/grbTvtI41tTjd9RF60mbwBoP7YiPPuZK/G5l6A7+ZeqX9L0g5A70VNEADLGPj31B+ZYDvV/Vsq/9vAP2BG8C8BALnUqgtl4z8E/klP3SQAiEcayAskwDnBv/bLRAJwwp2gXsAvASD4VxJu/CQABv6rRP8+4D3F888amBoAEgB13WXNdY2WAHAtZf3s5uyqM+Td+uE/SgBk/q7vlkedkgCYQDi06nBKv5uMIQQra4J7aoAvp+UYcBqAnFN07K4PxNGP/bnYD3u6OVBG05xnh7XHeEiM+SPFheTLfp/64LcLliAtB9MAeLFDjyM6f9Zl1jPWRNZdyDnWSU7+JV0hAfCT5PDjf5UEgBhgHTrlYO1dFi84Tvs1Cfq1E4eBStAtUIZREegC+BlgOtV/G5hpAOKmmyIZLDUJMp9qr4CfcEF/2vUbk3UTSD17v24TgEq4J/1VA6C6iQcRwMZhl4lq/7Um9r5h5jWW3jiXTU6tMwuGi5TMZLrx22ZYwFT/T8m4S+qwuO39sF3ehL70+hdrV02lYCvlqgvfnMDyEk4gyQtZI+AUiEoA8ML29Fogu40AAAir5j90v78F/NlMq/J/EeBfokENAOtCvVqn/5UEqAQARIAkADL7zz4dIgIYB8fEMVI6hjORAMeY6c5JpXNyMx9pA+2hnf3mpZtngGTA8jYSIDUB2Lyx5iPdTOp2Y1elG73cdBIn3UP2mhduyYCqFZAaAW5eaSPtdXwHSAD67Vr+2GwB7FHXRKoKD/BlQ6fBDVgmDsAfEgAgjD8bO099AF8AcAwkAM8pEgNQZMPKnoh3+1RNATaYagdIArDhBDBj2FSSLwQE/zOeeqm9IMCnfgn+tSuJRztoTxrJACRx6R/bTTzALT8k70g297x3eX8K8iEpsCv1r9K2MAdPPdn4t3EtwO2pP2Gc+jP2gmwk49r6yB/9oWEuTFH9F/yj/j9UF+oAwADgC/QlI0ivkQBAAkoA/xIBqNGjCYDxSgDyU577wANdv69O3fe1PD4oLqBHVgJAd0rjJwEw8p8AbiYBMKQB0Fpb8WNdh1xlDWX95L2x7rehdRL/QQLA98RYeUkATCAcapce1U1f0g9oXLCess9lDRCEA55xC35xeyLfA/S12zWDvTSG+GAK0moE+qyh+AH+WfuIRxhlIzGWj0w75ZB2F7xCfHApmPIVf/EP+vpbju9b1j7WUd8lXA9mjeR55Rlk3WSNY917+Yf9Yp8HWMFTf8A/Zj2XjjpmB2feUv0X9KdM1X9O4ulATvo94WcQALmQAQBu1esBzwnWK1AfA+KE8XGmMQLA/AT5ym35bguvJADuKURAJQckAQCQkiStCTs0kYf8W3lUv21pa3h11/zmch+zHPJmwWFxwGhnUzPV1O8B8GDzgPtfAdjwXRl2b/oKIaiqUpCFXKVJoCh4FIDxMhVoCv6REgAtDYAEtZ52Vw2AqQQA4Bqjur/AX5X/U578s7EW/FMPCABP/ysBUL/+ryaAJAAy+yb7bA4iIMfR8c0xX9tzTmCvc0Z3F3SUn/krrc8t2gBjJABaABrAv8a1nw2dZmhTV/2TBCBsCPCP+dc83Zh4YsUmcuhqQGoDMJaMYTcCdYyOMigXmSlt9aRGLQA2cQL/Kj0pF2CzwRMkExeQjGTTB1hETRxQDviXCODZHSIG+G8CkgNDBAEkgOYlT/3WzXUgSQk2m9SLutKWBPnalYTbXtthm2xj+pOn4bQztQAolw0um23fp4J8wH8a/VOSlncv6/0p5wTgX3As4E8JGMekyj9AG4A/dOIv+EdOVf2XAED9v0UA4AcBkKf/LfBfSQDik9Y2VkkY3xvQrAHmKYfgXFmf/Yyv+9U81ccOaZEaAJz+tzQAIAIkAcjnXMYPOVj7Wdd6QK4GAOQo6+MUMM56KgFAetaQdZ4PlXDrX8pcEY/3CoRDljelTOq2A+Fwaw1m9KEdPKPsZdknA7rzVF9wnxLQTzwM/qwRpNHgVouIj8gDlpnrxGctqQYCAAxJOAfMpMWPf0FvOaQh3zTWg3WmHq4SP7FKKxw/CX/yggSgDyiDecG6LEmKFg9rJ6f/vFsgBpCsvXzck/TgXq67bEiAh+bSjKN1nKxu0Nme/CsF/rixE0fVf4B9Av8K+hPsp12gLvCeCtTv//L3foCByrzSXvNtuS1zFwk75ATB7qYQ+a0P+0+DGgGcEntdIDUCJALYDNQJmZN1V3ud7Lumvy7x7VMWDR5kjUQAcioBQLw7u1OU+j0ArwJA5rBgHOeRvLBcebnxQ2oEVilXXXhvBIi8SDQAf00lAAT/eUqdoFUwmwBX4Ks6vATAkPo/G/LLBv6HCICqAVCvAlRNAPrA/hgiArI/sdvX9j1SQsbxcbyQjiPS8V2DyM24d+Of80G7cyZlF/WovyzLeqy6EnsigPbQRtrLhi01AdQGkABASgC47rvmV0Decgv8Bf3KMaA/JSzLmkoETCABjjooF5W5WgBsziQBWMcF/9h1A37RAiAe4QmStROHsEzDhhaADCkAwOOUl5MriIGf/Kmf2pADkgQpCee+q9oDHKpAKhAHgIk/eXvSRLlsNtmIJtDXXiXxqbPGdiAJQxKGlFBoaQEAhimXd6kbe+yC/CQAUhtAO/dnsTMPTzUXOLUUECfo1y5wFlSr4bHt1F8CwNN/0ysZs5YdP4BDq04AIsY5T/fNoyXVECB+JQFsH1ICAFCiGbg/f4phucE+SQIAiQHsJwGgn+HIBP+SAF2FWevz59q/IQDUAJAAGAPkhEkAkI73A++8rgDeI0M/yryFAODdQX68L3K9Tjth4IgkHHg/dflRXm3bUPl7+1OWp/t8HwPQzbMtyO6B+/oEPwG/IJ9w1wLTkQcfPccwzyExnY/YX/r19/Vu1krmJmUNEQDsp8GZEAAYsSd2wsApWRfJAPb15On+XzwjLrJMwjOO4bzrOWR+3ke8p8+H/AD/jB3zg+fI9wQEs+uo343BfccdD5GlEAGc/DOX9h6oUyZsnf5LAighAGBm6ChYDjqYgUeNAiAOIVBP+ROgY09QrnsKGOfkv0UAtPLbJd8pZRPHDWDdEOJPeBIBgn429fQPJ8aA/koC4AeQZAI7WadIJ+yUuK041Knlv6ufD5GylZ66VuNCozy0PZZrObixk7/gv8qdSYBuDPMaAHavAnC6c9EfOpp5rfCFmlJQpVx1ZW6MADFBIy8agZfgCwCWAJSNocBUwDoG/gG7gF/BPxJw7L15gLOmRQB4997TfwD5KX9eAbAeagBIAFBn62+bJDhsswTILgSAfZx9L/hHVgIgx9GxVca4OxdS5pxxM6Pskh71V8u2Xue0ASQBmHts+DCSAGzKWkSA6z8yN3NjdokAwT1xtR8qs1zJADa7GDUCaJPto620m+cxSBz766iDchGZ00bBf57SsElrGcA9QNgTduIIngXKCaKxkwbgjZE4AESnpgCkAMAesyEHIAjWJkkB7Phz6i/wJz/qJPgXrAv4dSuti3XLdtT6G2bbDccfQsP/hID/Hd3GVg0FNv3YBfnIIQNRQNipvpVDOS2gLRhJ8A+YxtDvU079PfmHAGiB85Yf40kZrTpRF8zU03/zT7JAEsD2KSEWPP2XAECu9ymrUz6TrDschqnSL8BXA8CTf6XhEgCVBFiD82yC69iGAGDt80TeQ7tcM9NOOGs+8Vkvqe96jRx7bxF2k7qkBgBrr+UNkQ68QyoBsG4T76s5fzd4rwP20YhJsM8zDO6oAF9AjzQMu0agL6hHg8Y1jvUNUhMDwcma94p7XrshAiABcJOmkgDkC+hHAvLJC8DPvp29PLgT/ImdcOsu+FcLgAO7ITxCXlxDkCgQN4gXkBxoQwIwdrSZ/EjnO5a1jPcBoF9tANZc3jWs0ayT2CUoGnN1zvGdJy82BXSuQL8l//Vb390PAKf/fDWRgaCjAdsAf+QUk4B9Kvg2XosAEOwrjXssmRvBJAN4oJk4ECBMmDe+8/t7TQkmTIsAkAyYQxuAscjJvKu9pq/uofyIJ4hX0vZTmkPK3YUE4CpAEgCo96gFwMuNhat7GlfzPJEXnosv1JSCKSVt7Y3AEMmCp5lCAAhMBf/IFgGg+r/gVzA8RAAApDWo2Ff1f4H4KcG/ZQn+vQIACSABIPhHJgFge23/PuCfvpYAYJOjEfwjHTMk45hju94Ubca9G3/ngjLnS7V30U/2y7Kt2yQSgE0gppIAbupc/3MDqX0I8BN+KOAfS2/5blKGiIAGCUDf2FcnG5xTFcSJp+A/vwUAwB0yCawB1QmsTQNg1rAZFPQD2rGnwS8Np71pOBHDAPoB3dgF/5RB/cfAf60f9dfUMIkM2iHYpwz86R/SUXfjAXgBsGzY2QhLAKTkw4WC/BYJoKYAAOTY4w7QaQFtQTGgAztAWvBPG6eCf4A/hj4RjG+T9p9lWxckHw3L03/qtC0/6z5GAtAHgn8kwJ+ykghYEzI8+0f/8TFCDksqAQDg918ACv6VkgCm8fQf2ThVdQ3bEAAAedfxXLtZK5PEFYwnAcB7sOuUVWfG+oewngDgPSqJLIGc7wk1ApSEUR5xSTdR46ArbvuPdzRjK9gXKAvmUwqeUxLO9WRO8gX7AHfWAElMAL7EpZpMAn+Au4b4kAM555mbGNY4cALYQrwBAYAdIwEA2HeP77UA/IhT603d3dOTL/jUvHGTj98iQGaY9cBPEoBxIk/WPvLl/Yp2AP3CGsq6jIYThvWTtZTnmTWUMOq3xgXbB+4iY3D6D+hnEwrQHzJsqPn/sBAAAO59gb9gXTkVrEMA5DcASFfzqO6peU+Nx6RI4O+DjoQAgLViwjBJmTQsvID8qgEgAaC2AOH8q8Eh9ooJetGGh4OHqAJ82ln9rorbBYMx22Z46OtVALUAeHHR5ot8jmcs2xdqSoGUctWV15sEiYJ/ZIJJQaagUyDa0gBIEgAywGsAgl5BsKA4NQAAzYJo1ivWNAwgG8Dt/f+LIgAs17pUDQDrnuB/TP3fvkFKnCAlVCRYEvzT946D45Jj5RjmuDrWIZ0Hypwrae+SjG6kCD/WL+tBPVcY2kV7aTubr6oJIAngZk4ygI1k3UwK7gXhkgD6C9x1K/WfU1qHJAJoA+1RGwCQRJtpP/3Q9Qf9Yj911uv182RGbQCBLmBXQI/ULSAGBGvwM24F1/ojjQ+4FvQL9nUjkyBo2cnHU3+JCzUTJCUS3FMn3MTVDMXPelIObtKzYSUt9aH+hEFICJQBsID9BP/a/feF+V8Mkgy44447ztZfb2euHeXHnN4G/iFXBNDIXcC/p/9D4B/AInhPO/Ehd2rdOKHHePo/Bfzz0UHLIL7XAJSSDMgkABL8px1CYE0EHGVMzJT3NvskwDuAXnDfIgAI6/dS62sCLQKANcy819L1q0kAuF8HgCcId+9OOGs8ayR5z0EAWKZlpLQ81uUdNA5Kk291Um8AJ8CzAn3dnJRjcBMPsP+iv/PG/rCSa0iAcME8zz+mBfYF+VUC+tNAAEAeQCI4552nzEXwBLgC3JQEAHbu/iMJIw52MBDYCoPddtAW28WeHuKxz7cjAcRNEgDs8yEAzKNiLtLRL+A5xo0yyBNDOZAArG+smayTrPGsLUjWTtZU1jzi8C6+9NrBnOrTuZAAaAIMGeLAjgCypxpBusBcORVwG4+T9UoAWAfLMO6xpQ+zD7mbQiYMINDJgmTSwYAJ9BP4p12SgIXSCTsmmaRD4WNhQ2mG/MkrQT9tuirgfpd6bgP/hvNxjyESgG86nOKFeuvSP7uPL9SUAj3lqit1YwSLgkelwFKgKfBESgIkSBW4JgmQIDdJAAkAtQAkAgTRagBIAEgCXJT6PxoAEACUX0//qSP1te5ISIBt6v/ZNxIA9mH2q33dAv+MjePkuCEd0zVQ3Ix1N+7OAWXOk7R3US8M/FO2P+tkfTfaALSduQiAYPPnSY4qpEMkgBtJQbfAXimwr279jymt0xgRMEAC2F/XRjKmbNQwkgCCY4GzoJ6NGxs6jCC42g1HQgxozKNK8jROpjEfytEQFxDOiRL1tZ6CftwayiE+YbaNtIYraTN280BmncgHP+JQLvWCBFAKApAC/pYcIwHuuOOO/ooca8yRJtYNQUWeNmo3TDIDUD4Z/EMgd1oCU+79C86rpB6VAAD8QAYB3lvgP0mEmp9uSQC1AbwOINCSBPDkP8F/2gEokKBHGpsP6TUku6uuEACCf4H+kAaAJECLABjYY7HGNwkAwL17dffuKQXkrPn0w3qe8q4gz6EfYRsNANYZ0vu+mFKeBADvoC6vVWfGyuuCx3/kw1gK9gXFfJ0eO6f6jAHzAnAN3uMEX80WJX4YgD9kQJ78426B/uqnm/hqCaD+n88BKvTs0cEYgHziYseANTnxR2LEpIYraZftTUm+kADgFQA+8fAD+EsAkAe4h/5AJhFAGG7GEVzHu5S8SMvVANz0J2sl6zsfBeS7AID+FlG6JgGYU5frx0aADm6p/acfg9gC/1O1AOYA6ZUAGAL6kAVDYXP55wICAcAkoX+YIAk8nTRMQBY7gX6C/7SrKcDkygk5BNCP5c8DkO24HeyM3TbDApJXAbBzFYCXHOQNrGL3hF++B323ZYcXUTWCp5SrLt7GCBgTRAoskbygBFxJAABKW5oAAlpkAl1IgDEtAEF0SwNA8A8QVyX/VFLw3yIAJCus+ykJAMcoxy0JgBzjzp7jr73OFTcy+nfJLvxnXZDUe0MC0H5JgCnaALz8PU1CCrgT7KddsN/yM2xuaZ3GSADazDjTF+s+cdw65/X5ARgE/56QC5YTsLORawFzAboSAK3d+Ej8dAv6iZsgG6BN2dZHciIl4QJ10wrSBfZI8lAFlfT8j24N8TWm0Y3MfHWTB/bUAuBUC/DPKR6niy3wz78zxF8NgJRsiCUAmG/HmFVf/GVPfLtgv0oBh+AfkDNV5R/gL/gn3dDpv4C8SuJzAmodrBuEBAAcwN4C/5nPNiJAEkBNAkkAwT+SshLwa1dKEKz/m9FqzjFizFv3/wH4LQ0A/SUKJACQgFfMwHUS1q6eAADTQOQCsNXeGgLkgn+A+47q+P17hD0PbZQAsEzy3VbmjhoHk4eFq08CY3CEh1Y33/ZxZxoOsV71lldvcB/ge8x4qi+w3yYzL+LiRvIMMP95JtCMwa4WAKTEq57ZfRh9rQ0ALsWPPTV2DqqxC/6xA8YT+GtHG4Aw9utgMHCSGgCSAPjxfHighzsxlwQB4ygJAA4CI9C/kgJDoJ/yeMZYN0kzQFxNHtejRPx7n/f8t8KupNp/An/shFUCQODvBwA9jW/JBP9qACh3AeQMAiRAltFKzwcKW/5jfoD4sfBWWJIA1C0/GiFghoXCzkcCISZeec9bJ2sD8LDkhBwC+07UofBd/fPE33bcLnIbAUA4mzoXDckArwKw4F56lZ/tKwkvt5YR8KVcdXE35hASwBNrT7BbWgCpAQAJoBbA2Om/9/8B3hIApwL9WY4EgKf/Xk9onfxPvQJAf0iOJGFiH9qnyDz9Z9MiISMBgJQEcByROb5re44/9tZc0a8LvjQ/64S0Df2XnGk7/cHmERJgSBuAjaJ37JMIEHBXkF/dcwP9ofyyPtglAqg/m1RPu2jzeowdx0szWHNWhPEV/Au+kYBjSQDWdYG8AB8/7LvKJAMkBZSSA8gE4tZDIgJJuRmHNgDUBf7IHvSXE1yebwAd7RP4t4gAwT/l+K8TkwDArhYAaq4SAIL+Kt0MJwlwxx0PaQDwbM05puTF1QKBdZUCb8H/2Mf+erJ4DfgF/vgB/PmXf8gE5tUOuNFPOwQAxIkaCNYPUEC/5un/ruSCZSUBIAlAvpQpsJcEwF1Bf3UTBwDJGjjHWLXu/3u6L9gfkkkCCP6R6+sktXqs6ZMIAPbq7t0lADyN57lZr4fkN/br3yHEZQ0dIwAozzIp702f98vv8soB/cza1BU06/pLvT73SY//JQD/R/3mp/bA/2E//LCzati/Au7BeZ7UJ3jXThhkFh//ww838xxjnCqJoyFMEo31xI/oMU8B6IJ6wT91ApdCAIA9APuCfwA1xjSSHYD/tHvdATzjQSz7dwkAsBXkiBoz9EXFW2IrvwsA4U9+5ENZrn+si/iTF+sObaQNtJ91BP8L/C8cw/NYVRA2o0kCaJcAYDAA1oJvgD8DQ0dglxAwvEoANH4tID3Vz/8EMJbXyz/x3f0gIk+hCUBdWEx4sCtIZqIxaXvg38Uhnvb+TtTItwHUFOB0eVcAf0j86wT+920Lc3qbEfgr/SAg48o8GH7irkQIL7eWETSlXHVxN4YXTxoAJS84jaATycsWo3p6glUBbOv0Xw2ACv5b9/8F/979lwA4tQYA5WHy7n9V+xf0p+p/3v+nvWo+ICVDJACQkgD2H9J+tZ/tdyTj4NggJxAAOfba61zppkQ/f1Jiv0w/60wbdtYGSBKgRQQMAfNT+VcCQBIg/0uAJ16MO33QGfuks16/H3MbsFxP4HFX8C0BUOUQEbALSWCeEgJDUqJAAkDwn9oC2zaVPN+VCJAQSPBPuzDkjUwSILUAILjd9CKrPYG/9jvWBMBcoNKZyYmaoLolISwE2YL6KTLJAMF/3r8X4APC0y4oVwLqPeW0fgAeQDd96uk/wCgJhrE8a1glACABJAK4YpAkAERAkgCC/ypNM8d48Z7q97odcOcUX1AP6N+m/k/clgbA3U94wpudAyFZu84RAC/99P/5takBwB6dPXgF5MQhLiCe54V8OkN+Yz/Cb0oA0FeQqlUDAMxieUgJB8pz/WVdIq+xwvYNY334+Nd9TE8AcGgFAaBMMoD9KxgPvFeBPG6ALAQahBZzmXmI27lbpXkQj9N7vi+gQbWfb8kB4gXm7JnBLQBuSACJAOrEPh5DGM/Pc1719x8EUOOWFPDkPyUEACCdtOznOYwFk2HUCpBMIB1kAOseJIDA3zrhBv8yf3jfkyd5IAH8rDX2CesHfUOf2Xf4Uff1u3bf4Zw/HYPBoO9CADCp6Tg6lU6gw8YIgATsh5AAEgDIJA0A+7iV2tOd8bHvc+Jf89Dtg80kpj+UTBoBv98JYAJpWAQF+nkNIO1eCWAiHwLsp6SlvtR9V2ObTVfd+l8lydweM2yShrQAWBBo66VU+Zm2hAgEWlLQl3LVZbsxEgCCSSQLnybBf4sAELwKZgW4At568j92+u+9fwkAgTgn86ckASwXAoI6efqvyr/gv975T9Av8WE/IO0bpX2GtB8lANQCSE0AxgLj2OSYOY7IHN/OnmOPvTVP8OOnfMh1ef5mnWnDORKAPtlVG0AiIMH3qQB/LSfrkHbqCAngiRcbV9pK+ztjn3TW6/sDEAOmBdSconM6zppezRiwHwsjn6HwsTDTpBaABIAn/0jqzto5dZRss+BfzQDytiyICPzJOwkA6uR/KQBQt4A/J2D6C/yVd3QEACATgDW1vtvisU4Jqluyv7awvl8/BPoT6LfiAGoA/gnOBfdTJXVTEwE7wAUgTj+SB3lTdksDoIL9LNMw8hH0V0kYRIOAnjGQBEg/7UjJAOzMmW3jMBbOewP1f4E8kj2vcujkX3/imTY1ADjZ7sqt7xXcvTaXVwC8k8+JO8C7BcYJ+547H/hxNaJ4D5JPI//O69yvXytpI+sn6yiAXtKhVSblVwKAZ3j9fuUddJQfZfBfqwD8aARIAlQiADen/OBBASzzUyArmEVNHyJQQP+dL3pLr57/Lc/5of6DgnxUkI/oacAu1QjU0ZoWoLPfFnjjh51nFBIAO2Af3OmpPXb9keaZwF8sQjnUgX05RABlgVt5HsmHMNY58safg3FICPIVO1kG71DKIi+Av+tI9pMECJJnlTD2fF/5lCf/ejfIde4eZdy3ZsqkhQDwtH9IOghqADCR6Rw6144cIgAAyYeAfkE2AJpy/Q7AP179Xg/4x0A+YWPh5q0EmGvfVVIvHm4mBX3CpIEYEOwjCU93Tw5MvBIAKcBH5pyMx5A8dNT/shof5n3rt2v7nN+MZ8t4+q9MLQDK4r9lME67bNS2PrSnidC/3LqiWrKCvx48dXFXGl5oGgGlAJOXJYY+0XgyLVAVuApmAbcJeiUABMuCZ8A0a1W/IPPxps4AtjGq/ysF5C2Zavtz2SmHslP9vwX+1WqgjZpsu0A/pf2U0j5E2q8tAoAxcEwcI8fMMVxvUDbjux7nOg9yrnRRzs0d3Jf1Z71tz4YIcJ5KBLDBw3jSA4hGpb5eC2CD4Ik7soLzU7gT9KddAoA6u+mlnesxpg/oj2v/42QMoMs1AAB1Xgfw5B0pWBeYzyGn5GEcyge0W0/qugZmjNVOv540WF8JGCIAIAEoi7YnCcBpcg+quxNAAK1gvyUF/koJgDkJcTbSLeCPH8BXI8BuAfzq50Zef9KiAZCn/y0Qrp+gHDeAHjDFqV/WE4BNX3JyTxzLahEA5ovMvPUfOv1PIkCCIIE/dUigr10pIXDoVUbePa37//sQAPkNgM9+xtf96nq9yvnPutUTALzTXKcB95zwC8jraTz+A6fxU9bBvkzem0kAUKblJemAHX8Jhx01DrKt+9hvfOLXfvKPoQ0A0B8jAsAafLUftXeMQB4JUAb8IgHVgGLBNX67GkE76dgzu8dn30zeGAgACAk1A3ieAO3ENw6SNDUf6uZVACV+amezdycvwlhzIQBoJ+VJAiTWohzbDw7h+ebjhpIjCfyrXRJg/VxNmV/7jPP0NHc+5nHfKAEwpAEgKcAgJAFApwmQADpDBMCcVwEkAADb1GUKuJ8SZ1ewX+MD5AH3TCwkD02e+Ffgn241BACPnvanBoB2NQWYbDBUOSnnsu8KkPcF4qdIN1dbnOMtAuCvfOpjHhzSAoCsYY5iGJ9DX6bTn+pZYro4IVtGsKRcdfE2RuAokEQKLgWbU8C/IDcBsOAfoOzJPwSAYFoSgPVM9f+qBSAJgBSY65eEwFzgn3wsBwKAelE/NpzUN1X+64m/bbcvlAn2sSfg157AHzubFMkW+3+MAGDcHMv1hmszxt14O/bK1jzpom3mD/bL/LP+tGdDAjBvmbOSAGza3FxKBAyRAEkEnAL0ZxkJ+tO+EAB/OgUZV64EAHjTCI4B356OSwbghxGgH0tShif/58B/9wz/aQt2szGXJQFoI8b2eQ2B9qglkAQA4b1KfUcAQATkif82EuCOOx7SAJiLAGjd+1cNV+CPbIH/CvKrG0COn+AfKeBWtsC4YUoAPf3ECaMEAGABIA5AJx4gg/KQptsmLVuZYH/Ibp/klYAhEiC1AA7VAED1v6r/T9EAkCBIDYAkANAG4Nkts5/1+5av8gPuE5BDAPz44z/QHyQKxiUAeBeu33O8A7b9fF+cu3bAO8HyyB+sQnkY9v34Ud4zH/mU5/E+5pnsClp1hvyO/qPf1AZIDQDs6YYoYA0C0wjSAcnYBdL8dwHcxAF4C4x3JQFMS77kBT5g3y245+SfKwMQAIBy7OypDU9JWvb+5Gk9rRcSgz/hxAPwQwLwXCJ5XvnYIGXwjHF9oYWvyIc6QiSw9oDLAPhDWgCSAYUEmDLPjjcnvuDuL/weGijIH5JsVscIADpoiAAALM+hASDo5gH2tF2/bVISALC9LW6GT7kmQJ7EYxLyLQTqJ6jP0/6WBkCGk4bFUaAv8E9JGIzqq9/0o7fcU2lN0l395gLNpwD4h5axa1tbBAB+LCBJAqgF0Mv11RhIAEgb5sjAB2yO95Dvl7MvtyEp6FOuumI2RtAoASD4F0wJPgWjAlWBq+BWsCsIruB/GwEgCVCJALUCkhjwisAxiABJBfIe0gCgLXn6b5vtA6T9MhXwV9Bvf9v/SjYFmBwnx86xVMY4O/bKoblyko1NV685frbBNm2IAPqH/pII2EUb4KKIgAT+2KmHBIBXAGgP49513qoztn+OvrwyeQB0OFlXE0DADVj2nrxAWSJAySa5mkNJAfIT/FMH68ZYHdqptJX2kS8GYE99kwCgbYThbxgSACkJwJWAMRLA03/kHTMSABBwqVIPuB4D/4JsT9q3SeJ/7xu+7d+5/iK/5mnPvB+/IXAuGM9wCAD6KjUAAN2QKgDyPP3fRjIM5Y8GwBjozzBJAD6+VrUBPPFP8I992/clxuYiawp7VfZBefdfcK+a/5gcIwAazwJr17k7+YDsSgAIxsEQFYyzxnd5rDoz9Z1FvI3WAXOzlikBYHmQAxIOtIH3bJcH75upZXZRD/89+jGf9er6bQCvBnhVAC2BngjogDH7XNcD5o8EEgfBgHb20+ANwLWAew4iwDv+5M/+WXDONQTsqulLAhCfegj2rUt1Sw4QVxKANpk/+XLFQeIhsZSEBRik/8h796ywBqHxw/oh2B+SxIFkPJRgO3gW8B8ADiUAZGqGCIDUAABcH0oGqAWATLA+ZBf0M+AQAbqH4u/qD4hnQgDyWnmnJoCAXw0Apf6k578ETCEB3vjO7+9Vc5j4OTkPtR8KrK9q+imEQIsEaGkBvPBnO/axM9yT4qoK44qBMWW8WKTWm+6Dn+EjZeDLCDlkBEnIlUagiBRE0laMQBMgJRjdBv4Bvm7GVIkXKOcVgKoBwALbn+505CVEgMbTd2QagHklAdQQAMAfog3QIgAom/qlBoCn/7YXKQEg+JckQdp3Q0CfPhbkV+lYKB0jpOOGzPHE7jivZc4BNzF1vnRRT7u5ocADf7ZhM7fpC+cwGzdOb6ZoA3DfXuB9EUSAJIDA3/v/nFRRf+YFbev6a9UZ231g91295PQFoDfBsUQAktNy78tLBgj82Rjjh9RPqZ+SeBlXfyXpKIfysvwG4Nmrkxlr8jVvCA7KlgBQ0hfUgzAMYBYCADuS022/Ct7SAMBPEuCONQFAH+9V6T9NdHMb+Af0AsS3Af0MZ91lfWW97Ipa/Wlx52w3qf8YEZAEAHbICQkA6g3A4E4+YUlMtAiAmld1QwoA6hPkax/yJ9yw1AaowJ964rcGxOc6YaqDr/9X9f8xsN8KGyMAWH9LXVi7zhEAkLRJAHgiX8H4Aafxt5TZIgAor5bp2rt+p/ruLE06rrN/p3XXAgT8agAo9YcIaBnC06BZwD76UBJAgI10Xy4R4DUAJNrrAHbBvxIMJC4S+JOX+eqXkjQc0gH6sSt7/64sZBraSN0gADA8M1ybAPRv0wIgDns/4s21ru81U/YlAGDRGADAP4bBSaCfdgC1oF+5K8g2PmAaIOUDpf82SRrizE0CkC95DoH/Wi+AfgX91Y88t5EAaAWwuHI/jfsqTvacoPvafeCuKpCfq96tflDlpxIBfgNAqRbA333FSx8E9DOmzH0lCw3PDCzsXg/u8RMJBMZkgr9VV6XeCBh5ufQvmAb434UASDDcIgC8/1+vASQhoF1SoBIDgPEhrQBIAQH8PkSAadUssBwICQkA6tfSABgC/wn8JVKU24B+C/AL/h2zlI6n4xsyxz/tQ3OmS3rlfraF9m20Aegv+lkiYFdtgFMTAYJ/ripw8g/4p87Un7Zc5Cb0Ms0I+sH/EqCKPEBYYgDQjD21AiQDBM4CZiWAHvs2aZ5IAbpyLtV5+7pee6Du1DHbAPinfPwA/5wcAxolATjJxo+vgnMSzZW3SgQkAcAVuAZos0qTJHe/BdStk38ALnUR3CfI1k8p6N8D5N5AI6AC8nRzus+/AKOuEhbYVf/P03/qM0YA1NP/dAvmBf4taRylcXBDRoxpA0walIFIqP5LAAjkp57+G890/ieA/BBgg0xyrT6nkj8EyCEDZjiNp8yedGAdZT2VdEjiQbySGgfUn7l3GdZe1he1AfLbAAnu094iA/QjHuSR4FrgvY/MPNyPC/LFPOBQ/bw+oFvSgHwkJbAPEQFgJtKSJ1cNLKNiKdJXAgBMwDPOVYApWgCQAOwBWT/3WIMGnrodvVsEAJvS1lUAvgzJ3XaAjAQAjRZw4b/NCIiJp30fmVoAnLBOyQPwRby5SADyIy+MeU+ph6f9FfinP/lBFAD00QbIawDavQ5wDBLAMV3krR9EhASoBACbpbwGABGABgAvQQiab33Yf9rMUcYWw3URFhj6eMfH9hTRebHx86VaZQK+Hhx1cXuAJGA8BPxzGiP4TQ0AyIDWNYC8CrArEZBkQGoECNRTM0AwrzbANkLAcKTq/+RHOWokSE5QbzUbaOPQ6X8L/CfoF+Ar2Zi0TIL8ancMUzK+DVPnQZ0nOY+65Fful+25hQSgjyUB2NCx+QNcY1ofCGxpA3BCn3f357YD/jEV/APGqP96A7rqRsa2XrlBmrvCbIgByZIAyhYZYJgAnncBYF9QLRGQknA1AYhPHpl3XkWYG/zTV4y95VEWdUgCQCKAetEugD5gEfCPxPh9gF6lvdvEAmrZ/HItAOAvGeAVAAgA1ql9x4rrqpyyeZ8eYN0TEB2QBcxqANOC/Co5vefdwrzftx6mow+HtAHoCzb2ef8fO30FQVGJiUoAJMhPYqHaBfNVCvaVGZ5+2qs2AADukMMJ3jeAf/Y/qf7fOuUf8xsjAAaeC9awrSr5nsYD0iEIPI3nPdilZ533veVwD0nXzK1lJuGgxkGsv7uUOVSXg/z7/Vr5SKCaAEMySQHiYCQCWN8E8IJugXdL4jdkzIf9MkSAwBypAaRDALC2sqfGDQGgwU0+4LWh+uhP3Mw37YRhyAd//60g6yjPDesTz+8ULQBJgOe94Pn/Zf0ePmgMd07cIgBa4N/TKkAp4B0ADhmgBgCACEAzdA0AYCzoV04By604aAFIAPAgt+IM+QnUGbxDrgOQD/VgwgyVtc0/rwa0tAIkCMZIAMLUBIC1cnIeKpnYpwb/zKVNmd2DhP2cX+fehF+wvUUCePqvlAHnZKRFUjGHeBbUBmgw2js/zzMm8MXWkhX0rbpybwH//Qul2wjwktOwAfSkmg1UgllV21V1n0IAAJi9BjAkxzQEfu3d7/4NADgkgESAUjJgjAiQEFBKDCj1r6f/EgCWSx2op1oAUwgA+7GC/13BPuOUQD/tjOuAqXNAd2u+6NdldWV/tsF2zqoNIEifG/yTn6f/9eSfZ3K94V11o2L7ruwAHaHiN7ijKcCvUgCN9KQ+pfEB0GkE1abPNGknHHLpCO3qs5TgoBzqJOhXSghQJ+oP6E8tAAkB4gFsuRIA8AXc8s5DLfaOO+7oJf9mkf/dvp5vOzeJfuA6HaAfNVskBgCrAeQCkAH9CbBZVyFTDyEfRirc1AagH/hGggQAdeWknT6zjklOEL+C+5a7EgMJ7LXTH5StW7tgX/90a09tANaHkXaPBqn+D4CXABgD+kNhexIA564BVA0AgPjMYJy1c68yeVd3aVeduTTrL/tQVPkxaAXsayAHJAEA5mkA+riHAP+QP3iLdJAAlQgA85Cu3393JAAfpgfHSABs0wYgLflLEJBfC/iLrYhLOOsc+BdsQh6sU6yFU7UAJAG++Mue+PZuHpz2lx8BBOS3wL9+hL/+Zb+wUXcHtNJoOgEQgxo8gGab2QaMp4ZLAiBbAGtbPtQXsy1eKxxwzgTYRiIA8lvp028KETCFBHjNr3/XbAQA48m4XhbAfax6HEowJBEA8wgDKgHgNQDk0BURSAAM4RBqbNJPuwIMlsYLiZ8vppSCIORKI3Bkk4dJIMpmQqAqcEWOEQAtLQCvAKQWgKfmVQqmJQaSCMDuyXsSABACgnLtrHsAdoiA1AYQ1Avyx6Sn/5IJLQKgkgBefYAIkRTJe//2o/1KH2efOw5Ix2ZIMoaEOZYjMsc+7Tk/qr3LbvKJCnEv88+2beY+/Ua/0/+HagMA1ufWCEDrwH/5p9o/dY3xtk2Xud8vsm43e42AjgwQNAvuBfFKwHLaE9C37MZFGk4Z64+vMS5H+1EG7fi0R35aX2feXxX8JwlA/QD6XAcQ/KsRYDz8/+B9v9Hzn3xbCm0ASAC0ANhrdo3Zp003H/vtP9Kr1wr+UbUFtHKajtQI/FnfWTdZI4/WgZEx/00rATuAHrJEAoD69poSXV1bGgotAiDBftopBzdtF8wPSYF9hlc/3UrG8NCPk6H9WNX/h0B+yx/gr78kAkRCXgEY+EAh86tfm1mTWY9Z81okgOr/M5zG92X6HphaJvGoY1ffVWfIY59no0t2nB/vCPqYfx340c9aPSgpMFVKHHAwCZ4QOFcJoMcvCYKWHXAN6M89uyQAWIU8iMMenI/6WSZhSQJgJ55AHztYLo1h1IP05k8Z2olPOHXA/ryPeE+fb/8vBbtnH2A/VQuAeOw7D33udp4JvNi+80Vv2fpfACAB2Ajf/09/+RzAB7gA+IdO/pMMAPTiTplAeBc7oFkCAC0AyIhdSQCAFwCewaZs3FPqQDzSYFpppoD+VjlJBNTrALhZUIeuA6gJMCcJwEQ/FvC+iHxdOJBpDq0LecEAYgT/Sq8BAO7zGkCOP/OYKzWMsad1Oz/I8yfwhVRlgr4NCOqK32gACDx5uWF4kWgEq4LX1AKoGgBJAAiGlUkEaCdMexIEEgApJQOSBBiyp0ZAkgCSAUjJAGQlAgT/xCN9Bf/kb9nUS+KCNtAmNSHoj0oA2J/2L/1t/7eAP+O0g6ljXd11blR3V9RmY0PYdfnZTvtjVm0Av9Y/BxHgeuLpP88bc4W50Q3GqjO25bqMzdHbwUafUzI2a4B1TAJ4gfwukvTkN6DWfJQ20Q4IAK8gcMovkIcI0K4kLmqunOoBElMbAHBLPMIgBTjd5gcZgDYAarH7qpTf+Lmfezt5vOSp39rnA6iGhEjwD8AFREMAsE6u5/VR+m0oUwBdkgCAfgxtlwCgzlVDgTq3CIDMq9qJP0QACOSV9I12tQHSL8kB7KgjH9J/9ENV/xfM7yrHNABGCADWtFGVfMB/EgANMD40zEP+fZm8f3knsz5U0iHL4z0+Q5lDdTmKP+sFdZYMhRjAjBECkABolbRAf4L8Gi7QFnwr616dvbeAnDTkCZHJVaGaZyUBCAe4C/aHiAD8sz7ma1rSS0xwHQAcwPM+9T8CQBRg+nWgIwJO+Q74EAaVLykK8D3tZ1OqXQkBwHcAEtSnfQoJIAEAAEp7AqJd7EkC7JLOuEkCbDvNJw3xAepMCvM4lrwoEoAHigldH7Yr6e6uEiTY1z53W3joefj9dyISAFwDwLzo77xxVEsFEusFn/x/nKkC/LH/p//PUdU/J7wheKHxEyAoBT3KVRenN6wlGkFoJQEErEhJgDEtAMGvUgIgJWHpbpEAqR0gEVBJANwC8SorCSARUKVEQJIA+hG3RQBkWRIAkgC2izZKAEgC0H/25zYCwDEK6fjtKnMeaB+TXZGX62SDCs30s9304TkSgPFgswTgZjNYvw3g9wE4ndcA1tNIBOCX64J2JWsFdiRxleYr+Pf0n2eS+naGetOG5Xd4D/SAg3FnzNnEAVCSJJAs6P06sE84c4M0XfEXMg7UCQKgagEA5jWpFUBcSAAIC0C/JIBxJQGQgFYIAAAv8QYA22jPo0r+P/7gv+1V/gHSgH/IhwT/gFsMayTvn9EMjxzI2APO+QAgdU0CAHBNWKr+Swa0CIB66p8kwJgGgGC/gvz0T9Bf/dfrw949xTsLAkDwnqf5uxIAxN9RA4B68yzdZA/C+5ExOTIYpzzMVtLBbw6w56FuhYjtsriyv5XvPNY0DM87pB/rHd//4L9lfcqNux46weeK73pvjt/jHnV3b7Br/Lo+buISBztrC2sPe3n28WAxQbon8qj/C9SRhAPYwTaVCCDMA13jEVcjQUDeEhFIwj2Iph5cc7LO1JfvoUzVAJAEYJ+Jff1OOM1kgAAA2APwBftDkgpy2l6BP5oAdIoaARmedsDyHMA/QTfgCbPvVQBP8RnobSQAcZ0kpsu6HMOeRAB9P+U6wKvf9KPnHoB8GFp21WWuOvAX4KecG+y38qM8SIDWNQBehn4HYGzOQAC4gXdTz6b9NKvALaX4UmvJBI2rLmVvKvjn5SYBgGRRwwhaKwGgBoASwKuRANgmBcxJAqQ2gEQAAFsCIGXLH4AuAeB1AK8ECOgF90g1AwT+agAYlzzID1PBfyUAUgugRQBIAtCv9rXki+Ph+Kxljl21t8b6EL+uyH5jRB7X9Zf9Q3+eIwKY6xIBPMsSAYBySQDU8wXrSQBghwSQCADk49cC+6YzH+SWj/5RV+t+XcdmadeWHoCoANSrBcApv4C/P0kLIkCQTzgEABte7AByNQDcnOOPNoD/IQA7oGBLdc4Fs459/Hve/wEAIHfoAdOYCv65WrAGUufSX5Tjxd98z2/R7v7O//pbBfQP9faKgsBfMqBFACTgx56EAPGrBgBAXjMG/gX8yiQDZgAeN+Y6/Rf8DxEAIyelrGuDd/Lr6f9MYLwvk3lIH1bSoVUm8dbz1rX4oqbsScplfwLh2IP47oSeU3r36QDmJATwlwjgOeJOPc8Uz7+EgB+uJC7gHEAONgPDgEUrzhG3EVZJAOJKAgj8UxpGHqQ3f+KAz15/15/05UoCUCfWLIhAnnkB/hTJvpA15CSDQiHf8JRvf9dUAoDNK98BENQD+Ok8GRDsu2gCHEoGwMAAquYmAVpAnnKYCAx+K3zMj3qOhU8J2xAB97x18D8DQA5guArA/7F0otaHId2A/2MD/8w/7S0wvavfZhHpWLhWWsJb/nP7UQ4sp6f/SL8DkP8OcGysmSdqAkACYAAKJ1sM/rQgXmj8BAkpK3BcdfF6I+jkxYYRlCJ54WEkAJAA2JYGACSAgFcSYEgmKSABoBwiAtQCGJNJDEgCSARAAGgkBZT4SwKkzPhD4L8SABAWtMU22if0mQQK/Wjf0s/0u+OAdGzWMscux3QOe1dEP1+U5Hk7/LLv6N9zJABjIwkACJIEmPqfAgT3QzJBv8C/Bf6ZJ8wP6tcZN523yxh1TV5+jR64CegH7HMFAGAPGQCAF/BXIsAw4vsfBAC4bMhNo/RKAG7mX6P8QS9U/z39lwAACEgAPPu5z/wlnqvBDC4ogO8BoGrvfyyg7vQNIF7AX2UF+xXw1/CWBoCAfkgm0K92+nLX8Wl1L8AXAiDB+9Cp/1f94L88GwpL/zkJAP81H9LTeOrMGn0gGGcdvYV0SM0Dy8OPdzdlrt/PrsWtLr1WfrQZEoC9Ms+HoF8CgGcFTR8MdvxZW9Ag4tlHrZ5nC3/22q47uD39Z1+f+EY7WAgAD4ZDVhKAcMLAtMgkALTrT1mkJ40kANd4uf8vCYAGEKTFrgQAJAFp+FejJxl8GNQHXvfWSRoAbHKJKwHQn0h3g/nXutNPOh5pWEsCfgT9yjFANCVMNQxJAOq06/cALAeQjxYARj8lYQw8/+0Au/6nlLS1/+8LI/8ekI9gQALw7wFRPd9GAgwB8iH/KcB5atoaL91pn1LmRcdhUWP+JwGAne8AQASwEG2bKz4zxIMIkARgY3+SxeBPC0lQU+0JInvA0yVbYQSeEgBJArD4Y9hoaASxvISTCMCuJsCYlBQQICMF/1WmJgDAH3CtVDMgpeQAoNyTeoC7JABrofb0F+hLBKgdgNs0xDdPpGSDZWa9qhZAJQHoS/oVcCcBIAnguKxljlsdU91d1HMgHnf9Ebf+Wn41znV324f28zkigHGSCJiiDcAzPwT69U/wD+gX+KfaP6QD5TJH1pvcVTcQ1NH6XvdxWdo30gOo6ALmUwsA0A94B+xjJAGUkgC4IQH43gF+AF025RIAuiljpAq3BPF8cPoPEBT8e++f07FdtQluKeCIHjxrABZAiXUHcPvxP7UA+ndHdz0CMmCbBkCe/icZkGAfe7opU3fa9VMe8HHGW3qR9+fT3vIzvdo+wB2TYH5Xu3lIAuRHAKdqADAe7CEE4wn+8WcPwnvzQDDOWtoTAOTVKpPyMexteBcQr0uzIl1nbpv3J+1mPeD5YM/eH9B1dlT8Af6ozmtcS5BoGrEGQAJg0AYwLesMbvITlAv8UxoGjgLME1aJAPwI0wj+lfpLIpAndg5oIQH46OEdd9zRX2ngo6UA+l2vApgGMrGbG8f9MfH5YmtV+2eBqn64WcC8BkCD+T/nEgDcgaADp2gBAHLmIgHIq34PgEHeBrjGwpME8PQfAmAK+D+07LF6kTcLKUB/yPDxDZhYSADqnA+BdtX+K3CuwLu6a/zFfV7zgO8AMC4SAXwDABIAxvPlH/aLk+YPzwXzjLFW5ffEJIAvJEFCSgEOcpVGAgApCcCCrxkjAYbIAPwlByAKKiEAIE4CoNolAtQGSJCf9iQI9AeIJwGQmgDVLqDvN3YdOZBEgHbCMMZFVvBv2cokAGhbEgD0C/2TJID9vt7Q5PjkuOV4au+G8uCNCHnxUz7kur3+2p/98+GzwDPA/GdzyDxOEmBMG2CMCBgiAMgPQxmURZkLAXB7TcJdWuvJP0QAGgFISQGIgJaRBEBCAHDy9fCHP6IH/2zIMaTb4+7/TcA/hg00G3sMJ/+ciq3XtV2ad+q4N6mvVwCsez31T/c2AiBBf9oF8UjNGNgnLM2cAIP1JU//p4L9bZoAgv/6XwBGSCDX3xVrLu9G3pMC8JSC8SBGTbvrnDHd5jsA5C3xYJkSDmUtJu1t96MP+DaA2gDsjyHMeOY1PEOuM5CKrCmQa2gBQAJwwk66vBaAm/8+AijHiHeUAHZAPGr74FiBfCUC8BfsIyUAkOlPfqQlviQAmgCso7Rnn2sAEgBI3t1Hnxyoi+96DQBVCUAKJ++AQAYSs00LQNCvBOymfQz8bgtTCwC5Le7UcIkAJ8QUAmAszqHkAF+TVwvg5ts+bpQI4CrAG9/5/YNaAJcR3F/GOo2RHFlfFgNORSoBwEuOZwPSZWxu1DkpEZDXAo6+GDxUgC+0IZlgckMEsDnTCEQF/wIgFn4ML2aN4F8wi2ThS3/svFQ1vEzVAFBW8I+7RQBIBiiJo10pAG+RAAngq12Qz2l/NQn+Bf7KPPW3bOuCpI4SAEkC2Gf0qX1N3683yqtuODE5XnVMu+BbToPn2pTMlQ91vEo/+9h+32gDOPeZ314JAKhLArS+DZBAf8ieGgALAXCVpsrF1xWSSOCP1C4JwDvNbwVg16SWAHEhAbwWwIcFUffdtXV8+A/wj/o/arSAADb8I4Bv1yKOHv+v3/XY7/MjgJxcAvAT8GPnXaBfiwAYOvX/3jd8279DCwKD6j7/PxxZjUA/SQL9AP5zEymMG/ucKaf+Q6C/+qsBAPjfhwDgPch6695BQI4U/PPOXPcFa/W+7yvX+36dr2Vanu/qmco8+jw+QQE3IQjRBgC4qwEAAYCdZx/gDwkgEZDaABAAEGJcD2B/DREg+ci+HANuE/wj2aMjAfEQAIB2sKxAPokA/CrglwgwPXmQH+kgHtirqwlA/fe9BiAJcJLvAfAdgF2uAeR/A7Cxu2oBAHbmAv7kBbCWkJAI0D+B1S4AnPwgAJhITLCp4K2WwSTLOhxqJ/8XPe0HRsE/WgBeBeCjgE58HwaBa5WAXf3G7GOgeNewLG/XtBcRn7lAudYbiaFveeif86q//yAGlaVXveXVZ/Q/CwThPC9oq2BgITG6ka055nPitYATLMwU4cvQl1tKgY1y1cXvjQQAchsJwItSIxkwJHl55ouclypG8N+SEgItgC8xUKWgWxAuAVA1ASrwF8jjLwmgbKn+G5/8K/i3DsqsoyRAbircWNCXbC4kANYbG8fGsXKjk+NZx7obzuV3YA9k/9LnGxKAMWKsIAEAXxIBAndIgCQCAPdDwB//BP+p/t/SAIg5kfPgwKYuya96DwDWBf9ItAJSE0AyACIAu6SAZIBXCCAAIAIwu6r+d314E+APAQD4413KqT/r2VXqX75+zsk/JAAnlqr/C/i9BqCb8DzZTzsAgD5gjWDdoI8m9sUN4qPiDzkA+IcsWD//E7OYHo3vHI2B/wru0RDQT9nSGkgSIK8AsG6O1I61d6OSz56CdyRpMPm+XM+tFfE743uws+7868vsUm3+I4jlUh7G93OswaQ5pMydK3kZE/AehATgeQH8cwUAiRsCwKsAQ0QA2gA8M5y4qw1AGvJkXz5GAqAhzV7ePT04qZIBuAX8yCQFIADYt+OfJAAY9Ol3vay/trDPFQAIAEmAo38PgAFoXQNoXQHAj40tDQeY0HjsdKCGDr2IawAAY+ojATCHJgCADIaIicQg426BtENB/S7p0QKgrSy6Y1oAXgX4nfe+s/9/vP1E7k6hkS3gTBtb/lP9Dk0/tZzLFM8206cAfB56GEkXMZ4r7oEjCedZGTPM3yQGnBc8axjGnTvAJ1jIfTm1JC/Lalad38bwkpMASMmmpGV8OSLTSAj4Ek0NAEmAlEkEpAZAgugpdsA3JIAAXcAOwNc+JJMckARQGkZa81ZKOrSAv3WW1GhpAdBX9i19HhsNxsXxquPZBW02Ibf9ZoTOmPlnf9v/GyKAec6YSQS0rgVUIkAyIGWLAGhdAWBuxJygPtZt5iYv2V3FHqgkAKr9agNUDYB0SwoQlzSaXdX/8/Qf8H+VTv1zvNEAkADgBFCgPyQhBBL0s+HnjjvPa+Z7oJ3n/Sg/xkmgXkF8Bfe6lcbXrcTfPFsaAKyZI41hXaO9/VpLP7rWst5ix29G8E9VXEt74oG8LTfLa6y/pF1+XQ9AGPItAJ4dNADQCsAA5j3ZrxoBXgvgOUOTBsIN4gANGtTvyYc9OUC/EgHsx8ES/Atvrq9ziA2IZy+fEjsGDV6wIPt3sCAGbWzc7NmxEw9NgOd9xHt6N/URyAvqd5GSB1sIr8Pnzy7/DpATLf4bAJ0BKEktAO4/3NF9BAEyYAoJQHpAjlLAs6/kA4AtEgDgtG+egn4mEIZ8LgMJwMTjrvkQCQABgDo63wLI7wFUAkAQW4F1+qc94w35Z5zrZpctpO0aFhMMLOQ9r3txTwC85Knf2gN/VcH5QAhx/P4CdudUSr6r4cLCXMY4B32mTkAC8ELjl9KXHFJAo1x1fhvDi06TBEDaeUEOGV6aGl7alQBIIgB7iwQQLAuelfpXaThSEC4JMAT29Uc1EyCvW6DfksYR8Kek3KxH2rO+SQDQfvqnbm7s//W4OE7IHEftnffmh9/ym68H7GMk/b8hAdwkSgKoDeC1gLwa0CIDKvgf0wCgrMYGdBnr+cb5SufE2izoVwtAMI9b0K9UK0BNgUoAsH7v0iGe/n/2M77uV9fzdJfklyYud5sBIewFqvp/nv5DCksK8P4A9DMGl6YhEyvCeAnkWzJBveH6IdNuuBISoEUATJhbt6y1ufc40jq4KbPrus0aT7mNdzFxl7X31jl2k3cg5KEGYsBvAPhvR6s2AEC717jtDt8E2BAA+JMGIgBsyj6bfTcYyEM73GCUSgAI/FOShg/Be4jnPl0SAEl+kABoClAu9RDIW7ddJGlZH7quYu9wnB+dzjWAoVP/9AfQUCkJAAAKDacDYVJQ/6LTBCuA+2oA0YJ+5b4AvaYb0gTY978DCPgBYQwqA8zVAEFZLX+be64rAWgCTL0KgBZAXgUQlCeA1640TsqxMONNiWPcqyBhIW0TkkUAqZ35oEkCgIefk//+Rd89My/7ovv6+cNzw/xpGVhF5xh5QhZACOBPOucidhaf46wGm1x9SQ1JFqQ0q869Mb70WtKXYr6UsSchwEseUJsEAEBX8I+EGdUtCQA4TrA8ZB+KJ+ge0gIA6Av46+m9bkH+EAHQ59FpGAj+JRxaBECr/tQ9SQAJgBYJEGPiWNXx7KIsmxE64cg/+91x2GwSmfeM3RgRUMkAwH41XiNQm4Dngzx5lijjSBvfI3fbkv2peoD5AujnCgBGAkA/wX5KgH8lDHZV/2eOovqPFsCp2nqMcniHob3AngHwUdX/BfxIyADeNby/jlGXU+TJmiVYb8kE92knbrrTnvm0CAAIB/p5S/tyrV11cVuGddh4nfXgn3khyXtVjOu+8brg5TelB/r34poIANBz8l+1AdAUAGwDrtEAQLIH51kkPunYn6c2QBIB2BPsj9lf9KH3bbQBJAOQYGHwHXt38oMI5IoCz/ouoL/GBW+v/2PHlO7aL86uHwO891n3b0gAtABgWDgdlRiooH/IDaiRBFCOgeipp/kMRr0OcAgJIPgCuAHSMBIBY/U9dljrKoCn/2gAtK4CCGgB4GlvAfJt4VPyaOV7Gf1YLGwP8zmNIB/J4kBY+mFngeGjRVwBYPHhmYI844WPlg3zT+IIydxgPrcMcysJARYUyoCB5BmDHECrYL+nfXIqXlb8fGml9IWWctXFbZoWEZB+kgGSAEMEAC8DNQIkBCQCIAEExxU46z8kjV8JALUABPe6UwrklcSVBEBKBOiXBMAQ+Lc+VVJ//JCSHmwiJQEEe/QjfVpAn2PlOHbDdcvPMb8lYPE4uAfsdyRjcY4EcM73G54OjLU0AgT5Cf71Qwr+SctzISnUmAvW5eBGLRlcnx5g3gj4KxGAW8CfMuNh37U3mPeYXdNdtvg8YxIAXAVMwK8drQDW7vW6fNmasFN9+N6B4D2BewX4GUZ802hPmXGHCICukqyd236ub77zqjR8Wz67hpsv0jLTb9f8lvgP9cAKrQBO/wX0gH7cfIsEP0/aIQCwQwjwPPI9AK4XYM8rAWgETAX+rXjsx/l36+zzv/NFbzm79/k/e4Z2PJIDP/bnhHEIWEH9Pm72BUebDDAMUz8GyL+2ogGAEYE9gEb7VAkAEvQr5wLMEgXHIAGoIyCM9gPScAvo5qr/tnyyjwH6D/vhh537MKAkgDKvArRAvX7KMYA+Jc5Y+qEw1et5YDf2jqQ4F78Lw234kDyXpuRB/TEJ8LHDDioruNftQkB6/ZTcX0IVyS+ZbgiATgMAbQBAPePq3GwBfz72h38lCiQELMurBJARR1gUeGHxyxdXy+4LLuWqS6cb+6iRBGgRAAIiQEwawa5EQGoBDAH89JcoUBom2K4kQAJ2QX7KBPH4SxYI+Ks0P9NZXkrroqSOAn/ri6QNEgD2C/2WBECDBMix7IZo0QCgE074s/83zwljxDPAuDnvW0SAAD9BfwJ/wgX/pOe5cS507Vt1xjKtwwmbvRR1FXqAecMH/VIDALt+An5JANzGPeom9ZJ3Hs8ZIAMDCEHzUuCPZP3umrC65M2YXD0OnwTzLdBvWAL8IXumlwRoEQCf+6TH/9LkCj4U0XWuJXfManL0Vln4Lb8De4D1hWs2aAD0p/rdyT4kABo3gH5P/8GnagDwcUANz6aHaXn11n392Ml/DQNjkB/kA3t/iQkOASEAORCEcKBOh2oB0J6j/1eAbd8C4D8AeB2AqwCveuZrmif+u2oBJPhP+zYQvC1coDU3CUC5An4IAIzgTv9tdSPc+k2JW+NIAHDV4jlf+Jpz3wIQ9Kfk/7R6FSABfNoFzemnXWmcOSTgfZsZK4c6VQOAx48HWiNonku6ENT8AP6wjoB9wD+y1wDonhUWAeZJC/QP+eWYSwjgJ/lE+dSFNh+4rg4l96WVsvVyE1RMkauusHMmSQA2UYIggJBgKAmAtAN6kwCooF6QjD8GcKRdmYBawA0YB6An0Mde/SqIz3CJAKQkgH7mlaAfu+Urs27Vbv1tvwQA/bOFBKhjODT+i//xeiDHgOdmhRkjAjjRZ/5KArRkBf/Mg5HTf5/r47VyyflK9gBzDcBfjUAff//1H3Y+IkiaK9nYmSoNOAEQsPHP+/6s6zyDMxVzKbJhnUnQLtgXvCfQb/lleNqNi2wRAHxk8VJ0wFKJi+yBG340ENCNAXAnAYDqPaCcw0SupicBwH45scEhRABaw5SDun81+LMe4A8uQBNALYV9NABIw7dCjtbxf+/znv9WQYtAv0pJALQAaAxqDoLRfSWgZk7gn8BJe14JwK7/HNLTWYmABGtz5N/KI/ua8M9/3ue/f+oHARmzCqyPAfBrGbo9tdedsgL6fFAr4G65PRlvhc3hR30A3cjMDzfqPzzkPCMYNgE8P6oAcW/f/+JQQT8n/5oMa429JBPzDi0U6gMrerSFYbsmQIIZ7NuIgFUXZ2MEPZ6AtkiAIVKgRQAIjFOyYREoa0caR3At8G4RAIB7/QX++uGvSRJAAkHgj9TPtJZZJXXCz7ohrW+VY1oABQDS74xPHbPOa/ldQA84Dj4zq64Og0QAIAOgNWaI0yKByLczOfadc/ktPdDuAdZcNtqAe075AfoSAKkRsOud/3ZpV9+X/gJwcALo6T9r9tVv2a0t4C5+Be7pxg6Ir35DbuMuBMCtfb34tHugfwd2a9Nf+dTHPKgGgMCa/wwAAAdrJAHAVQDwj3v3xBcQAVztBkO4z/ewb0iCXShnzEACQBRwNRhMcAgJwEHiUclETvW9CiDYH5L8izNOOl95x/cfTAJUQHsMQqBFAhz6XQAAWgKy1AjQvwXi5vCzz9ACAFzWqwCpAYB9SAsgAfg+dkF7Pkw+YPtIQbxynzyOlcaFAVnLgDzjAed58aOaEGWQANz9Y4xU8Qfka1emnyTA2DyRaEIj4EgkAODEn/aWFMSMSQGOctVl3AOdJABY3CoRICGQJIBaAEMEAIAYkMxLQuDfkgmkBdyA7gTzgn39kNVP8G6cFgkA8B8jALJ87GmynklcaLdtQ1oAE0gAx3mRp++BfG5ueT7yeUiNGIB+NQL/qgHCs9aZBP8+x6dv7VLileqBngjo1lFOn/w6t5L150o15siVpV/YpEMAsBYfubgLyZ41R8Au0NctgE+gb1j6DdlNj1QD4DO+7hvONHx3YK5GszdgvC7BHM71X/tczbzu+Wy0AQD9fggQsM3JOyf/lQBgDqkFwB5e3IKEBGA/zUf9+AD3EPBPf8ppEQDpjx0SgGsJEADgBMmKXSRpj3oVgIeBDxp48i/4x409jaebfPBgH7V/AaxgXzkGeg4JA1QlCcDVAPKbgwTIetEXMElI/I9BBGTfYYcEeOLzn/NHqQUgAeDHAJGv+fXv6v8tYEsLIMF/SyNAoI9sAeDLCNgrSD/UTbt5+FvtrwQAz8p73vOeP+m1ZToCgA+G5Cm/wD9lhk8hAZxfzDXqdVQVoVtfJfmy0j4mBTfIFUb1/xYJIBmQAEgSoEUACIKRCfyxsxlTsoHRbRoBtiA8gbwn9fpVKfhXGi4JoPTkX2m+pkvAX+3WT1mBv+2gXRiBoOTJAAGwAMJb5/RF+uSz47Ny7jlpPQuAfQF/HW+eK56zzixj3XXC8lt64Ng9wHrO+n3sci4qf9TwhwD8of4tAoB/BSgBAGCfo93ko2YL8sQkgOv8uTW+a9eqGMONj1x+jR5gb4cWLADbj3C3CAA0dNgbkQV7ZYkA9vPu7cEIHOSCFSECwDUJ+KsdYO93AFpEQPoRF7ffBdhHGwCN4jmJsFu6k/9hPkULAIDjBwHnuAqQoBZgswshAFhKEL7NnkQAduLvmsdQGQJ+QJnXAoir/1C6Xf2zv1ILAOAv+FdKAnzOO5/Us9P8W8BtID8fDh4K3IcC6Kuefgj8s3hAnOUVAAgyCID/+J//8wf4l0ASAMwzgb5Sv5TYNXVu1GeDuSUJAEi45aGez6O+hHS3JH5pfKEhV5okAbTThpaRAPAkVMCLBATr1i7Y15/FX7tpiCuwlgBgEyeQVwrUM0y/BOwZDshPA/jXXfMlD+pRpXVrgX6JDqXtlSARGNqXAQjpf8cjx6jzXn4X3AM5Ho7RqqtTb7Y9I4Ybv5Pmkfl23stv6YGlB5YemN4DvH8B6S/82e4L6usv+u8jTa8kD/JVpgZAEgC856bX9taYvBe5zsIHLPl3lkrsJ7jK4vrb739Yp30vS9ymJKzxvjaPWxt3m/vQXxA7AGxP3wH83v9H/X8NnOnDzY85oVZAgnuAPwTA6+/6k3NEAAelGQ97gvxtdkgA6gdRAQGwKwmg9gD13jRiZssN/s0fAN+Tf2VqAGiHBOCjC/x/xASlu9oBOQIbZfpVEHSoG+DP4PqRQPKbUxtAwM9dbcCZHwo8tN6mr/0LCcC3APiPAC0SQDIgtQBkvq46MD92/ZMFbJVFP6IJ40cA/ZaGBADEACTZGOAnrEUAMN74O+5DUhKABWrm9aCV3blFtETIl5R2pECkfwF27pVG0DIk80XpiScLYIL5tFcgTNw0xhU4SwII5BPEA9QF+i1pmpQ1vWBf8I/Uj7imBewL9KskjHpaZ6Vkh21C2lYJADYWbigamwrGI8epcy6/S9ADOSajz09X11XD+LxlPpegWUsVpvQAz+uJNbqmVGuJcxv3AO8TAX+Cd/22yW1p1ABA/b91BYDy9+1+3pd8uwKw3zKf+ehH9x+zXL8f9y1mLJ1r+Ipnm3cy7eFdzX6F+mGwY/D3/U38LuNVZ/JdPVbWbRtG333xlz3x7QBxPsgJCYBBc2Xb2NLnEEEJ8LkWkESAVwOSCJBw2Ab+DSc+RAD1gwAQ1E+9DsBH+Gnj0QaZDwJyv1+QP0YGQA74XwHyXwNWgLqrG6CTRMAQ8DnUv6UNMDcRAPjXHFrf7JfsUwgA/iOABICn/pIBytQCAMxC3LRA7eJ377l+2UaW8F8A0J7B8GDzzHD6j4EAyG8ASAQk6G/ZBf7KfB60K5kXkABonZyIBMj1h5db/hJ0+OITkChXXYKmqUQAL8D60hTkJuDVr0pepL5sDUvA3CIAWmC/+iVw96RevyESQOCvNE/SCfKpj3XSDiGgPevOC0+3dtvoBmIhAHJqXjl7fZaGniefK2Ur3ZVr/O1aYZ53VJ+XL5/frjPgUrZ7BchPIJ/2FgFgeErs6c50kABf8bpXbL4BkBoAXY+s9ukV3n8t8A/oT00ASYCuDNbOOX+u2T34dy8C4Oc5/6SnfuM/TIMfRkKA+Ox/1gCW9X3u+s3Z1gvPi3668zGP+0ZAMiQq+6GuUvTb1N8N0nGtADKAvT/XupMIAB8Rxl5b1X4B/lRpOoD/LiSApMFcV2KanfKKpzz0L83GTv8lCIhDAzgFPZQEEOAmsEn7VAAtaJoSv2oDeC1gStpd4yQRoJbArnnYH0gNBACaBgB9SQBBPxJC4KNe/jEfRP7K7z+w+RYAk3sB++fBfqs/xvoJ0I9KDx/R1I5mDBoAf/j+93+QZwNgnsA/7cxV3djT7Do3mFM8g0f+zwDNNaPz9MWUEjtGYKJcdX6jRiKgEgC+QAW6VRI+ZowvcBZsA8AB4oLylAL7DNdP8K/MOGNEgPlnPoJ8JBuA6rbOgn3c2m2X0j5gAzSBBHBj4Xh1w7P8LlEPOC77yEvUjKUq23qA9Q7g793nhQTY1mNL+Cl6gPfJEHBPEF9JAsNMm+Hph7/q/1UD4HOf9Phf2reN3POvp/533vnYMwmAJAGwE3/fsgbS9fsf9jO8h3k/D4H/JAKwVxKgy3/VGd/VA8Ut3nP1AHNerYAhIgASYCror/G8EoD28C4kAPjieS94/n9Zk0JzNfd8Pq954b/YfNE8tQAE/ikhAWAm5vgoYAW4u4KgfeMfWxvAekECeC0AwDaVCLBfyEfgn7J1DSBJAO1cA+BLtf3iuxAAWwmQMfDPfOf/kAL+MZz+8w0NTv75Txl/fPb7/XMhAZBgP0/9W/5jRIBzoUrmBvOJOndP8+r8E30yVwukCPy3Seq8MSxwLQJAcFslL1j8kNVkXEEyAFqQLQGQAF5wPiRJY3rkEAkg2PfkH6mfeZuXIJ+XP3Yl+Y8BftuktL32g6cI65eGfZzjUcetG4rldwl7oI5Ty30Jq325q8RzwrPj84fkmYNgw5/w9bNDfx/t19eh+1drEgDIu5/whDcfrcAl46UHJvQAp6LsGaupgD5BfY2rO9Ng16gBwMl/nv7vS4IB3hL8A/wx6af9iN8EYL3YnP6znnjyf+Pnfu7tH/+e938Ag13zKc994AHJAN7/Zf1ZCIAJ83XmKDc5cVf136sBr3zUHz2IdgD/7g/V/l2vA0AI+K8CIQHQFp5yFUAtgKN+uwI1CkiABPpjdkgAKs99ZwBugtN97ALdlNj3NQCqbWmTBOD7AGoDTEm7Le8aTh/5ocBdiYBWf0IA8LG5lgaA4B8tAK4BqAXAtYExgLvraXgr/nX1A/x78t86/ZcAeP3LfuHseR/xns0pv6f9VUoCpBybdxX862YuMbcu8CqAG+QWMEnAOWRf8cLEVAJAMKusIFf/MWma3OwPgfcE50kQ4C9gJ22abSSAwF9pXuaXACTtQyf9tANDu5S2EWlfSKTsQAA4jt1QLL+lB65lD9zkGeHZ+5Zv+ZZX8X2ON77pTf8S4zc7IOu+5mnPvJ/n9ZmPfMrzHvFRT30az+KxeqN/zgsBsJAAx+rtJd+pPQAQFdynFNTrJ7jXbTgfn65+ukmT3wCQAJAE2OfL5/17cf3BP0B+nvhjTzfgX4M/dkD61L7ZEm9DAFAn+hFwL/AfkxACxGVNYJ3iHd6VterM8m7e0ulHCr6Z1wMgAp70sa/prwG8+B/9o14TYB8iwDS7aAJw9f6FL3zh2XpOHKe53/CUb38XHzUbA/4ZBgnAvzmYiwQQ6AKeBTjKCqjncAu48gOBxyQC0AZgEsEiUf9t2gC23X6pEhLgzn/2mHMkAG4JAKUfA2RR3pUAaAH6OfJo5XuRfmNt8uSfu/+e/vNvSHgWPP3nCsAfvO83zu59/s8OEgAJ9pMQwD/N0NxuzQfiMg/4eOEFXQVgMWqB/zG/Sgasujw2/ypQ8CqYHZLGa8lMw8u03yB0L2RP+hK4C/wTnBuO1B/gnyA988o80i7wR+pv3pmf9UtJ/unGTluGTLbZPoEAWEgApujyux16gHnPc/WCF7zgHwDsf/Knf/qdv/bud/8GhvUZLS0NpC17mB//3v/f2Zu+7V1n93/7vz37f3zHv7/FfN93/vszvpMEGTB3Hw4RAJAA+56Ezl3HJb/brwd4l1QwP+ROEkDgb1xlxkkCgG8ASACoBQNo3rHHV57sJ9gX9CuNI/hX4s9/DNixzKHo7G1W9B/va9oyBvprGCQAaUjLWkZenVkIgK4TLvLHmLC/9jsAHAZiwAGc7Avqq9r/kJv4XAm4995/Nuk6AFoAaAwcVQuADt7lewAAIF6gMBlz/HtAwIwgdwgEHcu/agNABFiWRIFu5ZC/4VUK+CEBAJxoBNQ4uu2HMQnwQw19ihYA1wAgAmCw5gbaY+B57rJOnR9aE6j9J/inz9GWAfRj2Ej6AUDV/xPgY2eupJ9uZDXOAaXAH/fYfGAcePGcaKH0pdSS+I2ZSQSAIJY2aR+SAt0MJx2mRQAAEgTiAnzdSE4E0k38CtglAMxLgN+SYwRABflD7hbwt41V2g/2SzceqzD2fx2jLsqy2aATlt/V6AHmN88pYB+QL7gfkqzT3Kl86/3/sQf9Q8Af0A8ZgEzDIcmaCFjN0UNjBACA6Kgff5qjAUse17YHXvzN9/yWAH6bHAL+pMswwL8EwFwfAORd50m+p/+q/nv/v5IAxpMEmFEL4BYCAFBfgf6Q228BLATA5XysWK/5bgSq/ID/FhEwBPqrf5IAU64DEAesTR2O2juQANxtBtznif+QfU4SQLCTQEfgIyDaRwKypqSrRIDXAkg7NY+xciQBYJIwtjfT6Jcy+0M7BADq3570t2T9GCBAdipgnxqvgvJ909V8Ltqt2n+Cfz78x4PPnPf0X/X/N/zjf3P2RR/5u+9tAX7BP3Oo2rcRAM6NnA/4OQ+QzAU+CHgBVwFyLWqRAYRXoIlbEKrcaACwqRfAjknBbUuaTgJAEsATfEF7gnyBv2A/w/Srp/KVBCCNhEKLCDCMeOSZ+bUAfsuvgv102+6U9k/X56u1sc+RrbHpvJff0gOXtwd4dgD9Q0A//RP0A+oB/ZjWab+gXzlEBLDWQwZA7HE6xDO4T2+R9rMbVwAA/56Mooa6T95LmqUHDukBrsIk8E8gX4F9xtsWJgGQ/wJQ9f99PwAIUSYJAJgH4EsCtMC/BACS/xpAmplOV3mnntMA8H6/d/6HwL9XAFgTeO/zDievzriv6qzL7zL0APMNQM9h4CFEQJIAfBiQk/6x7wJwFeDommFsGHchAQBDSQLM8U2ACnYqCNI9p0yA37oWIBmQ8XYtHwKAqwCf8+Ff0qttSwiQTwK6bH/1TzfA7/Of9/nvTy2AsWsAaAFcF4C+L0Ew1H7U6HvTfdcC0J93/lH9x69++M/TfyT//m/o/n8L+EsUbCMAnAutOZJzgbn0FZ/84v92wlMjX0xV5hrdApj4JQhdde7eCFZT8iLErcww7KStfsYXHLcIAEBEC+QL9pFoAuhOsJ6n9C0SIPOVFEjwv40AoN7UOaVtSUmf4EZWU/vEPu5k9n0lAbrgDSmAffktPXBZeuAGz+KP/MiPvDUB/pCdNZl9SYL+lpp/gnyBv5L4agDop7tKCIFd7xJPIQAAR8S7LIOw1OP26AHmXAX229yVJMj4nv5z8u8HAOt/ANgFhLPPyfj5HwBQ6ZcESAJAOxJDPExPAMzzHwEGCQA+9icJ0JIQBawfnPDy7l/vbXw/3x6T7gq1kn0X36tAG+AQImAXEuBkWgBMREgA1fyHTv/TP0mABCZz2AU/uwLufeIL8AH8YxoB/3j1e5O0Clp14BpAAjvj6De1zyAApn4M0GsA9WOAAGINoHoIIO8DuOfMa5/yM822uvztj3xRfy8HlX9U/JMAEPzzjQxOlFT99/SfEyW+7eDpfsox8N8iAZwLVebcIKzOEeYCJMQFawGwhAPw+SnTjp8mgeiq828C+QpkdRO/GsOQgmMWagkAgHsCdgAFYJzNDvZ+Q77+Gr/AH0kaCQDy0kgEZJ4V/Fd3i1QwP+o61VTArzv7QHvpp+x3NxiOibJLsvyWHrj4HuAZ46N9v/u7v/v/HQL7+rMusw/xXv8UFX+BfZUJ8JMISP+WnZPTqb3GWlA1ADwNTS0A7KwRU/Nd4i09MEcPtK4BVJBf3Qn6sRv+qre8+tx/AGhpAEzUdrkJ2Ae4c3q/JgF4j32IwB/wryaARAASI/gnXNPnMxMBwDuXdzjrFvsJNQCGCIDlvwDMMVMvNg/mLXf6JQLAC2IGAD6mXgFI9y4kAFoAJ/lPMfxngHufdf/OJMBcHwYU5LRkBUe7ugX5Y+kE+ENEgBoBxhvLyzBOadGQePmH/eItHwGsgI401a+6AX34tU79vRJQrwH4LQBB/y4yAfUx7dvA+pxle/KPJsVHP2v14OMedXf/sPIAQwT4L/9a4F8iYOz0X5AvKSAhgGwZ54rjX2WdA9X99LtedpEfBKwrcQJK7UqB6KpL1DS8TIfCxvxJJyCWAGADLQGQgF2gL8hPmaQAaStQ35Yn6SEA2OgnEZBltvK17shKCGRY2gX7LVn6yn5XOh7KLvqGpMG+/JYeOHUP3EBjZtfTfoB6C/S3gDp+gv5qF/BnOHH0V6ZfxkUbYEqHsS4I9JFpIAISJBG2Xg+nZL3EWXrg4B5gflZAP8Ut6G/F9QpAfgBQ0ot33bZKA/4B7p7mYwf4oxFAfT3RF/ATLvD3WoDA37Sm31L2TQD9CBHH+/Mmzyjt6O+LTyAAJAiou/nzXu/yWnWGPJff1eiBG8xBNAIA91wN2IUIqCTA0FUAtQCYL0fvli+4+wu/5yJJgApuKhhKsHQse5IF9WpA/teAKUQABACAExJgSP3fNta2D7khAZ7x9Kef+28Agv+U/jeAZ7/33geZXGh4YPiAYwXUu5ACgnVlzWsO97a8t4UP1YGx4MOIf/cVL33wM37vb55hIFN4ufyVT33Mg09+8pN6Vg/w/4fvf/8H894/4B8/NpxTPv4n8E9CoBIAY3OY8XduKFtzAjICNvLoi8PuBfgyE2gKQJGrHU2mTXufjyA4AfQYWAf088JuSQkBgXoF5DVfXuIC/LTrpySMvGu+Ceqn2G1rS470afaZ45GyS7r8lh44fQ/wPE39oB+nIXnaDwjXAM6rSZA+xV7TT3HzPsBMIQHYxA0RAPqnmjTaAqcfkaXE27kH/BZABfXpTnuC/pY/BED9ACAEwJT7/5z2A9o9xQfYC+YB8b1mQHcaq4ZAkgDGUxL/E/7sJ2w0Bboxdn+yGW7e0ZQp6UCavpzObxPpTy2k7wkA1jD2EzzfAvyW2r/3/hf1/z/txOtggwhgD55EAIQA7jFtAEmA7/yuf95/9X+IBOBDtl/8ZU98+0n66u993vPfykkoqnWYVPsfshOPyvMhtTm+CSDgSVntuE9h6rUASIAkApIwyPoA+Ln/DxhNf+wJ7lqgbsxP1e8E+9WOFsDnvPNJZ7/y+w/0/w0ALQ0+9OgEA+Dyr440kD4SBIyhJEECbey7GNqd6Ssoz7C013hzuAH+5PPE5z/nj+gXwb8SPzQCWOxh9AD7Cf5R/ccPs+/pv0RAkgB1XtS5oXtsPtz3V3/7v6KKlPfjTrJQDBfiizUBZv+y7JIkEMW+GjE1bsvdpxcMtwgAAHcC/QT4hBmuvyA9gXrmCyFQSYBMC+BPIkC7cTJf8krQn+3ATlhKw5H2W9r1a8jsuzouXfTNZoiw5bf0wEl6gGdCdf4hyTrM/gIAL9geAv0J8gHvu7g95VeSvmU3TyVxqBcfCkSLcqzjehKwA/U9AOpAkKDfE1Fk1QI4+kegxiq8hN2OPXAT0J7AfsjeAvzETX81ACS2nOvcpx7rXN6TAnolYF47sgfnnYZAf5regXTcAv4qUfs3HLBey+adngRBloV9/Z7NZP2ehnc0aXm2AfaA/NaH/5IQkACgjewB1nnzjl5+V7cHVvzrQIkAtAH814EA/SEiQBKAL/7zYUAxWkr8wXAn0QKg/9EE2IcE4KuGAEi+UD4GWnYNEwgJmEiv/VRyGxFAPZIMgAAAdAI+h07/d+2HjA9grcBfd14DeOM7v/8MwF8NE0qTkw07/pA9kAJj4NywlsRvyNAvppkD4A/lIfDnxD+Bf9olAT7iff+3ngTgy//e+4d5w3j3n03fqU//nes59tXOOPFBwEu2dgomE3AmEK32VVf/6pdu80k/7JtvCQimPbUXqPOiFYAjcbdMhpG2AnTyx6+Vb9UoIK9+w99Jy7ZM0tf82QRMNbR5oql9hdt+bMkuePktPXD8HnjBC17wD4ZAP/6QrQn8AdqC7jyZn+KXcdKe+exiNw8JCcA/5vUv+4Uz1oih3uOZ51RfAkAwlESABICAiTBOmIbyXPyXHpi7B3jHCfoTzOtX5VAcwP9X/cR3bz4C6LxnTvMuHKn3TcBUqv0L6AH++KveD6jvgX2XH89JAn3SEIaf6YfKTS0C4lIOZWgazyDvz5tTCYAkBSoB0OWz6gz5Lb8r3gPs+SQCOJibci1AgmCMBED7jXxP1j1oAnBCPHTq3/LnhQ0JAIh65R3fPwsJALAW8Gg/BPQnSN8nnzEiwO8EkC9AEZArgLMs23KIRAuAySXgH5Kv+jevPWPi5Fj1mgBoA6xNJQZ0kw7wi3bAKcC6IP6QsgD8gn4AcevEvwX+//v/5VEfxLDYw9p5+i/4x42d0/ahL/97wt+6+2/Y3Kf/ziG0EpgPjZfUydaLKChfZNiraYHSMb9MnwDWNKuujHMkABuYCtQF3ykF4umnPQG6wDwJhpo2Qb72Kmve1JE8zV9Je7JN+iMNG5D0yaoz9k2V2Zfau+jL5oNOWH6n6QE+8jcE/j3xF1znKXwF6QLx6r+LO/PfZs9wyrCOgn8IgDEtAJ5fTvQFQsohAiBJADaWpxmdpZSlBz7kQzhtrEAf9xDYHwpTA4D/BOB8X6v/8/5p/vqPrH3JF5+79y+Az+sASQIQ3mV2k3oL+iUH/Ogf79tmgZ1nEgBqGVgW5RBe0lL/Fe9v3uvbNAAWAqD03jV3sj+UCPBfB0IGDF0LQPMYImCIBFALYOKHM+fpXUgAAGECyG12SADi8DG1uUgAQfSQFFzvK/chBQD7rW8E/PjjP9ADRYAo1yGok/XWLnDbV3oNYNvHAO953YvP3vXL/62/ysHHJDSMERNK6ZhKCugmPkSAJMAh4FyAf6jkDn/WA6CP4av+PESAfu6cebKPbIF+/HvQ330DAI0JzN+4665eU0LAr+o/bq59tMA/c0eAnzLtCfy1b5urzo0pcwYCANLtGmgBCFh5uWJHtozxkCuMIHkMpCcAF8CnzHDBeQXoU/I3HyXaAdotj/wtw7rblj1k9sc2e6s/8eOnfMi1/F16YOYeeOOb3vQvW+C/Av8WiN8X8Nd01d0qa8jPtC3w/50vekv/LYAxsI7q8wYIcRc6jKf/gCXsSuJAEqwJwJlHZMlu6YF2DzCPJQEq8NetNF4lAtQAQAtT7Zdt11p4Rr60IwDYjwnG81ReLQA1BHATDuBft+Smd/nxm3I9kjjEtTzLQEIAkH/juT6IAGBfwB6gq/OqM8u7dz1410kwxnd/xhMf5GpAXgtoEQFeExgiAU6uBcBAwGjvQgIAKjWcpnKffI7vAlRAtA1AHRo+RgpkGEQAJ8N+GwB5z8N/oP8XbRAEhFv3uSQEAHmNXQNAKwACwLFIwK8fAB87YYJ+JhnAVzdhnH6zuQF4J/g+FMxPSU95gH7iMpcwqLxzRQUNFeYmEsIJoI8qPyYJgGpP4M9/AoBIgQDgpUO72YwK/lFF5cNTgH/Be4L7ak838XWbNudOzlHGM8F+2qfMG9rP9RsA6iVbQIcAZ/UHuFa/MXcC3VWXticBEqDzchVwA8C1KzNcPyVhFfwL1LMM46cU7Lek8czfMqj/job2kyb7YZu91Z9dFsvmg05YfkftgRutr/wn8P/u7/i3t3zIbwiIz+Wfp/ralZShXeCP3xD45x2J4QrlUE+ipVVBv25BP8C/GuKc5N9BDVV88b8te4D3VYL7IXuLCCAuGgBgCN6d/gvMbaeYvBs5Pf1bX3D3BpB7Gi8wT/CPXw/Qbz2lnzxm1EmSgfyyHDUNioYl79KDCAD2B7SVfDpDfsvvmvYAmikQAQB/iQC0dlX/xz9JAa5hg73yejZ4DXLgZN8CcCx4gHmxcUIsMNwmBZmAM/5V2ZwkgIBIAAUgxug+pfzWh/2n/mN/lAkRAGDl9L+lHTA3GbCNAADYOg5JADh2+ulGMskAv4B+/Y9JAiTAB+QL9iUHBPzMIya/3y1Ael0BydxE8kVNiICP+s1P7U2Cf4E/oB/AT/8I/vHjYaTNbEr96B/9B2hPAkAwL7hvSf2Mm3JsflYiwLm+TQL+0QLYxq77TJ9ACjYpSvvcUsC76soY1QIQeCN56baMcQxrgfMkAYxnupZMEiDDTdsqg7Z0RoCPXaOf7d4mp/Z3V0T/I/7yW3pg1h5g3tcv/Qv8AdTHBP4J3HclDWpayYBKAAj8kWjLjV0DYPOWgN9T/x7gr0/9K/hXjZo4BYTMOk5LZksPtHqAdxSHSUPgf8if/yjAe448kcxfNFn0a5UVfjc4lff0HUCOHZPgH9AucD9EQ4aTWjQAzEsSwHKRjWfvFgLADwG2PgaI36c894EHiIM2AXsD+rZr86ozy7s3Bv+6WplD/utxDsgxEgGSAH5IEPBfSQBw2YXs8Zmw20gAwJKgUeCJBLwBrqZcCeAEHSC9DfDwYT1APwAOYPeiv/PGCyMB/MgfwP9rP/pf9R/9A+ynSQ0B7IZta+dQOG3n3wEO3f/HvxIAjA0TyjGqbr7fwHhBALRIALQDmAOAcgE6AD4N/rgNb7kzzFN9JCCW0302UZzwA+iHAH+Cf+zMMQz1w80LSyJgDPir/g+ZAjOXJ/+013v/CeCxC/BTpr3G190C/4wx/imrfWge6E+/QQBAtl2yxdMX21QwWuPRnKE8BMCrLk6TAGCzIfDGruHFq11JPO0C8/Wmos+fMmo5xleah2W2pHEpY6Ac27WvpL9IW/sy3V3wuX7FvfyWHpi1B5jff/C+3zhLtX82MQL/beC/gvDq3gXUZ1rBPOm1K9Mv7YQPgX/eWRiuTdLmoU4EaLQIgDz9F/BDBGB/2lt+pjfEAUA1VJGHilv8lx6YqwducEr+4m++57eGAP+r3vLqM0A/JFcF4xJfu4IXAFOC/ATmaee5OrChqx0JAN6lkwkA/wsA4H8hAA4cqauffAW5hUYA4B8SoH4fABKAbweAyTBqAqgFMPaOOWb33ASYjWkCDJEApIMEAOht0waYQgIAgLnvDdB9zhe+pge7uPEXkLfA1rH8+Ogf//ZvrGxB/xzaAbSTybONAADkS8bkiT+TSiIgSYHUABgiAZiMgGw3PYBPDAA+AX2CeuMI7gHr5JEAv9oJr0agz3zSmJfzkvby7YN77/1nZ5zsq+bvib+n/oB/gD9aA6Tx1J/TKTapgH/GVPDekhX0627FxW/b/NsV+EsA8B0ArwEccwHYM29elvwSgI7ZjVtlzUeAvOoi9iZP6FkkBdsp8U+TYdgNK+D/XFmEGa+m1y34x512w01fyqEdlrWPHOvXGtYVtSEBqh338lt64JAeuPGTP/3T7xT8s6ZynQrQvw347wLsD4mbpAD5VLekgBICwI/+QTZrfBdyqjfWYTz7nvZ7+l/BP6A/jQQAfsRFlXqsjCVs6YFj9gBzGBIqzXre+36+pXjIgwM0WFZ8hC+JgATr264U3FKZAY/WhwDVOqDsQzQAFgJgoNNvb++bzKm8GgDo9yqAJEBqAYDbcDfm4ul6MkkAAb9SUKkbyUkqEjAHaOWUsvWvAuvJP0SAACcl4BfQj5o3EjfAipNeSYBtQGvX8CHwBuAH/ENqjIH/VnkSAlU7QA2BbHO1TyEAIAcA645FPfFP4C8hkAQAG7ZKAqhqD1iXlWpJwfxYGHEqwK9uAb/+lC/Qd6753QIBPHUGxGMA+BIAnvar/v+yl7+sJ0EyPqdV9Bdz8R+vfq+fVy0wL9BXtuJUvzoHGFP8UtZxnur2Q4CQMCe/IzS89OSGQHtL4qcxN+PpVhoPmQB51bkHtQAq6BZ8Kw1H6hfAfGs5pMk8ttktAxnl0IYsS3tta7qzP6bYuyI2oN/4+C2/pQdm7YG77777C3iHsC6/+Wd++9ICf8F9Egnphx2z7fT/G57y7e+a0IE3KwGgyn8F/bolAJDEJf2uJ6kT6rVEWXrgaD3A+xDiahftFUgFQDmnpQAeTvyTBOAqwFzgn4bXDwFSlloGEA4FdPHuvEUDoKX6z38AaBEAHArw/iefzpDf8rs9e+CGRIAaARIBkAAcUCYJAEZ7xrOe+R9m0HrZv7d52VUgBiATbKbEDkhjM0AaVJVhOTghrgAH4NUC/kkOAH4B+pzkCv6RAPB6HQAQJ5CrAOxQN+VxQgwBsG9eSSxICCCTFNBfsEif0V7ID0D+w374YYNXAQDZjoWAOYF/2iEBiCvoZ7wkAfBj4gHEPXEXlB9DCvSTmBDoUxfBPhJ3rTP1/sP3v7//zwcQAIJ/CIEX/6N/1M9D8jMfgD/m/n/6y/2YOmccnwrmW+4xMmBsfjCejm2V9fkYcicBgBrq/k/2UVP6kqtyaqGZDrsAGbnSAKgxCbLTPhZmPPNY55nlbMoyjmlako0P/lUa1zyseyezLNo4h+my2WwwMj/8/eG//JYemK0H2CPwzgE854k/QFp3agPoR3iC8UPteaqf9gT5lGE99U+5Dfyj4bbt9N+OBQh5+i/4T3V/gD9gX5kEAHbSQgJcIqLXpi1y6YHBHgD8894bjFAC/Agg4BvDv/P7hD/7Cb29gPGScm/nDbUAJBqQ/hvBRt1vIQDy3/217BABXgEIAoB3/vL+3XvYrk/CXqumI7y+8ilP/nXIAL8LAI4Dq4HBwER8JPNCCQC6nK/dAv62EQGASg3AjE0BWgRD2gCC3wp2IAEAvpy2Y7BnHNwQA4A87IA4wfQYANsnDPAPCBT873r63yqT/ASeGS4BUCWgTyIEMqR1HYB7WUkAVMBfSQEmmMC/SkA2oDnzIz0TkjkwlQgQ3CutA/lSvmTRFKDfAv5Zb0gAHp4nP/lJZ574C/zVEgD448f8ov8ZB/u/BfT1GwP8xsm8zFPJ3E17zuVd7UkA8FzxcrlEy+KUl9uUODSJeGkSMK+6sFu0AATbSAF3ygzPOOTVmcw/7YRtyiK/ms8Ut/Ugr7WxjGzjvvYuy01faUfmj7yX39IDs/YAYPje5/9sry4vyEeiPo8R7AvucQvA9TuWbJEAgv0Mw46ZAv53IV05va8EwBDYr+BfYmC5CjDrdF0yO3IPQIDvQljx7kT93hN4pCSAgJwT+yNU+yYkwOojVz3Z0BMC3fWFRjm8N28hAIY0ACQDFgKg0ZOLV7MHeIdCdAH2/R4A3wvg32Q2E1yEJywEJ8KSAAJ9QJ1AUT+lIBLAiDYAgGVIG8CT/wT8AF0AT4sAIC81AwBz3AXHYG+BawHYrhLAv6/q/y5lDQHIVz7qj3rASj+gCYDhf63S9iQDkgBI8K9dKZBnjBJAV/sYKGdcMYD4MWM88ia/oTyHwP2Qf62r+SOdj5z4A/y5lyrw/5l/8ts9EG/ND/s/Af2QnXFthdXxTuBPmO6UhxAAXAMY+xL1RawT6zIFm1XuUqVMK1hWrrqMeiOw3lVuIQAo27KQt5Rl+pZMP+3Uz3zW0vwpay7TZdXnheRHvstv6YGj9QCn//e98u09eAbIA/AF0gnsKxFg3JQZf1+7wF5JPmk3X/wgA5DarXe9+8+9f79tA8CZ2pm9umf54n8SAEP2JAO8CnCpNoNTO2CJd9v1ADhhqoYMnUP8BP/a82QeQuBYp6BcLZhAWCwEwG03ky+mwcxz1vpdrtCctKa88AH0Ai3B/pAUBBJfbQBIgNZ/CpAEAPADbj3hryCpagD8b//qv/aq4gC8SgAItio4m+KeQ/V/Sjk1Tgtc4gcR8TUf+6ZzRMBzXvX3ezKA+yOCcsB+An76XrdySAMgQTf2llGdvspW3PRLoD4G4kmT4bqVGZZ2wgX9AH/cfIwKTRP6mH/liGn1N35D/d7yN37Nq+V2DtZ5vI+bjagfAYQAGPtf1CddGOYvrIJiAbNy1RXZmxb4NwzZCtcv4plvlqsfcrUtL/NsSdOHNO8sb4q9y2ID7InPr8qHfJe/Sw8csQfYOL/+Zb/Qn/QDrAH5GoF2Bf7Vbbw5pEBfSZ6e+KddwC8BgBwD/xIAu5z+0+2AC07wVf9PwJ8gf8xOGvLgvwJAJh5xOJeslx6Yowd4r03+8Yzkv/trEQCQAXN+A2By5R6KyLt1ZwIATYDlCsCOPb1Evxo9AOgAzAMsAZ2A/zFCgDgANeJBHnB677cBOPFPICS4v/m2j+tP/lun//ihHcD/kn/fU/7kg2+9/z/2IE8CAEJAu4BMEKZ7qgR0b/vq/9S8jAegbNnTr4JO1NBVRac+/BtCDP8WEa0AJPfa0dAA5Hsyz7i0DOEAZEG1MgG1dkkcpf5DciyvTGM8ZYZhx19Tw9IN6DePetov6G8Bf/sbWcek9r9xjFdl5qXdOdeSOed3sVcCYNdN6dVYYfpaJqjFjhE0K1edX28E3bqHpPGQEcf8LCelYciVJvNJO+Ett+lCmm+WhZ3fmBwKeyjl+b/GPe+7uJYeOLwHbvBlfNX8Bf4A6RbI149wwLhu5bEIAMG++SfoN0wCoHXyL/hn3d0VgHOKk1cAAPNDJMA3/8z/tvk3gJUQIM3yQcDDJ+ySw+XrAbRk/sZdd527AgAJoAaA3wW4wBNR3qE3efbRbKAe/os/P/in2j9SP+MQf/kGwOWbd0uNDuwB2H9OIgGcAkO1AACX2pXEEaSRhhcqJAD/KSC1AQD39zz8B3oNALQAvAKAPwbCgA8A8uGQH3/8BzZq/5zyAvqRZ92vEgCCsqmS03/KggCY497/tnITUCb4FPiPyed9xHvOMNQVQ59xL9O7mWxs2Hix0ckrHIJswbRjhYRUSaNfxsHu2CPNx3wF7ykNy7jajac7JWGA+2p+573v7Iklxj2/AyHw39bvhNe+N43+xtFdpfGVAn7c2ncB+WNxOfXnueP5wX7NCQBevmkEzcpVFz6HMb8sS7thyknlFYIh05iP0nJSds061+6hMOL5Iw4/5UOu6//3JmrZqM5h1iBtdf2bfbEt5OoRp/8CfoC8dsG24F7Qr7/ScN37Sk/8q8z8ePdh8EMm+O/DOvI8CQD/3R/rLGafq1Zs/KcSAN/0v/6XQQIAQkAtgAnqyhc7MZbSlx7YoQdQdx4iAAT/x7wCMKGqvE97AoDnuUUACPqVn/LcBx6AAOBZ5Z1EuvV+gHf+7fZ+ntDFS5Qr2wMAEE71AYMCNsBgBYqCReKgOo6bE4TUBpAIEOzz4TvAvtcBkLj50BtxuPPPtYGXf9gv9sCfD8FJAkgACMAqGEu3wK1KwDR+xyQABJOUg71lxsB/DfuKT/jjD0oIpCQeedNfGMgBNmZshHKsEvRrJxx7xtNegX8SAtXu/BDop6zXCRLoE4+0lukYA/ppyzMedu8ZcwDQ37rfX8dVd/a9ftvkLmmcewnoyT/du9ghpAT/twEBwJrIy7IagbNy1cVpGcLx3xYv49SydJtH5km6fUzmhd0ykPx0P+Ta/td022Nenxg32VzxcSg+3oQKKYaPSWnHn9MlNmy7ntxen246TksgXFqn/7sA+l3iJpAfsycBIMA3vgRAlbwD0ZwbA/9ce9ynJ9n0f8XrXtGD923XANAAGNMCgARAC4D/LLBPXZY0Sw9cxh7gVL0SAL3K//o/Ami/wDWc92uTAADoC/pTVgKA9TIIgMs4DEudlh7Yvwe4nwNjrjYAYE3wJ2jTjZQEANipDYAmgB8JBOhIAgCQ8H/G05/eq7obBvgX5AP6cKMKjh1gCGDFngBL8LUN5J3i9D+BJPYhI3CvQL+6Af74pcSeBkIAdxID2EnnxwbpO4zkAHfoW0ZyoEUMtPwcd8Y8wX3aIQGcO8wbyhXsc7rPuHmyn7LXfLj5fQeTNTkmlKVbuW3eMNeIMyZzPu5qR7PjpV9/3+aDVNdcA4AFSXArKFZWEL3q4mpqWLqNk9Jw81Z2WW7AuH7GrZL80g93NRmu3Xyr7JL3P/z5DcmHQm+Tv5ymCPo/7ZGftgH9An/8WgZSAEKg///P3buKE5nbpMuO0kxI/9bpv2BbcF8l4fhh3vhD/74nlVnjTbevrMCffOopv34SALzfpoB/iNZD5kuLABi6BvCDv/X+B8dIAEgEvgVwgfehjzKflkxv7x7oT9Y7Mle1fyUn//wnAIjcC+wh3r03AfDUk3cQ5DOAP1X/teO/EAAXOFpL0RfXAwB1/lMAd84BcoC9BP7VTjigHX/SAWi4FtAiApIQABQm+McOAQCgGiMABFxjIE2Q900Pe/Psd//NO2UFl7hbpgL+MXeSAF/0kb/7XtzKJASG7JICEgOQA9WoSVClBILSsUJKJKSfduP7LxDpI0E+Y4odYsbw19/1J702A/HwlwQ4prZGjts2O3ONOM65OSQEwKIB0APt/qXMi3kPs1qnUZoHeU4xxp8iaxk1TS2vq8LmR9ht/2PjBeABvAv662l/C/Rv85MQYDN3gadLV258GY96+g+QFtiPgXgJAQhivtODhAgYS7NrGGSAhIBgP8G/wF85dvLPfmSXr/63BvNz3vmkWzQAxggASID6DQDdfgsAEmB9otgqcvFbeuBK9gDPmmt9T/R2a/4lIbsmEwBJBKB9hobDogFwJafjUul9eoA7PYAUrwUA8jEQAkOGk1/icOoLEQAB4PcBAD0JngCcgEb80AbAnuBfAoANRmoACMaUpNeO1AAgUScHUB4LTAr6lZTdAv36AcQF5cokAAT8gHz8BfzaBfqSAErDyZM45m1+uKvJcg1Lv5bddlQJqMdPoI9kzDCOhxLgz9gzHxgbCBpU/zGME4b/kMD3I441btYlZZ1HzlXitOz67SN5rm4zAoAlSCBcwTLuCqj3dWfeLnvHLjfLrHbrcLvKm2ye2ASq0j8H6B8jBSQE2HCu/40Vc2n5lR5o3f0X2AvWdSvx157gf04CQJV/peA/paBfmeAfUiM/+MfJ/3oelB7YzfmJX/vJPzb1OwCc/o8RABABagEs/xZwt3FYYi89cEAP9AQAQF4NAE75BfstSbgEQHyXxj3FAVVZki49cAV6ABDvfwoA3KvePUQCEMevuee1gEoEoAkAeAL8c2oM0MedYN9T6SGQNQbOCHthp04+95f/EzRiB/gqKzBON4AadwtYt/wE74Ql8E932pMMaOU3p1+2K+21b6obQA/o/6oPfcU5A/jHn/iCfuKMkTeUW/Of082cI7+hubevP8THK+55bb9JdaPKCdU1/zeArHSC47TrhxwD/cYbi0OY8ZD1p1/Gwb4tz7HwmpfuWvZt5WaD1d/bL/f6t6n4jwH7fcMkBNAQoF7dQDBGt/2P+/AAZwC9pgJ/3UrBP+9qT/6VxplLJuAnz0oIAP7rnf8W+GejP8dgQwDkNQBO8Yc0AAD4264BEIdvAaAFMAdBMUcblzyWHrjmPcC7fMV7gGcOYM9H/lrAHz+uARDOGsK1gYUAuOazY2leuwc4LQCkoA2Amr8n/UMkAP5JFkgEqBHwwk//jv4L94IoToW1V5mEQA3TXYEaIBJi4a/deNzZ3/7IF/V2/DRzAkWBaMoExdpbANyT+gxL4J+gXjvh2pVD6dP/EDttIL1tUe7aj/S///oQcI/BTT6EmR92wiAG9DuWZA6Rd8oxu3NuXwnoh1BDSgDwXABQ2k/ftfIVII/JCuRbcVugvMZrdVyNk+7ME3/roX/1y7TaKRM7P2W194HX7c9Gxb+Afk/+9wXwc6eTEEBDYH0nPMfpug1Lsz1saLn7DwEAkK4EgCBewI9bu+D/zT/z2z0JgDT+HFKgT15JAqT91OCfTmS+5DUACYAhEgACYKoWwN1PeMKbmwO1eC49sPTAnD3AWr8CyPsdAEkA/91fSvZknv5DGqyv67gvmLNeS15LD1z+HuCjQaguA+gB+Z70jxEBkAV+H4B0EAl8KBCNAIgAgPq+YKqmE8ihXcAJ8uojV2d/6c884uxRH/ros7s/5uk9oFQjIAEn+RwCMAHEpBcYD8kK+AHwAGtBv+70026clEkG6J95kHYuQ5vMq9U+2z+lH+n7NK00hHMVAC2OHKtW3H386pjrTol9TsPpf4J/CACeh2v8LwDroibYQh5qEpjXvGq56Z6zDrVc3Vnedbbf6DdJRcX/soH+MRJBQsD/NHA73Mn29F8VeqUgXymg1y34V6L6b5y5JEBfEqDacbfAf5Kp/leVuU/VAQJJAKDCLwng3f6UEgBjHwMkvVoAc2kqXOfFZmnb0gMH9gDv5801gCQBeI9hIAC0C/7L6f9CABw4CEvyK9wDvFjrtYBdiAC+D4AmAcDHawFzEgGAQQAjoB/wD4DkJBlC4Cv/zP+0IQK4ew64E4iSLsHfFFAJEDZeCxTrl8BZe0sK4lN6yj8kySfjm69+uueQ2R7ttB+7/TCXZFwgaxg3tQTmyjvzqWMu4CeO9rkkG1W+jYGUCOA52Od/U1+xJUTQTbUTJGufS5p/q3usw1xl1XyybMtq1ePK+6WKP+A67/WPge0a9vCHP6L5tf8a75Ru2sI3CyAE1qCMDd+1+bGp9fQfYA+gFuAD4qudcPwF/Zz4C/wz7qEEQIL+PO3X3gP/jgDYpvbPerq+6jHrmJGnBADfAthGAPgdgDECIK8BLFoAsw7XktnSA60e4L3Mer6C6OWZBtyDaVjrWRsx2DH4C/7L6f+1fr+3Om7xW3rgXA94LQAgA6jnpH/b9wHQFDBeEgEQCmgF8OG3QzUCOP0H8AP+AW75Xwdwk/+LPvS+zR30ev88T5uJn2CxZRf8VkCsWzkGwMdO7QXyyDFjHsa3vKp1oP9USXrakPFtU0r6BnfKVn/t4sdYoAXAGOW47JJHjeuYtmT6YZ/TcPoP+Od50Xha1T1Yt9sLhfbaZu1zynNrVcMxV9lknXk1iroeXmyAUIPmxBxA7im/cleQDvj330TtmvYY8YfIiF5DoGuzhMBV1xDw9D/V/xP4C/gT0PNfXwD9SL/2Pyf4p6zWab/gH0m9qDMGAsP7/pCprKMYNKmO+Z8g9iEApl4D4FsAgI/rsVosrVh64NL2AO/rDQnAegERIBkA4MfoF/f+SYPxfX9pG7hUbOmBk/UAHy+Ddfe/BUzRBvD7AJABEAFcDeBqgRoBEAH7gi8A/+d8+Jf06v+Aff7N3NA3Bgj3K/RoB3DajBvQCOAUdCYwrIASt8BXewJj7IBnTrEF0WnXryUTvGOXAKjaAIJ+5RAZ0CpjFz/bkhK77W71zSF+9D999RWf/OL/hnQ89snTMSSt9pTVjnsuwzwD9EsAsHnFzXODOdnDevEF1Zen7pRpp8bpxj5mMj72sZ/5EEd7lUNh6a8dyY88rs2vPxlZq/gL/P2YH+D/EDAOAcD/iJYIAISnGct7CLCPpZkSZvlDcXsNgY4Q6P+91UOAbXVVBhsCx9N/ADUgPoF8C/wDzgX9SQrMaef0P00Cf8F/Pfmvav+nuEbFhwA5+d+mAeB3AbwGkFcDtBsnrwEsWgBX5Ula6nnFe8D3vKB+1bWn1wqA4F2TvL1f528c03Rey2/pgaUHsgdWvIBh4Xf5PkDVCJAI2FcjAIAI2OLjfwB61P8x/elr96/nIAKI0wJ2EgGcNvdaAV06/MiPNFPAJ2A4AbFuJEBbWUG3/krjvvJRf/Qg/yEBEgM7pqZNdxIG6T+n3Toi0wjK8dM+h6TfGcN9/y2gwP4igL/zTNV/T/49vQL8X+Ov/+f6UEGxbl+qKUk3FG5Yxq/2LLfazVf/TGve+8jMT/uVlZx++BV/gLCn/MohcLyPP4BbIgAyIA3+hgvMJQx071PmrmkoayiNhMBl/4YA6qysO0kASAIA5iUClBXgc/pf/Q51q/Y/BP6pn8B/7OT/VGsoBABaAJAAeQVAMC+4V0oAbLsGAKGABgCG+8dXduFYKr70wNXqgXz/j9mvVquW2i49cBE9MPR9gLGPBBrm1QDcP/fAO/rT0l2JANX/Ae7YPeGXCABEjpEBpAG0ZTq0AtQM2AC67hS5gtv8n/eC4ATIgHDcyqpan3EJg6zw3qXqlz/zT367/5eJkAIY8zPPdONHPhrc+xrzbUn86Atl7ZdD3RAAnP5DyuySVwJ/0ulO6XgeUwr+PfVHYm5j9f+6NAnKt0nSbYtjeC2jusfiGZYy7VkP8zVc95WTqeIv0E85BIDn8k+gr0ZAEgPpd0rw32qfhIAy40gIoCFwmf7TAKr/gn/V/yUAUh4K6qemv2rgnwd6iAAQ8KeEFPim//W/TPp3gGoB8EHARQvgyi2dS4WXHlh6YOmBpQfsAVhsTjc58UTFn2sBU74PAPj3egDS7wS85Knf2v/nAD4WCLgfA2yo//PFfwA0J+cASOInqAdMQgbct9YKGNIMMC35oVGQ5QpGE/hXP0Bxmgr6BeTEwW5c4gHw3/XL/23z/5YhATCQApzGYIhDXDUFJAaUag6Yv+VNlZmu2q2rkrZjT2l/HCrVAuBfA2Kfmh/jRdyWdCwN1z2n9N6/oJ/nQSKA5wOCy2fmNpKCZWU2veVnuGEpsafbuFPlIWkpw/RTy7t08Voq/gL/BLansgvuqzxV+YeUIyGgNC//0wDvxWPeUR+aXGjnse5sIwAA70MaAFOB/bZ4edqvfYrKP/Wvav8QLENtPob/ox/zWa+uGgCA/iENgCQEttnRAlj+I8AxRm3Jc+mBpQeWHlh64OQ9wMYDoMP3AX71V37twX2JANJyPeAV97y2B00QAQB4QL2AzRN///UfIJ8wiYAhMgBCAWCZZABpMl80CPhwoH7KCkQrGYBbgKwUfOvmdFu7knSAePoLwK8/QJ+6QQRADqARIFlAPNLQTiRhEgXYyUOSwToMSeMartt6mI9u+gF77Y+53IB+xpoxH8qTMSFsTOa4aT+WFPwz9wX9SDeyPBdX/YNiMywoAmhlZqmfMsO0G6bUf19pPtvkvvlfinSA0FTxB6gK+pEC10V+2ux9kRoCEAJ8cOqYkwL1eIAz644f0VMDALDP6f+pNAA89RfwV3fv/09/eVNPCItcM2mHmlMQV8fst1beEA6f8Xt/c3MFgGsAhxAASRyQFwQABqKhVf7it/TA0gNLDyw9sPTAleqBx/+FL/lFiQBO+ad8KNCrAWoEqEGQWgGcoEIGALYAcoB+T+oB9qjue9oPgBwjA4iPIR5kQBIC+rfAYoJOwSmgXjtSoJxSEK00jPgQAIB2fgB9/fAH8EMA/OH73/9BJG7jAvxxmxdurxHQ9hYhYVykdUGm3Tj66bZtyFMYxqH2LWMyVLZhjhvxtB9TMh8B/oJ/N7FKv1h9pR7i01VW8F1L1F9JeNpb7prH4u4+dvSlX/LFZ3/rC+4+82N++wD9esq9Tx63Qxo1GWpbIQL+xl13nTEWxwJ8gH/WGtadPP2XAFAmEbDtBH+fcE/6m4Cff+23/sr/lPv+HCpchBYFC0clAATwym2n/GPh5KEWwGc/4+t+dVmolh5YemDpgaUHlh64Fj3Ah6X4V38QAZzmA+x3IQLyegBkgFoBqFX7rQBP/dEG8D4/oBH/JAME95yWD2kGcOoPGQCYI48xwCgABWBrR+puAe8E6gJqpOkA9X989vu9yr/5GAao54eUEMANIWBcJKAfAgEDGdCqR5a9iz3buc1uu7bFGwvvrwF0mhpD1wBa40N++qddv2PIBP95gsUmHEKA+cozcC0e6otrxAL89+x77qYnGG2d/G8D94RzJz/zWey3agu0wL/AXwLG7xzsOZxDyW74UV5P/1sEAMBfEkAtgH0A/liaMfCv9gFS8E89XTeryv+pPvY31KlobKAB8FU/8d3nPgI4Bux3CVMLgI8BXoSGw1C7F/+lB5YeWHpg6YGlBw7uAV6iEAH82799iQDIgPxooFoBACtOPABhgHxAo0QAYL6SAYB84wKWf/zxH+gJAYAh8TGQB9sIAOILMJGCcOxpAMJDIDzjEQcwDwEAEZD5YZcAqBoA+BsXSZsgWdAWmIsAyHrOAewzvzG71wAYM+zErf3ecuN3KlPBPxvZ1ALAzfy86I3swQ/xvBlUML9L7oek3aWcaxOX++j5pX3sAv4hMsBwQb4EgB/m03+RD5EAU4H/n//vPukMQz/ONcEAjl69GwL/gH5NgnDsgnlO5bVPkfXbAQn80676v6f+FfxDlAr8kayXGPYNc/XRvvn8ue7fPlYCQIA/pxYABABXdPat55Ju6YGlB5YeWHpg6YFL2wOVCPBqgKr+XgHYJtUkgATAvO1tP785ab33+T+7IQJaZABg0q/8D10VAPxDBEwBkQJY4gKOVVdPUG6cIUlawgD3f/C+37iFACAMoC854BUA3Nz5z7IA/YB/tAMkAEhP3aYY47Ykfqc0jN/XfvS/6scry7W/UmI/tWGzqtq/wD8ldrVVLu1DuVTs2vcABIDAvRIB/os9gLxkQIJ6gW0lAMjPsIx/DLvlII+R/yF5WrfMg37kqgUGf/oY0F/7fo6Jh4o6JLhEeEv1X+CPVPVfCdCvQH4K+DcOQB97Av60C/4lHfLUn7om+Bf4Q2agPThH/xyaxxgBIBFwqFQL4K/f9djvO7S+S/qlB5YeWHpg6YGlBy5tD8B0oxHACx+NAEA8JMCu1wP414GSCJACXBH4yZ/6qR6UQQR40g94lAxI7QDIgLwqgJuPzk05/U+wSf6CUYGqRABu7QB146UUwEMA0J4E7obRR5IDSQCktgBxSUs/YvwGgHVK6Ul+ykoQEN/wTHsKO3328g/7xc33HCwz+w37RRjmleAfkJ+gH0IAN/Oaze2i+n9pl6HbpmJJAIwRAQBUQfYYGWAeStMkCJ7DLriuco68j5GHwB9J/hXwp5s2HTIBAaae+vMeZT0S/LP+JOhPu0A8pSf/gvkK7nW3ZIL9as8Tf8qjHtRN4J/gn7ZAZlzUXf+hsUC7omoAePKvnIMA4FsAy3cAhkZh8V96YOmBpQeWHrhWPZCbGICTgD5V/VvaAIB9ADEgK8PxJy3yHe94xwfv/8H7+zhsOrgegAFIVjIAEOl1AT4ouCsBkKCU/AXt1T4EYolP3WgTJEYlAAjDP8kBgD+EQI0rAZAfErTcKgX3An/C06/Gn9vNOGDIF8DPGAD61cCg3ZAYfLPBshPw46c77frtIqdqfPSk0jc9dPLPvMII+pWCfzbmzPELemhRlU9zs3OPmYyLffmdvgduQo7O/ZX4FgEAeAeQKhOcaicMIFvJgArIcc8JqMnPOrTk3OXtUnfbnml2Af62h3z2nV5o0nlaDvCfCv4B4ABxT/9TelIPiMdeyQBP+SUBKtjXbT5KgX+Cf+tMG7gaNfd837dfW+ke+chHfsYQAXAo8M/0fgyQ8lr1WPyWHlh6YOmBpQeWHriWPXDnYx73jZyWojINgALwSgQA6CvQhyzA1DDjSQaQB34QAgIzrwkAMAWhagagEbALcByKm4A1wWnaTZsEACQA9cKPcCSgnv5IcgDV/9957zubBADEANoE1uEipf2bkvoA+Pm4H2AfzQtkC/hDANhnSvvtlDJP/ZlH28A/m9xjfel7ZAEQxAv0V13cFf96EMPpWssYTty1Mb35dd7L7wQ9cAOwjpnz/rMEgOBTKfhX6t+Sgu4xMiBB8b52yqnlqz6vJNz67FvOPulqmQn8W/Wu7Ug38feZT7wn86TfdShlnvhXe578JxkgYFcK6JUCf4kA/VOaFkneVd1f4P8NT/n2d9GOq/AvUSEnKgGQwH0uO9cAIAEu4J2xzzRc0iw9sPTA0gNLDyw9MG8PcGLKBoHNAieqAGLAPCrtgnncgDAIAP0E/i1ZyQC+GbAhA7pyvCqAfNGH3jcLAQA4BeQmSB0CsIJ82gqwzzQZluQAAB9CQLKAvI0LMZBXAwg7pklwr93yBPrc5QfopxkC/Zz4A/yzHy7KjmYAJ1X3NU79JQKYp2x2nVOQWKi0zvtkjOYmUAe4nwP83KXFsJEdM8aDICiEAHma/2gllsCDe+DG5z7p8b/0whe+sL8/ztf7131/UMaVAADwpwGYSgIoE6xWu0C4kgGAasI0u4Js0tWyBP1VGo/67lve1PqRf8adAvxti5L6Vvuug/o1T3vm/QBu3hFIAben7JIAFfTrzhP/Cv5xA+7Nk/x1j4F+CQDTkU/Wp6r5X6BG1K7d3cdnPfycdz6p/y8AqPyn2n/aDyUCyGu5BrDXEC2Jlh5YemDpgaUHrlsPcErwkqd+aw++AFcAXokA3JIDLdA/5JdkAPlBBnBVAIDHfylACwEiYKpK+BzAVOBOewDumSdh+FFXQL9hxE1CQALAqwGVACAdcZQC9DkkJ/kAfE/z0aLw2wr+K0a/ryDZomq//5YRd572286Lkow/dQXMA/CZbxjtbrbxw44kLuaEX/wXmG+APxvWBPyolHKPNQ2bcEz6EQ8jSUAekgHdurLqzEIEHH+BvfHFX/bEt7PGPfBjbz7j38YB3hmTQ4qWAEjQL3CufrgBq/oLtIck8QDHLTIAf0CvJkF0y54AmfIE/WlPP/ytJ3JqOa2yqx95Vb8x4G/ZtkE3dRzymzimN3gWIcVZ/zGC7iESQMBfpeC8SoG+IB5p3llWy55pWsBfNf+rqtoOGVoJgDmBfxIHXgNgvCfOjSXa0gNLDyw9sPTA0gPXtwd4CQOqIAMAWIIxyYAE+wDldI/ZkwwgHoCavCED2LhABkgIAAaPCUYB7Gg0eKffsiQAJAdwc+qPu6UtQD60peaTQJ+8072rPdNzws93E/x2gqf6An3qKsj3Xy56wn9ZTvntayTA/4Wf/h1nzDXBvvNNoI80TD/mJXPlROB/FPgL+gH5qJJjnvnIpzwP8/XPfvbLX/LSl7wWqR+SOEkMSAZcUiLgJvWjzpCELcMHxTDEgejoVkcIjMv+2xAA/BcP1rJnPP3pvTYA7di38kkAAEYFyy2ZgDrtgm3kkCFvQPMQGUCYcSq4NqzmLeBXZjh5ZX5pb+U/1a/mY3uQhFkH7GnwT/eQ3XhTxpPnjzUFoM1/goEAEMAL0hOEV9CPW2CuBgBu7YB/3An6tbcAv36WaV0oh7XQE3+B/1VQ898yDqtKACRon9MOsfC5//CVH2Td+v+3dzbA1l1lfSczzMv0SnQjWnRGEaszKpSpDNIJYDRYCOJbyUwRAtGYjzaTEIIQoUxMbEJMDMQpI7w2oBgGCUwRUqoidRRRpCRUy8doRfweiw5YaZVxaAozkvd0/3bO7+S56917n73P97n3uTPrPmuvvfZaa//31/r/17PWmdOm3J0IJAKJQCKQCBwvBOj4P+Prn/chRushZpBdhABCH9mft68UA1gzwF8UKL0DILer9BCAJEPcIfQQd7YJEtNSHGAfYgHp5tGSBnEoBQD3YyH8bhuPNsZj/jIdd38EAEg/+ST60Tqyv0uj+557tFxTiT/Xm3sLjNvIP2kSf+KSf4joBp7GGfmncx1H/B3RhyxK9t98552/9ou/+Ivv/+0Pf/hjf/CJT/zxJz/5yb9i2gyW7Xvv+eCn3vu+932UPD91xx1vURiQOFMmI9CFELANb4ATtAkydM21V3/stht+ejImMILKsVMxYAOXabEqTl5wwXt4lyEA8Ef89ttvj1MCRgsZUQCABEPsSxvFAPdBYKMIEOOQWLYlw9GSLtmWPLutjeS4TItlEZf8a91vGR6/jKWs8njbjo3nar1Y2hK3x8RH3CEVU4p45yAAQL4h3iUZN71LBJCsYyX+xCXz0Vp2tHG/ZUn8Jf+0cypWjb5PR+CxyawHF//cbY3rPwTdMIb4//hv/PbE/DFumpay8QLInwPc5OXNuhKBRCARSAT2CgE68ggBjLoyGgtZi2IAhH4e6e/aH8UA1xhgxL0ZoX/nmdMFlhUEFAAg711BcSBOF5Dkk0aA0HI8eRUQsOSLZDfGXfyQNAl+jJum9Vi2TUMMQQxw2zy7bnXz5x6KU024zpH8KwJgHflXBGCtCo5HmNrAAwT5p2PdzPOHlEPOqZvnQeIP6Yfcc+8qjkXCD+lHEChFAYUB0ikDMUAhgDoUAqajetW0LbRprX+0YQzZn5cXAWGN10uBZhF7wBoAUQB4QAaYTJaZEhAFgEjijUNaIb8Sd9PLNLfLfOaXmEdr2RwLkcaWoSTN8fi+uMeV5Y3djm30WMk/+2yD9a3Kjn1oGFV3GgBkvI2cN4S+Xo8kigCSdawj/6aV7v+xzBiX/Huc5Ufiv+xUlbF4bCp/FAAk6322j+R7XMwT4ywGmD8HuKkrm/UkAolAIpAI7DUCdDwYecArAIIGWY9iAMRm3YIAo8BOG1hEEICkQ9xLAYA0AoQUMg/RJw8dQSxpBMg21jIk35aLjYH9tPP6K94x8wbwmLF2ld4QY+teJD/nLemP00q6iL8L/Gkl/1zvay+8+fSGHp4Z+XfUPxJ/yDqkHaL/ufvuu597HqIvkY/u/m1xpgWQF2+A6CWAZ0ApBOgNUJ93VQe9AVYOA/Uwcj+P0C+6n0XVpuewsrazcN8y4dJLL2lG/SX+0cYpAWPchBUAILeRvMdtiW+0Evt4TBlnG0Ic8xKXNEfrsdQxTwyIx3XFJeK2me3zznta7xQE83bZTRB/2kn9Y286vnG835kKgG0TASToWEh63CbOMaZJ6ks7hPjj6k+gTbvuVTMW5zI/o/KO/GMl8UOs5L60XcfqBXDUMS0xzu1EIBFIBBKBRGApBJjHTKfEOdyQOjrOCACMrEGMCF2j/0PSo4eAwoIeAo4S40bO6DAkEcI5RBSQzEeiHuOSXQUAOoHWS5ygMGBejlcoMM42I/+Qf+Y3KiB4zFjLAn9jj9lkfkf6I/FHLIqu/l0j/lzPMtDxRUDY0Hx/nodO8g+Zx3XfEX9sJP2Mnse5/XQsy+B+PQhKMQFBgDqoi7wID+sWAVY96t8nElDXUi+dcDAEdNEA+ewTABADWqYEVKH61qgCQEnSIyGHkLptvjJN0uz+kviX2+aLBN40rOVhS0GAsgjxWOPuK49/48/+zOSmG2+c4f/d559/RrnxmBjfFPGPbW+9WD2JvG94v7sWQCkAQNwl+JHUS/ijjfkUBuIx7vcYXf2d448wd1xIqgJAF2knvST4bncdE/fHuALAhqaT9dxtuSsRSAQSgUQgEdhTBBgpZT5dHOWFMCMIIAIoCEjih5D/tjwcX4oC1EFdzU8O1it6KwzYgYqiwNgRdIUCrAIBpJ4AkSUtTgloEwDIgwAgMVqGkO+aAFASfkf7OVc8NXTj7xrx51qVgoDbCDpXXvDy0xtc3OoQ+cfbhY43RBxCzog99zIkHeJPmqRfog9hN3B8DKZjzU/ZigGUqWimNwD7yUs5PGP166Gqw8o8ARjd9r7clOV8VvGau/B5z51ARBcJp069rvlFEjw44sh/WzxOCeDa9bVdAQDCK/HWRhJs3H3RlnGILGmEGI/bZbr5IfLGsdYrCdeaLmnuEwDA+667ao+ca18yYc0EftmFa2EZXTbWZflY61yXpT1916xl3wHvHtcBQAjo8gKAvDuKL6mXyI+1bcR/jPdJy3nsXVIUAEoPgEje28i++0sbRYMyzjQA1gLZO6CywYlAIpAIJAKJwA4icMCaAbhsO1UAUgdJh7wjBigItJH8sWmlIMDxpSgAEY1TB2547DuaBfVYVA8SO1YYgMSXo/lsIwBA+N2vaIAIgQiwzDQA2ogAsEhblxEdymOpH/xYyE/Cz3WOhF9i30b8JfjmwRpnH9eKcs859ymv2eC93Un+GaVntB+yyJx93fQl55BCiT6j9Y7YQ9jbAvvNrxhAWXT2KZs6EAKYVsC29axaBNgG+UdkwGtoFdeVVfs39cf7xF8J6CNlCgCRdEfiLTl+6uMf3xBftmNetyX0WvJ0xePx5tGyTxFAa37qkpT3ufNTFsG2cww/m4gIoBDAvpjHvLEO4pH4G7f8Mdb6rLPtWPNgx9xvPJ/co4y8IyIrADjqL+GPtiT/ztsfYp3bT33Uy4j0qkSyMee9C3kVACL5l9CX5N30LlvmZzuG637z7RMEgB+4bWNTy3YB4mxDIpAIJAKJQCKwfgQYvcWdUjEAkijZo1OtIADhIT6W/Lflp5wYYh7d+Bm1UhSAvEI4IbQQW8UBiK6hJMHb2r7+YXesRQCIokKMc55s3/olH2oEE7ABK0ZQHd33eiryiHFJ/ucRf8rh/lgVQRxxd0P+CRWEHQJABxziLfnn/mRU3lF/9kv8yc9xYcG+irLqwEh9DKQ1gbzWBbFXCNAbgLoQyfA2iCKAdU3Lsd315ri/bZF/vQz6SPTQM9mkAIDQwPXgvocss/ZA3c6qbGsUACCekO1o2+JlnrgtWYfg9sXj/rZ8pmFLIYA02gWxj1Mq2CY9hki0FQ8oj/SYz32WIdmPNpY1NE4d5o1x09os+crrNHD7BO8ip3thI+lXEIgu/BJ+SL3EHhHBIMnnmwjR53nn2d+gl9PAU99ONsg45D8KABL5kuhL5sv0cpt8kP0ynW3r4r26nTPOWhOBRCARSAQSgWOAAB1/OlWQyDg3vPQOWJUYIPmPgoBu1lF08KcIcfeNwgCuoIoDXQLBJsWARQSASOiNa8u2k86UBiwBz4VTL//NBhN+qhGcEG7EFau3RRvxVwSI5B+ir2jgMVsi/j5xzeg/nXA6gnTIJf8u0qfLfxyNL8h4VRema34XMTe9qa/O3/zCQBQCFB4QGpwSgPeBIgBto94pYbA+z2OQ5Rwk4tuyEKFBje3JtGkBQG+DOCWgHKmNAkAk3ZLsSJKJm46FvMbtmNYXZ1/cbznz0qMQEOO0C+KOGMBIP/P7iZdtl2zHdI6L+SPhN+5xYyx1jMkf83Jsz23Uu4vriyv/x3/387MFARUBJP7Rdd9pZ3w3uMch+nzzKCdJfi/UzU4EgNe8/ZcmhEjwI3knHrcVCLRt+2Kax2sRARBi5rcucyQCiUAikAgkAonA0gjw0UUMwDsAkl16B0DQnSqwakFAAqswUIoCpEtsIb10+qPXAMRJz4EugYDpBXGKgaQ62pKAz9t+4dmnej0AKNsyYtw0LSTfEPO51oFrHIDB33z2jw9N2xAb9okRRF4yH0m/xD9a9yMCsDjgdMS/WvqGWqyATvKPCz73Xxv5L0b8FyLidXPPEALwBugSARAFIO9LigAHEJNtEf9Y77JeANsSABACeH8wBx5iHM8jCgAQT0h4tMTL7TKP25DYPhLvfq15tW3ppmnJG+Meq6WtCgHM80cQcFSf4wjkIS3ul+xHa/4xlrLL/G1pZZ64zTVZ7NXwkIcwSo8ACsnHA4AgyS9H87kPeD55huv6eCfk30gEogAQSXsbue/aL7H3GK3p2re9688aIQGxIRcCHHmhMnsikAgkAolAIrAqBPgIR+8AXcwhlpDOdYsBigJYhQFsmzhAHgkwiw8yOq5IwLxY2q4nAcJGDPxiQQyMFhlcsLDNKjREwg6hL7dNk+BrJf+SfNYngOjTqQVjzofzhfAToodExMZz1/aRf8m+FtIPLpz/lPiv6vZZtBxIeOP6L/mGaOOCz/nr9h+JN+SfY+qwKPGvDz30NxMC9AbQC8G2cO+zCCHbCAS0NbSD4wf9gXkk4duM3/zSOyZTsjSo7WWmbQoAiACsCcEieH0CAGRVMo1lO6Z1xc0bjzUOuTWOdbu05mlLL9Mg6uRvs6ZJ8sGdcN111zW/pIAoAPlvxJC6nK/72kcfmutPXcsGcOoqg/Z17SM9Xp/yHpq3zbPG8QZFuHQZn4fcYvt5H+kBIFHvIvDuH2sh/jFw/Co8khY74zwqEUgEEoFEIBFIBCICJ6IgAGGEPEI2IWYQIoJEvSSo69y2TqwkWDFAMjzPSoixigecHyJCY+s4HgduE2+263QIfCT1MR5JvkQfks9CVrSJdtLmSPQj2fechuA39Jw5R84JEQRvj2U65PEGWUG8Id7R9R+vFH6Gj3tMwg35hwgULv+rIv+exhkiQPQEcGFA2ua84TFTASiLX+nA42KbpL+sGxdpARhrty0AcE0QamK7uTZ6AUj2S5If0+M+CLjbpYXIRrJfxtkug8eQLok3ze2+cmIeyzAN0s/7iDUREAZIXyXx5/xpq5Z4V6DumNdjuA7Td81ggSxey4xvHoE2AaCN4N/5+j9qRu/b9pHm6L773Y7EP8Z5L9Znm14bm7/kWWMikAgkAolAItCNACOFEBhGMHG9h1BCLB21hrhC2ghjSOwQotuVh7oj0ac9cXsdcc/Zlal1S2V7HSS/69xJV0xQCHCbfZy7pJ+fhuS6LTPa231nLLUHYnDG6L/z/pl3D6GDPLeMuK+DVFDmGW2iDbSFdsX1AFra1AkGIgYL15UEfNvbeAHQts6G9+zYpgCAEFM3repo3gmEgW963Le8AhIqmZegs20gzf1ayGxbuse7v9w2XVvuZ9t9pW3b5/GS/rhNGnP9Gfkvib+EnDoMbWnuw3Lubse4afNsPAbMeWY6rk0m7zACXQKAhB8bQyT4kdArAphWbpuuveNV9y7ljbTDkGbTEoFEIBFIBBKBI4XACUZ3dGlWEIB4SkQVBBQFVikMSHpLkq8IEG1XnGPjvrhdxq2H86Ru3fTbLOdp6CPwy+yzfDFmmzbSPkZTmK7AtYE87+hdB9E+cPSfdkIacPnHtZt5/x3kf9Uj/yU8TbvqxEPCBPe6iwLGto3xAqAifp5zl7wAEAC4T0oQhmxvQwBAhLnooosuHtK+aZ4D7i3ElzbPAIgrQXKtNU1LOiTY/W3bcV/bfo/Xmt/tLks+RQAtaYz84/bfJgBI+LWUPS9wruYxXlr3a9lvCCP+OZI74gbdpawIAJBxCT/E3bjE3zTIO2naeSRfst9mKSdFo126E7ItiUAikAgkAonAQASYE820AebzuX6ABBvSDEmFsDp9YFlhQFJeWuvUsr8tbto8G8tX6OBcliHwY46V7Je4eV5gjVcG7v14adSXax864GeMtDvKDslzru+SC+4NvHPPyHZInIjrAegFsOhaADwjkO5dEwEW8Q7ZtADAlJBF2hmvLsdHzwDJK1ZCXlr3aSG/MY/bpTWP6Wy3xSOpb9tvmvm0CACEUgAg/xDiz/mQN4YyrdwmL2kx5Ih/vMP2O857SQFAYi/xj9vGoyW+SHjPb/xFIyTkQoD7fe9k6xOBRCARSAQSgRkCjL4xzxhRgDnoQ4WBIeIAokIk5xJ5ifEYOyQveTYhAEShRBw4V87PEX4JPyPKOzSnf3bdB0Rmo/8QbEZ/2kbYx7jZD6hzTJYzBArbGD0UWgSKuXWcc+5TXsNzsG33f+tHkFhkLQBW4d/U3xyX/7mYt2VAjOkSAyS4kvg2CxluSzct7o9x9pfbMc19En32xbjlQ/5pJ/vKQBmkYfsCx7NfG+NdaaQTkvi33VX7nYYAwC8uxJH9GJfwKwq89Y0PkH7tIgKAx1x5xdV350817vf9k61PBBKBRCARSAR6EYBMQTqcQkDHY6w4UAoAEPQYFATG2jYxwHKXEQAcyZfgR28IR/exeAfYBjBBOHEePyP8i87Z7r0gm905G2GH4CMSMaLOom6MsOMJwDkuQq5XfBqHRAraRNu4bqwFEL0Aph3XQdMTyAt53jUvAPAegx/34tve/vafXzSA4zwBYQGX/zGnMMvLVA6ENKYKSKwlum1WEt5G3CHR7u+Kl/tjvlim+bCKAFrbFck/5QwJHGu+rjj73Wdd2D0h/rxjCPv85zls6jwOGP1XAIDUEyD7WuPug7wTj1ZCP9YySDD2HbTPFzfbnggkAolAIpAIJAJTBCBZCgNtXgOQeYi/LvTzRACJ+1A7TyxAACBA4m0DtiT3kdBDdAgeE9tMfQTKjGT/ygtefhpxZE9H9+fdz3RoD82x1/0fESAS60V+am9e5SP2n9FO2nbvPR/8FNdToWIRLwVGnndNAFhgDm4kKGPjB7j09wkAq3D5H3GtZ1kRaMACMSAS3xjvIumRsEOg47Zx07WmY2OacW3MR5z2sM+R/rFCgMdTBiFuG8caIP47Kj623Xtcz7Z002bXewcjtrHNrrO5MwFAgj/PSvzNN5b0x/zpAbDOS5tlJwKJQCKQCCQCe4oAowMQ4lIgYIRcDwK9CCTqWEl2l+0TByDrUXCwXAl+F7mX1EvsaR/txHWfBfqYrw/Bx4Ufl/Ap0a/29NKMbTYd24pRV64ppMKf/osL7EGsw8j62DpWlb/xAtBTwWkAXH/aSts5B86Fc6oD5zboj2vP/dosvMXc22nQNX/T9uQFF7xnUMNXlIkFH9sEAKZYvPrVr769rmbra1kgQCkGlJ4BEnIJemkhzpHUu9/jtG3pMc0Rf/NjSZOkjyH+HqOlnr44+3ZkxL+NDJdp3Jll2rxtj8Fu8s92lXWazr1fhcD2IA+jOt/Cf5Dwt7/2482ovqS+zyoARBtJfVecef/lvsc94vIrFm54HpgIJAKJQCKQCCQCxxsByBjEDFLNwkJRMMCrgAC5gpArHkQBAVLWFSTxEnq2KctyIfUEyBTEnpFeCMSUIB7vC/Pg2Z+A2CsAgA9kEHfvV978yp9ehlQ/WMXKYnTID4kVTgOgzbSdKQycy1SsIP+gP459xZWvau41yT/2jdf/6lbWB2AtAM5lUOOXz3TiuS94/r0IKVEE2JTL/4LNr7g3/UUByHEk5cZjeoy7X3Kv7Uov95dCAGWTh3StcbbLYP6udPdjCc151ue7IFbLHCYJjpbyfLZieltcstxmy/zLtHORY6mfdlXTIKm3Xc0+3iWIT7xXsNN3C8eYv46u/o/6hgoArg0QBYKxQkAUARBZV39GWWIikAgkAolAIpAIJAKJwC4gMJtb7/x/3L0hf7r/LzqqvoaTo2N+SACgjbS1nK4w7aTTQR/8x+gqAtJbbvngzAOgEQPqubjYTXsBvPBFV39qcOOXy3jiX1zyjI9FAQBBBQKyXLEbO/oE965igCQ+Wkg02xDuaGOern2Sfa35PDamEzeU5L7cjiSffW6bT+LP87cxJA9XJBEmlTh/prVZnre2UNXphrb9bWVZX33oWv4OIPNgy71DCF5OVV1jJfEn3XxYtjmWPHXgfNbW1lfdUE9Hm87/H2oXJf56AiD81ueUf4lAIpAIJAKJQCKQCCQCRxSBQ271zqsvF9YLHd61dXYH4EvdTcedTriCBW3taC+d88F/nCOu5ZD9UgTAE4CwaSEAEWAqZgw+jwUynsBLBgEguPxv8zovcAqzQw6iZ4AkHTJNcBsL0XY7xvvS3CfpdxtLGaRrjbNtkORry3S22YeYwf09O6vNR7j+3gPGo20j8jGtqo+fhTBqPksL+z0ulm+8zrbyv8brCXxxdX/y2TfcTCCuxxPvF4k/aXgIEYgXYgFtp61r+cObbSjxJ5/k32PcjqP78+Jbvu/WgmMWmggkAolAIlAjwMcYd+g6ysdrn/9O4FqeH6x9voTZ9i0j0EqoyxH1qQCwC++LM9rLQoCrEAC4Dpwn6wFEwt94AUynAygMbNIbYOoJsDaSUZ924wEAhidPnnz2lu/HlVYPiYs/LxgJu3FId1tcUh9tG/GPx7LfILkvbST/xGOA+G9xxF/svdewZZCsR1vV+VoDfQ0Cz5VxbEv+WJ511tlWTq4puwJjSP8zH/4Lv/J9X/bJz3zv2R/5PeJPO/sNb4qCAKQfYUChAEsafY6ph0y1hjbWRT7wx/0rmR9qI+lXFOgj/Y78k2f6E59WnzYRSAQSgUTgCCFQXXPt1R9748/+zISOLor2vp4bH+J/+p+feP+T/vJfTrDM8yatPp9dICr7Cmu2+3ghcIhQM6ceIsg0AKcA0AndZQEg/mSho3PLttdfBnDUHxHAeBQHNiUE/OBll/7hGm/LA86X67zGOrZeNKRvnhgQybxxbCT+CgYxjTykkxZtJP8l8Wef5H9HiL/XqCTgbkeSTryKIRJ84zyHBMiycfdpYxl13DqsU1vvWslfM/pPvweyD/m/+Ku+cD+BuEFBQDGAvIoDegrwvHAOdatoM+1cyx/v4ZL83/1TD/wcYEyX+Me0IQJAFAeO+jtgLRcoC00EEoFEYNcR4OV+04/f8Of/8zMfnXxh8tfNT7hdd911jbvhPr74Gf1/xJ9+8wQBgPCln/1nTUAM2GdhY9fvo2zfkUJg7wUA1yxAvFiVAMAVpnPPIpIl+Y/bxF18UrsOUeCmG2+cfMf5T3trejut5tmDkDZiQD3i/tTHP36uB4BiAKTdeGkd+ddG8m+8FAF2jPhHcCXeWom5tqozN0Eij5Xklxa8owjg/nis5dXWOqx7VeSacg5oBySeEX/Jv/apj7j/tAExQK8ArHGnCyAo0f5pe1fVxrq4M//GTAVQCIg2kvyu+HTw5MzKMyURSAQSgURgfxGg4/je9/3HyT33fGBy1113TYj/zWf/uAnv+qWf2ZWfFxoEMOfCQjXXfObUaYk/QsB5rzu38QR41suedd8lX/GGSX7QBsGZmY43AocEAEab8AA4rlMA2m4F3jeQekf+2zwBEALWQfxjmS+86qoJpLWtjZm2OAKQOL4VkHEIekns3Y4j/jHufkg+6dFK/KOlDuqCiC7e6rUdCZEtg4QcWxkieZfQayX8WAYXIMvYmE7c/JZl2bW1ztiWOnnhkXbLqWgHJJ5Rfok/VuIfrZ4AWkUABATeC7R/2lbKX+vfGBFAL4ChIgDv/bU2PgtPBBKBRCAR2A4CfIBx/VcEuPudtUtrPQ3g9//0A403AF4BegPULeTju3N/jOrjwQDxN3zXRy+ZPOklPzK54bHvmNz6JR+aQPyve9QHJj9R/WVjs8O8c5cxG7RbCOzbIoAVnW468XTAFSxWtQZA36XhZywh5KwDcNdPfOSMhQLXLQIwDQCvp7425r7lEODeAmMIevQMkOSXFmJvmiP/0bYRf+7d5Vq51qMlylqJeCv5l8BrJficYwwKAKaRj7j5PX46ol7VZ0iwbtuyDMnm2Ebs5L1RCgCR9Mc4XgCQf8M2BQAwKUWA//T6Pzv0KwGR8EcRoGvUn3Q8p+qy8y8RSAQSgUTgKCPASAckGk+A37r3XY0IgBigNwACAT8JxYd5WzjQGQj1V3TIvuaHHvPLkH2J/+2/+prJi5/zANn/ybP/z4QA6Zf4/9CX/5dGAEAMYK0DOhvbOp+sNxHYYQTO+BlA59RDruks03mfPo9VfR7LdMKXhYG61/YzgAMbd4Ar/s0vvWP2awF6BCAAGOLI/ariTEdIr6aBV2k12So9A/iJSIl+JP2mYcvRf7cREnZ4xL9Eyue7Icz1zqWJP+8P3yPESzGgFAIKb4BViACcy+zdUc7/j4S/LR7XBUAIYC2AbXgAeKEg7JL7PqsYQJ4uAeCiiy662HLTJgKJQCKQCBxxBOjMP/vkc96E678iQPQGwCuAlae3NdpEp8uF/VzkT1d/7A/cdvNpCD6k/xWP+bvJrV/ziTMCxN/AfuIsEnjEL22eXiIwFoFmUSzeCXTMefb4DfhPf/rT/0BHk84y6bsqADAViLbSZtoO0aCt05FEycxYTIbkr/AuevWLaxF1+vOAkv91eQLwzuZaDGlc5lk5Aid4FiDyUQwoBYBy9J/803tx5Q1aU4GSZazku6rjlcQc64g9zxrBkX0s96iB55HQYFfj5zbWPPFYy51i1tQ7bUds19jnujkXyqQu3hMuANhG+NvSogiwbQGgxqNZn6T0BlAMiMS/j/znuwQk8y8RSAQSgWOIAB/DN9/12j/BG4CR/1OnXndobQDWCuD3ocm3SXjoLED0Y2CBPzwAcPFnlL+P/CsIQPqJ3/ktn2sC8Ysfc9Pnp9MCxnYiNglB1pUIbAoBnoNDo+r8FBSk+s133vlrkmreAdNOOaRgW3+HpivQNtpIW2nzlsSKA6cGRAFAEUC7Ci8A6qmB3yb+27ruu1bvQUNqCzFA8s+IP98YiPGuNXxOe/wmYglnCAASdL30IvmX0EeSL/HnWTWOjXk8jncM5REon/dNEAJsi22zrXNOqdndnAtlURej96sSALb9TgTXV93w/kPTACT9CgJu6wXAOxN8hwCXeRKBRCARSASOKAJ8iPECiFMCEAJ+/3/8wWl+KYB0pgxs0huADoLkHw8AyD+L/EH+If4SfOzLvvTTzbbWfae+4a8nt/2Tv5ngKfCvH3Zbsz5AmxDA+deXtqrDmA7FEb0b8rSOIQLc97N59Tx7jPx/8pOf/KuOhQCrOv82npVD7eS5ZYqC0xX0VoBETDu3G28n2OGmj1cAIZL+sULALbfecuh4ytq0EFtf5/wbgADXBcLPaP9UXK4GHLZrWXi+YpBwcy5NgOy2EX/OH2IdST3PggGSCunGjhECFAGsv7a0yTbW0cHvIY6Zzf+nLczlZ1S/bbS/LY1FAl0PIHoAbFsAAAT+EE14H7aJAQgAd77+j5q5/vkOeQCv/J8IJAKJQCJQI0CnBRFAIYCpAYgAbLM2AAsEMkWADs4mlGPEhkf93CObFf39aT9W9r/yK95+iPxD9iH5UQhgG6LP6P93Pfx5k6/6x181qb6san5v+V992fWNIIAHwc8/6r4mH3GOJz9rBYBFfiTzsThGCDSdYzqy3PddxJoOPp3MLXZ46fwf8lToEipCGzm3bfwdQH5w2b/96jfMiPxYESAKCAgL2ziRrPPYIOCz0rwP6rM+JADwTPHtJ/CeMDh6L/mPpF/iD+F+9OU/+u+whlIM8HjKs+zoCVC3p5qGKALY5npX7x/5GpGTelYlANDW6btmaDt6G7mKnVwfhIArr7j6bgPbtHUV5WcZiUAikAgkAkcMgSgCQPydEhDXBvjwhz98/yZWouYjxqJ/igBXnX9LQ9wh6QZH+kvyjwDAiL/E/8tfVD34U4G3PvL+hz3z4c3PNJ185FWNRwG/HKAIgHBAeQgHzPOkA3LELnOeTiLQhsBsIUA6inTOcRP933/7t18spwHwbNYFVHXYZKd31oFXpGhrI23fskjRhm2F634UAiKxHxrfpAdW20lk2rFAgOeM0En+FQB41iTtWsi/xF6ij4X8G9yO+zlG4YCyKJvnXAGAOqdEuwpts63YeX/kacTDVQoAtJFy6zCkDXW2/EsEEoFEIBFIBHYQAeb7OxVAjwB+IQB3VNYD8JcCiG9icSM6BYzKv/DsUxNG/yX/0SoEQPwJkPezzjprIvF3KgHWqQQH93zl5OxfOLsJTDE4+aTnn0Y0oA6mDhCYbsA57uBlyiYlAqtGoOkg27mnk+zoOlMBGEHiWWwh2Jvo+FLHIYGCttAmfvqPQFtpMx3yLQkUQ67HCUbxhxL+mI/FvoZUsME8h1bHRyxFcOW9SyBOWhPqdygEr25btcH2LVQVJJP7CLEFQZxQF7SJe3zWXupHMOJe+cDjnvIFwnv/0aMmhNc+/CtnXmprEKc5T0OnAEC9PGcKABJ3LNc5EntJP/Ybrn33u+O2cfMrHFAOGJQiANdmCRGA82oVAHDtb3P5L9OcAsDUAX5CkPZOr0E1xa02+ZcIJAKJQCKQCOwhAnzYWf2/FAEQA/AEuP3225tpAawNsClvAGCkI4b7PqQ8kn/j//4rfueBqQH1aP4//+ZzT0PuIfuR/LOGgNvEy3De686dle/6Acz128PLmE1OBMYiQAd5RrLpgNPBZWX9z9133/14AUCKSC9Itu64Y+sbmr9pV515tkaBbaNN5UKFdMinJGHd7Rra/jPyMS1Acs9PCRrvs1yLMwraQgLYI4pC8plW9XVf++jGm+rJ55wzOe+8px0KpPFzeeQhL8dwLGVsoemdVYIt7WIBP9ppQMRQyNgE/tQh6Zfwz7P8HCVEufPkxu3oJP88UwhrkfxHAYC2EyTzknst5L8M7tNyLGUoAHCfrEgE8LwaAYDyqWvsGgDO/1cAoJypALCz75pxlz9zJwKJQCKQCBxrBPjwtokAiAJOC2gWCax/KhCPANYLoAMFMVgncJSv277Ev7S48r/4OW+YjfRL+LWlCMDoP2mIBVEA0KsgBYB1XtEse8cQoKN8iGgzyo4HAIFRdjrovB8KEcAO9qpPx3IPtYk26J2wR6P/h7CJIkAf8WffLsz955rzjoccQ5TbCH8pAJTbHCPJ3gUhAFFZsq+V9NNOft4Pi4DRCAH1+R+6iPVGGJUud43ZrpirHUf6If6fOuuRzah/lwjAfsPUU2FMnW15fd5Gj/5L/iXz2pL0l9t8X82reDBEBKgbX02D5Nu2t50XaexvFQCGeAA4+v+9Z3/k96IAMPU2og35lwgkAolAIpAI7D8CfNj4fW2nAZS2nBbw+7UY8LJXvPzv1+0ySYerTwSAuF/3ba+f4OIfyb4CQLQSf9Kuv+IdjWcBUwDwMnCxQT72+3818wwSgUEI0EmeeQEw+kZn3J8E9BcBHKFj9Cu429sRH1TRgExNW+p8DfmnroaE1qNuiBL33vPBT8X1CWgreXZ99D+edxQB2jwBSJu6/lfxuE3HJcqQ4ZLUf/f55zdpQ63HKwSsiLiOgoT7SFIfbST9kP8Y2Kc3wLTNB+KCeICgMaoR08wIaVzjSP4l9VoFANz/jSsQmAd7zrlPeU1dLM/N2D+Pwfrc8TxXChxx9J82l6P/kHeJvLYk++f97H/7IqFMZ9tj2kSABbwAPJ+IA2kLCwBMB9ADoOUXANrqi3VnPBFIBBKBRCAR2CsEDnD75ScAGfnvmhaANwBrAlx77UsmN9144+Saa6/+GJ2EdZ2pIoBrAvAzf3oCsKAf2ywe2CYCOC0AS/iB224+zboB/LQgwUUAmW6A0IBd57msC6MsNxFYEIGmo0yHn/sesgThZioA7vZYthEBJN1rEAFoQ0NAJB7URZ1tbaGNtDW0Yy865LQXkk9oWyCQdM5tweu49GEIKmfVbvuQ5DjiX5J9Sf0863Hmo0zKpg7qWrrBAwqAqEPkIfQxSPaf+vjHz4h/236FAMrQa0DblFt/Lwc0o8nC9X/f5beelvxHMh/j7sfOy7+gEMHzYuC5a5692jYCAO0kcI14zngWCdybPJPl6H9J8CX+3/POP5oQ3C7zRREgegFQF/USaANtUZigjdP20mbPoXz+2W7OieNpc5wCMNYDQAGAdk0Fx7K+urr8SwQSgUQgEUgE9h+BCiEAYo+7P94AigFa1gZ44VVXNWsEIAiwzUJG9amv5ePIwoCQc4l/tIgAuPMjABAY4We0n/BdH71ktn3997+t+SlApg0w5x/vAUQFyv32E0+fPPFh5zQLCtLx2P9LmGeQCAxCoOks07Gls0wnlw4zLve42zvqrggQyfe0M1zVtdgZH1RhyDTrqFMWHX2ePYkGdTrvHw8AttlHG2nrtP5F6w7N2Fy0WRTwsrsmt9UBEQDS75QAcN9cSw7XBK4QcwivhD1ayPyLHv7oL8ZR6UhaiTtaTR7yKgBoLY86qIs6D7ditVuR/CM8ECD+kP5I/BUDFADYJh7TORbCXwbEAMjrgJY3C0JK7ttG9H/noS+afPx3Pz/57+//RIMl5H9S/7FdYh23F/Cq4Lkz8Pw0ZLm2MwGA50sSzvPmM8m59gkAkv2Lf/l/nf6x//r3EyxBISCKAFEAgKC3iQC0o0cA8NnnXMq/5pw4nueKRfxcA2CMAKD7P22b9guquqK2+sr6czsRSAQSgUQgEdhfBPjoKQbgFeDUAIQAxAEC3gCIAIQ1egOcYLV/vQBKAeBZL3vWfZB/V/onztoAjPK/5txfa7wE/Ok/yD9eA4z4Q/q/8aGPa+Io/dPOVH7g9/eWzZaPR4D7/dBUgCgCuPBeKQLEznl9fEUZdaAsQx099Gd6U1+9pyLE0UaJhuQfAcJ5/7Rpn8k/SPAuhfwrACgC7AL5ZwE/Sbo2kv5IOofEIbmKAZanGEBd6xQB/JUCSDzkHaJOvI34S/SjRQBQNFAYKMm/2+TjPub6dv3xXekj/+L52cv+4X6IP9sIAr/17g9P3DZPacF5Sk67qi/Tef748zk8QwCIz2QpAET3/0joIf8QfQj/O//8vllACCDMEwFGCABV3XbaHN839ebsz/NaeAoA7v8EBQCeT953dQ3WOassI4lAIpAIJAKJwJFGgE4Go/xvvuu1f4IQgCAA+ceyRgC/GkBgCgEd3RoMOxpL40LnAKLOT/c18/4f9YGZNwAeAFEAgPyzTTqkX3d/RAOOhfzHEX+8C0Z2oJY+nywgEdghBHhOCTMyLhHXEyBOB+BZZD/EgOemRQioKKsOdtK1pp8x0ijJoGzIv1MQIvmnTuualm+76839+OMcogCAR8DUk2ErJwCeEPFI/iHpT3/iyYa8l2Rz0W2EAMpUCMAqAtCGZU8eXJkTz7ucciHlkn3jjvybro3EnziEH3KPaMCxbkv422yfKz7nN4T8L4otx/XV34Ktzw129mxyH+qJs6gAIPnnl0TwXuAPEQ9BoM0TIHoB9AkAegHU7a2mwXZjOY/yj/SK9xPkvfQAiF4AMe5PATr/XwGA+4s21GV21VfWn9uJQCKQCCQCicCRQ+CAjzUrGUP2EQGcGlB6A6yic1ejdwD5p0PGqD0/AdjnAYAAcOHznju57uCtjWAA4Yf4M/f/FY/5u8nLvvTTk4sfc9PnGZXZZuf7yN0VeUL7jIBk4NAK/HSeFQHo1LMwINsIfOyjY6wQoBjAM09nuS2wj0BegsSfsninsBAp7v4IDljqsh7yTzvhVQ30XnbEOfdXXv6TzWJ/nO+2bxjIPwQ3EnPd/JchpG3H6hEQ66Ju2rAIDtw7/CzeVeffMiHg8cVPwkLQWW8Ags83IxJ/4yXpZ5t9kewTd5ty2oh/TOv6lvCd4dwJbbisIo1rxvMxAMeS/Ff1MTNBjufL57N8NuPIP8Td0f/S7T+S/wckgMkEAcApAeb3+DWIAM27jOvBufD+KNcAaCP9MU0BwPn/QQBoExsGwJ5ZEoFEIBFIBBKBI4QAH1nIgF4BCAF4BOAJwJSA4A2wzFmf0KWTkftI/h3Vh9A/4tZH3g/5J9AhZOQfsQCvgReefaoJigE3fNO9H12mQXlsInAEEegUARiVf+/73vdRiDk/EcjcfNLiqJ1iQBQEJPpa9kksyC/x1+WfshkxjIsPku8okP/p/VIxUj31kELE2NofxJQRbgk5I/8QyVUQ0r4yqMOpANRNG2jLCCCqkxdc8B6Jv+QfCyGHzFtuFAMk/9goAJhOO+KoP+TftEj0u+Id53Di1Fd/3/3rFAAsu6P+ElaecQP3n6ERAfieDxUBJPBYSH3b6L8CAM90FADisUMFANpGqNtcTYNt93zq5NlfM6WJ9wbvGDwAIPMQe4i+ZL+0eACQVgoAvLOmdVNX/iUCiUAikAgkAokACPBxpFOLV4ALB2JdG4CfwJp+QBcCjLLpeOEJwMh+nAZAHFd/1gf48hdVp+kI/vyj7mtW+Ocn/n7wof92cv3D7mgEAOIc/2Nnv2fo4k0LtTcPSgT2FAE6uHSsZ54AEnZIOj8RiFt+FAIYpY9igCP2EPe2EEk/xyImxDKpg/I4lroZxdv3kf9duxfAFrLrav8Q8nWOUJeCAHUpAtAG2kKb5uHE/SDhZ8SfuNsnn/T8054TpB7yLrkvbRQAiEv0sY78E+ebQ5mS/hg3TYtIXbYfAipBLzFo2/YaaNvylGmWz/SHsv6ObQmzz3rzvNd5z/AEAG+ff5/b6AkgkZ8nAOgBUK4DMJT88/x3kH/aznnEv+a8yK8HQJwCgBdgFAF0+49iQBQAEDm5jnUFVR3KumK9GU8EEoFEIBFIBI4vAnx0IeyM/iMCRG+AZdxe6SDSyWI0HwLv6D8CAIHF/Uhj5J84q/sjGLDQH3Mk6bgQ6Axg6ytUHd+rlGeeCHQiIDGYrQkgCeD5lbQzWo+7L2IAUwMg8ooBEPiugJs/efEooAyORwDweOpI8t95bVayg/chRJeR8k2TfwksxFURgLYMmMd+INm//op3NC7/UQBwxJ5zgqhHMaBPAGgj/5QVyX8k/k8+62tmgoDkX1uKGNzLi5B5MRpiFQBYsHHgzcHz7TPuKHpVp50hAEB8ffbnCQCQe0b5IftxGsAq1gCAzC8iALR5ACgAONofxQDjCADO/+e86dOATx1SAKhByL9EIBFIBBKBRKAXATpA/DIAngD8VCBhoKtiZ7l0SCDxjuQrAGDv/JbPNeSftQIg/8wJ5QPeWVjuSAQSgTYEJAgNKaADHMkAzzUE39F7Xff1DIDQM4cfkk8gTpqE33xROIjEn7qoM3T620b62tqdaXMQgKRCaCHKhE24/XcRWeq2HbSpJNDxVJjvz6j/q1/8rgk/6RrJ/4VPuboh/IzmQ/Yh5MZL8u82+yX65G8b/ZfYRxvFgJhOvPy2Md1jqABgPgm922DX90sA5APHgQKABBbrM97pARCf+T4BIE4DUARACDC0LQDIMSvwAPA84q1C/IwpABB6iL0CgGS/tOwvBYCpBxI45V8ikAgkAolAIpAIDETgBJ0H5m3ecustk0svvWQynQM78PD2bHS2cO1HCNAbwJ/3g/zjLUAHpv3oTE0EEoE5CNi5bjrTcW4wRI2gEKBXAHP3IfWQfQk/pN9t9pEHN3+9BST+lCfxDy6/En/akn8rQCCO/m+T/CsKKAL0eQEg+kL4GflHACjd/xF6IeaQe8ohSPS7LAIAQRLvcVi9Atyn7SP/5CmnASBaRCLvOZfWPKUt85Xb5CeMEAC4g3yutTxjZ4gACHAEPQB4PvmOt00BUADwZwAh/M75J04oF/9TAKA83gGUTaAe6izfBUEMrKbt7Xo3cF7N+dB+ynQNgO89+yO/B8HvEwFKAYD2pABQI5p/iUAikAgkAonAogjwYadTRCeLj/6i5XgcH3cWAGxEgFoIiCP/dZ4kDQKVNhFYDIFIEmYuwnSs20YHFQR0/4fkS/RNG9LZr5ta1aGrg7/YmeRRIFCdddZZzdx/fpZPwlkSy7ZtXN85tiuwfxFBgTbQFtYCoGzaSEPjH98MRv2b0f/C/R9hgO8JBByyj1UM6CP/7FMAiKP/liXpj7bP/Z98HBvbjQcAmEjU23AlzetgPm1Xfo8x3wICAM2MzzbPWkOadbePgp8iAN9bCHufCCDRd76/21hIv2Ho6L/tqdtXTYNttf1t3/nmXHhH2WY8ABQAXvXE/9ss9leO/rONAMAiwf4CAOc+FR/a6qmblH+JQCKQCCQCiUAiMAgBCETpLjnowPZMJ5wSwLx/RmEovz1rpiYCicACCNjZnpGESBCiGMCI2bzgCF85yle3q6oDdVhfHV34j3LyLyCA+AI5Pm8B1/95AoDCAPkktH0ENu6DwNIm2lYKw9wrjPgz+m+I7v+XP/2HG9IPiYfUY40rAED0YxyiThr5JO6kEUwjfd6IfxQHzB+/PXi6KQB4vmJTWkm9+dq2y32UQfkjBQDvCJ8xLM9K82zX9pDQx/lEAYDrQ+gSAST4JeE3XbugAGA7Y9uJxz/Pp6Lt0QMAYs/PAZcCgNuQf/ZHAYB3VF14VYeynlhnxhOBRCARSAQSgURgGwjQSSk7j9toR9aZCBxhBOx4N2TB0TnFADrcdJj7AnkIHOPxNV5VHSjT8uvocn8DFpVbroI9PBpMILjMF49kckh8qACAELBI+XgB0LZ43bhHmtH/KfnXAyAKAM7/l9RrJf3REo/EH4JPnZybAoBEXnLPPuPaLmGAdAintwZC2Ace95QvKAJA2A0S/FIIKLe7ro3lKACU0w9sQ4+V0PrMSa4bAYBn0+eZb2spAswTACT6pUWsh/zrSYDluw1u4EU9He+Hqj6X+I6w3W2n2LyfeA/pAcCIfhQAIPsQ/0j+id/x1L/4f+SjnbSLttQVULd4tdWXaYlAIpAIJAKJQCKQCCQCicCRRsDO94w01Gc7Iw4Qt7ZQEP6qPsbjLW9loEHWUhA8DCck8bGPfdxCrvpRAIB0RmLKNuRXLwBs3D8kThm0LRJZrt+VF7z8tCP/2igA+PN/En9JfRzxl/grBkD6JfHEJf/EJfla87mNbRMFSCdv9GzjfmcBP85Nwt5lwUjy34dXeTxlE6Jwcviqz93y2fNZnHkA8AxDgAmQaQg6hJrAtYkiAKQe0lwSfrch4MTjyH8b+ace6qNu8KtbX02D7bO90caTNH3mAUA9CgAQfIl/m2V/yy8AUDfl5l8ikAgkAolAInA0EeDDy4eeDzwujHRosHz0+TAfzbPOs0oEEoEFEbDDrbWj3mXNp12w2v7DJHb5znoQJ8g1xHgI0SxJaJ8AQF5I6DICAG2ibVEAYA79bOX/6QKAiAB9AgBEXDEgEv8YLwUAzo1j2gSASPwl+WVa3I4CAMhfecXVd3d5AZRkvm27vA5sm0/yj8fFgmKXz6CWZ/YMIY9nCGIevQAcWY+E3rij/KVlP2Q8En/KceSf8jsEAN8ltlP74M39YMx9nQJAlwjg6D9iAW2nXfSH6qKpP/8SgUQgEUgEEoGjhUCj7NfuoY4QOSLSZpuf1qs7knR0NtS5nv0eeTkKwfb0A13VV4SPNB///EsEEoFjjgDvMogZdjqSeMwRechDwGMR93xI5xgBgLxtxHVeGm2jjV4ovjHzBACmDjDyLunXSvjLbUSGKAD4jRtC/iPR74qXI/F8W/ECQASQuA+1kn1tPC6Sf3CrMVvm2ydplmhXdXkzT4AoAEQRQDIfrSJAtOyP5D8KAH3kP3gA2C7b2Xeu5mkVAHDvHyIA0EbOddqGvvq8XdMmAolAIpAIJAL7gUBD/OsOsp0gLB2huD0vTgebTg9K/irOmpEMRn742cBnfP3zPsQiTzE4+oON6eQlcBwdR86tbk8q96u4KFlGIrBnCPBOkqTxjqqbX+3ZKay8uYzQQxznEfG2/X0CQDn6D1FtK2NemuV44nieRQGgbQpAFADi9wsBwG+XcUWBsQJAOQ2g3PY+w5YCAOfy3Bc8/94oAnCekcyPjXO8AfIPTmK2oJU0YyXbhzwBFAH0BOB7z7caa2A7igHGTS/zS/4pk0Aduv4vSP49fc6jVQB4+zN/9+MKAG85/x8mhnL+P22nTZRTB8rLv0QgEUgEEoFEYP8R4GPLnEs7SauwigFT8j0aJIh/JPjGIfrGJf5uuy+KAcYRBJqfHaw7SKj5oxuUByQCicBeIhAFgIaYPSACHOuOPALAouQ8CgDR1T/GIaOLlo84wLGU5w1XCgBtiwCWAgDXuvyWQfxpP+mKAZJ20tjX5wHAfvNjy+24r5wCwLnwPTz11d93P14A0RNgESFA4o8Fb75xdRXL3tccb5gJAHXaIS8ARQC9ADgvQxQBIPol2Xc/1mOwEn/JvwIAddfBtti2OmnQuZK/EQCoAzKPSz+j/3oAvOnbPzsj/4gAiAKIA286792/Ql7aSZsoZ2Cddbb8SwQSgUQgEUgEdhyBPvL/jQ99UBgo4xwX08rOltuIAdPOEB/juX/kldRHki/Bj2kx7n4tq0KzH6sQoEUMSHfguZciMyQCe48ABCQSM+K8k47z8w8GixJ0SG8k+21x8kBM5430d+2nbbTRm49reO2FN5+W+OsBgFcA73hsFAAg96UHG22KxJ949AAwf58AEO+jvtF/8rUJAJwP5wI2XSIA+zj/aIl3Bcg/YToFTsiWsZJsLMS7IvC8EKiHAClGACiDpL6L6Lsf67FzRv6pvxQABvUl6uPI10wdjAIA5B6S3xD9DgHg5m/7Dz+NYMBxU2xpw9B666z5lwgkAolAIpAI7CgCdIQl6tghhD7mN952XBQWWC+A0NUpEh46DXTouoLknv1dcYl/macsk1WlV+AyadPTJgKJwG4icIL3XCRvxEmbuvbuZqvX2CrOfZ0CgKIAxLSL5Pel0zbaKASQsH/zzJe/HwFAEQDbJwD4bdI64u82NpL9sQJAeT+V233fOjzcJPicq8G0aMs42wbJP/iI1QosJNcg8a7qtEMiAAKAo/YSeGybVwDtI0j4tR5HWQTFhak419RZ12sbbNMYEk7eA8qlfj0AIPd4ADgNgJH/X3nGFxtPAEf/FQBo67Q9tCP/EoFEIBFIBBKB/UYA19jYGSrjJamP2zEej4vpxBEBJP/RMgpSosdHGlJeEvWx27FTyLFsd4Xrv/9tk2effM6byrbkdiKQCBwdBBD6SoLGNu+uFZOnvQANcg2J7CPhXfuiB0BbGZBSBQBsW56usk3nmCgA1KBWeG058o+dJwBA6AmO/MfvlPtIk/i7v+0+Ma0c9S+3Y7554jL7wYpzVQDosubBxsDxENQ13HSRbEvAK66DXgCRsEvgsZJ6xQDaF9Ni3OMk/tgB5H8hAYB2MMCAWz/kXi8AXP7vvugzX0QAwCoAXP2tl72M/LR32qYx9a7hkmSRiUAikAgkAonAkghAwO3wzLOR1NtxKjtNZRkQ/yd86xNayT8duzYBACLeRdQl8l2267iYDtlvQt15xN522V0TO5Lnnfv0H10S0jw8EUgEdhiBci0AyRrvsr7R2h0+pYWbBhaQRwn3GDtPAKAsiLEiAPnHlE9e2kYb4wlCmH1fKwTwfvebcPJJzz9NvXyLnAIQv1NRCPA7Fu8Bv2HsM720lBHTym330Y4hxBxyyXlK6qMAYFqXxYugxmfVo9KS3DYBgLoqAoQ4hkjgJfVRDIhpxjmGuKQ/ljetR+EBG9tTbw7+47gDym6wrgk9XgBRAIDwKwBI/tmPAIA4SBvrMqo6iE0dzb9EIBFIBBKBRGDPEOBjaGdHG0l+jLvfDhPbJbk3j7aN+EP6UdO7oGJf06mTpNc2kveh8ZLk21GU7GN1Iy3tcRwJ7LoemZ4IHEEEKt5DkrTSloTzCJ7/7JSakdAFiDnkHNIruYectpF7CLx5yN+Wpy+NY0qRGAI3E3ARcadCrgIAU8Ickdfdn2scRQC+UZTt94z9HmM+bHlvtG17XNu+wnthhntXhHNlET9wayP8LBxIusIIWHSVtcL0SLol41VdfiMAaCNxVwiQ2GONu6/NxjIotw7Wtwz5r4tpSDtlHFoIEIIfRQAEgDj6z75i/n81Las2+ZcIJAKJQCKQCOwhAnROJOt9ViHAjpEu/Cy2FIPpXXZAx7r6kct+6uMQcjp1kaxL4O3s3fzSOw6N4rvfY9ymLMk+aSXZb9umDXt4ObPJiUAiMBAByAfvvDbSRhrvRsjIwOKGZpPEDM2/iXwVBJ0R5z4i3rZviAAAOV5UAKBNHFuDUJVAsA6AIm8UhRUBEKc51u+a3y62iZch3gfmxcb0sXHOfVGPEu5PxIALn/fcCaSfAOnH/uBll/5hGyYlRktsO8KtpahOEaDeV8UQSTznwXYk+3F/GY/lTOMKALH+etfoP49vBAC8MsCX0f0uAYB09pOP/JxDXesuPsOjwcgDEoFEIBFIBI4pApBxO0dYSX5Mi3E7Q5B7SH8k+eV23Gd8yEgI7vdthFwSHwm88Tai31XG0HQEg2N6W+RpJwLHBgE8fXjHdRE73lmr9AbS9RiAiUMs6mjF9jb/+BZALttIfl9anwAAeadMyT+2y0ugqw5HuduwYRqAZL9NAHjB+Zc3I/qQ8HIagOSfa29cy71AevQc6Lo/SF/l6H/beUL2L730kgnhhVdd1YSpANCWfV1pkmfKJy4pb7NVvb8JkdwrBMQ087XYtnJtA5Y/7QNbw/43bactPottAkDp/l/M/08BYBjWmSsRSAQSgURg1xCw4xsJfhlXEJD409npWshPkt9nawz4cPb+Ofo/lKivK18KAL2XKXcmAkcGgYYI9EwH4L0HQZ4KAXPfYX3AUAYj13WeCrGT913fdKi+sla5j3ZB5ruIeFd6FAAi0W+LQ5S7yulKp/wp7q2ni6u8IgA/DagQYJpeACW595sW07nOpisAKBz0kXzayLFl4JipwNPa9oGJBz0CwCIEeGC1ndmosyHRtZUIl2mkE6oYIP5xuyXucaW1PuvBLvrXlEVbmI7AveU6AIz2Q/wNLAyoB0AKAIvCncclAolAIpAI7BICVUn2u7Zjh6iP3LMPL4Ann3POIc8AjxnayU0BYJduk2xLInB8EIDklyTObcgc70hWn4fUTV2BR4PDsZJ+f8puBSRxdDvaDuD8x47QDxUAwG/sFAPaQpva2moabtmSfck/1jR+Bpa6CZJ9rdfWb5x5uM7sg/xHLwD2l2SfNMsp7RCPN8+jx84EAKYC6AWwBQ8Amyj5jmS8jJcE3u2qLoTANpbgvjZblmvd9WHNX7ltep/lmKZ+BQCev9ILoPQAQCggf31sNT2+NvmXCCQCiUAikAjsCQJ8yOiYdBF+0hn5j50ZOkhdI/8Q/nlrAMzrxEXoUgCIaGQ8EUgENomA78f4/otxCB/vSEaeWXkdYXM6stnZTF2eycCo/6kX3d2MDOPCzq+dTIlF5/Gb2sG5Q3DHEPV5AgD7x4oKeAPQBo6lTfPOnzn2kfwbVwRAhJao8y0zHq9rjCsAkFcRIIoEMW9XnDrwLJnX9gH7GwEA1/+bbrxxcvvtt0+uvfYlkx0QAGx6G0mPaW3EvistHjcvbv2LWMquEPG61gGIo/+IA9yHQQDg+PxLBBKBRCARSAT2CoGKTmuXCEBHh6BA4Ah+m43Ev2sNANLHoOOo2Lpc+9vKpUNepiNEjGl35k0EEoGjgwDknHdkH8FjH+/FUgyA8DvHGPLwlls+OHnpNdfcWqNzAOGfTgFoSMg88WDTiEKmF1kLoMuFf9F02jBm8Ty+aRJ+BQAt6XzTJP7aeG1jmt9A9vMdVASI+bvilEMYIlwMvLaNAHDddddN3v3L72kC8akAsE0i2lY3aX0B4t+3v2sfULFvVX+UNRMAuHeiBwDkPwoAJ0+efHZYALCqj11lW1Z1TllOIpAIJAKJQCIwCIHmZ7Ak+pH0O9pfEvy+7TaBgLSxHSE6yCUZX2Y7kvuueFv5EIBBKGamRCAROLII8P7Cg8lR4ZL4Sfgki7wjIWcIiG+8/lcnd/3ER5rAtuR/7Dtx0+AusljfokS/7Tg8BmjDIucNtnhmEE5ecMF7WAgQIeDkk55/mm9cvH6R9HsdYxp5/S6WUwFiOcYtY4zH24BzbAQARv/f++u/vksCwLymS5KxYwNle3xZT1d6ma9vmzIOEN/aFgJsEwDINxXrFDH6ys99iUAikAgkAonAbiPQ5gkgme8j/Oed97SZ63/bvP8nfOsTFvr5I+bjRULeRdpjOvnL7VjGvDgd9ZiHjvpuX7VsXSKQCGwSATr/jEj7vpT0lVYSSDrvQIgnJBTLe2XXyT+Y4urMeSziut9G6MekUSd1r3JaBOStEXLqkd7o2eG16rNcxygClCKC158yEInWsJ7DTAC4554PTO5+592THfEAWOTxUwjw2CFkfkgeyxtqWwUAvQBY+M/F/y666KKLv/M7v/NpKQAMhTbzJQKJQCKQCOwNAo5w6Q2ARQToEwDYp1AQLZ1ePAjGuG9GoOj4RTI+Nl6S+XKb8trSrGfq+o/Kn3+JQCKQCJyBAGIAbsONIFB7B/D+RBjoCuRbJaE9o0HjEyBAVd9hEGZI7SZFAMn/JkQSrlkf8Y/7JPldlrwrHvWPl6YRAG659ZbJERAAPK91kHrLHmJnAgDPJfcbbv4IAIoAxlvc/9MDYAjCmScRSAQSgURgPxBoEwEg85L7LjHA/ViIP2FJ9/kTkHAJubaLtHele9wYS7071lHfj5snW5kIJAJ7gUAzEl6LFYxozmvwJkWATZL/cN6VXh2Q+0j6jTPiH4WdMh/71ixY9AkA4VQyOhIBiPxsHQBG+Rntl/hjIf85+j8S1cyeCCQCiUAisH8I2DnEA0C3R0k9BL8UAUryT2doOk9uqZMvpwGMIfGL5mVhrkV/2mupk82DE4FEIBEYgYCjlvMO4V08JfpV826vR70hsGNGq6mL+fgsyjfm1wGGuv1TJmVTx7bFVzFqxPB6DZiO9hyQD5F7De7+bZf0BGtK6AHAQoBhCkBb/kwbhsAhLwAW+YPsQ/oNkv9pv6Cqi83R/2HYZq5EIBFIBBKBfUSAjg2dIAi9QgCiAGJA9ArQ3X8NoyBVmxfAouS+7zjqWdJjYR8vcbY5EUgE9hQBfkqQ99aVV1x9N+8uCClk1cA2eVhzgMC7XPd13tWLnDYj5Yv+pF+XGMCoP2VS9iJtOibHHPIAWEYAgMgydWUVuHGPraKcLZbRCAB1/Y0XAM8OIkAMiGdgNh3UkPxzXP4lAolAIpAIJAJHGwE+gnQyFQToQM5C3bFcV0eADmwfcV/FPjrRq/BYONp3QJ5dIpAI7BACJ3j/4o117YU3n37l5T/ZWOJXXvDy04wW87OEeGch2uqy3oz8P0D+q0XPhXc93wFI+6IeAY74UwZlrev7seg57uBxJ577guffqwcAvwSABwBpY9v6Hec/7a2Esce15Ud8akvfozSI/BkigCIaNsn/Hl3NbGoikAgkAonA2hA4gRiAdwBh2nGr1lUbH98hJP+2y+6aXP/9b3swXPGOSZNW277jIf/Usa72Z7mJQCKQCKwDAd7DiADMU3dk3znrWtO1kO1VtUUhALd9xQBG89umCJDGPgQD8nJMEv/RV6KZdsB396XXXHMrgvwi3y5+FvHC5z13sqzoTd38GsHos9i9Aw6JAOASQ93cqg458r971y1blAgkAolAInCUEejzAri+JvgQf37juQwzQYA8LUIAAgGufkcZuzy3RCARONIIHDRTtWohQJJfWhewI9+akKiaNtTigl5htAGSTyBuOqR/2o5qTW3JYucggHBz6aWXTK659uqPLep5wRSCN9/12j+56cdv+PM51e3L7igCNAsD1g2v6kA8yX8NQv4lAolAIpAIJAIbRyCKAA3pbyH+V51/y4TQKgQUIgAj/6uaB7lxMLLCRCARSAQKBHifQbBjYF49ngJF1tw85ghA/CHvrCWA5fvK/YPLew1NVQeJb0OGSWc/+cjPFATc/xfxQNhh6BUBuuwONz2blggkAolAIpAIHFEE6ICwmBUr9ROc78qcV8LlT//hCUEhAEseAqIA82Qh/nRilnV/PKIQ52klAolAIpAIHA8ETuCNAZFnNB93fkf18Q6IAdJ/6tTrGrGAb/AR95wrBYDjcTfkWSYCiUAikAgkAolAIpAIJAKJQCKQCCQCiUAikAgkAolAIpAI7DcC/x/O5vaWwk4PNAAAAABJRU5ErkJggg=="]}]
DragonBones Name
Armature Name
Skin Name
Animation Name
X 1.00
Background Color
Show Grid
Show Bone